Datasets:

anumafzal94

/

pubmed_full_finetuning

like 0

You are an expert at summarizing long articles. Proceed to summarize the following text: this 34-year - old male patient had an impacted mytilus coruscus shell in the esophagus . , the patients received a chest ct after contrast enhancement using a toshiba aquillion operating at 120 kvp and 62 mas , with a slice thickness of 3 mm ( fig . 1 ) . this 52-year - old male patient had a fish bone lodged in the espophagus . prior to fb removal , the patient received a chest ct after contrast enhancement using a siemens navigator operating at 120 kvp and 90 mas , with a slice thickness of 2 mm ( fig . the axial ct data were saved in dicom file format . to reconstruct the 3d images , the outer surfaces of the fb , skin , bones including vertebrae , inner surface of the trachea , and esophagus were drawn in all frames after detection of the outlines . the 3d images and photographs were compared with respect to the shape and location of each fb in the esophagus . after rotation of the 3d images , they looked similar in shape and orientation to the photographs of the fbs that had been removed . this 34-year - old male patient had an impacted mytilus coruscus shell in the esophagus . , the patients received a chest ct after contrast enhancement using a toshiba aquillion operating at 120 kvp and 62 mas , with a slice thickness of 3 mm ( fig . the fish bone was removed by open thoracotomy under general anesthesia . prior to fb removal , the patient received a chest ct after contrast enhancement using a siemens navigator operating at 120 kvp and 90 mas , with a slice thickness of 2 mm ( fig . the axial ct data were saved in dicom file format . to reconstruct the 3d images , the outer surfaces of the fb , skin , bones including vertebrae , inner surface of the trachea , and esophagus were drawn in all frames after detection of the outlines . the 3d images and photographs were compared with respect to the shape and location of each fb in the esophagus . after rotation of the 3d images , they looked similar in shape and orientation to the photographs of the fbs that had been removed . although the flexible fiberoptic endoscope is a very popular tool for fb extraction , the rigid esophagoscope is equally safe and represents a good tool in the hands of an experienced surgeon . if endoscopy fails , an open thoracotomy is the method of last resort . in asian countries , since fish bones and shells tend to be calcium - rich , they are visible upon routine x - ray examination , if sufficiently large in size . use of a flexible fiberoptic endoscope can often allow both a definitive diagnosis and extraction of the fb . in the present cases , prompt extraction of the rigid and sharp - edged fbs is necessary , since they can cause erosion and laceration of the esophageal mucosa if left untreated . endoscopic extraction is not risk - free , and problems that arise can demand emergency surgery . rapid knowledge of an esophageal fb , specifically , its composition ( i.e. , hard or soft ) , shape , size , location , and orientation , is vital for a surgeon in tailoring the safest and most effective treatment . our patients were successfully treated under endoscopy or by thoracotomy with full knowledge about the fb . at the time of the treatment the 3d reconstructions were made retrospectively , as was the comparison of these image reconstructions with actual photographs . the time required for making the reconstructed image was less than 30 minutes once the chest ct had been acquired , it took even less time when skilled personnel was involved . this shows another example of the practical value of ct reconstruction from the clinical point of view . therefore , while the present data was not instrumental in the treatment of the patients from which the data was drawn , the potential of ct reconstruction for future cases was confirmed . in the case of the shell fb , photographs of the shell that was removed were taken without inclusion of a ruler and the images were distorted due to endoscope angles , so measurements were not possible . for this fb , the 3d reconstructed images were helpful in determining the shape , size , and the relative location of the shell , and its orientation in the esophagus . rotation of the 3d images could be performed to mimic the endoscopic images and to be used in simulation of surgical procedures if needed . as a result , the patient was required to fast for 7 days until a second endoscopy confirmed healing . in this patient , real photographs and 3d images were available and were used for comparisons of fb size , location ( in the 3d image only ) , and orientation . the shape in the 3d images was very similar to that in the real fb photograph . the 3d image was rotated to match the endoscopic view of the fb ; the accuracy of the result indicates the potential of the approach as a simulation method . information concerning the distance from a target point to the fb is available with one mouse click . since ct is calibrated data , the 3d images can always be used for measuring distance . a 3d reconstructed image from ct data can be converted into a real touchable physical model through rapid prototype ( rp ) technology . before operations for cardiac anomaly or bone - destroying cancer surgery , the use of rp can generate a surgical simulation or allow a bone defect to be measured to make implants or flaps . patients with a vessel anomaly , vascular tumor , or stabbing injury can also benefit from the 3d reconstruction technique . organs with hollow spaces occupied by fluid or air are the best candidates for virtual endoscopy . the technique has been adapted in the screening for polyps or other space - occupying lesions of the large intestine . virtual endoscopy has not been attempted frequently for esophagus procedures , since flexible fiberoptic endoscopy is quick and convenient . in contrast , virtual esophagoscopy requires pretreatment with a gas - forming formula and motility - decreasing injections that distend the esophageal lumen to allow full examination of the esophagus . the gas - forming medicine might not be suitable for patients with an esophageal fb because of the danger of leakage of the medicine through damaged esophageal mucosa . until now , virtual endoscopy has not been tried in patients with esophageal fb . the reconstructions were able to accurately indicate the shape , size , location , and orientation of the fb in the esophagus in two patients . the type of material comprising an fb can not be determined in the absence of information concerning the ingested material . on the other hand , endoscopy is superior to 3d reconstruction in identifying the composition of an fb . the information in a 3d reconstructed image can be quickly converted into an rp , which can be used to simulate an extraction procedure such as flexible fiberoptic endoscopy or open surgery . finally , the present ct data was acquired in 2- or 3-mm - thick slices . use of slices of 1 mm thickness or less would provide finer detail , and the resulting 3d reconstruction would even more realistically mimic the fb .

this study was conducted to investigate the clinical application of three - dimensional ( 3d ) reconstructed computed tomography ( ct ) images in detecting and gaining information on esophageal foreign bodies ( fbs ) . two patients with esophageal fbs were enrolled for analysis . in both cases , 3d reconstructed images were compared with the fb that was removed according to the object shape , size , location , and orientation in the esophagus . the results indicate the usefulness of conversion of ct data to 3d images to help in diagnosis and treatment . use of 3d images prior to treatment allows for rapid prototyping and surgery simulation .

You are an expert at summarizing long articles. Proceed to summarize the following text: neuropathic pain , including phantom pain , is a chronic condition caused by a primary lesion or dysfunction of the nervous system.1 neuropathic pain is very common.2 about 60% of patients with limb amputation have phantom pain at 2 years postamputation . the pain does not change after 6 months postamputation.3 neuropathic pain is multidimensional , including sensory and affective components.4 when superficial tactile stimulation is applied to the hand area where acupuncture points are located , activation is seen only in somatosensory cortices . however , when the acupuncture points are stimulated and pain is experienced by the subjects , activation of additional cortical areas , such as anterior cingulate cortex and insula , is observed.5 sensation ( painful stimuli ) and perception of pain are possibly two different but parallel processes.4 neuropathic pain is difficult to manage and is associated with poorer physical , psychological , and social functioning.68 many nonpharmacological modalities have been used for management of neuropathic pain with different mechanisms . transcutaneous electrical nerve stimulation has been used for pain relief.9 the possible mechanisms are the gate control theory10 and the release of endogenous opioids.11,12 the well - accepted mechanism for acupuncture - related pain relief is the release of endogenous opioids , which is reversed by naloxone ( opioid - antagonist).13,14 recently , it has been found that repetitive painful stimulation ( aversiveness ) leads to significant pain attenuation . the induced pain attenuation is not naloxone - reversible.15 given our recent discovery of systemic effects of voluntary breathing , including reduction in muscle tone,16,17 here we report an innovative intervention that integrates all these modalities by voluntary breathing , ie , breathing - controlled aversive electrical stimulation ( breestim ) , to acupuncture points for neuropathic pain management . we hypothesized that breestim would have a greater analgesic effect than electrical stimulation alone ( estim ) , because it integrates the aforementioned different pain - modifying mechanisms . he had a work - related traumatic injury to his left leg 3.5 years ago that resulted in an above - the - knee amputation . at the time of study he was working full time . he had no skin issues with the residual limb and usually wore his prosthesis about 1214 hours a day with a 1-hour break . however , he had severe and constant pain and he had to schedule his work break around his pain medication schedules . characteristics of phantom pain were mainly burning and electrical shooting down to the phantom foot . the subject provided informed consent prior to participation in the study , according to procedures approved by our institutional review board . the subject was planned to undertake the following experimental protocol : treatment ( five consecutive days ) washout ( 1 week ) control ( five consecutive days ) washout ( 1 week ) treatment ( 5 days ) follow - up ( 1 week ) . each breestim session consisted of 120 stimuli , which usually took about 3040 minutes including breaks between stimulation trials . in control , the subject received only estim during normal breathing . this within - subject crossover design allowed comparisons of effectiveness in reduction of neuropathic pain between breestim and estim . the washout / follow - up period allowed washout of previous intervention , as well as assessment of possible accumulative or carry - over effect . the experimental set - up was adopted from our recently published protocol.17 the subject was seated comfortably . the arms and hands were placed comfortably on the experimental table in approximately symmetrical positions . surface electrodes were placed over acupuncture points neiguan and weiguan on the ipsilateral forearm.18 the intensity of electrical stimulation was started from 0 , gradually increased to the highest level as tolerated using an electrical stimulator ( digitimer ds7a ; welwyn garden city , england ) . however , the intensity of electrical stimulation was self - selected . during estim , a single - pulse electrical stimulus ( width 0.1 ms , square wave ) was delivered to the forearm through surface electrodes randomly every 47 seconds . during breestim , the subject was asked to wear a face mask . the face mask was connected indirectly to the experimental computer via a pneumotach system ( hans rodolph , inc ) . a stimulus was triggered if the airflow reached or exceeded 40% of maximum airflow during a volitionally effortful inhalation.17 rest was taken upon request . during the entire experimental period ( 4 weeks ) , the subject maintained the same dose and schedule of pain medications . both breestim and estim treatment sessions were performed at the same time of the day ( between 11 am and noon ) , such that changes in the pain rating could possibly be attributed to stimulation effects and not diurnal variation . the subject was instructed to take a single isolated deep breath , similar to routine deep breaths , but faster and stronger , usually involving obvious expansion of the chest wall . it has been reported that there are respiratory - specific connections between the insula and the activity of pulmonary stretch receptors.19 when wearing a face mask , the subject tolerated such breathing very well . no hyperventilation was reported.17 the primary outcome measurement included visual analog scores ( vas ) and modified visual analog scores ( mvas ) . 20 mvas further quantifies the effect of pain reduction by measuring duration and amount of change in vas , ie , how much pain was reduced and how long it lasted ( reduction hours ) . the secondary outcome measurement was general well - being schedule survey and center for epidemiologic studies depression scale national institute of mental health survey to examine the possible effect of pain reduction on general well - being , depression , and quality of life of the patients . these surveys have been well validated and commonly used.2123 any side effects , tolerance of voluntary breathing via a face mask , and psychosocial effects were recorded . the intensity of electrical stimulation ( the lower panels ) was comparable between breestim and estim interventions ( figure 1 ) . overall , breestim had greater analgesic effects than estim ( the upper panels ) . on average , breestim produced a 24 point reduction on vas for 34 hours after each session . the patient reported that his baseline pain level was 57/10 prior to each treatment session . the subject was excited that his intense and constant shooting phantom pain disappeared after breestim on day 1 , despite the fact that the sensation of phantom leg/ foot remained . the shooting phantom pain disappeared after the breestim protocol ( 1 week ) or at follow - up after estim ( a total of 4 weeks ) . unfortunately , the subject did not receive the second breestim session , because of the experimental error . during reassembling of the experimental setting prior to the second breestim session the subject received sustained electrical stimulation for approximately 5 seconds ( supposed to be 0.1 ms ) at the aversive level during the first breestim trial on day 1 of the planned second 5-day breestim treatment . he felt fearful and anxious about further breestim trials and reported that his shooting pain came back as constant 7/10 . one of the authors also tried and experienced the same sustained electrical stimulation during normal breathing , and felt transient pain on the stimulated area for about an hour . during a follow - up clinic visit 4 weeks later , the subject reported that the baseline burning pain remained the same , while the shooting pain gradually subsided to 2/10 , lasting about 1 minute every 34 days . no noticeable overall change in quality of life was found based on general well - being and center for epidemiologic studies depression scale surveys , although the subject reported that he felt great during and after each breestim along with pain reduction . this case demonstrates that breestim has greater and longer analgesic effects than estim on chronic phantom pain . this is possibly attributed to the fact that breestim has integrated different pain - modifying mechanisms into one intervention , including the following : electroacupuncture effect . acupuncture - related analgesic effects that are naloxone - reversible are triggered when acupuncture points are stimulated.5,24 habituation to aversive stimuli . habituation to aversive stimuli occurs and is not naloxone - reversible.15 therefore , the two mechanisms could have additive analgesic effects . the intensity was about the same between breestim and estim groups ( figure 1 ) . it is thus less likely that aversive electrical stimulation plays a primary and/or placebo role in pain reduction . the insular cortex is consistently activated during various sensorimotor respiratory tasks.25 the insular cortex is critical in affective processing of pain.26 anterograde amnesia to aversive stimulation . when aversive stimulation is delivered during activation of the insular cortex , item - specific anterograde amnesia to the stimulation occurs.27 in other words , unpleasantness of peripheral noxious stimulation is not remembered or decreased immediately after voluntary breathing - controlled electrical stimulation , when the insular cortex is activated during voluntary breathing . as such , it is expected to facilitate habituation to aversive stimulation even at a higher intensity , subsequently increasing the analgesic effect of stimulation , thus a positive feedback loop . this is likely the case during breestim , because the subject requested a higher intensity of electrical stimulation gradually during each session , even noxious , for a better analgesic effect . as described , this positive feedback loop is likely to occur by triggering the reward system.28 as observed , the intensity of aversive electrical stimulation is driven higher gradually during the course of stimulation . however , a large - scale clinical study , possibly with imaging studies , such as functional magnetic resonance imaging , is needed to corroborate the findings and underlying mechanisms . the accidental finding of disappearance and reappearance of shooting phantom pain associated with breestim provides a unique opportunity to advance our understanding of the mechanisms underlying postamputation neuropathic pain . this finding implies that shooting stimulus does not change , but it is not perceived as aversive after the first breestim . however , aversive perception of shooting stimulus is likely retriggered by an unexpected , fearful sustained electrical stimulation in the second breestim . it has been reported earlier that when associated with a negative emotional context , pain ( eg , phantom pain after amputation ) could be perceived as aversive and retriggered by a stressful life event.3 this accidental finding supports the idea that sensory and affective ( unpleasant ) components of neuropathic pain ( phantom pain ) are processed in parallel.4 it also suggests that breestim could modify the affective component , resulting in additional analgesic effects .

in this case , a 31-year - old male suffered phantom neuropathic pain for more than 3 years after an above - the - knee amputation . his shooting phantom pain disappeared after the first session of breathing - controlled electrical stimulation , and reappeared or was triggered 28 days after an experimental error during which he received sustained electrical stimulation . in other words , painful shooting stimuli may not have been cured but forgotten and retriggered by a fearful event due to the experimental error . therefore , this accidental finding provides a unique opportunity to understand sensory and affective components of neuropathic pain , and a novel intervention could modify the affective component of it .

You are an expert at summarizing long articles. Proceed to summarize the following text: in recent years , electromagnetic ( em ) wave absorbing materials have aroused great interest because of more and more civil , commercial , and military applications in electromagnetic interference ( emi ) shielding and radar cross section ( rcs ) reduction in the gigahertz ( ghz ) band range . traditionally , em wave absorbing materials , which are composed of magnetic metals or alloys particles , are restricted in application because of high specific gravity and formulation difficulty . it is hence desirable to have microwave absorbing materials that are lightweight , structurally sound , and flexible and show good microwave - absorbing ability in a wide frequency range . in terms of these criteria , one - dimensional nanostructures , which have a tremendous surface area and more dangling bond atoms on surface , appear to be good candidates . recently , carbon nanotubes ( cnts ) [ 4 - 6 ] , magnetic - particle - doped cnts , magnetic nanowires ( nws ) , nanostructured zno , and mn3o4 were intensively studied and found to be promising microwave absorbing materials . many groups found zno nanomaterials with different morphologies show excellent microwave absorption behavior , and partly attributed to its semiconductor character . microwave absorption property of zno has been investigated thoroughly in previous reports . in this work , sno2 has been paid attention in a variety of applications in chemical , optical , electronic , and mechanical fields , due to its unique high conductivity , chemical stability , photoluminescence , and gas sensitivity [ 13 - 16 ] . however , the research on its dielectric property and microwave absorption has not been reported . here , both the complex permittivity ( r = j ) and permeability ( r = j ) of the sno2 nws / paraffin composites with different loading proportion were studied , and the measured results are compared with calculation results from effective medium theory ( emt ) . the excellent absorbing properties of the nw paraffin were revealed , and the relationship between absorption property and the proportion between sno2 nws and paraffin were also investigated . briefly , a small amount of sn powder ( purity : 99% , about 3 g ) was placed in an alumina crucible . a porous aluminum oxide ( aao ) template coated with au film of about 10 nm was used as substrate , which was positioned about 5 cm downstream from the precursor . then , the crucible was put into a quartz tube that was located at the center of an electronic resistance furnace . one end of the quartz tube was connected with a mass - flow controller , which introduces a constant mixed carrier gas flow of ar and o2at a flow rate of 100 and 10 sccm , respectively ; the other end of the quartz tube was evacuated by a pump . the furnace was heated to 1,000 c and kept for 1 h. after the furnace was cooled naturally down to room temperature , white wool - like products in high yield were found on the substrate . the powder samples were characterized by high resolution transmission electron microscopy ( tem ) and selected - area electron diffraction ( saed ) on a jem-2010 transmission electron microscope operated at 100 kv . field emission scanning electron microscopy ( fesem ) observation was performed on a hitachi s-4800 field emission scanning electron microscope . the products were mixed with paraffin wax with different volume fraction and pressed into toroidal - shaped samples ( out = 7 mm , in = 3.04 mm ) for microwave absorption tests . the real part and imaginary part of the complex permittivity and permeability of the samples were measured using the transmission / reflection coaxial method by an agilent e8363b vector network analyzer working at 0.118 ghz . the diameters of the sno2nws are about 100 nm , and the lengths are up to micron scale . from tem image ( fig . aandbdifferent magnification fesem images of sno2nws.ctem image anddhr - tem image of sno2nws , the inset is the saed pattern figure 2is the typical sem image of the sno2nws / paraffin composite with 50 vol.% loading . from fig . 2a , it is clear that the inclination angle of these nws ( indicated with arrows ) in the composites is different , leading to the randomly oriented nws in the composites , and the volume proportion of nws close to the surface is much lower than 50% , which is lower than that inside the composites ( indicated with ellipse in a gap ) . as paraffin is em wave transparent , em waves can easily penetrate into the microwave absorbing materials with this structure . a , bthe sem images of the sno2nws paraffin composite with 50 vol.% loading we independently measured the relative complex permittivity and permeability of the sno2nws / paraffin composites in a frequency range of 218 ghz ( fig . 3a one can see a decrease of and an increase of with frequency rise . it reveals that the real part exhibits an abrupt decrease from 23 to 18 at the 04-ghz range , an approximate constant over 412 ghz and a broad peak at 1218 ghz . meanwhile , the imaginary part increases from 0.1 to 0.5 in the whole frequency range . as shown in fig . 3b of complex permeability , a decrease of from 1.2 to 1 and an imaginary part close to 0 can be related to the absence of ferromagnetic components in the sample . the tangent of dielectric and magnetic loss can be expressed as tan e = / and tanm = / , respectively . from fig . 3a - b , it can be seen that tan eincreases from 0.1 to 0.5 in the whole frequency range , while tan mis below 0.1 . it suggests that microwave absorption enhancement of composite results mainly from dielectric loss rather than magnetic loss . athe real part ,bthe imaginary part of the permittivity , andcreflection loss of the composite samples with 50 vol.% of sno2nws according to the transmission line theory , the normalized input impedance zin of a microwave absorber is given by(1 ) where r and r are the relative permeability and permittivity of the composite medium , c the velocity of em waves in free space , f the frequency of the microwave , and d the thickness of the absorber . the reflection loss is related to zin as(2 ) where is the characteristic impedance of free space . figure 3c shows the microwave reflection loss of composite with 50 vol.% loading at different composite thicknesses . with matching thicknesstm = 7 mm , the maximum reflection lossrmaxis ca . 16 att = 2 mm , the bandwidth corresponding to reflection loss below 10 db ( i.e. , over 90% microwave absorption ) is higher than 1.5 ghz . it can be seen that the sample of 50% proportion does not exhibit good ability of microwave absorption compared with the results of zno and cnts [ 5 - 11 ] , in order to find optimal loading proportion and to investigate the intrinsic reasons for the absorption . figure 4a , b show the real part and the imaginary part of the permittivity of the composite samples with different contents of sno2 nws . it can be seen that the values of both real part and imaginary part of the permittivity increase significantly with sno2 nws loading increasing , and the variation curve of every contents has the similar shape with that of 50 vol.% . figure 4c f shows the microwave reflection loss of composite with different loading proportion at different composite thicknesses . composite of 10 , 20 , 30 , and 40 vol.% loading proportion have their matching thickness tm = 7 , 5 , 7 , 7 mm and the approximate maximum reflection loss rmax = 27.5 , 32.5 , 25 , 18 db . it can be found that the microwave absorption property of the sno2 nw / paraffin composites becomes better with the decrease of proportion of sno2 nws and get optimal proportion at 20% when the best em parameter matching realizes . in particular , the composite sample of 40 vol.% exhibits enhanced microwave absorption with an absorber thickness of 2 mm , which is same as that of 50 vol.% shown in fig . athe real part andbthe imaginary part of the permittivity andc freflection loss of the composite samples with different content of sno2nws the dominant dipolar polarization and the associated relaxation phenomena of sno2 constitute the loss mechanisms . composite materials , in which semiconductor nws are coated with a dielectric nanolayer , introduce additional interfaces and more polarization charges at the surface . the interfacial polarization is an important polarization process and the associated relaxation will also give rise to a loss mechanism . it is reasonable to expect that the dielectric loss may be due to significant contributions of the interfacial polarization . it is well known that sno2 nws have excellent gas sensitivity and can form space charge layer of several nanometers on the surface . molecular dipoles formed at the nws surface interact with the microwave field , leading to some absorption losses through heating . from fig . f , it can be seen that composite of 10 , 20 , 30 , 40 vol.% loading proportion have their approximate reflection loss rmax at 11.5 , 10 , 8.5 , 8 ghz at thickness t = 7 mm . with the increase of proportion in the nanocomposites , the matching frequency tends to shift to the lower frequency region , and similar results have been gained on cnts and zno nws . fan et al . pointed out that with an increase of cnt content in composite , the electric field of short - distance resonance multipoles leads to dominance of reflection property rather than absorption property . they reported that increase with increasing cnt concentration , resulting in a shift of reflectivity peak toward lower frequency . the revelation is important because it suggests that the range of absorption frequency can be easily tuned by changing the sno2 nws content of composites . thus , wideband absorption could be achieved by coupling sno2 nws / paraffin layers of different sno2 nws contents . so , it is of great significance to calculate real and imaginary part of complex permittivity at different loading proportion of sno2 nws . composites consisting of metallic or semiconductor particles embedded in a dielectric matrix have been widely used and studied for years [ 20 - 22 ] , but their physical properties are still not fully understood or unveiled . it would be extremely useful to predict the properties of composites once the properties of constituent components are known and extract the properties of constituents from the measured composite properties . if the composites are isotropic and homogeneous , this work could be done with emts . the effective macroscopic em properties of the composites are modeled on the effective dipole moments per unit volume , which is determined by the intrinsic dipole moment contributions of each constituent and their relative volume concentration . among emts , the bruggeman ( bg ) formula is the most commonly used . in this work , the complex permittivity of sno2 nws / paraffin composites at microwave frequencies has been studied in the framework of the bg formula.(3 ) from formula ( 3 ) , one can calculate e , m as follows:(4)(5 ) is either of the real part and imaginary part of the complex permittivity and complex permeability . e , i , m correspond to the parameter of the effective medium , the insulator , and the semiconductor particles , respectively . the insulator is paraffin in our experiment , real part and imaginary part of the complex permittivity are 2 and 0.01 , respectively , as shown in fig . 4a , b using the bg equation , the effective permittivity of the sno2nws / paraffin composite at 100 mhz was calculated over a wide particle volume fraction range of 1050% and was compared to the measured values in fig . prior to the calculation , the permittivity of sno2nws at 100 mhz was extracted from the measured effective permittivity of a mixture sample with sno2nws of 40 vol.% using eq . comparison between the calculated and measured effective permittivity : areal part andbimaginary part of the composite at 100 mhz versus the volume fraction of sno2nws the real and the imaginary parts of the permittivity increase with the volume concentration . bg formula predicts a distinct increase happening at around 30 vol.% , which results from the semiconductor insulator transition at the percolation threshold , and a linear increase after percolation , which is the same as measured results but with a different slope . bg formula is often used in the case of spherical inclusions whose diameter d is much smaller than the incident wavelength . in our experiment , sno2 nws are around 100 nm in width and up to micron scale in length ; the aspect ratio is so large that error may be brought and result in the difference in slope . as bg formula has difficulty in dealing with composite with percolation , we find that emt can be only used in qualitative analyses , and leads to large error in quantitative analyses . in conclusion , sno2nws have been prepared by a cvd method and their microwave absorption properties have been investigated in detail . complex permittivity and permeability of the sno2nanostructures and paraffin composites have been measured in a frequency range of 0.118 ghz , the value of both real part and imaginary part of the permittivity increase significantly with increasing sno2nws loading , and the variation curve of every content has the similar shape . the value of maximum reflection loss for the composites with 20 vol.% sno2nws is 32.5 db at 14 ghz with a thickness of 5.0 mm . we find that bg equation can be only used in qualitative analyses , and leads to large error in quantitative analyses .

in this article , sno2nanowires ( nws ) have been prepared and their microwave absorption properties have been investigated in detail . complex permittivity and permeability of the sno2nws / paraffin composites have been measured in a frequency range of 0.118 ghz , and the measured results are compared with that calculated from effective medium theory . the value of maximum reflection loss for the composites with 20 vol.% sno2nws is approximately 32.5 db at 14 ghz with a thickness of 5.0 mm .

You are an expert at summarizing long articles. Proceed to summarize the following text: ( a ) resolution of the parm+amppnp reconstruction was estimated using resmap and this estimate was plotted back onto the cryo - em density . ( b ) the power spectrum of the aligned segments ( left ) compared to the power spectrum of the re - projection of the cryo - em reconstruction ( right ) . a reflection is observed in both cases at 4.8 indicating that the resolution extends beyond this shell . ( a ) atomic model of one protofilament ( strand ) of parm is shown with the residues at the protein : protein interface highlighted in red . ( c ) the complete parm filament ( i.e. both protofilaments / strands ) shown end - on . ( d ) atomic model of the parm filament with the inter - protofilament residues at the protein : protein interface highlighted in orange . ( e ) a magnified view of d ) . ( f ) an orthogonal view of d ) . see ed table 2 for a detailed list of interacting residues . ( a ) cryo - em density for the parm+amppnp filament is shown at an isosurface contour level of 2.0 from the mean value . overlaid on the density , refined atomic coordinates from refmac are additionally displayed as grey ribbons . ( b ) the same figure as a ) , except the cryo - em density shown at an isosurface contour level of 1.5 from the mean . ( d - f ) a magnified view of the primary salt - bridged interface consisting of charged residues that form the parm inter - protofilament interface . the cryo - em density is shown as a mesh at three different contour levels to demonstrate resolved side chain densities . positively charged residues are highlighted in red while negatively charged residues are highlighted in orange . ( g ) two residues ( k258 and r262 ) that were the best resolved ( marked with an * in d ) , were mutated to aspartic acid to test the importance of this inter - protofilament interface . a cryo - em image of this mutant protein assembled with amppnp is shown . a much higher concentration of the protein was required to obtain filaments on cryo - em grids ( supplementary methods ) . ( h ) randomly selected cryo - em images of parm+amppnp and parm(k258d , r262d)+amppnp were used to count occurrences of straight and bent filaments by visual inspection . for the parm protein , 82% of all filaments were classified as straight , while 18% were bent ( n=345 ) . using exactly the same classification criteria , only 15% of the filaments were found to be straight and 85% of the filaments were bent ( n=45 ) for the parm(k258d , r262d ) mutant protein . ( i ) reference - free class averages show that most of the parm(k258d , r262d ) filaments are made up of double protofilaments like wild - type parm . a few class averages show that single protofilaments were present in the sample ( lower panels ) . however , the double mutation destabilises the entire parm filament , making filament formation an unfavourable reaction , illustrating that even though the inter - protofilament interface is small , it is critical for parm filament formation . ( a ) parm protein ( 10 m ) was incubated with atp ( 2 mm ) and cryo - em samples were prepared after 5 minutes . ( b ) after two hours , no filaments were seen in the same reaction . ( c ) when sodium orthovanadate ( 4 mm ) was included in the reaction , filaments could be observed even after two hours . ( d ) the same reaction as a ) , except atp was replaced by adp . ( e , f ) we performed real - space helical reconstruction of the parm+atp filaments ( red ) and parm+atp+vanadate filaments ( yellow ) , and compared them with the parm+amppnp filament structure ( green ) . comparison shows that parm is held in a very similar conformation until hydrolysis of atp is complete or until phosphate is released since we currently can not distinguish these two possible effects of vanadate . ( a ) a cryo - em image of parm+amppnp + 2% peg 6000 . instances of doublets are marked with yellow arrowheads . ( b ) more examples of parm doublets observed in cryo - em . ( c ) ( d ) directionality assignment of the filaments in the doublet . individual sub - segments and their assigned directionality are indicated by triangles , coloured based on the cross - correlation score in the alignment procedure : red indicates a poor cross correlation score while green indicates a good score . ( f ) the thickest parts of parm filaments of the doublet ( as they appear in projection ) are marked with black arrowheads . ( a ) two parm monomers arranged in an anti - parallel orientation , as obtained from the parm cryo - em doublet model . ( b ) two parm monomers arranged in an anti - parallel orientation , obtained from crystal packing of a monomeric parm x - ray structure ( pdb 4a62 ) . ( c ) two residues at the interface of the doublet ( see ed table 2 ) , s19 and g21 were mutated to arginine to improve affinity of parm filaments to each other . cryo - em images of the mutant protein with amppnp show spontaneous doublet formation and filament bundling without crowding agent , validating the doublet model . ( a - k ) e. coli b / r266 cells were transformed with a high - copy ( pdd19 ) , or medium - copy ( pkg321 ) plasmid containing the parmrc locus . this figure shows a gallery of parm bundles ( blue arrows ) and doublets ( yellow arrows ) observed in these cells . panels a , c , e and h show cells transformed with the high - copy number plasmid while panels b , d , f , g , i , j and k show cells transformed with the medium copy number plasmid . each experiment with different copy number plasmids was performed only once due to low - throughput nature of cryo - et . image processing statistics for cryo - em reconstructions of parm filaments interfaces forming residues of parm residues of parm that are part of interfaces have been highlighted . inter- and intra - protofilament interface - forming residues have been highlighted in red and green respectively ( web version ) . these residues have been assigned using a 4 distance cut off based on the parm+amppnp structure . residues forming the inter - filament interface in the parm doublet have been highlighted in blue ( web version ) . this assignment was based on a 7 distance cut off for c- atoms in the derived model of the parm doublet because of the lower accuracy of the model . instances of single , double and bundled parm filaments seen in bacterial cells with different copy number plasmids the parmrc locus was inserted into high , medium and low - copy number plasmids ( plasmids pdd19 , pkg321 and pkg491 respectively ) . the ratio of observed doublets per cell ( i.e. the number of doublets observed divided by the number of cells imaged ) was 5.8:1.6:0.3 ( ~19:5:1 ) . these ratios are roughly the same as the expected copy number ratios of the different copy - number plasmids .

active segregation of e. coli low - copy number plasmid r1 involves formation of a bipolar spindle made of left - handed double - helical actin - like parm filaments 1 - 6 . parr links the filaments with centromeric parc plasmid dna , while facilitating the addition of subunits to parm filaments 3,7 - 9 . growing parmrc spindles push sister plasmids to the cell poles 9,10 . here , using modern electron cryomicroscopy methods we have investigated the structures and arrangements of parm filaments in vitro and in cells , revealing at near atomic resolution how subunits and filaments come together to produce the simplest known mitotic machinery . to understand the mechanism of dynamic instability we determined structures of parm filaments in different nucleotide states . the structure of filaments bound to amppnp was determined at 4.3 resolution and refined . the parm filament structure shows strong longitudinal interfaces and weaker lateral interactions . also using electron cryomicroscopy , we reconstructed parm doublets forming antiparallel spindles . finally , with whole - cell electron cryotomography we show that doublets are abundant in bacterial cells containing low - copy number plasmids with the parmrc locus , leading to an asynchronous model of r1 plasmid segregation .

You are an expert at summarizing long articles. Proceed to summarize the following text: it accounts for only 0.5% of childhood rms and 4.4% of childhood pulmonary neoplasms . to the best of our knowledge , a male child aged 3 years , presented with recurrent right - sided pneumothorax with intercostal drainage for 1 year . mass lesion was suspected and on posterolateral thoracotomy , a whitish - yellow multiple gelatinous soft cystic masses were found which were excised completely . histopathological review was suggestive of spindle cell sarcoma and immunohistochemistry ( ihc ) revealed cells positive for desmin and myod 1 , suggestive of embryonal rms . there was no evidence of metastasis and was staged as group ii according to intergroup rhabdomyosarcoma study ( irs ) group . child had received chemotherapy as per the irs iii protocol and was disease free for 160 months . a female child aged 9 years , presented to hospital elsewhere with fever , cough , and hemoptysis for 2 months and decreased breath sounds in the right infra - axillary area . she was found to have mass lesion in the apical segment of right lower lobe by chest x - ray [ figure 1 ] and ct scan [ figure 2 ] . the histopathology revealed lung tissue with a tumor composed of compact spindle cells arranged in fascicles , cells showed moderate pleomorphism with an occasional mitosis . ihc revealed cells positive for desmin , myod 1 , and focally positive for s-100 , suggestive of embryonal rms of spindle cell variant . the patient received chemotherapy as per the irs iii protocol and was disease free for 19 months . chest x - ray showing mass lesion in the right mid - zone ( case 2 ) ct scan chest showing mass lesion in the apical segment of right lower lobe ( case 2 ) a female child aged 3 years , presented with history of dyspnea , fever , and cough for 2 months . she was diagnosed to have right - sided pneumothorax which did not improve following insertion of intercostal drainage . histopathology showed spindle cell sarcoma [ figures 3 and 4 ] and ihc revealed cells positive for desmin [ figure 5 ] , focally for myod 1 [ figure 6 ] and h - caldesmon , suggestive of embryonal rms of anaplastic type . h and e ( original magnification 100 ) showing lung alveoli on top , bronchiole and embryonal rhabdomyosarcoma below h and e ( original magnification 400 ) showing spindle - shaped cells , with a mitotic figure in the center . few strap cells with bright eosinophilic cytoplasm ( arrow ) immunohistochemical ( abc technique , 400 ) examination shows cytoplasmic positivity for desmin in the spindle cells immunohistochemical ( abc technique , 100 ) examination shows positivity for myod 1 in the nuclei of spindle cells a male child aged 3 years , presented with recurrent right - sided pneumothorax with intercostal drainage for 1 year . mass lesion was suspected and on posterolateral thoracotomy , a whitish - yellow multiple gelatinous soft cystic masses were found which were excised completely . histopathological review was suggestive of spindle cell sarcoma and immunohistochemistry ( ihc ) revealed cells positive for desmin and myod 1 , suggestive of embryonal rms . there was no evidence of metastasis and was staged as group ii according to intergroup rhabdomyosarcoma study ( irs ) group . child had received chemotherapy as per the irs iii protocol and was disease free for 160 months . a female child aged 9 years , presented to hospital elsewhere with fever , cough , and hemoptysis for 2 months and decreased breath sounds in the right infra - axillary area . she was found to have mass lesion in the apical segment of right lower lobe by chest x - ray [ figure 1 ] and ct scan [ figure 2 ] . the histopathology revealed lung tissue with a tumor composed of compact spindle cells arranged in fascicles , cells showed moderate pleomorphism with an occasional mitosis . ihc revealed cells positive for desmin , myod 1 , and focally positive for s-100 , suggestive of embryonal rms of spindle cell variant . the patient received chemotherapy as per the irs iii protocol and was disease free for 19 months . chest x - ray showing mass lesion in the right mid - zone ( case 2 ) ct scan chest showing mass lesion in the apical segment of right lower lobe ( case 2 ) a female child aged 3 years , presented with history of dyspnea , fever , and cough for 2 months . she was diagnosed to have right - sided pneumothorax which did not improve following insertion of intercostal drainage . histopathology showed spindle cell sarcoma [ figures 3 and 4 ] and ihc revealed cells positive for desmin [ figure 5 ] , focally for myod 1 [ figure 6 ] and h - caldesmon , suggestive of embryonal rms of anaplastic type . h and e ( original magnification 100 ) showing lung alveoli on top , bronchiole and embryonal rhabdomyosarcoma below h and e ( original magnification 400 ) showing spindle - shaped cells , with a mitotic figure in the center . few strap cells with bright eosinophilic cytoplasm ( arrow ) immunohistochemical ( abc technique , 400 ) examination shows cytoplasmic positivity for desmin in the spindle cells immunohistochemical ( abc technique , 100 ) examination shows positivity for myod 1 in the nuclei of spindle cells primary pulmonary rms is a rare disease in children , accounts for only 0.5% of pediatric rmss and 4.4% of all childhood pulmonary neoplasms . in the irs involving 646 children with a primary pulmonary lesion , when rms develops in the pre - existing congenital cystic adenomatoid malformation ( ccam ) , spontaneous pneumothorax is one of the most common clinical presentation . in our case series , the cystic malformation was found only in case 1 , which was confirmed by the intraoperative findings . as this child had undergone surgery elsewhere , we do not have enough evidence to say it as a ccam . cystic pulmonary malformation can serve as a substrate for the development of primary rms , pleuropulmonary blastoma , myxosarcoma , reticulosarcoma , hemangiopericytoma , bronchogenic carcinoma , and mesenchymoma . the commonest primary lung tumors under the age of 15 years are bronchial adenoma ( carcinoid , mucoepidermoid carcinoma , and adenoid cystic carcinoma ) , bronchogenic carcinoma ( mostly as adenocarcinoma or undifferentiated small cell carcinoma ) , and plasma cell granuloma . in contrast , leiomyosarcoma , fibrosarcoma , bronchial papillomatosis , pulmonary rms , and pulmonary blastoma are rare . on reviewing the literature , the first case of pulmonary rms was published by mcdonald and heather in 1939 . among the 30 cases ( including our cases ) [ table 1 ] , 16 arose from pre - existing pulmonary cystic lesions and 14 without any malformation including two from the bronchial wall . the distribution was equal in both the lungs . among the 30 cases , 29 underwent surgery , 18 received adjuvant chemotherapy , 8 received adjuvant chemoradiotherapy , and 1 received only chemoradiotherapy . the disease - free duration among these children ranges from 3 months to 160 months . published cases of primary pulmonary rhabdomyosarcoma although the etiological factors for the pulmonary rms are unknown , it can be divided into two groups , those originating from normal lung and those from abnormal lung . recently , there has been an increase in the number of cases detected with the availability of prenatal ultrasound scan . first hypothesis states that tumor arises from heterotopic islets of striated muscles , thus explaining the frequent association of rms with pulmonary malformations such as bronchogenic cysts , cystic adenomatosis and extralobar sequestration where these islets are usually present . in second hypothesis , a neoplastic transformation of the uncommitted mesenchymal cells present in the interstitial lung tissue or bronchiole . surgical excision is considered the treatment of choice , adjuvant chemotherapy ( vincristine , actinomycin , ifosfamide , and doxorubicin in combination ) is recommended in all the cases and margin positive or residual disease should be irradiated . the presence of simultaneous cystic lesion could be considered one of the favourable prognostic factor because it helps in early detection and complete surgical removal . to conclude , the tumors of the lung should be considered in the differential diagnosis of a child who presents with a cystic mass . the cystic pulmonary malformation can serve as a substrate for the development of primary rms , identification of malformed pulmonary tissue requires a careful follow - up . the early surgical intervention may prevent the long - term morbidity and mortality associated with advanced disease .

primary pulmonary rhabdomyosarcoma in children is rare . three children aged three , nine and three years were evaluated for abnormal shadows on radiological examination with pneumothorax in two cases . resection and histopathological examination revealed embryonal rhabdomyosarcoma in all and cystic malformation in first case . all the three children were treated with surgery and first two received adjuvant chemotherapy . the disease free duration was 160 months , 19 months and seven months respectively . the literature on primary pulmonary rhabdomyosarcoma in children was reviewed .

You are an expert at summarizing long articles. Proceed to summarize the following text: the world 's primary source of caffeine is the coffee bean , which is the seed of the coffee plant , from which coffee is brewed and therefore it is one of the most important commodities in the international agricultural trade , representing a significant source of income to several coffee growing countries . the genus coffea belongs to rubiaceae family which has 500 genera and over 6,000 species , in which coffea arabica ( 2n = 44 ) and coffea canephora ( 2n = 22 ) are the two commercially cultivated species . currently the production of arabica and robusta coffee accounts for 65% and 35% , respectively ; however arabica coffee typically contains half the caffeine of the robusta variety [ 1 , 2 ] . the world coffee production in 2012/2013 was 155,140 ( in 1,000 60 kilogram bags ) , but then in 2013/2014 and 2014/2015 there is a decline in coffee production and it is predicted to be decreased . this decreased coffee production is predominantly associated with variable climatic conditions , particularly limited water stress ( drought ) , where water shortages are responsible for the greatest crop losses around the world [ 3 , 4 ] . in several coffee growing countries drought is considered to be the major environmental stress affecting coffee production , in particular coffea robusta . because the robusta coffee is shallow rooted , it has largely been cultivated in water constraint , experiencing the stress at various crop phenology , which impacts crop growth and development above ground [ 57 ] . indeed drought - adapted plants are often characterized by deep and vigorous root systems , since root associated traits play a crucial role in maintaining canopy hydraulic conductance with high carbon assimilation in drought [ 8 , 9 ] . breeding coffee plants for root traits to enhance the productivity under water stress is very much required , but little progress has been achieved due to quantitative nature and poor knowledge of the genetic control of drought tolerance . furthermore , the quantitative nature of root traits could be either constitutive or adaptive , but difficult to phenotype . therefore , it is not surprising that a majority of genetic research has focused on aboveground traits while the hidden half of the plant is much less represented in recent research . with the conventional breeding methods , molecular marker technology and genomics serve as a tool for selecting such complex traits and allow breeders to track genetic loci controlling drought resistance traits , without measuring the phenotype , thus reducing the need for extensive field testing over space and time [ 1113 ] . with the functional genomics it was shown that the increase in the amount of rbcs1 ( rubisco small subunit ) protein could contribute to the antioxidative function of photorespiration in water - stressed coffea canephora plants . furthermore it was also shown that drought acclimation in coffee canephora clones probably involving the abscisic signalling pathway and nitric oxide are major molecular determinants that might explain the better efficiency in controlling stomata closure and transpiration displayed by drought - tolerant clones of c. canephora . with an advent of next generation sequencing ( ngs ) technologies the developed crop - specific hub , the coffee genome hub ( cgh ) ( http://coffee-genome.org/ ) , can be exploited to identify the genes / snp markers conditioning for drought and root associated secondary traits by resequencing intra- and interspecific genetic resources of robust coffee species . therefore , it is very important to identify the genetic loci conditioning root associated traits for breeding better drought tolerance clones . with this background , our study aims at ( 1 ) developing a mapping population with contrasting parental lines for root traits and phenotyping , ( 2 ) genotyping the mapping population with rapd and ssr markers , and ( 3 ) detecting the association of molecular markers with complex physiological and morphological traits . to identify the markers linked to root and associated physiological traits , f1 mapping population was developed by crossing low root type l1 valley as female parent with high root type s.3334 as male parent . after successful pollination , matured 300 coffee fruits were sown in nursery and after 48 days and 135 healthy seedlings were transplanted to carbonized rubber containers ( 35 kg capacity ) for better establishment . this experiment was conducted at central coffee research institute , chikmagalur district , karnataka state , india . institute is situated at 1322 north latitude and 7528 east longitude at an elevation of 824 to 884 meters above mean sea level . the moisture regime of 70% field capacity ( fc ) was imposed for 180 days after six months of coffee seedlings established in carbonized rubber containers . gravimetric approach was followed to maintain 70% fc , where potted plants were daily weighed to add water which was evapotranspired . during the treatment period ( 180 days ) , after the treatment period , root traits such as root length ( cm ) , number of secondary roots , root dry weight ( g / plant ) , shoot dry weight ( g / plant ) , and root to shoot ratio were recorded . besides , morphological , gravimetric , and gas exchange parameters were also recoded . dna was extracted from frozen leaves using cetyltrimethyl ammonium bromide ( ctab ) method . for the ctab technique , 900 l of ctab extraction buffer was added to lyophilized leaf tissue in 2 ml eppendorf tubes and then lightly vortexed . the tubes were placed in hot water bath ( 65c ) for 45 min and mixed with 400 l of chloroform : isoamylalcohol ( 24 : 1 ) and centrifuged for 15 min . the aqueous layer was collected , and 800 l of isopropanol was added to precipitate the nucleic acids . nucleic acid pellets were washed with 400 l of 70% ethanol , dried , and resuspended in 100 l of tris - edta buffer ( 10 mm tris with ph 7.5 and 0.5 mm edta ) . rapd ( random amplified polymorphic dna , operon technologies ) primers were used to genotype mapping population . polymerase chain reaction was carried out in 15 l reaction containing 1x buffer , 2 mm dntps , 2.5 mm mgcl2 , 5 m primer , and 1 u taq dna polymerase ( neb ) . amplification was performed with the following thermal cycle profile : 94c/4 min hot start denaturation , followed by 35 cycles of 94c for 1 min , primer annealing at 38c for 1 min , extension at 72c for 2 min , and a final extension at 72c for 8 min . the pcr products were run on 1.5% agarose gel at 90 volts for 1 h 30 min and amplified fragments were documented using hero lab gel documentation system ( inkarp ) . ssr ( simple sequence repeats ) primers for polymerase chain reaction were synthesized based on the information available in coffee genome database and also from in - house developed from s.3334 coffee accession . pcr amplification was carried out with 15 l reaction mixture having 50 ng dna , 1x pcr buffer , 100 m dntps , 250 m primers , and 1 unit taq polymerase enzyme ( neb ) . amplification was performed with the following thermal cycle profile : 95c for 5 min , followed by 35 cycles of polymerization reaction , each consisting of denaturation at 94c for 15 s , annealing at 60c for 45 s , and an extension step at 72c for 1 min . amplified fragments were detected using a silver - staining procedure ( promega , madison , wi , usa ) . s.3334 ) for root traits were screened with 320 rapd ( series from opk1 to opz20 ) and 55 ssr markers . the polymorphic rapd bands were visually scored for the presence ( 1 ) or absence ( 0 ) and in ssr analysis the segregating band from the female parent was scored as 3 , male parent as 1 , and heterozygous bands were scored as 2 in all individuals of f1 mapping population . based on the segregation of rapd markers in the mapping population , the putative genotypic interpretation of the parents for the marker locus was made and the chi - square test was performed ( http://www.physics.csbsju.edu/stats/chi-square_form.html ) . single point analysis [ 21 , 22 ] for detecting the association of molecular markers with complex physiological and morphological traits was done using sas software . to find the amount of variability explained by these markers , regression ( r ) values were worked out by one - way analysis of variance ( anova ) , by general linear model ( glm ) procedure . in this analysis , different traits were treated as dependent variable and the various molecular markers as independent variables . a total of 30 different physiological and morphological traits were used to associate with the 85 polymorphic molecular markers . at the end of experiment period about 180 days water stress , pots were completely saturated with water and then , in next day , all plants were carefully detached with water force to avoid root loss . the data on root length , secondary roots , and root biomass data of parental lines ( table 1 ) and f1 mapping population were recorded ( table 2 ) . there was significant genetic variability observed in root length , ranging from 41.5 cm to 83.0 cm with a mean of 57.08 cm . similar trend was followed in dry weight , ranging from 2.57 g to 34.69 g with a mean of 13.81 g / plant , and root to shoot ratio varies from 2.57 to 4.41 with mean ratio of 3.77 . it was observed that f1s root traits were distributed between the values of the respective parental lines without much considerable transgressive segregation ( figure 1 ) . the quantitative nature of these traits showed continuous variation , confirming the metric nature of the traits . morphological traits such as plant height , number of nodes and leaves , stem girth , internodal length , leaf area , shoot dry weight , and total dry matter were recorded . besides , genetic variability in the mapping population in net photosynthesis ( pn ) , stomatal conductance ( gs ) , transpiration rate ( e ) , intrinsic wue ( pn / gs ) , and mesophyll efficiency ( ci / gs ) was observed at single leaf level . significant variations were observed in water use efficiency ( wue ) and associated physiological traits like cumulative water transpired ( cwt ) , net assimilation rate ( nar ) , mean transpiration rate ( mtr ) , leaf area duration ( lad ) , and c in the population . g / kg with an average of 5.40 g / kg and considerable transgressive segregation was observed . the nar and mtr also varied with mean values of 13.07 mg / dm and 2.44 ml / dm of leaf area , respectively . similarly , the functional leaf area ( lad ) varied between 1065.89 and 7992.77 dm / day with mean leaf area duration of 4376.57 dm / day . c also varied between 19.75 and 26.53 with a mean of 21.80 ( table 2 ) . the variation in wue , cwt , c , and so forth , showed that traits are metric nature and mapping population could be utilized for the identification of marker linked to quantitative traits . the plants with the higher root biomass showed higher total biomass and correlation between these two traits is highly significant ( r = 0.968 ) ( figure 2 ) . it signifies the importance of root system in determining the total dry matter by absorbing the water from sub - soil layers from its better root system compared to parental lines . subsequently strong positive significant correlations were noticed between root weight and total transpiration ( r = 0.940 ) , cwt and mtr ( r = 0.524 ) , and total dry matter and cwt ( r = 0.970 ) ( figure 2 ) , suggesting that maintaining canopy hydraulic conductance with high carbon assimilation is one of the drought tolerance mechanisms . significant inverse relationship between wue and c ( r = 0.413 ) was observed ( figure 2 ) . it suggests that c could be a strong surrogate measure for wue even in mapping population . the relationship between cwt and wue was poor , suggesting stomatal control of wue in mapping population and , similarly , between root weight and wue . however , significant negative relationship between mtr and wue was observed ( r = 0.552 ) in mapping population ( data not shown ) . it suggests that stomatal factors regulate the wue in these plants rather than photosynthetic efficiency ( mesophyll factors ) . the contrasting parental lines l1 valley ( low root type ) and s.3334 ( high root type ) were genotyped with 320 rapd primers , of which 41 polymorphic primers generated 70 polymorphic loci ( table 3 ) . since rapd is dominant marker , the pcr amplified dna fragments were scored as dominant ( aa / aa ) , whereas absence of bands was scored as recessive ( aa ) . more than 85% of the primers produced single polymorphic locus and 15% of the primers yielded more than three polymorphic loci . all the rapd markers in the f1 generation of c. canephora segregated in ratios that were not consistent with mendelian inheritance . the chi - square tests were performed for each marker to determine segregation distortion from the expected allele frequency ratio of 1 : 1 . at a significance level of p = 0.05 , 38% of the marker loci were not following the mendelian inheritance ( table 4 ) . it is expected that rapd bands of maternal dna origin would show non - mendelian inheritance . besides rapd marker system , 55 ssr markers were also used for genotyping ; however , only nine primers showed polymorphism ( table 5 ) , but did not follow the mendelian segregation . the low level of dna polymorphism between the two parental accessions , coupled with the large number of common bands , implies parental lines could be less diverse . complex physiological traits have been described by a small number of major qtl , but it is intricate to find useful qtl for a particular trait , as their individual contribution is smaller . therefore under such condition single marker analysis ( sma ) is generally a good choice when the goal is simply a detection of marker locus linked to a trait . however , estimation of its position and its effects requires further complex analysis such as marker regression or interval analysis . in our study single marker anova is used to identify markers showing significant association with 29 morphophysiological traits ( sas software with p 0.05 ) . in the single marker analysis , simple regression model was examined to study the association between marker loci ( independent ) and trait score ( dependent variable ) and also computed the percent phenotypic variance explained by each marker . seventy polymorphic marker loci were employed for simple regression analysis ; however , it was discovered that 37 rapd and 5 ssr markers explained their association with morphophysiological traits . the single marker analysis revealed four markers such as ops1850 , opk11780 , opy201200 , opz101350 , and cm13400 were significantly associated with root length ( p = 0.05 ) and explained phenotypic variance of 4.41% , 2.95% , 3.56% , 5.12% , and 5.12% , respectively . a number of secondary roots linked to three markers such as opo16450 ( 4.40% ) , opk111000 ( 5.51% ) , and opv14550 ( 5.82% ) were significantly ( p = 0.05 ) associated . similarly six markers such as opk111000 ( 3.26% ) , opp91030 ( 3.5% ) , opm11600 ( 3.75% ) , opl19900 ( 5.61% ) , opl19600 ( 4.11% ) , opr4600 ( 3.30% ) , and cm211300 ( r = 4.96% ) revealed significant ( p = 0.05 ) association with the root to shoot ratio ( table 6 ) . however , root dry weight is associated with only one maker opl11400 ( 4.86% ) . besides root traits , polygenic inheritance traits such as morphological , gravimetric , and gas exchange at single leaf level traits were also deployed for marker trait association . single marker analysis revealed more than three markers linked to each trait and 25 markers are colocalized with more than one trait and 17 markers are associated with single trait ( table 7 ) . the marker opp51800 is coassociated with shoot dry weight and leaf area duration ( lad ) , and these two traits are positively correlated ( r = 0.93 ) . four markers ( opl11450 , opl191650 , opm171400 , and opk20350 ) linked to nar and two markers opr4600 and opl122000 are significantly ( p = 0.01 ) associated with cumulative water transpired ( cwt ) . the c is the surrogate method to quantify the water use efficiency and it was demonstrated that there is inverse relationship between these two traits . of the six associated markers , opz101350 was found to be associated with c and wue with phenotypic variance of 4.12% and 3.02% , respectively . this marker locus could be negative additive effect since traits are negatively related . the mesophyll efficiency ( ci / gs ) , intrinsic wue ( a / gs ) , and photosynthetic rate ( pn ) are , respectively , associated with cm13400 ( 4.83% ) , cm171210 ( 3.45% ) , and cm171190 ( 3.72% ) ( table 7 ) . whereas positively related traits are associated with the same marker such as opp51800 ( lad and shoot dry weight ) , opz101030 ( mtr and gs ) , and opk20350 ( ci and nar ) alleles contribution from s.3334 . the markers linked to other gas exchange parameters were given in table 7 , which are contributed from s.3334 . we developed a f1 mapping population by crossing contrasting root traits s.3334 high root type as male and l1 valley low root type as female to identify makers linked to root traits and water use efficient types . however , in annual crops , f2 , recombinant inbred lines ( rils ) , near isogenic lines ( nils ) , and doubled haploids ( dh ) mapping population will be used to associate markers with the trait of our interest . however , in perennials the germplasm lines and the cultivated accessions are often highly heterozygous ; consequently f1 population developed from heterozygous parents was used in this study and showed considerable phenotypic and genetic variations . one of the objectives of studying the mapping population was to score the variability in roots and other physiological traits under drought and thus mapping population was gown up in 70% fc of water stress to study the heritability of root traits . indeed root traits are highly complex genetic mechanism , controlled by multi genes and highly heritable in water non limiting environment . the results demonstrated significant variability was observed in root dry weight ( rdw ) , total dry matter ( tdm ) , root to shoot ratio ( rsr ) , cumulative water transpired ( cwt ) with considerable transgressive segregation ( figure 1 ) , and quantitative inheritance of drought tolerance . however , significant positive correlation between rdw / tdm , rdw / cw , and tdm / cwt indicates that under drought increased root growth maintains the shoot hydraulic conductance as adoptive strategy [ 29 , 30 ] . the decreased mean transpiration ( mtr ) and increased water use efficiency ( wue ) could be due to decreased stomatal aperture through chemical signals such as aba . however , some of the clones showed that increased mtr with increased cwt would favor the stomatal conductance and net photosynthesis . inverse relationship between c and wue in robusta coffee accessions was observed ( figure 2 ) , thus measuring c which can be a surrogate method to identify best wue types clones in breeding [ 19 , 32 ] . breeding for such quantitative traits is highly complex cumbersome and thus by determining the allele of a dna marker , plants that possess particular genes or quantitative trait loci ( qtls ) are better than their phenotype . with this background effort was made to identify the markers linked to root and associated physiological traits in coffea canephora . despite the efforts , no successful linkage map could be obtained , partly due to the inadequate number of polymorphic markers generated from this study . the output of the association analysis indicates that , out of 29 traits , only 24 traits were linked to 85 markers . even markers linked to traits explaining the phenotypic variation were not more than 10% . in the present study , this suggests that the successful application of molecular markers in trait mapping greatly requires more polymorphic markers , while successful mapping attempts could still be carried out in the absence of a linkage map as done in chickpea . although construction of linkage map was done in c. arabica and c. canephora predominantly using aflp and rapd markers , association with the traits was not attempted . similarly the first molecular linkage map generated using pseudo testcross strategy for coffea canephora ( cxr kagnalla ) has the largest number of mapped ssrs ( 71 genomic , including nine est - ssrs ) , but trait association was not correlated . most of the markers explained phenotypic variance between 3 and 4% ; however , only two markers , that is , opz111500 and opv14500 , were significantly ( p < 0.01 ) linked to photosynthetic rate ( pn ) , accounting the variation of about 9.23% and 9.30% , respectively ( table 7 ) . the root traits such as root length , number of secondary roots , root dry weight , and root : shoot ratio , revealed significant association ( p < 0.05 ) with markers and the variability ranges from 2.95 to 6.86% ( table 6 ) . this suggests the trait variability explanation is not sufficient to answer the probabilities of occurrence of these markers due to limited polymorphic markers . in the present study , the ssr markers identified herein are significantly associated with morphological and physiological traits , but these markers were explaining the trait in the range between 2.83% and 7.19% . this study has provided more detailed information of root and associated physiological traits relationships under drought and identification of markers linked to such traits with the limited polymorphic markers by employing single marker analysis ( sma ) . further studies are needed to confirm the estimation of qtl positions and effects and to validate markers prior to routine marker assisted selection for drought tolerance in coffee .

coffea canephora exhibit poor root system and are very sensitive to drought stress that affects growth and production . deeper root system has been largely empirical as better avoidance to soil water limitation in drought condition . the present study aimed to identify molecular markers linked to high root types in coffea canephora using molecular markers . contrasting parents , l1 valley with low root and s.3334 with high root type , were crossed , and 134 f1 individuals were phenotyped for root and associated physiological traits ( 29 traits ) and genotyped with 41 of the 320 rapd and 9 of the 55 ssr polymorphic primers . single marker analysis was deployed for detecting the association of markers linked to root associated traits by sas software . there were 13 putative rapd markers associated with root traits such as root length , secondary roots , root dry weight , and root to shoot ratio , in which root length associated marker ops1850 showed high phenotypic variance of 6.86% . two microsatellite markers linked to root length ( cpcm13400 ) and root to shoot ratio ( cm211300 ) . besides , 25 markers were associated with more than one trait and few of the markers were associated with positively related physiological traits and can be used in marker assisted trait selection .

You are an expert at summarizing long articles. Proceed to summarize the following text: but , it can be confused with true right atrial mass in transthoracic echocardiogram , especially in patients with embolic events . in this case report , transthoracic echocardiography suggested the presence of a right atrial mass in patients with a pulmonary embolism . a 73-year - old woman was referred to our hospital for surgery due to tuberculosis spondylitis and concomitant ankylosis . her blood pressure was 110/70 mmhg , and her electrocariogram showed a normal sinus rhythm with a heart rate of 60 beats per minute . however , twenty days after surgery , the patient complained of dyspnea ; the arterial oxygen saturation was decreased to 82% , the d - dimer and b - type natriuretic peptide were increased to 9.73 ug / ml and 2,042 pg / ml , respectively . for evaluation of hypoxia , the transthoracic echocardiogram was perfomed and revealed right side cardiac chamber enlargements without right ventricular dysfunction . furthermore , a 2.2 2.4 cm homogenous non - mobile echogenic mass was found within the right atrium ( fig . because of this finding , we performed a transesophageal echocardiogram that showed the right atrial mass was actually a prominent crista terminalis ( fig . 2 ) . subsequent chest computed tomography ( ct ) and magnetic resonance imaging ( mri ) revealed findings consistent with a pulmonary embolism ( fig . 3 ) , deep vein thrombosis , and a prominent crista terminalis without any definite right atrial abnormal mass ( fig . the crista terminalis is a fibromuscular ridge derived from the regression of the septum spurium as the sinus venosus is incorporated into the right atrial wall.1 ) because of the variation of the regression process , the prominence of the crista terminalis varies widely in adults . pharr et al.2 ) reported that if the prominence of the crista terminalis is superior , it can appear as a right atrial mass on the transthoracic echocardiogram . 2 shows the prominence of the crista terminalis at the superior part of right atrium close to superior vena cava . however , there is no large study on the frequency and characteristics of a prominent crista terminalis with transthoracic echocardiography . furthermore , all seven patients previously reported in case studies of a prominent crista terminalis were women between the ages of 49 and 77 similar to the case reported here.2 - 6 ) therefore , the age and gender of patients with a prominent crista terminalis appear to be similar to the age and gender of patients with a myxoma . in our case , the patient presented pulmonary embolism after long term immobilization with finding of coincident right atrial mass , which could be misdiagnosed with thrombus or other intra - cardiac mass . recently , mckay and thomas4 ) reported that identification of physiologic structures in the right atrium using additional three dimensional ( 3d ) transthoracic imaging can avoid unnecessary tests such as transesophageal echocardiography or mri . thus , we thought that emerging 3d transthoracic imaging could be another alternative modality to differentiate the prominent crista terminalis from the true right atrial mass . in conclusion , transesophageal echocardiography , ct / mri , and 3d transthoracic imaging could be used to differentiate a prominent crista terminalis from a true right atrial mass . understanding of the right atrial anatomy is important to making an accurate diagnosis and to avoid unnecessary additional tests .

a prominent crista terminalis is a normal anatomic variant which consist of thick muscular bridge within the right atrium . however , it could be often misdiagnosed with an abnormal mass on the transthoracic echocardiography . the case report presented here , describe the findings of transthoracic echocardiography that suggested a right atrial mass in patients with pulmonary embolism . however , subsequent transesophageal echocardiography and cardiac computed tomography / magnetic resonance imaging differentiated a true right atrial mass from a prominent crista terminalis .

