Datasets:

anumafzal94

/

pubmed-test-2048

like 0

the extensive loss of the alveolar ridge and teeth in the posterior mandible presents a complex case for reconstruction . several augmentation techniques are currently utilized to create sufficient bone volume for predictable placement of endosseous implants in such cases . the numerous surgical approaches proposed consist of autogenous bone grafts , alloplastic materials 18 , and recently , alveolar distraction osteogenesis 9 . after tooth loss , the alveolar ridge undergoes a continuous resorptive process that is severely accelerated by denture wear 10 . this process is the most pronounced during the first 12 months after the tooth extractions 11,12 . extensive resorption of the alveolar ridge in a vertical direction may compromise implant placement and prosthetic rehabilitation . the continuing resorption of the alveolar ridge will eventually result in insufficient bone height superior to the ian , making dental implant placement impossible without performing augmentation of the alveolar bone in terms of height . the augmentation procedure above the ian provides sufficient bone for implant placement and allows for long - term successful restoration of missing teeth with implant - supported prosthesis . all the methods suggested should take into consideration patient - related issues , which consist of pain , swelling , sensory nerve disturbances , incidence of graft failure and resorption , and functional long - term restoration . the reconstruction of vertically atrophic posterior mandibles with onlay bone grafts has been well documented , but the results have not been promising . different donor sites ( symphysis menti , calvaria , iliac crest ) have been used as sources of autogenous bone . vermeeren and associates 13 demonstrated bone resorption up to 50% even when autogenous onlay grafts were used . rigid fixation of the graft material is imperative to prevent microrotation , which can result in nonunion or fibrous union of the graft material . the use of expanded polytetrafluoroethylene membranes is a treatment option for posterior mandibular reconstruction that has been used with varying degrees of success , as reported by various authors 15,16 . tinti and coworkers 17 commented that vertical augmentation is a highly sensitive technique , predictable only when the surgical protocol is followed strictly . vertical ridge augmentation of the atrophic maxilla and mandible by means of a titanium mesh and autogenous bone grafts has been used successfully and has gained popularity since its introduction 18,19 . the titanium mesh used must be fixed by titanium screws , and infection is a common complication 18 that may cause loss of grafted bone , resulting in failure . visor osteotomy was first described in 1975 by harle 20 to increase the absolute height of the atrophic edentulous mandible . in this technique , when the procedure is applied to vertical ridge augmentation in the posterior mandible , the mandible is split vertically and , unfortunately , the width of the ridge is reduced . the sandwich technique , which uses bone block graft positioned between osteotomized bony segments , was developed by schettler 21 in 1974 stoelinga and colleagues 22 combined the visor osteotomy and sandwich techniques to augment the severely atrophic edentulous mandible with success 22 . a 49-year - old female patient was presented with a bilaterally atrophic mandible and a need for implant therapy . a thorough radiographic examination using cone - beam tomography revealed mandibular ridges that were not suitable for immediate implant placement in terms of height ( 6.2 mm on the left side and 7.2 on the right side . the patient was suggested the augmentation of the ridge using an interpositional block of allogeneic bone under local anesthesia . the patient gave her written informed consent , and a preoperative radiograph ( fig.1a ) , computerized tomographic ( ct ) scan and cone - beam tomography of the left and right mandibular ridges were obtained ( fig.1b ) . the mucoperiostal flap was raised to expose the mental foramen , and the mental nerve was identified , this helps to design the horizontal bone cut . then , two other vertical bone cuts were performed on the extremities of the horizontal cut . the more mesial vertical cut was performed 2 mm away from the adjacent tooth . the bone segment was then raised upward to leave space for the bone graft ( fig.2 ) , with no disturbance of the lingual periosteum . an allogeneic bone block was inserted interpositionally and placed in the middle of the space formerly created without any fixation between the basal segment and the cranial segment ( fig.3a ) the remaining spaces in both ends were filled with particular bone graft ( fig.3b ) . the wound was then closed primarily with 4 - 0 vicryl u - shaped suture . a postoperative cone - beam x - ray and ct scan were obtained to assess the new vertical height of the mandible ( fig.4a and b ) . after 3 months of healing , a crestal incision on the attached gingiva was made . the mucoperiostal flap was detached and endosseous implants were inserted using the classical approach , two into the right side , and three in the left side of the mandible , measuring 4 mm in diameter and 10 mm in length . the primary stability was relatively high ( fig.5 ) , and allowed for placement of the healing abutments ( fig.6 ) . post surgical follow - up visits were carried out at months 1 , 3 , 6 , 12 , 18 , and 24 after the surgical procedure . at each follow - up procedure , after 2 years of follow - up , the patient s conditions were optimal , the hard and soft tissue did not show any changes . ( a ) allogenic bone block inserted interpositionally and placed in the middle of the space between the two bone segments . ( b ) cone - beam tomography of the new mandible heights after the surgical procedure . moderate to severe posterior mandibular atrophy was successfully treated with interpositional sandwich osteotomy bone grafts . this led to the successful placement of implants and fixed prosthetic implant restorations , thus allowing ever more patients to be considered for implant treatment . the technique , which has been recently revisited , permits dental rehabilitation in terms of raising the bone above the nerve , reshaping the alveolar crest , and normalizing the interocclusal distance and the crown - implant ratio .

key clinical messagethe continuing resorption of the alveolar ridge will eventually result in insufficient bone height superior to the ian , making dental implant placement impossible . the augmentation procedure above the ian in terms of height provides sufficient bone for implant placement and allows long - term successful restoration of missing teeth with implant - supported prosthesis .

the structures of acl and mcp in the gas phase were optimized at the b3lyp/6 - 31 g * level . the structures of the water clusters were determined with classical molecular dynamics trajectories ( see details in the si ) . the cluster models include solvents that have at least one of the atoms within 3 and 4 from acl and mcp , respectively . the geometry of the acl and mcp in the water clusters was further optimized at the b3lyp / cc - pvdz and cam - b3lyp / cc - pvdz levels , respectively . in the optimization , the water molecules were fixed at the md structure and replaced by point - charges ( tip3p charges ) . we also fixed the c atom next to the o atom of acl . in mcp , the atomic coordinates of the central c atom were fixed . the hf orbitals were transformed into mos localized within each fragment ( solute and solvent ) . our transformation uses reference orbitals ( rmos ) obtained with external calculations for isolated molecules . , we show the populations at the fragments . in the perturbation - selection step of the sac - ci calculations , a set of threshold , levelfour , as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be re - organized for online delivery , but are not copy - edited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors

intermolecular interactions regulate the molecular properties in proteins and solutions such as solvatochromic systems . some of the interactions have to be described at an electronic - structure level . in this study , a commutator for calculating the excitation energy is used for deriving a first - order interacting space ( fois ) to describe the environmental response to solute excitation . the fois wave function for a solute - in - solvent cluster is solved by second - order perturbation theory . the contributions to the excitation energy are decomposed into each interaction and for each solvent .