You are an expert at summarizing long articles. Proceed to summarize the following text: accurate diagnosis , measurement of impairment , and monitoring of symptoms overtime are important for successful management . stimulants are effective in controlling adhd core symptoms in 70%80% of the patients ; these are considered the safest of all the medications utilized in this condition ( olfson et al 2003 ) . the evidence supporting medication - based interventions is strong ; consensus treatment algorithms to guide the multimodal treatment of adhd , alone and in combination with common co - morbidities , have been discussed ( remschmidt 2005 ) . methylphenidate , the most frequently used stimulant , gives better motivation and drive than the others making patients work more intensely ; the duration of its effect is short , but the breadth of its impact is impressive ( conners 2002 ) . treatment with stimulants is more effective in the reduction of adhd symptoms than an intensive program of behavioral and cognitive intervention ; the combination of stimulants with psychosocial interventions offers few advantages over medication alone ( santosh and taylor 2000 ) . the multimodal treatment study concluded that careful medication management with good follow - up is more effective than intensive behavioral treatment ( the mta cooperative group 1999 ) ; combination of medication and intensive behavioral treatment was also significantly superior to psychosocial treatments alone in reducing adhd symptoms . nevertheless , many societies and child health specialists prefer to rely on psycho - educational interventions such as occupational therapy , special education , and psychotherapy , rather than stimulants , despite the cost and the time investment involved ( nianiou et al 2003 ) . the literature provides little support for expanded psycho - educational treatment options and stresses the need for well - designed rigorous studies ( aap 2001 ) . neuropsychological evaluation of children with adhd is often requested on diagnosis along with behavioral rating scales for parents and teachers ( biederman et al 2004 ) . however , measuring progress of children involved in treatment is not routinely done . the reason for this could be related to assessment difficulties ; lengthy testing sessions are counterproductive because attention problems interfere with the process and create difficulties in the interpretation of incorrect results . testing for treatment response in individual children with adhd has not been adequately evaluated ( mollica et al 2004 ) . the clinical effectiveness of stimulant medications is no longer in doubt but the efficacy of psycho - educational interventions and the patterns of changes in adhd need to be explored . visual perception is the capacity to interpret or give meaning to what is seen ; it includes recognition , insight and interpretation of what is seen , at the higher levels of the central nervous system ( buktenica 1968 ) . they have been investigated in children with reading problems and have been found to probably contribute to them ( griffin et al 1993 ) as well as in children with cerebral palsy ( menken et al 1987 ; stiers et al 2002 ) . the objective of this investigation was to examine changes in a tvps that has not been previously utilized in children with adhd , before and after intervention with individualized psycho - educational training and stimulants . we hypothesized that all children were going to have significant changes in their tvps scores in the second time of measurement . sixteen children , 13 boys and 3 girls , 711 years of age ( mean age 8 years and 3 months ) were enrolled in the study . the patients were included on the basis of fulfilling dsm - iv adhd diagnostic criteria ( apa 1994 ) and being students of regular schools . comorbidity with other conditions commonly seen in children with adhd , resource class , or other type of tutoring within the school system were not exclusion criteria . according to our treatment protocol for children with adhd , all of them were referred for comprehensive psycho - educational testing and intervention prior to the initiation of stimulant treatment . after the testing was completed they became involved in a 5-hour / week remedial program of occupational therapy and special education that was carried out by the same team of occupational therapists , special educators , and clinical psychologists . the psycho - educational training was individually tailored to each child s needs and flexible enough to accommodate for changes . occupational therapy was geared towards attention training ; it was based on therapeutic principles of motor - perceptual training , cognitive - perceptual training , and sensory integration . special education included psycho - paedagogic sessions based on behavioral techniques ; additionally , an educational program in accordance to the grade level of the child was followed . after 6 months of psycho - educational activities methylphenidate was prescribed at a dose of 1 mg / kg / day , divided in 3 daily doses , to be given at 8 am , 12 noon , and 4 pm . eight children ( 6 boys and 2 girls , mean age 7 years and 11 months ) took the medication as prescribed and 8 ( 7 boys and 1 girl , mean age 8 years and 6 months ) did not , because the families chose not to proceed with medication due to their own fears and beliefs regarding stimulant use . the tvps ( nonmotor ) revised ( tvps - r ) was utilized ( gardner 1996 ) . visual discrimination , which refers to a subject s ability to match or determine exact characteristics of two forms when one of the forms is among similar forms . 2 . visual memory , which refers to a subject s ability to remember for immediate recall ( after 45 seconds ) all of the characteristics of a given form , and being able to find this form from an array of similar forms . 3 . visual spatial - relationships , which refers to a subject s ability to determine the correct direction of forms ( spatial relations ) . 4 . visual form - constancy , which refers to a subject s ability to see a form , and being able to find it , even though the form is rotated , reversed , or hidden among others . 5 . visual sequential - memory , which refers to a subject s ability to remember a number of forms in a series . 6 . visual figure - ground , which refers to a subject s ability to perceive a form visually , and to find this form hidden in a conglomerated ground of matter . 7 . visual closure , which refers to a subject s ability to determine , from among 4 incomplete forms , the one that would be the same as the completed one . tvps - r measures to what extent a subject ( 413 years ) can perform in the above subtests . in fact it is described as a test nonbiased for culture , gender , and education . from the original raw scores determined for each subtest the following derived scores are obtained : standard scores for each age level , percentile ranks , and perceptual ages . these derived scores allow comparisons of the subjects performance to that of normal children of the same age - group . the test was given twice ; first , upon diagnosis and prior to any intervention and subsequently , eight months after occupational therapy and special education were initiated . in the medicated group we had two experimental conditions ( medicated and nonmedicated children ) and different subjects have been used in each condition . in order to compare the mean total scores , an analysis of variance has been performed . because we had a pre - treatment and a post - treatment test and one experimental condition with two levels ( medicated and nonmedicated ) we performed a two - way analysis of variance ( mixed model ) with one between variable having two levels ( a. education plus medication and b. education without medication ) and one within variable also having two levels ( a. pre - treatment test and b. post - treatment test ) . the dependent variable was the total tvps scores which was composed of 7 sub - scores . sixteen children , 13 boys and 3 girls , 711 years of age ( mean age 8 years and 3 months ) were enrolled in the study . the patients were included on the basis of fulfilling dsm - iv adhd diagnostic criteria ( apa 1994 ) and being students of regular schools . comorbidity with other conditions commonly seen in children with adhd , resource class , or other type of tutoring within the school system were not exclusion criteria . according to our treatment protocol for children with adhd , all of them were referred for comprehensive psycho - educational testing and intervention prior to the initiation of stimulant treatment . after the testing was completed they became involved in a 5-hour / week remedial program of occupational therapy and special education that was carried out by the same team of occupational therapists , special educators , and clinical psychologists . the psycho - educational training was individually tailored to each child s needs and flexible enough to accommodate for changes . occupational therapy was geared towards attention training ; it was based on therapeutic principles of motor - perceptual training , cognitive - perceptual training , and sensory integration . special education included psycho - paedagogic sessions based on behavioral techniques ; additionally , an educational program in accordance to the grade level of the child was followed . after 6 months of psycho - educational activities methylphenidate was prescribed at a dose of 1 mg / kg / day , divided in 3 daily doses , to be given at 8 am , 12 noon , and 4 pm . eight children ( 6 boys and 2 girls , mean age 7 years and 11 months ) took the medication as prescribed and 8 ( 7 boys and 1 girl , mean age 8 years and 6 months ) did not , because the families chose not to proceed with medication due to their own fears and beliefs regarding stimulant use . the tvps ( nonmotor ) revised ( tvps - r ) was utilized ( gardner 1996 ) . . visual discrimination , which refers to a subject s ability to match or determine exact characteristics of two forms when one of the forms is among similar forms . 2 . visual memory , which refers to a subject s ability to remember for immediate recall ( after 45 seconds ) all of the characteristics of a given form , and being able to find this form from an array of similar forms . 3 . visual spatial - relationships , which refers to a subject s ability to determine the correct direction of forms ( spatial relations ) . 4 . visual form - constancy , which refers to a subject s ability to see a form , and being able to find it , even though the form is rotated , reversed , or hidden among others . 5 . visual sequential - memory , which refers to a subject s ability to remember a number of forms in a series . 6 . visual figure - ground , which refers to a subject s ability to perceive a form visually , and to find this form hidden in a conglomerated ground of matter . 7 . visual closure , which refers to a subject s ability to determine , from among 4 incomplete forms , the one that would be the same as the completed one . tvps - r measures to what extent a subject ( 413 years ) can perform in the above subtests . in fact it is described as a test nonbiased for culture , gender , and education . from the original raw scores determined for each subtest the following derived scores are obtained : standard scores for each age level , percentile ranks , and perceptual ages . these derived scores allow comparisons of the subjects performance to that of normal children of the same age - group . the test was given twice ; first , upon diagnosis and prior to any intervention and subsequently , eight months after occupational therapy and special education were initiated . in the medicated group in our study we had two experimental conditions ( medicated and nonmedicated children ) and different subjects have been used in each condition . in order to compare the mean total scores , an analysis of variance has been performed . because we had a pre - treatment and a post - treatment test and one experimental condition with two levels ( medicated and nonmedicated ) we performed a two - way analysis of variance ( mixed model ) with one between variable having two levels ( a. education plus medication and b. education without medication ) and one within variable also having two levels ( a. pre - treatment test and b. post - treatment test ) . the dependent variable was the total tvps scores which was composed of 7 sub - scores . in table 1 the age , sex , adhd type , co - morbidity , and medication status of the children are listed . the comprehensive psycho - educational testing that preceded the remedial treatment program revealed that in addition to the adhd , four children had borderline intelligence , six were dyspraxic , and three dysgraphic . three children did not demonstrate associated co - morbidity . after all data were collected and the standard scores were obtained , we performed descriptive statistics on each variable . table 2 indicates the means , standard deviations , and ranges of the total and sub - category scores in both tests , in medicated and nonmedicated patients . as we can see , both medicated and nonmedicated children appear to have an increase in their score means in the second time of measurement with the exception of closure category in the nonmedicated group where a small decrease was noticed ( from mean 5.375 3.02 to mean 4.25 3.732 ) . subsequently , in order to compare all groups a 2x2 mixed analysis of variance was performed with medication as a between groups factor and test - retest scores as within factor . at first , a t - test was performed for the purpose of detecting any differences between the total tvps scores of the two groups ( medicated and nonmedicated ) in the pre - treatment condition . the t - test value was nonsignificant ( t = 0.0031 , p = 0.741 ) , indicating that the two groups ( medicated and nonmedicated ) were equivalent . the analysis of variance ( table 3 ) resulted in a nonsignificant f for the two groups , medicated and nonmedicated ( f = 0.0031 , p = 0.9563 ) , indicating that there was no differential effect of the two levels of treatment . furthermore , the analysis of variance revealed a significant f for the pre - treatment and the post - treatment total tvps scores ( f = 30.91 , p < 0.0001 ) indicating that there was a significant difference between the pre - treatment and the post - treatment tests . the interaction between pre - post treatment and level of treatment ( medicated nonmedicated ) was nonsignificant ( f = 2.20 , p = 0.1604 ) . as we can observe from the mean values on table 2 ; both groups ( medicated and nonmedicated ) started with an equivalent total score on tvps and , in the post - treatment test , both groups improved considerably , and the medicated children did better . the sample was smaller than required in order to allow for analysis of the subcategory scores . the findings of this study supported our initial hypothesis ; all children enrolled in intervention had significant changes in the tvps total scores in the second time of measurement . this was noted irrespective of medication status with one exception in the score means in closure category in the non - medicated group . these improvements were not merely the result of normal development because the analysis was done on standard scores for each age level that allowed comparisons of the subjects performance to that of normal children of the same age - group . the aim of this study was not to examine the effect of the stimulants versus that of the remedial program and it was not anticipated that half of the subjects were going to be retested without medication . for this reason a control group was not included and retesting of the medicated children prior to stimulant onset was not planned . it was subsequently ascertained that medicated and nonmedicated children were not significantly different at the outset through a t - test on the pretreatment tvps scores . comorbidity with other conditions commonly seen in children with adhd was present in the majority of the subjects . it was not an exclusion criterion as this is very common , occurring in over 50% of patients ; in fact , adhd overlaps with other disorders at an extremely high rate ( gillberg 2003 ) . iq testing may not be reliable in untreated children with adhd because of inattention and it is often underestimated ; moreover , it has been shown that visual perception impairment and intelligence impairment may coexist as two separate and irreducible deficits ( stiers 1999 ) . the importance for a consensus on the processes that are necessary in monitoring children with adhd after a treatment plan has been established , has been previously stressed ( foy and earls 2005 ) . the tvps was chosen as an outcome measure because it is brief and easy to administer , important factors when assessing children with adhd . it is frequently utilized by occupational therapists to monitor the progress of children involved in training . the test - retest reliability of the total tvps scores has been demonstrated in learning disabled children ( mcfall et al 1993 ; burtner et al 2002 ) and in chinese preschoolers ( chan and chow 2005 ) . in contrast , the test - retest reliability estimates scores on the subtests were low and should be used with extreme caution . in the present study the tvps was useful in measuring the progress of children with adhd following a treatment program . how can we explain the improvement of visual perceptual skills when applying techniques that enhance attention ? its adequate functioning is required for the development of cognitive abilities including the complex ones involved in scholastic progress . as a result , children with attention deficits often have difficulties in reading , writing , and arithmetic . according to posner and petersen ( 1990 ) , attention encompasses the following subsystems : orientation to sensory stimuli , filtering and selection of inputs , and maintenance of the thought on a stimulus , mental activity , or goal . impaired attention hinders information processing at multiple levels and has been used as an explanation for the functional decline that occurs in aging and dementia . impairments of attention in early dementia may contribute to performance reductions in other cognitive domains , including memory and executive functions ( rizzo 2000 ) . it is possible therefore that improvements in the tested visual perceptual skills were the by - product of the enhanced attentional processing skills that was accomplished through this treatment schedule . we did not however document a significant effect of methylphenidate even though medicated children scored higher in the second measurement ( table 2 ) . methylphenidate improves vigilance performance , short - term memory performance , and visual problem solving ( swanson et al 1993 ) . there is short - term benefit of stimulants regarding increased concentration and improving on - task behavior , whereas the long - term studies are difficult to evaluate because of methodological problems ( douglas et al 1988 ) . in one study the longer term stimulant - treated group had better executive function performance ( vance et al 2003 ) . nevertheless , stimulants and other medications are unable to completely ameliorate all the difficulties for all children with adhd . therefore , attention needs to be directed toward psycho - educational interventions and their ability to increase the successful functioning of children with adhd ( hoffman and dupaul 2000 ) . the deficit in working memory in children with adhd can be improved by training ; this also improved response inhibition and reasoning and resulted in a reduction of the parent - rated inattentive symptoms of adhd ( klingberg 2005 ) . visual perceptual skills improved in children enrolled in individualized psycho - educational intervention , irrespective of stimulants . the effect of the stimulants could have been investigated if the same children had been examined serially , after psycho- educational training , before and after methyl - phenidate administration . a larger sample of patients and a carefully executed design is important for this purpose .

attention deficit hyperactivity disorder ( adhd ) is treated with stimulants and psycho - educational remedial programs despite limited literature support for the latter . this study aimed to examine changes in a test of visual perceptual skills ( tvps ) that has not been previously reported in children with adhd enrolled in such a program.methodssixteen children , 711 years old , with adhd were involved in occupational therapy and special education geared towards attention training . six months later methylphenidate 1 mg / kg / day was prescribed . it was not taken by eight children because of family choice . the tvps was given twice , upon diagnosis , and 8 months post - intervention . the groups were compared by a repeated measures analysis of variance ( anova ) with medication as a between groups factor and test - retest scores as within factor.resultsall children demonstrated increases in total scores in the second measurement . medicated children scored higher but anova showed a nonsignificant f for the two groups , medicated and unmedicated ( f = 0.0031 , p = 0.9563 ) , indicating a nondifferential effect of the two levels of treatment . it revealed a significant f for the pre- and post - treatment total tvps scores ( f = 30.91 , p < 0.0001 ) indicating a significant difference between pre- and post - treatment tests . the interaction between pre - post treatment and level of treatment ( medicated unmedicated ) was nonsignificant ( f = 2.20 , p = 0.1604).conclusiontvps scores improved in all children following intervention . medicated children did better , but differences were nonsignificant .

You are an expert at summarizing long articles. Proceed to summarize the following text: according to world health organization reports on 2010 , 9 million new and relapse tuberculosis ( tb ) cases has been estimated around the world and 17,000 patients with tb in iran . due to the prevalence of tb in our area , detection of latent tuberculosis infection ( ltbi ) in limited groups of patients such as a candidate for organ transplants or other immunosuppressed individuals is very important and useful . the incidence of ltbi among kidney transplant recipients is estimated at 20 - 70 times higher than in the general population . therefore , current guidelines recommend a generalized screening for evidence of latent infection prior to and after transplantation , to start target appropriate preventative prophylaxis . the tuberculin skin test ( tst ) and interferon - gamma release assays ( igras ) are standard immunologic tools for ltbi detection . until 2001 , the tst was the only method and gold standard for diagnosing ltbi , but after that developing igras change the way . these tests measure the interferon ( ifn)-gamma released by t - lymphocytes in response to mycobacterium tuberculosis - specific antigens including early secreted antigenic target 6 ( esat-6 ) and culture filtrate protein 10 ( cfp-10 ) . these blood tests offer several potential advantages over tsts , including lack of booster effect , once patient encounter for testing , uniform standards for positivity and lack of cross - reactivity with the mycobacterium bovis - bacillus calmette - guerin ( bcg ) and most non - tuberculosis mycobacteria . published data on the performance of the igras in kidney transplant candidates are limited . moreover , in our country , there is little information about the usefulness of the igras in detection of ltbi in these patients . one of the aims of the present work was a comparison of the igra ( t-spot.tb ) and tst test in detection of ltbi in kidney transplant candidates and evaluating the agreement between the two tests . chemoprophylaxis of immuncompormised patients with positive tst and\or igras in our area according to the high prevalence of tb would be able to prevent active tb . the currently recommended prophylaxis of latent tb in our country is based on the monotherapy with isoniazid ( isonicotinylhydrazine ) for at least 9 months . therefore , in this study the patients with positive tests , received isoniazid prophylaxis and had been followed up for active tb for 1 year . this prospective study was conducted in the teaching hospitals of isfahan university of medical sciences , iran , from march 2010 to february 2011 and was approved by the ethics committee of this university ( research project number : 185185 ) . a total of 44 adult patients candidate for receiving a kidney transplant were included in the study . furthermore , if patients refused to continue prophylactic treatment and following up and/or symptoms of isoniazid - induced hepatitis or drug reaction were occurred , they were excluded . patients underwent tst and t-spot.tb testing before scheduled transplant surgery ( blood samples were collected before tst ) and follow up for activating ltbi after surgery . t-spot.tb assay ( oxford immunotec , oxford , uk ) was performed according to the manufacturers recommendation and defined as positive , negative or indeterminate based on manufacturers recommended criteria . briefly , before the tst , 8 ml peripheral venous blood was collected and processed within 4 h. the peripheral blood mononuclear cells ( pbmcs ) were isolated by standard ficoll - hypaque density - gradient centrifugation . the pbmcs were counted and adjusted to a cell number of 2.5 10 pbmcs/1 ml . four wells of the 96-well microtitre plates ( nil control , positive control , panel a and panel b ) , precoated with monoclonal antibody to gamma ifn , were seeded with 100 l of 2.5 10 pbmcs / well . two wells contained different peptide antigens ( esat-6 [ panel a ] and cfp-10 [ panel b ] ) , the nil control well contained the cell in medium alone , and after the appropriate incubation time ( 16 - 20 h ) at in a humidified incubator at 37c and 5% co2 , the plates were washed with phosphate - buffered saline ( pbs ) four times . an appropriate volume of conjugate working solution was prepared ( 1:200 dilution in pbs ) for the secondary incubation ( 60 min at 2 - 8c ) after which the wells was washed again ( 4 ) , as suggested above . results are presented as the number of spot - forming cells and the reaction was observed visually . we used criteria for positive , negative , and indeterminate outcomes that were recommended by the manufacturer . tst was performed using the 5 iu purified protein derivative ( ppd ) ( pasteur institute , tehran , iran ) injection into the volar aspect of the forearm intradermally by trained personnel . a positive test was defined by the size of induration ( not the erythema ) induced by ppd 48 - 72 h after the injection . if induration size was 10 mm , test was considered positive as recommended by local guidelines ( ministry of health and medical education ) . for all individuals with a positive skin test and/or t-spot.tb test isoniazid prophylaxis was started and continued for 9 months , according to national guidelines and recent studies . if suspected sign and symptoms of tb were observed in these patients , they were evaluated for pulmonary and extra - pulmonary tb based on symptoms by specialists . the results were analyzed using the spss software , version 17.0 ( spss inc . , chicago , il , usa ) . numerical variables are reported as mean standard division and categorical variables as number and percentage . the categorical variables were compared by fisher 's exact tests or pearson 's chi - square test , as appropriate . the kappa test was used to analyze agreement between the two tests where > 0.75 represented excellent agreement , 0.4 - 0.75 represented fair to good agreement , and < 0.4 represented poor agreement . all tests of significance were two - tailed ; p 0.05 were considered to be significant . this prospective study was conducted in the teaching hospitals of isfahan university of medical sciences , iran , from march 2010 to february 2011 and was approved by the ethics committee of this university ( research project number : 185185 ) . a total of 44 adult patients candidate for receiving a kidney transplant were included in the study . furthermore , if patients refused to continue prophylactic treatment and following up and/or symptoms of isoniazid - induced hepatitis or drug reaction were occurred , they were excluded . patients underwent tst and t-spot.tb testing before scheduled transplant surgery ( blood samples were collected before tst ) and follow up for activating ltbi after surgery . t-spot.tb assay ( oxford immunotec , oxford , uk ) was performed according to the manufacturers recommendation and defined as positive , negative or indeterminate based on manufacturers recommended criteria . briefly , before the tst , 8 ml peripheral venous blood was collected and processed within 4 h. the peripheral blood mononuclear cells ( pbmcs ) were isolated by standard ficoll - hypaque density - gradient centrifugation . the pbmcs were counted and adjusted to a cell number of 2.5 10 pbmcs/1 ml . four wells of the 96-well microtitre plates ( nil control , positive control , panel a and panel b ) , precoated with monoclonal antibody to gamma ifn , were seeded with 100 l of 2.5 10 pbmcs / well . [ panel a ] and cfp-10 [ panel b ] ) , the nil control well contained the cell in medium alone , and after the appropriate incubation time ( 16 - 20 h ) at in a humidified incubator at 37c and 5% co2 , the plates were washed with phosphate - buffered saline ( pbs ) four times . an appropriate volume of conjugate working solution was prepared ( 1:200 dilution in pbs ) for the secondary incubation ( 60 min at 2 - 8c ) after which the wells was washed again ( 4 ) , as suggested above . results are presented as the number of spot - forming cells and the reaction was observed visually . we used criteria for positive , negative , and indeterminate outcomes that were recommended by the manufacturer . tst was performed using the 5 iu purified protein derivative ( ppd ) ( pasteur institute , tehran , iran ) injection into the volar aspect of the forearm intradermally by trained personnel . a positive test was defined by the size of induration ( not the erythema ) induced by ppd 48 - 72 h after the injection . if induration size was 10 mm , test was considered positive as recommended by local guidelines ( ministry of health and medical education ) . for all individuals with a positive skin test and/or t-spot.tb test isoniazid prophylaxis was started and continued for 9 months , according to national guidelines and recent studies . if suspected sign and symptoms of tb were observed in these patients , they were evaluated for pulmonary and extra - pulmonary tb based on symptoms by specialists . the results were analyzed using the spss software , version 17.0 ( spss inc . , chicago , il , usa ) . numerical variables are reported as mean standard division and categorical variables as number and percentage . the categorical variables were compared by fisher 's exact tests or pearson 's chi - square test , as appropriate . the kappa test was used to analyze agreement between the two tests where > 0.75 represented excellent agreement , 0.4 - 0.75 represented fair to good agreement , and < 0.4 represented poor agreement . all tests of significance were two - tailed ; p 0.05 were considered to be significant . a total of 44 adult patients that candidate for receiving kidney transplant were enrolled in the study . demographic and clinical characteristics of the study participants overall , 8 ( 18.2% ) of cases were positive by tst and 6 ( 13.6% ) subjects by t-spot.tb test . the agreement between tst and t-spot.tb test was moderate ( = 0.49 , 95% confidence interval [ ci ] 0.145 - 0.839 ) . as shown in [ table 2 ] , the concordance between t-spot.tb test and tst was 86% . the induration size on tst was significantly associated with positivity on the t-spot.tb test [ p < 0.001 , figure 1 ] . the relation between history of bcg vaccination and underlying diseases and two tests are shown in [ table 3 ] . agreement between tst and t-spot.tb test comparison between the induration size on tuberculin skin test and t-spot.tb test the association between clinical items and tst or t-spot.tb results we found that 10 ( 22.7% ) patients had positive skin test and/or t-spot.tb test and they had indication to start isoniazid prophylaxis . of these , four had positive results for two tests , four had positive tst , but negative t-spot.tb test and two had negative tst but positive t-spot.tb test . although , all the patients with positive test had isoniazid prophylaxis , one patient was diagnosed as active tb after tuberculin prophylaxis . in addition , one patient with tst positive result was lost to follow - up after transplantation , because of his death that was caused by renal transplant rejection . although igras are increasingly recommended for diagnosis of tb , but in our region igras has been used in research settings only , and these tests are not routine . the renal transplant recipients are usually screened for ltbi by tst . in this study , the usefulness of tst and t-spot.tb test to detect ltbi was tested in renal transplant candidates . in our study , used tst and quantiferon -tb ( qft ) gold for detection of ltbi in candidates of kidney transplantation . they found that 21.9% patients had positive tst and qft gold and agreement between qft and tst was 75% . furthermore , they did not find any association between two test and bcg vaccination . in another study by kim et al . in other studies , the different percentages of tst and igras positivity were reported in immunosuppressed and hemodialysis patients . seyhan et al . have reported 34% and 43% tst and qft gold positivity in hemodialysis patients ; respectively , and agreement between two test was 65% . also soysal et al . reported 39% and 61% tst and t-spot.tb test positivity in this group of patients ; respectively and agreement between two test was 60% . found 17.4% and 44.2% tst and t-spot.tb test positivity in immunosuppressed hematology patients ; respectively and agreement between two tests was 67.8% . the positive percentage of our results are less than other studies and agreement between two tests was moderate , although the induration size of tst significantly associated with positivity on t-spot.tb test . due to lack of access to complete clinical records of transplant recipient candidates and the absence of organ transplantation bank in our country , the patients may be immuncompormised before the assays because of their underlying disease or their treatment schedule . there are few studies on isoniazid prophylaxis in transplant candidates . in our study , 10 patients had indication for isoniazid prophylaxis . kim et al . found that 27 patients had indication for isoniazid prophylaxis and of these , only five patients received isoniazid . they did not mention how long patients were followed up and whether the isoniazid prophylaxis is effective or not . in our study , after the prophylaxis , one patient was diagnosed with active tb . these findings show that isoniazid prophylaxis was not as effective as we thought and we should use a more effective regimen . also , there is few data on the appropriate time to begin the prophylactic treatment . some patients require immediate transplantation and they receive immunosuppressive drug before the prophylaxis is completed . thus , additional studies are needed to determine the right time to begin the prophylaxis . because there is no diagnostic gold standard test for ltbi , the evaluation of sensitivity and specificity of igras is difficult . therefore , further studies are needed in various patients with different levels of the competency of the immune system . in addition , these tests should be evaluated in different geographic areas according to the incidence of tb , performance of bcg vaccination and the social and health level . all authors have contributed in designing and conducting the study . my , ps , mm , shsh , hh , shs , and sht collected the data and rsh , zf , and sr did the analysis . all authors have assisted in preparation of the first draft of the manuscript or revising it critically for important intellectual content . all authors have read and approved the content of the manuscript and are accountable for all aspects of the work .

background : detection of latent tuberculosis infection ( ltbi ) in transplant candidates is very important . the tuberculin skin test ( tst ) and interferon - gamma release assays ( igras ) are standard immunologic tools for ltbi detection . the aim of this study was to compare the tst results and t-spot.tb test ( a type of igras ) in kidney transplant candidates for the screening of ltbi and follow the patients with positive test for an activation of tuberculosis ( tb ) after transplantation and using anti - tb prophylaxis.materials and methods : this study was a prospective study and carried out in 44 renal transplant candidates from march 2010 to february 2011 in the teaching hospitals of isfahan university of medical sciences , iran . tst and t-spot.tb test were performed and their results evaluated . patients with a positive skin test and/or t-spot.tb test were started on anti - tb prophylaxis and followed after transplantation for an activation of their ltbi for 1 year.results:overall , 8 ( 18.2% ) patients were positive for tst and 6 ( 13.6% ) patients for t-spot.tb test . the agreement between tst and t-spot.tb test was moderate ( = 0.49 , 95% confidence interval 0.145 - 0.839 ) . the overall agreement between tst and t-spot.tb test was 86% . no relation was found between the underlying diseases and tst or t-spot.tb test positivity . although isoniazid prophylaxis was used for patients with positive tst and/or t-spot.tb test , one patient had reactivation of tb.conclusion:in kidney transplant candidates both tst and t-spot.tb test were comparable for the diagnosis of ltbi with reasonable agreement between the tests . however , further studies are needed to determine the ability of t-spot.tb test to detect ltbi and to evaluate the need for prophylaxis in these patients .

You are an expert at summarizing long articles. Proceed to summarize the following text: the development of pleural or pericardial effusion in end - stage renal disease ( esrd ) patients is a relatively common occurrence arising from various causes . uraemic pleuritis or pericarditis is usually characterized by serosanguineous or haemorrhagic exudate , and continued haemodialysis is known to be the most effective treatment method for this . repeated fluid aspiration , pleurodesis or decortication two cases of refractory uraemic pleuritis and pericarditis that successfully responded to corticosteroid have been reported [ 34 ] . herein , we report the third case of refractory uraemic pleuropericarditis that showed complete remission upon corticosteroid therapy . the patient was diagnosed with hypertension 25 years ago and had been receiving haemodialysis for the last 10 years . she was diagnosed with uraemic pleuropericarditis just 1 month ago and had been receiving intensive haemodialysis at our hospital ( high - flux dialyser : fmc f60s and the surface area : 1.3 m , blood flow rate : 250 ml / min , dialysate flow rate : 500 ml / min , hd duration and frequency ; for 4 h four times a week , no heparin use ) . on admission , her blood pressure was 160/90 mmhg , pulse rate was 110/min and body temperature was 37.9c . a simple chest x - ray demonstrated cardiomegaly , and loss of both costophrenic angles and echocardiography revealed a large amount of pericardial effusion . laboratory data revealed a white blood cell count of 10 730/mm , the haemoglobin concentration of 9.3 g / dl , the platelet count of 161 000/mm , blood urea nitrogen of 43.0 mg / dl and serum creatinine of 6.1 mg / dl . the serum c - reactive protein ( crp ) level was 6.08 mg / dl and the serum albumin level was 4.1 g / dl . serologic tests revealed the absence of human immunodeficiency virus and hepatitis a , b and c virus . the anti - nuclear antibody , anti - neutrophil cytoplasmic antibody and anti - glomerular basement membrane antibody were all absent . upon thoracentesis , a haemorrhagic lymphocyte - predominant exudate was retrieved , and cytologic examination , bacterial culture and acid - fast staining all revealed negative findings . adenosine deaminase ( ada ) was slightly increased ( 75 iu / l ) in pleural effusion . we diagnosed her as having recurrent uraemic pleuropericarditis and started treatment with on - line haemodiafiltration for 4 h each for four to six times a week without using heparin ( dialyser : fmc f60s and the surface area : 1.3 m , blood flow rate : 250 ml / min , dialysate flow rate : 500 ml / min , substitution dialysate flow rate : 180 ml / min ) . despite of administration of antibiotics and nsaids , she required repeated thoracentesis and pericardiocentesis for relief of symptoms , and the crp level was as high as 30.50 mg / dl on the 58th hospital day . a pleural biopsy was performed and thick fibrinous pleuritis was identified without evidence of infection or malignancy . after that , we administered prednisolone 40 mg / dl ( 1 mg / kg / day ) orally . the patient 's symptoms had abated by 1 week after the start of prednisolone therapy , and pleural and pericardial effusion had decreased ( figure 1 ) . we maintained prednisolone at its initial dose for 36 days and tapered it by 10 mg a week . on the 71st hospital day , she was discharged without any symptoms , and the crp level had decreased to 2.08 mg / dl ( figure 2 ) . ( a ) initial chest x - ray reveals cardiomegaly and both pleural effusion . ( b ) follow - up chest x - ray 1 month after corticosteroid therapy shows completely improved pleural effusion and cardiomegaly . ( hd , haemodialysis ; nsaids , non - steroid anti - inflammatory drug ; pl , prednisolone ; opd , outpatient department ) . the incidence of pleural or pericardial effusion in esrd patients is 20% [ 12 ] . before making the diagnosis of uraemic pleuritis or pericarditis , other causes , such as overhydration , congestive heart failure , coronary artery disease , infection , collagen vascular disease , malignancy etc . , must be ruled out [ 12 ] . in our case , the diagnoses of infection , collagen vascular diseases or malignancy were ruled out both serologically and histopathologically . we also excluded heart problems because echocardiography revealed normal left ventricular systolic function without any regional wall motion abnormality . in uraemic pleuritis , pleural effusion is typically a serosanguineous or haemorrhagic lymphocyte - predominant exudate with pleural tissue exhibiting chronic fibrinous pleuritis , which was exactly the case with our patient . the pathogenesis of uraemic pleuritis or pericarditis remains uncertain but underdialysis is proposed to be a reason considering the fact that the intensified continued haemodialysis regimen has almost always been effective [ 12 ] . however , several cases refractory to continued haemodialysis that evolved into more severe clinical entities , such as pulmonary restriction or cardiac tamponade , have been reported . even though surgical decortication was suggested for the treatment of refractory pleuritis , this surgical procedure is dangerous for esrd patients with comorbidity . alternative therapeutic interventions for refractory uraemic pericarditis include pericardiocentesis , pericardiostomy with or without instillation of intrapericardial glucocorticoids , pericardial window and pericardiectomy . nsaids have been found to have limited success in refractory uraemic pericarditis . in our case , continued on - line haemodiafiltration , antibiotics and nsaids all proved futile in treating pleuropericarditis . because the crp level went on increasing , we made a decision to administer corticosteroid orally ( 1 mg / kg / day ) to suppress nonspecific inflammation . iyoda and kim had reported cases of refractory pleuropericarditis and pleuritis successfully treated with corticosteroid . the patients had been on haemodialysis therapy for 5 and 13 years each before admission . in our case , the length of haemodialysis treatment before admission was 10 years . including our patient , these three patients improved completely by corticosteroid therapy . this may imply that nonspecific inflammation might have been involved in the development of uraemic pleuropericarditis in long - term haemodialysis patients . along with prednisolone , our patient took a proton pump inhibitor due to a history of gastric ulcer . the patient has not experienced adverse effects of steroids including gastric ulcer recurrence . to our knowledge , this is the third case report of conventional therapy - resistant uraemic pleuropericarditis that was successfully treated with systemic corticosteroid . terminal complications of uraemic pleuropericarditis such as pulmonary restriction or constrictive pericarditis call for surgical intervention . however , except in those extreme cases , systemic corticosteroid therapy may be considered for the treatment of refractory pleuropericarditis .

uraemic pleuritis and pericarditis are frequently observed in chronic renal failure patients and tend to improve with continued haemodialysis . however , certain cases have been reported that do not respond to continued haemodialysis alone . a 67-year - old female on long - term haemodialysis was diagnosed with uraemic pleuropericarditis and treated with intensive haemodialysis and given a non - steroidal anti - inflammatory drug to which she showed no response . we report a case of uraemic pleuropericarditis refractory to traditional therapy , which was treated successfully with corticosteroid therapy .

You are an expert at summarizing long articles. Proceed to summarize the following text: bacterial endogenous endophthalmitis ( bee ) is a severe infection of intraocular tissues due to blood borne bacterial metastasis from other organs . although vitrectomy , systemic antibiotics , and intraocular antibiotic injections are the mainstays of treatment , the final functional result is often poor due to diffuse tissue necrosis and retinal detachment post - vitrectomy.1,2 silicone oil was proven to be bactericidal experimentally by ozadamar et al in 1999.3 implementing this finding , azad et al and kaynak et al have conducted two clinical trials which showed some benefit of silicone oil as an adjunct to vitrectomy in endophthalmitis treatment . subjects treated with vitrectomy with silicone oil were found to have better functional outcome with fewer additional operations.1,2 however the trials were conducted for post - traumatic and postoperative endophthalmitis respectively and evidence for silicone oil use in bee is lacking . we carried out a randomized controlled trial for bee comparing vitrectomy with silicone oil tamponade with conventional vitrectomy alone . consecutive subjects with bee were screened for enrollment into this prospective , randomized controlled trial conducted at a single center ( vietnam national institute of ophthalmology ) . written , informed consent was obtained from all participants . the study had the approval of the ethical review committee of hanoi medical university and was carried out in accordance with the tenets of the declaration of helsinki . all patients underwent a systemic evaluation and review of the medical history to identify any risk factors or precipitating factors for bee . the inclusion criteria were as follows : clinically diagnosed with bee , as evidenced by the presence of pain , blurred vision , eyelid edema , conjunctival chemosis and hyperemia , corneal edema , anterior chamber cells and hypopyon , vitritis and/or retinitis , and/or chorioretinal abscesses . the absence of red pupil reflex or grade 5 of vitreous opacity according to the grading system of endophthalmitis vitrectomy study ( evs ) of 1995,4 with visual acuity ( va ) limited to light perception , and/or dense vitreous opacity on ultrasound consistent with that level of vision . no response to medical treatment with intravitreal and systemic antibiotics alone and clinical picture deteriorated over first 2436 hours whose initial va ranged from 20/200 to hand motion . once the clinical diagnosis had been made , anterior chamber ( ac ) tap and vitreous tap were performed . the samples were first directly examined by gram stain before culturing into appropriate media ( blood agar , chocolate agar [ 35c37c , 5%10% co2 ] , and macconkey agar [ 35c37c for columbia blood agar with hemin and vitamin k for anaerobic bacteria ] ) . if bacteria were not found on gram stain , the subject would be excluded from the study . blood culture was performed in cases with fever , and urine culture was performed for all patients . a standard systemic workup was done for all including infectious disease physician consultation , blood tests ( including complete blood count , glucose , electrolytes , hiv , hepatitis b surface antigen ) , urinalysis ( including ph , protein , glucose , bilirubin , cells ) , sinus x - ray , chest x - ray , and abdominal ultrasound . patients were randomized into two study groups , group 1 underwent vitrectomy alone and group 2 underwent vitrectomy with silicone oil tamponade with randomization occurring at two time points : upon diagnosis of bee clinically and microbiologically , if the red reflex remained , patients would be first treated medically ( by intravitreal and systemic antibiotics - please see the sections materials and methods and associated medical treatment ) and closely monitored over 24 hours . if there was poor response to the medical treatment ( more pain and/or more hypopyon , and/or more vitreous opacity ) after 2436 hours , the patients would be enrolled into the study and randomized to either of the two study groups.4 for patients in whom the red reflex was poor at presentation due to vitreous cavity being densely opaque clinically and/or ultrasonographically , patients would be immediately randomized into either of the two study groups after informed consent . the randomization list was generated automatically with help of random allocation software ( developed by saghaei m , department of anesthesia , isfahan university of medical sciences , isfahan , iran ) . a standardized treatment protocol was used with all patients receiving vancomycin ( 1 mg/0.1 ml for intravitreal injection ; 1 g / day or 40 mg / kg / day divided into four doses for intravenous injection ) and ceftazidime ( 2 mg/0.1 ml for intravitreal injection ; 2 g / day or 75 mg / kg / day divided into two doses intravenously ) . patients who were allergic to penicillin were given amikacin ( 400 g/0.1 ml for intravitreal injection ; 6 mg / kg/12 h for intravenous injection ) . intravenous antibiotics were given for at least 1 week ( up to 2 weeks ) depending on the clinical responses ( such as the grade of ac hypopyon , the residual pus at the vitreous base ) and were always followed by another week of oral antibiotics . steroids were prescribed 48 hours after the initialization of antibiotics if there was favorable clinical judgment ( dexamethasone 0.4 mg/0.1 ml for intravitreal injection along with 1 mg / kg / day of prednisolone by mouth for 4 weeks).4 a three - port 20-gauge vitrectomy was performed under the ophthalmic endoscopy system ( fibertech co. , ltd , tokyo , japan ) . after a complete vitrectomy had been performed ( with posterior vitreous detachment in all cases , and vitreous completely removed up to equator ) , patients randomized to group 1 received 0.05 ml of vancomycin ( 1 mg/0.1 ml ) and 0.05 ml of ceftazidime ( 2 mg/0.1 ml ) , and patients in group 2 were injected with silicone oil as well as vancomycin and ceftazidime.5 if retinal tears were caused during the time of surgery , they were treated with endolaser and endotamponaded with short term gas ( sf6 ) in group 1 and with silicone oil in group 2 . if retinal detachment occurred after the surgery in group 1 , patients were all reoperated to reattach the retina , using silicone oil tamponade . patients were scheduled for examination at 1 week , 1 month , 3 months , 6 months , and 9 months postoperatively . silicone oil was removed at 3 months follow - up if the eye was stable and fulfilled the following criteria : no inflammation , normal intraocular pressure ( iop ) , flat retina , and no active proliferative vitreoretinopathy ( pvr ) . if there was localized retinal detachment , this had to be fully corrected before the oil removal.1,2 cases where oil could not be removed were considered failures . this maneuver was performed through two - port technique : one opening for infusion which created the passive pressure to egress the oil gradually through the other opening . air fluid exchange was done when needed to expel all small oil bubbles.6 the study outcome criteria included functional success , anatomical success , and overall success , as well as complication rates : functional success : was defined as of va counting fingers ( cf ) at 1 meter , and any better than preoperative va . anatomical success : was defined as of media clarity grade 2 or better ( according to grading system of evs , 1995).4 overall success : was defined as a va cf at 1 meter and better than pre - operative va and media clarity grade 2 , and an attached retina without intraocular oil . all intraoperative and postoperative complications were noted , such as retinal tears , retinal detachment , macular anomalies , cataract , phthisis bulbi , and others ( with comparison between two groups ) . the complications related to oil removal ( such as retinal detachment , and suprachoroidal hemorrhage ) were also recorded . the sample size for a significance level of 0.05 with a power of 1b = 0.90 for all of our comparisons was calculated using the formula for a single blinded randomized controlled trial n={z1/22p(1p)+z1p1(1p1)+p2(1p2)}2(p1p2)2 where n is sample size in each group ; p1 is the estimated success rate of the control group ( 0.5 ) ; p2 is the estimated success rate of the study group ( 0.8 ) ; and p is the mean success rate of both groups . a standardized treatment protocol was used with all patients receiving vancomycin ( 1 mg/0.1 ml for intravitreal injection ; 1 g / day or 40 mg / kg / day divided into four doses for intravenous injection ) and ceftazidime ( 2 mg/0.1 ml for intravitreal injection ; 2 g / day or 75 mg / kg / day divided into two doses intravenously ) . patients who were allergic to penicillin were given amikacin ( 400 g/0.1 ml for intravitreal injection ; 6 mg / kg/12 h for intravenous injection ) . intravenous antibiotics were given for at least 1 week ( up to 2 weeks ) depending on the clinical responses ( such as the grade of ac hypopyon , the residual pus at the vitreous base ) and were always followed by another week of oral antibiotics . steroids were prescribed 48 hours after the initialization of antibiotics if there was favorable clinical judgment ( dexamethasone 0.4 mg/0.1 ml for intravitreal injection along with 1 mg / kg / day of prednisolone by mouth for 4 weeks).4 a three - port 20-gauge vitrectomy was performed under the ophthalmic endoscopy system ( fibertech co. , ltd , tokyo , japan ) . after a complete vitrectomy had been performed ( with posterior vitreous detachment in all cases , and vitreous completely removed up to equator ) , patients randomized to group 1 received 0.05 ml of vancomycin ( 1 mg/0.1 ml ) and 0.05 ml of ceftazidime ( 2 mg/0.1 ml ) , and patients in group 2 were injected with silicone oil as well as vancomycin and ceftazidime.5 if retinal tears were caused during the time of surgery , they were treated with endolaser and endotamponaded with short term gas ( sf6 ) in group 1 and with silicone oil in group 2 . if retinal detachment occurred after the surgery in group 1 , patients were all reoperated to reattach the retina , using silicone oil tamponade . patients were scheduled for examination at 1 week , 1 month , 3 months , 6 months , and 9 months postoperatively . silicone oil was removed at 3 months follow - up if the eye was stable and fulfilled the following criteria : no inflammation , normal intraocular pressure ( iop ) , flat retina , and no active proliferative vitreoretinopathy ( pvr ) . if there was localized retinal detachment , this had to be fully corrected before the oil removal.1,2 cases where oil could not be removed were considered failures . this maneuver was performed through two - port technique : one opening for infusion which created the passive pressure to egress the oil gradually through the other opening . air a three - port 20-gauge vitrectomy was performed under the ophthalmic endoscopy system ( fibertech co. , ltd , tokyo , japan ) . after a complete vitrectomy had been performed ( with posterior vitreous detachment in all cases , and vitreous completely removed up to equator ) , patients randomized to group 1 received 0.05 ml of vancomycin ( 1 mg/0.1 ml ) and 0.05 ml of ceftazidime ( 2 mg/0.1 ml ) , and patients in group 2 were injected with silicone oil as well as vancomycin and ceftazidime.5 if retinal tears were caused during the time of surgery , they were treated with endolaser and endotamponaded with short term gas ( sf6 ) in group 1 and with silicone oil in group 2 . if retinal detachment occurred after the surgery in group 1 , patients were all reoperated to reattach the retina , using silicone oil tamponade . patients were scheduled for examination at 1 week , 1 month , 3 months , 6 months , and 9 months postoperatively . silicone oil was removed at 3 months follow - up if the eye was stable and fulfilled the following criteria : no inflammation , normal intraocular pressure ( iop ) , flat retina , and no active proliferative vitreoretinopathy ( pvr ) . if there was localized retinal detachment , this had to be fully corrected before the oil removal.1,2 cases where oil could not be removed were considered failures . this maneuver was performed through two - port technique : one opening for infusion which created the passive pressure to egress the oil gradually through the other opening . air the study outcome criteria included functional success , anatomical success , and overall success , as well as complication rates : functional success : was defined as of va counting fingers ( cf ) at 1 meter , and any better than preoperative va . anatomical success : was defined as of media clarity grade 2 or better ( according to grading system of evs , 1995).4 overall success : was defined as a va cf at 1 meter and better than pre - operative va and media clarity grade 2 , and an attached retina without intraocular oil . all intraoperative and postoperative complications were noted , such as retinal tears , retinal detachment , macular anomalies , cataract , phthisis bulbi , and others ( with comparison between two groups ) . the complications related to oil removal ( such as retinal detachment , and suprachoroidal hemorrhage ) were also recorded . the sample size for a significance level of 0.05 with a power of 1b = 0.90 for all of our comparisons was calculated using the formula for a single blinded randomized controlled trial n={z1/22p(1p)+z1p1(1p1)+p2(1p2)}2(p1p2)2 where n is sample size in each group ; p1 is the estimated success rate of the control group ( 0.5 ) ; p2 is the estimated success rate of the study group ( 0.8 ) ; and p is the mean success rate of both groups . between august 2008 and october 2010 108 consecutive patients who fulfilled our inclusion criteria were recruited into the study and were randomized into two groups : 53 patients in group 1 and 55 patients in group 2 . all patients were available for the 9 months postoperative visit ( primary endpoint ) although some patients missed some of the interim visits . demographic and systemic characteristics of study subjects were summarized in table 1 as well as clinical features upon presentation in table 2 . at 9 months postoperatively , on the eyes which has been free from oil for about 6 months ( all cases in group 2 and reoperated cases for retinal detachments in group 1 ) , there was a significantly better outcome in group 2 in terms of overall success ( group 1 , 43.4% versus group 2 , 67.3% ; p=0.01 ) and functional outcome ( group 1 , 50.9% versus group 2 , 74.6% , p=0.02 ) . the rate of va improvement over baseline tended to be better in group 2 , 40% versus 22.6% of group 1 ( p=0.0521 ) . the anatomical result in group 2 also had a trend of being better ( group 1 , 64.2% versus group 2 , 80% ; p=0.07 ) . patient age had a clear effect on the final functional outcome , being better in the group of patients older than 40 years ( relative risk [ rr ] = 2.39 , p=0.02 ) . in contrast , there was no association between sex ( p=0.62 ) or history of systemic risk factors ( p=0.603 ) with final success rate . in terms of preoperative va , the group with va of better than light perception at presentation had better overall outcomes than those with light perception only ( p=0.03 ) . other signs of severity of bee , namely the height of hypopyon , presence of vitreous opacity , retinal necrosis , and vitreous opacity on ultrasound , were also associated with poorer final outcome ( p=0.034 , 0.009 , 0.01 , and 0.017 respectively ) . in group 1 , the rate of retinal detachment over the early study period ( within the first 3 months ) was higher ( 36/53 , 67.9% ) compared to group 2 ( 3/55 , 5.45% ; p=0.0000001 ) . in group 1 , most of the retinal detachments occurred within first postoperative week due superior retinal dialysis ( 27/53 , 50.9% , which were not seen at the time of surgery ) , the remaining were due to later retinal breaks happening within the first month of follow up . all subjects with retinal detachment had to be reoperated to reattach the retina under silicone oil . in contrast , the retinal detachments within first 3 months in group 2 were typically due to traction under the oil bubble and were normally repaired with scleral buckling . we compared the safety of silicone oil removal in patients of group 1 and those of group 2 and found that the rate of retinal detachment after silicone oil removal in group 1 was much higher than that of group 2 ( 7/19 , 36.8% versus 3/45 , 6.6% ; p=0.009 . there was also a significant difference in the rate of irreversible visual loss complications ( fibrosed and atrophic macula ; inoperable retinal detachment ; phthisis bulbi and evisceration ) in group 1 compared with group 2 ( 43.4% versus 21.8% with p=0.01 , table 5 ) . there were nine cases of oil in the anterior chamber : four in group 1 and five in group 2 . in four cases ( two in each group ) , silicone oil was removed earlier than scheduled due to oil related complications leaving no sequelae . there was only one case of high iop post - surgery , which was treated successfully with glaucoma eye drops . at 9 months postoperatively , on the eyes which has been free from oil for about 6 months ( all cases in group 2 and reoperated cases for retinal detachments in group 1 ) , there was a significantly better outcome in group 2 in terms of overall success ( group 1 , 43.4% versus group 2 , 67.3% ; p=0.01 ) and functional outcome ( group 1 , 50.9% versus group 2 , 74.6% , p=0.02 ) . the rate of va improvement over baseline tended to be better in group 2 , 40% versus 22.6% of group 1 ( p=0.0521 ) . the anatomical result in group 2 also had a trend of being better ( group 1 , 64.2% versus group 2 , 80% ; p=0.07 ) . patient age had a clear effect on the final functional outcome , being better in the group of patients older than 40 years ( relative risk [ rr ] = 2.39 , p=0.02 ) . in contrast , there was no association between sex ( p=0.62 ) or history of systemic risk factors ( p=0.603 ) with final success rate . in terms of preoperative va , the group with va of better than light perception at presentation had better overall outcomes than those with light perception only ( p=0.03 ) . other signs of severity of bee , namely the height of hypopyon , presence of vitreous opacity , retinal necrosis , and vitreous opacity on ultrasound , were also associated with poorer final outcome ( p=0.034 , 0.009 , 0.01 , and 0.017 respectively ) . in group 1 , the rate of retinal detachment over the early study period ( within the first 3 months ) was higher ( 36/53 , 67.9% ) compared to group 2 ( 3/55 , 5.45% ; p=0.0000001 ) . in group 1 , most of the retinal detachments occurred within first postoperative week due superior retinal dialysis ( 27/53 , 50.9% , which were not seen at the time of surgery ) , the remaining were due to later retinal breaks happening within the first month of follow up . all subjects with retinal detachment had to be reoperated to reattach the retina under silicone oil . in contrast , the retinal detachments within first 3 months in group 2 were typically due to traction under the oil bubble and were normally repaired with scleral buckling . we compared the safety of silicone oil removal in patients of group 1 and those of group 2 and found that the rate of retinal detachment after silicone oil removal in group 1 was much higher than that of group 2 ( 7/19 , 36.8% versus 3/45 , 6.6% ; p=0.009 . there was also a significant difference in the rate of irreversible visual loss complications ( fibrosed and atrophic macula ; inoperable retinal detachment ; phthisis bulbi and evisceration ) in group 1 compared with group 2 ( 43.4% versus 21.8% with p=0.01 , table 5 ) . there were nine cases of oil in the anterior chamber : four in group 1 and five in group 2 . in four cases ( two in each group ) , silicone oil was removed earlier than scheduled due to oil related complications leaving no sequelae . there was only one case of high iop post - surgery , which was treated successfully with glaucoma eye drops . in this randomized clinical trial , we found significant differences between two groups over time . at 9 months after the surgery ( study endpoint ) , group 2 ( who underwent vitrectomy with silicone oil ) had better functional outcome and overall success . this finding agrees with the conclusions from previous studies,1,2 and shows the long term advantages of endotamponade with silicone oil for endophthalmitis . the treatment of bee in the south east asian region , particularly with the major pathogen klebsiella pneumoniae from hepatobiliary infections , has been generally challenging with very poor outcomes.7 more recently , thanks to advances of vitrectomy , the reported treatment outcome of bee has improved modestly to a success rate of 33%7 to 40%.8 most authors agreed upon the crucial role of vitrectomy in improving visual function , eyes which had been treated surgically seemed to have three times more chances of recovering useful vision and three times less chance of being eviscerated.710 when compared with the surgical outcome from similar studies in the region , we found our result seemed to be more favorable , our overall success rate of 74.6% in group 2 compared with 30% by yoon et al.9 the better outcome of silicone oil assisted vitrectomy could be explained as follows : silicone oil may help antibiotics to eradicate the microbes leading to a quicker recovery.3 some authors in the past hesitated to use silicone oil in endophthalmitis eyes due to the fear of microbial pooling and uncontrolled antibiotic concentration behind the oil bubble.11 however , later study showed the inhibiting effect of silicone oil for microbes including anaerobes.3 furthermore , antibiotics penetrated so well into the sub - oil space that oral ciprofloxacine ( 0.75 g twice a day ) could easily bring about the microbial bactericidal concentration ( mbc ) and/or microbial inhibiting concentration ( mic).11 silicone oil could also help prevent postoperative retinal detachment . another advantage of using silicone oil is that the oil keeps the media clear , which helps postoperative examination and additional laser treatment when needed . oil also has good surface tension , pushing the retina against the eye wall , and blocking retinal tears.1,2 there are some disadvantages to performing vitrectomy in severely infected bee eyes : 1 ) the media opacity obscures visualization , leading to unexpected damage to the retina ; 2 ) the infected and necrosed retina may be vulnerable during the operation to surgical traction especially at the vitreous base , where there is strong vitreo - retinal adherence ; 3 ) the inflammation may continue after the surgery , causing late necrosis of underperfused zones like the ora serrata ( retinal dialysis ) ; and 4 ) ciliary body damage ( necrosis , shock ) may cause postoperative hypotony . all these issues may cause retinal detachment.1,2,5,12 thus , vitrectomy in bee could be considered as a double - edged sword , on one hand , it may help to clear the infection while on the other hand , it could increase the risk of retinal detachment . our study has shown notable differences in post - vitrectomy retinal detachment rates in eyes with bee . in group 1 , 50.9% ( 25/53 ) of patients experienced a retinal detachment within the first post operative week . these detachments were associated with a superior retinal dialysis and all patients required re - operation with silicone oil tamponade to obtain re - attachment and stabilization of the eye . among the other cases , there were nine more cases of retinal detachment that occurred later , making the total number of 36 retinal detachments ( 67.9% ) in group 1 . in contrast , in group 2 , there were no retinal detachments during the hospitalization period and within first 3 months there were only three cases of retinal detachment ( 5.45% ) caused by residual traction under the oil bubble . most of late complications in the treatment course of bee are related to pvr . in the 27 cases of retinal detachment in group 1 where repair with silicone oil assistance was performed , the vicious cycle of pvr was triggered.13 although the retina was attached initially under oil , pvr was further accentuated by the second surgery , leading to later recurrent retinal detachment in nine cases . all these nine cases were considered inoperable , and oil was left permanently in the eye . among 36 oil - filled eyes of group 1 , at 3 months after the procedure , there were only 19 cases that were considered suitable candidates for oil removal . unfortunately , the recurrent rate of retinal detachment in this group was also high , up to 36.8% ( 7/19 ) . compared with the rate of recurrent retinal detachment after oil removal in group 2 , we saw a clear difference : 3/45 , 6.6% in group 2 versus 7/19 , 36.8% ( p=0.008 ) . in other words , the relative risk of oil removal in group 1 compared to group 2 was 4.31 ( range , 1.2215.27 ) . the recurrent retinal detachment was almost always due to the progressive pvr , causing new breaks and/or tractions.6,14,15 all recurrent retinal detachments after surgery were complicated due to the combination of rhegmatogenous and tractional factors.13,14 the prognosis was poor and many eyes became phthisical . at the final follow - up , the number of very poor outcomes ( including macular fibrosis , inoperable retinal detachment , phthisis bulbi , evisceration ) in group 1 was significantly higher than that of group 2 ( 43.4% versus 21.8% with p=0.02 ) and this is reflected in the overall success rates . most of the patients in our trial from vietnam with bee were previously fit and healthy ( 75% ) with no other medical conditions , and with the mean age of only 32 years . in contrast , in the 17 year review of jackson et al8 bee usually occurred in patients with pre - existing diabetes mellitus , with mean age of 48.9 years . in vietnam , meanwhile another review in the south east asia region showed that the most common risk factor for bee was hepatobiliary infections ( 13/27 cases equivalent to 48%).16 however , none of recruited subjects had fever during the hospitalization time so the proposed mechanism of bacteria metastasis was bacteremia rather than septicemia . the source of many of these infections remains unclear due to the low rate of culture positivity . we subsequently ran another analysis using polymerase chain reaction ( pcr ) and sequencing technique to evaluate the vitreous samples from another 23 patients with bee and we found 47.8% ( 11/23 ) positive with streptococcus pneumoniae . basing on that evidence we suspect that we may have needed a more sensitive assay for the tests in our initial study . in addition , the high rate of upper respiratory infections in vietnamese patients may have contributed to episodic asymptomatic bacteremia in our patients and the widespread inappropriate use of antibiotics may have resulted in the disease remaining sub clinical . we found that the positive rate of vitreous analysis was much higher than that of aqueous taps ( on smear 81.5% versus 48.1% ; on culture 13.9% versus 3.7% ) . this finding was similar with previous studies.1720 the overall positive rate of bacterial cultures was relatively low , only 19/108 cases accounting for 17.6% . the most frequently seen pathogen was staphylococcus aureus ( 6/19 , accounted for 31.5% ) , followed by streptococcus pneumoniae ( 3/19 , 15.7% ) , and pseudomonas aeruginosa ( 3/19 , 15.7% ) ( table 4 ) . in other countries of south east asia , the most common bacterium were gram negative rods klebsiella from hepatobiliary infections.7,19 in europe and north america , the most common isolates were gram positive cocci like staphylococcus and streptococcus from arthritis and endocarditis.8,19,21,22 in the study , we found that markers of severity of bee like preoperative va , hypopyon height ( in mm ) , vitreous opacity grade , and fundus affected areas ( necrosis , abscesses ) were associated with poorer final result , which is in agreement with previous studies.2325 the evs study has already shown the benefit of urgent vitrectomy for post cataract endophthalmitis with no pupillary red reflex and vision acuity limited to light perception.4 the difference in bee patients was that the anterior segment was also usually severely involved . if the anterior segment was very opaque the vitrectomy indication would need to be based on the ultrasound evaluation ( as shown in the inclusion criteria ) . intraoperatively , we typically found retinal necrosis and chorioretinal abscesses , findings not commonly associated with endophthalmitis complicating cataract surgery , and which likely contributed to the poorer prognosis ( table 3 ) . in cases treated initially with antibiotics the clinical evolution needed to be closely monitored for a timely surgical indication . the main limitation of this study was the low rate of positive cultures , which may be partly explained by the prior use of antibiotics from referring centers , and the small volume of collected samples . in future , in order to elucidate the bacterial basis of this disease , we may need to use other methods such as pcr and sequencing which can bring about a higher sensitivity and specificity . in this randomized control trial for bee , we found better functional and overall outcomes in subjects treated by vitrectomy with silicone oil compared to vitrectomy alone . there was a high rate of retinal detachment in the group treated by vitrectomy alone . we thus recommend that severe cases of bee be treated by vitrectomy with silicone oil .

background / aimsto compare treatment outcomes with and without silicone oil tamponade in patients undergoing pars plana vitrectomy ( ppv ) for severe endogenous bacterial endophthalmitis ( bee).methodsone hundred and eight consecutive patients with severe bee ( defined by the absence of pupil red reflex at presentation and/or dense vitreous opacity on ultrasound and no improvement after 2436 hours of medical treatment ) were randomly assigned to two treatment groups : group 1 , standard ppv with intravitreal antibiotics ; and group 2 , ppv with intravitreal antibiotics and silicone tamponade . overall success was defined as : a visual acuity count fingers at 1 meter , with an attached retina , and no intraocular oil.resultsfifty three patients were randomized to group 1 and 55 patients to group 2 . the mean age of study subjects was 32 years and baseline clinical characteristics were similar in both groups . at the final follow - up visit at 9 months , the overall success rate of group 2 ( 67.3% ) was significantly better than group 1 ( 43.4% ; p=0.01 ) . there were also fewer devastating complications ( such as inoperable retinal detachment , phthisis bulbi ) in group 2 compared with group 1 ( 21.8% versus 43.4% ; p=0.01).conclusionthe outcome at 9 months of patients with bee treated by vitrectomy with silicone oil was better than those treated by vitrectomy alone .

You are an expert at summarizing long articles. Proceed to summarize the following text: thus it becomes very important to balance conservation of normal cells and elimination of affected cells . sometimes limitation of duration and quantity of radiation therapy is necessary to minimize side effects on normal tissue , and in severe cases alternative treatment is considered . treatment is difficult , and often osteoradionecrosis leads to damage such as deformity of jaws . several theories for the pathogenesis of osteonecrosis have been suggested , and it is widely accepted that hypoxic , hypovascular and hypocellular change of radiation exposed bone are a primary mechanism . osteoradionecrosis is defined as non - vital bone appearing at irradiated areas , and is characterized by delayed healing with little new bone formation locally for 3 to 6 months . the mandibular body is the most affected site , with over 50% of cases occurring after tooth extraction . as head and although several treatments for osteoradionecrosis exist , such as local wound debridement , antibiotics , surgical treatment and hyperbaric oxygen therapy , definitive treatment for osteoradionecrosis is controversial . this paper is a case report of osteoradionecrosis of the mandible that was treated with sequestrectomy and iliac bone graft , with a current literature review . a 72-year - old male patient visited the department of oral medicine with trismus following extraction . the patient s medical history includes a tonsillectomy and right radical neck dissection followed by radiation therapy due to right tonsillar cancer seven years prior . three months before the visit , the right mandibular first molar and second molar were extracted at a local dental clinic , followed by trismus developing . at the first visit , the mouth opening was 10 mm , nerve damage signs were absent , and a moth - eaten appearance was observed at the right mandibular angle area in panoramic view ( fig . osteomyelitis was diagnosed and he was referred to the department of oral and maxillofacial surgery . after eight months , an in duration manifested at the right mandibular angle and submandibular area ; an orocutaneous fistula formed , with pus discharge above the right mandibular inferior border area and right mandibular posterior edentulous gingiva . from cone - beam computed tomography ( ct ) and panoramic view , extensive bone destruction was observed from the right mandibular body to the mandibular angle area . 2 ) . sequestrectomy , iliac bone graft , and umbilical fat pad graft was performed via a submandibular approach under general anesthesia ( fig . one month after the operation wound dehiscence was observed at the submandibular operation site . to promote secondary healing , terudermis ( olympus terumo biomaterials corp . , as secondary healing proceeded , wound dehiscence recovered , there was no more pus discharge , and mouth opening improved to over 30 mm ( fig . 5 , 6 ) . radiation therapy and dental treatment development have decreased the risk of osteoradionecrosis of the jaw . still , osteoradionecrosis remains the most severe complication of radiation therapy . since there is no exact definition of osteoradionecrosis , diagnosis depends on clinical symptoms , with radiographic findings also suggested as diagnostic criteria . typical symptoms of osteoradionecrosis include nonvital bone exposure , sequestrum , orocutaneous fistula and pathologic fracture of mandible . generally osteoradionecrosis is diagnosed if non - vital bone exposure with delayed healing lasts three to six months , with non - specific neoplastic findings of the bone . the exact morbidity rate following tooth extraction is not known but several reports state that about 2% of tooth extraction leads to osteoradionecrosis . the difference in morbidity rate is thought to stem from the greater radiation exposure to the mandible , and the effect on blood supply during radical neck dissection , cutting facial artery and branches . before the 1990s , morbidity of almost 16% was reported , but radiation technique development reduced that to 2% . in addition to development of radiation technique , part of the decreasing risk of osteoradionecrosis is attributed to less frequent teeth extraction after radiation therapy , due to increased dental care and caries prevention with fluoride for head and neck cancer patients . when osteoradionecrosis is suspected after tooth extraction , delayed healing of less than three months is difficult to diagnose as osteoradionecrosis , because radiation exposed tissue has low recovery capacity . in that situation , observation is recommended over surgical treatment . once osteoradionecrosis is diagnosed , treatment depends on the affected range of the lesion . in localized and stabilized osteoradionecrosis , conservative therapy such as hyperbaric oxygen therapy , careful oral hygiene management and local sequestrectomy is preferred , accompanied by long - term antibiotic therapy . however , if the patient is suffering from pain , if there is bone exposure , if there is lack of response to antibiotics , trismus , oroskin fistula or pathologic fracture , an extensive surgical approach is necessary [ 8 ] . the basic principle of the surgical approach for osteoradionecrosis is elimination of all necrotic tissue and severe scar tissue , and reconstruction of the defect with well - vascularized tissue . as in extensive osteonecrosis , segmental mandiblectomy and soft tissue excision is often necessary . at the same time , vascularized free flap reconstruction is also considerable . non - vascularized free bone graft into a defect has a limited success rate , and especially with radiation wounds , a high complication rate . a well - vascularized free flap yields more predictable and esthetic results compared with non - vascularized tissue graft . an abundant blood supply in the non - radiation - exposed vascularized graft tissue can promote healing even in osteoradionecrosis affected marginal tissue . localized flap or distant flap can also provide vascularized tissue but these flaps are less reliable in providing sufficient blood supply comparing with a vascularized free flap . in general , microvascular reconstruction is thought to be the most effective reconstruction method for advanced osteoradionecrosis . the greatest advantage of microvascular reconstruction is safety resulting from intrinsic blood supply from a main perforator vessel even at an extensive lesion . this study presents osteoradionecrosis on a recurrent tonsil cancer patient who had repeated radiation therapy and radical neck dissection . soundness of the lingual cortex was checked on the cone - beam ct images , and the lingual cortex was identified after sequestrectomy . during surgery , normal facial artery and branches thus , sequestrectomy and non - vascularized iliac bone graft were selected as the alternative treatment methods for osteoradionecrosis of the mandible . at postoperative exam , although there was noticeable delay in the healing process , especially wound dehiscence , regular wound dressing and secondary healing process using terudermis ( olympus terumo biomaterials corp . ) at this point the patient has no more pain and pus drainage and neither the necrosis nor the cancer have recurred . with extensive osteoradionecrosis , mandibular reconstruction using vascularized free flap should be considered first . in this case , with a localized osteoradionecrosis lesion where preoperative conservative therapy was sufficient , satisfactory results were obtained using free iliac bone and an umbilical fat pad graft with an abundant blood supply .

osteoradionecrosis is one of the most serious complications of patients receiving radiation therapy . it is characterized by hypovascularity , hypocellularity , and hypoxia - inducing necrosis of bone and soft tissue following delayed healing . in this case , a 72-year - old man was referred to the department of oral and maxillofacial surgery complaining of trismus following extraction three months before first visit . he had a history of right tonsillectomy , radical neck dissection and radiotherapy performed due to right tonsillar cancer seven years prior . after the diagnosis of osteoradionecrosis on right mandibular body and angle , conservative antibiotic therapy was used first , but an orocutaneous fistula gradually formed , and extensive bony destruction and sequestrum were observed . sequestrectomy , free particulated iliac bone and umbilical fat pad graft were performed via a submandibular approach under general anesthesia . preoperative regular exams and delicate wound care led to secondary healing of the wound without vascularized free flap reconstruction .

You are an expert at summarizing long articles. Proceed to summarize the following text: surgical resection has been the choice in treatment of patients with non - small cell lung cancer ( nsclc ) with resectable primary tumor and without lymph node metastasis ( ct1 - 3n0 ) . however , some patients are not suitable for surgical resection because of several reasons , including inadequate cardio - pulmonary function , old age , medical comorbidities , and refusal of surgery by the patients . definitive radiation therapy ( rt ) is considered a reasonable alternative to surgery in this clinical setting . the clinical outcomes following conventionally fractionated high dose rt delivering 60 - 66 gy with 1.8 gy or 2.0 gy per fraction were generally rather unsatisfactory : 2-year local control ( lc ) rates were 55%-70% ; and 5-year overall survival ( os ) rates were 5%-42% , respectively . as a way to intensify the local tumor control probability without compromising the risk of normal organ damage in high dose rt , a few altered fractionation schemes are considered . hyperfractionation , defined as more than one fraction per day at lower dose per fraction , is thought to be beneficial in suppressing tumor repopulation without increasing the risk of late morbidity . accelerated fractionation , defined as more than one fraction per day without lowering the fractional dose , mainly aims to reduce tumor repopulation and to dramatically reduce the total treatment duration . hyperfractionation and accelerated fractionation , however , are currently infrequently used in the routine clinics because of more frequent and severe acute toxicities in addition to the laboriousness and inconvenience both to the patients and the care - givers . hypofractionation , defined as lower total fraction number at higher dose per fraction , is thought to be advantageous in controlling tumors that grow slowly and/or have a significant hypoxic fraction . stereotactic body rt ( sbrt ) , an extreme example of hypofractionation , is a reasonable alternative to surgery , but has a few practical limitations of tumor size and location associated with severe complication . the improvements both in diagnostics and rt techniques have enabled the delivery of high dose and conformal radiation to the target region only . however , coupled with these improved dose distribution profiles , the merits of shorter treatment duration seem to have been underestimated , mainly because of the traditional myth of late toxicity risk . the authors have employed a modest hypofractionation schedule in treatment of patients having nsclc without lymph node metastasis , who are not ideal candidates for either surgery or sbrt for more than 15 years . our clinical experiences with 60 patients , who had centrally located ct1 - 3n0 nsclc and were treated with 54 - 60 gy in 18 - 20 fractions by 3 gy per fraction , were previously reported . soliman et al . reported their promising clinical outcomes following 48 - 60 gy in 12 - 15 fractions by 4 gy per fraction in treating patients with peripherally located ct1 - 3n0 nsclc . encouraged and motivated by this , the authors have adopted a new fractionation schedule delivering 60 gy in 15 fractions mainly to selected patients with non - centrally located tumors since 2011 . the authors retrospectively assessed the clinical outcomes , toxicities , and cost - effectiveness following two modest hypofractionation schedules , under the consistent selection criteria in a single institute , and would report our experiences . the current study was approved by the institutional review board of samsung medical center ( 2015 - 07 - 046 ) , and the authors retrieved the data of the patients treated with definitive rt alone for nsclc . between january 2001 and june 2014 , 131 patients underwent definitive rt alone for newly diagnosed ct1 - 3n0 nsclc . histopathologic confirmation of non - small cell carcinoma was achieved in all patients , and the clinical stages according to the seventh american joint committee on cancer staging manual were assigned based on chest computed tomography ( ct ) in all and fluoro - deoxyglucose positron emission tomography ( pet)ct in 109 patients ( 87.9% ) . in 17 patients ( 13.7% ) , who had equivocal finding on the hilar and/or mediastinal lymph node involvement on imaging studies , endobronchial ultrasonographic aspiration biopsy was performed to confirm the absence of lymph node metastasis . after excluding four patients who did not complete rt and three who were lost to follow - up immediately following rt , all patients underwent ct simulation typically in the supine position and the gross tumor volumes ( gtvs ) were delineated under lung window setting . the clinical target volumes ( ctv ) were generated with 5 mm expansion of the gtvs in all directions , which were then modified considering the adjacent anatomic limits . in principle , elective nodal irradiation ( eni ) to the ipsilateral hilar and/or mediastinal lymphatics was not routinely added , however , was optionally added mainly to those with centrally located and large tumors . in 20 patients , who had primary tumors located in the lower lobes and/or showed significant respiratory motion , the gtvs were delineated on the internal target volume concept following four - dimensional ct . three or four coplanar beams of 4- , 6- , or 10-mv photons from a linear accelerator were arranged so as to cover the ctvs plus 1.5 cm margins while avoiding the dose - limiting normal organs such as the spinal cord , lung , heart , and esophagus as much as possible . in patients who did not undergo four - dimensional ct , v20 of the lung was to be kept 27.5% and the mean lung dose was 16 gy . maximum doses to the spinal cord and esophagus were not to exceed 35 gy and 45 gy , respectively . the prescription policy was to deliver at least 97% of the prescribed dose to 95% of the ctvs . from 2001 till 2010 , one dose - fractionation schedule was used for delivery of 60 gy in 20 fractions over 4 weeks to 79 patients ( group 1 ) . since 2011 and thereafter , however , two different dose - fractionation schedules were used for delivery of 60 gy in either 20 fractions over 4 weeks to 20 patients ( group 2 ) or in 15 fractions over 3 weeks to 25 ( group 3 ) , respectively . the biologically equivalent doses at / of 10 gy ( bed10 ) were 78 gy and 84 gy to the patients in groups 1 and 2 and those in group 3 , respectively . the selection of dose schedule in groups 2 and 3 depended on the location , size , and the geometry of the tumor in relation to the esophagus . if the shortest distance between the ctv margin and the esophagus was 1.5 cm , 60 gy in 15 fractions was preferred to 60 gy in 20 fractions ( fig . follow - up visits and imaging were obtained according to institutional protocol and included a follow - up visit with a chest ct scan 1 month after treatment and 3 - 4 months interval follow - up visit with either chest ct scan or pet scans alternatingly . os , progression - free survival ( pfs ) , and lc were calculated as the interval from the first date of treatment to the date of death or last follow - up , any progression detection , and consequent tumor growth at the primary site , respectively . morbidities following rt and the cost incurred by rt course following two dose schemes were compared . the survival rates were calculated using the kaplan - meier method and compared using the log - rank test for univariate analysis . multivariate analysis was described with hazard ratios ( hr ) and their 95% confidence interval ( ci ) was derived from the cox proportional hazards model . the current study was approved by the institutional review board of samsung medical center ( 2015 - 07 - 046 ) , and the authors retrieved the data of the patients treated with definitive rt alone for nsclc . between january 2001 and june 2014 , 131 patients underwent definitive rt alone for newly diagnosed ct1 - 3n0 nsclc . histopathologic confirmation of non - small cell carcinoma was achieved in all patients , and the clinical stages according to the seventh american joint committee on cancer staging manual were assigned based on chest computed tomography ( ct ) in all and fluoro - deoxyglucose positron emission tomography ( pet)ct in 109 patients ( 87.9% ) . in 17 patients ( 13.7% ) , who had equivocal finding on the hilar and/or mediastinal lymph node involvement on imaging studies , endobronchial ultrasonographic aspiration biopsy was performed to confirm the absence of lymph node metastasis . after excluding four patients who did not complete rt and three who were lost to follow - up immediately following rt , all patients underwent ct simulation typically in the supine position and the gross tumor volumes ( gtvs ) were delineated under lung window setting . the clinical target volumes ( ctv ) were generated with 5 mm expansion of the gtvs in all directions , which were then modified considering the adjacent anatomic limits . in principle , elective nodal irradiation ( eni ) to the ipsilateral hilar and/or mediastinal lymphatics was not routinely added , however , was optionally added mainly to those with centrally located and large tumors . in 20 patients , who had primary tumors located in the lower lobes and/or showed significant respiratory motion , the gtvs were delineated on the internal target volume concept following four - dimensional ct . three or four coplanar beams of 4- , 6- , or 10-mv photons from a linear accelerator were arranged so as to cover the ctvs plus 1.5 cm margins while avoiding the dose - limiting normal organs such as the spinal cord , lung , heart , and esophagus as much as possible . in patients who did not undergo four - dimensional ct , v20 of the lung was to be kept 27.5% and the mean lung dose was 16 gy . maximum doses to the spinal cord and esophagus were not to exceed 35 gy and 45 gy , respectively . the prescription policy was to deliver at least 97% of the prescribed dose to 95% of the ctvs . from 2001 till 2010 , one dose - fractionation schedule was used for delivery of 60 gy in 20 fractions over 4 weeks to 79 patients ( group 1 ) . since 2011 and thereafter , however , two different dose - fractionation schedules were used for delivery of 60 gy in either 20 fractions over 4 weeks to 20 patients ( group 2 ) or in 15 fractions over 3 weeks to 25 ( group 3 ) , respectively . the biologically equivalent doses at / of 10 gy ( bed10 ) were 78 gy and 84 gy to the patients in groups 1 and 2 and those in group 3 , respectively . the selection of dose schedule in groups 2 and 3 depended on the location , size , and the geometry of the tumor in relation to the esophagus . if the shortest distance between the ctv margin and the esophagus was 1.5 cm , 60 gy in 15 fractions was preferred to 60 gy in 20 fractions ( fig . follow - up visits and imaging were obtained according to institutional protocol and included a follow - up visit with a chest ct scan 1 month after treatment and 3 - 4 months interval follow - up visit with either chest ct scan or pet scans alternatingly . os , progression - free survival ( pfs ) , and lc were calculated as the interval from the first date of treatment to the date of death or last follow - up , any progression detection , and consequent tumor growth at the primary site , respectively . morbidities following rt and the cost incurred by rt course following two dose schemes were compared . the survival rates were calculated using the kaplan - meier method and compared using the log - rank test for univariate analysis . multivariate analysis was described with hazard ratios ( hr ) and their 95% confidence interval ( ci ) was derived from the cox proportional hazards model . the median age of all patients was 74 years ( range , 54 to 89 years ) and over three - quarters ( 98 patients , 79.0% ) were male . squamous cell carcinoma was more common in 71 patients ( 57.3% ) than adenocarcinoma in 36 ( 29.0% ) and other types in 17 ( 13.7% ) . the performance status was eastern cooperative oncology group ( ecog ) 0 - 1 in 68 patients ( 54.8% ) , ecog 2 in 51 ( 41.1% ) , and ecog 3 in five ( 4.0% ) , respectively . all patients received rt as an alternative to surgical resection because they either had poor pulmonary function in 62 patients ( 50.0% ) , had poor performance status or old age in 35 ( 28.2% ) , had medical comorbidity in 16 ( 12.9% ) , or refused to undergo surgery in 10 ( 8.9% ) , respectively . no significant differences in the distributions of sex , histologic type , median forced expiratory volume in 1 second ( fev1 ) , and ecog performance status were observed among the groups . the median tumor size of all patients was 4.3 cm ( range , 1.2 to 8.5 cm ) , and group 2 patients tended to have larger tumors than those in groups 1 and 3 , but the difference was not statistically significant ( 4.2 cm vs. 4.8 cm vs. 4.1 cm , p=0.236 ) . ct stages in all patients were ct1 in 25 patients ( 20.2% ) , ct2 in 65 ( 52.4% ) , and ct3 in 34 ( 27.4% ) , respectively , and group 3 patients tended to have ct1 - 2 tumors more frequently than other groups , which , however , was not statistically significant . the proportion of patients having a central tumor , defined as a tumor located within 2 cm of the proximal bronchial tree , was 65.3% of all patients , which was significantly lower in group 3 ( 78.5% vs. 60.0% vs. 28.0% , p < 0.001 ) . the proportion of patients receiving eni ( median , 30 gy in 10 fractions ) was 25.0% of all patients , which also was significantly different among groups ( 29.1% vs. 40.0% vs. 0% , p=0.003 ) . the mean and median shortest distances between the ctv margin and the esophagus were 3.0 cm and 2.0 cm ( range , 0.6 to 9.0 cm ) in group 2 and 4.6 cm and 4.2 cm ( range , 1.5 to 9.6 cm ) in group 3 ( p=0.021 and p=0.012 ) , respectively . during the median follow - up period of 16.7 months ( range , 1.2 to 119.5 months ) , 72 patients ( 58.1% ) experienced disease progression and 66 ( 53.2% ) died . the first progression presented as locoregional failure in 35 patients ( 48.6% ) , distant metastasis in 29 ( 40.3% ) , and synchronous combined failure in eight ( 11.1% ) , respectively ( table 2 ) . the rates of lc , pfs , and os of all patients at 2 years were 62.6% , 39.1% , and 59.1% , respectively . the lc and pfs rates at 2 years were not significantly different among groups ( 59.3% and 36.1% vs. 56.9% and 34.6% vs. 75.2% and 51.6% , p=0.174 and p=0.280 , respectively ) . the os rate at 2 years was significantly better in group 3 compared with others ( 51.3% vs. 74.4% vs. 86.2% , p=0.002 ) . prognostic significance of several factors was analyzed by univariate analyses , which included treatment group , age , sex , histologic type , performance status , tumor size , ct stage , and tumor location ( table 3 ) . age , sex , and tumor location were not significant factors affecting any of the clinical outcomes ( lc , pfs , and os ) . the significantly favorable factors on lc were ct1 - 2 ( p=0.002 ) and ecog performance status of 0 - 1 ( p=0.042 ) , those on pfs were ct1 - 2 ( p < 0.001 ) , tumor size of 3 cm or smaller ( p=0.002 ) , ecog performance status 0 - 1 ( p=0.033 ) , and non - adenocarcinoma histology ( p=0.038 ) , and those on os were ct1 - 2 ( p=0.009 ) and treatment group 2 or 3 ( p=0.002 ) , respectively . tumor size of 3 cm or smaller was a favorable factor with borderline significance on os ( p=0.060 ) . in multivariate analyses , the significantly favorable factors on lc were ct1 - 2 ( p=0.014 ) , those on pfs were ct1 - 2 ( p=0.002 ) , non - adenocarcinoma histology ( p=0.003 ) , and ecog performance status of 0 - 1 ( p=0.009 ) , and those on os were treatment group iii ( p=0.026 ) and ct1 - 2 ( p=0.035 ) , respectively . ct1 - 2 , as in univariate analyses , was the most powerful favorable factor affecting all three clinical outcomes of lc , pfs , and os ( hr , 0.363 , 0.437 , and 0.565 ; 95% ci , 0.165 to 0.798 , 0.254 to 0.752 , and 0.320 to 0.998 , respectively ) . eighty patients ( 64.5% ) developed radiation pneumonitis : most had grade 1 and 2 ( 42.7% and 17.7% , respectively ) ; four ( 3.2% ) had grade 3 ; and one ( 0.8% ) had grade 5 , respectively ( table 4 ) . an 80-year - old female in group 1 , who had a 2.6 cm tumor involving the left upper lobe and fev1 value of 1.44 l , developed symptomatic pneumonitis after 5 months of rt and died 7 months thereafter without evidence of cancer progression . no significant difference in the incidence of radiation pneumonitis was observed among the treatment groups ( p=0.596 ) . forty - six patients ( 37.1% ) developed radiation esophagitis : 24 ( 19.4% ) and 22 ( 17.7% ) had grade 1 and 2 , while no patients had grade 3 or higher . no patient in group 3 developed grade 2 esophagitis and this difference was statistically significant ( p=0.003 ) . under the korean health insurance policy as of august of 2015 , the direct treatment costs incurred solely by rt course ( including simulation and planning ) per person were calculated as 3,380,000 korean won ( krw ) , approximately 2,860 usd , in groups 1 and 2 and 2,620,000 krw , approximately 2,220 usd , in group 3 , respectively . the median age of all patients was 74 years ( range , 54 to 89 years ) and over three - quarters ( 98 patients , 79.0% ) were male . squamous cell carcinoma was more common in 71 patients ( 57.3% ) than adenocarcinoma in 36 ( 29.0% ) and other types in 17 ( 13.7% ) . the performance status was eastern cooperative oncology group ( ecog ) 0 - 1 in 68 patients ( 54.8% ) , ecog 2 in 51 ( 41.1% ) , and ecog 3 in five ( 4.0% ) , respectively . all patients received rt as an alternative to surgical resection because they either had poor pulmonary function in 62 patients ( 50.0% ) , had poor performance status or old age in 35 ( 28.2% ) , had medical comorbidity in 16 ( 12.9% ) , or refused to undergo surgery in 10 ( 8.9% ) , respectively . no significant differences in the distributions of sex , histologic type , median forced expiratory volume in 1 second ( fev1 ) , and ecog performance status were observed among the groups . the median tumor size of all patients was 4.3 cm ( range , 1.2 to 8.5 cm ) , and group 2 patients tended to have larger tumors than those in groups 1 and 3 , but the difference was not statistically significant ( 4.2 cm vs. 4.8 cm vs. 4.1 cm , p=0.236 ) . ct stages in all patients were ct1 in 25 patients ( 20.2% ) , ct2 in 65 ( 52.4% ) , and ct3 in 34 ( 27.4% ) , respectively , and group 3 patients tended to have ct1 - 2 tumors more frequently than other groups , which , however , was not statistically significant . the proportion of patients having a central tumor , defined as a tumor located within 2 cm of the proximal bronchial tree , was 65.3% of all patients , which was significantly lower in group 3 ( 78.5% vs. 60.0% vs. 28.0% , p < 0.001 ) . the proportion of patients receiving eni ( median , 30 gy in 10 fractions ) was 25.0% of all patients , which also was significantly different among groups ( 29.1% vs. 40.0% vs. 0% , p=0.003 ) . the mean and median shortest distances between the ctv margin and the esophagus were 3.0 cm and 2.0 cm ( range , 0.6 to 9.0 cm ) in group 2 and 4.6 cm and 4.2 cm ( range , 1.5 to 9.6 cm ) in group 3 ( p=0.021 and p=0.012 ) , respectively . during the median follow - up period of 16.7 months ( range , 1.2 to 119.5 months ) , 72 patients ( 58.1% ) experienced disease progression and 66 ( 53.2% ) died . the first progression presented as locoregional failure in 35 patients ( 48.6% ) , distant metastasis in 29 ( 40.3% ) , and synchronous combined failure in eight ( 11.1% ) , respectively ( table 2 ) . the rates of lc , pfs , and os of all patients at 2 years were 62.6% , 39.1% , and 59.1% , respectively . the lc and pfs rates at 2 years were not significantly different among groups ( 59.3% and 36.1% vs. 56.9% and 34.6% vs. 75.2% and 51.6% , p=0.174 and p=0.280 , respectively ) . the os rate at 2 years was significantly better in group 3 compared with others ( 51.3% vs. 74.4% vs. 86.2% , p=0.002 ) . prognostic significance of several factors was analyzed by univariate analyses , which included treatment group , age , sex , histologic type , performance status , tumor size , ct stage , and tumor location ( table 3 ) . age , sex , and tumor location were not significant factors affecting any of the clinical outcomes ( lc , pfs , and os ) . the significantly favorable factors on lc were ct1 - 2 ( p=0.002 ) and ecog performance status of 0 - 1 ( p=0.042 ) , those on pfs were ct1 - 2 ( p < 0.001 ) , tumor size of 3 cm or smaller ( p=0.002 ) , ecog performance status 0 - 1 ( p=0.033 ) , and non - adenocarcinoma histology ( p=0.038 ) , and those on os were ct1 - 2 ( p=0.009 ) and treatment group 2 or 3 ( p=0.002 ) , respectively . tumor size of 3 cm or smaller was a favorable factor with borderline significance on os ( p=0.060 ) . in multivariate analyses , the significantly favorable factors on lc were ct1 - 2 ( p=0.014 ) , those on pfs were ct1 - 2 ( p=0.002 ) , non - adenocarcinoma histology ( p=0.003 ) , and ecog performance status of 0 - 1 ( p=0.009 ) , and those on os were treatment group iii ( p=0.026 ) and ct1 - 2 ( p=0.035 ) , respectively . ct1 - 2 , as in univariate analyses , was the most powerful favorable factor affecting all three clinical outcomes of lc , pfs , and os ( hr , 0.363 , 0.437 , and 0.565 ; 95% ci , 0.165 to 0.798 , 0.254 to 0.752 , and 0.320 to 0.998 , respectively ) . eighty patients ( 64.5% ) developed radiation pneumonitis : most had grade 1 and 2 ( 42.7% and 17.7% , respectively ) ; four ( 3.2% ) had grade 3 ; and one ( 0.8% ) had grade 5 , respectively ( table 4 ) . an 80-year - old female in group 1 , who had a 2.6 cm tumor involving the left upper lobe and fev1 value of 1.44 l , developed symptomatic pneumonitis after 5 months of rt and died 7 months thereafter without evidence of cancer progression . no significant difference in the incidence of radiation pneumonitis was observed among the treatment groups ( p=0.596 ) . forty - six patients ( 37.1% ) developed radiation esophagitis : 24 ( 19.4% ) and 22 ( 17.7% ) had grade 1 and 2 , while no patients had grade 3 or higher . no patient in group 3 developed grade 2 esophagitis and this difference was statistically significant ( p=0.003 ) . under the korean health insurance policy as of august of 2015 , the direct treatment costs incurred solely by rt course ( including simulation and planning ) per person were calculated as 3,380,000 korean won ( krw ) , approximately 2,860 usd , in groups 1 and 2 and 2,620,000 krw , approximately 2,220 usd , in group 3 , respectively . hypofractionation is attractive in that dose escalation is possible while maintaining or shortening the treatment duration , and has recently been increasingly applied to a few solid tumor types including breast cancer , prostate cancer , and glioblastoma . sbrt is an example of an extreme method of hypofractionation , which has emerged as a reasonable alternative to surgical resection in several clinical settings . sbrt has resulted in very promising lc rates approaching the 90% level when applied to nsclc patients with early stage and operable lesions but are , at the same time , not physically fit for surgery . severe complications , however , have been reported in patients with centrally located tumors , typically within 2 cm from the central bronchial tree ( 2-year freedom from severe toxicity , 54% ) . thus centrally located tumors or large - sized tumors have usually been considered ineligible for sbrt due to fear of excessive toxicity risk . the optimal dose scheme for treatment of patients who are unfit for both surgical resection and sbrt has not yet been established . two recent prospective studies reported favorable clinical outcomes following high dose rt by modest hypofractionation schedules in patients who were unfit for both surgical resection and sbrt in ct1 - 2n0 nsclc . the cancer and leukemia group b ( calgb ) trial 39904 prospectively evaluated accelerated three - dimensional conformal radiation therapy for delivery of 70 gy in 17 - 29 fractions for early stage nsclc and reported a median survival of 38.5 months and disease relapse rate of 25.6% . a canadian multi - institutional prospective phase ii trial reported very promising 2-year lc rates of 87.4% following 60 gy in 15 fractions . the largest retrospective canadian study reported a 2-year lc rate of 76.2% in 118 patients following a total dose of 48 - 60 gy in 12 - 15 fractions , in which most patients received 48 gy ( 59.7% ) or 52 gy ( 37.1% ) . reported a 2-year lc rate of 74.6% in 26 patients following median 70 gy ( range , 60 to 72 gy ) in 15 - 18 fractions . in the current study , the authors achieved a 2-year lc rate of 75.2% in group 3 following 60 gy in 15 fractions , which was quite comparable with other studies mentioned above . actually , the 2-year lc rate following 60 gy in 15 fractions as in the current study was numerically superior to those achieved by the authors following 60 gy in 20 fractions : 56.9% in the current study ( as in group 2 ) ; and 57.9% in a previous study . delivery of higher bed10 by 60 gy in 15 fractions ( bed10 , 84 gy ) , compared with delivery of 60 gy in 20 fractions ( bed10 , 78 gy ) , as in the current study , appeared to have been translated into numerically improved lc ( p=0.174 ) and pfs ( p=0.280 ) , though without statistical significance , and significantly improved os ( p=0.002 ) , even though the patients profiles were not the same ( table 2 ) . improved lc following 60 gy in 15 fractions was also observed in patients with tumors larger than 3 cm ( 77.2% vs. 54.3% , data not shown above ) . two canadian studies were consistent in that tumor size larger than 3 cm was a significantly adverse factor with respect to distant metastasis , which was also affirmed in univariate analyses in the current study ( table 3 ) . in multivariate analyses , however , less advanced ct stage was proved as a significantly favorable factor with respect to lc , disease - free survival ( dfs ) , and os in the current study ( table 3 ) . in the current study , although group 3 was a significantly favorable factor for os in multivariate analysis , the actual significance should be further validated because of the retrospective nature , small sample size , and possibility of case selection bias . severe toxicities including radiation pneumonitis and esophagitis were uncommon following high dose rt by 4 gy per fraction , mainly because elective mediastinal irradiation in patients with cn0 stage was omitted in all studies . the authors have positively affirmed the safety of this regimen through the current study , particularly with respect to radiation esophagitis ( table 4 ) . although 4 gy per fraction demonstrated improved lc compared with 3 gy per fraction even in tumors larger than 3 cm , bed10 was still lower than the recommendations by others , who proposed minimum bed10 over 100 gy mainly in the sbrt setting . in this context , determination of an optimal dose schedule at limited toxicity level in patients who are not good candidates for surgical resection or sbrt by virtue of large tumor size and/or tumors located close to the esophagus is still a challenging issue . the results of two ongoing clinical trials , in treating centrally located nsclc , are awaited : radiation therapy oncology group 0813 ( nct00750269 ) is a dose - escalation study starting from 50 gy in five fractions to determine the optimal dose ; and the lungtech trial nsclc ( nct01795521 ) is to evaluate efficiency and toxicity by 60 gy ineightfractions . one study on postoperative breast irradiation showed that a cost - minimization strategy could result in a 43% cost reduction in rt . one should be cautious ; however , in the instances when the benefit of cost - saving following hypofractionated rt is offset by greater cost in managing the subsequent toxicity , and this type of negative trade - off should not be justified . though the fraction number was reduced from 20 to 15 in the current study , the authors achieved even better clinical outcome profiles which included the toxicity profiles at a reduced direct cost of 22.5% ( 3,380,000 krw vs. 2,620,000 krw ) . assuming that roughly half of the rt alone candidates are to receive 60 gy in 15 fractions , instead of 60 gy in 20 fractions , the direct cost saving would reach approximately 12.2% . most korean candidates for curative rt alone , instead of surgical resection or sbrt , usually require assistance in their daily lives either from family members or other care - givers , including escort to and from the rt facility on an out - patient basis . though not measured herein , the overall cost saving , not to mention the patients convenience , could become even greater , when considering the opportunity cost that could be incurred to patients and their helpers . in addition , more efficient use of rt resources may be realized , which is often critical and important in a busy clinic . compared to two previous prospective studies , the current study , though retrospective in nature , has a few strong points : the calgb 39904 trial included tumors smaller than 4 cm and did not report clinical outcomes in detail based on the fractionation schemes ; and canadian phase ii trial reported the outcomes following high dose rt by 4 gy per fraction only without comparison with other fractionation schemes . the current study , under the consistent selection criteria and fractionation scheme , included patients with small to large sized tumors , and reported clinical outcomes , including the issue of cost - effectiveness , in detail based on two different fractionation schedules . as in other reports , patients with tumors larger than 3 cm had poor lc ( 2 year lc of 69.6% vs. 58.7% ) , and among them , those treated with 60 gy in 15 fractions had better lc and survival outcomes . this implies that larger tumors might require a higher dose for lc as previously suggested in many other reports . effort to escalate radiation dose safely using a proton beam would be highly rewarding , even in the situation when tumors are closely located to critical normal structures , like the esophagus . proper use of intensity - modulated radiotherapy ( imrt ) or proton beam therapy could be advantageous in safely delivering higher radiation dose to the target . videtic et al . reported excellent lc and favorable survival ( 3-year lc and os were 94% and 52% ) with tolerable toxicity profiles in treatment of medically inoperable stage i nsclc patients with 50 gy in 10 fractions using the imrt technique alone . reported 92% lc at 2 years following 48 - 56 gy in 4 - 7 fractions in treatment of ct1 - 3 nsclc patients using volumetric modulated arc therapy . reported the clinical outcomes following hypofractionated proton beam therapy in treatment of patients with ct1 - 2n0 nsclc : by escalating the dose from 60 gy in 10 fractions to 70 gy in 10 fractions , improved 4-year lc rates from 45% to 74% in ct2 tumors were achieved . based on the excellent safety profiles , even in patients with large and centrally located tumors , hypofractionated proton beam therapy should be regarded as a promising alternative instead of photon beam therapy in treatment of early stage nsclc patients who are not amenable to surgical resection or sbrt . in summary , the current study demonstrated that 60 gy in 15 fractions by 4 gy per fraction resulted in comparable , even improved , clinical outcomes with excellent safety , particularly in patients with peripherally located ct1 - 3n0 nsclc who are poor candidates for surgical resection or sbrt . by reducing the fraction number from 20 to 15 , in addition to the saving in direct and opportunity cost , improved patients convenience , more efficient use of resources would be anticipated . to further improve the clinical outcomes , particularly in larger tumors , risk adaptive dose escalation using advanced rt techniques , such as imrt or proton beam therapy , might be warranted .

purposehigh dose definitive radiation therapy ( rt ) alone is recommended to patients with ct1 - 3n0 non - small cell lung cancer , who are unfit for surgery or stereotactic rt . this study was conducted to evaluate the clinical outcomes and cost - effectiveness following rt alone using two different modest hypofractionation dose schemes.materials and methodsbetween 2001 and 2014 , 124 patients underwent rt alone . from 2001 till 2010 , 60 gy in 20 fractions was delivered to 79 patients ( group 1 ) . since 2011 , 60 gy in 20 fractions ( group 2 , 20 patients ) , and 60 gy in 15 fractions ( group 3 , 25 patients ) were selectively chosen depending on estimated risk of esophagitis.resultsat follow - up of 16.7 months , 2-year rates of local control , progression - free survival , and overall survival were 62.6% , 39.1% , and 59.1% , respectively . overall survival was significantly better in group 3 ( p=0.002 ) . in multivariate analyses , ct3 was the most powerful adverse factor affecting clinical outcomes . incidence and severity of radiation pneumonitis were not different among groups , while no patients developed grade 2 esophagitis in group 3 ( p=0.003 ) . under current korean health insurance policy , rt cost per person was 22.5% less in group 3 compared with others.conclusionthe current study demonstrated that 60 gy in 15 fractions instead of 60 gy in 20 fractions resulted in comparable clinical outcomes with excellent safety , direct cost saving , and improved convenience to the patients with tumors located at 1.5 cm from the esophagus .

You are an expert at summarizing long articles. Proceed to summarize the following text: neonatal surgical emergencies carry the risk of mortality and co - existing unpalliated congenital heart defects make the anaesthetic management a formidable challenge . until the surgical palliation by norwood and allograft cardiac transplantation by bailey in the 1980s , mortality of hypoplastic left heart syndrome ( hlhs ) was 100% . hlhs is the abnormal development of the left - sided cardiac structures , resulting in obstruction to blood flow from the left ventricle . necrotising enterocolitis ( nec ) , one of the common neonatal gastrointestinal emergencies , is characterised by ischaemic necrosis of the intestinal mucosa , invasion of organisms and dissection of gas into the muscularis and portal system . hlhs neonates who develop nec belong to a unique group of term babies with reasonable birth weights , unlike the common nec patient . these children require meticulous preoperative evaluation and with thorough preparation they tolerate general anaesthesia well . we have reported a neonate with unpalliated hlhs who underwent an emergency laparotomy for nec . a 4 kg term male with normal apgar scores and blood investigations at birth , developed respiratory distress , acidosis and abdominal distention following initiation of oral feeds . echocardiogram reported hlhs with atrial septal defect ( asd ) . with a diagnosis of nec , the baby was scheduled for emergency laparotomy . in the neonatal intensive care unit ( nicu ) , the baby was intubated , ventilated , umbilical vessels were catheterised and infusion of dopamine and prostaglandin e1 was started . the post - operative course was marked with cardiovascular instability following sepsis . on day seven , the fourth post - operative day , the baby died following a cardiac arrest . children with severe uncorrected heart defects presenting with non - cardiac surgical emergencies are a major challenge to the anaesthetist and only few case reports are available in the medical literature . nec and hlhs though inter - related , are two distinct entities and to understand the anaesthetic implications of both , we need to know the pathophysiology of each . hlhs is the most common form of functional single ventricle heart disease with a prevalence rate of 2 - 3 cases per 1000 live births.,it is characterised by underdevelopment of the left heart with hypoplasia of the left ventricle and ascending aorta with atresia , stenosis or hypoplasia of the aortic or mitral valve ; resulting in the right ventricle supporting the pulmonary and systemic circulation . survival depends on a patent ductus arteriosus ( pda ) for systemic perfusion and an adequate asd for mixing of oxygenated and deoxygenated blood . neonates with a non - restrictive asd , are asymptomatic after delivery and become symptomatic with pda closure . initial management is providing adequate systemic perfusion by maintaining a pda with prostaglandin e1 ( 0.01 - 0.05 ug / kg / min ) and if necessary , creating a transcatheter atrial septoplasty . the incidence of nec varies between 1 and 8% with a mortality rate between 20% and 40% . treatment is by nasogastric decompression , antibiotics , fluids , parenteral nutrition and insertion of a peritoneal drain . plain abdominal x - ray on the left shows pneumatosis intestinalis ( large arrow ) a specific characteristic finding in necrotising enterocolitis . x - ray on the right is a follow - up film , which shows free air indicating perforation of the bowel ( small arrow ) immaturity of the gut is an important predisposing factor . reports where nec has been described in term infants with congenital heart disease have attributed all deaths to nec . among patients with hlhs , with decreasing pulmonary vascular resistance ( pvr ) , left to right shunting at the ductal level may decrease mesenteric flow , resulting in bowel ischaemia . prostaglandin use , indwelling umbilical catheters and cardiac catheterisation have been implicated in nec , but the underlying circulatory physiology may be more contributory . after birth , three factors affect the haemodynamic status : decrease in pvr , size of the asd and closure of pda . the ratio of pulmonary blood flow to systemic blood flow ( qp / qs ) describes how the cardiac output from the single ventricle is partitioned . with the ductus open , most infants with hlhs can maintain a balance between pvr and systemic vascular resistance . however , a marked discrepancy in blood flow to the pulmonary and systemic circulations causes rapid onset of haemodynamic instability . an increase in qp / qs ratio results in excessive pulmonary flow at the expense of systemic flow . the ductus provides blood to the coronary arteries and the descending aorta and as it constricts , hypoperfusion occurs , resulting in shock . because of this unique parallel circulation and propensity for systemic hypoperfusion , neonates with hlhs frequently develop nec . a prolonged period of stabilisation in the nicu before transfer to theatre needs to be balanced against the requirement for early surgical intervention . anaesthetic management of such infants include a strategy to maintain qp : qs slightly < 1 . kang et al . described the anaesthetic management of two neonates with hlhs with a tracheoesophageal fistula in one and meningomyelocele in the other . in both cases , they minimised excessive qp by prostaglandin e1 in the first case and by adding nitrogen for a hypoxic mixture in the second case . walker et al . reviewed the notes of children with complex cardiac anomalies presenting for non - cardiac surgeries , including laparotomies for nec . our patient tolerated general anaesthesia well , but developed sepsis resulting in fatal cardiovascular collapse . measures that induce pulmonary vasoconstriction , such as permissive hypercarbia or low inspired oxygen concentration , maybe utilised to counteract the presence of high qp . as recent advances allow for the palliation of hlhs , the incidence of these patients presenting with nec is likely to increase and hence , we made an attempt to review the literature about the perioperative management of this rare group patients .

necrotising enterocolitis ( nec ) and congenital heart disease are two distinct disease processes , but they appear to be inter - related , particularly in patients with the congenital heart condition known as hypoplastic left heart syndrome ( hlhs ) . both nec and hlhs are causes of significant morbidity and mortality in the neonatal population . as medical and surgical advances allow for the palliation and correction of complex heart lesions at an earlier gestational age and lower birth weight , the already high - risk of nec in this population is likely to increase . in this article , we report a case of a neonate with unpalliated hlhs who underwent emergency laparotomy for nec . we also discuss the pathophysiology of these two diseases and the perioperative care of this rare group of patients .

You are an expert at summarizing long articles. Proceed to summarize the following text: amyotrophic lateral sclerosis ( als ) is a rapidly progressive , fatal degenerative disorder , involving the first and foremost motor neurons of the cerebral cortex , brainstem and spinal cord . the world federation of neurology ( wfn ) research group on motor neuron diseases have developed the 1994 el escorial diagnostic criteria and the revised 2000 criteria , to assist in identifying and classifying als patients for investigational studies . there are a number of als syndromes that must be recognized , these include : sporadic als : most of the cases are sporadic als , occurring alone or present incidentally with other preexisting disease processes . familial or hereditary als : a minority of patients that als manifests in one or more generations , associated with different modes of inheritance . als - mimic syndromes : this syndromes present as a result of other pathogenic processes and do not represent other forms of als . als with laboratory abnormalities of uncertain significance ( als - laus ) : als occurring in association with laboratory defined abnormalities that are of uncertain significance to the pathogenesis of als and since it seems to be untreatable , all efforts must be directed to exclude other diagnoses . in addition , electrodiagnostic investigations typically comprise neuroimaging studies to exclude anatomic structural disorder such as cervical myelopathies , and typical laboratory investigations to search for any latent treatable metabolic abnormality . als - laus includes patients with clinically definite or clinically probable als associated with : autoantibodies ( high - titer gm1 ganglioside antibody , etc . ) , endocrine abnormalities ( hyperthyroidism , hyperparathyroidism , etc . ) , monoclonal gammopathy ( monoclonal gammopathy of unknown significance , waldenstrom 's macroglobulinemia , osteosclerotic myeloma , etc . ) , infection ( hiv-1 , htlv-1 , varicella - zoster , brucellosis , etc . ) , lymphoma ( hodgkin 's and non - hodgkin 's lymphoma ) and exogenous toxins ( e.g. lead , mercury , aluminum ) . there have been various reports of patients with both monoclonal gammopathy and motor neuron disease ( mnd ) . monoclonal antibodies are produced by expanded single b - cell clones and are variously recognized as monoclonal protein , m protein , m component , monoclonal gammopathy , or paraprotein . the non - malignant monoclonal gammopathies have been identified as monoclonal gammopathies of undetermined significance . the medical literature suggests that patients with mnd may have a higher incidence of lymphoproliferative disorders ( lpd ) . when mnd does occur in association with lpd , it appears to have both upper motor neuron ( umn ) and lower motor neuron ( lmn ) involvement compatible with a diagnosis of als . the association between mnd and lpd could be accidental , but lpd seems to be unduly common in patients with mnd compared to the general population . despite an initial report suggesting that major improvements occurred occasionally with reductions in paraprotein levels using immunomodulatory treatments even in some patients who had the clinical appearance of als , most of the subsequent literature disagreed . showed that most of the patients with mnd with lpd had hodgkin 's or non - hodgkin 's lymphoma , such as myeloma or macroglobulinemia . among these patients , only some had a favorable neurological response to immunotherapy , and most died of the neurological disease . other reports highlight the association of mnd and the presence of a lymphoplasmacytoid infiltration of waldenstrom 's macroglobulinemia in particular , and the lack of neurologic improvement after treatment of the underlying disorder with plasmapheresis and immunosuppressive therapy . the association of muscle weakness with primary hyperparathyroidism ( php ) dates back to the 1800s , and since then numerous patients have been reported with php , muscle weakness , hyper - reflexia , and muscle atrophy . there were even reports of patients with php , and signs of als who underwent parathyroid adenoma resection and demonstrated improved muscle performance . however , rodriguez et al . reported on a series of patients with the diagnosis of als and concluded that there was no pathogenic association between thyroid or parathyroid dysfunction and als . jackson et al . reported five patients with als and php that underwent parathyroid adenoma resection . each patient subsequently had normal serum calcium and pth levels , but unfortunately they all had progressive weakness that eventually resulted in death within 3 years . patients with php often have brisk muscle stretch reflexes with flexor or extensor plantar responses . severe respiratory muscle and bulbar involvement resulting in hoarseness and dysphasia , as well as abnormal tongue movements have been reported in php . however , there are some important differences between als and php symptoms . patients with php may develop muscle weakness and atrophy in lower limbs that tends to be symmetric and involves predominately the proximal muscles . patients with php may also have associated ataxia and abnormal upper limb posturing along with cognitive dysfunction , emotional lability , personality changes , anxiety , and hallucinations . although there are remarkable correlations between php and mnd , most of the literature does not indicate a conclusive relationship between als and hyperparathyroidism and its treatment does not lead to improvement of mnd . by 2002 , there had been reports of 19 patients with mnd , with no evidence that hiv infection increases the likelihood of developing als . most of them had a disorder that was unlike als in one major way , the rapidity of progression . the time from onset of symptoms to severe disability was in weeks and not months . csf protein content was increased in most cases , but the most remarkable difference from als was the regression of symptoms by the treatment of infection . therefore , als in hiv - positive people may take either of two forms , one that responds to treatment and another that does not . predictors of therapeutic response are young age at onset , progression in days or weeks , and abnormal csf . the unresponsive form may be sporadic als that occurs by chance . in htlv-1 infection , als syndrome has been described , but in some cases chance could not be excluded . typically , htlv-1-infected patients with symptoms and signs suggestive of als have a high htlv viral load and present symptoms and sings suggestive of tropical spastic paraparesis jointly with symptoms and signs typical of als . in general , these patients tend to progress more slowly than typical sporadic als . thus , patients from endemic areas with symptoms and signs suggestive of als combined with sensory symptoms or bladder dysfunction should be tested for htlv infection . saadatnia et al . , described a 55-year - old persian man with typical presentation of als in whom raised level of antiphospholipid antibodies was found . after 3 months of treatment , the symptoms improved and antiphospholipid antibody titres decreased . furthermore , a small number of studies have described the association of als with systemic lupus erythematous ( sle ) even with neurolupus . als - laus includes patients with clinically definite or clinically probable als associated with : autoantibodies ( high - titer gm1 ganglioside antibody , etc . ) , endocrine abnormalities ( hyperthyroidism , hyperparathyroidism , etc . ) , monoclonal gammopathy ( monoclonal gammopathy of unknown significance , waldenstrom 's macroglobulinemia , osteosclerotic myeloma , etc . ) , infection ( hiv-1 , htlv-1 , varicella - zoster , brucellosis , etc . ) , lymphoma ( hodgkin 's and non - hodgkin 's lymphoma ) and exogenous toxins ( e.g. lead , mercury , aluminum ) . there have been various reports of patients with both monoclonal gammopathy and motor neuron disease ( mnd ) . monoclonal antibodies are produced by expanded single b - cell clones and are variously recognized as monoclonal protein , m protein , m component , monoclonal gammopathy , or paraprotein . the non - malignant monoclonal gammopathies have been identified as monoclonal gammopathies of undetermined significance . the medical literature suggests that patients with mnd may have a higher incidence of lymphoproliferative disorders ( lpd ) . when mnd does occur in association with lpd , it appears to have both upper motor neuron ( umn ) and lower motor neuron ( lmn ) involvement compatible with a diagnosis of als . the association between mnd and lpd could be accidental , but lpd seems to be unduly common in patients with mnd compared to the general population . despite an initial report suggesting that major improvements occurred occasionally with reductions in paraprotein levels using immunomodulatory treatments even in some patients who had the clinical appearance of als , most of the subsequent literature disagreed . showed that most of the patients with mnd with lpd had hodgkin 's or non - hodgkin 's lymphoma , such as myeloma or macroglobulinemia . among these patients , only some had a favorable neurological response to immunotherapy , and most died of the neurological disease . other reports highlight the association of mnd and the presence of a lymphoplasmacytoid infiltration of waldenstrom 's macroglobulinemia in particular , and the lack of neurologic improvement after treatment of the underlying disorder with plasmapheresis and immunosuppressive therapy . the association of muscle weakness with primary hyperparathyroidism ( php ) dates back to the 1800s , and since then numerous patients have been reported with php , muscle weakness , hyper - reflexia , and muscle atrophy . there were even reports of patients with php , and signs of als who underwent parathyroid adenoma resection and demonstrated improved muscle performance . however , rodriguez et al . reported on a series of patients with the diagnosis of als and concluded that there was no pathogenic association between thyroid or parathyroid dysfunction and als . jackson et al . reported five patients with als and php that underwent parathyroid adenoma resection . each patient subsequently had normal serum calcium and pth levels , but unfortunately they all had progressive weakness that eventually resulted in death within 3 years . patients with php often have brisk muscle stretch reflexes with flexor or extensor plantar responses . severe respiratory muscle and bulbar involvement resulting in hoarseness and dysphasia , as well as abnormal tongue movements have been reported in php . however , there are some important differences between als and php symptoms . patients with php may develop muscle weakness and atrophy in lower limbs that tends to be symmetric and involves predominately the proximal muscles . patients with php may also have associated ataxia and abnormal upper limb posturing along with cognitive dysfunction , emotional lability , personality changes , anxiety , and hallucinations . although there are remarkable correlations between php and mnd , most of the literature does not indicate a conclusive relationship between als and hyperparathyroidism and its treatment does not lead to improvement of mnd . by 2002 , there had been reports of 19 patients with mnd , with no evidence that hiv infection increases the likelihood of developing als . most of them had a disorder that was unlike als in one major way , the rapidity of progression . the time from onset of symptoms to severe disability was in weeks and not months . csf protein content was increased in most cases , but the most remarkable difference from als was the regression of symptoms by the treatment of infection . therefore , als in hiv - positive people may take either of two forms , one that responds to treatment and another that does not . predictors of therapeutic response are young age at onset , progression in days or weeks , and abnormal csf . the unresponsive form may be sporadic als that occurs by chance . in htlv-1 infection , als syndrome has been described , but in some cases chance could not be excluded . typically , htlv-1-infected patients with symptoms and signs suggestive of als have a high htlv viral load and present symptoms and sings suggestive of tropical spastic paraparesis jointly with symptoms and signs typical of als . in general , these patients tend to progress more slowly than typical sporadic als . thus , patients from endemic areas with symptoms and signs suggestive of als combined with sensory symptoms or bladder dysfunction should be tested for htlv infection . saadatnia et al . , described a 55-year - old persian man with typical presentation of als in whom raised level of antiphospholipid antibodies was found . after 3 months of treatment , the symptoms improved and antiphospholipid antibody titres decreased . furthermore , a small number of studies have described the association of als with systemic lupus erythematous ( sle ) even with neurolupus . als - laus meets the clinical and electrophysiological criteria for clinically probable or clinically definite als but has laboratory - defined features which may be relevant to the development of the als phenotype , or may be coincidental finding . owing to a relentless progression of als towards death , all efforts must be made by the clinician to exclude alternative and more treatable entities .

amyotrophic lateral sclerosis ( als ) , the most common form of motor neuron disease , is a progressive and devastating disease involving both lower and upper motor neurons , typically following a relentless progression towards death . therefore , all efforts must be made by the clinician to exclude alternative and more treatable entities . als with laboratory abnormalities of uncertain significance is a subgroup of als that occurs in association with laboratory defined abnormalities that are of uncertain significance to the pathogenesis of als . the clinical utility of these abnormalities and what they ultimately mean in patients with als is discussed here , along with a review of the literature .

You are an expert at summarizing long articles. Proceed to summarize the following text: camptodactyly - arthropathy - coxa vara - pericarditis ( cacp ) syndrome is a genetic disorder caused by mutation in the proteoglyacn prg4 gene on chromosome 1 ( online mendelian inheritance in man omim number 208250 ) . the syndrome is characterized by congenital or early - onset camptodactyly and childhood - onset of non - inflammatory arthropathy , coxa vara deformity , or other dysplasia associated with progressive hip disease and non - inflammatory pericardial effusion . it has an autosomal recessive mode of inheritance and the causative gene is located on chromosome band 1q25 - 31 . we present a case of a female child who presented with early onset camptodactyly , non - inflammatory arthropathy , short femoral necks , with distinctive features on biopsy and magnetic resonance imaging ( mri ) , without pericarditis or pericardial effusion . a 3-year 3-month - old child presented with a 4-month history of swelling of both knees and wrists . the parents also stated that they had noticed bent fingers for nearly one and a half years . on examination , the patient had camptodactyly of the fingers with swelling of both knees and wrists without restricted motion or signs of inflammation like erythema or tenderness . systemic examination showed no evidence of fever , lymphadenopathy , skin rash , or other systemic features . routine blood work - up revealed normal hemogram , erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) with negative antinuclear antibody ( ana ) . anteroposterior ( ap ) radiograph of pelvis revealed a broad short femoral neck and coxa vara [ figure 1 ] . x - ray of the knee revealed bilateral effusions with osteopenia and no erosions [ figure 2 ] . mri of the hip showed a large joint effusion and intraosseous fluid - filled herniations affecting the acetabulum with intra - articular connection [ figure 3a ] . the synovium was mildly thickened and showed enhancement , better appreciated on the left side [ figure 3b ] . conspicuously , t9/21/2013here was absence of cartilage destruction . knee mri showed large amount of joint fluid [ figure 4a ] with mildly thickened enhancing synovium [ figure 4b ] . anteroposterior radiograph of pelvis shows smooth flattening of femoral heads with irregular acetabulae ( arrows ) . plain ap radiograph of both knees shows periarticular osteopenia , apparent widening of the joint space the result of effusions ( arrow ) and enlargement of the epiphyses secondary to the hyperaemia ( double arrows ) . coronal stir image of hips ( on 3 t system ) shows large bilateral joint effusions . note the intra - osseous acetabular herniations communicating with the effusions ( arrows ) and ( b ) 3-year 3-month - old girl child with cacp syndrome . coronal t1-weighted image of hips ( on 3 t system ) obtained after administration of gadolinium shows rim enhancement of joint capsule ( better appreciated on the left side ) and of walls of intraosseous herniations ( arrows ) . coronal stir image of both knees ( on 3 t system ) shows large effusions . small intraosseous cysts are identified along the medial femoral condyle ( arrows ) and ( b ) 3 year 3 month old girl child with cacp syndrome . coronal t1 weighted of both knees ( on 3 t system ) shows effusion with mildly thickened synovium ( arrows ) . ancillary investigations like-2 dimensional ( 2d ) echocardiography carried out did not reveal effusion or pericarditis . cacp syndrome , first described in 1984 , is characterized by congenital or early - onset camptodactyly , childhood - onset non - inflammatory arthropathy associated with synovial hyperplasia , progressive coxa vara deformity , and non - inflammatory pericardial or pleural effusion . it is an autosomal recessive condition caused by loss of function mutations in the proteoglycan-4 ( prg4 ) gene , leading to absence of lubricin in the synovial fluid and accumulation of synovial fluid in the joint spaces . marcelino et al . , ( 1999 ) identified the prg4 gene within the chromosome 1q25-q31 as the critical region for the autosomal recessive cacp syndrome ( phenotype number 208250 ) . children with cacp syndrome often present with camptodactyly ( bent fingers ) and swollen joints with preserved range of motion without other signs of inflammation . camptodactyly is a universal finding in patients with cacp and is usually bilateral and congenital , but may develop in early childhood . squaring or flattening of the metacarpal and phalangeal heads can be seen on radiograph of the hand . arthropathy principally involves large joints such as elbows , hips , knees , and ankles . the hallmark of this condition is intra - osseous fluid - filled herniations affecting the acetabulum that is seen on conventional radiographs as benign radiolucent acetabular lesions . there is mild synovial thickening and rim - like enhancement of the fluid - filled bursae . the presence of coxa vara is variable with studies reporting figures between 50% and 90% . pericarditis is a variable finding and has been reported in up to 30% of cacp , and it may be mild and self - limited . laboratory investigations including esr , crp , and full blood count are normal in patients with cacp syndrome . synovial fluid in this condition is clear , honey - coloured , and low in cell count . the synovial histology shows little or no mononuclear infiltration , but there is a typically described multinucleated giant cells infiltration . giant cells have been identified as macrophage in origin based on cd68 expression and electron microscopic features of macrophages . studies involving synovial fluid examination from a patient with cacp showed that hyaluronic acid molecules adopted an extended and more rigid conformation , suggesting that synovial fluid lacking lubricin would be less able to dissipate the energy of impact that occurs during motion . jay et al . , ( 2007 ) concluded that lubricin provides a chondroprotective feature to synovial fluid that is distinct from the role lubricin plays at the cartilage surface as a boundary lubricant . this condition must be distinguished from juvenile idiopathic arthritis since the management of juvenile idiopathic arthritis ( jia ) requires anti - inflammatory drugs , often with methotrexate and steroids owing to the inflammatory nature of the disease , whereas cacp syndrome does not respond to these drugs and is treated symptomatically and with physiotherapy . jia has been classified by the international league of associations for rheumatology ( ilar ) into : systemic onset juvenile rheumatoid arthritis ( jra ) : arthritis in one or more joints with or preceded by fever of at least 2-weeks duration , documented daily for at least 3 days accompanied by one or more of the following : evanescent ( non - fixed ) erythematous rash , generalized lymph node enlargement , hepatomegaly and/or splenomegaly , and serositisoligoarthritis : arthritis affecting one to four joints during the first 6-months of the disease , with the persistent type affecting not more than four joints throughout the disease course , while the extended type affects a total of more than four joints after the first 6-months of the diseasepolyarthritis ( rheumatoid factor ( rf ) negative ) : arthritis affecting five or more joints during the first 6-months of disease ; rf is negativepolyarthritis ( rf positive ) : arthritis affecting five or more joints during the first 6-months of the disease ; two or more tests for rf at least 3-months apart during the first 6-months of disease are positivepsoriatic arthritis : arthritis with psoriasis or arthritis and at least two of the following : dactylitis , nail pitting ( onycholysis ) or psoriasis in a first - degree relativeenthesitis related arthritis : arthritis with enthesitis or only arthritis / enthesitis with at least two of the following : presence of or a history of sacroiliac joint tenderness and/or inflammatory lumbosacral pain , presence of human leukocyte antigen ( hla - b27 ) antigen , onset of arthritis in a male over 6-years of age , acute anterior uveitis , or history of ankylosing spondylitis , enthesitis - related arthritis , sacroiliitis with inflammatory bowel disease , reiter 's syndrome or acute anterior uveitis in a first - degree relativeundifferentiated arthritis : arthritis that fulfills criteria in no category or in two or more of the above categories . systemic onset juvenile rheumatoid arthritis ( jra ) : arthritis in one or more joints with or preceded by fever of at least 2-weeks duration , documented daily for at least 3 days accompanied by one or more of the following : evanescent ( non - fixed ) erythematous rash , generalized lymph node enlargement , hepatomegaly and/or splenomegaly , and serositis oligoarthritis : arthritis affecting one to four joints during the first 6-months of the disease , with the persistent type affecting not more than four joints throughout the disease course , while the extended type affects a total of more than four joints after the first 6-months of the disease polyarthritis ( rheumatoid factor ( rf ) negative ) : arthritis affecting five or more joints during the first 6-months of disease ; rf is negative polyarthritis ( rf positive ) : arthritis affecting five or more joints during the first 6-months of the disease ; two or more tests for rf at least 3-months apart during the first 6-months of disease are positive psoriatic arthritis : arthritis with psoriasis or arthritis and at least two of the following : dactylitis , nail pitting ( onycholysis ) or psoriasis in a first - degree relative enthesitis related arthritis : arthritis with enthesitis or only arthritis / enthesitis with at least two of the following : presence of or a history of sacroiliac joint tenderness and/or inflammatory lumbosacral pain , presence of human leukocyte antigen ( hla - b27 ) antigen , onset of arthritis in a male over 6-years of age , acute anterior uveitis , or history of ankylosing spondylitis , enthesitis - related arthritis , sacroiliitis with inflammatory bowel disease , reiter 's syndrome or acute anterior uveitis in a first - degree relative undifferentiated arthritis : arthritis that fulfills criteria in no category or in two or more of the above categories . cacp syndrome can be clinically mistaken for polyarthritic jia or systemic jia with pericarditis . in cacp syndrome , children usually present with a joint swelling with absence of features of inflammation and examination reveals camptodactyly . jia is primarily an inflammatory arthritis with or without systemic involvement . on laboratory investigations , patients with jia have elevation of both esr and crp , since it is an inflammatory condition , while these parameters are normal in patients with cacp syndrome . radiologic features of cacp syndrome - related arthritis include those of a non - erosive arthropathy with large joint effusions . inter - osseous herniation of the joint capsule and fluid produces fluid - filled intra - osseous cysts with enhancement of the capsule . these cysts particularly are characteristic of cacp syndrome and are not seen in jia . in the acute phase of jia , imaging shows evidence of effusions and local hyperemia ( due to its inflammatory nature ) as initial widening of joint space , soft - tissue swelling , periarticular osteopenia , and enlargement of the epiphyses [ figure 5 ] . in the chronic stage , the inflammatory pannus causes destruction and leads to findings of joint erosions and joint space narrowing with eventual subluxation , dislocation and ankylosis leading to epiphyseal disturbances with resultant growth abnormalities and deformities . coronal stir image of both knees ( on 3 t system ) shows large effusions . small intraosseous cysts are identified along the medial femoral condyle ( arrows ) the acute non - erosive phase of jia may present with joint effusions and periarticular osteopenia [ figure 5 ] and hence lead to radiological confusion with cacp syndrome . however , in chronic cases of jia cartilage destruction , erosions , and ankylosis is seen . destruction of articular cartilage is also not seen in cacp , however , in advanced or long - standing disease , cartilage destruction may occur without erosive change . the synovial thickening seen in cacp is thin compared to the florid thickening and enhancement in jia . a recent in vitro study demonstrated that rehabilitative joint motion can stimulate chondrocyte prg4 secretion , suggesting that physical therapy may aid in the resolution of the camptodactyly and be appropriate as potential therapy for the arthritis involving the other joints . cacp syndrome is an autosomal recessive syndrome characterized bycamptodactyly , arthropathy , coxa vara and pericarditis with distinct radiological and histopathological features and should be considered in juvenile patients presenting with non - inflammatory arthropathy . increased awareness of this familial condition is required to prevent confusion with other inflammatory musculoskeletal conditions seen during childhood , particularly juvenile idiopathic arthritis . differentiation from jia is clinically important in view of the different management prototcol for the two conditions , and in particular , because of the possible severe side effects associated with treatment for jla .

camptodactyly - arthropathy - coxa vara - pericarditis ( cacp ) syndrome is an inherited disorder characterized by congenital or early - onset flexion camptodactyly , childhood - onset of non - inflammatory arthropathy , often associated with non - inflammatory pericarditis or pericardial effusion and progressive coxa vara . the causative gene is located on chromosome band 1q25 - 31 . this gene encodes for proteoglycan-4 ( prg-4 ) , which is a surface lubricant for joints and tendons . this syndrome has distinct radiological and histological features , which are important to recognize since it may clinically mimic juvenile idiopathic arthritis and mutation studies may not be easily available . we describe a case of a 3-year 3-month - old female with features of cacp syndrome .