a 56-year - old gentleman previously known to have rheumatic mitral stenosis , presented with a recent increase of dyspnea ( new york heart association class iii ) , now associated with orthopnea and paroxysmal nocturnal dyspnea . on examination , he had rapid atrial fibrillation with a pulse rate of 130/min . after control of the pulse rate with digoxin and beta blockers , echocardiography revealed a mitral valve area of 1.1 cm by pressure half - time method , a mean diastolic pressure gradient of 18 mm hg across the mitral valve , a total mitral valve score of 9/16 , and no mitral regurgitation . moderate calcification of the mitral valve was noted ; however , since no commissural calcium was found , percutaneous mitral valvuloplasty was planned . trans - esophageal echocardiography showed no thrombi in the left atrial appendage , a mitral valve annulus diameter of 38 mm , and a thin inter - atrial septum ( 2 mm ) . the procedure was performed through a right femoral vein puncture , employing the multi - track technique , using 2 balloons ( 20 and 18 mm in diameter ) . following a smooth trans - septal puncture , the mitral valve was crossed with a judkins right catheter , and 2 wires were secured in the left ventricular apex with a double coil clearly seen in both . the 2 balloons were advanced along the wires and inflated ; yet , surprisingly , no clear waist was seen ( figure 1 ) . skeptic about the balloon position , the operator decided to redo the inflation more proximally , wherein a clear waist was seen that ultimately yielded to balloon inflation . suddenly , blood pressure collapsed to 80/60 mm hg , with a slow though still irregular bedside echocardiography confirmed the presence of moderate pericardial effusion so that pericardiocentesis was immediately performed ( figure 2 ) . roughly , 250 ml of frank red oxygenated blood were drained out of the pericardial sac . in the mean time , heparin was counteracted by protamine sulphate administration , and dopamine infusion started at a rate of 10 g / kg / min . blood pressure returned back to 100/60 mm hg , and the pulse rate rose to 100 bpm . the pigtail catheter in the pericardial sac stopped to drain any more blood ; however , once again , blood pressure started to drop progressively down to 60/40 mm hg , and the pulse rate surged now to 110 bpm . amazingly , bedside echocardiography unveiled an echo - dense mass posterior to the left ventricle . unfortunately , however , during transfer to the operating room , the patient was arrested in asystole . resuscitation started straight away and continued for 15 min , well inside the operating room . following median thoracotomy , the surgeon was confronted with a large blood clot filling the posterior pericardial sac . the clot was removed at once ; the heart restarted to beat at 70 bpm and blood pressure was restored to 100/70 mm hg . a 1.5 cm tear was discovered in the left ventricular apex , which was sutured with teflon sutures . eventually , the patient was hemodynamically stable but was discharged to the intensive care unit in deep coma , wherein he was supported with mechanical ventilation . his consciousness level improved the next day , so that his glasgow coma score was 6 ; the day after , it reached 9 . thereafter , he became fully conscious , and was disconnected off mechanical ventilation ; however , he suffered some memory deficit , and mild motor dysphasia . three days later , he regained an almost normal neurological state and was discharged from the intensive care unit . post - procedural echocardiography revealed a mitral valve area of 1.9 cm , with no mitral regurgitation , and confirmed the absence of further accumulation in the pericardium . over the past two decades , percutaneous mitral valvuloplasty has emerged as the procedure of choice in the procedure is associated with mortality rates that range from 0 to 3% , chiefly due to cardiac tamponade , severe mitral regurgitation , or deterioration of the patient 's general condition . the incidence of hemopericardium following percutaneous mitral valvuloplasty is reported at 1 - 3% , being related to either trans - septal puncture or left ventricular perforation with guide wires or balloons . the site of perforation is crucial for both the immediate and long - term outcome . frequently self - limited perforation of the right atrial appendage often responds well to pericardiocentesis , and spontaneous closure is the rule . on the other hand , left ventricular apical perforations can be swiftly fatal due to the high left ventricular pressure , especially if induced by the rigid balloon catheters rather than the guide wires , and therefore frequently need emergency surgical repair . pick up cases which need life - saving immediate pericardiocentesis , aided by reversal of anticoagulation by protamine sulphate , even before hemodynamic deterioration . bedside echocardiography is the standard of care for prompt diagnosis , and should be an indispensable workhorse in any cath lab that performs percutaneous mitral valvuloplasty procedures . during pericardiocentesis , one should always ensure a proper position of the pigtail catheter inside the pericardial sac , guided by fluoroscopy and bedside echocardiography . however , if the clinical condition deteriorates despite the absence of effluent from the pericardium , emergency surgical exploration would be mandatory . moreover , it is widely acknowledged that blood in the pericardial sac does not clot due to the defibrination effect by cardiac motion . in the current case , however , rapid accumulation of a large amount of blood over a brief period of time might have been the cause of blood clotting in the posterior pericardial sac , further augmented by protamine sulphate injection . it would be wise to inflate the balloons extremely cautiously , so that if no waist is seen , inflation should be immediately halted and the balloon catheters pulled back to a more proximal position , in order to avoid injury of the left ventricular apex .

the incidence of hemopericardium following percutaneous mitral valvuloplasty is reported at 13% , being related to either trans - septal puncture , or left ventricular perforation with guide wires or balloons . we report a case of percutaneous mitral valvuloplasty for a middle - aged man with moderately severe rheumatic mitral stenosis . the procedure was performed through a right femoral vein approach , employing the multitrack technique , utilizing 2 balloons ( 20 and 18 mm ) . inadvertently , the procedure was complicated by cardiac tamponade . despite immediate diagnosis and prompt pericardiocentesis , hemodynamic stability was not maintained . echocardiography revealed a mass in the posterior pericardial sac . the patient was arrested in asystole , and rigorously resuscitated during transfer to the operating room . exploration revealed a tear in the left ventricular apex that was adequately sutured . in a few days , the patient gradually regained adequate consciousness , and was ultimately discharged . post - procedural echocardiography revealed a mitral valve area of 1.9 cm2 , with no mitral regurgitation .

once believed to be rare , trichotillomania is now thought to affect as much as 4% of the population . usually beginning in early childhood or adolescence , most patients with trichotillomania do not seek treatment until 17 years of age . patients with trichotillomania often hide their hair - pulling behavior , and the disorder is often suspected by typical dermatological findings , such as alopecia . eating the part of hair pulled out is a common practice and trichorhizophagia is a new term to denote the habit of eating the root of hairs pulled out , associated with trichotillomania . here we report a case of trichotillomania with trichorhizophagia in schizophrenia and discussed the various treatment options . a 58-year - old , married , hindu , unemployed male , a confirmed case of schizophrenia of 30 years duration with no family or past history of psychiatric illness , no history of any medical or surgical illnesses , presented in our opd with pulling hair and eating the hair root for the last 5 years . prior to the consultation in our hospital , he was on irregular treatment with haloperidol . he used to pluck hair from the scalp and eyebrows and developed patches of hair loss in these areas . usually he plucks one or two hairs at a time and plays with hair for some time or rubs the root of the hair along the lips and then discards it . at times he bites the hair and swallows the bitten part containing the root of hair discarding the rest . the patient admitted hair - pulling behavior and reported a kind of pleasure in doing this activity . he has not attempted to resist this habit and it was not a concern for him . there were patches of alopecia on the scalp and right eyebrows with no local inflammation , itching , or pain . he was started on olanzapine and the doze was titrated to a maximum dose of 20 mg per day over a period of 1 month . he showed significant improvement of schizophrenic symptoms except hair pulling behavior . since behavior therapy was not possible at this stage as the patient was not cooperative , escitalopram 10 mg was added to the previous regime for controlling the hair pulling behavior . after 3 months of combined therapy he almost completely stopped the hair pulling behavior , subsequent biting , and eating hair roots without any exacerbation of psychotic symptoms . there was regrowth of scalp hair as well . till date , the patient is maintaining improvement and is attending our opd with regular follow up . trichotillomania is considered to be a rare disorder encountered in clinical practice . although trichotillomania was reported to occur with many psychiatric disorders , the exact prevalence rate was not reported . other comorbid conditions reported include dissociative experiences , dementia , parkinson 's disease , partial seizures , and prader- willi syndrome . possible hypothesized causes include a biological basis , as well as hair pulling in response to life stresses . some of the ssris especially escitalopram , fluoxetine , and fluvoxamine are found to be effective . recently , there was a report of resistant trichotillomania treated with risperidone augmented with fluoxamine . the index case had compulsive plucking of hair and eating the hair root for the last 5 years , which was not part of any delusions or hallucinations . although olanzapine has shown efficacy as monotherapy against psychosis , addition of escitalopram only produced marked improvement in compulsive behavior . this case points to the efficacy of combination of olanzapine and escitalopram particularly in patents showing psychotic symptoms along with trichotillomania . moreover , in patients with hair pulling behavior , it is prudent to inquire about trichophagy because it can lead on to rare but potentially life - threatening condition called trichobezoar .

trichotillomania is a disorder characterized by chronic hair pulling that often results in alopecia . eating the part of hair pulled out is a common practice and trichorhizophagia is a new term to denote the habit of eating the root of hairs pulled out , associated with trichotillomania . many psychiatric disorders are prevalent among patients with trichotillomania . here we report a case of trichotillomania with trichorhizophagia in a 58-year - old man with schizophrenia . the various treatment options are also discussed .

optical coherence tomography ( oct ) , since its introduction in the late 90s , has become an indispensible imaging technique for evaluation and management of retinal and optic nerve disorders . as a non - invasive test , enhanced depth imaging ( edi)-oct enables cross sectional imaging of the retina with resolution approaching histologic sections . current spectral domain ( sd)-oct devices are empowered by software capable of measuring retinal thickness and constructing retinal maps ; these features are particularly useful in evaluating and comparing retinal structures in pathologic conditions such as macular edema and vitreoretinal interface disorders . the choroid is a vascular compartment which provides oxygen and nourishment to the outer retina ; it seems to play a pathophysiologic role in many disorders affecting the retina , such as age - related macular degeneration ( amd ) , central serous chorioretinopathy ( csc ) , polypoidal choroidal vasculopathy and vogt- koyanagi - harada ( vkh ) disease . light scatter by the retinal pigment epithelium ( rpe ) and choroidal vasculature degrades the quality of images obtained from the choroid in conventional oct methods.1 nevertheless , in vivo cross - sectional visualization of deeper choroidal layers is now achievable with the recent introduction of edi - oct.2,3 we obtained edi - oct images in eyes with dry and wet type amd and compared them to that of normal eyes ( fig . 1 ) . the novelty of our approach is to provide choroidal mapping and choroidal volume measurement in retinochoroidal disorders . to obtain the choroidal image , we positioned the combined heidelberg spectralis device ( spectralis hra+oct , heidelberg engineering , heidelberg , germany ) sufficiently close to the eye , obtaining an inverted image of the fundus ; an alternative method was employing the automatic edi mode of the apparatus . by applying these methods , the choroid approximates the zero - delay line , positioning the most sharply focused portion of the oct scan at the level of the choroid . we selected a high resolution 19 line raster scan protocol to encompass the macula within a 2020 area ( fig . the automatically plotted boundary lines of the retina were adjusted to choroidal boundaries ; internal limiting membrane ( ilm ) to rpe / choroid junction , and rpe to choroid/ sclera junction ) . the resultant images were viewed and measured with the heidelberg eye explorer software ( version 5.3 ) to produce a color coded topographic map of choroidal thickness and volume ( fig . the subfoveal area had the largest choroidal thickness ( ct ) in normal eyes ( 248.9350.92 m ; mean subject age , 65.81 years ; sample size , 32 ) . mean total choroidal volume ( cv ) in the central 3.45 mm macular zone was 2.32 l in the normal group . , subfoveal ct was found to decrease 17.39 m per each decade of age in normal subjects . mean ct and cv measurements within the etdrs layout profile showed gradual nasal thinning of the choroid . these observations are similar to the results of previous edi - oct studies in normal eyes which have revealed highest ct at the fovea decreasing on both temporal and nasal sides , but more so nasally ( fig . we observed that mean subfoveal ct in wet amd eyes was greater than that in dry amd eyes ( 233.1372.95 m versus 217.8274.52 m ) despite similar mean age in both groups . this pattern of difference was demonstrated at all measured locations across the macula , but was only statistically significant 1 mm temporal to the fovea . similarly , measured cv values in wet amd eyes were higher than dry amd eyes ; the differences were statistically significant at all locations except nasal sectors . mean total cv in the central 3.45 mm macular zone in dry amd eyes was 1.8 l , the corresponding value was 2.32 l in wet amd eyes which is still larger than normal eyes . in another subset of patients , we employed the 31 raster line pattern to generate a choroidal map in csc . subfoveal choroidal thickness in these subjects was 45479 which is significantly larger than normal . comparing the area of increased ct on choroidal maps with the area of hyper - permeability on indocyanine green angiography , we demonstrated that in 91% of patients the hyper - permeability region resides within the area of increased ct on choroidal maps ( fig . ocular and systemic disorders associated with vascular changes can affect the choroid which itself contains rich vascular networks . previous studies employing sd - oct for choroidal evaluation measured ct at limited points.2 - 8 however , choroidal mapping can provide topographic and volumetric information in the entire macular area and in each subfield as defined by the etdrs layout pattern . these measurements may more accurately exhibit choroidal structure . in a study including 80 eyes of 40 healthy volunteers , shin et al used sd - oct applying a high resolution 6 radial scan protocol to obtain choroidal images.9 each radial line averaged 8 b - scan images . the authors failed to reconstruct maps in 16.2 % of cases because of obscure choroidal boundaries limiting accurate segmentation . we were able to create topographic maps in all cases even in wet amd eyes in which posterior shadowing of retinal lesions made the segmentation process somehow difficult in some cases . because each section was composed of an average of 100 scans , image clarity was enhanced . the eye - tracking technology , which is a specific feature of heidelberg devices , also improved image quality . moreover , a 6-radial scan protocol can not represent the entire macular area and encounters a higher probability of interpolation errors . we used the 19 line raster protocol , a denser scan in the macula which is more representative and valid for choroidal measurements , however , this required more effort and time for the segmentation process . it seems that choroidal vascular changes play certain roles in the development of chorioretinal disorders . figure 4 demonstrates increased ct in an eye with csc , which is evident by the presence of hot colors in the choroidal map . quantification of choroidal thickness and volume by edi - oct can help clinicians evaluate the efficacy of therapeutic intervention for pathologic features of the choroid such as choroidal hemangiomas ( fig . 5).10 normal reference values for ct and cv can be established by various sd - oct devices . this normative database can be used to analyze choroidal changes due to various pathologic states . we detected an increase in ct and cv in wet amd eyes in comparison to dry amd eyes , which approximated values in our normal control group . subfoveal ct has been reported to be increased in csc and vkh disease , but reduced in high myopic chorioretinal atrophy and idiopathic macular hole.11 - 16 the importance of choroidal measurements may emphasize the necessity of creating automated segmentation algorithms similar to the retinal map analysis protocols for faster and more precise evaluation of choroidal structure . in conclusion , choroidal mapping and quantitative analysis of the choroid seem to be a valuable method for evaluating chorioretinal disorders and monitoring the effect of therapeutic interventions . further investigations are warranted to better establish the use of topographic ct and cv mapping in various chorioretinal disorders and to provide a normative database .