You are an expert at summarizing long articles. Proceed to summarize the following text: influenza virus infection poses a global health and economic challenge that has yet to be addressed . during an annual influenza season , an estimate of 35 000 people die due to influenza - related illnesses , which places influenza among top 10 leading causes of death in the u.s . what is more alarming is the emergence of highly pathogenic avian influenza ( hpai ) strains , such as h5n1 , and more recently the h7n9 , which have much higher mortality rate than seasonal influenza strains . it has been shown that these hpai strains need to acquire only one or a few mutations to become transmissible among humans , which raises the likelihood of the next influenza pandemic . there are currently two classes of approved anti - influenza drugs : m2 channel blockers ( amantadine and rimantadine ) and neuraminidase inhibitors ( oseltamivir and zanamivir ) . resistance to both classes of drugs raises great concern : resistance to m2 inhibitors is so prevalent that the centers for disease control and prevention ( cdc ) recommended discontinued use of this class of drugs , and resistance to the only orally bioavailable drug oseltamivir was dominant in the 20072008 influenza season . this leaves zanamivir as the last resort of treatment ; however , the low bioavailability and its nasal route of administration limit its use in severely ill patients . thus , there is a great need for the next generation of orally bioavailable antiviral drugs . one challenge facing anti - influenza drug development is the heterogeneous makeup of the circulating influenza viruses , which comprise several influenza strains with different susceptibilities to antiviral drugs . for example , among the influenza viruses in recent influenza seasons , the h1n1pdm09 and seasonal h3n2 strains are oseltamivir - susceptible and amantadine - resistant , while the seasonal h1n1 strains are mostly oseltamivir - resistant and amantadine - susceptible . moreover , influenza viruses continue to evolve , and it is almost impossible to predict the drug susceptibility of a novel influenza strain . as an illustration , the h5n1 strains isolated from vietnam , thailand , and cambodia have the characteristic s31n mutation , which confers amantadine resistance . however , strains isolated from other countries , such as china , indonesia , japan , and korea , mostly carry the wt m2 and remain susceptible to amantadine . from the drug discovery standpoint , it would be ideal to develop broad - spectrum antiviral drugs that are active against multiple influenza virus strains , thus circumventing the need of combination therapy which often has drug drug interaction - related issues . herein , we focus on m2 as a drug target and report the design of a novel class of m2 channel blockers that are active against both the wt and the s31n mutant . the influenza a virus m2 protein ( a / m2 ) is a virus - encoded proton channel that plays multiple roles during the viral replication cycle : in the early stage of virus uncoating , m2 facilitates unpacking of viral rnas by acidifying the viral interior ; in the late stage of viral replication , m2 equilibrates the ph across the golgi apparatus in order to prevent premature conformational changes of another viral surface protein - hemagglutinin . m2 is a validated drug target of antiviral drugs , amantadine and rimantadine . however , mutations surrounding the drug binding site , such as s31n , v27a , a30 t , and l26f , lead to escape of drug inhibition . in cell cultures , a large number of drug - resistant m2 mutants readily emerged under amantadine drug selection pressure . a subset of these mutations was also observed in influenza - infected patients following treatment with amantadine . reverse - engineered viruses harboring various pore - lining mutations were competent to replicate in mice , raising concerns that m2 might not be an ideal antiviral target . however , electrophysiological investigations showed that the majority of the resulting amantadine - resistant m2 channels had shifts in their conductance characteristics that might render the viruses less fit . this is probably because even minor changes of one amino acid side chain lead to four changes in m2 s 4-fold symmetric homotetrameric pore . indeed , many of these m2 mutations gave somewhat attenuated viruses that have a tendency to revert to the wt m2 in the absence of drug pressure and do not appear to be highly transmissible . corroborating observations in cell cultures , large - scale sequencing of transmissible viruses from 1918 to 2008 have identified only three major amantadine - resistant m2 mutants , s31n , v27a , and l26f . among these three drug resistant mutants , s31n is the predominant mutant and persists in more than 95% of currently circulating influenza viruses . drug discovery efforts targeting these m2 mutants have long been hampered because of the lack of high - resolution structures , the constricted drug binding site , and the dynamic nature of this protein . nevertheless , progress has been made in designing inhibitors targeting the drug - resistant mutants of m2 guided by md simulations and nmr structures m2 . the designed small molecule channel blockers inhibit v27a , l26f , and s31n m2 with potencies greater than that of amantadine in both electrophysiological assays and antiviral plaque reduction assays . these inhibitors not only represent excellent leads for further development , but also help stabilize the otherwise dynamic m2 protein , leading to the determination of the first high resolution solution nmr structure of the a / m2-s31n mutant . herein , we describe the extension of these studies to design dual inhibitors targeting both wt and the s31n mutant . such broadly specific antiviral drugs are superior to mutant - selective inhibitors : ideally , a single drug will be sufficient to combat multiple circulating influenza virus strains , thereby alleviating the need for combination therapy as required when treating human immunodeficiency virus ( hiv ) infections . all starting materials for compound and peptide synthesis were purchased from commercial vendors and used without purification , unless otherwise stated . compounds were purified by silica gel flash column chromatography and characterized by esi - ms , h nmr , and c nmr . details about inhibitor synthesis procedures and characterization can be found in the supporting information . all compounds were initially tested in tevc assay using xenopus laevis frog oocytes microinjected with rna expressing either the wt or the s31n mutant of m2 as described in a previous report . the potency of the inhibitors was expressed as the percentage inhibition of a / m2 current observed after 2 min of incubation with 100 m compounds , and potent inhibitors were further tested at series dilutions to quantify their ic50 values . wt m2-expressing a / udorn/72 and m2-s31n - expressing a / wsn/33 were used to infect mdck cells in the presence or absence of compounds to evaluate their antiviral activity . we used the 2246 transmembrane segment of the tetrameric m2 protein ( udorn sequence ) ( m2-tm ) , modeled after the intermediate - ph structure of the 2546 segments , with two histidines doubly protonated and the other two in the neutral state . we embedded each complex with compound 11 in an 8 8 nm 1-palmitoyl-2-oleoylphosphatidylcholine ( popc ) bilayer , hydrated by a 150 mm kcl water solution . we used the charmm36 , cgenff , and tip3p force fields for the treatment of m2-tm and lipids , 11 , and water molecules , respectively . we optimized the partial charge of the bromine atom of 11 by mp2 calculations , as detailed in the supporting information . 11 was placed in the channel with the bromo - thiophene moiety facing h37 and v27 in the wt m2-tm and s31n mutant , respectively . we performed minimization and initial equilibration of water molecules , as well as relaxation of residues 2224 , with harmonic restraints on the protein backbone and on the bound 11 . we gradually released these restraints over 50 ns of simulation followed by a 150 ns unrestrained run . hplc purified peptides were mixed with deuterated n - dodecylphosphocholine ( dpc ) ( cambridge isotope laboratories ) at 1:50 molar ratio in ethanol . the resulting ethanol solution was mixed by vortexing , and the ethanol was removed by nitrogen purging . next , aqueous buffer [ 10% d2o in h2o , 50 mm sodium phosphate ( ph 6.8 ) ] was added to the dried mixture and vortexed for 2 min , and the ph of the final sample was adjusted to the desired value with either naoh or h3po4 . the final nmr sample conditions are the following : for s31n , 2 mm a / m2-s31n ( 1949 ) ( monomer ) , 20 mm 11 , 100 mm deuterated dpc , and 50 mm sodium phosphate buffer in 10% d2o , 90% h2o , ph 6.8 ; for wt , 2 mm a / m2-wt ( 1949 ) ( monomer ) , 2.5 mm 11 , 100 mm deuterated dpc ( cambridge isotope laboratories ) , and 50 mm sodium phosphate buffer in 10% d2o , 90% h2o , ph 7.5 . isotopically labeled peptides used in this study , a / m2-wt ( 1949 ) vasigh and a / m2-s31n ( 1949 ) vanig , were synthesized using the optimized solid phase synthesis protocol as described previously . peptides were purified by high performance liquid chromatography ( hplc ) with a c4-vydac reverse phase column . the purity and identity of the peptides were confirmed by analytical hplc ( > 98% purity ) and esi - ms . for a / m2-wt ( 1949 ) vasigh , calcd ms : 1539.3 ( + 2 ) , 1026.5 ( + 3 ) . obsd ms : 1539.3 ( + 2 ) , 1026.5 ( + 3 ) . for a / m2-s31n ( 1949 ) vanig , calcd ms : 1549.3 ( + 2h ) , 1033.2 ( + 3h ) . obsd ms : 1549.3 ( + 2h ) , 1033.2 ( + 3h ) . all spectra were recorded with standard pulse sequences at 313 k on a bruker 800 or 900 mhz spectrometers equipped with cryogenic probes . to obtain assignments , 2d n and c hsqc for both wt ( 1949 ) vasigh and s31n ( 1949 ) vanig m2 in the absence / presence of 11 , and 2d c(c)h tocsy experiments for both m2 samples in the presence of 11 were carried out . the 2d c(c)h tocsy ( 70 ms ) experiments were recorded with t1,max = 7 ms for the c dimension and t2,max = 81 ms for the h dimension with 32 scans . 2d c(h)h noesy experiments with mixing time of 150 ms were carried out with t1,max = 7 ms for the c dimension and t2,max = 71 ms for the h dimension , 128 scans . chemical shifts were referenced with respect to the residual water peak at 4.63 ppm , and c and n chemical shifts were referenced indirectly via gyromagnetic ratios . the time domain data of indirect c or n dimensions were extended once by linear prediction . the time domain data were multiplied by sine square bell window functions shifted by 90 and zero - filled once before fourier transformation . the 2d c - edited noesy allows observation of noes from the protons that are directly attached to the c atoms to any protons that are within approximately 5 , so both peptide drug and peptide peptide noes are present in a given experiment . also , although the drug is not c labeled , intramolecular noes originated from its protons attached to c at natural abundance ( 1.1% ) can be observed due to the fact that the drug is in large molar excess and the free drug has favorable relaxation properties . drug noes we first focused on the isolated noe peaks that could be assigned unambiguously ; an intermediate model was generated once we were able to determine the drug orientation . with aid of the model drug noe peaks , even in overlapping areas , based on the network anchoring method . note , however , that ambiguous noes have to be supported by other noes systematically in this procedure . h upper distance constraints between drug and peptide for structure modeling were extracted from the noesy spectra and listed in supporting information table s3 . drug noes in addition to distance constraints and backbone dihedral angle constraints from the s31n - wj332 ( 2 ) structure . previous sar , structural studies , and md simulations of drug m2 interactions revealed a common mechanism of drug action : potent m2 inhibitors , regardless of whether they target wt , s31n , v27a , or l26f , all contain a positively charged ammonium , which presumably serves as a mimic of the conducting hydronium ion that forms water - mediated hydrogen bonds with backbone carbonyls of m2 . in addition , channel blockers bind to m2 through hydrophobic interactions and 3-dimensional - shaped ( 3d - shaped ) scaffolds are generally preferred over planar molecules . nmr structural studies of a high - affinity inhibitor of s31n revealed that this inhibitor bound to s31n in a different orientation than previously characterized inhibitors of the wt protein : drugs like amantadine ( 1 ) and rimantadine bind to wt m2 channel with their positively charged ammonium facing downward toward h37 ; while m2wj332 ( 2 ) bound to the s31n mutant in the opposite orientation with its ammonium facing upward v27 . the orientations of amantadine ( 1 ) and rimantadine in wt , and m2wj332 ( 2 ) in m2-s31n , were modeled by md simulations , and the orientations were confirmed by solution and solid - state nmr spectroscopies , and further corroborated by sar studies . the observed drug - flipping phenomenon provides a rationale for design of dual inhibitors that target both wt and s31n in opposite orientations . to design such dual inhibitors , we started with our earlier reported inhibitors that had moderate inhibition against both wt and s31n ( table 1 ) . asterisk indicates that the values represent the mean of three independent measurements in tevc assays . we typically see no more than 5% variation in the % inhibition on a given day , or 10% error for measurements made on different days with different batches of oocytes . , we noted that , as the r substitution on the five - membered heterocycles gets bulkier , the wt inhibition of the corresponding compounds decreases drastically . therefore , to maintain the wt activity , we decided to examine compounds with small r substitutions ( e.g. , halide , methyl , methoxy ) . it is also known that a variety of hydrophobic scaffolds are tolerated for wt inhibition , while adamantane is the preferred moiety for s31n inhibition . thus , we chose adamantane as the hydrophobic scaffold in order to retain s31n activity . with these two criteria in mind , we devised a general structure for the dual inhibitors as shown in scheme 1 . the linker between adamantane and the heterocycle was kept constant as an ammonium methylene , as it has been shown to be critical for s31n inhibition . on the basis of the binding mode of m2wj332 ( 2 ) in s31n mutant as shown in figure 1 , the r group was expected to form hydrophobic interactions with the v27 side chain methyls . ( a ) solid state nmr structure of amantadine - bound wt a / m2 ( pdb : 2kqt ) . amantadine binds in the channel with its positively charged ammonium facing toward the c - terminal h37 . ( b ) the solution nmr structure of m2wj332 ( 2)-bound a / m2-s31n ( pdb : 2ly0 ) . m2wj332 ( 2 ) binds with its positively charged ammonium facing upward the n - terminal v27 . ( c ) chemical structures of amantadine ( 1 ) and m2wj332 ( 2 ) . compounds were synthesized with highly efficient reductive amination and alkylation as described earlier . all compounds were initially tested in two - electrode voltage clamp assays at 100 m concentration ( table 2 ) . for the potent compounds , these measurements are made prior to the establishment of equilibrium due to very slow on and off rates for entry of the bulky drugs into the column and the problems of maintaining cells at low ph for extended periods . hence the ic50 values determined by this procedure are significantly higher than the true binding constants . the most potent compound from the five - membered heterocyclic series was n-[(5-bromothiophen-2-yl)methyl]adamantan-1-amine ( 11 ) , which showed 76% and 77% inhibition against s31n and wt m2 , respectively . in comparison , the bromo - substituted thiazole and isoxazole analogues were less active ( 11 versus 8 , 9 , and 10 ) . chloro - substituted thiazole ( 6 ) had moderate activities against both wt and s31n . interestingly , the chloro - substituted 1,2,4-thiadiazole analogue ( 7 ) showed improved potency against s31n , and retained its wt inhibition in comparison to 6 . methyl - substituted compounds were in general less active than their bromo- and chloro - substituted counterparts ( 15 versus 6 and 8) . methyl substitution slightly increased s31n inhibition , but decreased wt inhibition in the case of 1,2,4-isoxazole ( 21 versus 12 ) . compounds with hydrophilic amine substitution ( 16 ) and bulky tert - butyl substitution ( 24 ) were inactive against both wt and s31n . one asterisk indicates the values that represent the mean of three independent measurements in tevc assays . we typically see no more than 5% variation in the % inhibition on a given day , or 10% error for measurements made on different days with different batches of oocytes . all compounds were tested at 100 m . because the bromo - substituted thiophene 11 had the highest dual inhibition against both wt and s31n , we decided to further explore the sar . as shown in table 3 , removal of the bromo substitution resulted in drastic decrease of s31n inhibition ( 11 versus 25 ) , presumably due to the lack of favorable hydrophobic interactions with the v27 side chains . however , removal of the bromo substitution had no effect on the wt inhibition ( 11 versus 25 ) . other halides such as chloro and iodo were similarly tolerated in the same position , and the resulting compounds retained potent inhibition against both wt and s31n ( 11 versus 26 and 27 ) . the ec50s of 5-halide - substituted adamantyl thiophene amines ( 11 , 26 , and 27 ) all fell in the single digit low micromolar range . methyl - substituted thiophene ( 28 ) was 2-fold less active than its bromo analogue ( 11 ) in inhibiting both wt and s31n . methoxy substitution at the same position also resulted in a less active compound ( 29 ) . compounds with ethyl ( 30 ) and cyclopropyl ( 31 ) substitutions showed drastic decrease in wt inhibition , while having little or no effect on their s31n inhibition . collectively , the sar correlates with the design rationale in which a bulky r group is not tolerated in wt inhibition . moving the substitutions from the 5-position of the thiophene to the 4-position ( 32 ) or the 3-position ( 33 ) led to the loss of activity against both wt and s31n , suggesting the binding geometry of the drug is important . introducing an extra methyl at the 4-position also decreased the activity ( 11 versus 34 ) . cellular cytotoxicity of the active dual inhibitors , 11 , 26 , 27 , 28 , and 29 , were profiled using the 3-(4 , 5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide ( mtt ) assay . the selectivity index for the most potent dual inhibitors , 11 and 27 , were > 37 , rendering them as promising candidates to be further pursued in the following in vivo mouse studies . one asterisk indicates the values represent the mean of three independent measurements in tevc assays . we typically see no more than 5% variation in the percent inhibition on a given day , or 10% error for measurements made on different days with different batches of oocytes . the compounds that showed > 80% inhibition at 100 m were further tested at 30 m . the data are presented as % inhibition at 100 m/% inhibition at 30 m . n.t . = our design was based on the idea that dual inhibitors bind to wt and s31n in opposite orientations . to experimentally validate this hypothesis of flip - flop drug binding , we recorded solution nmr noesy spectra to determine drug - m2-tm interactions . c labeled amino acids at selected positions were used for this study in order to simplify the spectrum and obtain unambiguous drug - m2-tm noes . the channel - forming transmembrane peptide corresponding to the pore of wt m2 is denoted wt ( 1949 ) vasigh , meaning residues at v27 , a30 , s31 , i33 , g34 , and h37 are uniformly n c labeled . for the s31n ( 1949 ) vanig peptide , residues at v27 , a30 , n31 , i33 , and g34 are uniformly n c labeled . the chemical shifts for the complexes of wt vasigh and s31n vanig in the presence of 11 were very similar to those observed for the amantadine - bound wt m2 tm and the m2wj332 ( 2)-bound s31n , respectively . assignments were obtained by direct comparison and confirmed by 2d c(c)h - tocsy , and assignments of i33 and v27 are labeled in supporting information figure s3 . two - dimensional c - edited noesy experiments with 150 ms mixing time were used to identify peptide drug noes for s31n ( 1949 ) vanig peptide ( figure 2a ) and the wt ( 1949 ) vasigh peptide ( figure 2b ) . the assignment of the complex of s31n ( 1949 ) vanig in complex with 11 ( figure 2a ) is similar to that used previously to solve the corresponding complex with m2wj332 ( 2 ) . noe peaks between g34 c and the drug protons h7 and h8 were assigned straightforwardly because the c chemical shift of gly is very unique and easily identified . chemical shifts of drug protons h1 and h2 are overlapped , but the two protons have strong noes to the v27 methyl groups that do not overlap with any other peaks , clearly showing that the val27 methyl groups and the thiophene ring of 11 are very close in space . next , the isolated peak of n31 c and the drug h6 was assigned . furthermore , additional noe assignments for peaks that were overlapped with another were assigned on the basis of the network anchoring approach with aid of the intermediate models . similarly , for the wt ( 1949 ) vasigh sample , we began with the noe peaks that could be assigned unambiguously ( figure 2b ) . a cross - peak between i33 methyl groups and the thiophene ring ( 11 h1 to i33 2 and 1 ) , together with the lack of noes to val27 methyl groups ( as were the case for s31n ) , place the aromatic group pointing down into the channel . additionally , noes between v27 methyl groups and the adamantane protons h6 , h7 , and h8 indicate that the adamantane is located near the n - terminus . at this stage , we generated an intermediate model , which aided the assignment of additional peptide drug noes . from the adamantane protons ( h6 , h7 , and h8 ) , we assigned noes to the c atoms of v27 , a30 , and s31 . noes were also assigned between the thiophene proton h2 and the methylene protons h5 from the drug 11 and the methyl group of ala30 , respectively . for the wt ( 1949 ) vasigh sample , we also observed a series of noes from the i33 1 methyl and a number of aliphatic protons , near the chemical shifts of adamantane protons ( upper right of figure 2b ) . we were unable to assign this region of the spectrum , because it is heavily congested with intraresidue noes from i33 as well as noes to other regions of the protein ( the noes seen in a c - filtered experiment do not differentiate signals from drug versus other protons in the protein ) . given the heavy congestion of the spectrum in this region , we could not rule out the possibility of noes from drug 11 to i33 , which would have been consistent with the drug binding with thiophene in the up orientation . however , the lack of systematic noes between the thiophene protons ( h1 and h2 ) and v27 as were seen in the complex with s31n ( 1949 ) vanig ( figure 2a ) together with the presence of noes locating the thiophene ring in the channel near ala30 indicate that 11 is primarily bound with the heteroaryl group pointing down . thus , while we are unable to rule out the possibility of other minor conformers , these data clearly confirm that the predominant orientation for wt is with the adamantane up near val27 and the thiophene directed downward . these peptide drug noes , along with the distance constraints and backbone dihedral angle constraints for defining the peptide s tetrameric structure obtained for the s31n - m2wj332 ( 2 ) structure , were used to build the models using xplor - nih as shown in figure 2d . there were no distance violations ( > 0.5 ) for the assigned noes . ( a ) 2d c h noesy ( 150 ms ) experiment for s31n ( 1949 ) vanig sample in the presence of 11 . ( b ) 2d c h noesy ( 150 ms ) experiment for wt ( 1949 ) vasigh sample in the presence of 11 . assignments for drug peptide cross peaks are labeled in blue and listed in supporting information table s3 . ( c ) illustration of relative position of 11 in s31n and wt , based on intermolecular peptide drug noes . drug noes in addition to distance constraints for the peptide obtained for s31n - wj332 structure . left is for s31n , and right is for wt in both parts c and d. positions of the dual inhibitor 11 in s31n and wt are flipped and mirrored along residue 31 , providing a direction to design an inhibitor for all m2 mutants . models generated using the drug - m2 noes were deposited in pdb with codes of 2muw and 2muv for drug - bound wt - m2 and the s31n mutant , respectively . we used md simulations of m2-tm in a phospholipid bilayer to investigate the dual inhibitory behavior adopted by compound 11 against the m2 proton channels ( both wt and s31n mutant ) ( figure 3 ) . given the very slow on and off rates of amantadine derivatives ( typically on the hour time scale ) , the extended structure of the inhibitor , and the restricted geometry of the pore , it was necessary to initiate the simulations with the molecule already inserted in the pore in the predominant orientation inferred from solution nmr . in both simulations , the ammonium gradually converges to stable positions along the pore . in the wt m2-tm , we initialized compound 11 to minimize steric clashes : during the first tens of nanoseconds , the ammonium s position shifts by about 1 toward v27 and aligns itself with the backbone carbonyl of g34 , which is the native binding mode for amantadine . the movement of 11 toward its final pose is accompanied by a conformational change of the m2-tm backbone , in the direction toward the low ph structure . after 200 ns , the root - mean - square deviation ( rmsd ) of the backbone atoms from the starting structure is 4 , whereas the rmsd from the low ph structure is 2.5 . for comparison , md simulations of the stable drug - free or inhibitor - bound conformation yield rmsds of approximately 1 , attributable to thermal fluctuations : therefore , the final structure is similar to , but distinct from , the low ph structure . a similar conformational change was also observed in phospholipid bilayers as an effect of mutations of d44 . close interactions are formed between the phosphate groups of the lipids with r45 , and water molecules between v27 side chains disappear altogether . within the pore , the bromine atom of 11 forms transient , nonspecific interactions with water molecules , the backbone carbonyl of g34 , and the imidazole of h37 : this is in agreement with the ranking of the binding energies with these three moieties in quantum mechanical calculations ( see supporting information ) . in the s31n mutant , we initialized 11 with the bromo - thiophene moiety facing toward v27 , and the ammonium aligned with the side chain of n31 , as in the s31n - m2wj332 ( 2 ) structure ( pdb : 2ly0 ) . the v27 side chains are packed tightly around the thiophene group in the starting structure : the c atoms from opposite monomers are separated by 7.8 . during the first 100 ns , the n - terminal residues slightly expand to accommodate the thermal fluctuations of 11 ( the separation between opposing cs increases to 9.2 ) . water molecules that are initially positioned around 11 leave the region between v27 and g34 , with the exception of two water molecules coordinating the ammonium group , also seen in the previous s31n - m2wj332 ( 2 ) simulations . in this binding mode , the bromine atom is surrounded by the v27 side chains , and only partially exposed to the outer solvent : the pair correlation function with water oxygens ( see supporting information ) shows 4 or 5 water molecules weakly interacting with the bromine . the first hydration shell is centered at 3.5 of distance from the bromine , while the second appears as an even broader peak centered at 6 ( integrals at 5 and 8 , respectively ) : both features resemble very closely those of a methyl group at an oil water interface . this mode of interaction is in agreement with the sar of molecules with bromine substituted by other halogens , as well as a methyl ( table 3 ) . in summary , the drug binding orientation of dual inhibitor 11 as inferred from solution noes are supported by md simulations , showing the relative orientations were indeed stable within the simulation time . final md snapshots of compound 11 bound to the transmembrane segment of wt and s31n m2 in a lipid bilayer . left : 11 bound within wt m2 after 200 ns . the protein backbone is shown as ribbons ; pore - lining side chains and backbone carbonyls , ligand , and water molecules within the pore are shown as sticks . water molecules solvating the bromine atom in the outward - facing pose ( right ) are also shown . the heterogeneity of influenza viruses poses a great challenge in the development of anti - influenza drugs . for effective neutralization of influenza viruses , influenza vaccines normally contain two strains of influenza a viruses , a / california/7/2009 ( h1n1)-like virus and a / texas/50/2012 ( h3n2 ) virus , plus at least one strain of influenza b virus , typically b / massachusetts/2/2012 . although influenza vaccines remain the cornerstone in prophylaxis of influenza infection , they are much less active than small molecule antivirals in treating influenza - infected patients . moreover , due to antigenic shift and antigenic drift of influenza viruses , influenza vaccines have to be reformulated each year ; plus , there is generally a six - month delay in vaccine production . the limitations of influenza vaccines together with the heterogeneous makeup of influenza viruses call for broad - spectrum small molecule antivirals . we designed a class of such broad - spectrum dual inhibitors with ec50 values against wt and m2 s31n influenza viruses , which is comparable with that of amantadine ( 1 ) in inhibiting wt influenza virus . our design was based on the hypothesis that dual inhibitors bind to wt and m2-s31n channels with opposite orientations : the aromatic headgroup faces down toward the c - termini and toward n - terminus in wt and s31n channel , respectively . starting with our previously discovered lead compounds showing moderate dual inhibition , we identified halide - substituted thiophene compounds having the highest potencies . the antiviral activity of the most potent inhibitor , 11 , in inhibiting wt and the s31n mutant is on par with that of amantadine ( 1 ) in inhibiting wt virus . all unambiguous noes indicated that the inhibitors bind to the wt and s31n channels in opposite orientations , although we can not rule out the possibility of other minor conformational states of the drug in the wt protein due to spectral overlap . the dual inhibitors reported herein provide promising lead compounds for further medicinal chemistry optimization with the ultimate goal of developing broad - spectrum anti - influenza drugs .

influenza virus infections lead to numerous deaths and millions of hospitalizations each year . one challenge facing anti - influenza drug development is the heterogeneity of the circulating influenza viruses , which comprise several strains with variable susceptibility to antiviral drugs . for example , the wild - type ( wt ) influenza a viruses , such as the seasonal h1n1 , tend to be sensitive to antiviral drugs , amantadine and rimantadine , while the s31n mutant viruses , such as the pandemic 2009 h1n1 ( h1n1pdm09 ) and seasonal h3n2 , are resistant to this class of drugs . thus , drugs targeting both wt and the s31n mutant are highly desired . we report our design of a novel class of dual inhibitors along with their ion channel blockage and antiviral activities . the potency of the most active compound 11 in inhibiting wt and the s31n mutant influenza viruses is comparable with that of amantadine in inhibiting wt influenza virus . solution nmr studies and molecular dynamics ( md ) simulations of drug - m2 interactions supported our design hypothesis : namely , the dual inhibitor binds in the wt m2 channel with an aromatic group facing down toward the c - terminus , while the same drug binds in the s31n m2 channel with its aromatic group facing up toward the n - terminus . the flip - flop mode of drug binding correlates with the structure activity relationship ( sar ) and has paved the way for the next round of rational design of broad - spectrum antiviral drugs .

You are an expert at summarizing long articles. Proceed to summarize the following text: there is no doubt that in vivo imaging of glucose catabolism by positron emission tomography ( pet ) through the use of the pet tracer fluorine-18 - 2-fluoro-2-deoxy - d - glucose ( fdg ) has revolutionized diagnosis and staging of cancer . fdg , an analogue of glucose , is transported into cells by glucose transporters and follows the glycolytic pathway being phosphorylated by hexokinase into fdg-6-phosphate . at this point fdg is metabolically trapped because it can not follow the normal glycolytic pathway due to the substitution of the 2 hydroxyl group by fluorine 18 ( f ) , causing its accumulation in the cell . higher accumulation of fdg in cancer cells compared to normal cells allows the imaging by pet of the warburg effect or aerobic glycolysis which is uniquely observed in cancer . the association of this effect to malignancy has made fdg an indispensable or at least a very important imaging agent in the diagnosis , staging , restaging , and assessment of treatment in various types of cancer including lung , colorectal , esophageal , stomach , head and neck , thyroid , cervical , ovarian , and breast cancers , as well as melanoma and most types of lymphoma [ 1 , 3 ] . the in vivo imaging of anabolic rather than catabolic carbohydrate pathways has a potential usefulness in cancer management by offering the clinician complementary information on cancer carbohydrate metabolism that is currently unavailable in vivo . this paper addresses the key points of different strategies that have been developed to image the in vivo expression of sialylated oligosaccharides synthesized by an essential cellular process known as glycosylation . glycosylation involves the synthesis and attachment to proteins ( glycoproteins ) and lipids ( glycolipids ) of a structurally diverse group of oligosaccharides chains also known as glycans that are synthesized in the endoplasmic reticulum and golgi apparatus of all human cells . along this paper the role of sialylated antigens in the glycophenotype of cancer , their biosynthesis , and emerging imaging tools are described in text and figures as the foundations of a preliminary suggestion towards a new clinical approach in tumor imaging . each type of human cell displays in its surface an array of glycans attached to proteins or lipids to form glycoconjugates . the different types of monosaccharides and linkage combinations can be found on glycans code for biological information that translates into structural or functional properties of the glycoconjugate . the type and degree of expression of glycans is determined by the type and activities of the proteins involved in their synthesis that can be different from one cell type to another and even differ to some extent between the same types of cell . this dynamic temporospatial characteristic of glycosylation and the great intrinsic information it can carry as a glycan code have been evolutionarily selected as an important mechanism for cells to communicate and enhance distinct physiologic and pathologic states , including malignant transformation . glycan code has been probed and imaged extensively in vitro mostly by the use of antibodies that recognize carbohydrate epitopes or through carbohydrate - binding proteins known as lectins . in the case of cancer certain characteristics of the glycan code one of these being the overexpression of sialic acid ( sia ) residues that are present in many characterized carbohydrate antigens . a substantial component that distinguishes malignant from benign glycophenotypes is the neoexpression or overexpression of sialylated epitopes in the cell surface that include sialyl - tn ( stn ; sia26galnac - t / s ) , sialyl t ( st ; sia2 - 3gal1 - 3galnac - t / s ) , sialyl lewis x ( sle ; sia2,3gal1,4(fuc1,3)glcnac ) , and sialyl lewis a ( sle / ca19 - 9 ; sia2,3gal1,3(fuc1,4)glcnac ) , figure 1 . additionally , various tumors including small cell and nonsmall cell lung carcinomas , multiple myeloma , neuroblastoma , and wilms ' tumor express sia as a homopolymer called polysialic acid or psa ( sia2,8sia ) [ 812 ] . the neo- or overexpression of these sialylated antigens is mainly caused by an increase in the expression of sialyltransferases ( sts ) and fucosyltransferases ( futs ) , glycosyltransferase enzymes responsible for their synthesis that add sia and fucose residues to glycans , respectively . additionally , effective increase in antigen synthesis requires not only glycosyltransferase overexpression but also adequate donor and acceptor substrate synthesis which requires regulation of other elements of the glycosylation machinery . this increase in sialylated antigen expression during cancer progression has been associated to hypoxic conditions that develop in a growing tumor and induce transcription of sts , futs , and nucleotide - sugar transporters that provide them with donor substrate [ 1417 ] . overexpression of sialylated antigens like sle and sle plays an important role in the biology of cancer , particularly the metastatic process . overexpression of these antigens in circulating cancer cells allows them to attach to a family of endogenous lectins called selectins that are expressed in endothelial cells of high endothelial venules ( hevs ) , but also platelets and leukocytes . selectins normally participate in the first phase of what is known as the leukocyte adhesion cascade that allows leukocytes to roll over the inflamed vascular endothelium through selectin - carbohydrate interactions mediated by ligands that express sle and sle epitopes . leukocyte rolling gives way to more stable interactions with endothelial integrins that allow them to transmigrate to the interstitial space to culminate an immune response . cancer cells that disperse from a primary tumor and access the vascular compartment have exploited this leukocyte adhesion cascade mechanism to attach to hev and extravasate to initiate the establishment of metastatic lesions . also , overexpression of sle antigens has been found to facilitate tumor angiogenesis by mediating cancer cell adhesion to endothelial cells [ 19 , 20 ] . it is clear that increased expression of sialylated antigens on cancer cells is closely implicated in the process of cancer progression , and more malignant cancer cells tend to have a more enhanced expression of these carbohydrate determinants . the numerous clinical statistics made available to date show that the intensity of sle and sialyl tn expression on cancer cells significantly correlates with the prognosis of patients and are reviewed elsewhere [ 2124 ] . a statistically significant correlation between the postoperative patient prognosis and sle expression has been reported for colon and stomach cancers while its correlation with sle expression has been reported for lung , breast , prostate , stomach , colon , and urinary bladder cancers . also , in both small cell and nonsmall cell lung carcinomas , colorectal cancer , and multiple myeloma , the expression of psa has been correlated with tumor progression [ 8 , 9 , 11 , 12 , 26 ] . unfortunately , the determination of the sialylation status , particularly of solid tumors , is currently performed mainly on tissue sections obtained from tumor biopsies limiting the number of possible assessments through time . the name sialic acid collectively refers to a family of over 50 naturally occurring sugars and a growing number of synthetic analogs . in humans sia is a nonulosonic amino sugar with a carboxylate at the c1 position that is ionized at physiological ph giving it a negative charge ( figure 2 ) . sia has the potential for additional substitutions with acetyl , methyl , sulphate , and phosphate groups at the hydroxyl groups on the 4- , 7- , 8- , and 9-carbons that give it additional properties . the negative charge of sia and its terminal position in glycans have given it a predominant role in determining the nature of glycan interactions involved in many essential functions of human physiology . the biosynthesis of sia begins in the cytosol with the formation of n - acetylmannosamine ( mannac ) from a relatively minor proportion of udp - n - acetylglucosamine ( udp - glcnac ) , obtained form the extracellular environment or derived from glcnac via the action of glcnac 2-epimerase ( figure 2 ) . in mammals , the second step involves the condensation of either mannac or macnac-6p with phosphoenolpyruvate ( pep ) to give neuraminic acid or neuraminic acid-9p , respectively . in mammals , finally , in the nucleus the activation of sia with cytidine monophosphate ( cmp - sia ) is generated with the use of cytosine triphosphate ( ctp ) . once in the cytosol cmp - sia is then transported to the golgi lumen by a specific transporter ( cmp - siatr ) where it is used as donor substrate by more than twenty human sialyltransferases ( sts ) that incorporate it into the nonreducing end of glycans [ 16 , 31 , 32 ] . linkage of sia by sts can be done to a terminal galactose residue ( gal ) via 2,6 or 2,3-linkage , to n - acetyl - galactosamine ( galnac ) or galactosamine residues via 2,6-linkage , or to another sia as an 2,8 homopolymer ( figure 3 ) . the presence or absence of sia as well as the type of linkage it presents in the glycan have been selected in evolution as recognition characteristics that allow or hamper biding of glycan ligands , thus determining important molecular interactions that affect cell behavior including cell - cell , cell - matrix , and cell - soluble molecule interactions that play roles in both physiological and pathological processes . because of the clear association that has been established between sialylated antigen overexpression and tumor aggressiveness , the imaging of tumor sialylation would offer a concomitant or alternative study to pet - fdg imaging not only to diagnose cancer but also to assess patient 's prognosis . to obtain the in vivo sialylation status of a tumor there are at least two strategies for the in vivo imaging of tumor sia expression . one involves metabolic labeling that allows imaging of de novo synthesis of sia , and the second one involves native sia recognition by imaging probes . metabolic labeling allows the study of a metabolic pathway by administering to the cells compounds that are modified analogs of natural substrates for that particular pathway . modification of these compounds aims at providing a means for their detection without interfering with their metabolic use . an ideal candidate compound for evaluating tumor sialylation in vivo has to be cell permeable , has to be able to enter the cmp - sia biosynthesis pathway at a committed stage , and although modified has to be efficiently used by sts . the use of labelled sia or cmp - sia is restricted because of the lack of plasma membrane transporters and the negative charge of unmodified sia that limits its cellular permeability . uptake studies with f - labelled sialic acids n - acetyl-3-[f]fluorosialic acid ( 3-sia ) and n - acetyl-2-deoxy-2,3-difluorosialic acid ( 2,3-disia ) showed inefficient uptake and unsuitability for in vivo imaging . an alternative to solve this problem is the use of modified permeable sia analogs [ 34 , 35 ] or permeable sia precursors that can be subsequently detected by imaging probes . sia precursors , particularly based on mannac , have been favored over sia analogs for in vitro and in vivo imaging because of lower cost and synthetic tractability of mannac over sia . of the different analogue precursors of sia biosynthesis , mannac analogues are ideal candidates for metabolic labeling because mannac is the first pathway intermediate to be committed to sia biosynthesis , assuring that imaging of the labelled mannac analog reflects glycan sia expression . and although mannac is permeable , mannac analogs can be further acetylated to increase passive membrane permeability . among many modifications that have been achieved on the mannac sugar with chemical reporters that allow its detection , only an azide - labelled bioorthogonal chemistry has successfully been used to image in vivo its incorporation as glycan - bound sia . the azide group at the c2 carbon of mannac analogs does not interfere with the flux of the precursor towards sia synthesis , activation in the form of cmp - sia or st - mediated transfer . also , it is abiotic allowing the development of both intracellular and surface chemoselective ligation strategies for its efficient detection by bioorthogonal chemistry through modified phosphines or alkynes . a peracetylated analogue of mannac bearing the azide chemical reporter group ( ac4mannaz ) has been administered to mice in vivo without toxicity and was found to be suitable for imaging [ 41 , 42 ] . after cellular uptake ac4mannaz is deacetylated in the cytoplasm and then metabolically converted to n - azidoacetyl sialic acid ( sianaz ) that is then activated with cmp and used by sts as donor substrate to be incorporated into glycans ( figure 4(a ) ) . the glycan - associated sianaz is then probed in vivo through the staudinger ligation that allows the azide group to interact with triphenylphosphine derivatives . an electrophilic trap of methyl ester group in ortho position to the phosphine structure provides a reactive site for the nucleophilic nitrogen from the azide group that temporarily forms an aza - ylide intermediary ( not stable in water ) with the phosphorus atom . intramolecular cyclization between the nitrogen and the carbonyl group of the methyl ester group releases methanol and forms a stable amide bond rather than the products of aza - ylide hydrolysis . in vivo animal imaging potential of this strategy in a murine model of lung carcinoma has been recently reported . the resulting sianaz was detected by administration on day 11 of biotinylated phosphines ( figure 4(b ) ) that were detected 2 hours after by intravenous injections of fluorescent or radionuclide - labelled avidin molecules . radionuclide detection with a spect camera which is the most closely related to what human applications would use was achieved with an indium-111-labelled neutravidin - dota , showing a significant azido - labelled mannac - dependent increase in tumor - to - tissue contrast . as the authors of this paper suggest , this strategy requires further improvement by reducing it to a one - step probe approach by using phosphine molecules modified with gamma or positron emitting radioisotopes and with an improved hydrophilic nature of phosphines to reduce the nonspecific stromal binding that was observed in this study . also , other compounds like cyclooctynes could be used to detect azide groups via strain - promoted azide - alkyne cycloaddition ( figure 4(a ) ) . some derivates possess a ring strain and electron - withdrawing fluorine substituents that together promote the [ 3 + 2 ] dipolar cycloaddition with azides to form regioisomeric mixtures of triazoles . this reaction has higher reaction kinetics compared to the staudinger ligation and has been further improved by synthesizing second - generation difluorinated cyclooctynes ( difos ) that have propargylic fluorine atoms that increase its interaction energy with the azide ( figure 4(a ) ) . these difos have been successfully employed for dynamic in vivo imaging of developing zebrafish , and important advances have been made to improve their synthesis . it is worth considering that fluorophore modified phosphines or cyclooctynes could also be used for imaging of the sialylation status of superficial cancers like skin melanoma or colorectal cancer through fluorescent endoscopy . it is noteworthy to mention that advances in positron emitters through the staudinger ligation have been achieved using phosphine - substituted thioesters with f - fluoroethylazide . a second strategy consists in using imaging probes that recognize native sia in the cell surface . historically , sialic acids have been explored in vitro using plant lectins like wheat germ agglutinin ( wga ) that detects sia independently of its type of linkage , sambucus nigra lectin ( sna ) that recognizes 2,6 sia or maackia amurensis aggluttinin ( mal ) that recognizes 2,3 sia . also , antibodies directed against sle or sle determinants have been used for many years ; this is the case of ca19 - 9 a tumoral marker used for detection of sle determinants in gastrointestinal tumors . these in vitro tools have been difficult to translate in vivo not only because of their immunogenicity , that at least for antibodies could be circumvented by humanizing them , but also because of their molecular weight , that would restrict them to the vascular compartment . this vascular restriction would not be a problem if the aim was to image the expression of sia on the vascular network of a tumor , for example , or in chronic inflammatory diseases . in the case of lectins , immunogenicity could be avoided if human endogenous sialic - acid - recognizing lectins were to be used like siglecs or selectins , but again their use would probably be limited to the vascular compartment . nonetheless , other alternatives show promise mainly in the field of magnetic resonance imaging for the detection of native sia molecules ( figure 5 ) . these compounds were obtained by inclusion of a central chelating unit based on the dtpa - bisamide structure ( dtpa , diethyl - enetriamine pentaacetic acid ) . molecular modeling studies indicate that both compounds can allow two - site binding to sia through ester formation by interaction of the boronate function in the ligand with the geminal diol of sia and an electrostatic interaction between a positively charged aminoimidazolium ( l1 ) or aminomethyl ( l2 ) group present in metaposition relative to the boronic function and the carboxylate group of sia . both gadolinium complexed ligands showed high specific and reversible binding towards sia . the dynamic equilibrium that the compounds showed between their sialic - acid - bound and free states would allow them to be excreted physiologically . similarly , a thiourea - based synthetic receptor ( 2-{[3-(4-nitrophenyl)ureido]methyl}phenylboronic acid ) reported by regueiro - figueroa et al . that contains phenylboronic acid functions also showed a high specificity towards sia due to cooperative binding through ester formation with the phenylboronic acid and hydrogen bond interactions between the carboxylate group and the thiourea moiety ( figure 5 ) . this native recognition approach compared to metabolic labelling has the potential to recognize the type of sia linkages and even carbohydrate antigens , offering additional specific information , but this aim requires further research . although glycans equip the cell surface with efficient and dynamic signalling mechanisms that have been partially deciphered to convey important clinical information , glycans and glycan - mediated interactions have been rarely targeted for in vivo imaging with some exceptions that particularly involve quantification of liver function [ 5052 ] . in vivo imaging of tumor sialylation is in the transition stage from the bench to the bedside and is only limited by minor improvements in radioisotope probe synthesis to be used concomitantly or alternatively with fdg in the medical management of cancer . the metabolic labelling with sia precursor analogs and detection offered by bioorthogonal chemistry offer at this moment a high value for clinical use in the near future . it is important to press for the continuing technological development of these strategies to assess as soon as possible their clinical value in diagnosis , staging , prognosis , and treatment response . imaging of tumor sialylation brings together information of both catabolic and anabolic processes associated to malignancy which can only improve patient management .

in vivo assessment of tumor glucose catabolism by positron emission tomography ( pet ) has become a highly valued study in the medical management of cancer . emerging technologies offer the potential to evaluate in vivo another aspect of cancer carbohydrate metabolism related to the increased anabolic use of monosaccharides like sialic acid ( sia ) . sia is used for the synthesis of sialylated oligosaccharides in the cell surface that in cancer cells are overexpressed and positively associated to malignancy and worse prognosis because of their role in invasion and metastasis . this paper addresses the key points of the different strategies that have been developed to image sia expression in vivo and the perspectives to translate it from the bench to the bedside where it would offer the clinician highly valued complementary information on cancer carbohydrate metabolism that is currently unavailable in vivo .

You are an expert at summarizing long articles. Proceed to summarize the following text: acetaminophen also known as paracetamol , tylenol , and acetyl - p - aminophenol ( apap)is possibly the most used drug in the world , with around 50 million weekly users in the us alone . originally cyclooxygenase ( cox ) enzymes , the classical target of nonsteroidal anti - inflammatory drugs , were considered the on - target for acetaminophen . however , the evidence for this remains controversial ( reviewed in ref ( 2 ) ) , and other proteins , such as transient receptor potential cation channel , member a1 ( trpa1 ) , have been recently suggested to mediate the therapeutic effects via acetaminophen metabolites . direct targets of acetaminophen have remained elusive as research has focused on downstream events following acetaminophen metabolism . although acetaminophen is safe at low doses , overdose is the leading cause of acute liver failure . a very complicated and incompletely understood process that takes place mainly in the liver and kidneys but involves several cell types , including hepatocytes and cells of the immune system ( reviewed in refs ( 46 ) ) . at the molecular level the two main factors in acetaminophen toxicity are formation of a highly reactive metabolite n - acetyl - p - benzoquinone imine ( napqi ) and production of reactive oxygen species ( ros ) , especially superoxide anions . the reactive oxygen species and napqi are largely counteracted by glutathione in the early stages of toxicity . however , after glutathione depletion , napqi forms protein adducts and damages mitochondria , which are considered as the main source of superoxide in later stages of toxicity . formation of napqi is essential for toxicity , but it alone may be insufficient for causing necrotic cell death . production of ros can activate c - jun n - terminal kinase ( jnk ) and transient receptor potential melanostatine 2 ( trpm2 ) ca channels leading into further mitochondrial damage and amplified ros formation . changes in cytosolic ca levels have been observed early in hepatotoxicity , and trpm2 channels have been recently shown to mediate acetaminophen hepatotoxicity . it is believed that an initial oxidative stress may be needed for the activation of jnk and ca channels . however , napqi mediated mitochondrial toxicity and ros formation should only take place after glutathione depletion , and oxidative stress , which is commonly measured by indirect indicators of ros , is not considered to take place early in toxicity . interestingly , recent advances in live oxidative stress monitoring in vivo have observed excess ros formation almost immediately after acetaminophen overdose . importantly , the molecular source and cell type of origin for the initial ros remains unclear . here we show that the cytosolic protein quinone reductase 2 ( nqo2 ) is a novel off - target for acetaminophen and many acetaminophen - like compounds . nqo2 , which is highly expressed in human liver and kidneys , mediates acetaminophen induced superoxide production in cultured cells . imatinib mesylate , nmeh ( 1-methyl-1,4-dihydronicotinamide ) and mntbap chloride were from santa cruz biotechnology . all other compounds , including acetaminophen ( meets usp testing specifications , 98.0101.0% ) and its analogues , were from sigma - aldrich unless stated otherwise . acetaminophen and its analogues were diluted in dmso , which alone served as a vehicle in all experiments , except when indicated otherwise . recombinant dt diaphorase ( nqo1 ) and nqo2 ( both human enzymes ) were from sigma - aldrich . for thermal shift assays involving apap analogues , a his6-tagged nqo2 ( human ) expressed in escherichia coli bl21(de3 ) was used . acetaminophen affinity column was prepared by coupling 5 mm 4-acetamidothiophenol ( sigma - aldrich ) to sulfolink coupling gel ( pierce ) in 10 mm tris - hcl , 5 mm edta , 25 mm tcep , ph 8.5 . one gram of mouse liver was homogenized in 10 ml of pbs containing 1% triton x-100 , 1 mm dtt , and 1 proteinase inhibitor cocktail ( sigma ) and batch purified using 1 ml of affinity matrix . eluted proteins were concentrated by trichloroacetic acid / acetone precipitation , separated on 412% sds page , and stained with colloidal coomassie followed by mass spectrometry identification . briefly , 5 m nqo1 or nqo2 , 5 sypro orange ( sigma - aldrich ) , and indicated chemicals were mixed in buffer ( 10 mm hepes , 150 mm nacl , ph 7.5 ) on ice with final sample volume of 50 l . dmso was used as solvent for all chemicals with final dmso concentration of 1% ( w / v ) . sample temperature was increased 1 c / min , and fluorescence ( ex = 470 nm ; em = 520 nm ) was measured using eppendorf mastercycler ep realplex thermal cycler . cell culture , counting , and fluorescence measurements were done essentially as in ref ( 21 ) . hela cells were cultured in high glucose dmem supplemented with 10% fbs ( sigma - aldrich ) , 1% l - glutamine , and 1% pen strep . cell counting and fluorescence measurements were done using an accuri c6 cytometer ( becton - dickinson ) so that only cells of viable size were included in the analysis . for measuring superoxide levels , mitosox red ( life technologies ) was added to 5 m final concentration for 30 min , after which cells were washed twice with pbs and analyzed with a flow cytometer . for measuring ca levels , fluo-3 ( sigma - aldrich ) was added to 5 m final concentration for 30 min followed by an additional 30 min with 1 mm probenecid ( sigma - aldrich ) , after which cells were collected and analyzed as with mitosox measurements . cell viability was assessed by counting cell number and measuring membrane integrity as descripted below for cetsa experiments . rnai was performed by reverse - transfecting with 40 nm sirna with hiperfect ( qiagen ) . nc1 negative control sirnas were from integrated dna technologies ( idt ) . for overexpressions human codon optimized nqo2 ( geneart ) was gateway cloned into pdest40 vector containing 3xv5 tag in c terminus . plasmids ( 3 g of plasmid per well on a 12-well plate ) were transfected with fugene hd ( promega ) . for western blots , antibodies were used at their recommended concentrations and detected using infrared - dye conjugated secondary antibodies and licor odyssey detection system . antibodies used were gapdh ( # 5174 ) from cell signaling technology , sod1 ( hpa001401 ) from sigma - aldrich , and nqo2 ( nbp1 - 31563 ) from novus biologicals . cetsa was performed as in ref ( 22 ) with minor modifications and with addition of a loading control . hela cells were trypsinized , washed with pbs , and suspended in pbs supplemented with protease inhibitor cocktail ( sigma - aldrich ) . the cell suspension ( 5000 cells/l ) was treated with compounds in dmso ( final concentration not exceeding 0.5% ( w / v ) ) for 1 h at 37 c with gentle mixing . each sample ( 70 l ) was then heated at the indicated temperature for 3 min using an eppendorf thermomixer with mixing ( 500 rpm ) and lysed with three freeze thaw cycles using dry ice and a 42 c water bath . cell lysates were centrifuged at 16000 g for 15 min at 4 c , and analyzed by western blotting . for quantitation , band intensities were normalized to the mean of the three lowest temperature bands , in which protein levels stayed constant , and then nqo2 bands were normalized to sod1 bands used as loading control . for analysis of cellular membrane integrity and cell viability , cells were heated as the cetsa samples , followed by 10 min incubation with 30 g / ml propidium iodide and analysis by flow cytometry . acetaminophen binding to nqo2 structure ( pdb : 1zx1 ) was modeled with dockingserver ( www.dockingserver.com ) using default parameters of the program . acetaminophen binding to the nqo2 active site was measured using electronic absorption spectroscopy essentially as described . briefly , 2 mg / ml his6-nqo2 was mixed with 0.5 mm acetaminophen or dmso in 25 mm hepes , 150 mm nacl , ph 7.5 , and absorption spectra were measured between 250 and 550 nm . the absorption spectrum of free fad ( 100 m ) with 5 mm acetaminophen or dmso was measured as a control . nqo1 and nqo2 inhibition was measured by mixing 50 l of 50 mm hepes - koh , ph 7.4 , with 0.01% tween20 , 0.18 mg / ml bsa , and 1 m fad containing 100 ng of recombinant nqo1 or nqo2 ( sigma - aldrich ) and mixing with 50 l of the same buffer with test compounds . reactions were initiated by adding 50 l of assay buffer containing 50 mm hepes - koh , ph 7.4 , with 0.01% tween20 , 0.18 mg / ml bsa , 1 m fad , and 500 m nadh ( for nqo1 ) or 500 m nmeh ( for nqo2 ) as cosubstrates as well as 600 m mtt and 300 m menadione . substrate assays were performed similarly to inhibition assays except omitting the menadione substrate . for kinetic assays acetaminophen and menadione were diluted directly into the reaction mix in order to omit dmso as dmso alone yields some background activity . absorbance was measured every 30 s after the reaction was started and background correction was made using a sample without nqo2 . human normal tissue blot ii was obtained from prosci incorporated ( poway , ca ) and stained with nqo2 antibody . nqo2 mrna expression levels are from illumina body map rna - seq data ( e - mtab-513 ) . correlation values for figure 1c were calculated using logarithmic two parameter nonlinear regression equation in sigmaplot . sigmoidal curves were fitted to cetsa and itdrfcesta data using sigmaplot . for kinetic analysis , ligand binding curves and confidence intervals were fitted and vmax , km , and regression correlation ( r ) were analyzed using sigmaplot and its enzyme kinetics application . statistical significances were evaluated by anova and two tailed t test with bonferroni correction ( n.s . = nonsignificant , * = p < 0.05 , * * = p < 0.01 , * * * = p < 0.001 in all figures and panels ) . page separation of protein eluates from thioacetaminophen ( + ) and control ( ) columns . ( c ) thermal shift assays of apap and amap with nqo2 and apap with nqo1 . ( d ) nqo2 thermal shift assay of acetaminophen regioisomers ( 2 mm ) , nitroacetanilide ( 2 mm ) , and nqo2 inhibitors quercetin ( 1 m ) and resveratrol ( 10 m ) . dicoumarol ( 10 m ) control for nqo1 is shown ( n = 34 in panels c and d ) . we investigated potential direct targets of acetaminophen by affinity purification from a mouse liver lysate . to simplify the coupling chemistry , we attached thioacetaminophen to sulforeactive affinity matrix via thioether bond as chemical properties of ethers and thioethers are very similar ( figure 1a ) . proteins were eluted with free acetaminophen . despite high background in control and thioacetaminophen columns , a protein of 25 kda mass spectrometry unambiguously identified this protein with 92% sequence coverage as quinone reductase 2 ( supporting information figure s1 ) , formally known as nad(p)h dehydrogenase , quinone 2 ( nqo2 ) , which is a cytoplasmic protein also known as quinone reductase 2 ( qr2 ) . nqo2/qr2 should not be confused with the mitochondrial nqo2 ( formally known as ndufv2 ) involved in oxidative phosphorylation . the binding of nqo2 to thioparacetamol column was confirmed by western blotting of the eluates ( figure 1b , bottom ) . relatively little is known about nqo2 , and the endogenous substrates of nqo2 have remained largely elusive , although dopamine has been suggested . nqo2 is known to be important in drug metabolism , and nqo2 has been associated with numerous disorders , including cancer and neurodegenerative diseases . exogenous substrates of nqo2 include menadione , and several inhibitors have been described , for example , quercetin , resveratrol , and imatinib / gleevec ( see supporting information figure s2 for structures ) . despite its name , nqo2 uses nonphosphorylated dihydronicotinamides and not nad(p)h as its cosubstrate and nqo2 substrate specificity is not limited to quinones . inverse pharmacological approaches have identified nqo2 as a binding partner for many interesting compounds such as resveratrol , chloroquine , and melatonin . to validate acetaminophen binding to nqo2 in vitro we performed thermal shift assays using recombinant nqo2 . acetaminophen and its regioisomer 3-acetaminophenol ( amap ) both stabilized nqo2 against thermal denaturation in a concentration dependent manner ( figure 1c ) . acetaminophen interaction was selective for nqo2 as no binding was observed with the closely related nqo1 ( dt - diaphorase , figure 1c ) , while a known inhibitor of nqo1 , dicoumarol , significantly stabilized this enzyme ( figure 1d ) . nqo2 inhibitors quercetin and resveratrol also caused substantial thermal stabilization of nqo2 ( figure 1d ) . analysis of all regioisomers of acetaminophen indicated that the hydroxyl group position is not critical for nqo2 binding ( figure 1d and supporting information table s1 ) . it is well - known that in vitro assays represent cellular binding poorly , as drug concentration and target engagement are dependent on adme properties ( absorption , distribution , metabolism , and excretion ) . to better reflect physiological binding conditions inside cells , we performed cellular thermal shift assays ( cetsa ) between acetaminophen and nqo2 in live hela cells ( figure 2a ) . we improved the original method by including superoxide dismutase 1 ( sod1 ) as a control protein . sod1 is a thermostable protein , and we did not observe any significant reduction in sod1 levels with cetsa treatment temperatures up to 80 c ( figure 2b ) . we also validated that none of the compounds in our assay affected sod1 levels ( figure 2c ) . to validate that the observed bindings take place inside intact cells although membrane integrity was lost in the highest temperatures used , in temperatures where nqo2 became destabilized membranes remained intact ( figure 2d ) . we conclude that the binding observed is taking place in intact cells and not just cell lysates . the interaction between drug and target protein increases the thermal stability of the protein , which can be measured by separating and quantifying nonaggregated levels of the target protein at different temperatures . sod1 levels did not change significantly when hela cells were treated as in cetsa ( left panel ) or itdrfcetsa ( right panel ) experiments . for the itdrfcetsa experiment the second highest concentration of each chemical was used , as samples reached maximal nqo2 intensity at this concentration . hela cells were treated as for cetsa , after which cells were treated with propidium iodide for 15 min before analyzing membrane integrity and cell count using flow cytometer . apap ( 10 mm ) , amap ( 10 mm ) , and quercetin ( 100 m ) were incubated with hela cells for 1 h. representative nqo2 western blots of each sample are shown . nqo2 levels were normalized to sod1 levels used as loading control ( not shown ) . note that the membrane integrity is not maintained at the highest temperatures ( panel d ) , but nqo2 binding is observed already before this , indicating binding in intact cells . ( f ) isothermal ( at 72 c ) dose response fingerprints in hela cells after 1 h exposure to apap , nitroacetanilide , resveratrol , and menadione . representative nqo2 western blots of each sample are shown . statistical significance between apap and nitroacetanilide with 0.5 mm concentration consistent with the in vitro thermal shift assays , treatment with acetaminophen , amap , and quercetin stabilized nqo2 in live hela cells ( figure 2e ) . to more quantitatively understand the nqo2 binding affinity in living cells , we performed isothermal dose response fingerprint analysis based cetsa ( itdrfcetsa ) . this assay indicated that the cellular binding affinity of acetaminophen was 500 times weaker than that of resveratrol and approximately 1 mm extracellular concentration is required to observe binding under our experimental conditions ( figure 2f ) . the binding pocket of nqo2 is hydrophobic , and known inhibitors of nqo2 have planar aromatic ring systems ( supporting information figure s2 ) , which bind adjacent to the isoalloxazine ring of flavin adenine mononucleotide ( fad ) and are coordinated by aromatic amino acid residues in the catalytic pocket.in silico docking to nqo2 suggested a similar mode of binding for acetaminophen ( figures 3a and 3b ) . to validate this prediction , we utilized electronic absorption spectroscopy , which has been used previously to assess nqo2 composition and drug binding . the absorption spectrum of nqo2 bound flavin ( absorbance in the 350500 nm range ) was affected by acetaminophen and its regioisomers ( figure 3c and supporting information figure s3 ) in a similar manner to that observed with imatinib binding at the active site . we observed no effect of acetaminophen on free fad ( figure 3c , bottom right ) . the spectroscopy data indicates that acetaminophen binds very close to fad in the active site . further supporting this , thermal shifts caused by quercetin and menadione , which both bind to the nqo2 active site , were not additive with acetaminophen ( figure 3d ) . these data suggest that acetaminophen binds nqo2 near the active site similarly to known inhibitors , substrates , and cosubstrates . to conclusively confirm the binding orientation of acetaminophen , cocrystallization of acetaminophen with nqo2 ( a ) in silico docking analysis of apap to nqo2 ( pdb : 1zx1 ) indicates binding at the active site adjacent to the isoalloxazine ring of flavin adenine mononucleotide ( fad ) . ( b ) suggested interacting amino acids in nqo2 based on in silico docking assays . ( c ) electronic absorption spectroscopy of nqo2 with 0.5 mm apap ( red ) and dmso ( blue ) . inset on right top corner shows difference spectrum , and inset on right bottom shows spectra with free fad . ( d ) nqo2 thermal shifts of apap ( 10 mm ) with known nqo2 active site binding molecules menadione ( 50 m ) and quercetin ( 1 m ) ( n = 4 ) . however , nqo2 activity was not affected by acetaminophen or amap ( up to 10 mm ) , whereas known inhibitors of nqo2 potently inhibited nqo2 activity in an in vitro enzyme assay ( figure 4a and supporting information figure s4a ) . similarly , acetaminophen displayed no inhibitory effect on nqo1 ( supporting information figure s4b ) . we next considered the possibility that acetaminophen might act as a substrate or cosubstrate . no activity was observed when the assay cosubstrate nmeh was replaced by acetaminophen , indicating that acetaminophen is not a cosubstrate ( supporting information figure s4c ) . instead , nqo2 could utilize acetaminophen and amap as weak substrates ( figure 4b ) . this activity was abrogated by quercetin ( figure 4b ) , and no substrate activity was seen with nqo1 ( supporting information figure s4d ) , indicating a nqo2-dependent reaction . kinetic substrate analysis validated acetaminophen acting as a weak nqo2 substrate with km = 417 10 m compared to km = 4.3 0.1 m for menadione ( figure 3c ) . as the weak substrate activity of acetaminophen could be potentially explained by synthesis byproducts and/or degradation products , we tested if simple quinones and hydroquinones might explain this activity . however , 4-benzonquinone and 4-hydroquinone displayed no such activity in the nqo2 assay ( supporting information figure s4e ) . acetaminophen seems to therefore function as a novel , albeit poor , nqo2 substrate , although it is not clear what nqo2 modifies acetaminophen to . nqo2 was incubated in the presence of compounds at the concentrations indicated and nqo2 activity measured with a colorimetric assay . substrate activities of menadione ( 25 m ) , apap ( 2.5 mm ) , amap ( 2.5 mm ) , and control ( dmso ) are shown . ( c ) kinetic analysis of nqo2 substrate activity with menadione ( left ) and acetaminophen ( right ) . red lines represent 95% confidence intervals of the fitted ligand binding curves ( black ) . nqo2 activity was measured with increasing substrate concentrations at fixed enzyme and cosubstrate ( 500 m nmeh ) concentrations . note that acetaminophen and menadione were dissolved in the assay buffer in order to omit dmso ( n = 3 in all panels ) . acetaminophen and amap were not obvious candidates for possible nqo2 substrates based on previously known substrate structures . we therefore extended our in vitro thermal shift and substrate assays by screening 22 compounds with structural similarity to acetaminophen ( supporting information figure s2 ) . nqo2 could bind and utilize many acetaminophen analogues as substrates ( supporting information table s1 ) , and there was a weak correlation between the binding and substrate assays ( figure 5a , supporting information table s1 ) . in contrast , nitroacetanilide had high binding affinity in vitro ( figure 1d ) , and it displayed stronger nqo2 binding than acetaminophen in itdrfcetsa ( figure 2e ) . acetaminophen - like compounds display wide range of nqo2 substrate activity in vitro and correlating superoxide production in cultured hela cells . ( a ) comparison of nqo2 thermal shifts and nqo2 substrate activities for acetaminophen analogues ( 2 mm ) . hela cells were treated with apap ( 5 mm ) for 2.5 h followed by 0.5 h treatment with superoxide scavenger , mntbap ( 200 m ) . hela cells were treated with apap ( 2 mm ) or napqi ( 20 m ) for 8 h. note that only a small fraction of apap is metabolized to napqi , and higher napqi concentrations are lethal to cells . hela cells were treated with p450 inhibitor disulfiram ( 2 m ) for 1 h followed by apap treatment ( 5 mm ) for 2 h. data normalized to controls without apap treatment for clarity . ( e ) comparison of nqo2 substrate activity and cellular superoxide production by acetaminophen and its analogues . for mitosox measurements hela cells were treated with 2 mm chemicals for 1 h. see supporting information figure s1 and table s1 for structures and data , respectively ( n = 3 in all panels ) . nqo2 has been shown to be capable of producing ros , and acetaminophen overdose causes extensive oxidative stress . most studies on acetaminophen induced ros are done in vivo and have therefore relied on indirect measurements of ros , like nitrosylation of tyrosine residues and lipid peroxidations , which are only observable after ros mediated damage accumulates . to measure if acetaminophen interaction with nqo2 could be involved in superoxide production , we used mitosox fluorescence probe , which can react with both intra- and extramitochondrial ros and is most sensitive toward superoxide . importantly , acetaminophen induced mitosox signal was fully reversed with the addition of superoxide scavenger mntbap ( figure 5b ) . we used hela cells as a cell culture model for nqo2 mediated ros production as hela cells express nqo2 and have relatively low baseline ros levels ( data not shown ) . furthermore , we did not observe superoxide production in hela cells after treatment with napqi , and acetaminophen induced superoxide levels were unaltered when p450 enzymes required for napqi formation were inhibited with disulfiram ( figures 5c and 5d ) , indicating that the ros formation by acetaminophen is largely separate from napqi mediated damage in this cell culture model . furthermore , to focus on direct effects of acetaminophen , we used dmso , which inhibits acetaminophen metabolism and napqi formation , as a solvent for acetaminophen . in summary , the hela cell model is thus ideal to confirm binding and to separate ros effects from napqi mediated toxic effects . acetaminophen and its analogues displayed large differences in superoxide production , and there was a positive correlation ( r = 0.499 ) between superoxide production in hela cells and nqo2 substrate activity in vitro ( figure 5e , supporting information table s1 ) . a notable exception was amap , which did not increase superoxide levels although it clearly binds nqo2 in cells ( see figure 2e ) . it has been suggested that reactive metabolites of amap and apap differ in their ability to diffuse across mitochondrial membranes and arylate mitochondrial matrix proteins . this data suggests that nqo2 may be involved in acetaminophen induced superoxide production , although other mechanisms must also exist to explain the difference between amap and apap . we next wanted to understand if there are biological consequences for the nqo2 interaction . as relatively little is known about nqo2 , we examined the nqo2 protein and mrna expression levels in a panel of normal human tissues . although nqo2 was present in all tested tissues , the levels were clearly highest in liver and kidney ( figure 6 ) , the main sites of acetaminophen toxicity . we also observed unreported nqo2 variants of approximately 35 kda in the skeletal muscle . however , these nqo2 variants may have been partially donor specific as a similar nqo2 pattern was not seen in an independent human skeletal muscle sample ( supporting information figure s5 ) . tissue western blot displays unknown nqo2 variants in skeletal muscle . for quantifications , the correlation between nqo2 substrate activity and superoxide production with the acetaminophen - like compounds suggested that nqo2 might be involved in acetaminophen mediated ros production . to examine this we inhibited nqo2 with quercetin , resveratrol , and imatinib . acetaminophen induced superoxide levels were significantly lower in the presence of all these inhibitors in hela cells ( figure 7a , left ) . although these nqo2 inhibitors have off - target effects and possible antioxidant effects , it seems more likely that these inhibitors reduce superoxide through their common target , nqo2 . to confirm this , we inhibited nqo2 with two independent sirnas and similarly observed partial reduction in superoxide production by acetaminophen ( figure 7b , middle ) . knock - down efficiency of nqo2 was approximately 50% , as measured by western blotting ( figure 7b , left ) , matching the reduction in superoxide levels . overexpression of nqo2 in hela cells resulted in a significant increase in superoxide production by acetaminophen ( figure 7c , middle ) , and this roughly correlated with the level of nqo2 overexpression ( figure 7c , left ) . ( a ) apap induced superoxide production ( left ) and intracellular ca levels ( right ) after chemical inhibition of nqo2 . hela cells were treated with control ( dmso ) , quercetin ( 10 m ) , resveratrol ( 10 m ) , or imatinib ( 20 m ) for 1 h followed by 4 h treatment with vehicle ( dmso ) , apap ( 5 mm ) , or amap ( 5 mm ) . hela cells were treated with control or nqo2 sirna for 48 h followed by 4 h treatment with vehicle ( dmso ) , apap ( 5 mm ) , or amap ( 5 mm ) . hela cells were transfected with empty vector or nqo2 , incubated for 36 h followed by 5 h treatment with vehicle ( dmso ) or apap ( 5 mm ) . in panels b and c representative western blots of nqo2 levels are on the left , superoxide levels in the middle , and intracellular ca levels on the right . data is normalized to each control for clarity ( n = 34 in all panels ) . changes in both cytosolic and mitochondrial ca levels are considered as one of the earliest signatures of acetaminophen hepatotoxicity . as ros levels may impact ca homeostasis , we measured if nqo2 has an effect on acetaminophen modulated ca homeostasis , as measured by the ca sensitive fluorescence probe fluo-3 . inhibition of nqo2 reduced the changes in ca levels caused by acetaminophen ( figures 7a and 7b , right ) . although hela cells can not be considered as a suitable model for acetaminophen toxicity , both genetic and chemical inhibition of nqo2 in hela cells resulted in a modest protection from high doses of acetaminophen ( supporting information figure s6 ) . altogether , this data indicates that nqo2 activity can modulate superoxide production and changes in ca levels induced by acetaminophen in hela cell culture . we have identified nqo2 as an off - target for acetaminophen with a role in superoxide production and modulation of ca levels in cultured hela cells . while we have comprehensively validated the binding of acetaminophen to nqo2 with several independent methods in vitro , in mouse liver lysate , and in cultured hela cells , all of the data indicates that this is a relatively weak interaction and the in vivo significance of this binding will require further studies . although in our experiments acetaminophen did not inhibit nqo2 in vitro , our results are consistent with previous findings that acetaminophen protects cells from menadione toxicity , possibly through nqo2 substrate competition . instead of nqo2 inhibition , we observed that acetaminophen acts as a weak nqo2 substrate . the substrate activity of acetaminophen was approximately 100-fold less than that of menadione , which is a highly active nqo2 substrate . the thermal shift assay similarly suggested that acetaminophen binding is > 100-fold weaker than that of menadione . menadione toxicity requires both nqo1 and nqo2 catalyzed metabolism , and in mice , the ld50 for menadione is 13 mg / kg , but this depends on the cosubstrate availability . for comparison , acetaminophen has an intraperitoneal ld50 500 mg / kg . thus , the difference in substrate activity is slightly higher than the difference in the in vivo toxicity , which may be because of assay conditions and due to the well - known routes of acetaminophen toxicity . whereas most nqo2 binding compounds are inhibitors of this enzyme , our observations suggesting that acetaminophen acts as a weak nqo2 substrate propose a new metabolic route for acetaminophen . although it is theoretically possible that nqo2 catalyzes a reaction between acetaminophen and napqi , whether and exactly how nqo2 is involved in acetaminophen metabolism in vivo remains unknown . interestingly , if nqo2 has a role in acetaminophen metabolism and toxicity in vivo , the presence of nqo2 cosubstrates may represent a source of variation in the individual responses to acetaminophen . although superoxide is a very reactive molecule as such , the cytotoxic effects of superoxide are attenuated through the action of superoxide dismutases and only excessive amounts overwhelming the capacity of the dismutases will result in oxidative damage . although the mitosox probe does not react exclusively with superoxide , the acetaminophen induced ros could be rescued with a superoxide scavenger , suggesting that acetaminophen produces mainly superoxide in our model . this superoxide production was also seen with many acetaminophen - like compounds that display nqo2 substrate activity in vitro , supporting the conclusion that nqo2 is a cellular source for acetaminophen induced ros . furthermore , our screen of acetaminophen - like compounds , some of which are also fragments of more specific drugs , provides a basis for structure activity studies to better understand nqo2 function . the low affinity binding between nqo2 and acetaminophen suggests that nqo2 does not play an active role in the therapeutic effects of acetaminophen . however , the pharmacokinetics of acetaminophen result in very high plasma concentrations , especially when compared to other known nqo2 targeting chemicals , like resveratrol . with itdrfcetsa we detect an interaction between acetaminophen and nqo2 with approximately 1 mm extracellular concentrations of the drug , which is in agreement with the in vitro substrate assay with a km value of 0.4 mm . acetaminophen plasma concentrations can reach up to 10 mm in overdose patients , and , at least in rodents , acetaminophen plasma and tissue concentrations are known to be essentially the same . we also observed that nqo2 is predominantly present in liver and kidney , the tissues where acetaminophen is known to cause toxicity . it seems therefore possible that nqo2 may have a role in acetaminophen induced superoxide production also in vivo . high levels of oxidant stress occur after most of the acetaminophen has been metabolized in vivo , napqi mediated damage and jnk kinase mediated amplification of ros being key events . interestingly , jnk activation is considered to require an initial ros stimulus , although the source of this stimulus in acetaminophen toxicity is unknown . in nqo2 knockout mouse we propose that acetaminophen may act in part through nqo2 in the initial phase of toxicity , where increases in ros and cytosolic ca levels concomitant with glutathione depletion are observed . if so , nqo2 mediated ros production would not necessarily be the main cause of toxicity but rather a damage augmenting mechanism . this theory does not contradict the current model of acetaminophen toxicity where inhibition of napqi formation protects from acetaminophen overdose , and n - acetyl cysteine , which is a nonspecific ros scavenger , reverses oxidative stress and toxicity . consistent with our observations , nqo2 inhibitors , resveratrol and quercetin , have also been shown to alleviate acetaminophen toxicity in mice . however , additional studies are required to fully validate nqo2 inhibition as the protective mechanism instead of antioxidant properties or inhibition of napqi formation . conclusive in vivo validation that nqo2 participates in ros production in early acetaminophen toxicity would require live monitoring of ros in nqo2 knockout animal model , which is beyond the scope of this work . altogether , our findings broaden the spectrum of known acetaminophen targets and suggest a potential new mechanism through which acetaminophen can mediate its biological effects .

the analgesic and antipyretic compound acetaminophen ( paracetamol ) is one of the most used drugs worldwide . acetaminophen overdose is also the most common cause for acute liver toxicity . here we show that acetaminophen and many structurally related compounds bind quinone reductase 2 ( nqo2 ) in vitro and in live cells , establishing nqo2 as a novel off - target . nqo2 modulates the levels of acetaminophen derived reactive oxygen species , more specifically superoxide anions , in cultured cells . in humans , nqo2 is highly expressed in liver and kidney , the main sites of acetaminophen toxicity . we suggest that nqo2 mediated superoxide production may function as a novel mechanism augmenting acetaminophen toxicity .