there are a limited number of non - invasive imaging techniques available for assessing the choroid , a structure that may be affected by a variety of retinal disorders or become primarily involved in conditions such as polypoidal choroidal vasculopathy and choroidal tumors . the introduction of enhanced depth imaging optical coherence tomography ( edi - oct ) has provided the advantage of in vivo cross - sectional imaging of the choroid , similar to the retina , with standard commercially available spectral - domain oct machines . in this article , we review this imaging technique and introduce choroidal mapping as a novel approach for obtaining accurate topographic and volumetric information on the choroid in normal and diseased states .

syndrome of inappropriate secretion of antidiuretic hormone ( siadh ) , also known as the syndrome of inappropriate antidiuresis ( siad ) , is one of the most common causes of hyponatremia1 ) . impaired water excretion in the absence of renal insufficiency , glucocorticoid deficiency , hypothyroidism and decreased effective arterial blood volume are the hallmarks of this syndrome . although a growing number of drugs have been reported to produce siadh , most published reports concern vasopressin and its analogues such as thiazide and thiazide - like diuretics , chlorpropamide , carbamazepine , antipsychotics , antidepressants and nonsteroidal anti - inflammatory drugs . old age seems a risk factor of siadh following the use of many of these drugs . a combined use of these drugs , excessive fluid intake , and other underlying conditions which limit free water excretion will increase the risk3 ) . sodium valproic acid ( vpa ) , known as a carboxylic acid , is being used for an anti - epileptic in idiopathic and symptomatic generalized epilepsies and for some symptomatic focal epilepsies as well as trigeminal neuralgia , migraine and bipolar disorders4 ) . its mechanism is unknown ; however it is probably associated with the metabolism of the gaba neurotransmitter . the toxic effect it provokes there are several vpa - related idiosyncrasies ; the most noteworthy are alopecia , bone marrow aplasia , immune - mediated hepatotoxicity and pancreatitis5 ) . here we describe a patient with hyponatremia caused during the treatment with the antiepileptic drug , i.e. , sodium valproic acid ( vpa ) . the clinical course indicated that vpa contributed to an siadh6 ) . to our knowledge , this is a rare case of example in the medical literature in english which shows an association between vpa and siadh . he had suffered from generalized tonic clonic epilepsy that occurred after a craniectomy due to right epidural hematoma . the patient was treated with sodium valproate in a dose of 900 mg / day for 9 months . he had been removed a brain tumor 4 years before and he had craniectomy for an epidural hematoma 10 months ago . he was admitted to our hospital with a reported seizure , dizziness , nausea and vomiting for the day . his vital signs , physical and neurological examination on arrival were within normal limits except drowsy consciousness . significant laboratory findings were : sodium of 111 ( 135 - 145 ) mmol / l , potassium of 2.6(3.5 - 5.0 ) mmol / l , chloride 66 ( 95 - 110 ) mmol / l and serum osmolarity of 245 ( 280 - 300 ) mosm / kg . urine sodium and urine osmolarity were 58 mmol / l and 751 ( 50 - 1,200 ) mosm / kg , respectively . ante meridiem cortisol level , thyroid stimulating hormone , and free thyroxine level were within normal limits . the results of her rapid acth stimulation tests were also within normal ranges ( table 1 ) . valproic acid level was revealed to be within therapeutic range ( 62.76 g / ml ; an optimum therapeutic range 50 to 100 g / ml ) . the diagnosis of siadh was made based on hyponatremia , and low serum and high urine osmolality . no other causes of hyponatremia , including diuretic therapy , tumors and respiratory system disease , were present . the sodium valproate treatment was discontinued , and hypertonic saline was infused because of his symptomatic and profound hyponatremia . his serum sodium concentration increased to 131 the symptoms resolved immediately after the correction of hyponatremia . during the next 48 hours , normal saline infusion was given , and serum sodium level was restored to 134 mmol / l . the patient presented with hyponatremia , hypoosmolality , impaired excretion of water , which are all features of siadh7 ) and of generalized tonic clonic convulsions . we consider these seizures to be caused by hyponatremia due to siadh ; because other symptoms differed from those of the initial convulsive episode and serum vpa level which was useful to assess the patient compliance was within the target therapeutic range . other causes of hyponatremia such as volume depletion , hypothyroidism , renal or adrenal insufficiency and diuretic abuse , and vomiting were excluded . the correction of the patient 's hyponatremia , combined with the discontinuation of sodium valproate , resulted in the resolution of his hyponatremia . this is the first report in korea on such an adverse reaction to this medication . use of vpa could lead to gastrointestinal discomfort , weight gain , hair loss , tremor and sedation , but these side effects seems rather uncommon , mild , and transient during vpa monotherapy8 ) . potentially hazardous reactions such as hepatitis and pancreatitis have occurred in a few patients on vpa , generally in multidrug therapy8 ) . ( consider including this in the introduction before noting side effects are quoted ) , we could find only a few patients who reported hyponatremia at different times after sodium valproate use9 - 13 ) . the mechanism by which valproic acid could cause hyponatremia or siadh has not been fully elucidated . most cases of drug - induced hyponatremia involve the elderly , and could be related to an altered antidiuretic hormone ( adh ) regulation or action of adh on kidneys12 ) . we speculate that dopaminergic , serotonergic and noradrenergic systems may play a role in siadh due to sodium valproate14 ) . another hypothesis is that valproic acid has a direct effect on tubular cell function , because a few cases of tubular dysfunction in association with valproic acid with a positive dechallenge have been described5 ) . thus , we consider this episode of siadh to be due to a combination of factors including serotonergic stimulation of adh , reduced sensitivity of the hypothalamic osmoreceptors , and reduced renal ability to conserve salt and water . hyponatremia accompanied by cns disorders has shown to increase delayed cerebral ischemia and mortality rates15 ) . therefore , we suggest that patients who have high risk of hyponatremia are recommended to measure the baseline electrolyte levels before starting therapy with sodium valproate16 ) , and to monitor for electrolyte levels throughout the full course of treatment .

we report a rare case of the concurrent manifestation of central diabetes insipidus ( cdi ) and type 2 diabetes mellitus ( dm ) . a 56 year - old man was diagnosed as a type 2 dm on the basis of hyperglycemia with polyuria and polydipsia at a local clinic two months ago and started an oral hypoglycemic medication , but resulted in no symptomatic improvement at all . upon admission to the university hospital , the patient 's initial fasting blood sugar level was 140 mg / dl , and he showed polydipsic and polyuric conditions more than 8 l urine / day . despite the hyperglycemia controlled with metformin and diet , his symptoms persisted . further investigations including water deprivation test confirmed the coexisting cdi of unknown origin , and the patient 's symptoms including an intense thirst were markedly improved by desmopressin nasal spray ( 10 g / day ) . the possibility of a common origin of cdi and type 2 dm is raised in a review of the few relevant adult cases in the literature .

it is characterized by the diversion of portal venous blood away from the liver , by either end - to - side or side - to - side shunt . a two - and - half - year - old child presented with respiratory distress , poor growth , and loss of appetite for 2 months . computed tomography ( ct ) showed mild cardiomegaly with collapse / consolidation of bilateral lung lobes . incidentally , there was the presence of an end - to - side shunt between the right branch portal vein ( pv ) and the inferior vena cava ( ivc ) with fusiform aneurysmal dilatation of the pv continuing into the left branch , which abruptly ended after a short distance . there was aplasia of the right branch of the pv [ figures 1 and 2 ] . the hepatic artery appeared normal . the splenic and superior mesenteric veins had normal orientation , and these vessels joined to form the main pv . a diagnosis of congenital extrahepatic portocaval shunt ( ceps ) ( abernethy malformation type 1 ) with pv aneurysm was made . since the patient was asymptomatic and liver enzymes were normal , the patient was advised follow - up . there was the presence of end - to - side shunt between the right branch of pv and the ivc ( solid thick arrow ) , fusiform aneurysmal dilatation of the pv , which was continuing into the left branch ( thin arrow ) coronal multiplanar reconstruction ( mpr ) shows the presence of end - to - side shunt between the right branch pv and the ivc ( b ) ( arrow ) with fusiform aneurysmal dilatation of the pv ( a ) . the portal venous system and ivc develop between the 4th and 10th weeks of embryonic life by selective apoptosis of some portions of the vitelline , which may lead to the potential for congenital portosystemic shunts . type i ceps ( congenital absence of the pv ) is an end - to - side shunt between pv and the systemic circulation . here all the splanchnic venous return enters the systemic circulation , and the liver is not perfused with portal venous blood at all . type ii ceps is a partial side - to - side shunt between the portal and systemic vein , where only a fraction of the splanchnic venous return bypasses the liver parenchyma . ceps are also associated with an increased frequency of hepatic neoplasms.[37 ] it has been proposed that the diversion of hepatotropic substances in the splanchnic venous blood , such as insulin and glucagon , away from the liver results in alterations of development , function , and regenerative capacity of the liver . this diversion , along with increased arterial hepatic flow , may contribute to the development of hepatic neoplasms . currently , a diagnosis of abernethy malformation is usually made by noninvasive cross - sectional imaging techniques such as ultrasound , ct , or mri , which show the shunt and any intrahepatic pv branches . however , liver biopsy may be necessary in patients with suspected type 1 malformation since an occasional patient may have small pv radicles which can not be seen on ultrasound but can be observed on liver biopsy . pv aneurysm is a rare clinical entity having a focal fusiform or saccular dilatation of more than 20 mm . aneurysms of the pv may occur either proximally at the junction of the superior mesenteric vein and splenic vein or more distally in the pv radicals . congenital origin is suggested based on the discovery of variations in the embryologic development of the pv and may be associated with multiple vascular malformations . the origin of acquired pv aneurysms is more commonly secondary to cirrhosis and other hepatic diseases . pancreatitis can be included as an extrahepatic cause . in the majority of cases , patients are clinically asymptomatic . the majority of patients with abernethy malformation have other associated anomalies such as liver and cardiac abnormalities . described a case of 24-year - old man having ceps type-2 with pv aneurysm during an investigation for nonspecific abdominal pain . determining the patients with type i malformation need clinical , biochemical , and imaging follow - up . however , those patients with type 2 malformations need surgery or percutaneous transcatheter coil placement . in conclusion , although ceps is a rare anomaly , it must be recognized early to prevent the consequences of metabolic derangements by appropriate surgical treatments . , the detection of tiny intrahepatic portal venous radicals may be beyond the resolution limits of the available imaging methods . the limitation of imaging in determining the type of shunt in some cases should be recognized , and a histopathological confirmation of the type of shunt may be crucial in deciding the treatment course .

abernethy malformation is an extremely rare anomaly of the splanchnic venous system . we describe multidetector computed tomography findings of an incidentally detected abernethy malformation with portal vein aneurysm in a two - and - half - year old child . the computed tomography scan was performed for the evaluation of respiratory distress , poor growth , and loss of appetite .

parent - of - origin effects is a broad term that encompasses two distinct phenomena parent - of - origin effects on transcription , and parent - of - origin effects on mutation rates . a parent - of - origin effect on transcription , or genomic imprinting , results from epigenetic modification of the genome which , in turn , results in unequal transcription of parental alleles . for these imprinted genes , expression of the alleles is dependent upon the sex of the parent from which they were inherited ( 1 ) . a parent - of - origin effect on mutation rate , however , refers to the preferential occurrence of some spontaneous mutations in either the father 's or the mother 's germ line . the mechanisms by which these spontaneous mutations arise depend upon the parental germ line in which the mutation occurred . for example , base substitutions , arising from errors during replication , tend to be paternal in origin , owing to the greater number of cell divisions in spermatogenesis as compared with oogenesis ( 2 ) . oocytes are arrested in prophase of meiosis i until sexual maturity , when one oocyte per month is selected to resume the cell cycle . it is thought that the longer the oocytes are arrested in meiosis , the greater the chance for a nondisjunction event to occur ( 3 ) . advanced parental age seems to influence the development of some , but not all , of these mutations ( also referred to as the paternal or maternal age effect ) ( 2 ) . in 1998 , the catalogue of imprinted genes and parent - of - origin effects was first published ( 4 ) . this catalogue served as the basis for the development of a more comprehensive , searchable , online database , made publicly available in 1999 . the original database included 41 imprinted genes , and other parent - of - origin effects , including some records on the parental origin of spontaneous mutations ( 5 ) . we have added recently a comprehensive section on spontaneous mutations that show a bias with respect to their parental origin . this new part of the database can be searched according to mutation type , disorder , chromosomal location , gene name and inheritance pattern . outcomes of the search are presented in a tabular format with the following information : disorder , inheritance pattern , incidence of disorder , gene name , chromosomal location , evidence of a paternal or maternal age effect , mutation type and any recurrent mutations associated with a parent - of - origin effect , number of paternal mutations , number of maternal mutations and pubmed reference ( e.g. table 1 ) . in the case of base substitutions , data are separated according to the type of base substitution ( missense mutation , nonsense mutation or splice site mutation ) , whether the mutation is a transition or transversion mutation , and whether the base substitution falls within a cpg dinucleotide . for deletions and insertions , the distinction is made between large deletions and insertions ( > 20 bp ) and small deletions and insertions ( < 20 bp ) . this size distinction is made based upon the possibility of different mechanisms contributing to these different types of mutations , and therefore potentially different parental origins ( 2 ) . in general , large deletions do not appear to have a parent - of - origin effect , whereas small deletions tend to be more paternal in origin . currently , > 1700 mutations with a parent - of - origin effect are catalogued in this database . the other major section of the database includes known imprinted genes and observations of other putatively imprinted genes . of the 464 database entries , 152 entries describe 85 unique imprinted genes in humans , mice , cattle , sheep , pigs , rats and marsupials , as well as 14 genes for which the evidence of imprinting is conflicting or provisional . an additional 186 entries report parent - of - origin effects in the transmission or linkage of simple and complex genetic conditions including human diseases and animal quantitative traits . the imprinted gene and parent - of - origin effect database is housed at the university of otago in dunedin , new zealand and can be accessed at . the database is maintained by the corresponding authors who welcome submissions and comments and is updated as new literature is published . submissions to the imprinted gene database should be directed to i.m.m . and submissions to the parental origin of de novo mutations database example of report for parental origin of de novo mutations showing base substitutions within a cpg dinucleotide ad , autosomal dominant ; xd , x - linked dominant ; xr , x - linked recessive ; p , point mutation ; ms , missense mutation ; ns , nonsense mutation ; cpg , mutation in a cpg dinucleotide ; ts , transition mutation ; tv , transversion mutation .