You are an expert at summarizing long articles. Proceed to summarize the following text: the l1 family of cell adhesion molecules ( the l1 family ) includes l1 , close homolog of l1 ( chl1 ) , ngcam - related cell adhesion molecule ( nrcam ) and neurofascin . these molecules regulate neuronal development and networking ( burden - gulley et al . , 1997 ; hortsch , 2000 ; katidou et al . , 2008 ) . defects in l1 family members are implicated in various neurological diseases including x - linked mental retardation , multiple sclerosis , low - iq syndrome , developmental delay , and schizophrenia ( kenwrick et al . , 2000 ; knock - out of l1 family members in mice led to guidance errors in corticospinal and retino - collicular axons , hippocampal ca3 mossy fibers , olfactory neurons , and retinal axons ( maness and schachner , 2007 ) . the mice also exhibited abnormal cerebellar development , dendritic misorientation defects , and behavioral deficits . l1 family proteins are type i membrane proteins with heavy glycosylation ; they contain an ectodomain ( 1,100 residues ) with six ig - like domains ( ig1-ig6 ) and five fibronectin - type iii domains ( fn1-fn5 ) , a single pass transmembrane region and a cytoplasmic domain ( 110 residues ) ( hortsch , 1996 ) . homophilic and heterophilic interactions of l1 on the cell surface mediate functions including axonal guidance , neural system development , and cell migration ( maness and schachner , 2007 ) . partners for heterophilic interactions include integrins , neurophilin-1 , tag-1 , and receptor tyrosine phosphatases that potentiate cell mobility and signal transduction ( maness and schachner , 2007 ) . the adhesive function of l1 induces cellular signaling processes involving activation of tyrosine protein kinases ( silletti et al . , 2004 ) . the short cytoplasmic tail binds to cytoskeletons including ankyrin and spectrin , thus mediating intracellular signal transduction ( bennett and baines , 2001 ) . when backcrossed with the c57bl/6 mouse strain , a mouse line lacking l1-l1 homophilic interactions due to the deletion of the sixth ig - like domain of l1 resulted in a severe hydrocephalus and became embryonic lethal after several generations ( itoh et al . , 2004 ) . in inflammatory conditions , homophilic interaction of l1 between dendritic cells ( dcs ) and the vascular endothelium mediates enhanced dc transmigration ( maddaluno et al . , 2009 ) . chl1 plays a pivotal role in neuronal positioning in the visual and somatosensory cortex by coordinating with 1-integrins ( schmid and maness , 2008 ) . homophilic interactions of neurofascin are critical for neurite induction ( pruss et al . , 2004 ) . l1 syndrome diseases include x - linked hydrocephalus as a result of stenosis of the aqueduct of sylvius ( hsas ) , mental retardation , aphasia , shuffling gait , and adducted thumbs ( masa ) syndrome , and x - linked spastic paraplegia ( wong et al . , 1995 ; hortsch , 2000 ) . the studies on the crystal structure of ig - like domain 1 - 4 in neurofascin suggested that many pathological l1 mutations affect conserved amino acid residues within these domains and interfere with homophilic interactions ( liu et al . , 2011 ) . sixteen mutations were found in the n - terminal horseshoe region that mediates homophilic interaction , indicating that disruption of the horseshoe was the likely cause of the diseases . some of these mutations have been investigated by others ( de angelis et al . , 2002 ) and the possible effect on horseshoe conformation discussed . these mutants usually affect adhesion - dependent cell signaling by reducing l1-protein 's adhesive abilities without altering their expression ( nagaraj et al . , 2009 ) . l1 mutations are also associated with fetal alcohol spectrum disorders ( fasd ) ( ramanathan et al . , 1996 ; kenwrick et al . , 2000 ) . a series of structural modeling and mutagenesis studies indicate the presence of an alcohol binding site in the domain interface of the l1 horseshoe region , whose perturbation by alcohol could disrupt homophilic interactions ( arevalo et al . , 2008 ; dou et al . , 2011 cell adhesion molecules such as integrins , cadherins , ig - like cams , and selectins are often aberrantly expressed in human cancers , and contribute to disease progression ( kwak et al . , 2011 ; witzel et al . , 2012 ) . various human tumors with poor prognosis for example , the invasive front of colon cancers expresses l1 ( gavert et al . , 2005 ) , and stable ectopic expression of l1 in fibroblastic cells induces the expression of metastasis - associated genes ( silletti et al . , 2004 ) . due to the wide expression of l1 in cancerous tissues and its cell surface localization , l1 is regarded as a useful target for the diagnosis of advanced cancers and a potential candidate for therapeutic intervention ( knogler et al . the crystal structures of l1 homologs , hemolin ( su et al . , 1998 ) , axonin-1 ( freigang et al . , 2000 ) , tag-1 ( mortl et al . , 2007 ) and dscam ( meijers et al . , 2007 ; sawaya et al . , 2008 ) suggest that the four n - terminal ig - like domains of l1 adopt a horseshoe - shaped conformation in which the first and second ig - like domains ( ig1 and ig2 ) fold back to interact with the fourth and third ig - like domains ( ig4 and ig3 ) . the arg - gly - asp ( rgd ) sequence in ig6 is essential for integrin interactions ( thelen et al . , 2002 ) . other evidence indicates a regulatory role of carbohydrates in l1-mediated homophilic adhesion ( acheson et al . , 1991 ; kleene et al . , 2001 ) . several models for l1 homophilic interactions have been proposed based on l1 homolog structures , including hemolin ( su et al . , 1998 ) , axonin-1 ( freigang et al . , 2000 ) , tag-1 ( mortl et al . , 2007 ) , and dscam ( meijers et al . the structure of neurofascin ( liu et al . , 2011 ) , the first l1 family structure to be defined , showed a novel homophilic interaction mechanism that could be compared with previous models . the cryo - electron tomograms of l1 bound to microsomes also elucidated the patterns of homophilic interaction under physiologically relevant conditions ( he et al . , 2009 ) . in this review , we focus on the recent discoveries in the structural mechanisms of l1 homophilic interactions and compare them to other l1 homologs . understanding the structural mechanism of l1 homophilic interactions may contribute to the development of therapeutic strategies for diseases mediated by defects in l1-related cellular functions . ig - like cell adhesion molecules ( ig - cam ) such as l1 and ncam are the most ancient and diverse family of cell adhesion proteins ( rougon and hobert 2003 ; aricescu and jones , 2007a ) . some of them have homophilic binding specificities , while others have heterophilic specificities , which allow them to interact with other ig - cams or other types of cams . ig - cam ectodomains have a modular structure , with ig - like domains located near the membrane - distal n - terminus and other types of domains such as fibronectin type iii ( fn domain ) connecting them to the membrane - spanning domain ( figure 1 ) ( williams et al . , 1989 ; shapiro et al . , 2007 ) the adhesive function of ig - cams is usually mediated by ig domains ( williams et al . , 1989 ) . in comparison to igs that use a defined structural mode for antigen recognition such as the complementarity - determining loops ( cdrs ) , ig - cams exhibit mechanistic diversity because of the highly diverse arrangements of domain modules . the l1 family of proteins includes mammalian l1 , chl1 , nrcam , and neurofascin ( hortsch , 2000 ; katidou et al . , 2008 ) . other homologs include the insect adhesion protein hemolin ( su et al . , 1998 ) , the glycosyl phosphatidylinositol ( gpi)-anchored neural cell adhesion molecule ( ncam ) axonin-1 ( chicken)/tag-1(mammalian ) ( furley et al . , 1990 ; zuellig et al . , 1992 ) , and the down syndrome protein dscam ( figure 1 ) ( schmucker et al . , 2000 ) . the ectodomain of the l1 family proteins has six ig - like domains and five fn domains , whereas l1 homolog ectodomains exhibit distinct domain structures . the ectodomain of hemolin has four ig - like domains , whereas the ectodomain of axonin-1/tag-1 has six ig - like domains and four fn domains ( figure 1 ) . different dscam isoforms share a common domain structure , with ten ig - like domains , six fn domains , a single transmembrane region , and a c - terminal cytoplasmic tail ( figure 1 ) . other ig - cams that exhibit homophilic interactions include cd2 , cadherin , ncams and others ( figure 1 ) . the t - cell surface protein cd2 ( selvaraj et al . , 1987 ) has two ig - like domains that bind to its homologs cd58 ( selvaraj et al . , 1987 ) and cd48 ( kato et al . , 1992 ) on opposing cells , forming pseudo - homophilic interactions . , 1992 ; bodian et al . , 1994 ) showed a head - to - head interaction between the gfcc'c " sheets of ig - like domains from two interacting molecules . cadherins mediate various cell - cell contacts via homophilic interaction between the same isotypes ( steinberg and mcnutt , 1999 ) . the crystal structure of a c - cadherin ectodomain containing five tandem cadherin domains showed homophilic interaction involving the first cadherin domain in trans ( boggon et al . , 2002 ) . in addition to the trans interaction , the cadherin structure exhibited a cis interaction between the first domain of first cardherin and the interface of the first and second domains of the second cadherin , creating a zipper - like structure ( boggon et al . , 2002 ) . ncam is one of the most extensively studied ig - like domain - containing cams and play vital roles in brain development and function . major types of ncams including ncam-120 , ncam-140 and ncam-180 contain five ig - like domains and two fn domains in their extracellular regions ( maness and schachner , 2007 ) . studies on various ncams suggest the zipper - like models ( walmod et al . , 2004 ) . necl molecules , which play a vital role during synapse assembly , contain three ig - like domains in their extracellular regions . the crystal structure of the n - terminal ig - like domain of necl-1 showed homophilic interactions with a zipper - type arrangement ( dong et al . , 2006 ) . type iib receptor - type protein tyrosine phosphatases ( rptps ) , such as rptp have ectodomains that mediate homophilic ( adhesive ) interactions and intracellular phosphatase domains that dephosphorylate target proteins ( tonks , 2006 ) . type iib rptps share a common architecture , in that their extracellular regions contain one meprin / a5/m ( mam ) domain , one ig - like domain and four fn domains . the structure of a full - length rptp ectodomain ( aricescu et al . , 2007b ) showed that the determinants required for homophilic interaction are the residues of mam , ig1 , fn1 and fn2 domains . homophilic interaction would generate a zipper - like structure via cis - interaction with adjacent molecules ( aricescu and jones , 2007a ) . the crystal structures of ig1 - 4 domains from l1 homologs indicated different modes of homophilic interactions ( su et al . hemolin , an innate immunity - related molecule in insects , contains four ig - like domains ( ig1 - 4 ) that share 38% sequence homology with l1 ig1 - 4 domains ( su et al . , 1998 ) . the crystal structure determination of hemolin ig1 - 4 domains revealed a unique domain arrangement among the ig - like domain - containing cell surface proteins . previously described ig - like domain proteins such as cd4 have a linearly - arranged domain structure ( wu et al . , 1997 ; boggon et al . , cd4 has four ig - like domains in a beads - on - a - string formation ( wu et al . , 1997 ) . in comparison , the ig1 - 4 domains of hemolin form a horseshoe structure where ig1 and ig2 fold back to interact with ig4 and ig3 , respectively ( figure 2 ) ( su et al . , 1998 ) . an extended linker between ig2 and ig3 creates a sharp bend of the ig1 - 2 domains toward the ig3 - 4 domains . the domain interactions between ig1 and ig4 , and between ig2 and ig3 comprise an array of hydrophobic interactions , and residues involved in these interactions are highly conserved in the l1 family . in the crystal of hemolin ( su et al . , 1998 ) , there were no crystal contacts to suggest the mechanism of its homophilic interactions . however , based on the structure and previously described homophilic interactions in ig - like domain - containing molecules such as cd2 and cadherin , su et al . , proposed a model ( figure 2 ) ( su et al . , 1998 ) in which , ig1 - 2 of hemolin move away from ig3 - 4 to form a domain - swapped horseshoe with the ig3'-4 ' of another hemolin molecule from an opposing membrane . the chicken ncam axonin-1 has six ig - like domains and four fn domains ( zuellig et al . , 1992 ; freigang et al . , 2000 the crystal structure of the ig1 - 4 domains of axonin-1 also showed a horseshoe shape , confirming the generality of the ig1 - 4 domain arrangement in hemolin ( figure 2b ) ( freigang et al . , 2000 ) . the inter - molecular interaction continues through the crystal lattice and forms a zipper - like structure . the crystal contact showed a significant burying surface , where the loop ce of ig3 protruded to interact with the central hole in the face of the next molecule , including residues of fg loop of ig2 ' . the c - termini of the dimer point in opposite directions so that facing membranes can be connected by the homophilic interaction . when residues involved in the dimeric interaction ( deletion of residues 187 - 190 and h186a / f189a ) are mutated , the myeloma cells expressing mutant axonin-1 can not aggregate , in comparison to normal axonin-1 expressing cells , which aggregate readily ( freigang et al . later , the ig1 - 4 structure of tag-1 , the human homolog of axonin-1 was determined ( mortl et al . , 2007 ) . although tag-1 has a horseshoe structure similar to that axonin-1 , the zipper - like dimer interaction of axonin-1 was not observed in the tag-1 crystal . instead , a two - fold symmetry - mediated dimer interaction is formed by side - to - side interactions between g strand of ig2 with g strand of ig2 ' , generating an intermolecular -sheet ( figure 2 ) . the buried surface created by dimeric interaction in the tag-1 crystal is 2240 , indicating that the interaction likely has a physiological relevance . in addition , the importance of fg loop in ig2 in myeloma cell aggregation was reported for axonin-1 , the chicken homolog of tag-1 ( freigang et al . , 2000 ) . because the same regions of two tag-1 monomers are used in the dimeric interaction , the interaction can not be extended to form a zipper - like structure as proposed in the case of axonin-1 ( figure 2 ) . the possibility of two different modes of dimeric interaction in these closely related molecules must be resolved by further structural and functional analysis . the drosophila protein dscam , which contains ten ig - like domains and six fn domains , mediates cell - cell interaction in brain cell networking ( schmucker et al . , 2000 ) . among the ten ig - like domains , ig2 , ig3 and ig7 have 12 , 47 and 33 alternative sequences , respectively , giving 18,048 potential derivatives ( schmucker et al . , 2000 ) . homophilic interactions occur only between the same isotypes ; interactions between different isotypes are rare , providing necessary specificity in brain cell networking . the crystal structure of ig1 - 4 domains from two different isotypes of dscam revealed their novel dimeric interactions ( meijers et al . , 2007 ) ( figure 2d ) . in comparison to the dimeric interactions of axonin-1 ( freigang et al . , 2000 ) and tag-1 ( mortl et al . , 2007 ) , where interaction occurred between side regions , the dimeric interaction in dscam involved the main surface of ig2 and ig3 . the ig2 surface interacts with the same surface of ig2 ' and the ig3 surface interacts with the same surface of ig3 ' . a two - fold symmetry axis mediates both interactions , and the c - termini are on opposite sides , such that the opposing membranes can be associated by dscam homophilic interaction . structural studies of dscam ig1 - 8 revealed the same dimeric interaction of the horseshoe region as that occurring in the the ig1 - 4 domain structures ( sawaya et al . , 2008 ) . in addition to the interactions mediated by ig2 and ig3 in the ig1 - 4 region , ig7 of dscam interacts with ig7 ' of the other monomer in a face - to - face interaction with the same two fold symmetry axis as that occurring in the ig2 and ig3 interactions ( sawaya et al . , 2008 ) . tight interactions of the three ig domains in dscam generate a double - s conformation ( figure 3 ) . the double - s conformation of dscam ig1 - 8 indicates the critical role of the domains outside the horseshoe region in the homophilic interactions of l1 homologs . because of the tight intermolecular interaction between two ig1 - 8 molecules , alteration in non - horseshoe domains can affect the orientation of inter - horseshoe regions and direct homophilic interactions mediated by non - horseshoe domains earlier experiments with recombinant l1 produced in escherichia coli indicated that ig2 was sufficient to induce trans - homophilic interaction and neurite elongation ( zhao et al . , 1998 ) . the bacteria - derived fn domain spontaneously formed trimeric and higher - order complexes , suggesting that fn domains were also necessary for l1 homophilic interactions in cis ( de angelis et al . , 1999 ) . later , domain - mapping experiments used eukaryotic cell - derived l1 constructs and found that the homophilic interactions involved more domains . the first four ig domains ( ig1 - 4 ) promoted homophilic cell adhesion and ig1 - 6 were necessary for optimal neurite outgrowth ( haspel et al . an insect cell expression system showed that a protein containing ig1 - 4 domains mediated the homophilic interaction , whereas ig2-fn5 or ig1 - 3 did not , indicating that ig2 was not sufficient for the homophilic interaction ( gouveia et al . co - immunoprecipitation studies of truncated forms of l1 and endogenous full - length l1 showed that the l1 ectodomain ( l1/ecd ) and l1/ig1 - 4 interact homophilically in trans ( gouveia et al . , 2008 ) . kinetic analysis by surface plasmon resonance showed that the kd of the whole ectodomain - whole ectodomain interaction was 116 2 nm , and the kd value of the whole ectodomain - ig1 - 4 interaction was 130 6 nm ( gouveia et al . , 2008 ) . thus , ig1 - 4 was the minimum portion of l1 to exhibit a similar homophilic interaction activity similar to that of full length l1 . consistent with this , insect cells stably expressing l1 adhered only to l1/ecd- and l1/ig1 - 4-coated surfaces or to hek293 cells overexpressing l1 on the cell surface . after the determination of the crystal structure of ig1 - 4 domains of insect hemolin ( su et al . , 1998 ) , su et al . , proposed two mechanisms to explain the homophilic interaction . the first mechanism is that ig1 - 4 domains exist in equilibrium between the extended and folded - back conformations and that the extended conformation mediates the homophilic interaction in trans . in this model , all ig domains interact with ig domains of the partner molecule in an antiparallel orientation ( i.e. ig1-ig4 ' , ig2-ig3 ' , ig3-ig2 ' , and ig4-ig1 ' ) ( figure 2a ) . the second mechanism suggests that the folded - back ( horseshoe ) conformation is the active form . in this model , the compact horseshoe structures of opposing l1 molecules do not open , but rather interact with each other . although there is no clear structural evidence to favor either model , experimental data seem to rule out the extended conformation model . deletion of ig1 or ig4 was sufficient to impair the homophilic interaction ( gouveia et al . , 2008 ) , supporting the latter mechanism because deletion of these domains disrupted the horseshoe structure , but not the antiparallel interaction between the linearized domains . ethanol inhibits cell - cell adhesion mediated by l1 in neuroblastoma - glioma hybrid cells , cerebella granule cells , and human l1-transfected murine fibroblasts ( charness et al . , 1994 ; ramanathan et al . , 1996 ; wilkemeyer and charness , 1998 ) , indicating that ethanol can disrupt homophilic interaction of l1 . indeed , mutations in the l1 gene produce neuropathological abnormalities similar to those found in fasd caused by prenatal ethanol exposure . these abnormalities include growth deficiency , mental retardation and facial malformations ( sampson et al . , 1997 ; hoyme et al . , the alcohol effect on l1 occurs for methanol through 1-butanol , but disappears for alcohols larger than 1-pentanol , indicating the presence of an alcohol binding pocket of a limited size in l1 ( ramanathan et al . , purified l1 ig1 - 4 protein was photo - labeled by photoactivatable analogs of alcohol , 3-azibutanol ( 1-butanol analog ) and 3-azioctanol ( 3-octanol analog ) ( arevalo et al . , 2008 ) . the photoactivatable analogs labeled tyr418 on ig4 and several n - terminal residues including glu33 and glu24-glu27 on ig1 . in a modeled structure of the l1 ig1 - 4 based on the horseshoe structure of axonin-1 ( freigang et al . , 2000 ) , the photo - labeled residues were found at the interface between ig1 and ig4 , indicating that the surface formed by these residues was likely the alcohol binding site ( arevalo et al . , 2008 ) . in the model , glu33 and tyr418 were located closely with the distance of 2.8 between them , indicating that the residues formed a strong hydrogen bond . the n - terminal regions including glu33 and glu24-glu27 could not be modeled because the axonin-1 structure did not contain the region . alcohol binding to the pocket in the domain interface of glu33 and tyr418 likely affected the conformation of the horseshoe structure of l1 , preventing of ideal interaction between the horseshoe regions . the proximity of glu33 and tyr418 and their role in homophilic interaction were tested by cysteine substitution mutations ( the e33c / y418c mutant ) ( dou et al . , 2011 ) . cells transfected with the cysteine mutant showed significantly increased l1 adhesion as compared to those transfected with the wild - type protein or single cysteine mutants . moreover , reducing conditions decreased the effect of the mutation , indicating that reversible disulfide bond formation between cysteines stabilized the horseshoe conformation and the resulting homophilic interaction . the inhibitory effect of ethanol on l1-mediated adhesion decreased in cells expressing the e33c / y418c mutant l1 . although the modeling studies and mutation analyses convincingly present the potential alcohol - binding site in l1 , the shape of the binding pocket and the interactions between alcohol and l1 need to be defined by experimental structure studies . the role of the n - terminal residues including glu33 and glu24-glu27 also has to be resolved . the horseshoe structures found in l1 homologs ( su et al . , 1998 ; freigang et al . , 2000 , 2007 ; sawaya et al . , 2008 ) suggest that l1 has a similar structure . however , the structures proposed different models for the homophilic interaction ; therefore , a physiologically relevant analysis was necessary . cryo - electron tomography of l1 addressed some of the questions surrounding the homophilic interaction mechanism ( he et al . , 2009 ) . tomographic reconstructions of the interfaces between l1-presenting liposomes showed regularly spaced globular densities appearing as dots in a row among the overall diffuse densities ( he et al . , 2009 ) . the approximate size of the dots with tomogram resolution of 4 - 5 nm was consistent with the size of dscam horseshoe pairs of 60 70 80 and 60 60 100 ( pdb files 2v5r and 2v5s ) , indicating that the dots represented the paired dimer of l1 horseshoes . the discrete arrangement of dots in the area of membrane interaction suggested that l1 homophilic interaction did not occur as proposed in the zipper model . the interacting horseshoes in the zipper model with indefinite repeats of horseshoe domains should appear as a continuous and solid line of density in tomograms . moreover , the domain - swapped multimerization model where domains 1 and 2 forms a horseshoe with domains 4 and 3 of the opposing membrane ( figure 2a ) , was not consistent with the l1 tomography observations . with the domain - swapped multimerization model , the tomograms should show a zig - zag pattern of individual horseshoe density . instead of the zipper or domain - swapped multimerization models , the discrete and regularly spaced dots fit the model of a dimer seen in the dscam ( meijers et al . , 2007 ; sawaya et al . , 2008 ) and tag-1 structures ( mortl et al . , 2007 ) . in dscam and tag-1 dimers ( figures 2c and 2d ) , one region of the first horseshoe interacts with the same region of the second horseshoe ( d2-d2 ' and d3-d3 ' in dscam ; d2-d2 ' in tag-1 ) through a two - fold symmetry axis . this dimeric interaction produces an isolated dimer , which is consistent with the discrete dots in l1 tomograms . although the domain - swapped multimerization model does not fit the tomographic observation , one - to - one domain - swapping may result in an isolated dimer ( figure 2a ) , which can not be ruled out as a possible model for the observed dots . l1 has twenty - one glycosylations consisting of four , five and twelve sites in the horseshoe , ig5 - 6 and fn domains , respectively . various studies have shown that l1 glycosylation affects its homophilic interaction ( acheson et al . , 1991 ; kleene et al . , 2001 ) . carbohydrate - protein or carbohydrate - carbohydrate interactions often regulate homophilic interaction of cell surface proteins ( bucior and burger , 2004 ) . furthermore , the l1 ectodomain binds to sialic acid , revealing that l1 functions as a sialic acid - binding lectin ( acheson et al . , 1991 ; kleene et al . in an experiment to analyze the role of carbohydrates in l1 , he et al . . , 2009 ) expressed l1 in mammalian and insect cells with attached complex n - linked and oligomannoside carbohydrates , respectively , on their membrane proteins . when the two types of l1 were reconstructed with liposomes , they produced similar dots between the two interacting liposomes ; however , the dots had different inter - dot distances : 100 for the mammalian cell - derived l1 and 140 for the insect cell - derived l1 ( figure 4 ) . thus , the regular spacing of dots in tomograms likely represents interactions with long chains of carbohydrates attached to l1 ectodomains . when the terminal sialic acids on mammalian cell - derived l1 were removed by sialidase or cell - growth in a medium containing kifunensine , the liposome interaction pattern changed ( he et al . , 2009 ) . these observations indicate that the carbohydrates on l1 play a pivotal role in determining the distances between horseshoe dimers , thus modulating homophilic interaction patterns ( figure 4 ) . the carbohydrate attachment sites of mammalian l1 are completely conserved , and there are no additional sites , further indicating the importance of carbohydrates in l1 function . however , the mechanism by which the flexible carbohydrate chain maintains the precise distance between the dots observed in the tomograms is of interest . it is unlikely that the carbohydrate alone can hold the interacting horseshoe regions in a regular fashion . the remaining domains ( ig5 - 6 and fn1 - 5 domains ) are also likely to mediate the homophilic interaction and regular inter - dot spacing . the role of carbohydrates in homophilic cell adhesion interactions was shown in ncam ( kadmon et al . , 1990 ; acheson et al . , 1991 ) and coxsackievirus and adenovirus receptors ( excoffon et al . , 2007 ) . the terminal sialic acids are also vital for ncam homophilic interactions ( fujimoto et al . , 2001 ; varki , 2007 ) as well as heterophilic interactions between l1 and cd24 ( kleene et al . , 2001 ) recently , the first structure of the l1 family proteins was determined for neurofascin ( liu et al . , 2011 ) . the ig1 - 4 domains of neurofascin were overexpressed and purified from an insect expression system . the purified neurofascin ig1 - 4 shows a 47 kda band on sds - page , as expected from the calculation of its theoretical molecular weight . however , in a gel filtration experiment , the protein produced a peak at 100 kda position , which was twice the monomeric size , indicating that neurofascin ig1 - 4 forms a dimer in solution . the neurofascin ig1 - 4 ( liu et al . , 2011 ) has a horseshoe structure as that of l1 homologs ( su et al . , 1998 ; freigang et al . , 2000 the ig1:ig4 and ig2:ig3 interdomain interactions involve large surfaces with hydrophobic patches , indicating that the horseshoe structure of neurofascin ig1 - 4 is likely stable . the residues involved in the domain interactions of neurofascin ig1 - 4 are conserved in other members of the l1 family ( liu et al . , 2011 ) . consistent with the dimer formation in solution , the two different crystal lattices of neurofascin ig1 - 4 contain a common neurofascin ig1 - 4 dimer with extensive monomer - monomer contacts ( liu et al . , 2011 ) . the neurofascin ig1 - 4 dimer formation is mediated by the side of ig2 domain , resulting in the formation of a supramolecular -sheet with a two - fold symmetry ( figure 5a ) . when mutations were introduced in the residues involved in the dimeric interaction , most mutant proteins showed a shift in gel filtration peak positions towards the monomeric molecular weight . among the mutations , the substitution of thr 222 to ala ( t222a ) showed a clear movement of the peak . thr 222 of one monomer forms a hydrogen bond with gln 224 of the other monomer at the center of the supramolecular -sheet , and the mutation result indicates its importance in the dimeric interaction . suparmolecular -sheet formation of neurofascin ig1 - 4 is similar to the dimeric interaction in tag-1 ( figure 5b ) ( mortl et al . , 2007 ) . the two - fold symmetry - related dimeric interaction between the side regions of neurofascin ig2 produced an isolated dimer , consistent with the discrete inter - membrane dots observed in l1 tomograms ( he et al . although the dscam horseshoe dimeric interaction ( meijers et al . , 2007 ; sawaya et al . , 2008 ) also generates an isolated dimer without further continuation of the interaction , the dscam interaction occurs throughout the domain face ; this differs from the edge interaction observed in neurofascin ig1 - 4 . because both neurofascin ig1 - 4 and tag-1 horseshoes exhibit the same suparmolecular -sheet formation , this mode of interaction may represent homophilic interaction of l1 family molecules and their homologs . the neurofascin ig1 - 4 structure was used to map pathological mutations in neurological disorders such as hsas , masa syndrome , and x - linked spastic paraplegia ( wong et al . , 1995 ; most mutations were found in the domain interfaces ( l120v , g121s , g370r , r184q / w , and y194c ) of the horseshoe formation or in the hydrophobic core of individual domains ( i179s , h210q , p240l , c264y , g268d , p333r , w335r , and l391p ) , confirming the importance of the horseshoe structure in l1 function . in contrast , one mutation ( i219 t ) corresponding to ile213 in neurofascin ig1 - 4 produced a neurite branching defect and was located in the hydrophobic cluster that mediates dimeric interaction in neurofascin ig1 - 4 crystals , supporting the model of homophilic interaction proposed by the crystal structures . although the neurofascin ig1 - 4 structure is useful for explaining pathological mutations in the horseshoe region , it does not provide information on other domains , including ig5 - 6 and fn domains ( fn1 - 5 ) where various disease - inducing mutations occur ( de angelis et al . , 2002 ) . the lack of homophilic interaction of l1 in a mouse line carrying a deletion of the ig5 domain ( itoh et al . , 2004 ) also indicates that involvement of domains other than the horseshoe region can affect the homophilic interaction of l1 family proteins . mutations in non - horseshoe regions may change the structure of the horseshoe region or direct intermolecular interactions . structural analysis and carefully designed mutational and functional studies of molecules containing domains outside the horseshoe region are required to answer this question . homophilic interactions between l1 family proteins are essential for neural system development and brain cell wiring . because homophilic interaction - mediated signal transduction activates cell growth signaling , it is believed that cancer progression also involves the homophilic interaction of l1 . various models for homophilic interaction have been proposed for cell adhesion proteins ( figure 2 ) , including zipper , domain - swapped monomer , domain - swapped multimer , two - fold symmetry related surface interaction and two - fold symmetry related edge interaction models based on the structures of axonin-1 , hemolin , dscam and tag-1/neurofascin , respectively . the two - fold symmetry - related surface or edge interaction and domain - swapped monomer models are consistent with the discrete and equally spaced dots observed in cryo - electron tomograms of l1 . interestingly , dimeric interaction via the edge of ig2 domain was observed in tag-1 and neurofascin , suggesting that the symmetry - related edge model may represent the homophilic interaction mechanism of l1 and its homologs . current understanding of homophilic interaction in l1 family molecules is based mainly on the crystal structures of the first four ig - like domains of a horseshoe structure . however , for a complete understanding of homophilic interactions , structural determination of l1 including other ig - like and fn domains is necessary . such studies may reveal novel supra - structures such as the double - s conformation observed in the dscam ig1 - 8 dimer .

homophilic interaction of the l1 family of cell adhesion molecules plays a pivotal role in regulating neurite outgrowth and neural cell networking in vivo . functional defects in l1 family members are associated with neurological disorders such as x - linked mental retardation , multiple sclerosis , low - iq syndrome , developmental delay , and schizophrenia . various human tumors with poor prognosis also implicate the role of l1 , a representative member of the l1 family of cell adhesion molecules , and ectopic expression of l1 in fibroblastic cells induces metastasis - associated gene expression . previous studies on l1 homologs indicated that four n - terminal immunoglobulin - like domains form a horseshoe - like structure that mediates homophilic interactions . various models including the zipper , domain - swap , and symmetry - related models are proposed to be involved in structural mechanism of homophilic interaction of the l1 family members . recently , cryo - electron tomography of l1 and crystal structure studies of neurofascin , an l1 family protein , have been performed . this review focuses on recent discoveries of different models and describes the possible structural mechanisms of homophilic interactions of l1 family members . understanding structural mechanisms of homophilic interactions in various cell adhesion proteins should aid the development of therapeutic strategies for l1 family cell adhesion molecule - associated diseases .

You are an expert at summarizing long articles. Proceed to summarize the following text: due to its tragic and unexpected nature , sudden cardiac death ( scd ) in athletes has been brought to public attention in recent decades . the incidence of scd has been reported to be approximately 1 - 2 per 100,000 person - years , with a 2.5 times higher risk in athletes when compared with nonathletes . different studies have reported various cardiac diseases as the most common cause . in studies done in the united states , hypertrophic cardiomyopathy ( hcm ) was the most common cause , followed by congenital coronary artery anomalies ( cca ) , myocarditis , and arrhythmogenic right ventricular cardiomyopathy ( arvc ) ; ion channelopathies such as long qt and brugada syndrome were also identified . scd can also be induced by a traumatic blow to the chest ( commotio cordis ) . also , the incidence of scd is known to be greater in males than females [ 14 ] . soccer is the most popular sport in the world , played by men , women , and children of all ages . unfortunately , soccer has been plagued in recent years by deaths at the professional level during internationally televised games . this paper aims to review the physiology of soccer , the relationship between scd in soccer and other sports , the commonest causes of scd in young athletes , and the current screening guidelines in place by the fdration internationale de football association ( fifa ) for soccer . searching primarily the pubmed database , a search of american and international articles available in english was performed . there was no definite time period set due to the limited studies on scd and sport , but keywords were used to find peer - reviewed articles and case studies on the current reporting of soccer and scd . keywords used in the search were soccer , soccer cardiac , soccer and sudden cardiac death , and athlete sudden cardiac death . authors in the selected studies defined scd as cardiac arrest during or within 112 hours of competition [ 14 , 617 ] . a young competitive athlete was defined as an individual < 35 years old who participated in 2 h a week of physical training or participated in organized team or individual sports that required regular competition against others as a central component , placed a high premium on excellence and achievement , and required systematic and , in most instances , vigorous training [ 2 , 18 ] . while some studies included subjects over the age of 35 , the results focused on subjects from those studies under the age of 35 . this paper aimed to highlight the reported causes of scd in young competitive soccer players , as well as the most common causes of scd in young competitive athletes overall . the game of soccer relies on aspects of psychological , physiological , and biomechanical / technical skill . players at the highest levels of competition master all of these components , but players of all levels excel at certain skills over others . however , in recent years there has been a trend towards selecting players with more favorable anthropometric profiles to compete at the highest level . studies conducted by filming soccer players found that distances covered at the top level during a 90-minute game are about 1012 km for players on the field and 4 km for the goalkeeper . during a soccer match , sprinting occurs approximately every 90 seconds and lasts 24 seconds [ 20 , 21 ] . the game is dynamic considering that in addition to running , there is also twisting of the torso to change direction , heading , tackling , and holding the ball against defensive pressure . energy production while playing soccer is mainly dependent on aerobic metabolism ; however , the work intensity can approach the anaerobic threshold , which is defined as the highest exercise intensity where the production and removal of lactate are equal ( usually at 8090% of maximum heart rate ) . table 1 lists the cardiovascular diseases that have been reported in scd while playing soccer and other sports . the listed results focused on athletes under the age of 35 , since it is known that athletes over 35 experienced scd most commonly due to atherosclerotic cad [ 1 , 2 , 4 ] . several of the studies in table 1 report soccer as the most common sport associated with scd [ 1 , 3 , 4 , 6 ] . however , it is only the study done by corrado in the veneto region of italy that reported that the incidence of scd associated with soccer was not statistically significant when compared with other sports , nor was any sport associated with a specific form of fatal disease . in a study done on scd in spain , the subjects under 30 were not found to have any predominant cause of scd associated with soccer . in another worldwide study where soccer was found to be the most common sport associated with scd , the authors concluded that this was simply due to this sport being played more than others in regions from which the studies were reported and that in fact it was most likely the sports with high cardiovascular demand and isotonic work that put athletes at greatest risk for scd . on june 26 , 2003 , an internationally televised semifinal match was played for the fifa confederations cup between columbia and cameroon at stade de gerland in lyon , france . during the 72nd minute of the match , marc vivien fo , a 28 year - old veteran midfielder of the cameroon national soccer team collapsed on the center circle [ 23 , 24 ] . attempts to revive him with cpr were started on the field , and after 45 minutes of resuscitation efforts , he died shortly after arriving to the stadium 's medical center . on autopsy hcm is known to be the most common cause of scd in young athletes in the united states . it has a prevalence of 1 in 500 in several countries including usa , europe , japan , china , and east africa . the pathophysiology lies in autosomal dominant mutations in 11 or more genes encoding thick and thin contractile myofilament protein components of the sarcomere or the adjacent z - disc . suspicion for this diagnosis is suggested by cardiac symptoms , with the findings of a murmur or abnormal electrocardiogram . abnormal ecg patterns are present in the majority of hcm patients ( 7595% ) ; these findings include markedly increased r- or s - wave voltages , deep and prolonged q - waves , and deeply inverted t - waves . imaging findings show an absolute increase in the left ventricular wall thickness ( to 21 - 22 mm on average ) , which can also be associated with mild right ventricular hypertrophy . athletes who are suspected to have low - risk hcm can participate in leisurely sports with yearly followup ; qualifying criteria includes no scd in relatives , no symptoms , no lvh or ventricular arrhythmias , and normal diastolic filling / relaxation . athletes confirmed to have hcm with any of the aforementioned characteristics are to be restricted from competitive sports as it is believed that high - intensity sports predispose to subendocardial ischemia that leads to ventricular arrhythmias . a study by corrado showed that cca were associated with the highest risk of scd in young competitive athletes , and various studies have reported that cca are the second most common cause of scd in athletes under 35 , associated with 1525% of cases [ 1 , 2 , 4 , 2931 ] . table 1 lists case studies of scd in soccer that have been found to be due to cca on autopsy . studies have shown that the most common malformation reported in scd series both in the young and in the athlete is the origin of a coronary artery from a wrong aortic sinus of valsalva , either the right from the left coronary sinus or the left from the right coronary sinus , with a proximal course between the aorta and the pulmonary trunk . the diagnosis is most commonly confirmed by transthoracic echocardiography in children and is supplemented by mri and ct angiography . timely diagnosis of cca is critical because ( 1 ) athletes must be restricted from competitive activity to prevent scd and ( 2 ) cca are surgically correctable . on august 25 , 2007 , a soccer game between la liga spanish teams sevilla and , 22-year - old sevilla defender antonio puerta crouched next to the penalty box , then collapsed . he was substituted and managed to walk off the field , when he reached the locker room he collapsed again , and was pronounced dead at virgen del roco university hospital ; his autopsy revealed arvc . in the veneto region of italy , arvc is the cardiovascular disease that conveys the second highest risk of sports related sudden death , and in spain it was found to be a predominant pathology associated with scd in athletes < 30 years old [ 1 , 8 ] . it is currently estimated that disease prevalence is between 1 in 2000 and 1 in 5000 . arvc is characterized by structural and functional abnormalities of the right ventricle , ranging from regional wall motion abnormalities and ventricular aneurysms to global ventricular dilation and dysfunction ; it may also involve the left ventricle . symptoms of arvc include palpitations , syncope , cardiac arrest , or scd in adolescents or young individuals . the presence of t - wave inversions in v1-v3 or premature ventricular complexes ( pvcs ) of lbbb morphology on 12 lead ecg are the clues noted during cardiovascular screening . however , less commonly patients may present with what appears to be congestive heart failure ( chf ) due to dcm . patients with arvc should not under any circumstance be allowed to participate in competitive sports in order to prevent scd [ 28 , 36 ] . dundela f.c . is a northern irish intermediate - level professional soccer team . on august 25 , 1995 , the team 's captain michael goddard was struck on the chest by a ball and collapsed ; he was found to be in cardiac arrest and died shortly afterwards . commotio cordis is defined as when blunt trauma to the chest leads to ventricular fibrillation and therefore cardiac arrest ( most commonly during the t - wave upstroke on ecg , causing a pvc , which leads to ventricular fibrillation ) . due to a rise in reported incidents , a study recently done by maron compared the international cases of commotio cordis with those inside the us . the results of this study showed that in both groups commotio cordis occurred among young males and that resuscitation and defibrillation rates did not differ between us and non - us subjects . although a difference was found in the sports involved : in the us the sports most commonly involved were baseball / softball and american football , in non - us subjects the most common sport was soccer , followed by cricket and hockey . a notable finding in the international subjects was that in seven of the cases involving soccer , a traumatic blow caused by a soccer ball to the chest led to commotio cordis . this finding contradicts the previous notion that air - filled projectiles conveyed a lesser risk than those with a solid core ( baseballs , lacrosse balls ) . however , this study is limited by the fact that the data is predicated on incidents reported to the commotio registry and may not represent all cases of commotio cordis worldwide . in the aforementioned studies reviewing scd and sport , there has always been a percentage of the sample in which the cause of scd could not be determined by autopsy . however , the reports have been largely variable , ranging anywhere from 1% to 16.3% [ 1 , 2 , 4 , 7 , 8 ] . a study in the uk reported soccer as the most common sport associated with scd in ages 1135 , but the autopsies of athletes from all sports had a morphologically normal heart in 23% of cases . studies done in the us and uk with the families of an individual who experienced scd found that in 4050% of families studied , relatives had an ion channel disorder such as catecholaminergic polymorphic ventricular tachycardia , long qt syndrome , and brugada syndrome [ 39 , 40 ] . in soccer , like all other sports , doping has become a relevant issue , as evidenced in the 1994 world cup when the argentinian superstar diego maradona was expelled from the tournament after testing positive for several banned substances . however , the studies that have been mentioned either excluded toxicological confounders as a cause for scd , or had such a small percentage of cases that they were not addressed [ 1 , 2 , 68 ] . androgen abuse has been shown to have the direct effects of cardiac hypertrophy and myocardial fibrosis , and indirect effects of hypertension , dyslipidemia , arrhythmia , and myocardial infarction . one study reviewing the autopsy findings of four body builders who experienced scd found cardiac hypertrophy and fibrosis in the myocytes of these subjects . other medications that may play a role in soccer players ' scd include but are not limited to nsaids , antihistamines , and herbal supplements . of note , cox-2-selective nsaids prescribed for musculoskeletal and arthritic complaints have been shown to have an increased risk of adverse cardiac events . furthermore , some second - generation antihistamines such as terfenadine and astemizole have been shown to reach high serum levels through drug and food interactions thereby predisposing to qt prolongation and ventricular arrhythmias . the studies reviewed above show that in italy and much of the rest of the world , the sport in which scd occurs most often is soccer [ 1 , 6 ] . however , in the united states , the sports most commonly associated with scd are basketball and american football . therefore , it is reasonable to conclude that the regional difference in scd and sport are likely due to the most common sport being played and that it is the increased cardiovascular demand that predisposes to scd rather than the sport itself . this study is limited in that most of the studies reviewed do not report whether there is in fact a correlation between soccer and a form of scd . however , the one study that did assess this variable was the study done in the veneto region of italy , which found no statistical significance between the incidence of scd in soccer when compared with other sports , nor did it find a relationship between soccer and an underlying cause of scd . also , while the sample was considerably smaller , the study of scd in spain also did not find a predominant cause of scd associated with soccer . the most common cardiac abnormality implicated in scd in young athletes < 35 years old in the united states is hcm , followed by cca and ion channelopathies , while in italy the most common causes of scd in young athletes were cca , arvc , and premature coronary artery disease . a study of scd in spain showed arvc to be the most common cause ; however , in the uk isolated lvh ( confirmed by microscopy to not have myocyte disarray ) was most common , followed by arvc [ 6 , 8 ] . these results show that there may be a greater prevalence of arvc in european nations compared to the united states . it is worth mentioning that preparticipation screening with ecgs in italy is suspected to be the reason why there is a decreased incidence of scd due to increased identification and management of hcm . reviewed studies around the world and also found cca and hcm to be the most common causes of scd but suggested that these pathologies may be the most common because they are the easiest to identify , and that more occult etiologies such as arrhythmias and arvc may be underrepresented . as noted previously , in each of the studies discussed there was a percentage of the sample in which no cause was found [ 1 , 2 , 4 , 68 ] . moreover , given the high prevalence of ion channel disorders found in family members of individuals who experienced scd , more research is needed on the efficacy of screening the relatives of these individuals and prevention of scd [ 39 , 40 ] . while most studies excluded positive toxicological findings , the cardiac effects of steroids and other medications may predispose to scd [ 4345 ] . since soccer players stereotypically have a slender build for speed and agility , steroid use may seem counterintuitive , but some players have tested positive [ 41 , 46 ] . fifa which is the worldwide governing body of soccer , has taken a staunch stance against doping and in 2001 suspended legendary dutch players edgar davids and frank de boer after testing positive for the anabolic steroid nandrolone . in evaluating these studies , sampling bias is an issue considering that the research on scd is based on autopsy results from reported cases , and there is the possibility that cases may go unreported . there is a need for a mandatory reporting database of these incidents in the united states and other countries . until there is better reporting of these incidents , the true incidence and etiology of scd in soccer and other sports will remain unknown . the current guidelines for preparticipation screening have not reached a consensus ; in 2004 and 2005 the european society of cardiology and international olympic committee published notably similar guidelines , which contrasted the american guidelines [ 4 , 28 ] . the main difference was the addition of a 12-lead ecg to the history and physical examination . this decision had been based on the study done by corrado that showed a significantly decreased incidence of scd due to hcm in the italian population . however , the low specificity of ecg as a screening tool in an athletic population is a major disadvantage for its use [ 4749 ] . in 2005 , fifa took action to prevent scd in soccer . prior to the 2006 world cup in germany , the fifa medical assessment and research centre developed and implemented a comprehensive precompetition medical assessment tailored specifically to this population . the cardiovascular screening included a personal and family history , physical examination , a 12-lead resting ecg , as well as an exercise ecg and an echocardiogram . the results showed that cardiovascular preparticipation screening in international elite soccer teams seemed appropriate and that while ecg and echocardiography with further standardization could be useful , exercise stress testing remained questionable . moreover , it was previously believed that preparticipation screening distressed soccer players due to the fear of being removed from competition . however , a study done with norwegian professional soccer players found that the players felt more confident after screening and would recommend it to other players . future studies on scd in soccer and other sports involves more detailed reporting of scd by cause and associated sport . there was a case by zeller et al . in table 1 of scd in a 26-year - old soccer player whose only suggestive finding was marked early repolarization on ecg . furthermore , a recent study by lengyel reported a statistically significant qt prolongation at rest in professional soccer players when compared to aged matched controls . future studies need to be directed towards identifying further cardiac risk factors that may lead to scd in soccer players . after the death of marc vivien foe in 2003 , fifa reacted by making it mandatory to equip all stadiums with automated external defibrillators ( aeds ) as well as to have available medical and paramedical personnel who are able to manage emergencies such as cardiac arrest . a remarkable result of these initiatives can be attributed to the case the 24-year - old fabrice muamba , who on march 17 , 2012 , collapsed on the field during an internationally televised game between bolton and tottenham of the english premier league . resuscitation began on the field and muamba is reported to have been in cardiac arrest for 78 minutes and to have received a total of 15 defibrillator shocks . while he has now retired from soccer , muamba has made a full recovery with no neurological deficits , a medical miracle likely related to the onsite aed and well trained personel rapidly responding to this emergency . because soccer is the most commonly played sport worldwide , more of those considered at risk experienced an episode of scd while playing the sport . several studies reported that soccer was the most common sport associated with scd , and that the causes of scd were similar for soccer as among sporting activities in general ( hcm , cca , and arvc ) . therefore , we conclude that preparticipation screening in soccer players should focus some effort on screening for those structural and/or electrical abnormalities associated with these conditions . given the popularity of the sport worldwide and recent deaths of soccer players on the field , further research on this topic is encouraged .

sudden cardiac death ( scd ) in young competitive athletes ( < 35 years old ) is a tragic event that has been brought to public attention in the past few decades . the incidence of scd is reported to be 1 - 2/100,000 per year , with athletes at a 2.5 times higher risk . soccer is the most popular sport in the world , played by people of all ages . however , unfortunately it is cardiovascular diseases such as hypertrophic cardiomyopathy and arrhythmogenic right ventricular cardiomyopathy that have subtly missed screening and claimed the lives of soccer stars such as marc vivien foe and antonio puerta during live action on the field and on an internationally televised stage . this paper covers the physiological demands of soccer and the relationship between soccer and scd . it also reviews the most common causes of scd in young athletes , discusses the current guidelines in place by the fdration internationale de football association ( fifa ) for screening among professional soccer players , and the precautions that have been put in place to prevent scd on the field in professional soccer .

You are an expert at summarizing long articles. Proceed to summarize the following text: ulcerative colitis ( uc ) is a chronic nonspecific inflammatory disease of the colon with unknown etiology . pathological colonic lesions are usually limited to the mucosal and submucosal areas , while diarrhea , pusmucus bloody stool , and abdominal pain are common clinical symptoms . more attention is being focused on this disease because its morbidity has increased in recent years in china , where uc was once an uncommon gastrointestinal disorder . previous studies on the pathogenesis of uc have shown that colonic mucosal inflammation and ulceration are closely related to the excessive degradation of extracellular matrix ( ecm ) by matrix metalloproteinases ( mmps ) , which are overexpressed and activated to cause colonic mucosal injury and inflammation . mmps are a group of zinc - dependent proteases that are produced and secreted by connective tissue cells , endothelial cells , mono - macrophages , and other cells . their activity can be inhibited by their natural inhibitors tissue inhibitor of metalloproteinases ( timps ) . timps are a group of secretive glycoproteins that have the capacity to inhibit mmp activity , thereby attenuating ecm degradation . timps also participate in tissue structural modeling and maintenance , and indirectly influence ecm - dependent signal transduction . four subtypes of timps have been identified in mammals : timp-1 , timp-2 , timp-3 , and timp-4 . timp-1 is a soluble glycoprotein with a molecular weight of 29 kd that inhibits primarily mmp-1 , mmp-3 , and mmp-9 . animal and clinical studies have revealed the overexpression of various mmps and timps in the inflammatory areas of colonic mucosa in uc ; mmps expression tend to be particularly high . it is believed that increased ratio of mmp / timp is one of the mechanisms in the pathogenesis of uc [ 24 ] . mmp-1 and timp-1 are thought to be more closely associated with uc than other mmps and timps ; studies [ 2 , 57 ] have reported that their expression in patients with uc is significantly higher than in normal control subjects . in particular , mmp-1 overexpression has been correlated with mucosal inflammation and the initial steps of ulceration . furthermore , mmp-1 and timp-1 levels in the peripheral blood were also found to be elevated in patients with uc in studies by wiercinska - drapalo and holten - andersen . however , the correlation between plasma levels of these proteins and their mucosal expression or with uc disease severity is not clear . in this study , we examined mmp-1 and timp-1 expression both in the colonic mucosa and plasma to study their relationship and association with disease severity in patients with uc . thirty patients ( male , n = 14 ; female , n = 16 ; mean age , 46 years ; age range , 2373 years ) with uc diagnosed by clinical symptoms , endoscopy , and pathology findings were enrolled in the study . of the 30 patients , 4 patients had pan - colon lesions , 2 had semicolon lesions , 17 had rectosigmoid lesions , and 7 had rectal lesions . patients were divided into groups based on the diagnostic criteria of uc severity : 12 patients were classified as mild ( m group ) and 18 classified as moderate - to - severe ( mts group ) . meanwhile , 15 normal subjects were recruited as normal controls ( male , n = 6 ; female , n = 9 ; mean age , 41 years ; age range , 2263 years ) . biopsy samples from mucosal lesions of uc patients and normal mucosa of the normal control subjects were divided into two parts . one part was immediately snap frozen in liquid nitrogen and stored at 80c for reverse transcription- ( rt- ) pcr , and another part was fixed in formalin , embedded in paraffin , and cut into 4 m thick sections for immunohistochemistry . the supernatant was collected after spinning at 1000 g for 30 minutes , and then at 10 000 g for 10 minutes at 2c to 8c to remove blood platelets . total rna was extracted from the frozen samples using an rna isolation kit ( invitrogen , calif , usa ) following the manufacturer 's instructions . rt - pcr was performed using the takara rna pcr kit 3.0 ( amv ; dalian baosheng biotechnology company ) following the manufacturer 's instructions . primer sequences used in this study were as follows : sense : 5-atgcgaacaaatcccttctacc-3 ; antisense : 5-ttcctcagaaagagcagcatcg-3 ; sense : 5-ggacaccagaagtcaaccagacc-3 ; antisense : 5-cgtccacaagcaatgagtgcc-3. -actin ( internal control ) : sense : 5-ccttcctgggcatggagtcctg-3 , antisense : 5-ggagcaatgatcttgatcttc-3. reverse transcription was carried out at 30c for 10 minutes , 42c for 30 minutes , 99c for 5 minutes , and 5c for 5 minutes . pcr conditions were as follows : initial denaturation at 94c for 2 minutes , followed by 35 amplification cycles of 94c for 30 seconds , 53c for 30 seconds , at 72c for 1 minute , and extension at 72c for 10 minutes . for semiquantitative analysis of gene expression , amplification products were assessed on a 2% agarose gel . the band density was determined by the bio - imaging system ( pall company , usa ) . mmp-1 mrna and timp-1 mrna were expressed by the ratios of mmp-1 , timp-1 , and -actin od values . after initial treatment , samples were incubated with the primary antibodies , mouse antihuman mmp-1 monoclonal antibody and mouse anti - human timp-1 monoclonal antibody ( santa cruz , usa ) , at room temperature for approximately 1.5 hours . samples were washed 3 times with pbs , then incubated with a peroxidase - conjugated secondary antibody for 15 minutes , followed by washing with pbs . positive results of immunohistochemistry were determined by the appearance of brown or yellow dab staining . the image - pro - plus 4.5 microscopic image analyzing system was used to determine the intensity of staining . five fields in each section were randomly chosen , and the total optical density and total image area were measured . the mean optical density was calculated as the ratio of the total optical density and total image area ; larger mean optical densities indicate greater expression of the corresponding proteins . elisa for plasma mmp-1 and timp-1 was performed using an elisa kit ( r&d systems , usa ) following the manufacturer 's instructions . all values were expressed as mean sd . analyses of variance ( anova ) with student - neuman - keuls post - hoc test were used to compare mrna levels of mmp-1 and timp-1 in patients with different disease severity . spearman correlation analysis was used to determine the relationship between plasma and mucosal mmp-1 and timp-1 levels . colonic mucosal expressions of mmp-1 and timp-1 in uc patients were significantly higher than those of in the normal controls ( p < .05 , table 1 ) . in addition , mmp-1 and timp-1 expression increased with the severity of ulcerative colitis ( table 1 ) . mmp-1 and timp-1 expression levels in both the mild ( m ) and moderate - to - severe ( mts ) groups were significantly higher than those of normal controls ( p < .05 ) , and they were expressed to a greater extent in mts group compared to m group ( p < .05 ; table 1 ; figure 2 ) . the elisa study ( table 1 ) showed that the overall plasma levels of mmp-1 and timp-1 in uc patients were significantly higher than those of the control group ( p < .05 ) . however , no difference was observed between plasma mmp-1 levels of patients with mild ulcerative colitis and normal controls or between disease severity groups ( mts versus m group ; p > .05 ) . in contrast , plasma timp-1 levels in the mts group were significantly higher than those of the m group and significantly higher in the m group compared to the normal controls ( p < .05 ) . plasma mmp-1 and timp-1 levels were correlated with their colonic mucosal expression in uc patients ( mmp-1 , p < .05 , r = 0.81 ; timp-1 , r = 0.91 ; figures 3 and 4 ) . in this study , we determined mmp-1 and timp-1 expression levels in ulcerative colitis patients compared with normal controls . colonic mucosa expression was determined at the mrna and protein levels by rt - pcr and immunohistochemistry . both mmp-1 and timp-1 expression increased in the colonic mucosa of uc patients compared to normal controls , and the expression levels were correlated with disease severity . however , plasma timp-1 was well correlated with disease severity , but plasma mmp-1 was not . our results are consistent with findings from mckaig et al . and supported previous studies demonstrating that mmp-1 reflected acute tissue injury and was associated with the initial steps of ulceration in uc and new blood vessel formation . [ 2 , 4 ] von lampe b et al . also showed that timp-1 mrna expression was 9- to 12-fold increased in uc lesions . mmp and timp expression increased not only in tissues but also in the peripheral blood samples from patients with acute coronary syndrome , cancer , hepatitis , rheumatoid arthritis , and normal persons.[1115 ] wiercinska - drapalo a et al . used elisa to determine mmp-1 and timp-1 expression and found that serum mmp-1 and timp-1 were significantly increased in patients with uc compared with normal controls . they also found that timp-1 level was related to endoscopic mucosal injury , disease activity index , clinical activity index , and c protein level although mmp-1 was not . our study produced similar findings ; plasma mmp-1 levels were higher in uc patients , but did not correlate with disease severity . further analyses of plasma levels and mucosa expression revealed that plasma levels of both mmp-1 and timp-1 correlated with mucosa expression . these findings indicate that plasma mmp-1 and timp-1 generally reflect the disease state , and timp-1 level was additionally associated with disease severity . mmp-1 is primarily associated with the initial steps of ulceration in uc , [ 2 , 4 ] which may explain its lack of association with disease severity . in our study , most of the patients were suffering from chronic recurrent uc , so plasma mmp-1 could have been affected . the elisa assay used in this study measures only free mmp-1 and mmp-1 combined with timp-1 . in addition , timp-1 is more easily released into the blood ; therefore , its measurement sensitivity is higher than that of mmp-1 . according to a previous study , this may be another reason why plasma mmp-1 level increased only in moderate - to - severe disease patients , but not in mild disease patients . in conclusion , plasma mmp-1 and timp-1 reflect their colonic mucosal expression to some extent ; plasma timp-1 reflects colonic mucosa lesion severity more sensitively than plasma mmp-1 level . after excluding other diseases such as coronary heart disease and liver disease that are also associated with increased mmp-1 and timp-1 expressions , plasma mmp-1 and timp-1 , especially timp-1 , could possibly become useful biomarkers for uc diagnosis and disease severity , and may be useful to guide therapy .

background . both plasma and mucosal levels of matrix metalloproteinase-1 ( mmp-1 ) and tissue inhibitor of metalloproteinase-1 ( timp-1 ) have been shown to be independently correlated with ulcerative colitis ( uc ) , but their relationship with each other and to disease severity remains unclear . this study aims to evaluate the relationship between colonic mucosal and plasma levels of mmp-1 and timp-1 with each other and with the severity of ulcerative colitis ( uc ) . methods . colonic mucosal lesions and venous blood samples were collected from 30 patients with uc and 15 normal subjects . real - time reverse transcription - pcr and immunohistochemistry were used to determine colonic mucosal mmp-1 and timp-1 expression ; elisa was used to measure plasma levels of mmp-1 and timp-1 . results . expression of colonic mucosal and plasma mmp-1 and timp-1 in patients with uc was significantly higher than that of controls ( p < .05 ) , and was positively correlated with disease severity ( p < .05 ) . plasma mmp-1 and timp-1 levels were well correlated with their corresponding expression in colonic mucosa ( p < .05 , r = 0.805 and 0.908 ) . conclusion . plasma mmp-1 and timp-1 levels reflect their colonic mucosal expression to some extent in patients with uc . plasma mmp-1 and timp-1 , in particular , demonstrate the potential to become biomarkers to clinically diagnose uc , predict its severity , and guide further therapy .

You are an expert at summarizing long articles. Proceed to summarize the following text: depressive disorders are among the most commonly diagnosed diseases and are among the diseases most disabling an individual s functioning . the annual prevalence of depression in the adult population ranges from 6% to 12% , and according to various reports , among those over 65 years of age it ranges from 5% to 30% . the etiology of recurrent depressive disorder ( rdd ) has not yet been fully discovered . for many years , numerous and often competing theories currently , it is assumed that the determinant of the disease is multifactorial , and particular elements are not mutually exclusive , but rather complementary . one of the theories , which are developing intensively at present , is a hypothesis of circadian rhythms disturbance . according to this theory , the reason for recurrence of depression is a disruption of synchronization of basic physiological and metabolic rhythms , which determine adaptation to changes in the outer world ( among others , the circadian rhythm of day and night ) . since circadian and neurotransmission systems are tightly connected , circadian and/or sleep - related abnormalities may impact the functioning of the dopamine and serotonin circuitry , which in turn affects mood regulation . cognitive function impairment in a group of patients with depressive disorders can differ in character and severity , from selective , specific , and mild deficits to generalized and intensive changes . cognitive deficits mainly concern declarative and working memory . depressive disorders are , in general , associated with deficits in both free and cued recall of episodic information and deficits in short- and long - term memory . the early onset of rdd is associated with a significant volume loss of the hippocampus in patients with geriatric depression and in middle - aged adults . reported an association between the length of untreated depressive episodes and hippocampal volume reductions in recurrent geriatric major depressive disorders . dysfunctions of working memory are also observed in patients with rdd , as well as in their first - degree relatives . working memory impairment is particularly explicit in elderly patients with depression , but may also be observed in younger subjects . deficits in this area exert negative effects on performance levels in psychological tests and on everyday functioning of affected patients , as well as being responsible for decreased remission rates . there are several hypotheses attributing to the etiology of depression to melatonin ( n - acetyl-5-methoxytryptamine ) . according to wetterberg , decreased levels of this hormone are observed in depressive patients ( called low melatonin syndrome ) . low melatonin secretion may be associated with a genetic marker , which also contributes to a higher risk of depression development . furthermore , elevated level of melatonin in the morning also may be associated with depression , and , according to other authors , concentrations of melatonin that are too low or too high are harmful . new evidence suggests that late melatonin elevations may suppress pars tuberalis thyrotroph embryonic factor ( tef ) , a photoperiodic switch that might control human depression . confirmation of the high importance of melatonin and melatonin receptor agonists in the pathogenesis of depression is the effectiveness of their use in sleep disorders and circadian rhythms disturbances , which in turn are common prognostic factor for the disease development . in addition to sleep induction and circadian rhythms regulation , melatonin is also involved in various other physiologic functions , including immune response , antioxidative defense , metabolic regulations , and memory . melatonin is a peptide that is produced at night in the corpus pineal in a rhythmical pattern and is controlled by an endogenous clock in the suprachiasmatic nucleus of the hypothalamus . melatonin receptors are expressed in many different cell types , including those of the nervous , cardiovascular , digestive , and endocrine systems . the last step of the metabolic synthesis of melatonin is conversion of n - acetylserotonin to melatonin in methylation reaction , which is catalyzed by n - acetylserotonin o - methyltransferase ( asmt ) , also known as hydroxyindole - o - methyltransferase ( hiomt ) . astm gene is located in the pseudoautosomal region of the x chromosome , which is a candidate region for the development of mental illness . the purpose of this study was analysis of asmt gene both on mrna and protein levels in patients with rdd , and to investigate the relationship between asmt expression and cognitive performance . the study was carried out in a group of 236 subjects aged 2067 ( m=39.79 years , sd=14.02 ) . the participants were divided into 2 groups : patients with rdd ( n=131 ) and healthy subjects ( a comparison group , cg , n=105 ) . all the patients were native poles , inhabitants of the central poland , and unrelated . respondents , before deciding to participate in the study , were informed of its purpose , ensured that the participation is voluntary , and guaranteed that the personal data and the results of the tests will not be distributed , but only used in the overall statistics . table 1 presents characteristics of the study group by sex , age , education , and the course of disease ( rdd group ) . statistically significant differences between the 2 groups were found in terms of sex ( c=1.46 , p=0.227 ) , education ( z=3.18 , p=0.001 ) , and age ( z=10.44 , p=0.001 ) . an informed , written consent for participation in the study was obtained from each subject , according to the protocol approved by the bioethics committee of the medical university of lodz ( no . patients were selected for the study according to the inclusion criteria of icd-10 ( f32.07.32.2 , f33.0f33.8 ) . the presence of axis i and ii disorders , other than depressive episode , and the diagnosis of somatic diseases and injuries of the central nervous system ( cns ) , which could have affected the cognitive performance , were regarded as exclusion criteria . other exclusion criteria were : inflammatory or autoimmune disorders and unwillingness to give informed consent . in all the included subjects , case history was obtained prior to main study procedure , using the standardized composite international diagnostic interview ( cidi ) . additionally , the number of depression episodes and the disease duration periods were recorded in each patient . during hospitalization , the healthy controls included community volunteers enrolled into the study on the criteria of the psychiatric cidi interview . controls with other psychiatric diagnoses concerning axis i and ii disorders , neurological disorder , and substance abuse or dependence were excluded from the study . all subjects were free of medical illness , including infections and inflammatory or allergic reactions . none of the control subjects or depressed patients were treated with drugs known to influence lipid metabolism , immune response , or endocrine function . the control subjects were free of all medication for at least 2 months prior to blood sampling . none of the control subjects were drinkers , heavy smokers , or had ever taken psychotropic drugs . assessment of cognitive function was based on the trail making test ( tmt ) , the stroop test , the auditory - verbal learning test ( avlt ) , and the verbal fluency test ( vft ) . descriptions of these tests have been presented elsewhere . regarding the patients with rdd , hdrs , the stroop test , tmt , avlt , and vft were applied at the therapy onset . all the patients were examined on admission ( i.e. , at the symptomatic phase , before or shortly after previous antidepressant drug regime modification ) . in the cg group , examination of patients by the above - mentioned tests was done by the same person in each particular case : the same psychologist examined the patients with neuropsychological tests , including an evaluation of obtained results , while the hdrs test was performed by the same physician - psychiatrist . absorbance measurements were performed automatically at wavelengths of 260 , 280 , and 320 nm , and the protein concentrations were calculated according to the warburg formula : protein concentration [ mg / cm ] = 1.55 ( a280a320 ) 0.76 ( a260a320 ) . to 0.01 cm of the protein solution ( standard and sample ) , 0.2 cm of bca reagent ( pierce ) was added , and , after thorough mixing , incubated for 30 min at 37c . after cooling to room temperature , the absorbance was measured at a wavelength of 562 nm using a bca reagent buffer as a control . a commercial kit was used to quantify the asmt protein levels in the sera ( human acetylserotonin o - methyltransferase [ asmt ] elisa kit from antibodies - on line gmbhaachen [ germany ] ) . dna was extracted from whole blood according to the gtc method . the asmt promoter b polymorphisms rs4446909 and rs5989681 were analyzed by direct sequencing polymerase chain reaction(pcr ) product . amplification was performed using 0.1 lg genomic dna , 200 lm each dntp , 5xgotaq buffer solution , 1 u gotaq polymerase ( promega , madison , wi , usa ) , 0.5 lm primers 5ggacctgctcaatccataagacg3 and 5ctagaaatttgcattaaccgta3 specific for both polymorphisms . amplification product 201 bp was sequenced using specific primer and 5cctgctcaatccataagacgat3 by dna sequencing service ibb pan warsaw . the human asmt and 18s ribosomal rna gene expression were quantified by real - time pcr using abi prism 7000 sequence detection system ( applied biosystems , foster city , ca , usa ) according to the manufacturers protocol . total rna(1lg ) was extracted from the whole blood using trizol reagent ( life technologies inc . , carlsbad , ca , usa ) , and was processed directly to cdna synthesis using the oligotex kit ( qiagen , chatsworth , ca , usa ) . briefly , 2.5 , 2.0 ; 1.5 , 1.0 ; 0.5 and 0.25 ll of synthesized cdna were amplified in triplicate for both 18s likewise , 2 ll of cdna was amplified in triplicate in all isolated samples for each primer / probe combination and 18s ribosomal rna . each sample was supplemented with both respective 0.3 lm forward and reverse primers , fluorescent probe , and made up to 50 ll using qpcrtm mastermix for sybir green all of the following pcr primers were designed using primerexpress ( applied biosystem ) software and 5agcgcctgctgttcatga3 ; 5ggaagcgtgagaggtcaa3 ; 5cgtctaccacatccaaggaa3 and 5gctggaatttaccgccggct3 specific for mrna of human asmt and 18s ribosomal rna , respectively . 18s rna was used as an active and endogenous control to correct for differences in the amount of total rna added to the reaction and to compensate for different levels of inhibition during reverse transcription of rna and during pcr . all samples were incubated at 50c for 2 min and at 95c for 10 min and then cycled at 95c for 30 s , 56c for 1 min , and 72c for 1 min for 40 cycles . sybr green i fluorescence emission data were captured and mrna levels were quantified using the critical threshold ( ct ) value . analyses were performed with abi prism 7000(sds software , foster city , ca , usa ) . controls without rt and with no - template cdna were performed with each assay . to compensate for variations in input rna amounts , and efficiency of reverse transcription , distributions were analyzed using the shapiro - wilk test . to compare nonparametric variables in the test groups , the pearson c ( qualitative variables ) and the mann - whitney u test for 2 independent groups were used . to evaluate the relations between analyzed variables , spearman s r rank order correlation coefficients were estimated . for all analyses , which should be regarded as exploratory ( without correction for multiple testing ) , nominal statistical significance was defined as p<0.05 . the study was carried out in a group of 236 subjects aged 2067 ( m=39.79 years , sd=14.02 ) . the participants were divided into 2 groups : patients with rdd ( n=131 ) and healthy subjects ( a comparison group , cg , n=105 ) . all the patients were native poles , inhabitants of the central poland , and unrelated . respondents , before deciding to participate in the study , were informed of its purpose , ensured that the participation is voluntary , and guaranteed that the personal data and the results of the tests will not be distributed , but only used in the overall statistics . table 1 presents characteristics of the study group by sex , age , education , and the course of disease ( rdd group ) . statistically significant differences between the 2 groups were found in terms of sex ( c=1.46 , p=0.227 ) , education ( z=3.18 , p=0.001 ) , and age ( z=10.44 , p=0.001 ) . an informed , written consent for participation in the study was obtained from each subject , according to the protocol approved by the bioethics committee of the medical university of lodz ( no . patients were selected for the study according to the inclusion criteria of icd-10 ( f32.07.32.2 , f33.0f33.8 ) . the presence of axis i and ii disorders , other than depressive episode , and the diagnosis of somatic diseases and injuries of the central nervous system ( cns ) , which could have affected the cognitive performance , were regarded as exclusion criteria . other exclusion criteria were : inflammatory or autoimmune disorders and unwillingness to give informed consent . in all the included subjects , case history was obtained prior to main study procedure , using the standardized composite international diagnostic interview ( cidi ) . additionally , the number of depression episodes and the disease duration periods were recorded in each patient . during hospitalization , the healthy controls included community volunteers enrolled into the study on the criteria of the psychiatric cidi interview . controls with other psychiatric diagnoses concerning axis i and ii disorders , neurological disorder , and substance abuse or dependence were excluded from the study . all subjects were free of medical illness , including infections and inflammatory or allergic reactions . none of the control subjects or depressed patients were treated with drugs known to influence lipid metabolism , immune response , or endocrine function . the control subjects were free of all medication for at least 2 months prior to blood sampling . none of the control subjects were drinkers , heavy smokers , or had ever taken psychotropic drugs . assessment of cognitive function was based on the trail making test ( tmt ) , the stroop test , the auditory - verbal learning test ( avlt ) , and the verbal fluency test ( vft ) . descriptions of these tests have been presented elsewhere . regarding the patients with rdd , hdrs , the stroop test , tmt , avlt , and vft were applied at the therapy onset . all the patients were examined on admission ( i.e. , at the symptomatic phase , before or shortly after previous antidepressant drug regime modification ) . in the cg group , examination of patients by the above - mentioned tests was done by the same person in each particular case : the same psychologist examined the patients with neuropsychological tests , including an evaluation of obtained results , while the hdrs test was performed by the same physician - psychiatrist . absorbance measurements were performed automatically at wavelengths of 260 , 280 , and 320 nm , and the protein concentrations were calculated according to the warburg formula : protein concentration [ mg / cm ] = 1.55 ( a280a320 ) 0.76 ( a260a320 ) . to 0.01 cm of the protein solution ( standard and sample ) , 0.2 cm of bca reagent ( pierce ) was added , and , after thorough mixing , incubated for 30 min at 37c . after cooling to room temperature , the absorbance was measured at a wavelength of 562 nm using a bca reagent buffer as a control . a commercial kit was used to quantify the asmt protein levels in the sera ( human acetylserotonin o - methyltransferase [ asmt ] elisa kit from antibodies - on line gmbhaachen [ germany ] ) . the asmt promoter b polymorphisms rs4446909 and rs5989681 were analyzed by direct sequencing polymerase chain reaction(pcr ) product . amplification was performed using 0.1 lg genomic dna , 200 lm each dntp , 5xgotaq buffer solution , 1 u gotaq polymerase ( promega , madison , wi , usa ) , 0.5 lm primers 5ggacctgctcaatccataagacg3 and 5ctagaaatttgcattaaccgta3 specific for both polymorphisms . amplification product 201 bp was sequenced using specific primer and 5cctgctcaatccataagacgat3 by dna sequencing service ibb pan warsaw . the human asmt and 18s ribosomal rna gene expression were quantified by real - time pcr using abi prism 7000 sequence detection system ( applied biosystems , foster city , ca , usa ) according to the manufacturers protocol . total rna(1lg ) was extracted from the whole blood using trizol reagent ( life technologies inc . , carlsbad , ca , usa ) , and was processed directly to cdna synthesis using the oligotex kit ( qiagen , chatsworth , ca , usa ) . briefly , 2.5 , 2.0 ; 1.5 , 1.0 ; 0.5 and 0.25 ll of synthesized cdna were amplified in triplicate for both 18s ribosomal rna and asmt gene to create a standard curve . likewise , 2 ll of cdna was amplified in triplicate in all isolated samples for each primer / probe combination and 18s ribosomal rna . each sample was supplemented with both respective 0.3 lm forward and reverse primers , fluorescent probe , and made up to 50 ll using qpcrtm mastermix for sybir green i ( eurogentec , seraing , belgium ) . all of the following pcr primers were designed using primerexpress ( applied biosystem ) software and 5agcgcctgctgttcatga3 ; 5ggaagcgtgagaggtcaa3 ; 5cgtctaccacatccaaggaa3 and 5gctggaatttaccgccggct3 specific for mrna of human asmt and 18s ribosomal rna , respectively . 18s rna was used as an active and endogenous control to correct for differences in the amount of total rna added to the reaction and to compensate for different levels of inhibition during reverse transcription of rna and during pcr . all samples were incubated at 50c for 2 min and at 95c for 10 min and then cycled at 95c for 30 s , 56c for 1 min , and 72c for 1 min for 40 cycles . sybr green i fluorescence emission data were captured and mrna levels were quantified using the critical threshold ( ct ) value . analyses were performed with abi prism 7000(sds software , foster city , ca , usa ) . controls without rt and with no - template cdna were performed with each assay . to compensate for variations in input rna amounts , and efficiency of reverse transcription , distributions were analyzed using the shapiro - wilk test . to compare nonparametric variables in the test groups , the pearson c ( qualitative variables ) and the mann - whitney u test for 2 independent groups were used . to evaluate the relations between analyzed variables , spearman s r rank order correlation coefficients were estimated . for all analyses , which should be regarded as exploratory ( without correction for multiple testing ) , nominal statistical significance was defined as p<0.05 . asmt gene expression at mrna was significantly lower in the rdd group when compared to the cg ( p<0.01 ) . likewise , asmt gene expression at protein level was significantly lower in the rdd group when compared to the cg ( p<0.01 ) . the average level of asmt gene expression measured at the mrna level for the whole group is : m=0.21 ( sd=0.09 ) , at the protein level : m=12.84 ( sd=3.29 ) . statistically significant differences were found in the cognitive performance in all tests between the rdd group when compared to the cg ( table 2 ) . table 3 presents the correlation between both asmt mrna and protein expression levels and the results of neuropsychological tests , separately for rdd and cg test group . in patients with rdd , statistically significant correlations occurred between both mrna and protein expression levels and the following tests : part a of the tmt(negative correlation ) , and verbal fluency test ( positive correlation ) . in the cg group table 3 also presents the results of testing correlation between both asmt mrna and protein expression levels and the neuropsychological tests for the entire group . there was a statistically significant correlation between both asmt gene expression levels and all the neuropsychological tests used in the survey . obtained results demonstrate that at both mrna and protein expression levels of astm gene were higher in controls than in patients with rdd . the increase of these parameters in healthy controls in comparison with depressed subjects indicates the importance of melatonin in the etiology of recurrent depression . the presented results are in agreement with reports by gaecki et al . and etain et al . , showing that a single - nucleotide polymorphism ( snp ) in asmt gene expression was associated with depression ( a group of 181 patients with rdd and 149 controls ) . the presence of aa genotype of rs4446909 polymorphism and of gg genotype of rs5989681 polymorphism was associated with lower risk for having rdd ( odds ratio=0.1;95% ci=0.030.58 ; p=0.007 ) . one or 2 g alleles were observed in 99% of cases and 92% of controls . examined 345 patients with bipolar disorder(bd ) and 220 healthy controls , and showed that rs4446909 polymorphism of the asmt gene was significantly associated with bd ( p=0.01 ) and associated with a lower mrna level ( p<0.001 ) and a lower enzymatic activity ( p<0.05 ) of asmt . a reduced concentration of melatonin is also reported in dementia , in schizophrenia , in children with autism spectrum disorders ( asd ) , and in patients with attention - deficit hyperactivity disorders ( adhd ) . an important factor for the development and course of depressive disorders may be the neuroprotective effect of melatonin , which results from the reduction of glutamatergic cytotoxicity , oxidative stress , and inflammation ( including neuroinflammation ) . melatonin decreases levels of proinflammatory cytokines , which have a significant influence on the occurrence of neurobiological changes in depression . melatonin enhances cell survival and dendrite maturation of new neurons in the dentate gyrus ( dg ) of adult mice . moreover , monje et al . investigated whether long - term light deprivation in the constant darkness ( dd ) paradigm affects depression - like behavior in mice and concomitantly modulates the levels of proinflammatory cytokines . they found that after 4 weeks of dd , mice display depression - like behavior , which is paralleled by reduced hippocampal cell proliferation . this chronobiologically - induced depressive state is associated with elevated levels of plasma interleukin-6 ( il-6 ) and interleukin 1 receptor , type i ( il1-r1 ) protein levels in the hippocampus , and also alters hippocampal protein levels of the clock genes per2 and npas2 . furthermore , there were observed morning elevations of plasma il-6 and a reversal of its circadian rhythm in mdd patients ( the circadian rhythm of il-6 was shifted by 12 h , and its physiological complexity was reduced ) . another important function of melatonin is modulation of neuronal plasticity and regulation of behavior control and mood . melatonin has an effect on proper functioning and protection from oxidative stress of the hippocampus , the area of the brain important for the development and course of depression . another finding of our study is the link between cognitive impairment in rdd patients and reduced mrna and protein expression levels of the asmt gene . to our knowledge this is the first study investigating the relationship between cognitive function and mrna and protein expression levels . in rdd patients , there were statistically significant associations of asmt mrna and protein expression level and : tmt test part a ( negative correlation ) , and verbal fluency test ( positive correlation ) . in the group of patients with depression , reduced asmt gene expression is related to decreased efficiency of those cognitive functions attributed to frontal lobes and hippocampus : working memory , attention , and verbal fluency . for the entire group , the analysis revealed a significant correlation between mrna and protein expression levels of the asmt gene and all the results of neuropsychological tests . both mrna and protein expression levels of the asmt gene affect : auditory - verbal and visual - spatial working memory , verbal fluency , verbal memory , auditory - verbal immediate and deferred memory , the effectiveness of learning , and attention span . these results are in line with the data obtained in studies based on animal models . laborie showed a positive effect of phototherapy and melatonin medication on the improvement of cognitive functioning in 189 patients ( mean age 85.8 years ) with symptoms of dementia . these 2 therapies help to resynchronize the circadian rhythm and thus might improve cognition and abnormalities of mood and behavior , as well as independence and sleep disturbance . the obtained results demonstrated a slower cognitive decline and less diminution of autonomy in those who received phototherapy and melatonin . according to baydas et al . , melatonin has a modulatory effect on the expression of neural cell adhesion molecule ( ncam ) in brain areas involved with cognitive function . melatonin may be involved in structural remodeling of synaptic connections during memory and learning processes . moreover , results obtained by ramrez - rodrguez et al . indicate that melatonin also modulates the neurogenic process in the hippocampus during normal aging of mice . moreover , recent data have shown that neurodegenerative diseases ( e.g. , alzheimer s disease [ ad ] or parkinson s disease [ pd ] ) are often associated with sleep disturbances beyond what is observed in normal aging . disturbed regulation of sleep often occurs early in the course of ad and pd , and may contribute to the cognitive and motor symptoms . . observed that chronic administration of melatonin significantly reduced lipid peroxidation and restored the decreased glutathione levels induced by chronic hyperhomocysteinemia in mice . they also found that learning and memory deficits were reversed by long - term treatment with antioxidant melatonin . taken together , these findings indicate that a subgroup of individuals with rdd and low melatonin levels could benefit from the use of melatonin as a therapeutic compound . melatonin treatment seems to help patients with rdd to fall asleep and to sleep through the night . further studies are required to determine the role of melatonin deficit in affected individuals , and , more generally , of circadian and seasonal rhythms , in the susceptibility to neuropsychiatric disorders . although the study was performed in a homogeneous group of patients , a possible stratification effect should be taken into account . another limiting factor may be the presence of statistically significant differences between the 2 test groups , especially in terms of age , education , and number of schooling years . our study confirms previous results showing decreased mrna and protein expression levels of the asmt gene in depression . our data suggest a relation between decreased mrna and protein expression levels of the asmt gene and cognitive impairment .