the imprinted gene and parent - of - origin effect database ( ) consists of two sections . one section catalogues the current literature on imprinted genes in humans and animals . the second , and new , section catalogues current reports of parental origin of de novo mutations in humans alone . the addition of a catalogue of de novo mutations that show a parent - of - origin effect expands the scope of the database and provides a useful tool for examining parental origin trends for different types of spontaneous mutations . this new section includes > 1700 mutations , found in 59 different disorders . the 85 imprinted genes are described in 152 entries from several mammalian species . in addition , > 300 other entries describe a range of reported parent - of - origin effects in animals .

traumatic brain injury ( tbi ) is the most frequent reason for neurosurgical consultation in the emergency room . minor or mild tbi is common in elderly patients , many of whom are treated on anticoagulant . the common practice is to discharge these patients if computed tomography ( ct ) of the brain is normal . however , a small subgroup of these patients may experience a delayed intracranial bleeding2,4 ) . here , we describe a patient on anticoagulant therapy that developed an acute subdural haematoma ( sdh ) 48 hours after a mild head injury . furthermore , this case report wishes to raise the awareness among emergency department physicians and neurosurgeons that treat elderly anticoagulated patients , for a possible delayed onset of intracranial haematoma , even if the initial assessment is normal . a 66-year - old male presented to the emergency department after a fall and a mild head trauma . the patient had a history of atrial fibrillation and was on acenocoumarol ( sintrom ) . initial ct scan of the brain was without any sign of intracranial hemorrhage or cranial fracture ( fig . 1 ) . the laboratory workup revealed an international normalized ratio ( inr ) of 2.5 . forty - eight hours later the patient was transferred to the emergency room with a decreased level of consciousness and vomiting . on neurological examination he had a score of 9/15 on the glasgow coma scale ( e2v2m5 ) and a dilated left pupil unresponsive to light . a ct scan of the brain revealed a large left acute sdh with midline shift ( fig . the point of the haemorrhage was some bridging veins to the transverse sinus , which were promptly coagulated . postoperatively , the left pupil became small and reactive and a ct scan demonstrated complete removal of sdh . the patient progressively improved and one month after the operation he was discharged for further physiotherapy ( fig . this case is another example of the very low risk of delayed subdural haematoma after minor head injury in patients , who are treated with anticoagulants . some reports of delayed haematomas after minor head injury in adults , with a negative initial ct scan , have already been described . however , the incidence has turned out to be extremely low ( < 0.02% ) . it is generally accepted that elderly tbi patients are at greater risk for clinically important brain injury . furtherrmore , oral anticoagulation is associated with a significant risk of intracranial bleeding , even after a minor head trauma2,3 ) . there have been previously five well - documented reports of delayed subdural haematoma after tbi2,5 ) . the clinical and radiologic characteristics are summarized in table 1 . as it is shown in the above table more specifically , there were two deaths , two patients remained with severe and one with moderate disability , while one had a good recovery . one commonly discussed mechanism for the development of acute sdh is the rupture of bridging veins , which empty into the dural sinuses . as the veins cross the subdural space , they have little supporting structure , and are therefore more vulnerable to injury at this point . in elderly patients with cerebral atrophy , bridging veins are stretched and transverse a greater distance in the subdural space . doherty suggests that rupture of these veins is the mechanism for delayed sdh in patients with trauma - induced hypotension and cerebral edema . in addition , there is a delayed tamponade effect since the atrophied brain is shrunken away from the inner table of the skull . in these patients with hypotension , matsuda et al.4 ) suggest , that inflammation or vasoparalysis resulting from local hypoxia after a head trauma may increase the permeability of the vessels and may form coalescent small perivascular haemorrhages . in this case , the patient had been straining to tighten a bolt of his football helmet when he suffered the acute subdural hemorrhage . this valsalva maneuver might have caused increased intracranial pressure , hypercapnia , and subsequent venous congestion , resulting in subdural hemorrhage because of a rupture of coalescent vessels . in our patient , it was found intraoperatively that the cause of the subdural hematoma was the tearing of some bridging veins to the transverse sinus . it is believed that these bridging veins were damaged by the primary injury and 48-hours later , a valsalva maneuver and a temporary increase of the icp could have caused the tearing of the bridging veins and the subsequent development of the haematoma . therefore , an overnight observation period and a negative first ct scan do not entirely eliminate the possibility that the patient will later develop an intracranial haematoma . this possibility , according to the persisting literature , seems to be greater for the patients over the age of 65 , who are under anticoagulant therapy . the nice guidelines6 ) state that it is safe to discharge the abovementioned patients if imaging is normal . however , as it was explained above , these patients may be then exposed to comparatively high risks of delayed deterioration . currently , there are no specific guidelines regarding the anticoagulated patients with a negative initial ct scan4 ) . one recent paper from menditto et al.5 ) also underlines the need for reevaluation of the current guidelines after a head injury on patients receiving anticoagulant therapy . they suggest a 24-hour observation period for all the patients under anticoagulants followed by a second ct scan . both of them had an inr greater than 3.0 and age over 65 years old . based on the current literature and on our experience we propose a modification of this protocol . we suggest all the patients receiving anticoagulants to be hospitalized for 24 hours followed by a second ct scan . for the subgroup of patients over the age of 65 and with an inr greater than 2.5 , we suggest to extend the observation period to 48 hours followed by a ct scan . as long as we can not prevent primary injuries , we should not fail to prevent fatal deterioration if at all possible . our case report underlines the need , that physicians and neurosurgeons should maintain a high level of vigilance in anticoagulated patients , after a mild tbi , due to a possible delayed onset of intracranial haematoma , even if the initial assessment is normal . we recommend that all anticoagulated patients , who experience a head injury , should be hospitalized for a 24-hour neurological observation followed by a second ct scan . for the subgroup of patients over the age of 65 and with an inr greater than 2.5 , we suggest to extend the observation period to 48 hours followed by a ct scan .

mild traumatic brain injury is common in elderly patients , many of whom are on anticoagulant . the common practice is to discharge these patients from the emergency room if the computed tomography ( ct ) of the brain is normal . however , a very small proportion of these patients may develop a life threatening intracranial haematoma in the following days . we present here a case of a 66-year - old male on anticoagulant therapy that developed a subdural haematoma 48 hours after a mild head injury , with a normal initial ct scan of the brain . the patient underwent a craniotomy with evacuation of a large subdural clot . postoperatively he had progressively improved and six months later has a glasgow outcome score of three . this case is characterized by the delayed onset of a subdural haematoma in a patient on anticoagulation and we discuss here the possible pathogenesis related to this phenomenon . we also briefly review the pertinent literature and the current guidelines for the management of this type of head injuries .

this is a widely endorsed public perception of fear , derision and avoidance of the mentally ill . one reason could be lack of awareness , but other reasons abound . to take an example , popular films seem to suggest that people with mental illnesses : are mass - murdering , homicidally inclined violence junkies;have themselves to blame for not being strong enough to battle illness;have been visited by the divine wrath of an unforgiving god . are mass - murdering , homicidally inclined violence junkies ; have themselves to blame for not being strong enough to battle illness ; have been visited by the divine wrath of an unforgiving god . in this case , stigma works insidiously when internalized to erode the sense of self - worth or social relevance . it works at various levels to instill a deep level of insecurity . to take an example , childless women experience self - stigma . questionable person proves his claim to normalcy by citing his acquisition of a spouse and children , and oddly , by ttesting to his spending christmas and thanksgiving with them . people 's perceptions are not going to change overnight that is not to imply that everyone thinks alike . a community 's attitude toward the mentally ill plays a paramount role in treatment - seeking , drug compliance and rehabilitation . i hope that this article will help raise greater levels of awareness and help combat stigma against the mentally ill .

stigma against people with mental illness is a very complex public health problem . there could be diverse reasons for this ranging from : lack of awareness;fear of a dimly - comprehended and much - misunderstood illness;illogical generalizations ; anddisrespect for the heterogeneity of life . the result - for the mentally ill - could well be diminished access to social determinants of healthcare , employment , and housing . in addition , people with mental illnesses are exposed to numerous health risks such as malnutrition , drug abuse , violence and homelessness . maybe this explains nondisclosure of illness in an increasingly degenerate civil society .

when detection is delayed or the rupture occurs spontaneously , it sometimes resembles acute kidney injury because ascites , oliguria and increasing serum creatinine levels are observed in patients with intraperitoneal urinary leakage . a 37-year - old woman presented with post - operative acute abdominal distension and an increasing serum creatinine level 7 days after total abdominal hysterectomy for uterine myoma . her serum creatinine and urea nitrogen levels were elevated , but the serum beta2-microglobulin level was within normal limits . the patient had no history of kidney disease , and her serum creatinine level on post - operative day 1 was normal ( 0.76 mg / dl ) . sodium , potassium and chloride levels in the ascitic fluid were 37 , 19 and 76 meq / l , respectively , which differed markedly from the serum electrolyte levels ( table 1 ) . laboratory findings of two cases of intraperitoneal urine leakage because these symptoms may also be caused by drug - induced nephropathy , all medications were stopped . however , no decrease in ascites or in the serum creatinine level was observed . since the patient s urine volume had decreased , a urinary catheter was inserted . the perforation was closed surgically , and a subsequent retrograde cystography did not reveal urinary leak . retrograde cystography exhibiting bladder perforation in case 1 ( a ) and case 2 ( b ) . a 70-year - old woman with a history of radiotherapy for cervical cancer 16 years earlier presented with progressive abdominal distension over a 2-week period . on admission sodium , potassium and chloride levels in the ascitic fluid were 21 , 23 and 78 meq / l , respectively , which differed from the serum electrolyte levels ( table 1 ) . after placement of the catheter in the bladder , the ascites disappeared , and the serum creatinine level decreased to the normal range . we performed retrograde cystography , but bladder perforation was not detected . because the patient s condition had improved , she was discharged from the hospital . three months after discharge , the patient was re - admitted with massive ascites and an increasing serum creatinine level . to determine the cause of serum creatinine elevation , we performed technetium-99 m diethylenetriaminepentaacetic acid ( tc-99 m dtpa ) renography , which showed extravasation of tc-99 m dtpa into the peritoneal cavity . retrograde cystography revealed a small perforation in the bladder ( figure 1b , arrow ) . intraperitoneal urinary leakage is characterized by an increase in the serum creatinine level caused by reabsorption of creatinine in the urine through the peritoneal membrane , oliguria and ascites . because most cases of intraperitoneal urinary leakage are the result of blunt trauma , leakage without obvious trauma the incidence of bladder injury after total abdominal hysterectomy is 0.1% . because most bladder injuries are identified intraoperatively , delayed appearance of urinary leakage however , the literature includes one report of delayed intraperitoneal urinary leakage after caesarean section . although spontaneous bladder perforation is uncommon , several cases have been reported in association with intravesicular obstruction , infectious lesion of the bladder , bladder diverticulum , bladder carcinoma , chemotherapy , and alcohol or substance abuse . therefore , acute kidney injury with massive ascites and peritonitis should be distinguished from urinary leakage . however , our two cases had abdominal pain , but rebound tenderness , which is a sign of peritonitis , was not noted . because bladder rupture without signs of peritonitis has been reported , symptoms of peritonitis may sometimes be unclear . although a correlation between serum and ascitic electrolyte levels has not been clearly established , some papers have reported this correlation [ 79 ] . sodium , potassium and chloride levels in ascitic fluid are nearly identical to those in serum ( ascites vs. serum ; sodium 133.1 6.6 vs. 131.8 6.3 mmol / l , potassium 4.1 0.8 vs. 4.3 0.9 mmol / l and chloride 107.2 7.6 vs. 101 7 mmol / l ) in cirrhosis patients . in peritoneal dialysis patients , electrolyte levels in peritoneal dialysate that are retained longer than 24 h are nearly identical to those in serum ( peritoneal dialysate vs. serum ; sodium 141.4 vs. 140.6 meq / l , potassium 4.7 vs. 5.1 meq / l and chloride 108.5 vs. 102.7 meq / l ) . another report noted that the ratio of sodium , potassium and chloride between serum and transudates which include ascites is 0.95 , 0.740.80 , and 0.950.99 , respectively . however , in our two cases , the ascitic sodium , potassium and chloride levels differed markedly from their serum levels . both serum beta2-microglobulin and creatinine levels are usually elevated in patients with acute kidney injury . this was not the case in our first patient , and this discrepancy may be a clue to the presence of intraperitoneal urinary leakage . the reason for this discrepancy has not been elucidated ; however , beta2-microglobulin , due to its larger molecular size , may not be absorbed through the peritoneal membrane similar to creatinine . in addition , although we did not measure urea nitrogen and creatinine in the ascitic fluid , the higher levels in ascites than in the blood are additional clues suggesting the possibility of intraperitoneal urinary leakage . in summary , we report two cases with intraperitoneal urinary leakage resembling acute kidney injury . these cases suggest that bladder perforation should be considered in the differential diagnosis of acute kidney injury with massive ascites .

ascites , oliguria and increasing serum creatinine levels are often noted in patients with acute kidney injury . however , these presentations are also observed in patients with intraperitoneal urinary leakage . bladder perforation without obvious trauma is sometimes mistaken for acute kidney injury . we report two cases of bladder perforation resembling acute kidney injury . the first case was a 37-year - old woman with delayed intraperitoneal urinary leakage following total abdominal hysterectomy , and the second was a 70-year - old woman with spontaneous bladder perforation . although the initial diagnosis in both cases was acute kidney injury , rupture of the urinary bladder was later identified .