backgroundrecurrent depressive disorder is a multifactorial disease ; one of the typical features is cognitive impairment . the purpose of this study was analysis of asmt gene expression both on mrna and protein levels in patients with recurrent depressive disorder ( rdd ) and assessment of the relationship between plasma level of asmt protein , gene expression on mrna level , and cognitive performance.material/methodsthe study included 236 subjects : patients with rdd ( n=131 ) and healthy subjects ( n=105 , cg ) . cognitive function assessment was based on : trail making test , the stroop test , verbal fluency test ( vft ) , and auditory verbal learning test ( avlt).resultsboth mrna and protein expression levels of asmt gene were significantly higher in healthy subjects when compared to rdd . the average asmt mrna expression level measured for the entire group was m=0.21 ( sd=0.09 ) , and the protein level was m=12.84 ( sd=3.29 ) . in patients with rdd , statistically significant correlations occurred between both mrna and protein expression levels and part a of the tmt ( negative correlation ) and verbal fluency test ( positive correlation ) . in the group cg , there was no statistically significant association between the analyzed variables . in the entire group there was a statistically significant correlation between both asmt mrna and protein expression levels and all the neuropsychological tests used in the survey.conclusions1 . our study confirms previous results showing decreased mrna and protein expression levels of asmt gene in depression . 2 . our data suggest a relationship between decreased mrna and protein expression levels of asmt gene and cognitive impairment .

You are an expert at summarizing long articles. Proceed to summarize the following text: they drift from standard classifications , and their treatment is controversial . of such cases are hip dislocations with associated fractures of the ipsilateral femur . this case report describes the condition of a 30-year - old man involved in a motor vehicle collision . clinical examination , x - rays , and computed tomography scan revealed a posterior hip dislocation with an ipsilateral femoral head and mid - shaft fractures . the patient was treated by closed reduction of hip dislocation using a temporarily applied external fixator followed by intramedullary nailing of the femoral shaft . achieving a closed reduction is a challenge with ipsilateral fractures but it should be favored over open reduction due to a lower risk of complications . the type of femoral head fracture , in this case , may have aided in an easier reduction . hip dislocation is an orthopedic emergency and its treatment is challenging if associated with ipsilateral fractures . the decision of a closed versus an open approach should be made after considering the management plans of other injuries . there has been a significant increase in the complexity of fractures due to the increasing variety of traumatic mechanisms such as high - speed collisions , falls from heights , construction related high - energy injuries , and more . these fractures tend to drift from the standard classification systems , and their treatment is usually controversial because of varying outcomes . one such example is hip dislocations associated with head , neck , intertrochanteric , shaft , distal femur fractures , or knee dislocation . in this report , we study the case of a 30-year - old man who sustained a posterior hip dislocation with concomitant ipsilateral femur head and shaft fractures . only one similar case was previously published in the literature , and there were some differences noted between the two cases . a 30-year - old man presented to the emergency trauma room following a motor vehicle collision in which he was the front - seat unrestrained passenger . at the time of presentation , the patient was vitally stable , conscious , alert , oriented with a glasgow coma scale 15/15 . the trauma surgery team assessed the patient initially and implemented the advanced trauma life support protocol ; he was deemed to be hemodynamically stable with no other systemic injuries . the patient was , however , complaining of moderate left hip and thigh sharp pain as well as left shoulder pain . on examination , active and passive movements of the left thigh were not possible due to pain with no neurovascular deficits detected distally . x - rays of the pelvis and left femur revealed a posterior fracture dislocation of left femoral head with an ipsilateral femoral mid - shaft fracture and a computed tomography ( ct ) scan of the pelvis showed large and small fracture fragments within the acetabulum originating from the medial aspect of the femoral head ( fig . 1 ) . a shoulder x - ray also revealed a non - displaced left scapular body fracture . an attempt of left hip closed reduction was made while the patient was still in the emergency department and it was , however , unsuccessful . pre - operative ( showed fracture dislocation of left hip and an ipsilateral femoral shaft fracture ) . after being cleared by the trauma team , the patient was admitted to the orthopedic service with a working diagnosis of left posterior hip dislocation with a pipkin type 1 ipsilateral femoral head fracture and an ipsilateral femoral shaft fracture . the patient was taken to the operating theater for closed versus open reduction and intramedullary nailing of the left femur . within 5 h of his injury , the patient underwent closed reduction of the left hip with the aid of a temporary external fixator applied on the femoral shaft proximal to the fracture ( fig . the external fixator rod was used as a handle , and the reduction was successful after the first attempt , as confirmed by the c - arm and ct reconstruction ( fig . subsequently , the external fixator was removed , and intramedullary nailing of the left femur was carried out . after completion of the procedure , the left hip was examined and found to be stable with the femoral head fragment not affecting the movement . the patient was discharged after 3 days with a clean , dry wound and full weight bearing ambulation as tolerated . unfortunately , he was lost to follow - up and attempts to contact the patient were unsuccessful . intraoperative ( showed a temporary external fixator applied on the femoral shaft proximal to the fracture and intraoperative computed tomography scan reconstruction ) . the primary challenge , in this case , was achieving closed reduction of the hip dislocation ; this was particularly difficult due to the inability to transmit the force needed for reduction through to the hip and the difficulty controlling the thigh . this necessitated the use of other indirect methods of reduction like the temporary external fixator ( fig . 3 ) . postoperative ( showed congruent reduction of left hip fracture - dislocation with i m nailing of left femur shaft fracture ) these challenges were also faced by other treating surgeons in similar cases , and each team was able to achieve the reduction by closed manipulation or manual traction maneuvers , indirect reduction with the aid of external tools such as a loop and open reduction . early reduction of the dislocation is important to prevent significant complications associated with late reduction like osteonecrosis and subsequent hip arthritis . moreover , closed or indirect reduction is favored over open reduction especially if there is no plan for internal fixation of the acetabulum or proximal femur because of the significant risks involved with open surgery which include but is not limited to : sciatic nerve palsy , heterotopic ossification , avascular necrosis , blood loss and infection . it is worth noting that in the similar case described by galois et al . ; the femoral head fracture was suprafoveal pipkin type 2 while in our case it was infra foveal pipkin type 1 . the latter type may have contributed to an easier reduction which is possible through closed methods , while in the former case the fractured fragment may have necessitated open reduction , due to a mechanical block inhibiting reductions by closed methods , and internal fixation to restore and maintain the articular congruency and the weight bearing surface of the hip . traumatic hip dislocation is a significant orthopedic emergency and its treatment is more challenging if the dislocation is associated with other concomitant ipsilateral fractures . management should start with emergent reduction , and the treating orthopedic surgeon should make the decision of a closed versus an open approach after taking into consideration the other injuries and fractures and considering their definitive management plan . the use of indirect reduction instrument , such as an external fixator , may preclude an open procedure which will prevent surgical complications .

introduction : complex fractures are increasing because of various traumatic mechanisms . they drift from standard classifications , and their treatment is controversial . of such cases are hip dislocations with associated fractures of the ipsilateral femur.case report : this case report describes the condition of a 30-year - old man involved in a motor vehicle collision . clinical examination , x - rays , and computed tomography scan revealed a posterior hip dislocation with an ipsilateral femoral head and mid - shaft fractures . the patient was treated by closed reduction of hip dislocation using a temporarily applied external fixator followed by intramedullary nailing of the femoral shaft . achieving a closed reduction is a challenge with ipsilateral fractures but it should be favored over open reduction due to a lower risk of complications . the type of femoral head fracture , in this case , may have aided in an easier reduction.conclusion:hip dislocation is an orthopedic emergency and its treatment is challenging if associated with ipsilateral fractures . the decision of a closed versus an open approach should be made after considering the management plans of other injuries .

You are an expert at summarizing long articles. Proceed to summarize the following text: ultrasound examinations have become the routine technique for the evaluation of the inflammatory changes in the musculoskeletal system in children in the course of systemic inflammatory conditions such as jia . they allow to identify the inflamed structures of the locomotor system such as e.g. joints , bursae , and tendon sheaths , and to determine the type of the inflammatory changes ( the presence of fluid and/or synovial hypertrophy ) and their severity . however , even though where there are no inflammatory changes within the examined area , the classical ultrasound examination rules them out with a probability nearing 100% , where they are present , an accurate evaluation of their severity is subjective and tends to depend on numerous factors , such as the examiner 's experience , the position of the limb in the case of peripheral joints , or the device and the transducer used . in pediatric patients the considerable variations in the size of the joints depending on the child 's age , and the presence , especially in the youngest children , of large quantities of hypoechogenic cartilage tissue easily mistaken for inflammatory changes , make up for additional difficulties . in compliance with the ultrasound examination standards , the severity of inflammatory changes is determined in a semi - quantitative 3-degree scale , describing them as slight , moderate and severe . some authors score the fluid and the synovial membrane jointly , whereas others score them separately . this may lead to substantial variations between researches in the scoring of the fluid and the synovium , to the effect of different assessment of the effectiveness of the undertaken treatment . this is where the application of 3d imaging option , routinely used e.g. for fetus assessment , becomes helpful . 3d imaging may facilitate an objective evaluation of the severity of the inflammatory changes , and their quantitative presentation . this paper discusses the suitability and the limitations of 3d imaging for the sake of ultrasound examinations of the musculoskeletal system in pediatric patients with rheumatologic conditions . ultrasound examinations are crucial for the vascularity assessment of inflammatory changes detected in the structures of the locomotor system . rheumatologic patients are evaluated with the help of power doppler and color doppler options . these , however , are not always sufficiently sensitive to detect synovial vascularity , which prompted search for other ways of determining the flow within the inflamed structures . the introduction of third generation uca , which are readily mobile within the vascular bed and reach the vascularized synovium with the blood stream , while at the same time being resistant to the pressure in the left heart ventricle , has facilitated more sensitive detection of the flow within the synovial membrane . even though the role of uca for rheumatology has not yet been fully determined , they hardly seem to find routine application in future clinical practice . the role of 3d imaging is to present the examined region in a spatial way , thereby facilitating evaluation which is accurate and as objective as possible . the examined structures are frequently recorded in the form of tissue blocks which are processed and assessed after the examination has been completed , allowing a thorough , comprehensive analysis of the examined region , and calculation of various parameters whose assessment in the course of a routine , gray - scale ultrasound is difficult , if not impossible altogether . additional volumetric transducers ( for the locomotor system ultrasound , a linear one ) facilitating data acquisition , as well as suitable software for further processing are required to carry out a 3d examination . the acquisition of 3d data takes place while the transducer is statically placed over the assessed area which is then automatically swept by the ultrasound beam . the collected data are presented in three planes : x , y and z ( fig . 1 ) . the 3d option allows imaging in a plane parallel to the front - face of the transducer z or c plane ( also known as bird 's eye view ) , inaccessible in typical 2d imaging . a valuable 3d option in ultrasound examinations in rheumatology is the presentation of the revealed inflammatory changes in the form of a solid ( fig . this gives the possibility to calculate accurately the volume of the involved structures , such as joints or bursae . due to their irregular shape , their volume should not be estimated with the aid of standard algorithms used for volumetric evaluation , employing three dimensions or one dimension and the area of the change . the unquestionable advantage of calculating the volume of an inflamed structure presented in 3d consists in the feasibility to objectively assess both the severity of the inflammation process , and the changes potentially occurring in response to treatment ( fig . 3d imaging of the subacromial - subdeltoid bursa ( sasd ) also revealing the vascularity of the bursa walls in color doppler option 3d imaging . fig . 2 sasd volume , 6 weeks after topical administration of glucocorticoids this type of imaging , however , has numerous limitations . it is impossible to present as one solid some structures that are larger and longer ( e.g. some involved tendon sheaths ) , and which exceed the size swept by the ultrasound beam . also , there is the problem of assessing larger joints through osseous structures , impermeable to the ultrasound beam . cartilage elements of poor echogenicity present in children 's skeleton structures can be mistaken for inflammatory changes , making the examination more difficult . in 2d imaging , dynamic examination aids such cases , helping to successfully distinguish inflammatory changes and cartilage structures . the small size of the examined structures in younger children causes some problems too , and so does poor adherence of the transducer to the examined region e.g. the ankle . moreover , 3d investigations are sensitive to motion artifacts , therefore the examined region should be stabilized and still upon data acquisition , which is naturally more challenging in pediatric patients than in adults , of tentimes requiring multiple attempts . it also seems that 3d evaluation should be applied for structures in which the inflammation process occurs mainly in the form of synovial membrane hypertrophy , since inflammatory changes visible predominantly in the form of effusion , which is prone to pressure and readily mobile , may render varying images during a single examination . a 3d examination may also be combined with the doppler option , as in 3d power doppler ultrasound ( 3d pdu ) . it facilitates three - dimensional imaging of the distribution of vascular segments within an involved structure , t hu s enabli ng to a ssess t he va scu la r a rch itect u re of a given change ( fig . 4 ) . the additional benefit is a quantitative assessment of the vascularity of the region of interest , e.g. the hypertrophic synovium in the joint or in the bursa , and presenting it in the form of parameters such as the vascular index ( vi ) , the flow index ( fi ) or an index combining both preceding parameters , the vascular - flow index ( vfi ) . determining these parameters for specific inflamed synovial structures allows to evaluate treatment effectiveness accurately , and to detect potential remission in the course of follow - up examinations . assessment of the sasd vascular architecture visible in examination 1 all things considered , 3d imaging is an interesting option for the sake of assessment of inflammatory changes visible in an ultrasound examination of patients suffering with rheumatologic conditions . it makes the examinations more objective and provides new parameters valuable for the analysis of the vascularity of the changes , and thereby of the inflammation process activity . hence , it aids follow - up examinations and helps to evaluate remission in response to treatment . it is , nonetheless , considerably limited by factors such as the necessary equipment ( specialized transducer and software ) , anatomy , and the time required for the examination ( a technically valid examination and its further processing are substantially more time - consuming than the classical ultrasound method ) . as a result currently , third generation uca are used in clinical practice , such as sonovue from bracco , that is sulphur hexafluoride stabilized by a phospholipid shell . the investigation uses a suspension of gas - filled microbubbles of a diameter < 10 m allowing the agent to move easily within the vascular tree , without the risk of occluding the microcirculation . with the blood flow , the bubbles reach also inflamed regions such as the thickened and hypertrophic synovium present in jia , thereby finding use in rheumatology diagnostics . contrast - enhanced ultrasound examinations were first employed for rheumatology , including jia patients , in the beginning of the last decade . yet , originally , the agents were used to enhance doppler signal in vessels , hence facilitating vessel detection in the classical doppler options like contrast - enhanced power/ color doppler ( cepd / cecd ) . these days , the flow of uca in blood vessels is rendered as gray - scale image with low mechanical index ( mi ) , known as contrast - enhanced ultrasound ( ceus ) ( fig . 5 ) , and is carried out with special software . even in the beginning , it was noted that regardless of the used method , uca in rheumatology increase the sensitivity of vascular detection in the synovium as compared to the classical doppler options . the agents help to detect vessels of a diameter < 40 m , invisible in classical doppler options , bringing us closer to evaluation of flow at tissue level . contrast - enhanced ultrasound of the wrist joints . on the left side , visible contrast - enhanced synovium within the midcarpal and the radiocarpal joint ; synovial membrane enhancement in the radiocarpal joint is partial , with an area of unvascularized synovium . on the right side , view of the evaluated area in b - mode option the test is carried out upon administering the uca suspension intravenously , e.g. into the basilic vein . then , the flow of the agent into the inflamed region , displaying hypertrophic and thickened synovial membrane , is observed in real time . fluid and inactive changes , such as old , fibrous synovium are not enhanced . hence , contrast - enhanced ultrasound helps to distinguish active changes in need of treatment or treatment modification , from inactive ones found e.g. in the case of a long - established jia with a persisting residual synovial hypertrophy . the effect may also be evaluated quantitatively by analyzing time intensity curve ( tic ) and then estimating the area under curve ( auc ) . it is not only peripheral joints that may be evaluated in this way , as some reports have suggested the usefulness of uca e.g. for the assessment of sacroiliac joints . the examination has numerous limitations , including the cost of the contrasting agent , and invasiveness ( intravenous administration of the agents ) . uca are safe substances which are quickly removed from the body , and rarely cause any side effects , yet so far they have not been registered for use in rheumatology or pediatric rheumatology . oftentimes , the vascularity assessment performed with the aid of classical doppler options is sufficient . the sensitivity of traditional examinations using power doppler option is comparable to the sensitivity of postcontrast mri . jia cases with subclinical course of disease , where classical doppler ultrasound does not reveal synovial inflammatory activity , would be where contrast agents should be employed to confirm the activity of the inflammation process . as of now , ceus examinations remain a highly sensitive method of synovial vascularity assessment , yet one without practical indications . 3d imaging is an option enabling a more accurate assessment of inflamed structures such as joints or bursae , which moreover provides new parameters useful for the assessment . also , it contributes to an increased comparability of assessment by various examiners , and helps to determine treatment effectiveness in follow - up ultrasound examinations . due to limitations arising from equipment requirements and technical difficulties , the method is rarely used in clinical practice . contrast - enhanced ultrasound is the most sensitive ultrasound method available , allowing to detect the synovial vascularity in rheumatologic patients , and to confirm the vascular flow where it is impossible to determine by classic doppler ultrasound . due to the high cost of the contrast agents , the invasiveness of the method , and the fact that uca have not yet been registered for pediatric rheumatology examinations author does not report any financial or personal links with other persons or organizations , which might affect negatively the content of this publication and/or claim authorship rights to this publication .

the application of 3d imaging in pediatric rheumatology helps to make the assessment of inflammatory changes more objective and to estimate accurately their volume and the actual response to treatment in the course of follow - up examinations . additional interesting opportunities are opened up by the vascularity analysis with the help of power doppler and color doppler in 3d imaging . contrast - enhanced ultrasound examinations enable a more sensitive assessment of the vascularity of inflamed structures of the locomotor system , and a more accurate analysis of treatment 's effect on changes in vascularity , and thereby the inflammation process activity , as compared to the classical options of power and color doppler . the equipment required , time limitations , as well as the high price in the case of contrast - enhanced ultrasound , contribute to the fact that the 3d analysis of inflammatory changes and contrast - enhanced ultrasound examinations are not routinely applied for pediatric patients .

You are an expert at summarizing long articles. Proceed to summarize the following text: meningiomas account for approximately 30% of all primary intracranial tumors , and the majority are benign . the growth rate is variable in these tumors , and after radiographic diagnosis a large proportion of meningiomas frequently plateau in size and either stop growing or grow very slowly.1 asymptomatic solitary meningiomas are therefore typically managed with clinical and radiographic follow - up . the relationship between meningiomas and sex hormones is well known , and a growing number of reports have illustrated regression of meningiomas after hormonal withdrawal.2 3 4 regression after intratumoral hemorrhage has also been reported,5 whereas spontaneous regression is probably extremely rare.6 here , we report regression of a meningioma associated with 1-blocker treatment for benign prostatic hyperplasia ( bph ) , a drug that has previously not been linked directly to regression of meningioma . the patient did not present with , or went through , intratumoral hemorrhage , which would explain the regression . a 59-year - old male patient had experienced slight memory problems and unspecific visual disturbances . the initial magnetic resonance imaging ( mri ) showed a lateral sphenoid wing meningioma on the right side with a maximum diameter of 43 mm , and the estimated tumor volume was 29.9 cm ( fig . c ) . the tumor showed all typical characteristics of a meningioma including extra - axial location , contrast enhancement , and dural tail . the tumor was considered an incidental finding , the surgery was not recommended and the patient was followed with serial mri . the first control mri after 12 months demonstrated that the tumor was reduced by 50% to 14.8 cm ( fig . the tumor had shrunken further to 10.0 cm ( not shown ) . on the last mri after 37 months the tumor was reduced further to 6.7 cm , that is a reduction of 78% from the initial volume ( fig . ( a c ) at diagnosis ( october , 2010 ) showing a right - sided typical sphenoid wing meningioma with a maximum diameter of 43 mm and an estimated tumor volume of 29.9 cm . ( d f ) after 12 months ( october , 2011 ) , the tumor volume was reduced to 14.8 cm . ( g i ) after 37 months ( november , 2013 ) , the tumor volume was reduced further to 6.7 cm . the patient did not receive any steroid medication before or during the follow - up . he had not been treated for any malignant disease . during the follow - up , however , the patient was treated with an 1-adrenoceptor antagonist ( tamsulosin ) for bph . data regarding the natural history of untreated meningiomas have been published in several studies , but evidence - based guidelines for treatment of patients with small meningiomas are still lacking . in patients selected for observation , sughrue et al found that 51% of untreated meningiomas < 2.5 cm in largest diameter demonstrate no growth over a follow - up period of 4.6 years , and that an additional 26% grew < 10% per year.7 since most meningiomas are benign tumors , the principal reason to treat meningiomas is to relieve symptoms related to tumor compression of surrounding neurological structures , or to arrest growth in small asymptomatic tumors documented to be growing on serial imaging . the fact that intracranial meningiomas arise in women at 2 to 3 times the incidence for men , along with modulation of meningioma biology during pregnancy , suggests a plausible link . hormone receptor analyses have revealed that , unlike breast cancer , meningiomas are commonly strongly progesterone receptor - positive , but only rarely and weakly estrogen receptor - positive.8 progesterone receptors are expressed predominantly in benign meningiomas with low proliferation indices.9 whereas progesterone - agonist treatment may promote growth in meningiomas,10 11 treatment with the antiprogesterone receptor agent mifepristone may induce regression.12 13 14 it has been suggested that multiple meningiomas possess more hormonal dependency than an isolated meningioma since there is a higher female preponderance ( sex ratio 8.8/1 in multiple meningiomas vs. 23/1 in solitary meningiomas ) . regression of multiple tumors has been observed after cessation of long - term progesterone agonist therapy.4 regression of a meningioma has been reported in an 80-year - old male patient with bph following change of medication from chlormadinone acetate ( a progestin steroid with an antiandrogen and antigonadotropic effect ) to naftopidil ( 1-adrenoceptor antagonist).2 the cessation of the progesterone agonist was interpreted as the explanation for the effect on tumor , but in light of the present case report , we propose that the observed regression could as well be due to the introduced 1-blocker or a combination of the two drugs . the 1-receptor is a mediator of contraction in smooth muscles , and can be found in skin , sphincters , gastrointestinal tract , nerves , and brain . a possible explanation for an induced regression of meningioma by 1-blockade could be decreased effect of receptor activation that maintains growth and sustains the size of the tumor.15 16 whether meningiomas express adrenoceptors , however , has not been extensively investigated . the first logical step would therefore be to perform receptor analysis to investigate whether meningiomas express adrenoceptors to any extent or other receptors that may represent targets for designed drug therapy . biopsies from all patients operated for meningiomas at our hospital are stored and are available for later investigations . some recent studies show that the 1-adrenoceptor antagonist naftopidil induces apoptosis in malignant mesothelioma cells by activating caspase-8 in association with upregulated tumor necrosis factor- and increased fasl secretion followed by the effector caspase-3.17 studies of 1-adrenoceptor blockade and tumor treatment have mainly been done on prostate cancer , renal cell tumors , malignant pleural mesothelioma , and bladder tumors.18 19 due to the high incidence of meningiomas and the large proportion of small tumors that do not grow , a relatively large group of patients are currently followed for incidental meningiomas without treatment . the encouraging observation in our patient warrants further appropriate evaluation of 1-adrenoceptor blockade in a prospective trial with accurate volumetric assessment in a preselected population with incidental meningiomas . men above the age of 60 would for natural reasons be good candidates , but since 1-blockers have a low adverse effect profile a study group should not necessarily be that restricted . we are able to match our national drug registry with the cancer registry and thereby identify eligible patients . this report of regression of an asymptomatic meningioma associated with 1-antagonist treatment is a reminder that treatment of incidental meningiomas must be based on thorough consideration of the patients medication history , especially in elderly men undergoing endocrine therapy for prostate disease and women treated for uterine cancer . whereas surgery and occasionally radiation therapy are standard treatment for solitary meningiomas , these treatment modalities are not suitable for meningomatosis . the prospect of medical treatment is furthermore tempting in multiple meningiomas and recurrent disease , since surgery and radiation often are insufficient . although approximately 50% of incidentally diagnosed meningiomas do not grow , genuine spontaneous regression is extremely rare . however , a few cases of regression after progestative hormonal treatment withdrawal have been reported . furthermore , regression of a meningioma has been reported in a male after changing the medication for bph from progesterone agonist therapy to 1-blocker . we here report regression of a meningioma to 22% of the initial volume after 3 years during treatment with 1-adrenoceptor antagonist , indicating an association between the adrenoceptor blocking and the observed regression of the meningioma . after the last mri ( 3-years follow - up ) , 1-blocker treatment was discontinued . if the meningioma should regrow , we have to consider putting the patient back on 1-adrenoceptor blocker or should we alternatively operate the tumor to study its receptor expression ?

background regression of meningioma has been reported after hemorrhage or hormonal withdrawal . here , we report a case of an incidentally diagnosed meningioma that regressed in association with 1-adrenoceptor antagonist . case report a 59-year old male patient with an incidentally diagnosed lateral sphenoid wing meningioma was followed with serial magnetic resonance imaging . the tumor with a maximum diameter of 43 mm showed progressive regression , and after 3 years the size was reduced to 22% of the initial volume . during follow - up the patient was treated with an 1-adrenoceptor antagonist ( tamsulosin ) for benign prostatic hyperplasia . possible mechanisms are discussed , including our main hypothesis of reduced mitogenic effects through phospholipase c - signal transduction . conclusion this is the first report of regression of an incidentally diagnosed meningioma associated with 1-adrenoceptor antagonist treatment .

You are an expert at summarizing long articles. Proceed to summarize the following text: research shows that many women with bc experience major depression and generalized anxiety disorder.2 significantly higher incidences of post - traumatic stress disorder and higher scores on emotional distress were also observed in women with breast cancer.3 one well - studied biological mechanism leading to anxiety , depression , and stress ( ads ) is cytokine - induced behavioral changes in sick individuals.4 there are both clinical and experimental evidence indicating that activation of the brain cytokine system is related to depression.4 cytokine activation not only relates to depression but also to cancer development.4 lyon et al have shown that many groups of cytokines were elevated in women with bc.5 another biological change ( other than cytokine activation ) that has recently emerged as a potential mechanism for the development of depression is epigenetics.1 dna methylation can prevent enzymes from binding to the promoter region of a gene and thereby cause up- or down - regulation of dna transcription,1 with these effects potentially being present for sites throughout the genome . an alternative means for altering the expression of genes is through position effects for genes localized near the telomere ( the ends of the chromosomes).6,7 as telomeres shorten , the reduction of heterochromatin could result in alterations in chromatin conformation , which leads to changes in the expression of nearby genes.8,9 furthermore , shortening of telomeres is associated with increased levels of chromosomal instability , which , in turn , could lead to alterations in gene expression . it has been shown that accelerated telomere shortening is associated with psychosocial stress,10 and that hypermethylation is associated with panic disorder.11 although there are growing numbers of research studies indicating that epigenetic changes are associated with ads , there is currently no evidence that this association is present in women with bc . the goal of this study is to identify methylation patterns that are associated with three psychoneurological symptoms , ads , in women with bc . a commonly used and well - validated questionnaire to measure anxiety and depression is the hospital anxiety and depression scale ( hads),12 and a widely used and well - validated instrument for measuring perceived stress is the perceived stress scale ( pss).13 genome - wide methylation was assessed using the high - throughput illumina human methylation 450k assay . traditionally , univariate models have been used to examine the relationship between molecular features and each outcome variable ( ads ) ; nevertheless , analyzing multiple outcome variables globally has become more frequent in many fields of biomedical research.14 in fact , this approach is especially helpful for evaluating traits that appear related . for example , evidence that stress is related to depression and anxiety in women with bc comes from the results of a study by varni et al , who found that higher levels of perceived stress were associated with increased depression and anxiety among survivors of childhood cancer.15 therefore , instead of fitting separate univariate models to each psychoneurological symptom , ads can be treated as a cluster of related symptoms and included together in a multivariate linear model . hence , an overarching goal of this study is to compare and contrast univariate and multivariate models when identifying molecular features associated with ads in women with bc . the study included 73 women with bc in stage i ( n = 21 ) , ii ( n = 44 ) , or iii ( n = 8) . this research was approved by the institutional review board at virginia commonwealth university ( vcu irb # hm 13194 ) and complied with the principles of the declaration of helsinki . the molecular features and ads the severity of depression and anxiety was measured using the hads , which is a 14-item questionnaire.12 among the 14 items , 7 assess anxiety and 7 assess depression . each item is on a four - level ordinal scale , the scale response is calculated such that the ordinal levels contribute 03 points , and the 14 items within each scale are summed . using these sums , subjects may be classified as normal ( score < 8) , borderline ( 810 ) , or having clinical anxiety or depression ( score > 10).16 although the scale has an ordered structure , we used the continuous version of hads in order to maintain all the information in the scale and protect power . stress was evaluated using a 10-item pss.17 pss was designed to measure the degree to which situations in one s life are appraised as stressful.13 items were designed to monitor how unpredictable , uncontrollable , and overloaded a respondent s life is by asking about the respondent s feelings and thoughts during the last month.17 of the 10 total responses on the pss , 6 were negative responses and were given the following numerical value : never = 0 ; almost never = 1 ; sometimes = 2 ; fairly often = 3 ; and very often = 4 . the remaining four positive items in the pss were scored in a reversed format according to standard approaches ( ie , never = 4 ; ; very often = 0).18,19 the scores were summed , with the higher total scores of pss indicating higher overall stress.17 the illumina human methylation 450k assay was used to profile human dna methylation using whole blood from women diagnosed with breast cancer . the -values were defined as the proportion methylated , and were reported for each cpg site using the minfi bioconductor package20 in the r programing environment.21 -values were plotted against the percentage of gc content across all samples . based on the results , cpg sites with gc content greater than 40% were filtered out . cpg sites with all -values over 0.9 or below 0.1 were considered to be constitutively methylated or unmethylated and therefore were excluded from the study.22 because single nucleotide polymorphisms ( snps ) may affect the performance of this assay,23 the cpg sites containing snps were also excluded . the illumina human methylation 450k assay uses two types of probe designs : infinium i and infinium ii . peak correction was used to align the m - values produced by the two types of probe designs ( m - value = log(/(l )).24 in this study , five subjects had multiple methylation profiles : because these profiles were highly correlated , the mean methylation levels were used . after taking the average , the m - values were back - transformed into -values , which were used in the analysis . the hads and pss scales were first examined using descriptive statistics . to identify the molecular features significantly associated with each of the scales , a linear regression model was fit to each of the 285,173 cpg sites . the p - values obtained from the linear regression models were adjusted using the benjamini based on the results , it seemed reasonable to fit a multivariate linear mixed model by combining all scales . the mixed model included a methylation component , two dummy coded indicators representing the type of psychoneurological symptom with anxiety as referent level , and the interactions between each indicator and the methylation component . in addition , the model included a subject - specific term to account for the correlation among scales . to illustrate the model with a formula , let yij represent the hads - anxiety , hads - depression , and pss outcome for i th subject , where j = l , 2 , or 3 , respectively . the model can then be expressed as yij=+1xi1+2xi2+3xi3+4xi4+5xi5+bi+ijwhere xi1 and xi2 are indicators representing depression and stress , xi3 is a methylation component , xi4 is the interaction between depression and the methylation component , and xi5 is the interaction between stress and the methylation component . the and the terms are the intercept and the slope coefficients , respectively , bi is the random subject effect , and ij is the sample error . the null hypothesis of no association between the methylation signature and ads across different psychological disorders was tested by the interaction effect . the likelihood ratio tests were used to compute p - values , and the resulting p - values were again adjusted using the bh method to control the fdr . in order to compare the performance of the multivariate models versus the separate models , all statistical analyses were performed using the r programming environment ( version 3.0.2 ) and the lme4 package.21 the study included 73 women with bc in stage i ( n = 21 ) , ii ( n = 44 ) , or iii ( n = 8) . this research was approved by the institutional review board at virginia commonwealth university ( vcu irb # hm 13194 ) and complied with the principles of the declaration of helsinki . the molecular features and ads the severity of depression and anxiety was measured using the hads , which is a 14-item questionnaire.12 among the 14 items , 7 assess anxiety and 7 assess depression . each item is on a four - level ordinal scale , the scale response is calculated such that the ordinal levels contribute 03 points , and the 14 items within each scale are summed . using these sums , subjects may be classified as normal ( score < 8) , borderline ( 810 ) , or having clinical anxiety or depression ( score > 10).16 although the scale has an ordered structure , we used the continuous version of hads in order to maintain all the information in the scale and protect power . stress was evaluated using a 10-item pss.17 pss was designed to measure the degree to which situations in one s life are appraised as stressful.13 items were designed to monitor how unpredictable , uncontrollable , and overloaded a respondent s life is by asking about the respondent s feelings and thoughts during the last month.17 of the 10 total responses on the pss , 6 were negative responses and were given the following numerical value : never = 0 ; almost never = 1 ; sometimes = 2 ; fairly often = 3 ; and very often = 4 . the remaining four positive items in the pss were scored in a reversed format according to standard approaches ( ie , never = 4 ; ; very often = 0).18,19 the scores were summed , with the higher total scores of pss indicating higher overall stress.17 the illumina human methylation 450k assay was used to profile human dna methylation using whole blood from women diagnosed with breast cancer . the -values were defined as the proportion methylated , and were reported for each cpg site using the minfi bioconductor package20 in the r programing environment.21 -values were plotted against the percentage of gc content across all samples . based on the results , cpg sites with gc content greater than 40% were filtered out . cpg sites with all -values over 0.9 or below 0.1 were considered to be constitutively methylated or unmethylated and therefore were excluded from the study.22 because single nucleotide polymorphisms ( snps ) may affect the performance of this assay,23 the cpg sites containing snps were also excluded . the illumina human methylation 450k assay uses two types of probe designs : infinium i and infinium ii . peak correction was used to align the m - values produced by the two types of probe designs ( m - value = log(/(l )).24 in this study , five subjects had multiple methylation profiles : because these profiles were highly correlated , the mean methylation levels were used . after taking the average , the m - values were back - transformed into -values , which were used in the analysis . the hads and pss scales were first examined using descriptive statistics . to identify the molecular features significantly associated with each of the scales , a linear regression model was fit to each of the 285,173 cpg sites . the p - values obtained from the linear regression models were adjusted using the benjamini based on the results , it seemed reasonable to fit a multivariate linear mixed model by combining all scales . the mixed model included a methylation component , two dummy coded indicators representing the type of psychoneurological symptom with anxiety as referent level , and the interactions between each indicator and the methylation component . in addition , the model included a subject - specific term to account for the correlation among scales . to illustrate the model with a formula , let yij represent the hads - anxiety , hads - depression , and pss outcome for i th subject , where j = l , 2 , or 3 , respectively . the model can then be expressed as yij=+1xi1+2xi2+3xi3+4xi4+5xi5+bi+ijwhere xi1 and xi2 are indicators representing depression and stress , xi3 is a methylation component , xi4 is the interaction between depression and the methylation component , and xi5 is the interaction between stress and the methylation component . the and the terms are the intercept and the slope coefficients , respectively , bi is the random subject effect , and ij is the sample error . the null hypothesis of no association between the methylation signature and ads across different psychological disorders was tested by the interaction effect . the likelihood ratio tests were used to compute p - values , and the resulting p - values were again adjusted using the bh method to control the fdr . in order to compare the performance of the multivariate models versus the separate models , the fdr thresholds used in the multivariate mixed model was set at 0.02 . all statistical analyses were performed using the r programming environment ( version 3.0.2 ) and the lme4 package.21 although the distribution of hads - depression is skewed somewhat to the right , based on the central limit theorem , the mean of hads - depression will follow a gaussian distribution due to the large sample size ( n = 73).25 pearson s correlation between anxiety and depression , anxiety and stress , and depression and stress were 0.657 , 0.668 , and 0.715 , respectively , indicating that the three outcome scales were highly correlated ; the scatterplot matrix supported this conclusion ( fig . when fitting separate models for each ads scale , among 285,173 cpg sites , the sites with illumina s cpg loci i d ( ilmnid ) cg14474520 , cg17527195 , and cg23431989 were significantly associated with depression ( table 2 ) . further investigation suggested that the methylation level at sites cg14474520 and cg23431989 were positively associated with depression ( slope coefficients : 104.6 and 70.52 ) . however , at site cg17527195 , the methylation level was negatively associated with depression ( slope coefficient : 39.42 ) . the cpg site cg14474520 is located on gene fam101a , and the cpg site cg23431989 is located on gene foxj1 . both fam101a and foxj1 are cancer - related genes . it has been shown that down - regulation of fam101a significantly reduces early apoptosis in rko colorectal cancer cells.26 recent studies have suggested that foxj1 may be involved in the development of more than one cancer . foxj1 can function as a tumor suppressor in breast cancer.27 it is also involved in adverse clinical outcome in ovarian cancers.28 chen et al found that high expression of foxj1 is associated with prognosis and tumor cell proliferation in hepatocellular carcinoma.27 the cpg site cg17527195 can not be mapped to any known genes at this time . after fitting multivariate models , the p - value histograms support the notion that the multivariate model is more powerful in identifying significant cpg sites ( fig . the observed p - values for the cpg sites from the multivariate models are skewed more to the right compared to the three separate models ( fig . the multivariate models identified 8,535 ads - related cpg sites ( fdr < 0.02 ) . these 8,535 significant cpg sites are located in different regions including 4,652 open sea ( 54.5% ) , 797 cpg islands ( 9.3% ) , 622 north shelf ( 7.3% ) , 1,099 north shore ( 12.9% ) , 518 south shelf ( 6% ) , and 847 south shore ( 9.9% ) sites . the cpg islands were defined as dna sequences with greater than 50% gc bases and more than 60% cpg observed / expected ratio . the 2-kb sequences upstream and downstream of the cpg islands were defined as north and south shores , respectively , and the 2-kb sequences directly upstream and downstream of the shores were referred to as north or south shelves , respectively . dna methylation sites in regions other than these are annotated as open sea.23 smaller numbers of significant sites can be identified by decreasing the fdr threshold ( fdr = 0.01 , number of significant sites = 6847 ; fdr = 0.005 , number of significant sites = 4579 ; fdr = 0.001 , number of significant sites = 8) . the information for the eight significant cpg sites when fdr = 0.001 are shown in table 3 . of particular interest among these eight significant sites is cg22749855 , which is located within the socs3 gene and is associated with a gene promoter . socs3 is a well - studied oncogene , and hypermethylation of the socs3 promoter is an important regulatory mechanism for ulcerative colitis - related colorectal cancer.29 interestingly , ulcerative colitis - related colorectal cancer is a condition that has also been associated with telomere shortening.30 using the mouse as a model , researchers have found that the socs3 gene is involved in depression in the mouse brain.31 socs3 has also been shown to play a role in limiting axon regeneration.32 another interesting cpg site is cg11334709 , which is located within the pik3cd gene . the pik3cd gene is associated with schizophrenia and increased expression of pik3cd has been observed with a variation of erb4 , a critical neurodevelopmental gene.33 figure 5 demonstrates how methylation is differently associated with the three psychoneurological symptoms at these eight significant cpg sites . additionally , we examined the robustness of our results by analyzing the modified version of hads ( hads with items 7 , 11 , and 12 removed).16 the modified hads was able to identify a larger number of significant cpg sites when fitting mixed models using an fdr of 0.02 ( 10,856 sites ) . however , the univariate analyses using the modified hads did not yield any significant cpg sites when the fdr was 0.02 . these results are consistent with the unmodified hads results , where we found 8,535 cpg sites significant when fitting mixed models but none that were significant univari - ately for anxiety or pss , and only three that were significant univariately for depression . although hads is commonly used to measure anxiety and depression , many researchers have argued that hads suffers from issues such as lack of consensus on an optimal cutpoint for detecting anxiety and depression , problematic fit of some items , and contradictory results regarding optimal dimensional structures.16 lambert suggested that , instead of using the original 14 items , removing items 7 , 11 , and 12 can improve the model fit.16 although in this current study the full hads was analyzed to allow for comparisons of results with other published work , we also analyzed the modified hads so that the results could be compared with the analysis of the original scale . for our methylation data , both the unmodified and modified hads were able to identify a larger number of significant cpg sites when fitting mixed models using an fdr of 0.02 ( 8,535 and 10,856 cpg sites , respectively ) in comparison with the univariate models . in fact , the univariate analyses using the modified hads did not yield any significant cpg sites for anxiety , depression , or perceived stress , which is similar to the unmodified hads that only detected three cpg sites , all of which were significantly associated with depression . the sensitivity study conducted by illumina stated that the human methylation 450 assay is reliable when detecting a -value of at least 0.2.23 when comparing two groups , is the difference between the mean -values in the two groups . because our outcome was continuous , we defined as the range of -values . among three significant cpg sites found by separate models , only cg17527195 had a greater than 0.2 ( 0.22 ) ; therefore , caution is needed when investigating the other two sites . among 8,535 significant cpg sites found by the multivariate models using the unmodified hads , the results of our study demonstrate that the multivariate mixed model is more powerful than fitting separate models . figure 4 further demonstrated that the p - value distribution from the multivariate models was more skewed to the right compared to those from the univariate models , giving rise to more significant findings at a fixed fdr . therefore , when analyzing correlated psychoneurological symptom outcomes , multivariate models are recommended . in the future , we will additionally have each patient s cytokine levels assayed using the bioplex system , telomere lengths using a fluorescent in situ hybridization ( fish)-based assay , and illumina methylation levels at baseline and at several follow - up time points .

breast cancer ( bc ) is the second most common cancer among women . research shows many women with bc experience anxiety , depression , and stress ( ads ) . epigenetics has recently emerged as a potential mechanism for the development of depression.1 although there are growing numbers of research studies indicating that epigenetic changes are associated with ads , there is currently no evidence that this association is present in women with bc . the goal of this study was to identify high - throughput methylation sites ( cpg sites ) that are associated with three psychoneurological symptoms ( ads ) in women with bc . traditionally , univariate models have been used to examine the relationship between methylation sites and each psychoneurological symptom ; nevertheless , ads can be treated as a cluster of related symptoms and included together in a multivariate linear model . hence , an overarching goal of this study is to compare and contrast univariate and multivariate models when identifying methylation sites associated with ads in women with bc . when fitting separate linear regression models for each ads scale , 3 among 285,173 cpg sites tested were significantly associated with depression . two significant cpg sites are located on their respective genes fam101a and foxj1 , and the third site can not be mapped to any known gene at this time . in contrast , the multivariate models identified 8,535 ads - related cpg sites . in conclusion , when analyzing correlated psychoneurological symptom outcomes , multivariate models are more powerful and thus are recommended .

You are an expert at summarizing long articles. Proceed to summarize the following text: enteral nutrition reportedly improves the pathologic and nutritional conditions of patients in the acute phase after surgery and of those with malignant head - and - neck or esophageal tumours . percutaneous endoscopic gastrostomy ( peg ) was developed as a means of securing a route for enteral nutrition in patients with dysphagia owing to various causes . peg tubes are widely used as a convenient and effective route to deliver enteral nutrition as well as to decompress the gastrointestinal tract . according to japanese guidelines , peg is widely performed and is indicated for patients unable to voluntarily ingest by mouth owing to cerebrovascular disorders or dementia and patients with repeated aspiration pneumonia . enteral nutrition has been used in patients who have difficulty in oral ingestion . with the advent of peg , tube replacement became relatively easy ; thus , gastrostomy is generally selected when oral ingestion becomes difficult . although the efficacy of gastrostomy is medically proven , there has been debate over the indications for peg in recent years , particularly with regard to its use in elderly patients . the japan geriatric society published a guideline on the decision - making process for health care for the elderly in june 2012 , noting that use of feeding tubes is a treatment option that should be included in the decision - making process that involves professionals , patients , and relatives . however , there have been no studies that have investigated underlying diseases requiring peg , decision - making process for peg , and the level of satisfaction of patients after peg in japan . to understand the current situation of peg , we retrospectively analyzed the underlying diseases and conditions of patients who underwent peg in a provincial city in japan . we also sent a questionnaire to the patients and their families to ask them about their satisfaction with and thoughts about peg . this study included 545 patients who underwent peg at yuri kumiai general hospital , akita , japan , between february 2000 and december 2010 . in september 2014 , we reviewed the medical records of these patients for the following information : underlying diseases , levels of consciousness , and independence in activities of daily living . the level of consciousness was determined using the japan coma scale ( jcs ) and the bedridden level was determined using the eastern cooperative oncology group ( ecog ) scale of performance ( tables 1 - 1 and 1 - 2table 1 - 1japan coma scale ( jcs)scoreidelirium , confusion , senselessnessiistupor , lethargy , hypersomnia , somnolence , drowsinessiiideep coma , coma , semicomatable 1 - 2eastern cooperative oncology group ( ecog ) scale of performance statusscore0normal activity1symptoms , but nearly fully ambulatory2some bed time , but needs to be in bed less than 50% of normal daytime3need to be in bed greater than 50% of normal daytime4unable to get out of bed ) . we also sent a questionnaire survey to the patients and patients families between december 2012 and may 2013 . the questionnaire consisted of the following questions : q1 who made the decision mainly for the patient to undergo peg ? q4 would you wish to undergo peg if you were in the same condition ? this study was approved by the institute review board of yuri kumiai general hospital ( march 16 , 2012 ) . all patients and patients family members who answered the questionnaire provided written informed consent . peg tubes were placed by the pull method using a safety peg kit ( boston scientific japan k.k . , tokyo , japan ) until 2005 and thereafter were placed by the modified introducer technique using a kangaroo seldinger peg kit ( covidien , medtronic , tokyo , japan ) after fixation using a funada - style fixture ( create medic co. , ltd . peg was not indicated for patients with a history of gastrectomy or patients suspected of having other organs between the gastric and abdominal walls . of the 545 patients with peg tube placement , 295 were men and 250 were women , with a mean age of 77.2 11.4 years ( range : 19 peg was indicated most frequently for cerebrovascular disorders , which accounted for 43.8% ( 239/545 ) of the cases , followed by aspiration pneumonia ( 24.0% ) , malignant tumors ( 6.4% ) , and neurological disorders ( 4.4% ) ( table 2 - 1table 2 - 1baseline characteristics of the patientsnumber ( men / women)295/250mean age , years ( range)77 ( 1998)disease at the time of pegn ( % ) cerebrovascular disorders239 ( 43.9)aspiration pneumonitis131 ( 24.0)malignant tumors35 ( 6.4)neurological disorders24 ( 4.4)dementia23 ( 4.2)others93 ( 17.1)peg : percutaneous endoscopic gastrostomy . ) . peg : percutaneous endoscopic gastrostomy . among the 397 patients ( 72.8% ) at level i of the jcs , only 30 patients were lucid and were able to make their own decision about peg tube placement ; this accounted for 5.5% of all patients who underwent peg tube placement . approximately 90% of patients had a consciousness level at which they were unable to say their own names or date of birth , or worse ( table 2 - 2table 2 - 2consciousness disturbance of the patientsjcs scorenumber of patients ( % ) i397 ( 72.8)(lucid)30 ( 5.5)ii110 ( 20.2)iii8 ( 1.5 ) ) . more than 80% of the patients were classified as grade 4 of the ecog scale of performance status , which is a bedridden state ( table 2 - 3table 2 - 3performance status of the patientsecog scorenumber of patients ( % ) 0110 ( 1.8)211 ( 2.0)380 ( 14.7)4444 ( 81.5 ) ) . the number of patients classified as grade 0 or 1 , indicating regarding the outcomes of patients after peg tube placement , 124 patients ( 22.8% ) became able to receive home medical care , and more than half were transferred to hospitals or nursing care facilities for recuperation . eighty - six patients ( 15.8% ) could not be discharged after peg and died during hospitalization at our hospital ( table 3table 3place of recuperation after peg tube placementplacenumber of patients ( % ) home124 ( 22.8)hospital for recuperation178 ( 32.7)nursing care facility142 ( 26.1)death at our hospital86 ( 15.8)unknown15 ( 2.8)peg : percutaneous endoscopic gastrostomy . ) . follow - up after peg was possible in 493 patients ( 90.4% ) for a median of 864 days ( range 45 , 282 days ) . confirmation of the survival or death of patients was performed by telephone or letter to the patients family . there were a total of 434 deaths ( 79.6% ) ; 34 deaths ( 6.2% ) occurred within 30 days after surgery , 207 deaths ( 38.0% ) occurred within 1 year , and 339 deaths ( 62.2% ) occurred within 3 years . questionnaires were sent to the patients and patients families . because the whereabouts of the families of 56 patients were unknown , questionnaires were sent to the 489 ( 489/545 89.7% ) patients who underwent peg tube placement between february 2000 and december 2010 . we received responses from one patient himself and 316 patients families ( 317/489 , 64.8% ) . at that time , 51 patients were alive and only one patient could answer the questionnaire by himself . the results of the questionnaire survey are shown in table 4table 4results of the questionnaire surveyq1 : who made the decision for the patient to undergo gastrostomy?patient8 ( 2.4%)patient s family194 ( 61.2%)doctor96 ( 30.3%)other13 ( 6.1%)q2 : was oral ingestion possible after gastrostomy?yes54 ( 17.0%)no263 ( 83.0%)q3 : was performing gastrostomy a good decision?yes182 ( 57.4%)no79 ( 24.9%)not clear56 ( 17.7%)q4 : would you wish to undergo gastrostomy if you were in the same condition as the patient?yes90 ( 28.3%)no175 ( 55.2%)not clear52 ( 16.5% ) . with regard to the person who made the decision mainly about peg tube placement , patients families most often made the decision , accounting for 61.2% ( 194/317 ) , and this was followed by the doctors ( 30.3% ) and patients themselves ( 2.4% ) . after peg tube placement , only 17.0% ( 54/317 ) of the patients became able to ingest food orally . when asked 57.5% of the patients families ( 182/316 ) answered yes , whereas 25.0% ( 79/316 ) answered no . on the other hand , when the patients family members were asked if they would wish to undergo peg if they were in the same condition as the patient , 28.4% ( 90/316 ) answered yes , whereas 55.3% ( 175/316 ) answered no . of the 545 patients with peg tube placement , 295 were men and 250 were women , with a mean age of 77.2 11.4 years ( range : 19 peg was indicated most frequently for cerebrovascular disorders , which accounted for 43.8% ( 239/545 ) of the cases , followed by aspiration pneumonia ( 24.0% ) , malignant tumors ( 6.4% ) , and neurological disorders ( 4.4% ) ( table 2 - 1table 2 - 1baseline characteristics of the patientsnumber ( men / women)295/250mean age , years ( range)77 ( 1998)disease at the time of pegn ( % ) cerebrovascular disorders239 ( 43.9)aspiration pneumonitis131 ( 24.0)malignant tumors35 ( 6.4)neurological disorders24 ( 4.4)dementia23 ( 4.2)others93 ( 17.1)peg : percutaneous endoscopic gastrostomy . ) . peg : percutaneous endoscopic gastrostomy . among the 397 patients ( 72.8% ) at level i of the jcs , only 30 patients were lucid and were able to make their own decision about peg tube placement ; this accounted for 5.5% of all patients who underwent peg tube placement . approximately 90% of patients had a consciousness level at which they were unable to say their own names or date of birth , or worse ( table 2 - 2table 2 - 2consciousness disturbance of the patientsjcs scorenumber of patients ( % ) i397 ( 72.8)(lucid)30 ( 5.5)ii110 ( 20.2)iii8 ( 1.5 ) ) . more than 80% of the patients were classified as grade 4 of the ecog scale of performance status , which is a bedridden state ( table 2 - 3table 2 - 3performance status of the patientsecog scorenumber of patients ( % ) 0110 ( 1.8)211 ( 2.0)380 ( 14.7)4444 ( 81.5 ) ) . the number of patients classified as grade 0 or 1 , indicating regarding the outcomes of patients after peg tube placement , 124 patients ( 22.8% ) became able to receive home medical care , and more than half were transferred to hospitals or nursing care facilities for recuperation . eighty - six patients ( 15.8% ) could not be discharged after peg and died during hospitalization at our hospital ( table 3table 3place of recuperation after peg tube placementplacenumber of patients ( % ) home124 ( 22.8)hospital for recuperation178 ( 32.7)nursing care facility142 ( 26.1)death at our hospital86 ( 15.8)unknown15 ( 2.8)peg : percutaneous endoscopic gastrostomy . ) . follow - up after peg was possible in 493 patients ( 90.4% ) for a median of 864 days ( range 45 , 282 days ) . confirmation of the survival or death of patients was performed by telephone or letter to the patients family . there were a total of 434 deaths ( 79.6% ) ; 34 deaths ( 6.2% ) occurred within 30 days after surgery , 207 deaths ( 38.0% ) occurred within 1 year , and 339 deaths ( 62.2% ) occurred within 3 years . questionnaires were sent to the patients and patients families . because the whereabouts of the families of 56 patients were unknown , questionnaires were sent to the 489 ( 489/545 89.7% ) patients who underwent peg tube placement between february 2000 and december 2010 . we received responses from one patient himself and 316 patients families ( 317/489 , 64.8% ) . at that time , 51 patients were alive and only one patient could answer the questionnaire by himself . the results of the questionnaire survey are shown in table 4table 4results of the questionnaire surveyq1 : who made the decision for the patient to undergo gastrostomy?patient8 ( 2.4%)patient s family194 ( 61.2%)doctor96 ( 30.3%)other13 ( 6.1%)q2 : was oral ingestion possible after gastrostomy?yes54 ( 17.0%)no263 ( 83.0%)q3 : was performing gastrostomy a good decision?yes182 ( 57.4%)no79 ( 24.9%)not clear56 ( 17.7%)q4 : would you wish to undergo gastrostomy if you were in the same condition as the patient?yes90 ( 28.3%)no175 ( 55.2%)not clear52 ( 16.5% ) . with regard to the person who made the decision mainly about peg tube placement , patients families most often made the decision , accounting for 61.2% ( 194/317 ) , and this was followed by the doctors ( 30.3% ) and patients themselves ( 2.4% ) . after peg tube placement , only 17.0% ( 54/317 ) of the patients became able to ingest food orally . 57.5% of the patients families ( 182/316 ) answered yes , whereas 25.0% ( 79/316 ) answered no . on the other hand , when the patients family members were asked if they would wish to undergo peg if they were in the same condition as the patient , 28.4% ( 90/316 ) answered yes , whereas 55.3% ( 175/316 ) answered no . to understand the current situation of peg tube placement in a japanese provincial city , we examined underlying diseases requiring peg and independence at the time of peg and sent qualitative questions associated with peg to patients and patients families . the rate of person 65 years or older was 29.4% in our city in 2012 . underlying diseases requiring peg tube placement were mostly cerebrovascular disorders and aspiration pneumonia . regarding the level of independence , most patients undergoing peg required assistance . in countries other than japan , peg tube placement is not proactively indicated for patients with dementia or elderly patients receiving end - stage medical care because there is doubt about the efficacy and improvement in survival rate in such patients who undergo peg tube placement . in this study , we obtained responses , mostly from patients families , to questions concerning the level of satisfaction with and thoughts about peg . the decision to undergo peg tube placement was made in most cases by the patients families or physicians . in japan , peg tube placement can currently be performed without obtaining consent from the patients themselves . only 17% of patients became able to ingest food orally , indicating that it is rare for many patients to achieve dramatic recovery in swallowing function when peg is selected as a method to prolong life . while 57% the family members replied yes when asked if undergoing peg was a good decision , only 28% would wish to undergo peg if they were in the same condition as the patients . there is a difference between the decision made by the patients families and family members opinion about peg tube for themselves . when considering peg tube placement , appropriate medical judgment and consideration of ethics are required . however , as the patients requiring peg often can not make choice for themselves , family members must make the choice on the patient s behalf in many cases . in these cases , the decision to insert a peg tube is influenced strongly by the family s emotions , social traditions , and public opinion . we examined underlying diseases requiring peg and thoughts of the patients families about peg in a provincial hospital in japan . second , the treatment period ( undergoing peg ) and questionnaire period were varying different . third , only 30 patients ( 5.5% ) were lucid when they underwent peg tube placement . nevertheless , the level of satisfaction with and thoughts about peg could be measured after a long - term progress and our trial about the questionnaire survey after peg was the first one in japan . it was crucial and helpful one for consideration about the future indications of peg . prospective studies of patients and patient s families should be performed by using questionnaire surveys to clarify the quality of life and ethical aspects associated with peg . conflict of interest : the authors declare that they have no competing of interests .

background : there has been debate over the indications for percutaneous endoscopic gastrostomy ( peg ) in recent years in japan . in addition , the level of satisfaction of patients and patient s family after peg remains unclear . the aim of this study was to investigate the current status of peg and the level of satisfaction of patients and patients families after peg in japan.methods : we reviewed the existing data of all patients who underwent peg tube insertion at yuri kumiai general hospital ( akita , japan ) between february 2000 and december 2010 . we examined the following points : underlying diseases requiring peg , levels of consciousness , and performance status . we also sent a questionnaire to the patients and patient s families to ask about their satisfaction with and thoughts about peg.results : the data of 545 patients who underwent peg were reviewed . there were 295 men and 250 women , with a mean age of 77.2 11.4 years . peg was indicated most frequently for cerebrovascular disorders ( 48.2% , 239/545 ) . there were 515 ( 94.4% , 515/545 ) patients showing consciousness disturbance and 444 ( 81.5% , 444/545 ) bedridden patients . the questionnaire was answered by one patient himself and 316 patients families . when asked , was performing peg a good decision ? , 57.5% ( 182/316 ) of the patients families answered yes . meanwhile , when patients family members were asked if they would wish to undergo peg if they were in the same condition as the patient , 28.4% ( 90/316 ) answered yes , whereas 55.3% ( 175/316 ) answered no.conclusions : few patients were able to make their own decision about peg tube placement because of consciousness disturbance . as a result , many family members of the patients did not want to experience peg for themselves . future studies should be performed to clarify the quality of life and ethical aspects associated with peg .

You are an expert at summarizing long articles. Proceed to summarize the following text: microbial adhesion takes place on all natural and man - made surfaces ( 1 ) and poses considerable threats in food processing , drinking water systems , and human health to mention a few . these threats are not always associated with adhering organisms , but often with their detachment causing contamination elsewhere . in human health for instance , contact lens - related microbial keratitis is caused by bacterial adhesion to and detachment from the contact lens case to the contact lens onto the cornea ( 2 ) . in food processing , pasteurized milk can become bacterially recontaminated by detachment of thermoresistant streptococci from heat exchanger plates in the downward , cooling section of pasteurizers ( 3 ) . bacterial detachment occurs through a viscoelastic failure model ( 4 ) , and oral biofilm left behind after toothbrushing has been found to possess expanded bond lengths between adhering bacteria due to viscoelastic deformation ( 5 ) . although more prominently demonstrated for bacterial detachment , viscoelastic deformation may also play a role in bacterial adhesion to substratum surfaces , since it increases the contact area between a bacterium and the surface . recently , it has been suggested ( 6 ) that deformation of bacterial cell surfaces during adhesion may result in so - called stress deactivation of the adhering organisms , making them more susceptible to antimicrobial agents which may provide new clues to prevent antibiotic resistance . deformation of the bacterial cell surface and an associated change in contact area in response to an applied external force are hard to model and require knowledge of the viscoelasticity of the bacterial cell surface . in colloid science , several deformation models ( e.g. , the hertz , johnson - kendall - roberts , and derjaguin - muller - toropov models ) have been developed to describe the deformation of an elastic sphere under an applied external loading force ( 710 ) . all models have in common that they require a priori knowledge of the reduced young s modulus e * of the particle ( i.e. , a bacterium ) , and substratum in order to calculate deformation and possible changes in contact area during loading ( 11 , 12 ) . note that there is a subtle difference between the reduced young s modulus e * and young s modulus e , according to the following equation : where is poisson s ratio of the material under consideration ( for most materials , is between 0 and 0.5 ) . poisson s ratio accounts for the fact that a material compressed or stretched in one direction usually tends to expand or become compressed , respectively , in the other two , perpendicular directions . poisson s ratio is the ratio of the fractional expansion divided by the fractional compression or vice versa ( 13 ) . use of atomic force microscopy ( afm ) allows control of the applied external force and measurement of the induced deformation . such data in combination with any of the deformation models mentioned above can be applied to determine the reduced young s modulus of both hard and elastic materials ( 1416 ) . application of these models assumes that the particles examined are homogeneous with respect to their composition and viscoelastic properties , but this is not the case for bacteria . bacteria can either be rod shaped or spherically shaped and are by no means structurally homogeneous . gram - positive bacteria consist of a cytoplasmic , intracellular fluid contained within a hard core , enveloped by a lipid bilayer or membrane covered by a thick and relatively rigid , cross - linked peptidoglycan layer ( fig . gram - negative strains possess a double membrane with a thin layer of peptidoglycan between the two membranes . the outermost bacterial cell surface may consist of proteinaceous surface appendages of different diameters and lengths of up to hundreds of nanometers or by a layer of extracellular polymeric substances ( eps ) , produced by the organisms ( 17 ) . as a consequence of the structural and compositional heterogeneity of bacterial cell surfaces , there is no homogeneous stress distribution upon external loading , and the softer outer layer may deform to concentrate the stress toward the more rigid , hard core . therefore , the contact volume and its reduced young s modulus are beyond experimental reach for bacterial cell surfaces using afm and existing deformation models . ( a ) three - dimensional ( 3d ) schematics of a gram - positive bacterium , consisting of intracellular cytoplasmic fluid contained within a hard core , composed of a lipid bilayer or membrane covered by a thick and rigid , cross - linked peptidoglycan layer . the softer , outermost cell surface may consist of a combination of proteinaceous surface appendages combined with eps ( extracellular polymeric substances ) . ( b ) bacterium upon initial contact with a substratum surface in the absence of an external deformation force . the contact volume is represented by a cylinder with an initial area s0 and initial height h0 . ( c ) deformation of the bacterial contact cylinder upon application of an external force fld to an area s and height h. in this paper , we present a new , simple model to derive the reduced young s modulus of the contact volume between an adhering bacterium and a substratum surface . our model is based solely on the assumption that contact is established through a cylinder with constant volume during deformation upon application of an external loading force . importantly , the model does not a priori require any assumptions on the properties and dimensions of the contact cylinder and is applicable to different bacterial strains and species , regardless of whether they are gram positive or gram negative , whether they are rod shaped or coccal , and other details of their surface structure and composition . the model requires measurement of force - distance curves using afm between a bacterial probe and a substratum surface and is applied here on six strains that allow pairwise comparisons to identify the effects of the following : ( i ) the absence or presence of fibrillar surface appendages ( two isogenic streptococcus salivarius strains ) ( 18 , 19 ) , ( ii ) slime production ( two staphylococcus epidermidis strains ) ( 20 ) , and ( iii ) the degree of cross - linking in the peptidoglycan envelope ( two isogenic staphylococcus aureus strains ) ( 21 ) . a summary of the relevant cell surface features of the different strains is given in table 1 . note that we confined our experiments to this selection of gram - positive cocci , because they have pairwise unique properties that contribute to the interpretation and validation of the results based on our knowledge of their cell wall properties . also , reproducible preparation of bacterial probes for rod - shaped organisms is more difficult than for coccal organisms . structural features of the different pairs of bacterial strains included in this study structural features of the different pairs of bacterial strains included in this study together with dimensions and reduced young s moduli of the contact cylinder between adhering bacteria and a glass substratum . the reduced young s moduli were obtained from the proposed elastic deformation model of the contact cylinder and from hertz modeling of the compression data , pertaining to the soft , outermost cell surface and for an unknown part to the bacterial hard core ( fig . 1 ) . the values for h0 and e * are means standard deviations for deformation measurements taken over 24 different spots on the glass substratum , comprising eight different bacteria . a bacterial probe attached to a tipless afm cantilever is compressed against a glass surface under the external loading force of the afm , yielding deformation of an assumed contact cylinder from an initial area s0 and height h0 ( fig . assuming that the volume of the contact cylinder remains constant during adhesion and associated deformation , its initial and final dimensions can be related to the deformation equation = h0 h according to ( 2)s = s0h0h0 while by equating the volume of the spherical cap contacting the substratum with the volume of a cylinder of equal height , s0 can be estimated as ( 3)s0=rh0 in which r is the bacterial cell radius , taken as 500 nm for all strains employed in this study ( 12 , 18 , 22 ) . as long as the bacterium is in contact with the substratum surface , can be calculated from the displacement of the sample stage as measured with the piezo - transducer of the afm , z , and the cantilever deflection d equating the elastic force fcant exerted by the cantilever with the force arising due to deformation of the contact volume according to hooke s law yields ( 5)fcant = kd = e*sh0 where k is the spring constant of the cantilever and e * is the reduced young s modulus of the contact cylinder . by combining equations 2 , 3 , and 5 , fcant can be expressed as subsequently , fitting of the experimental data for fcant and the deformation yields the reduced modulus e * and the initial dimension h0 . in fig . 2 , the force sensed by the afm cantilever , fcant , upon deforming an adhering bacterium is presented as a function of the deformation . since the strains included in this study are pairwise selected with respect to differences in cell surface features ( see table 1 ) , the graphs have been arranged so that strains showing the largest deformation within a pair are presented on the right . deformation force exerted by the cantilever fcant as a function of the bacterial deformation applied to two strains of s. epidermidis ( atcc 35983 and atcc 35984 ) , s. salivarius ( hb-7 and hb - c12 ) , and s. aureus ( nctc 8325 - 4 and its isogenic pbp4 strain ) . data could be well fitted to equation 6 , yielding values of e * and h0 for the contact cylinders . the data are summarized in table 1 , together with values for the initial contact areas s0 calculated from equation 3 . note that the quality of the fit to equation 6 is generally good , except for s. aureus nctc 8325 - 4 , probably as a result of its relatively small deformation upon external loading . the reduced young s moduli calculated by our proposed deformation model vary by a factor of 7 among this collection of strains , and within the pairs of staphylococci and streptococci , it is lower in bacteria that produce eps , possess fibrils , and lack cross - linking in the peptidoglycan layer . an important feature of the model is that the dimensions of the contact cylinder at zero external loading force are obtained as well . within each pair , a decrease in reduced young s modulus is accompanied by a larger height and contact area of the initial contact cylinder . the reduced young s moduli of soft materials can also be obtained using the hertz model ( 8 , 23 ) , assuming the adhesion force arising from the contact can be neglected . when applying the hertz model to bacteria , a bacterium is simply considered a uniform , elastic sphere and approach force - distance curves are fitted to fitting of the experimental data for fcant and the deformation using the indentation module of nanoscope analysis software ( bruker ) then directly yields the reduced young s modulus e*. analysis according to the hertz mode yields reduced young s moduli of the adhering bacteria only as a whole , and accordingly , as shown in table 1 , these values are about 3 orders of magnitude larger than obtained from our proposed deformation model . the measured adhesion forces for the strains involved in this study were generally less than 2 nn ( data not shown ) , which justifies the use of the hertz model . a bacterial probe attached to a tipless afm cantilever is compressed against a glass surface under the external loading force of the afm , yielding deformation of an assumed contact cylinder from an initial area s0 and height h0 ( fig . assuming that the volume of the contact cylinder remains constant during adhesion and associated deformation , its initial and final dimensions can be related to the deformation equation = h0 h according to ( 2)s = s0h0h0 while by equating the volume of the spherical cap contacting the substratum with the volume of a cylinder of equal height , s0 can be estimated as ( 3)s0=rh0 in which r is the bacterial cell radius , taken as 500 nm for all strains employed in this study ( 12 , 18 , 22 ) . as long as the bacterium is in contact with the substratum surface , can be calculated from the displacement of the sample stage as measured with the piezo - transducer of the afm , z , and the cantilever deflection d equating the elastic force fcant exerted by the cantilever with the force arising due to deformation of the contact volume according to hooke s law yields ( 5)fcant = kd = e*sh0 where k is the spring constant of the cantilever and e * is the reduced young s modulus of the contact cylinder . by combining equations 2 , 3 , and 5 , fcant can be expressed as subsequently , fitting of the experimental data for fcant and the deformation yields the reduced modulus e * and the initial dimension h0 . in fig . 2 , the force sensed by the afm cantilever , fcant , upon deforming an adhering bacterium is presented as a function of the deformation . since the strains included in this study are pairwise selected with respect to differences in cell surface features ( see table 1 ) , the graphs have been arranged so that strains showing the largest deformation within a pair are presented on the right . deformation force exerted by the cantilever fcant as a function of the bacterial deformation applied to two strains of s. epidermidis ( atcc 35983 and atcc 35984 ) , s. salivarius ( hb-7 and hb - c12 ) , and s. aureus ( nctc 8325 - 4 and its isogenic pbp4 strain ) . data could be well fitted to equation 6 , yielding values of e * and h0 for the contact cylinders . the data are summarized in table 1 , together with values for the initial contact areas s0 calculated from equation 3 . note that the quality of the fit to equation 6 is generally good , except for s. aureus nctc 8325 - 4 , probably as a result of its relatively small deformation upon external loading . the reduced young s moduli calculated by our proposed deformation model vary by a factor of 7 among this collection of strains , and within the pairs of staphylococci and streptococci , it is lower in bacteria that produce eps , possess fibrils , and lack cross - linking in the peptidoglycan layer . an important feature of the model is that the dimensions of the contact cylinder at zero external loading force are obtained as well . within each pair , a decrease in reduced young s modulus is accompanied by a larger height and contact area of the initial contact cylinder . the reduced young s moduli of soft materials can also be obtained using the hertz model ( 8 , 23 ) , assuming the adhesion force arising from the contact can be neglected . when applying the hertz model to bacteria , a bacterium is simply considered a uniform , elastic sphere and approach force - distance curves are fitted to fitting of the experimental data for fcant and the deformation using the indentation module of nanoscope analysis software ( bruker ) then directly yields the reduced young s modulus e*. analysis according to the hertz mode yields reduced young s moduli of the adhering bacteria only as a whole , and accordingly , as shown in table 1 , these values are about 3 orders of magnitude larger than obtained from our proposed deformation model . the measured adhesion forces for the strains involved in this study were generally less than 2 nn ( data not shown ) , which justifies the use of the hertz model . we propose a simple model to evaluate the elastic deformation of a bacterial cell surface upon external loading using afm . the model is based on the assumption that the contact between an adhering bacterium and a substratum surface can be represented as a cylinder having a constant volume during deformation , while the rigid , hard core of a bacterium ( fig . 1 ) does not a priori participate in the deformation unless severely softened , as for instance when cross - linking of the peptidoglycan in the cytoplasmic envelope is absent . the model allows for derivation of the reduced young s modulus of the contact volume from the relationship between the external loading force fcant and the deformation . like the hertz model , our model accounts only for elastic deformation , although it has been argued that bacteria should be regarded as being viscoelastic ( 12 ) . retardation time constants of bacteria based on standard solid models ( 24 ) are reported to be around 1 to 2 s , which is at least 10 times longer than the time scale in which we apply our external loading force . thus , considering the relatively high frequencies applied , a viscous contribution toward the bacterial cell surface deformation can be neglected using the current protocol . it could be argued ( fig . 1 ) that during application of an external loading force , not only is the contact volume between the rigid , hard core of a bacterium and the substratum surface deformed , but the volume between the bacterium and the afm cantilever is also deformed . however , the adhesion force of a negatively charged bacterium to a positively charged cantilever ( due to the adsorbed -poly - l - lysine layer ) is much stronger than to a negatively charged glass surface ( 2527 ) , while furthermore , the bond between the cantilever and bacterium has had ample time to mature . from this , we conclude that the contact volume between the bacterium and cantilever can be considered undeformable . nevertheless , the equations presented can be easily adjusted to include deformation of the contact volume between a bacterium and a cantilever . when for instance , both contact volumes would contribute equally to the deformation measured , should be replaced by /2 , which would yield 2-fold - smaller values for h0 and s0 , while reduced young s moduli would double . in order to judge whether the results obtained using our new model are realistic , we selected pairs of bacterial strains with distinctly different cell surface features and cell wall characteristics within each pair . within the pair of s. epidermidis strains , s. epidermidis atcc 35983 produces the least eps ( 20 ) , explaining why the height of its contact cylinder is found to be smaller and its reduced young s modulus is higher than that for s. epidermidis atcc 35984 . similarly , the differences in height and elasticity modulus between the isogenic s. salivarius strains can be ascribed to the difference in fibrillation of these strains . s. salivarius hb-7 possesses fibrils with a uniform length of 91 nm ( 18 ) , and the contact cylinder , with a calculated height of 44 nm , is fully located within the fibrillar layer . however , at the surface of s. salivarius hb - c12 , there are no fibrils ( 19 ) , and the contact cylinder with a height of 28 nm extends well into the peptidoglycan layer of the bacterial cell wall , giving rise to a higher reduced young s modulus than for hb-7 . the isogenic s. aureus strains differ with respect to the degree of cross - linking of their peptidoglycan layer . the peptidoglycan in the wall of s. aureus nctc 8325 - 4 is highly cross - linked , whereas that of the isogenic mutant ( pbp4 mutant ) is deficient in cross - linking ( 21 ) . accordingly , the bacterial cell wall of s. aureus nctc 8325 - 4 is more rigid than the cell wall of the pbp4 mutant , as indicated by the higher reduced young s modulus . furthermore , the different values of the height of the contact cylinder reflect the difference in softness of the bacterial cell walls between the two strains and how far it extends toward the peptidoglycan layer ( if not encompassing it ) . the fact that the method self - defines the dimensions of the contact cylinder is an important feature , as it makes the method applicable to highly complex bacterial cell walls , including those of gram - negative strains that possess a double lipid membrane . application of the established hertz model to our experimental data also yields pairwise differences in reduced young s moduli , demonstrating differences in cell surface features and cell wall characteristics within each pair of strains , similar to our new , elastic deformation model ( table 1 ) . however , the reduced moduli derived from the hertz model are orders of magnitude larger than those obtained from our proposed elastic deformation model . thwaites and mendelson ( 28 ) reported 10 mpa for the young s modulus of the peptidoglycan thread in bacillus subtilis cell walls , which is in the same order of magnitude as obtained for the present collection of strains using the hertz model . the high reduced young s moduli arrived in the hertz model likely pertain mostly to the bacterial hard core . on the other hand , the heights of the contact cylinder derived are limited to several tens of nanometers and therefore clearly refer to the features of the outermost cell surface ( with the evident exception of the staphylococcal strain that is deficient in peptidoglycan cross - linking ) . accordingly , reduced young s moduli of bacterial contact volumes involved in adhesion derived by our model fall within the range of data published for the young s moduli of biopolymer gels ( 29 , 30 ) and polyelectrolyte multilayers ( 31 ) , generally ranging from 1 to 100 kpa . thus , we believe that our elastic deformation model yields advantages over the use of other models like the hertz model , as it accounts for the heterogeneous composition and viscoelastic properties of bacteria , which is especially important to identify the elastic properties of the bond between an adhering bacterium and a substratum surface . in conclusion , a simple model is proposed to determine reduced young s modulus of the bond between adhering bacteria and substratum surfaces . the model is based on the measurement of the elastic deformation of an assumed cylindrical contact of constant volume and defines its own initial cylinder height . the resulting reduced young s moduli and the dimensions of the contact cylinders could be interpreted on the basis of the cell surface features and cell wall characteristics , i.e. , surfaces that are more rigid ( because of either lower fibrillation , lower eps production , or higher degree of cross - linking of the peptidoglycan layer ) have shorter contact cylinders and higher reduced young s moduli . unlike the values found using the hertz model , young s moduli derived for the contact volumes in our elastic deformation model correspond with young s moduli from the literature for biopolymer gels and polyelectrolyte multilayers . application of the established hertz model to our experimental data yields higher reduced young s moduli of all strains investigated , likely because the hertz model pertains to a major extent to the more rigid peptidoglycan layer surrounding the bacterial cytoplasm and , unlike our elastic deformation model , does not distinguish between the soft outer bacterial cell surface and the hard core of bacterial cells . although our model is applicable to different bacterial strains and species , regardless of whether they are gram positive or gram negative , rod shaped or coccal , and the details of their surface structure and composition , it is more difficult to apply to rod - shaped organisms , because the orientation of a rod - shaped organism with respect to the afm cantilever needs to be established and controlled . moreover , for rod - shaped organisms , other assumptions may have to be made with respect to the geometry of the contact volume , which does not necessarily need to be cylindrical as was assumed for coccal organisms . however , as long as the assumption of constant volume for the contact volume during deformation is made , our proposed method can be applied without further modification or difficulty . ( i ) s. epidermidis atcc 35983 and atcc 35984 are known as a poor and strong eps producer , respectively ( 20 ) . ( ii ) isogenic s. salivarius hb-7 and hb - c12 are two related strains that differ in their possession of fibrillar surface appendages ( 18 , 19 ) . ( iii ) s. aureus nctc 8325 - 4 and its isogenic pbp4 mutant differ in the degree of cross - linking of their peptidoglycan layer ( 21 ) . staphylococci were precultured from blood agar plates in 10 ml tryptone soya broth ( oxoid , basingstoke , england ) , while streptococci were precultured from blood agar plates in 10 ml todd - hewitt broth ( oxoid ) . after 24 h , 0.5 ml of a preculture was transferred into 10 ml fresh medium , and the main culture was grown for 16 h at 37c . bacteria were harvested by centrifugation at 5,000 g for 5 min , washed twice with 10 mm potassium phosphate buffer ( ph 7.0 ) and finally suspended in the same buffer . when bacterial aggregates or chains were observed microscopically , the suspension was sonicated for 10 s at 30 w ( vibra cell model 375 ; sonics and materials inc . , danbury , ct ) intermittently three times while the suspension was cooled in a water / ice bath . bacterial probes were prepared by immobilizing a bacterium to an np - o10 tipless cantilever ( bruker , camarillo , ca ) . cantilevers were first calibrated by the thermal tuning method , and spring constants were always within the range given by the manufacturer ( 0.03 to 0.12 n / m ) . next , a cantilever was mounted to the end of a micromanipulator and using a microscope to observe , the tip of the cantilever was dipped into a droplet of a 0.01% -poly - l - lysine solution with a molecular weight ( mw ) ranging from 70,000 to 150,000 ( sigma - aldrich , st . after 2 min of air drying , the tip of the cantilever was carefully dipped into a bacterial suspension droplet for 1 min to allow bacterial attachment through electrostatic attraction and dried in air for 2 min . all force spectroscopy measurements were performed in 10 mm potassium phosphate buffer ( ph 7.0 ) at room temperature on a bioscope catalyst afm ( bruker ) . in the method proposed , the bacterial probe was moved toward a glass microscope slide cleaned to a zero degree water contact angle ( gerhard menzel gmbh , braunschweig , germany ) at a constant velocity of 1 m / s . during deformation , the force fcant that was exerted by the cantilever was recorded as well as the displacement z of the sample stage as measured with the piezo - transducer of the afm until a maximum loading force of 3 nn . in order to verify that a bacterial probe enabled a single contact with the surface , a scanned image in afm contact mode with a loading force of 1 to 2 nn was made at the onset of each experiment and examined for double contour lines . double contour lines indicate that the afm image is not prepared from the contact of a single bacterium with the surface but that multiple bacteria on the probe are in simultaneous contact with the substratum . any probe exhibiting double contour lines were discarded . at this point , however , it must be noted that double contour line images seldom or never occurred , since it represents the unlikely situation that bacteria on the cantilever are equidistant to the substratum surface within the small range of the interaction forces , which is unlikely because the cantilever is contacting the substratum at an angle of less than 15. before the actual deformation measurements were taken , five force - distance curves of a bacterial probe toward a clean glass surface were measured at a loading force of 3 nn , and the maximal adhesion forces upon retraction were recorded . after each deformation measurement on a new spot on the glass slide and after increase of the external loading force on a bacterium up to 3 nn , the bacterial probe was retracted from the glass substratum , and the maximal adhesion force was measured again . whenever the maximal adhesion force recorded differed more than 1 nn from the initial value , the bacterial probe was regarded as damaged and replaced by a new one . ( i ) s. epidermidis atcc 35983 and atcc 35984 are known as a poor and strong eps producer , respectively ( 20 ) . ( ii ) isogenic s. salivarius hb-7 and hb - c12 are two related strains that differ in their possession of fibrillar surface appendages ( 18 , 19 ) . ( iii ) s. aureus nctc 8325 - 4 and its isogenic pbp4 mutant differ in the degree of cross - linking of their peptidoglycan layer ( 21 ) . staphylococci were precultured from blood agar plates in 10 ml tryptone soya broth ( oxoid , basingstoke , england ) , while streptococci were precultured from blood agar plates in 10 ml todd - hewitt broth ( oxoid ) . after 24 h , 0.5 ml of a preculture was transferred into 10 ml fresh medium , and the main culture was grown for 16 h at 37c . bacteria were harvested by centrifugation at 5,000 g for 5 min , washed twice with 10 mm potassium phosphate buffer ( ph 7.0 ) and finally suspended in the same buffer . when bacterial aggregates or chains were observed microscopically , the suspension was sonicated for 10 s at 30 w ( vibra cell model 375 ; sonics and materials inc . , danbury , ct ) intermittently three times while the suspension was cooled in a water / ice bath . bacterial probes were prepared by immobilizing a bacterium to an np - o10 tipless cantilever ( bruker , camarillo , ca ) . cantilevers were first calibrated by the thermal tuning method , and spring constants were always within the range given by the manufacturer ( 0.03 to 0.12 n / m ) . next , a cantilever was mounted to the end of a micromanipulator and using a microscope to observe , the tip of the cantilever was dipped into a droplet of a 0.01% -poly - l - lysine solution with a molecular weight ( mw ) ranging from 70,000 to 150,000 ( sigma - aldrich , st . after 2 min of air drying , the tip of the cantilever was carefully dipped into a bacterial suspension droplet for 1 min to allow bacterial attachment through electrostatic attraction and dried in air for 2 min . all force spectroscopy measurements were performed in 10 mm potassium phosphate buffer ( ph 7.0 ) at room temperature on a bioscope catalyst afm ( bruker ) . in the method proposed , the bacterial probe was moved toward a glass microscope slide cleaned to a zero degree water contact angle ( gerhard menzel gmbh , braunschweig , germany ) at a constant velocity of 1 m / s . during deformation , the force fcant that was exerted by the cantilever was recorded as well as the displacement z of the sample stage as measured with the piezo - transducer of the afm until a maximum loading force of 3 nn . in order to verify that a bacterial probe enabled a single contact with the surface , a scanned image in afm contact mode with a loading force of 1 to 2 nn was made at the onset of each experiment and examined for double contour lines . double contour lines indicate that the afm image is not prepared from the contact of a single bacterium with the surface but that multiple bacteria on the probe are in simultaneous contact with the substratum . any probe exhibiting double contour lines were discarded . at this point , however , it must be noted that double contour line images seldom or never occurred , since it represents the unlikely situation that bacteria on the cantilever are equidistant to the substratum surface within the small range of the interaction forces , which is unlikely because the cantilever is contacting the substratum at an angle of less than 15. before the actual deformation measurements were taken , five force - distance curves of a bacterial probe toward a clean glass surface were measured at a loading force of 3 nn , and the maximal adhesion forces upon retraction were recorded . after each deformation measurement on a new spot on the glass slide and after increase of the external loading force on a bacterium up to 3 nn , the bacterial probe was retracted from the glass substratum , and the maximal adhesion force was measured again . whenever the maximal adhesion force recorded differed more than 1 nn from the initial value , the bacterial probe was regarded as damaged and replaced by a new one .

abstractviscoelastic deformation of the contact volume between adhering bacteria and substratum surfaces plays a role in their adhesion and detachment . currently , there are no deformation models that account for the heterogeneous structure and composition of bacteria , consisting of a relatively soft outer layer and a more rigid , hard core enveloped by a cross - linked peptidoglycan layer . the aim of this paper is to present a new , simple model to derive the reduced young s modulus of the contact volume between adhering bacteria and substratum surfaces based on the relationship between deformation and applied external loading force , measured using atomic force microscopy . the model assumes that contact is established through a cylinder with constant volume and does not require assumptions on the properties and dimensions of the contact cylinder . the reduced young s moduli obtained ( 8 to 47 kpa ) and dimensions of the contact cylinders could be interpreted on the basis of the cell surface features and cell wall characteristics , i.e. , surfaces that are more rigid ( because of either less fibrillation , less extracellular polymeric substance production , or a higher degree of cross - linking of the peptidoglycan layer ) had shorter contact cylinders and higher reduced young s moduli . application of an existing hertz model to our experimental data yielded reduced young s moduli that were up to 100 times higher for all strains investigated , likely because the hertz model pertains to a major extent to the more rigid peptidoglycan layer and not only to the soft outer bacterial cell surface , involved in the bond between a bacterium and a substratum surface .

You are an expert at summarizing long articles. Proceed to summarize the following text: gingival recession affects larger portion of adult population which is the apical shift of gingival margin beyond cementoenamel junction ( cej ) . the main factors contributing to this phenomenon are toothbrush trauma , iatrogenic factors(uncontrolled orthodontic movement in terms of force ) , improper restorations , oral habits , and viral infections of the gingiva . compromised esthetics , hypersensitivity , higher incidence of root caries , and poor plaque control are associated with gingival recession . several techniques such as the laterally positioned pedicle graft , coronally advanced flap ( caf ) , free gingival graft , and subepithelial connective tissue graft are used which have yielded promising results . investigators have reported successful root coverage using surgical techniques based on the principles of guided tissue regeneration ( gtr ) . gtr based root coverage , however , offers the additional potential benefit of new attachment formation ( bone , cementum , periodontal ligament , and connective tissue ) along the previously denuded root surface . it is very difficult to maintain the space under the membrane since the membrane tends to collapse against the root surface . the use of bone graft under a membrane can prevent this and enhance clot stability and cell proliferation . unlike demineralized freeze - dried bone allograft ( dfdba ) , calcium sulfate does not possess osteogenic properties , but it has been used successfully as a binder / filler , functioning as a scaffold - type material in composite grafts and also as a resorbable barrier . doxycycline application to the root surface enhances the binding of fibronectin , which in turn favors the attachment and growth of fibroblasts on the root surface . the purpose of this unique study was to check the effectiveness of barrier and graft especially calcium sulfate along with root conditioning for the treatment of miller 's class i recession . a 24-year - old male soldier reported to this establishment with the chief complaint of sensitivity and unsightly appearance in relation to 11 and 21 . the following measurements were noted : recession depth ( rd ) , recession width ( rw ) , width of keratinized gingiva ( kg ) , clinical attachment level ( cal ) , and probing depth ( pd ) . rd was measured at the midfacial aspect of the tooth , from cej to free gingival margin which was 3 mm . kg was determined by subtracting rd from the cej - to mucogingival junction ( mgj ) measurement . in addition , gingival thickness ( gt ) was measured at a buccal location 1 mm apical to bottom of sulcus using number 15 reamer endodontic instruments . thus , diagnosis of miller 's class i localized gingival recession was arrived upon [ figure 1 ] . class i localized gingival recession recession in relation to 11 recession site was prepared according to the standard root coverage procedure described previously . after achieving adequate local anesthesia , a sulcular incision was made from the mesiofacial line angle to the distofacial line angle of the teeth . the sulcular incision was extended horizontally into each adjacent papilla , at a level just coronal to the cej , to within 1 mm of the adjacent teeth . starting at the terminal ends of the horizontal incision , two vertical incisions were extended apically well beyond the mgj to allow adequate flap mobilization [ figure 2 ] . the vertical incisions diverged significantly while progressing apically to preserve blood supply to the flap . the trapezoidal pedicle flap was initially elevated split thickness in the papillary gingiva , then progressed full thickness from the osseous crest to the mgj , and finally , split thickness again apical to the mgj . split - thickness dissection in the apical portion severed the periosteum to allow tension - free coronal positioning of the flap [ figure 3 ] . the accessible root surface was planned smooth with a hand instrument to eliminate any surface contamination . subsequently , the root was conditioned with doxycycline hydrochloride ( 50 mg/5 ml in sterile solution ) by light burnishing action using cotton tip applicator for 90 s followed by saline water irrigation . next , papillae adjacent to the recipient tooth were deepithelialized with a 15c scalpel . following flap reflection , intra - bone marrow perforations were made with a round bur in the interproximal areas mesial and distal to the recipient teeth roots . a bovine collagen membrane ( guidor matrix barrier , guidor ab , huddinge , sweden ) was trimmed to cover 23 mm of bone surrounding the exposed root surface . the membrane was secured to the tooth at the level of the cej with one 6 - 0 resorbable monofilament ( ethicon / johnson and johnson ) sling - tag suture engaging both membrane and papillae . the calcium sulfate graft ( capset , lifecore biomedical , chaska , mn , usa ) was mixed with saline to get a gel like consistency which was placed under the membrane using a sterile syringe . finally , the pedicle flap was coronally positioned to cover the membrane and secured to the adjacent papillae with interrupted 60 resorbable monofilament sutures . interrupted resorbable sutures were then used to close the vertical incisions [ figure 4 ] . postoperative home care instructions included refraining from any mechanical cleaning of the surgical areas for 4 weeks . the patient was then instructed to rinse twice daily with a 0.12% chlorhexidine gluconate mouthrinse for the next 2 weeks . patients were seen at 1 week , 2 weeks , 3 weeks , 3 months , and 6 months [ figure 6 ] . professional prophylaxis without prophy paste and reinforcement of oral hygiene instructions were also performed if indicated at each posttreatment visit . vertical incision given mesial and distal to 11 and 21 coronal advancement of flap done postoperative healing after 3 weeks postoerative view after 6 months recession site was prepared according to the standard root coverage procedure described previously . after achieving adequate local anesthesia , a sulcular incision was made from the mesiofacial line angle to the distofacial line angle of the teeth . the sulcular incision was extended horizontally into each adjacent papilla , at a level just coronal to the cej , to within 1 mm of the adjacent teeth . starting at the terminal ends of the horizontal incision , two vertical incisions were extended apically well beyond the mgj to allow adequate flap mobilization [ figure 2 ] . the vertical incisions diverged significantly while progressing apically to preserve blood supply to the flap . the trapezoidal pedicle flap was initially elevated split thickness in the papillary gingiva , then progressed full thickness from the osseous crest to the mgj , and finally , split thickness again apical to the mgj . split - thickness dissection in the apical portion severed the periosteum to allow tension - free coronal positioning of the flap [ figure 3 ] . the accessible root surface was planned smooth with a hand instrument to eliminate any surface contamination . subsequently , the root was conditioned with doxycycline hydrochloride ( 50 mg/5 ml in sterile solution ) by light burnishing action using cotton tip applicator for 90 s followed by saline water irrigation . following flap reflection , intra - bone marrow perforations were made with a round bur in the interproximal areas mesial and distal to the recipient teeth roots . a bovine collagen membrane ( guidor matrix barrier , guidor ab , huddinge , sweden ) was trimmed to cover 23 mm of bone surrounding the exposed root surface . the membrane was secured to the tooth at the level of the cej with one 6 - 0 resorbable monofilament ( ethicon / johnson and johnson ) sling - tag suture engaging both membrane and papillae . the calcium sulfate graft ( capset , lifecore biomedical , chaska , mn , usa ) was mixed with saline to get a gel like consistency which was placed under the membrane using a sterile syringe . finally , the pedicle flap was coronally positioned to cover the membrane and secured to the adjacent papillae with interrupted 60 resorbable monofilament sutures . interrupted resorbable sutures were then used to close the vertical incisions [ figure 4 ] . postoperative home care instructions included refraining from any mechanical cleaning of the surgical areas for 4 weeks . the patient was then instructed to rinse twice daily with a 0.12% chlorhexidine gluconate mouthrinse for the next 2 weeks . patients were seen at 1 week , 2 weeks , 3 weeks , 3 months , and 6 months [ figure 6 ] . professional prophylaxis without prophy paste and reinforcement of oral hygiene instructions were also performed if indicated at each posttreatment visit . vertical incision given mesial and distal to 11 and 21 coronal advancement of flap done postoperative healing after 3 weeks postoerative view after 6 months after 6 months , 100% root coverage was achieved in 11 and 97% in 21 . the periodontal literature describes several surgical procedures and clinical variations to cover root surface exposed by facial gingival recessions . the purpose of this case study was to determine the feasibility of adding bone graft , in particular calcium sulfate , along with collagen membrane - based gtr root coverage procedures . our results indicate that calcium sulfate plus a collagen barrier could be used to successfully treat gingival recession defects . caf presents several advantages with respect to other techniques : ( a ) reduced discomfort and pain for the patient ( avoidance of second surgical site ) ; ( b ) easy - to - perform surgical technique ; and ( c ) excellent esthetic results . according to the literature , the mean root coverage obtained by caf in the treatment of miller class i and ii defects ranges from 60% to 99% . it is physiologically absorbable , and it behaves similarly to subepithelial connective tissue grafts by providing a collagenous scaffold for tissue repair . it may secondarily augment the volume of gingival tissues following in vivo expansion , enzyme degradation , and eventual replacement by the surrounding connective tissue . the creation and maintenance of space between the root surface and the overlying gtr barrier is considered critical to the success of all gtr procedures , including those aimed at achieving root coverage . literature is replete with studies of the addition of dfdba may create and maintain extra space that is needed for new attachment formation . on similar lines calcium , sulfate was used as it is easily available , cheap , and biocompatible . the use of calcium sulfate as a graft / barrier may act as a binder , facilitating healing , and preventing loss of grafting material . it is well documented that calcium sulfate acts as a barrier , is tissue compatible , and does not interfere with the healing process . as a barrier , it prevents the colonization of the defect by gingival cells , allowing selective repopulation of the defect by periodontal ligament cells . calcium sulfate is biocompatible , and it completely resorbs within 410 weeks , depending on the vascularity of the grafted site . it is possible that the addition of calcium sulfate in the present study had a positive influence on healing . the increase of kg may be due to a potential space created by calcium sulfate and by the collagen membrane itself . a study reported that collagen membranes prevent apical migration and further support new connective tissue attachment . the gain in clinical probing attachment with no change in pd suggests that a new attachment formed . however , because of lack of histologic evidence , it is impossible to determine whether this gain in attachment resulted from the formation of a long junctional epithelium , a new connective tissue attachment , or a combination of both types of healing . doxycycline has been shown to retain its antimicrobial effect when combined with calcium sulfate ; thus , the addition of the doxycycline may have improved the response to grafting . the doxycycline binds not only to the graft material but also to the root surface . this study demonstrated that this binding may facilitate graft incorporation into the bone , resulting in an improved regenerative outcome over calcium sulfate alone . it is important to emphasize that this was a unique case study attempted to cover recession defects using a combination of principle of gtr and calcium sulfate . a randomized controlled trial comparing collagen membranes with and without calcium sulfate is underway to evaluate the clinical efficacy of this combination approach . results from this study indicate that use of calcium sulfate along with collagen membrane could be beneficial in promoting favorable clinical results .

the presence of mucogingival problem around anterior teeth is a challenge to the clinician as not only biological and functional aspects has to be addressed but esthetic aspirations of the patient have to be met . the use of guided tissue regeneration ( gtr ) procedures for the treatment of gingival recession has shown encouraging results and is gaining clinical acceptance . however , maintenance of space under the membrane remains a problem for clinicians . hence , this case study was an innovative attempt to evaluate the effect of adjunctive calcium sulfate placement along with collagen membrane gtr - based root coverage procedure .

You are an expert at summarizing long articles. Proceed to summarize the following text: laminins ( lms ) are abundant extracellular matrix ( ecm ) proteins present predominantly in basement membranes ( bm ) . at least 16 isoforms have been described and named according to their specific trimeric combination of , and chains using the new nomenclature . the existence of a lm-511 trimer ( 511 , formerly lm-10 ) was first reported in 199798 , some 15 y after the original discovery of laminin ( now named lm-111 , 111 trimer ) . given the more recent identification of lm-511 , our understanding of its specific function in normal tissues and in diseases has lagged on other lm isoforms , in particular lm-111 and lm-332 . notably , the recognition of lm5 as a distinct lm subunit and the characterization of various antibodies against human lm chains have clarified earlier discrepancies regarding the distribution of lm-511 in normal human and mouse tissues and in neoplasia . genetic ablation of lm5 in mouse marked the beginning of its functional characterization during development and later enabled investigations into the role of 5 laminins in specific organs . functional studies in vitro and identification of lm-511 receptors have been facilitated by the triple cloning of recombinant human lm 5 , 1 and 1 chains as a rich source of intact lm-511 and the development of protocols for the purification of lm-511 from culture media . together , these advances have contributed to the emerging view that lm-511 and its receptors regulate cancer progression . studies documenting the high expression of lm-511 in several cancer types are briefly reviewed below and discussed in relation to more recent in vitro and in vivo experimental evidence indicating that lm-511 and its receptors regulate tumor cell migration , invasion and metastasis . establishing the precise tissue distribution of lm-511 has been complicated by earlier studies assuming the existence of a single lm isoform . hence , many of the antibodies used for immunohistochemical ( ihc ) detection of lms were raised against lm preparations containing more than one isoform ( e.g. , human placental laminin ) or against lm subunits / fragments now known to be present in multiple isoforms including lm-511 ( e.g. , 1 and 1 chains ) . these problems were compounded by the fact that the 4c7 antibody previously used for the detection of lm1 chain actually recognizes the lm5 chain . the latter study helped reconcile the discrepancies between the relatively restricted tissue expression reported for lm1 mrna and the broad lm5 mrna or protein distribution detected by the 4c7 antibody in human . consequently , many of the earlier ihc studies need to be re - interpreted as evidence for the presence of lm-511 ( and in some cases lm-521 ) rather than lm-111 . since the 1 and 1 subunits are present in multiple isoforms and expressed in most tissues , the presence of lm-511 trimers in a given organ is often assumed solely based on the detection of the 5 chain . nevertheless , co - localization of all three subunits of lm-511 has been demonstrated more conclusively in many tissues by ihc or co - immunoprecipitation . the results from these studies have shown that lm-511 is abundant in the basement membrane of most mature epithelia and endothelia and are consistent with lm-511 being the most widely distributed lm isoform in normal tissues and in carcinomas . indeed , high expression of lm-511 subunits has been reported in many malignancies including colorectal , mammary , lung , thyroid , ovarian , prostate and basal cell carcinoma as well as in gliomas and melanomas . however , the precise pattern of lm-511 expression varies significantly between tumor types , from a continuous bm localization to a more diffuse stromal or tumor cell expression , and its level in tumor cells or in the associated vasculature is influenced by the stage of tumor progression . many studies have shown that the expression of lm-511 is often maintained or even increased in advanced tumors . for example , nagle et al . used a combination of antibodies to analyze the expression of lm chains in normal prostate , prostatic intraepithelial neoplasia and prostate carcinoma specimens . while the authors could detect the presence of multiple isoforms in normal prostate including 1 , 3 and 5 lms , they found a gradual loss of 1 and 3 isoforms whereas high expression of lm5 ( and therefore lm-511/521 ) was maintained in the majority of high grade tumors . similarly , high tumor cell expression of all subunits of lm-511/521 has been reported in metastatic melanomas . these observations raise the possibility that high expression of 5 lms may have prognostic significance in some tumor types . consistent with this , detection of lm5 in tumor cells of non - small cell lung carcinoma patients was found to provide the strongest independent prognostic value to identify patients with high risk of disease recurrence . a similar association is likely in breast carcinomas . despite the gradual loss of bm deposition often seen during breast cancer progression , it is clear that some lm ( unspecified isoform ) remains expressed in advanced tumors and in metastases . high to moderate levels of lm-511 subunits have been reported in ductal carcinoma in situ , tubular carcinomas , fibroadenoma , atypical medullary carcinomas and carcinomas of no specific type . our own investigation in a clinically relevant mouse model of spontaneous breast cancer metastasis revealed a direct correlation between tumor cell expression of lm-511 and metastatic potential . in particular , bone metastatic 4t1.2 tumors showed widespread expression of lm-511 and this phenotype was maintained in distant metastases . high tumor cell expression of lm-511 was observed also in advanced human breast cancers and bone metastases . this is in contrast to the downregulation of lm-111 and lm-332 expression that occurs in most ( but not all ) advanced breast cancers due to a reduced number of laminin - producing myoepithelial cells and/or decreased expression of these isoforms through promoter methylation . thus , we have argued that while the loss of lm-111 and lm-332 may contribute to the initial disruption of bm integrity and tissue organization , high levels of lm-511 ( or lm-521 ) in advanced breast tumors may be associated with increased risk of developing metastases and could predict poor clinical outcome . a more definitive demonstration of its prognostic value in breast cancer patients however , will require ihc analysis of lm-511 subunits in a large cohort of patients with known clinical outcome . nevertheless , it is noteworthy that lung , prostate and breast cancers , for which high expression of lm5 isoforms is most evident , have a high affinity for bone . future studies should explore whether lm-511 expression has particular clinical relevance to tumors with a propensity to metastasize to bone . whether lm-511 expression is associated with a specific subtype of breast tumors cell lines derived from the 4t1 mouse model of metastasis discussed above have a basal - like triple negative ( tn ) phenotype ( lack expression of estrogen receptor , progesterone receptor and her2/neu receptor ) ( ref . interestingly , immunostaining of a small number of high grade human breast cancer specimens showed that expression of lm5 is not limited to a specific breast tumor subtype but its expression is considerably higher in tn tumors ( fig . 1 ) . these observations further support a potential association between high lm-511 expression and aggressive metastatic cancers . the predominance of lm-511 in advanced breast tumors however does not preclude a contribution by other lm isoforms during the early stage of tumor progression . for instance , the presence of lm-332-producing myofibroblasts at the tumor - stromal interface has been demonstrated in some invasive breast tumors . lm-332 is expressed also in tn tumors but it is not clear whether these represent a subset of breast cancer patients distinct from those with lm-511-expressing tumors . representative ihc staining of lm5 in grade 3 luminal a , luminal b , her2 and tn human breast tumors showing highest expression ( brown ) in tn tumors . consistent with tissue expression studies , many tumor lines synthesize , secrete and adhere to lm-511 in culture indicating that lm-511 mediates its effects in tumors partly via autocrine stimulation . lm-511 is a more potent adhesive and migratory substrate than many other matrices in vitro including several lm isoforms and generally shows potency similar to that of lm-332 . however , commercial preparations of placental lm-511 commonly used in earlier functional studies can be contaminated by other isoforms and may be less active than lm-511 purified from culture media due to proteolytic degradation . nevertheless , it is clear that adhesion to lm-511 elicits a variety of tumor - specific cellular responses that are dictated in part by the repertoire and level of lm receptors expressed in each cell type as described below . multiple receptors including integrins , lutheran / basal cell adhesion molecule ( b - cam ) and -dystroglycan , are known to bind lm-511 but integrins have been by far the most extensively documented in tumor cells . for example , tani et al . reported that jar choriocarcinoma cells adhere to lm-511 via 61 integrin whereas panc-1 pancreatic adenocarcinoma cells utilize the 31 receptor even though both lines express both receptors . attachment of huh-7 hepatocellular carcinoma cells to lm-511 involves at least three integrins , 11 , 31 and 61 . in contrast , the human lung adenocarcinoma a549 cell line adheres to lm-511 exclusively through the 31 integrin . while be and m21 melanoma cells attach and migrate on recombinant lm-511 using both 31 and 61 integrins , we have shown that lim1215 colon cancer cells adhere and spread on lm-511 via multiple integrins including 21 , 31 and 64 , and their migration on this substrate is mediated by 31 and 64 . simultaneous inhibition of all three receptors with function - blocking antibodies in lim1215 cells resulted in significant death . many of the functions of lms in breast cancer progression and metastasis have been inferred from receptor studies . in particular , 31 , 61 and 64 lm - binding integrins mediate the migration and invasion of breast tumor cells and/or promote their survival and proliferation at metastatic sites . however , the functions of these receptors in vivo have been interpreted largely as evidence for the role of lm-111 or lm-332 rather than lm-511 in metastasis owing to its more recent identification . interestingly , a study comparing the ligand - binding specificity of these integrins to various lm isoforms clearly showed that 31 and 61 bind to lm-511/521 ( purified from a549 lung carcinoma conditioned medium and containing predominantly lm-511 ) with higher affinity than to lm-111 or lm-332 . integrin 64 was found to be selective for both lm-332 and lm-511/521 and to bind these isoforms with similar affinity . in light of these observations , it is probable that some of the functions assigned to lm - binding integrins in metastatic breast tumors are mediated through attachment to lm-511 . recent results from our laboratory are consistent with this possibility . specifically , we reported that metastatic breast tumor lines adhere and migrate more efficiently on lm-511 than non - metastatic lines . lm-511-induced haptotactic migration and invasion of human mda - mb-231 metastatic breast tumor cells were inhibited strongly by lebein-1 , a snake disintegrin targeting lm - binding 1 integrins , or an anti-3 integrin - blocking antibody . similar antibody perturbation experiments with metastatic mda - mb-435 breast tumor cells showed that these cells utilize both 31 and 61 to migrate toward lm-511 ( unpublished observations ) . interestingly , migration of mda - mb-231 and mda - mb-435 on lm-332 is 1-integrin dependent but not inhibited by a 3 or 6 antibody . together , these data indicate that lm-511 may be a more relevant migratory substrate than lm-332 in metastatic breast tumors expressing 31 and 61 integrins . lm-511-dependent haptotaxis and invasion of mouse mammary carcinoma lines were similarly inhibited by a 1 integrin - blocking antibody or by treatment with lebein-1 . consistent with the pro - migratory / invasive properties of lm-511 , we found that soluble or coated lm-511 induces matrix metalloproteinase-9 expression in bone metastatic 4t1.2 cells and this activity could be blocked in vitro using the inhibitory lm5-derived a5g27 peptide . to further demonstrate the relevance of these lm-511-tumor interactions to metastasis in vivo , we showed that selection of subsets of cells that migrate rapidly in response to lm-511 allowed the isolation of tumor variants more metastatic to multiple sites , particularly to bone . importantly , enhanced metastasis was accompanied by a small increase in cell surface expression of 1 integrin and a more significant upregulation of 4 integrin . this finding is likely to be highly clinically relevant given that 64 integrin associates most significantly with the aggressive basal - like subtype of breast cancer and predicts shorter time to recurrence and decreased survival . the prognostic significance of lm and 64 integrin receptor expression in breast cancer patients was investigated in an earlier study by tagliabue et al . they determined that the worst disease outcome was for patients with tumors co - expressing lm and 64 , suggesting the involvement of a lm - integrin autocrine loop in invasive breast tumors . the precise isoform could not be identified in that study due to the use of polyclonal antibodies . however , the authors noted that the lm antiserum used stained throughout the tumor areas in a manner analogous to the widespread lm-511 staining observed in mouse and human tn tumors ( fig . 1 ) . if correct , blocking the production of lm-511 or the function / expression of its receptors would be expected to impact on metastatic potential . to begin to address this , we have generated variants of the 4t1.2 bone metastatic mammary carcinoma line with reduced lm-511 by stable retroviral expression of a short hairpin rna targeting the lm5 chain ( unpublished , manuscript in preparation ) . ihc examination of lm5 in primary tumors 35 d post - implantation confirmed the sustained downregulation of lm5 compared with control tumors expressing a non - targeting construct ( fig . 2 ) . as expected , lm5 suppression was evident in the tumor cells but not in the vasculature . preliminary characterization of metastatic spread in these mice revealed a reduction in bone metastasis ( pouliot et al . , these observations strongly support a direct functional contribution of lm-511 to breast cancer metastasis . whether targeting lm5 also impact on the metastasis of other lm-511-expressing tumor types such as prostate or lung tumors is currently under investigation . representative 4t1.2 primary tumors expressing a non - targeting shrna ( a ) or a lm5-targeting shrna ( b ) . note the loss of lm5 in the tumor regions but not in the vasculature ( arrow ) . the increasing experimental evidence linking lm-511 to cancer progression supports the notion that lm-511 has a much broader role in tumor invasion and metastasis than previously appreciated . however , major questions remain regarding its prognostic significance , precise mechanism of action and potential as therapeutic target . evidently , many advanced tumors express lm-511 and studies so far point to a possible association with bone metastasis and/or the basal - like / tn phenotype . whether lm-332 and lm-511-expressing tumors represent overlapping or distinct tn subsets also needs to be addressed . a definitive answer to these questions will require a more in depth ihc analysis of larger cohorts of patients with known clinical outcome . however , the 4c7 anti - lm5 antibody commonly used for this application does not work well on formalin - fixed paraffin embedded tissues , most likely because the 3d conformation of the epitope recognized by the 4c7 antibody in the lg13 modules of the lm5 chain is destroyed by tissue fixation and processing . thus , the generation of more robust antibodies for staining of archival material should be a priority . future studies will need also to clarify the precise contribution of lm-511 to the metastatic process and its relationship to lm-332 . both isoforms have been implicated in tumor invasion and metastasis and share many of their receptors suggesting redundant functions . yet , observations in various normal physiological processes indicate that lm-511 and lm-332 also have distinct , non - overlapping and sometimes opposing functions . moreover , lm-511 promotes long - term proliferation and maintenance of pluripotency in stem cell cultures , whereas lm-332 enables proliferation but not pluripotency . these properties could be relevant to metastasis and may be utilized by tumor cells at distinct stages of the metastatic cascade , including the epithelial to mesenchymal transition ( emt ) required for tumor cell invasion . for example , downregulation of lm-511 and lm-332 occurring in cells undergoing emt may be necessary to decrease the strength of adhesion and facilitate the early acquisition of a mesenchymal phenotype . cells migrating away from the primary tumor , could utilize myofibroblast - derived lm-332 at the tumor - stroma interface . conversely , re - expression of lm-511 at late stage of metastasis may provide the plasticity required for the reverse process of met and facilitate the re - establishment of a proliferative epithelial phenotype at metastatic sites . this would be consistent with the recent demonstration that lm-511 promotes proliferation and partially blocks emt in human cells . an interesting possibility is that these distinct lm-511 and lm-332-dependent adhesive responses during emt and met may be differentially regulated by cd151 , an important modulator of lm - binding integrins . cd151 overexpression was shown recently to be an independent prognostic marker of poor overall survival in invasive breast cancer , particularly in quintuple negative breast cancer , a subtype of tn breast cancer . a proposed model integrating these multiple lm-511 functions during metastasis is presented in figure 3 . the model depicted above is based primarily on observations made in breast cancer metastasis models but incorporates also findings from studies in other tumor types as referenced below and in the text . ( 1 ) uncontrolled growth of the primary tumor and the loss of myoepithelial - derived lm-111 and lm-332 contribute to the initial disruption of tissue organization . sustained expression of lm-511 further enhances the breakdown of the surrounding basement membrane through induction of mmp-2/9 gelatinases resulting in exposure of tumor cells to the surrounding stroma . ( 2 ) under the influence of stromal factors , tumor cells undergo emt and loss of cell - cell contacts . snail - dependent downregulation of lm3 and lm5 may be required to reduce the strength of adhesive interactions and enhance 31 , 61 or 64 integrin - dependent cell motility . subsequent stromal invasion may be achieved by interaction of tumor cells with low level of tumor - derived lm-511 and/or lm-332 derived from myofibrobalsts present at the tumor - stromal interface . ( 3 ) changes in the composition of lm isoforms in the tumor vasculature and the abundance of lm-511 are likely to contribute to tumor cell attachment and intravasation . ( 4 ) homing of circulating tumor cells ( ctc ) and invasion into metastatic sites is mediated through 31 integrin interaction with vascular lms ( including lm-511 ) and mmp-9 proteolytic activity . binding of integrin 61 or 64 to endogenous lm-332 or lm-511 ( in organs rich in these isoforms ) promotes survival and growth of disseminated tumor cells ( dtc ) . alternatively , enhanced expression of lm-511 and autocrine stimulation may be required in bone where lm-332 or lm-511 expression is more restricted to promote strong adhesion and 61/64-dependent tumor cell survival . in addition , adhesion to lm-511 may provide the plasticity required for the process of met and the acquisition of a proliferative epithelial phenotype at metastatic sites . while current evidence supports the role of tumor - derived lm-511 in metastasis , the contribution ( if any ) of stromal / vascular lm-511 to metastasis is incompletely understood . the availability of various animal models of metastasis ( e.g. , mmtv - pymt or 4t1 model ) in combination with conditional lama5 knockout mice could provide a useful in vivo platform to address this and guide future research . the widespread expression of lm-511 in vivo makes direct targeting of this lm isoform impractical for cancer therapy . for instance , many studies have employed inhibitory peptides derived from lms , including all lm-511 subunits , to demonstrate the clinical relevance of targeting lm-511 in vivo for anti - metastatic therapies . some of these peptides were shown to exert either potent anti - metastatic activity in experimental models of melanoma metastasis to lung or bone or anti - angiogenic effects on mda - mb-231 mammary tumors in nude mice . peptides may block metastasis by interfering with the function of tumor or host - derived lm-511 since lm-511 is also abundant in blood vessels , lung and bone sinusoids . while peptides are unlikely to be useful for long - term therapy due to their short half - life in vivo , the above studies nevertheless provide proof of principle that targeting lm receptors could have therapeutic benefits . disintegrin are a class of inhibitors increasingly investigated for their anti - tumor / metastatic activity . lebein-1 , unlike most other disintegrins that target 3-type integrins via rgd sequences , has the unusual characteristic of being selective for laminin - type integrins , inhibiting the 31 , 61 and 71 integrins ( but not 11 and 21 collagen receptors ) in an rgd - independent manner . our recent demonstration of its potent inhibitory properties against lm-511-mediated adhesion , migration and invasion in vitro provides the rationale for further testing in vivo . consistent with this , pre - treatment of tumor cells with lebein-1 in vitro inhibits subsequent attachment to sinusoids and homing to the liver in vivo . understanding the molecular mechanisms by which lebein-1 interacts with lm-511 receptors and inhibits lm-511-mediated responses in tumor cells metastasis is responsible for the majority of cancer - related death and remains a major clinical challenge despite extensive efforts over the past decades aimed at understanding and targeting cancer . while much remains to be done , continuing research in the field of laminins could provide additional weapons to tackle this devastating disease and lead to the development of alternative strategies to prevent or delay metastatic progression .

laminins are major constituents of basement membranes . at least 16 isoforms have now been described , each with distinct spatio - temporal expression patterns and functions . the laminin-511 heterotrimer ( 511 ) is one of the more recent isoforms to be identified and a potent adhesive and pro - migratory substrate for a variety of normal and tumor cell lines in vitro . as our understanding of its precise function in normal tissues and in pathologies is rapidly unraveling , current evidence suggests an important regulatory role in cancer . this review describes published data on laminin-511 expression in several malignancies and experimental evidence from both in vitro and in vivo studies supporting its functional role during tumor progression . a particular emphasis is put on more recent studies from our laboratory and that of others indicating that laminin-511 contributes to tumor dissemination and metastasis in advanced breast carcinomas and other tumor types . collectively , the experimental evidence suggests that high expression of laminin-511 has prognostic significance and that targeting tumor - laminin-511 interactions may have therapeutic potential in advanced cancer patients .

You are an expert at summarizing long articles. Proceed to summarize the following text: psychological distress is a state of emotional suffering that is generally characterized by symptoms of depression and anxiety.1 it has been recognized increasingly that health issues related to mental , behavioral , and neurological disorders are growing throughout the world . such disorders are responsible for 10.4% of all disability - adjusted life years lost or lived with a disability.2 importantly , over three - quarters of the burden is in low- and middle - income countries , where the health infrastructure is least able to address it.3 the study of psychological distress among persons in african countries is sparse ; however , individual and socio - cultural factors , such as female gender , lower education and lower socioeconomic status,4 lack of social support,5 and stressful life events,6 have been shown to be important contributors . in a study conducted in ghana , the prevalence varied according to gender , marital status , education , wealth , religion , and self - reported poor health status . in addition , among women in relationships , those who reported having experienced physical abuse , who reported having high levels of partner control , and who were more accepting of existing gender inequality , had greater odds of reporting psychological distress.7 in a kenyan household survey study in nyanza province , the prevalence of common mental disorders ( eg , mixed anxiety / depression , panic disorder , generalized anxiety disorder ) was 10.8% , with higher rates of mental disorders among persons who were older and persons with poor physical health.8 the co - occurrence of psychological and physical illness has been found globally in rich , middle - income , and low - income countries , such as kenya.8 given the high prevalence of hiv in sub - saharan africa,9 it is especially important to assess psychological disorders , for instance depression,10 and even difficulty with coping skills in response to negative daily life events,11 as these can affect behaviors that place people at higher risk for hiv and other sexually transmitted infections ( stis ) . moreover , persons infected with hiv who also have depression or other psychological disorders have difficulty with self - care , which includes medication adherence12 and successful participation in a linkage to care intervention.13 psychological distress has not been well studied in developing countries . to add to the literature on factors associated with psychological distress in high burden hiv sub - saharan settings , we conducted a planned analysis of screening data collected to determine the acceptability of an intravaginal ring ( ivr ) to prevent pregnancy among young women in kisumu , kenya . the objectives were to determine , among women , 1 ) the prevalence of psychological distress as measured by the kessler ( k-6 ) psychological distress scale and 2 ) factors associated with psychological distress . screening data for a longitudinal ivr acceptability and use study were collected from april 2014 through november 2014 . following a community engagement process to create awareness about the study and establish initial as well as on - going collaboration with community stakeholders , women were recruited from family planning clinics within kisumu county , via 10 community health workers , and participant word - of - mouth referrals without incentives using convenience sampling . we recruited women who were using contraceptives and who were 1834 years of age , were sexually active in the past 3 months on more than one occasion , were not currently pregnant and not intending to get pregnant for the next 12 months , neither breastfeeding nor within 3 months of parturition at screening , had not used a long - term hormonal contraceptive in the past 3 months , lived in the kisumu catchment area ( ~150 km from kisumu city ) , and were within 30 days of their last oral contraceptive scheduled visit or within 3 months of receipt of their last depot medroxyprogesterone acetate injection . the women also had to be willing to undergo monthly pregnancy testing , periodic pelvic examinations , and hiv testing and interviews at screening , 3 months , and 6 months after study enrollment . finally , they had to be able to understand and read english , dholuo , or swahili , comprehend study procedures and provide signed informed consent . the study was approved by the scientific steering and ethical review committees of the kenya medical research institute ( kemri ) , an institutional review board for the united states centers for disease control ( cdc ) , and the kenya pharmacy and poisons board . women who completed the in - depth screening process received a bar of soap , 500 kenya shillings ( ~$5 usd ) for transport , feminine sanitary pads , and a treated malaria bed net in accordance with local reimbursement practices . after completing a brief prescreening computer - assisted personal interview ( capi ) , all women who met preliminary eligibility criteria consented to complete in - depth screening procedures . women completed audio computer - assisted interview ( acasi ) , provided a capi gynecological medical history , and underwent a pelvic examination . questions covered included those regarding demographic characteristics , reasons for taking part in the study , use of medications and adherence , concern about food insecurity , communication with partner about contraception and how many children to have , ever physically hurt or threatened to hurt by a sexual partner , sexual history , risk behaviors , sti in the last 3 months , and the k-6 psychological distress scale . pregnancy , hiv , and sti testing were conducted according to the kenya national guidelines.14 the questionnaires were available in the three local languages ( english , dholuo , or swahili ) . participants were able to select the language of their choice for capi and acasi questionnaire administration . staff were trained prior to and during data collection on understanding the intent of each question . participants completed a self - directed acasi tutorial before using the computer to answer questions . the dependent variable used in the analyses was psychological distress during the last 30 days using responses to the k-6 psychological distress scale,15 which is used for the world health organization ( who ) world mental health survey initiative.16 while anxiety and depression symptoms are included in the k-6 scale , it is classified as measuring nonspecific distress as opposed to a clinical diagnosis of a specific mental disorder.1,15 the k-6 has been validated in sub - saharan african countries.1619 questions were asked about how the person has been feeling during the past 30 days and how often they felt that way , that is , during the last 30 days , how often did you feel nervous , hopeless , fidgety , so depressed that nothing could cheer you up , that everything was an effort , the scale discriminates with precision between community cases and non - cases of diagnostic and statistical manual of mental disorders - iv disorders such as anxiety and mood disorders.15 for our analysis , k-6 psychological distress scale responses ranged from 0 ( none of the time ) to 4 ( all of the time ) . to calculate the final total score , we summed across these six items for a scale score ranging from 0 to 24 . the total scores were grouped into three categories ( low / no distress : 04 ; moderate distress : 512 ; high distress : 1324 ) based on previously identified thresholds for moderate as well as severe psychological distress.15,16,20,21 independent variables included age , ethnic group , marital status , religion , education , occupation , main source of income , concern about having enough food for self and family ( henceforth referred to as food insecurity ) in the past 30 days , being inherited after the death of a spouse , perceived overall health status , age at first sex , unprotected vaginal or anal sex in past 3 months , transactional sex history , recent transactional sex , hiv - infected partners in past 3 months , ever experienced forced sex , ever physically hurt or threatened to hurt by sex partner , got into trouble with family / friends , missed school , or got into fights because of drinking , ever used drugs , drug use in past 30 days , person making decision as to when to stop bearing children ( woman , man , both ) , person making decision on avoiding childbearing ( woman , man , both ) , self - reported sti in the past 3 months , and hiv test results . being inherited after the death of a spouse refers to the luo cultural practice in which a widow is required to marry a male relative of her late husband ( often his brother ) or in more recent times , a professional inheritor receives money or types of payment for inheriting a widow.22 data for this analysis were restricted to the baseline data . we excluded from the analysis two person s screening data , given technical issues with their acasi data . multinomial logistic regression was used to determine factors independently associated with psychological distress ( high vs low / no distress and moderate vs low / no distress ) . selection of predictor variables into a multivariable model and subsequent backward elimination was directed by the chi - square test using 0.25 level of significance as a cutoff . all statistical tests were two - sided and were interpreted at 0.05 level of significance . the analyses for this article were performed using sas for windows version 9.3 ( sas institute , inc . , cary , nc , usa ) . data for this analysis were restricted to the baseline data . we excluded from the analysis two person s screening data , given technical issues with their acasi data . multinomial logistic regression was used to determine factors independently associated with psychological distress ( high vs low / no distress and moderate vs low / no distress ) . selection of predictor variables into a multivariable model and subsequent backward elimination was directed by the chi - square test using 0.25 level of significance as a cutoff . all statistical tests were two - sided and were interpreted at 0.05 level of significance . the analyses for this article were performed using sas for windows version 9.3 ( sas institute , inc . , cary , nc , usa ) . most of the women screened were of luo ethnicity ( 90.9% ) , married or cohabiting ( 67.9% ) , had primary school education or less ( 68.2% ) , and were employed ( 63.4% ) . most women ( 58.4% ) scored in the moderate range ( 512 ) of the k-6 psychological distress scale , with an equal percent ( 20.8% ) scoring on the low / no side ( 04 ) and the high side ( 1324 ) of the scale . the proportion of hiv - infected women in the three psychological distress categories was as follows : low / no ( 8.4% ) , moderate ( 13.1% ) , and high ( 24.0% ) ( table 2 ) . in univariate analysis , the odds of hiv positivity was more than three times higher ( odds ratio [ or ] = 3.43 , confidence interval [ ci ] = 1.44 , 8.14 ) among women whose psychological distress was high compared to low / no distress . based on univariable analysis ( table 2 ) , 13 variables were included in the multivariable model : ethnic group , marital status , education , concern about food insecurity , perceived overall health status , age at first sex , recent transactional sex , hiv+ partners in past 3 months , ever experienced forced sex , ever physically hurt or threatened to hurt by sex partner , person making decision on when to stop bearing children , self - reported sti , and hiv test result . in the final model ( table 3 ) , moderate ( vs low / no ) psychological distress was significantly more likely among women who reported ever experiencing forced sex ( adjusted odds ratio [ aor ] = 4.27 ; 95% ci = 1.919.53 ) and among women who were concerned about food insecurity ( aor = 2.39 ; 95% ci = 1.224.67 ) . high ( vs low / no ) psychological distress was significantly more likely among women who reported ever experiencing forced sex ( aor = 6.06 ; 95% ci = 2.4315.1 ) , who were concerned about food insecurity ( aor = 3.65 ; 95% ci = 1.2310.9 ) , and who self - reported an sti in the past 3 months ( aor = 4.02 ; 95% ci = 1.659.83 ) . it is of note that high ( vs low / no ) psychological distress was more likely among women with lower education ( aor = 2.17 ; 95% ci = 0.994.77 ) , but the p - value was slightly higher than the 0.05 cutoff ( 0.053 ) . among young kenyan women screened for the study , 58% had moderate and 21% had high psychological distress as measured by the k-6 scale . while not a direct comparison , a us survey that used a stratified sample designed to provide estimates for the civilian noninstitutionalized population found that among women aged 18 years , only 3.9% had high psychological distress as measured by the k-6 scale.23 other studies touching on psychiatric issues in kenya , which did not use the k-6 scale , found a 10.8% prevalence of common mental disorders ( eg , depressive episodes , panic disorder , obsessive compulsive disorder ) among a rural general population determined using the clinical interview schedule revised and the psychosis screening questionnaire24 and a 20% prevalence of psychiatric disorders ( eg , anxiety and depression ) among patients in a clinic determined using a systematic psychiatric interview.25 prevalence of non - specific psychological distress is important from a holistic health perspective because , as noted by the who in their constitution , health is a state of complete physical , mental and social well - being and not merely the absence of disease or infirmity.26 public health , including physical and mental health , is influenced not only by individual characteristics but also by social , cultural , economic , and political factors.27 in our study , ever experiencing forced sex was associated with both moderate and high psychological distress among young women using contraceptive . forced sex was experienced by more than a third ( 34.6% ) of the women in our study of whom the majority were of luo ethnicity ( 90.9% ) and married or cohabitating ( 67.9% ) . for instance , among teenagers in ghana , the prevalence of forced sex was 18% and 13% in two waves of a cross - sectional survey,28 and among women in botswana and swaziland , the prevalence was 10.3% and 11.4% , respectively.29 sexual roles and gender scripts in sub - saharan african countries influence sexual experiences including sexual assault.30 biases in favor of male children disenfranchise girls and this can make them more vulnerable to forced sex.31 males are raised in a culture of male dominance , resulting in little couple communication about sex.32 moreover , there are many luo customary practices that involve sex , including construction of a house , marriage of children , the death of a spouse , and agricultural practices . these customary practices are required and if not followed , have a predetermined consequence of defying the cultural tradition called for instance , if sex is not performed before the harvest , the crops can not be brought in.33 women may not always be willing participants and thus lack control in these customary practices . lack of control over one s own sexuality has been associated with psychological distress in a previous study in ghana.34 our study showed that concern about food insecurity within the past 30 days was common across all psychological distress categories ( 85.2% ) and was associated with both moderate and high psychological distress among young women . while the relationship between food insecurity and physical health has been demonstrated,35 less attention has been paid to the relationship between a lack of food access and psychological health.36 a systematic review of the literature found that individuals in developing countries who experienced food insecurity were more likely to have elevated anxiety , depression , and other symptoms of common psychological disorders than individuals who did not experience food insecurity.37 food insecurity can have effects on at least two levels . insecurity can cause a feeling of lack of control , which can result in disorders such as depression and anxiety , and lack of adequate nutrition can adversely affect brain function , including cognition and mood regulation ; lack of proper nutrition has been shown to be associated with disorders such as depression and anxiety.3841 self - report of an sti in the past 3 months in our study was cited by nearly 30% of respondents and was independently associated with high psychological distress . among women in south africa who were recently sexually active , those reporting psychosocial problems also reported a greater proportion of condomless sex,42 and among adults in south africa , post - traumatic stress disorder was associated with sti risk behaviors such as alcohol and/or drug use before sex and condomless sex.43 in addition , being told that one has an sti can bring on psychological distress.44 our descriptive results showed that the proportion of hiv - infected women was highest in the high psychological distress category ( 24.0% ) compared to the moderate psychological distress ( 13.1% ) , and the low or no distress ( 8.4% ) categories . the univariate analysis showed an overall significant relationship between hiv positivity and higher psychological distress not found in the multivariable analysis . this finding corresponds with the literature indicating that mental health problems are associated with hiv risk behaviors and hiv infection.45,46 it also corresponds to a systematic review of african studies that found that people living with hiv or aids have more mental health problems than persons who are not hiv infected.47 services related to the psychological health and wellness of persons in kenya , especially those at high risk for hiv and those infected with hiv , are much needed.48 1 ) our sample size was limited and convenience sampling was used to recruit participants ; thus , the women in our study may not be representative of women residing in the kisumu catchment area . 2 ) we were not able to determine causality in stating that certain variables contributed to psychological distress . 3 ) numbers of hiv - infected persons in the low - to - no psychological distress category were low , and this may have limited statistical power in the multivariable analyses . 4 ) some potentially important variables were not included in our analysis due to omission ( eg , attempted or suicidal thoughts , and parental discussion about sex ) or low numbers ( eg , exchange of food for sex ) . a strength of our study is that it provides information about the important issue of psychological distress in an african setting where little published information is available . nearly 80% of women in our study had moderate or high psychological distress as measured by the k-6 scale . experiencing forced sex and concern about food insecurity was significantly associated with both moderate and high psychological distress . forced sex can increase the risk of psychological problems , leading to poor school performance and high - risk sexual behaviors , as well as physical health problems such complications from an unwanted pregnancy and stis including hiv.49 to reduce psychological distress , a focus on prevention as well as treatment is needed . women need social services and supports , and girls need a path toward a healthy and productive adulthood . both may include a combination of educational , social , health , and economic services ; in other words , a holistic or ecological approach . some studies have focused on innovative interventions that have the potential to empower women and girls to be able to avoid forced sex and reduce concern about food insecurity . for instance , a study in south africa found that a combined microfinance and health training intervention reduced women s experience of physical and/or sexual intimate partner violence in the past year compared to a control group.50 a novel and practical intervention study in kenya found that self - defense training significantly reduced the incidence of sexual assault among girls.51 another study by the population council used an asset building framework to create a program where girls could have their own savings account , which fostered self - esteem as well as offer a practical way to save for their future.52 most important is keeping girls in a safe school setting through at least secondary school , which provides the framework for the breadth of holistic and ecological approaches to empower them as they become young women . staying in school has been found to reduce the risk of hiv infection.5355 initiatives are underway to support these efforts . let girls learn builds on the united states agency for international development campaign for girls education , supports existing programs , and encourages other community - based nongovernmental organizations and governments to put more resources into girls education.56 together for girls is a public private partnership that stimulates policies and programs to prevent sexual violence and provides supportive care and services for victims of sexual violence.57 given that ~60% of kenya s population is 24 years of age,58 initiatives like these have an enormous potential to improve the psychological health of girls and women and by extension , the physical and psychological health of their children and the society at large . kenyan leadership and a strong national governance will be critical to the long - term success of public health initiatives.59

backgroundattention to mental health issues is growing globally . in many countries , including kenya , however , assessment of psychological distress , especially in rural areas , is limited.methodswe analyzed data from young women screened for a longitudinal contraceptive ring study in kisumu , kenya . multivariable regression analysis was used to assess factors associated with recent moderate and high psychological distress , as measured by the kessler ( k-6 ) psychological distress scale.resultsamong the 461 women screened , most ( 58.4% ) were categorized as having moderate psychological distress , 20.8% were categorized as having low or no psychological distress , and 20.8% were categorized as having high psychological distress . moderate psychological distress ( vs low / no ) was significantly more likely among women who reported a history of forced sex and were concerned about recent food insecurity . high ( vs low / no ) psychological distress was significantly more likely among women who reported a history of forced sex , who were concerned about recent food insecurity , and who self - reported a sexually transmitted infection.conclusionto reduce psychological distress , a focus on prevention as well as care methods is needed . girls need a path toward a healthy and productive adulthood with a focus on education , which would help them gain skills to avoid forced sex . women would benefit from easy access to social services and supports that would help them with basic needs like food security among other things . a holistic or ecological approach to services that would address mental , educational , social , health , and economic issues may have the highest chance of having a long - term positive impact on public health .

You are an expert at summarizing long articles. Proceed to summarize the following text: compared to bulk materials of the same substance , nanostructures attain a larger surface to volume ratio due to their small size and volume . the high surface to volume ratio , especially in metallic nanostructures , results in utterly different and sometimes unknown electrical , magnetic and optical properties ( 1 , 2 ) . for example , gold nanostructures ( including nanoparticles , nanorods and nanoshells ) are able to absorb the energy of laser radiation in the near infrared ( nir ) region and efficiently convert it to heat ( 3 ) . as gold nanostructures are biocompatible , the heat can be utilized in medical applications to damage malignant cells and to treat cancer ( photothermal therapy ) ( 4 ) . the main problem of these treatments in practice is low penetration depth of the laser ( 3 , 5 ) . in addition to nir lasers , other sources of electromagnetic spectrum such as radiofrequency generators are used for various purposes in medicine ( 6 ) . non - invasive and non - ionizing radiofrequency waves are able to penetrate deep into the tissues ; therefore , they can theoretically be applied to the tissues in any part of the body . electromagnetic waves at frequencies of 13.56 and 27.12 mhz have been previously used to induce hyperthermia effects as an adjuvant treatment together with radiotherapy or chemotherapy ( 6 - 8 ) . the main problem in using rf waves is non - selectivity of tumor tissue as a target rather than surrounding healthy non - target tissues and its almost identical absorption in these tissues ( 9 , 10 ) . over the past few years , several research groups have considered the targeted treatment of cancer cells by using rf radiation as primary treatment . they have done this by accumulating different nano - particles in malignant tissues ( 9 - 12 ) . in this regard , some in vitro and in vivo studies have been conducted using gold nanostructures exposed to rf radiation . the results show more efficient apoptosis of target tissues compared to healthy tissue ( 13 - 15 ) . however , it is not clear whether the heat produced via rf absorption by nanoparticles kills the target cells or direct biological effects of rf radiation , which are sub - lethal , become fatal in presence of nano - particles ( 16 - 18 ) . nevertheless , in vitro and in vivo studies on different cell lines have been repeated , and the results demonstrate the additional effectiveness of gold nanostructures and rf fields in targeted destruction of cancer cells ( 19 , 20 ) . however , according to the latest findings , the absorption of rf wave energy has been found to increase , provided that overall diameter of the particles is less than 10 nm ( 16 , 21 ) . the absorption of energy was also intensified by shell structure of the particles ( 22 ) . au - au2s ( ggs ) is a gold nanoshell with such features ( 23 ) . ggs presence with exposure to rf radiation is expected to cause targeted killing of malignant cells effectively . ggs structure consists of a dielectric core made of gold sulfide with a thin shell of gold . the nanoshells can be synthesized by a very simple , cheap and controllable method , in contrast with similar morphological nanostructures ( 24 ) . in addition , ggs similar to gold nanoparticle does not cause acute or chronic toxicity , easily penetrates the cells and can bind targeting agents ( e.g. antibodies , peptides or pharmacological agents ) ( 25 , 26 ) . this study has investigated the in vivo effects of ggs exposed to rf radiation on the ct26 tumor model . by mixing aqueous solutions of haucl4 ( alfa aesar , usa ) and na2s ( merck , germany ) , ggs was grown ( 24 ) . in fact , 20 ml of 2 mm haucl4 was mixed with 20 l of 1 mm na2s , and stored at 25c for 1 day . a uv - visible spectrophotometer ( uv 1700 , shimadzu corp . , japan ) was used to monitor the reaction at the wavelength range of 200 - 900 nm . after preparing the nanoparticles , 0.6 g polyvinylpyrrolidone ( pvp ; ( c6h9no)n ) was added to prevent nanoparticles aggregation . finally , to purify ggs nanoshells , the particles were completely separated using sequential centrifugation procedure ( 27 ) . then , we utilized transmission electron microscopy ( tem ) ( cm 120 , philips , germany ) operating at acceleration voltage of 120 kv to examine the morphology of ggs . the size distribution of the nanoparticles was determined by means of a particle size analyzer ( zetasizer , malvern ins . furthermore , we exploited the uv - visible spectrophotometer in order to record the ggs uv - visible absorption spectrum . iran ) derived from colon carcinoma of a balb / c mouse was grown in rpmi-1640 ( gibco , life technologies corp . , usa ) supplemented with 10% ( v / v ) fetal bovine serum ( fbs ) , 100 units / ml penicillin and 100 g / ml streptomycin . cell culture was performed at 37c in a 5% co2 humidified incubator ( nu 8500 , nuaire corp . the cells covered the bottom of the flask as a monolayer after 2 - 3 days of cell growth and proliferation . the cell count and survival rate were determined by a hemocytometer using trypan blue staining . inbred 4 - 6 week balb / c male mice weighting about 20 g were purchased from iranian pasteur institute and kept under standard conditions of temperature , humidity , lighting and feeding in an animal house . in order to induce tumor models , the animals were subcutaneously injected by 510 viable ct26 cells suspended in 150 l normal saline in the right flank . as the tumor volume reached approximately 100 mm ( 10 days after injection ) , 5 mice were randomly sacrificed , autopsied and were subjected to the pathological examinations , and the presence of tumor was confirmed . to prevent animal movement during treatment , the mice were anesthetized before treating . for this purpose , 6 mg / kg xylazine and 60 mg / kg ketamine we adapted variable power rf ( at the frequency of 13.56 mhz ) signal generator ( model 800 crystal brandmaster , britcher corp , usa ) for our purposes in this test . the generating machine consisted of a power generator and adjustable distance transmitting / receiving couplers . a spectrum analyzer ( hp 8566b , hewlett - packard , usa ) was connected to the system to measure transmitted power . the process of impedance matching during rf exposure was so advantageous for monitoring and minimizing the reflected rf power . 48 tumor bearing mice were randomly divided into four groups . in each group , there were 7 mice for follow - up and 5 mice for pathological studies . the groups were as follows : group 1 : control , group 2 : receiving ggs , group 3 : receiving rf radiation and group 4 : receiving ggs with rf radiation . the mice in groups 2 and 4 were intratumorally injected by 1 mg / kg ggs directly around various points of the tumor ( 28 - 30 ) . groups 3 and 4 were irradiated by 400w - power rf radiation for 4 min . to do this , the completely shaved region of tumor was placed between transmitter / receiver plates of rf signal generator . the plates were fully insulated to prevent electrical discharge and shock . in group 4 , the irradiation was performed 20 min after injection of the ggs ( 28 - 30 ) . monitoring the effects of treatments was performed by daily measurement of tumor diameters , including small diameter ( a ) , large diameter ( b ) and thickness of tumor ( c ) using a digital vernier caliper with accuracy of 0.01 mm . the volume of tumors ( v ) was estimated using equation ( 1 ) : ( 1)v = /6(a b c ) the monitoring continued for 40 days after treatment . the treatment day was considered as a reference in order to do the final comparison ; the relative tumor volume on all days was normalized to the volume on the reference day . according to the daily changes in relative tumor volume , the time needed for a 5-fold increase in tumor volume ( t5 ) the pathologic examinations revealed the percentage of necrosis in each tumor 24 hr after treatment day . using these results , reduction in volume of tumor tissue was estimated 24 hr after treatment . in order to perform histologic examinations on tumors and evaluate the changes resulting from the treatments , microscopic slides prepared from tumor tissues were studied by a single pathologist who was blinded to the treatment protocol , and the percentage of necrosis was reported . all data were analyzed using spss 12 after performing normality test and selecting the proper comparative tests . according to the normality test of kolmogorov - smirnov , the data distribution was normal . therefore , one - way anova with a confidence level of 95% was used to compare the data . by mixing aqueous solutions of haucl4 ( alfa aesar , usa ) and na2s ( merck , germany ) , ggs was grown ( 24 ) . in fact , 20 ml of 2 mm haucl4 was mixed with 20 l of 1 mm na2s , and stored at 25c for 1 day . a uv - visible spectrophotometer ( uv 1700 , shimadzu corp . , japan ) was used to monitor the reaction at the wavelength range of 200 - 900 nm . after preparing the nanoparticles , 0.6 g polyvinylpyrrolidone ( pvp ; ( c6h9no)n ) was added to prevent nanoparticles aggregation . finally , to purify ggs nanoshells , the particles were completely separated using sequential centrifugation procedure ( 27 ) . then , we utilized transmission electron microscopy ( tem ) ( cm 120 , philips , germany ) operating at acceleration voltage of 120 kv to examine the morphology of ggs . the size distribution of the nanoparticles was determined by means of a particle size analyzer ( zetasizer , malvern ins . furthermore , we exploited the uv - visible spectrophotometer in order to record the ggs uv - visible absorption spectrum . iran ) derived from colon carcinoma of a balb / c mouse was grown in rpmi-1640 ( gibco , life technologies corp . , usa ) supplemented with 10% ( v / v ) fetal bovine serum ( fbs ) , 100 units / ml penicillin and 100 g / ml streptomycin . cell culture was performed at 37c in a 5% co2 humidified incubator ( nu 8500 , nuaire corp . the cells covered the bottom of the flask as a monolayer after 2 - 3 days of cell growth and proliferation . the cell count and survival rate were determined by a hemocytometer using trypan blue staining . inbred 4 - 6 week balb / c male mice weighting about 20 g were purchased from iranian pasteur institute and kept under standard conditions of temperature , humidity , lighting and feeding in an animal house . in order to induce tumor models , the animals were subcutaneously injected by 510 viable ct26 cells suspended in 150 l normal saline in the right flank . as the tumor volume reached approximately 100 mm ( 10 days after injection ) , 5 mice were randomly sacrificed , autopsied and were subjected to the pathological examinations , and the presence of tumor was confirmed . to prevent animal movement during treatment , the mice were anesthetized before treating . for this purpose , we adapted variable power rf ( at the frequency of 13.56 mhz ) signal generator ( model 800 crystal brandmaster , britcher corp , usa ) for our purposes in this test . the generating machine consisted of a power generator and adjustable distance transmitting / receiving couplers . a spectrum analyzer ( hp 8566b , hewlett - packard , usa ) was connected to the system to measure transmitted power . the process of impedance matching during rf exposure was so advantageous for monitoring and minimizing the reflected rf power . 48 tumor bearing mice were randomly divided into four groups . in each group , there were 7 mice for follow - up and 5 mice for pathological studies . the groups were as follows : group 1 : control , group 2 : receiving ggs , group 3 : receiving rf radiation and group 4 : receiving ggs with rf radiation . the mice in groups 2 and 4 were intratumorally injected by 1 mg / kg ggs directly around various points of the tumor ( 28 - 30 ) . groups 3 and 4 were irradiated by 400w - power rf radiation for 4 min . to do this , the completely shaved region of tumor was placed between transmitter / receiver plates of rf signal generator . the plates were fully insulated to prevent electrical discharge and shock . in group 4 , the irradiation was performed 20 min after injection of the ggs ( 28 - 30 ) . 7 mice per group were considered for follow - up treatment . monitoring the effects of treatments was performed by daily measurement of tumor diameters , including small diameter ( a ) , large diameter ( b ) and thickness of tumor ( c ) using a digital vernier caliper with accuracy of 0.01 mm . the volume of tumors ( v ) was estimated using equation ( 1 ) : ( 1)v = /6(a b c ) the monitoring continued for 40 days after treatment . the treatment day was considered as a reference in order to do the final comparison ; the relative tumor volume on all days was normalized to the volume on the reference day . according to the daily changes in relative tumor volume , the time needed for a 5-fold increase in tumor volume ( t5 ) the pathologic examinations revealed the percentage of necrosis in each tumor 24 hr after treatment day . using these results , reduction in volume of tumor tissue was estimated 24 hr after treatment . in order to perform histologic examinations on tumors and evaluate the changes resulting from the treatments , microscopic slides prepared from tumor tissues were studied by a single pathologist who was blinded to the treatment protocol , and the percentage of necrosis was reported . all data were analyzed using spss 12 after performing normality test and selecting the proper comparative tests . according to the normality test of kolmogorov - smirnov , the data distribution was normal . therefore , one - way anova with a confidence level of 95% was used to compare the data . figure 1 illustrates the diagram of particle size analysis ( psa ) using dynamic light scattering ( dls ) method with a peak at 5.4 nm . tem image of the synthesized samples has been shown in figure 2 . in uv - vis spectroscopy of the synthesized samples , a strong absorption band was observed at 759 nm in the nir region and a weak absorption band was seen at 529 nm in the visible region , which confirms synthesis of ggs nanoshells ( 23 - 24 ) . figure 3 shows the changes in relative volume of tumors in different groups until 4 weeks after treatment . no growth inhibiting effect was observed in tumor volume of control and ggs receiving groups . tumor growth became slow in the rf irradiated group compared with the control group , but this effect was significantly more pronounced in ggs+rf group . statistical analysis showed that on 10 , 15 , 20 and 25 days after treatment , there was no statistically significant difference between relative volume of tumor in control group compared to ggs group and also rf group ( p=0.072 ) . but during all these days , relative volume of tumors in ggs+rf group was significantly with ggs and control groups ( p<0.001 ) . however , no significant difference was observed between the relative volume of tumors in ggs+rf group and that in rf group ( p=0.217 ) . figure 4 shows the time required for a 5-fold increase in tumor volume in different groups . the minimum and maximum t5 were determined as 7.3 and 12.4 days for control and ggs+rf receiving groups , respectively . statistical analysis showed no significant difference between t5 of the control group and that of ggs and rf groups ( p=0.789 ) . however , the difference between ggs+rf group and control or ggs groups were statistically significant ( p<0.012 ) . however , the t5 between ggs+rf group and rf group was not statistically significant ( p=0.157 ) . figure 5 illustrates volume of the lost tumor tissue in terms of percentage of total volume for different groups , according to the pathological findings . the lowest volume of lost tissue was calculated for ggs group as 4.2% and the highest volume was that of ggs+rf group with 31.5% . statistical analysis showed that the differences between percentage of lost tissue volume in control , ggs and rf groups were not significant ( p=0.902 ) . however , significant differences between all groups in comparison with the ggs+rf group has been observed ( p<0.013 ) . figure 1 illustrates the diagram of particle size analysis ( psa ) using dynamic light scattering ( dls ) method with a peak at 5.4 nm . tem image of the synthesized samples has been shown in figure 2 . in uv - vis spectroscopy of the synthesized samples , a strong absorption band was observed at 759 nm in the nir region and a weak absorption band was seen at 529 nm in the visible region , which confirms synthesis of ggs nanoshells ( 23 - 24 ) . figure 3 shows the changes in relative volume of tumors in different groups until 4 weeks after treatment . no growth inhibiting effect was observed in tumor volume of control and ggs receiving groups . tumor growth became slow in the rf irradiated group compared with the control group , but this effect was significantly more pronounced in ggs+rf group . statistical analysis showed that on 10 , 15 , 20 and 25 days after treatment , there was no statistically significant difference between relative volume of tumor in control group compared to ggs group and also rf group ( p=0.072 ) . but during all these days , relative volume of tumors in ggs+rf group was significantly with ggs and control groups ( p<0.001 ) . however , no significant difference was observed between the relative volume of tumors in ggs+rf group and that in rf group ( p=0.217 ) . figure 4 shows the time required for a 5-fold increase in tumor volume in different groups . the minimum and maximum t5 were determined as 7.3 and 12.4 days for control and ggs+rf receiving groups , respectively . statistical analysis showed no significant difference between t5 of the control group and that of ggs and rf groups ( p=0.789 ) . however , the difference between ggs+rf group and control or ggs groups were statistically significant ( p<0.012 ) . however , the t5 between ggs+rf group and rf group was not statistically significant ( p=0.157 ) . figure 5 illustrates volume of the lost tumor tissue in terms of percentage of total volume for different groups , according to the pathological findings . the lowest volume of lost tissue was calculated for ggs group as 4.2% and the highest volume was that of ggs+rf group with 31.5% . statistical analysis showed that the differences between percentage of lost tissue volume in control , ggs and rf groups were not significant ( p=0.902 ) . however , significant differences between all groups in comparison with the ggs+rf group has been observed ( p<0.013 ) . recently , the use of rf radiation together with nanoparticles ( especially gold nanoparticles ) has been noticed and discussed in order to induce lethal damage in malignant tissues . present study also indicates the relative tumor volume was significantly reduced in the treatment group ( ggs+rf waves ) in comparison with the control group . these results are in agreement with the findings of cardinal et al and curley et al . however , the origins and mechanisms of damage to malignant tissue are not clearly identified . based upon moran et al studies , it seems that gold nanoparticles with diameters less than 50 nm cause a sudden rise in ambient temperature via energy absorption of rf and heat generation ( 22 ) . as a result , by inserting the nanoparticles within the cancer cells and exposing them to rf radiation , irreversible damage can be inflicted to these cells , while due to the absence of nanoparticles in healthy tissues , these tissues suffer no harm . however , further detailed studies of li et al have shown that the heat is due to ionic impurities associated with nanoparticles ( 17 ) . to reduce the effect of such factors , we purified nanoparticles according to gobin et al ( 27 ) . having removed the impurities , san et al and corr et al determined that the diameter of nanoparticles should be less than 10 nm to generate suitable heat ( 16 , 21 ) . ggs nanoshells used in this study had these features and were prepared under such conditions . in contrast with other gold nanoshells , ggs nanoshells in sizes smaller than 10 nm are easily and inexpensively synthesized . , neither mortality nor other significant side effects have been observed in the ggs receiving group , like all other groups for 40 days after treatment , although no evidence of reduction in tumor volume was observed in the ggs group . in contrast , relative reduction in tumor volume was observed in the rf group , although this reduction was not significant compared to the control group , but also not negligible . recent theoretical bioelectric studies of iomin and experimental research of palti et al suggest that rf waves have the ability to interrupt or interfere with the cell cycle ( 31 - 33 ) . stupp et al have even utilized this phenomenon clinically for the treatment of gbm ( 34 ) . in addition , rf radiation to conductor environments such as living tissues inevitably induces high - frequency microcurrents . the presence of these microcurrents also impairs cellular processes ( 32 , 33 ) . according to the above - mentioned reasons , moreover , recent studies of raoof et al have shown that inherent permittivity of malignant tissues is more than that of normal tissues in the range of rf waves ( 18 ) . however , rf waves cause temperature rise in malignant tissues compared to healthy tissues , after being exposed to rf radiation . this means that even without the presence of nanoparticles , it is expected that damage to malignant tissues be greater than to healthy tissues with rf radiation ( 18 ) . in this study , based on statistical analysis , this decline in tumor volume however , based on theoretical studies of tiwari et al , interruption or disruption of cell cycle due to rf waves was obviously increased in presence of nanoparticles , which disrupt space symmetry of living cells ( 35 ) . in this way , we can state another reason for obvious reduction in volume of tumor in ggs+rf compared to rf group . in the present study , regardless of the hyperthermic justification for the reduction in volume of tumor in ggs+rf group , it seems that ggs presence in the cells enhances the effect of rf radiation in stopping growth of the tumor . based upon the reasons stated above , it seems that the presence of ggs biocompatible nanoshells in tumor cells perceptibly raises the thermal sub - lethal or bioelectric effects of rf , and these effects in turn inhibit tumor growth . the results of needed time for a 5-fold increase in volume of tumor also endorse the reasons . however , the results of lost tumor volume indicate significant differences for relative volume of tumor in ggs+rf group compared with all other groups , even irradiated rf group . in addition , it seems that the difference among the different treated groups gets stronger after 24 hr . however , over time and with proliferation of the tumor cells , this difference is blurred . as the damaging mechanisms usually act at the cellular level , causing no drastic genetic changes , reconstruction of tumor is not surprising over time . to get more definite results , we need fractionation of similar treatments with fractionated doses of ionizing radiation ( 18 ) . however , more comprehensive radiobiological studies in this field seem to be necessary . in this study , rf waves in the absence of ggs caused no effective reduction in volume of the tumor . however , the ggs nanoshells in tumors exposed to noninvasive rf radiation decrease growth of the tumors . although this was not the first time the simultaneous impact of nanoparticles and rf waves was observed , using ggs as a biocompatible as well as accessible and inexpensive nanoshell is a novelty .

objective(s):several studies have been carried out to investigate the effect of various nanoparticles exposed to radiofrequency ( rf ) waves on cancerous tissues . in this study , a colon carcinoma tumor model was irradiated by rf in the presence of gold - gold sulfide ( ggs ) nanoshells.materials and methods : synthesis and characterization of ggs nanoshells were initially performed . ct26 cells were subcutaneously injected into the flank of balb / c mice to create the colon carcinoma tumor models . then the tumors were subjected to different treatments . treatment factors included intratumoral injection of ggs and rf radiation . different groups were considered as control with no treatment , receiving ggs , rf irradiated and simultaneous administration of ggs and rf . efficacy of the treatments was evaluated by daily monitoring of tumor volume and recording the relative changes in it , the time needed for a 5-fold increase in the volume of tumor ( t5 ) and utilizing pathologic studies to determine the lost volume of the tumors.results : in comparison with control group , tumor growth was not markedly inhibited in the groups receiving only ggs or rf , while in the group receiving ggs and rf , tumor growth was effectively inhibited compared with the other groups . in addition , the lost volume of the tumor and t5 was markedly higher in groups receiving ggs and rf compared with other groups.conclusion : this study showed that rf radiation can markedly reduce the tumor growth in presence of ggs . hence , it can be predicted that ggs nanoshells convert sub - lethal effects of noninvasive rf fields into lethal damages .

You are an expert at summarizing long articles. Proceed to summarize the following text: chlamydia trachomatis ( serotypes d k ) are obligatory intracellular gram - negative bacteria that primarily infect the female cervix , urethra , and fallopian tubes . the majority of infection is asymptomatic and goes undetected , with an increased risk of pelvic inflammatory disease , and is the leading cause of ectopic pregnancy , tubal factor infertility,13 and chronic pelvic pains . in saudi arabia , the incidence of sexually transmitted infections is low compared with that in developed countries . gonococcal and nongonococcal urethritis and genital warts have been reported frequently among saudis , whereas aids , syphilis , and genital herpes are frequently reported among non - saudis.4 for diagnosis of chlamydia infection , cell culture of urogenital specimens has been considered the ideal method , although few laboratories could offer this , due to its cost and lack of experience in the cell culture technique . accurate results depend on the proper sample taking , carrying , storage , and interpretation . although culture is 100% specific for chlamydia ( no false positives ) , there is a growing observation that culture is not 100% sensitive . the combination of 100% specificity and the ability to detect viable organisms makes culture the standard for legal applications such as for sexual assault . with the availability of more rapid assays during the 1980s , many laboratories started to use enzyme - linked immunosorbent assay ( elisa ) due to its lesser demands on cost , skills , and time required for obtaining the results . however , these tests were less sensitive , as detection of antibodies in a single serum sample has frequently been found in the absence of active infection.5 despite the difficulty of differentiating between previous and current infections , the presence of chlamydia - specific antibody ( immunoglobulin [ ig]a ) is significantly associated with upper genital tract infection , particularly when the antibody titre is high.6,7 as sensitivity of the elisa test is low , this can assist but can not replace direct antigen detection or isolation of the organism by the culture technique.8 another widely used rapid simple test is enzyme immunoassay . it does not require any sophisticated equipment and it takes only 30 minutes to be completed . reported sensitivities of rapid tests relative to the culture range from 52% to 85% for endocervical swabs , and their specificities are over 95%.911 however , rapid tests are not recommended to be used in a low - prevalence population or for asymptomatic women , due to the potential for false positives . more recent and very sensitive nucleic acid amplification techniques ( naats ) , such as polymerase chain reaction and ligase chain reaction , have been used for detection of chlamydia genetic material dna in cervical and urethral samples.12 a further development is nucleic acid hybridization ( dna - probe ) tests , which also detect chlamydia genetic material dna . other diagnostic tests include transcription - mediated amplification , which amplifies the ribosomal - rna ; strand displacement amplification ; and direct fluorescent antibody tests . papanicolaou smear is not an option for chlamydia screening , as it has poor sensitivity and poor specificity . sweden is known to have the best chlamydia screening program in the world.13 in the usa , the centers for disease control and prevention have supported a screening program since 1988.14 the phased implementation of a national chlamydia screening program in the uk offers screening for all sexually active women , using naats.15 several studies have reported a decline in chlamydia prevalence after early screening and proper treatment.1618 the best evidence to date about the effectiveness of screening for chlamydia infection in preventing pelvic inflammatory disease is a randomized controlled trial conducted in seattle , usa.19 two swedish studies have supported its findings.20,21 selective screening is more cost - effective than universal screening , although the latter may be indicated when prevalence of infection is high.22,23 the present study aimed to screen saudi infertile sexually active women in jazan city , in the southwest region of saudi arabia , for possible chlamydia trachomatis infection . the study was conducted in jazan general hospital with the aid of laboratory facilities at the university of jazan . the study covered a period of 1 year ( from july 1 , 2011 to june 30 , 2012 ) . the study group included all saudi married women of primary and secondary infertility , aged between 18 and 40 years , who attended the outpatient gynecology clinic at jazan general hospital for infertility examination during the period of study and agreed to participate ( signed informed consent ) . the randomized control group included 100 saudi married pregnant women who attended the outpatient obstetrics clinic for routine antenatal care during the period of study and agreed to participate ( signed informed consent ) . randomization was done using the random allocation software ( developed by saghaei m , md , department of anesthesia , isfahan university of medical sciences , iran ) ( version 1.0 , released on may 2004 ) . structured meetings were conducted with all recruited women , where they received an information sheet about the study and signed an informed consent . relevant medical records were reviewed for any possible present and past medical or surgical diseases . for a precise detection of chlamydia infection , two methods have been used for screening an indirect method for detection of chlamydia - specific igg and iga antibodies in the sera ( elisa ) , and a direct method for detection of chlamydia organism ( mccoy [ medac gesellschaft fr klinische spezialprparate mbh , wedel , germany ] cell culture ) . about 5 ml of venous blood was drawn from each participant for measurement of serum chlamydia igg and iga antibodies using a peptide - based enzyme - linked immunosorbent assay ( igg - pelisa cat no 497/tmb , and iga - pelisa cat no 498/tmb medac , wedel , germany ) . each serum sample had a numerical code so that the clinical condition of the tested woman was unknown to the laboratory technician . each kit contained 96 wells , and all tests were performed before their printed expiry dates . the kits , microplates , controls , buffers , diluent , conjugate , 3,3,5,5-tetramethylbenzidine substrate , and stop solution were stored at 4c and allowed to stand for 1 hour at room temperature before use . results were interpreted according to the manufacturer s instructions , issuing a negative , equivocal , or positive result . the intensity of the color is proportional to the concentration ( titer ) of the specific antibody in the sample . samples with optical density values located within the gray zone were retested again after 2 weeks in order to determine a titre change . the staff nurse of the outpatient clinic and two general practitioners were taught how to collect endocervical and urethral specimens . we used a cyto - brush ( which collects more columnar cells than cotton - tipped swabs ) . the brush was inserted into the cervical os beyond the squamocolumnar junction 12 cm deep , rotated , and removed without touching the vaginal mucosa . the urethral swab was inserted 1 cm into the urethra , rotated once prior to removal , and placed in a separate tube of 2-sucrose - phosphate culture - transport medium . the examined women were instructed not to urinate within the previous hour ( as urination washes out the infected columnar cells ) . all collected samples were transported on wet ice to the laboratory of the university within 12 hours of collection . strict adherence to the standard techniques of collecting specimens has biased the findings toward screening outcomes . as chlamydia trachomatis is an obligatory intracellular pathogen , a specimen that lacks endocervical cells is discarded , as it will greatly increase the probability of a false negative result . inoculated cultures were incubated at 37c for 3 days , washed , fixed in methanol , stained with giemsa , ( medac gesellschaft fr klinische spezialprparate mbh , wedel , germany ) and screened by dark - ground microscopy for possible intracytoplasmic inclusion bodies . universal precautions were followed when handling such risky specimens , and all our laboratory workers were vaccinated against the hepatitis b virus earlier . after the screening reports were collected , all participants were informed about their test results and the implications were discussed with the staff nurse . any woman with a positive result was referred to the clinic for treatment with a notification letter for her husband to be tested and treated . the collected clinical and laboratory data were stored on microsoft excel spreadsheets for windows and then analyzed by suitable statistical methods using the statsdirect statistical software ( version 2.7.9 , released on july 9 , 2012 , statsdirect ltd , cheshire , uk ) . the data were double - checked carefully during the process of collection , transcription , and computer inputting . t - test and yates - corrected test with fisher exact at a confidence interval ( ci ) of 95% and a significance level of 5% were used . the rate of chlamydia trachomatis infection among saudi infertile women was higher than its rate among the saudi fertile women ( table 1 and figure 1 ) . the mean age of saudi infertile women enrolled in this study as the study group was 26.4 4.8 years . women aged less than 25 years ( 276 women ) had an infection rate of 7.81% , whereas those aged between 25 and 40 years ( 364 women ) had an infection rate of 7.19% ( figure 2 ) . this was not of statistical significance ( ci 0.972.42 , odds ratio [ or ] 1.53 , p - value = 0.0581 ) . most of the saudi infertile women had primary infertility ( 425 women ) with an infection rate of 11.72% , whereas 215 women had secondary infertility with an infection rate of 3.28% ( table 2 and figure 3 ) . cases with infertility duration less than 5 years were 498 women with an infection rate of 12.5% , whereas those with infertility duration longer than 5 years were 142 women with an infection rate of 2.5% . this finding was not of statistical significance ( ci 0.842.86 , or = 1.51 , p - value = 0.1832 ) . among saudi infertile women , a past history of sexually transmitted infection was mentioned by 165 women ( 25.78% ) , whereas 70 women ( 10.94% ) reported a previous pelvic surgery . a history of a new husband in the preceding year was mentioned by 47 women ( 7.34% ) , whereas 23 women ( 3.59% ) reported a past use of an intrauterine contraceptive cupper - t device . most women of the study group were asymptomatic ( 475 women ) with an infection rate of 11.72% , whereas 165 women were symptomatic with an infection rate of 3.28% ( figure 4 ) . this finding was not of statistical significance ( ci 0.752.28 , or = 1.29 , p - value = 0.3777 ) . inquiry revealed a complaint of painful micturition in 115 women ( 17.97% ) , vaginal discharges in 98 women ( 15.31% ) , pelvic pains in 96 women ( 15.0% ) , irregular uterine bleeding in 47 women ( 7.34% ) , postcoital bleeding in 27 women ( 4.22% ) , and urethral discharge in three women ( 0.47% ) . on pelvic examination the signs were muco - purulent cervicitis in 224 women ( 35.0% ) , cervical friability in 132 women ( 20.63% ) , and hypertrophic cervix in 56 women ( 8.75% ) . the rate of detection of chlamydia trachomatis infection among infertile women using the elisa test was 9.84% , whereas it was 12.03% using the culture technique ( tables 3 and 4 , figure 5 ) . this finding was not of statistical significance ( ci 0.551.15 , or = 0.798 , p - value = 0.2443 ) . lastly , a predictive analysis for the screening tests used in this study was done using the statsdirect statistical software ( table 5 ) . prevalence of infection is difficult to estimate without screening , as most of the cases are asymptomatic . although 929,462 cases of chlamydia infection were reported in the usa , according to the centers for disease control and prevention , in 2004,14 the actual number of cases is thought to be more than 2.8 million per year.24 according to the world health organization , new cases of chlamydia infection have been estimated globally to be 92 million.25 both health and economic consequences of infection are serious ; thus , prevention and early detection are essential . the findings of this study highlight the need for chlamydia screening programs , as the prevalence of infection among saudi infertile women in jazan city , saudi arabia , is high ( 15.0% ) . sociodemographic risk factors for infection include young age,26,27 an urban setting and low income,28 having multiple sexual partners29 or an infected partner,30 nulliparity,31 and irregular use of barrier contraceptives or using oral contraceptive pills.32 due to local cultural and social constraints , our study excluded saudi women aged less than 18 years . consequently , direct comparison on chlamydia prevalence can not be made precisely with western studies that include younger women ( aged 1519 years).14 moreover , unmarried saudi women were excluded from the present study , as the management of any positive cases would create both legal and social problems . furthermore , routine inquiries about number of sexual partners is not realistic in an islamic community . in our study , the rate of infection was 7.81% for saudi infertile women aged 18 to less than 25 years . this rate - age association is largely relating to the higher level of sexual activity among young women , whose squamocolumnar junction of the cervix still presents on ectocervix ( cervical ectopy ) , which provides a large target area for infection.33 that is why age is used in many countries as a primary determinant for selective chlamydia screening programs.34 the prevalence of chlamydia infection among asymptomatic healthy - looking saudi women is 8.5% in riyadh city,35 whereas it is 4.0% in our study in jazan city , saudi arabia . in this study , positive chlamydia was seen in 75 women out of 425 ( 17.65% ) with primary infertility , and in 21 women out of 215 ( 9.77% ) with secondary infertility . in an indian study , positive chlamydia was seen in 20 women out of the 74 ( 27.03% ) with primary infertility , and in eleven women out of the 36 ( 30.56% ) with secondary infertility.36 although chlamydia infection is not yet a fully reportable infectious disease in saudi arabia , sera from patients who attended our clinic in jazan was 9.06% positive for igg antibodies and 5.0% positive for iga antibodies . in makkah city , chlamydia igg antibodies were detected in 8.7% of pregnant saudi women,37 whereas in our study , igg antibodies were detected in only 4.0% . this study is considered the first to screen saudi infertile women for chlamydia trachomatis infection as a possible causative factor for their infertility . lack of chlamydia screening among saudi women might result from a lack of awareness of the high rate of infection among young asymptomatic women and its serious late complications . as there is a high prevalence of chlamydia infection among saudi infertile women ( evident in this study ) and a high relationship between chlamydia infection and tubal factor infertility ( evident in literature ) , it is mandatory to screen all saudi infertile women for chlamydia trachomatis at the start of their infertility examination prior to any invasive procedure . the limitations of data surveyed in this study include its restriction to the geographic boundaries of jazan city , to the time frame of 1 year , and to a specific target risk group ( saudi infertile women ) . there are several questions needed for further research , such as the prevalence of chlamydia trachomatis infection among the general population in saudi arabia , the cost - effectiveness of selective versus universal screening programs , and the effect of a screening program in reducing the rate of infertility . the prevalence of chlamydia trachomatis infection among saudi infertile women at jazan city , saudi arabia , is high ( 15.0% ) . this finding calls for a national screening program for the early detection of chlamydia trachomatis infection among infertile couples in saudi arabia . the elisa test seems to be a good alternative to the culture method for screening purposes . it has a high specificity ( 100% ) and a high negative predictive value ( 94.28% ) .

backgroundchlamydia trachomatis infection is a worldwide - distributed sexually transmitted infection that may lead to infertility.objectivesthis study aims to report the prevalence of chlamydia trachomatis infection among infertile women in saudi arabia.patients and methodsa community - based study carried out at the obstetrics and gynecology clinic at jazan general hospital , saudi arabia . the study group included 640 saudi infertile women who were aged between 18 and 40 years and who attended the gynecology clinic for infertility examination throughout 1 year of study ( from july 1 , 2011 to june 30 , 2012 ) . the randomized control group included 100 saudi fertile women who attended the obstetrics clinic for routine antenatal care . all recruited women were screened for chlamydia infection by enzyme - linked immunosorbent assay ( elisa ) for detection of serum - specific antibodies and then retested by the mccoy cell culture technique.resultsthe prevalence of chlamydia trachomatis infection among infertile women was high , at 15.0% . the rate of chlamydia infection detected by elisa was 9.84% , and it was 12.03% by the culture method ( p = 0.2443).conclusionthe high prevalence of chlamydia trachomatis infection among saudi infertile women demands a national screening program for early detection among infertile couples . elisa is available as a simple screening test alternative to the culture method .

You are an expert at summarizing long articles. Proceed to summarize the following text: primary tumors of the pleura can be benign or malignant and they may manifest as either diffuse or localized neoplasms . benign tumors are less common than the malignant ones , they are localized and arise from the submesothelial mesenchymal cells with a fibroblastic differentiation . in most cases , the solitary fibrous tumor of the pleura ( sftp ) can be asymptomatic ; sometimes , it causes symptoms ( as dyspnea , cough , chest pain ) following the compression of airways and pulmonary parenchyma . the best therapy for sftp is complete surgical resection with a long - term follow - up . we present two cases of sftp in two different patients , a new mother with a polyarticular paraneoplastic syndrome and an old man with obstructive pulmonary disease who had underestimated the occasional finding on the chest x - ray of a pulmonary small peripheral mass 4 years before . a 36-year old woman was admitted to the emergency department of our hospital with widespread polyarticular pain and fever ( t < the patient had given birth to a baby 1 week before the onset of the symptoms . with the worsening of fever ( t > 39c ) , a chest computed tomography ( ct ) scan was performed revealing [ figure 1a b ] a large inhomogeneous mass in the upper lobe of the left lung ( 18 11 9 cm ) . the ct scan also showed compression and atelectasis of the lung parenchyma with ipsilateral pleural effusion ; there were no significant lymphadenopathies of the main stations of the thorax . therefore , the patient was allocated to the division of pulmonology . at admission , she did not report dyspnea , cough , or chest pain but persistent polyarticular pain and fever ; the blood tests [ including waaler - rose and anti - neutrophil cytoplasmic antibody ( anca ) ] were normal except for a mild leukocytosis ( 13,360 cells / mm ) and an increase of c - reactive protein ( crp ) ( 16,65 mg / dl ) ( normal value : < 0,5 mg / dl ) . we decided to perform a ct - guided biopsy of the mass ; histological examination revealed the presence of sftp cells cd34+/b - cell lymphoma 2 ( bcl-2)+ with proliferative activity ( expressed with the index of proliferation ki-67 ) less than 5 . following this result , diagnosis of sftp was processed and joint pain and fever were considered as epiphenomena of the tumor ( paraneoplastic syndrome ) . therefore , the pulmonary lesion was surgically removed with subsequent reexpansion of the lung . case 1 - chest ct scans at the left pulmonary apex level ( a ) and at the aortic arch level ( b ) ; case 2 - chest ct scans performed for biopsy show an intraparenchymal neoplasm near the anterior chest wall ( c ) and at the aortic arch level ( d ) a 75-year old man was admitted to our hospital because of a chest x - ray that showed an opacity ( 5,8 4,9 cm ) in the left lung with mild dyspnea and productive cough that began 3 months earlier . the patient had a clinical and functional diagnosis of chronic obstructive pulmonary disease ( copd ) , with a moderate smoking habit ( 30 packs / year ) , chronic systemic hypertension , abnormal electrocardiogram findings ( brugada syndrome ) , diabetes mellitus ( dm ) ( type ii ) . a ct scan , performed 4 years before , had shown a smaller mass ( 3,5 2,5 cm ) on the left lung , next to the chest wall in comparison with that documented during hospitalization . at that time , no diagnosis was reached since the patient refused to undergo diagnostic biopsy . routine tests were normal including blood gas analysis ( ph 7,43 , paco2 45 mmhg , pao2 81 mmhg , and sao2 96% ) . due to increased mass dimension in comparison with previous ct scan , the patient was asked again to undergo a ct - guided biopsy of that lesion and he agreed [ figure 1c d ] . histological examination associated with the presence of cells cd34+/bcl-2 + was compatible with a sftp . the thoracic surgeon performed mass resection with a complete recovery of the patient . a 36-year old woman was admitted to the emergency department of our hospital with widespread polyarticular pain and fever ( t < the patient had given birth to a baby 1 week before the onset of the symptoms . with the worsening of fever ( t > 39c ) , a chest computed tomography ( ct ) scan was performed revealing [ figure 1a b ] a large inhomogeneous mass in the upper lobe of the left lung ( 18 11 9 cm ) . the ct scan also showed compression and atelectasis of the lung parenchyma with ipsilateral pleural effusion ; there were no significant lymphadenopathies of the main stations of the thorax . therefore , the patient was allocated to the division of pulmonology . at admission , she did not report dyspnea , cough , or chest pain but persistent polyarticular pain and fever ; the blood tests [ including waaler - rose and anti - neutrophil cytoplasmic antibody ( anca ) ] were normal except for a mild leukocytosis ( 13,360 cells / mm ) and an increase of c - reactive protein ( crp ) ( 16,65 mg / dl ) ( normal value : < 0,5 mg / dl ) . we decided to perform a ct - guided biopsy of the mass ; histological examination revealed the presence of sftp cells cd34+/b - cell lymphoma 2 ( bcl-2)+ with proliferative activity ( expressed with the index of proliferation ki-67 ) less than 5 . following this result , diagnosis of sftp was processed and joint pain and fever were considered as epiphenomena of the tumor ( paraneoplastic syndrome ) . therefore , the pulmonary lesion was surgically removed with subsequent reexpansion of the lung . case 1 - chest ct scans at the left pulmonary apex level ( a ) and at the aortic arch level ( b ) ; case 2 - chest ct scans performed for biopsy show an intraparenchymal neoplasm near the anterior chest wall ( c ) and at the aortic arch level ( d ) a 75-year old man was admitted to our hospital because of a chest x - ray that showed an opacity ( 5,8 4,9 cm ) in the left lung with mild dyspnea and productive cough that began 3 months earlier . the patient had a clinical and functional diagnosis of chronic obstructive pulmonary disease ( copd ) , with a moderate smoking habit ( 30 packs / year ) , chronic systemic hypertension , abnormal electrocardiogram findings ( brugada syndrome ) , diabetes mellitus ( dm ) ( type ii ) . a ct scan , performed 4 years before , had shown a smaller mass ( 3,5 2,5 cm ) on the left lung , next to the chest wall in comparison with that documented during hospitalization . at that time , no diagnosis was reached since the patient refused to undergo diagnostic biopsy . routine tests were normal including blood gas analysis ( ph 7,43 , paco2 45 mmhg , pao2 81 mmhg , and sao2 96% ) . due to increased mass dimension in comparison with previous ct scan , the patient was asked again to undergo a ct - guided biopsy of that lesion and he agreed [ figure 1c d ] . histological examination associated with the presence of cells cd34+/bcl-2 + was compatible with a sftp . the thoracic surgeon performed mass resection with a complete recovery of the patient . we have reported two cases of sftp diagnosed by transthoracic biopsy : the first of a young , new mother with fever and widespread joint pain without significant respiratory symptoms and the other of a 75-year old man with cough and dyspnea attributed to his copd and who was aware of having a pulmonary neoplasm from 4 years , the nature of which he had never ascertained . sftp is rare benign tumor and is more frequent in the sixth / seventh decade of life in both the sexes with a modest predominance among females . generally , solitary fibrous tumors of the pleura are isolated , well - defined masses while conglomerate or multifocal ones are rare presentations . approximately , half of the masses are pedunculated , with vascular supply maintained by the pedicle . sometimes , large tumors can produce symptomatic atelectasis or in rare cases hemoptysis by compression of a bronchus . furthermore , large tumors , more frequently than the small ones , produce paraneoplastic syndromes such as digital clubbing and hypertrophic pulmonary osteoarthropathy ( pierre marie - bamberg syndrome ) . in patients with hypertrophic pulmonary osteoarthropathy , bilateral arthritis - like symptoms are common findings ( e.g. joint pain , pain along the long bones , stiffness or swelling of the joints , and edema of the ankles ) . the resection of the tumor usually solves the paraneoplastic symptoms ( they generally disappear within about 25 months or longer after surgery ) but they may appear again with recurrence of the tumor . our first patient showed only joint pain and fever that were unresponsive to antibiotics and no respiratory symptoms despite compression of pulmonary parenchyma caused by the large mass ; on the contrary , the second patient showed respiratory symptoms that were linked to his copd . it is worth mentioning that the slow growth of this tumor of the pleura showed a slight increase in size ( 3,5 2,5 cm vs 5,8 4,9 cm ) in about 4 years . after an initial approach with chest x - rays , the ct scan is the best procedure in order to study more clearly the size and location of the tumor and to plan surgery in the best way . the ct scan visualizes a small sftp as well - defined soft tissue mass near the pleural layer , usually lobular in shape , homogeneous in density and noninvasive ; larger lesions , on the other hand , are generally heterogeneous and may reveal themselves as diffuse pleural opacities on ct scans . sftp can not be diagnosed only by radiological tools and transthoracic tissue biopsy is essential to reach a diagnosis . it is useful to evaluate the positivity of cd34 expression , a cell marker found in mesenchymal cells ( lost in malignant tumors ) , presence of bcl-2 ( b - cell leukemia / lymphoma-2 oncogene ) , vimentin and cd99 ( positive in sftp ) , cytokeratin ( positive in mesothelioma and negative in sftp ) . moreover , the proliferation marker ki-67 can be used to stratify lesions according to their clinical outcome . recently , a cutoff level of a proliferation rate of 12% ( ki-67 ) was suggested to distinguish benign and malignant lesions . the best and the only demonstrated effective treatment of sftp is surgical resection removing pulmonary parenchyma compression and allowing the reexpansion of the lung .

we report two cases of solitary fibrous tumor of the pleura ( sftp ) . the first appeared in a young , new mother as a large mass in the upper lobe of the left lung that caused compression of lung parenchyma without significant respiratory symptoms but with polyarticular paraneoplastic syndrome ; the other was documented by an occasional chest x - ray in a man affected by chronic obstructive pulmonary disease ( copd ) as a small peripheral mass 4 years before and no longer controlled . both patients underwent surgical resection with quick and full recovery . sftp is a benign , slow growing neoplasm that is mostly localized . it appears in adult or elderly patients often with few symptoms . the computed tomography ( ct ) of the chest with contrast medium is important in order to see the shape of the mass and relationships with adjacent structures but only histology can provide the diagnosis . surgery is the best treatment .

You are an expert at summarizing long articles. Proceed to summarize the following text: we conducted a 35-week randomized , double - blind , placebo - controlled , crossover study , with two 16-week treatment periods separated by a 3-week washout period ( supplementary fig . all study visits were conducted in the beth israel deaconess medical center general clinical research center in boston , massachusetts . all participants gave written informed consent before participation . the study was approved by the beth israel deaconess medical center institutional review board and was conducted according to the principles expressed in the declaration of helsinki . between 2007 and 2010 , we enrolled 41 women aged between 18 and 70 years with bmi between 28 and 40 kg / m . major exclusion criteria included having type 1 or type 2 diabetes , having uncontrolled hypertension or dyslipidemia , being treated with antiobesity medication within 1 year , having a history of bariatric surgery , and having previous treatment with exenatide . subjects injected 5 g of either exenatide or identically dispensed placebo before breakfast and supper . after 2 weeks , subjects increased their doses to 10 g exenatide or placebo twice daily . the primary outcomes of body weight ( kg ) and bmi ( kg / m ) were measured at all study visits , with subjects wearing light clothing and no shoes . body composition was measured using bioelectrical impedance analysis ( bia ; rjl system quantum ii bioelectrical body composition analyzer ) after an overnight fast . lipid panels , leptin , and adiponectin were measured after an overnight fast at weeks 0 , 10 , and 16 during both treatment periods . glycemic status was measured at the beginning and end of each treatment period with a standard 75-g , 2-h oral glucose tolerance test . insulin was measured using the access chemiluminescent assay ( beckman coulter , fullerton , ca ) . adiponectin was measured using an enzyme - linked immunosorbent assay technique ( alpco diagnostics , salem , nh ) , and leptin was measured using a radioimmunoassay technique ( linco research , st . resting energy expenditure ( ree ; kcal ) was measured after an overnight fast using the viasys indirect calorimeter . subjects wore a watch - sized sleep monitor and an accelerometer ( actigraph and actical ; mini mitter ) on the nondominant wrist for 2 weeks during each treatment period . subjects rated hunger , satiety , and nausea on a 10-cm visual analog scale every 2 weeks . our study was powered to assess the primary outcome of change in body weight during exenatide treatment . we calculated that we needed 42 subjects to detect a ( mean sd ) 2.6 1.3 kg difference in body weight between exenatide and placebo treatment at 16 weeks with 80% power and an value of 0.05 . using a 2025% drop - out rate differences in baseline characteristics between the two randomized groups of the study were assessed with t tests . we report the estimated mean or along with the p value and 95% cis . for repeated measures , we used linear mixed models to compare treatment differences over time . for subgroup analyses , we report the pairwise tukey - kramer adjusted p values . subjects who completed at least 10 weeks of either treatment period were included in the outcome analysis for that treatment period by using the last - observation - carried - forward method . all statistical analyses were performed using sas software version 9.1 ( sas institute , cary , nc ) . the primary outcomes of body weight ( kg ) and bmi ( kg / m ) were measured at all study visits , with subjects wearing light clothing and no shoes . body composition was measured using bioelectrical impedance analysis ( bia ; rjl system quantum ii bioelectrical body composition analyzer ) after an overnight fast . lipid panels , leptin , and adiponectin were measured after an overnight fast at weeks 0 , 10 , and 16 during both treatment periods . glycemic status was measured at the beginning and end of each treatment period with a standard 75-g , 2-h oral glucose tolerance test . insulin was measured using the access chemiluminescent assay ( beckman coulter , fullerton , ca ) . adiponectin was measured using an enzyme - linked immunosorbent assay technique ( alpco diagnostics , salem , nh ) , and leptin was measured using a radioimmunoassay technique ( linco research , st . resting energy expenditure ( ree ; kcal ) was measured after an overnight fast using the viasys indirect calorimeter . subjects wore a watch - sized sleep monitor and an accelerometer ( actigraph and actical ; mini mitter ) on the nondominant wrist for 2 weeks during each treatment period . subjects rated hunger , satiety , and nausea on a 10-cm visual analog scale every 2 weeks . our study was powered to assess the primary outcome of change in body weight during exenatide treatment . we calculated that we needed 42 subjects to detect a ( mean sd ) 2.6 1.3 kg difference in body weight between exenatide and placebo treatment at 16 weeks with 80% power and an value of 0.05 . using a 2025% drop - out rate differences in baseline characteristics between the two randomized groups of the study were assessed with t tests . we report the estimated mean or along with the p value and 95% cis . for repeated measures , we used linear mixed models to compare treatment differences over time . for subgroup analyses , we report the pairwise tukey - kramer adjusted p values . subjects who completed at least 10 weeks of either treatment period were included in the outcome analysis for that treatment period by using the last - observation - carried - forward method . all statistical analyses were performed using sas software version 9.1 ( sas institute , cary , nc ) . there were no significant differences among subjects randomly assigned to exenatide or placebo for the first treatment period . our study population as a whole had well - controlled cardiovascular risk factors ( 85% had systolic blood pressure < 140 mmhg , 80% had total cholesterol levels < 220 mg / dl , 93% had ldl < 160 mg / dl , and 85% had triglycerides < 150 mg / dl ) . baseline characteristics for subjects completing at least 10 weeks of treatment with either placebo or exenatide ( n = 41 ) sixteen weeks of exenatide treatment was associated with a significant decrease in body weight . subjects lost 2.49 0.66 kg during exenatide treatment compared with an increase of 0.43 kg 0.63 kg during placebo treatment ( p < 0.01 ) ( fig . this corresponded to a 2.7% decrease in body weight during exenatide treatment and a 0.2% increase in body weight during placebo treatment . a significant decrease in body weight was observed after 2 weeks of exenatide , and the difference persisted for the entire treatment period ( fig . exenatide was associated with a small but statistically significant decrease in bmi , and waist circumference decreased by 1.68 cm ( table 2 ) . b : individual weight profiles during exenatide treatment among high responders ( n = 11 ) . c : individual weight profiles during exenatide treatment among moderate responders ( n = 14 ) . d : individual weight profiles during exenatide treatment among nonresponders ( n = 12 ) . changes in metabolic parameters during exenatide and placebo treatment periods of interest , retrospective analysis revealed that weight loss with exenatide treatment was variable ( table 3 ) . ( n = 11 ) were high responders who lost > 5% ( range 512.5% ) of their body weight . a total of 39% ( n = 14 ) were moderate responders who lost < 5% ( range 0.44.8% ) of their body weight , and 31% ( n = 12 ) of subjects were nonresponders who achieved no weight loss or gained weight ( range 0.195.8% ) ( fig . five regained weight when switched to placebo ( 2.628.17% regain ) , one continued to lose weight on placebo , and one was not included in the data analysis because she completed < 10 weeks of placebo treatment . we did not identify any pretreatment metabolic parameters that predicted the degree of response to exenatide . changes in metabolic parameters during exenatide treatment among the three response groups exenatide was not associated with any significant change in metabolic parameters , including blood pressure , lipid profiles , insulin and adiponectin levels , and homeostasis model assessment ( homa ) scores . two - hour glucose values trended lower during exenatide treatment compared with placebo , although there was wide variability ( table 2 ) . we did not see any significant change in leptin levels when we compared exenatide with placebo ( table 2 ) ; however , we noted that leptin levels decreased significantly among high responders ( 39 4.8 ng / ml to 28.8 3.7 ng / ml ) ( table 3 ) , an effect not seen in nonresponders . there were no significant changes in adiponectin levels , insulin levels , or homa of insulin resistance scores when the data were analyzed by responder group ( data not shown ) . there was no significant change in ree , expressed as kilocalories per day or kilocalories per kilogram , for the study group as a whole or for any subgroup . high responders , who lost an average of 8% of their body weight , demonstrated a 0.6 kcal / kg increase in ree , whereas nonresponders demonstrated a 0.3 kcal / kg decrease in ree ; neither change was significant . there was no significant change in quantitative or qualitative physical activity , nor was there a difference in sleep parameters , including sleep duration , sleep efficiency , or wake after sleep onset . there was , however , a trend toward decreased sleep onset latency during exenatide treatment compared with placebo ( 29.9 17.6 min vs. 48.3 42.9 min , p < 0.06 ) . a total of 56% of subjects experienced one or more episodes of nausea during exenatide treatment compared with 21% of subjects during placebo treatment . two subjects dropped out during exenatide treatment and no subjects dropped out during placebo treatment because of nausea . four subjects had a slower titration to the 10-g dosage , and six subjects did not titrate above 7.5 g . scores were highest at week 4 and then decreased over the remainder of the treatment period . at week 16 , nausea scores were not significantly different between exenatide and placebo ( supplementary table 1 ) . additional adverse events during exenatide treatment included irritation at the injection site ( n = 1 ) , constipation ( n = 2 ) , bloating ( n = 1 ) , uncomfortable satiety ( n = 1 ) , fatigue ( n = 1 ) , diarrhea ( n = 1 ) , heartburn ( n = 1 ) , belching ( n = 1 ) , menstrual irregularity ( n = 1 ) , and respiratory infection ( n = 3 ) . a total of 56% of subjects experienced one or more episodes of nausea during exenatide treatment compared with 21% of subjects during placebo treatment . two subjects dropped out during exenatide treatment and no subjects dropped out during placebo treatment because of nausea . four subjects had a slower titration to the 10-g dosage , and six subjects did not titrate above 7.5 g . scores were highest at week 4 and then decreased over the remainder of the treatment period . at week 16 , nausea scores were not significantly different between exenatide and placebo ( supplementary table 1 ) . additional adverse events during exenatide treatment included irritation at the injection site ( n = 1 ) , constipation ( n = 2 ) , bloating ( n = 1 ) , uncomfortable satiety ( n = 1 ) , fatigue ( n = 1 ) , diarrhea ( n = 1 ) , heartburn ( n = 1 ) , belching ( n = 1 ) , menstrual irregularity ( n = 1 ) , and respiratory infection ( n = 3 ) . three subjects with ongoing nausea or abdominal pain had lipase levels measured . exenatide is associated with a reduction in hemoglobin a1c of 0.50.8% and liraglutide with a reduction of 1.11.5% ( 1114,17 ) . of interest , a consistent finding in large clinical studies is that hemoglobin a1c levels declined but then plateaued while weight loss continued ( 18 ) . one group reported ~3.3 kg placebo - corrected weight loss over 24 weeks ( 15 ) . ( 16 ) showed that 1.23.0 mg liraglutide daily plus aggressive lifestyle intervention for 20 weeks was associated with dose - dependent , placebo - corrected weight loss , ranging from 2.0 to 4.4 kg among nondiabetic obese individuals . our cohort of women lost , on average , 2.5 kg after 16 weeks of exenatide treatment , and we observed significant weight loss after only 2 weeks . importantly , we observed that 30% of our study population lost 8% of their body weight during exenatide treatment , whereas another 31% did not lose any weight or gained weight . to our knowledge , this is the first study to report stratified weight loss in response to exenatide treatment in obese , nondiabetic individuals . although we did not identify baseline characteristics that predicted the degree of response to exenatide treatment , our observation that significant weight loss was seen as early as 2 weeks and that high responders could be identified by 4 weeks has important clinical ramifications and demonstrates the value of a short clinical trial to assess the effectiveness in a given individual . a larger prospective study designed to investigate predictors of weight loss with exenatide is an important area for future investigation . the mechanisms of weight loss with exenatide are not fully understood but may include changes in energy expenditure , changes in leptin sensitivity , or nausea resulting in decreased food intake . significant weight loss is usually associated with a decrease in ree that favors weight regain ( 19 ) . ( 20 ) observed that a hypocaloric diet producing 10% weight loss resulted in a decrease in ree of ~130 kcal / day , and pereira et al . ( 21 ) found that a low - fat diet producing 10% weight loss was associated with a decrease in ree of 176 kcal / day , compared with 96 kcal / day with a low glycemic index diet producing the same degree of weight loss . dietary or pharmacologic interventions that blunt the decrease in ree with weight loss are in great clinical demand . we identified a potential effect of exenatide on ree because those who had the most robust weight loss with exenatide did not have the expected decrease in this parameter . rodent and human studies support a relationship between glp-1 and energy expenditure , possibly by activating the sympathetic nervous system . in rats , both peripheral and central administration of glp-1 receptor agonists increased blood pressure and heart rate by activating autonomic regulatory sites in the rat brain ( 22 ) . in lean , healthy males , peripheral glp-1 administration during a hyperglycemic clamp was associated with increased ree , and the glp-1 analog liraglutide has been associated with increased heart rate ( 23,24 ) . obesity is considered to be a state of leptin resistance , and weight loss is thought to improve leptin sensitivity . there currently is no technique for measuring leptin sensitivity in humans , and the decrease in leptin levels seen with weight loss generally is used as indirect evidence of increased leptin sensitivity . although there was no significant change in leptin levels during exenatide treatment when we analyzed our data in aggregate , we noted that leptin levels decreased significantly among exenatide high responders compared with nonresponders . however , this effect may be attributed to weight loss , per se , rather than exenatide treatment . a comparator group with calorie - restricted weight loss would help answer this question in future studies . nausea , the most common adverse effect of exenatide , also may contribute to weight loss . although exenatide was associated with more nausea than placebo , the severity of nausea decreased over time and nausea scores were not higher among exenatide high responders . our study included a small cohort of generally healthy obese women , which limits the generalizability of our findings . the overall drop - out rate was 35% , with 17% dropping out prior to being randomly assigned and 18% dropping out after being randomly assigned . a crossover study design introduces the possibility of both an order effect and a carryover effect . given the short half - life of exenatide and normal renal function among study participants , a 3-week washout period should have been sufficient to exclude a carryover effect . our study was powered for the primary outcome of weight loss during exenatide versus placebo treatment . retrospective analysis revealed that weight loss among our cohort could be grouped as 5% body weight , < 5% body weight , or weight gain . a larger , prospective study will be required to examine the metabolic parameters that may predict the degree of response to exenatide treatment . the trend in obesity literature typically has been to report the average response of an entire study population to a particular dietary or pharmacologic intervention . however , the analysis and reporting of weight loss data in aggregate can obscure individual responses to treatment . our study is the first study to describe weight loss variability with a glp-1 receptor agonist and demonstrates that a subset of women have a robust response to exenatide treatment that can be identified very early in the course of therapy . future studies examining the duration and magnitude of weight loss among individuals who have a robust response to exenatide treatment , as well as characteristics that predict response , may guide us toward a more personalized approach to pharmacotherapy for the treatment of obesity .

objectiveto investigate the effect of treatment with the glucagon - like peptide 1 receptor agonist exenatide on weight loss and metabolic parameters in obese nondiabetic women.research design and methodsforty - one obese women ( aged 48 11 years and bmi 33.1 4.1 kg / m2 ) participated in a 35-week randomized , double - blind , placebo - controlled , crossover study , including two 16-week treatment periods separated by a 3-week washout period . there was no lifestyle intervention . the primary outcome was change in body weight.resultssubjects treated with exenatide lost an average of 2.49 0.66 kg compared with a 0.43 0.63 kg weight gain during placebo treatment . weight loss with exenatide treatment was noted at 2 weeks . the degree of weight loss could be stratified . a total of 30% of subjects were high responders who lost 5% body weight ( 7.96 0.52% ) , 39% were moderate responders who lost < 5% body weight ( 2.43 0.45% ) , and 31% were nonresponders who gained weight ( 1.93 0.53% ) . waist circumference also decreased significantly with exenatide treatment . subjects experienced more nausea during exenatide treatment compared with placebo , but the severity decreased over time and did not correlate with weight loss.conclusionsshort-term exenatide treatment was associated with modest weight loss and decreased waist circumference in a cohort of obese nondiabetic women . a subset of individuals demonstrated robust weight loss that was detected very early in the course of treatment .