streptococcus agalactiae , also known as group b streptococcus ( gbs ) , is a bacterium often isolated from vaginal or rectal swab of pregnant women and long recognized as the major cause of neonatal sepsis , meningitis , and infection in pregnant women . gbs is a minor pathogen of necrotizing fasciitis ( nf ) ; however , the incidence of gbs nf in nonpregnant adults with underlying disease has increased in recent years . here , we report a case of bilateral gbs nf of the foot with a unique clinical presentation and describe the clinical characteristics of gbs nf based on a review of published cases . a 43-year - old male with a history of type 1 diabetes presented with severe pain in both feet . two weeks before our examination , he began to notice swelling and pain in the left sole , which gradually spread to his left lower leg . one week prior to presentation , the same symptoms began to emerge on his right sole and the dorsum of his right foot . the symptoms worsened , and he was admitted to our clinic because he had developed a fever of 39.2c and was unable to walk unassisted at the time of his first visit . on initial examination , he exhibited a reddish fluctuant cystic nodule on the dorsum of the right foot ( fig 1a ) , an ulcer covered with necrotic tissue on the lateral side of the right foot ( fig 1b ) , and swelling with redness on the dorsum of the left foot ( fig 1c ) . moreover , a large callus and ulcer due to diabetic peripheral neuropathy on the right sole ( fig 1d ) and streaks of necrotic skin on the left sole ( fig 1e ) were observed . laboratory analysis revealed elevated wbc ( 15,100 cells/l ) , c - reactive protein ( 22.8 mg / dl ) , blood glucose ( 434 mg / dl ) , hemoglobin a1c ( 12.2% ) and anti - gad - antibody ( 350 u / ml ) levels . computed tomography showed fluid collection , suggesting a subcutaneous abscess in the dorsum of the right foot ( fig 2a ) , and fascial thickening associated with fat stranding in both soles ( fig 2a , b ) . in addition , gas shadows were detected within the deep fascia of the right sole and left sole up to the lower leg ( fig 2a , b ) . as the gram stain of the exudate obtained from the necrotic skin of the left sole demonstrated the presence of gram - positive cocci and gram - negative rods , we suspected nf of polymicrobial origin , and the patient was empirically treated with meropenem . on the day following admission , debridement of necrotic tissues and amputation of the left fifth metatarsal bone were performed . a large amount of brownish pus was discharged from the dorsum of the right foot . necrosis of subcutaneous tissue , fascia and muscle were observed in both feet and the lower half of the left lower leg . culture of excised tissue of the left foot yielded gbs , group g streptococcus , and morganella morganii . in addition , culture of excised tissue of the right foot yielded gbs , staphylococcus aureus and pseudomonas species . furthermore , blood culture prior to administration of antibiotics yielded solely gbs . based on these findings , although debridement was repeated several times , necrosis of the fascia , muscles and bone developed in the tissues surrounding the excised parts of both feet and we were not able to control the infection . including our case , 22 cases of gbs nf in nonpregnant adults have been reported in english to date ( table 1 ) [ 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 ] . the mean age of patients was 54 years with a male : female ratio of 7 : 15 . nf can be classified as type i nf due to a polymicrobial infection or type ii nf due to a monomicrobial infection , and the majority of gbs nf cases were type ii nf . in the 22 patients , the lower extremity was the most common site of nf , accounting for approximately 70% of cases . notably , 16 patients ( 73% ) had diabetes and 3 had cancer ( 14% ) , suggesting that an immunocompromised host is a risk factor . our case was particularly rare in that nf occurred bilaterally and there was a time lag of 1 week between the development of primary and secondary nf . bilateral nf is rare , and approximately 15 cases have been reported in english to date [ 4 , 16 , 17 , 18 , 19 ] . it can be caused by ( i ) procedures of multiple puncture , cannulation or surgery ; ( ii ) direct spreading of nf to the opposite site , and ( iii ) metastatic seeding of bacterium during the bacteremia . almost all of the reported cases , except gbs nf cases , developed bilateral nf simultaneously . regarding bilateral gbs nf , two cases of bilateral gbs nf of an extremity have been previously reported and both cases developed secondary nf after a 1-week time lag [ 4 , 16 ] . one case developed nf on the right lower leg secondary to nf of the left lower leg , and the other developed nf bilaterally on upper and lower extremities secondary to septic arthritis of the left knee . of note in both cases , secondary nf appeared at remote sites several days after debridement or amputation of the primary infected lesion , and gbs was detected in blood culture even at the start of treatment for the primary infection . thus , hematologic dissemination of gbs is an early event in the development of secondary gbs nf , and it appears that the occurrence of secondary nf with a 1-week delay is due to the slow evolution of inflammation in remote fascia and subcutaneous tissue . including cases of bilateral gbs nf of an extremity , gbs was detected in blood culture in 50% ( 11 of 22 ) of gbs nf cases . importantly , patients with positive blood culture had a high mortality rate of approximately 30% , whereas none of the patients with negative blood culture died ( table 1 ) . although it is difficult to differentiate gbs nf and gbs cellulitis because the speed of evolution of gbs nf is slow , dermatologists must be aware of the characteristics of gbs nf and the possibility of appearance of secondary nf at remote sites with an approximate 1-week delay .

necrotizing fasciitis ( nf ) is a severe bacterial infection involving fascia and subcutaneous tissue . it generally affects upper or lower extremities unilaterally , and there are few reports of bilateral - extremity nf . here , we report a case of a 43-year - old male with type 1 diabetes who had nf on the left foot and subsequently developed nf on the other foot 1 week later . the patient survived with antimicrobial therapy and bilateral below - knee amputation . as group b streptococcus ( gbs ) was isolated by blood culture and culture of excised tissues of both feet , bilateral gbs nf of the foot was diagnosed . gbs is a rare causative pathogen in nf ; however , there have been two case reports of bilateral gbs nf of an extremity in which nf appeared on the opposite extremity 1 week after the primary site infection , as in our case . gbs was isolated from cultures of blood and excised tissues of both extremities in both cases . together , these observations suggest that gbs has a potential to cause secondary nf at remote sites by hematogenous dissemination with approximately 1 week delay and thereby lead to bilateral nf .

rapid correction of hyponatremia is a known risk factor for the development of osmotic demyelination syndrome ( ods ) , a disorder characterized by the wide spread development of demyelination in the pontine as well as the extra - pontine regions . we herewith describe a patient of ods in the face of a slow correction of hyponatremia and associated hypokalemia . a 47-year - old non - alcoholic male presented to the er with altered sensorium . one week earlier , he had been started on ofloxacin for a lower urinary infection , following which he developed oliguria and swelling of whole body . on examination , he had pedal edema , facial puffiness , and mild hypertension ( 146/92 mmhg ) . urine examination revealed a protein 100 mg / dl , 18 - 20 wbc , and 2 - 4 rbc per hpf . serum creatinine was 1.8 mg / dl , and a diagnosis of drug - induced interstitial nephritis was made . a history of jaundice , diabetes , uremia , or trauma was denied . on examination , the patient was an average - built man in grade 2 - 3 encephalopathy without any localizing neurological deficits . serum urea was 48 mg / dl ( normal 10 - 38 ) and the creatinine 1.6 mg / dl ( normal 0.6 - 1.2 ) . mmol / l ( normal 135 - 145 ) , serum potassium 2.5 mmol / l ( normal 3.5 - 5.3 ) , and the chloride 105 mmol / l ( normal 98 - 110 ) . the serum osmolality was 238 mosm / kg ( normal 285 - 295 ) with a urine osmolality 292 mosm / kg . the patient was started on 3% nacl till the sodium level reached 120 , when 3% saline was replaced with 0.9 n saline . correction was given at a rate not exceeding 8 mmol / l day , and serum sodium of 135 was achieved over a period of 8 days . simultaneously , serum potassium levels were corrected with intravenous potassium chloride [ graph 1 ] . the patient 's consciousness improved dramatically but only to deteriorate again after a period of 72 hours with steady deterioration over 24 hours till his speech became incomprehensible and he developed quadriparesis . neurological examination revealed generalized spastic quadriparesis , mutism and inability to swallow , characteristic of a pseudobulbar state with spontaneous eye opening consistent with the diagnosis of locked - in - syndrome . mri of the brain revealed symmetrical areas of altered signal intensity in the pons and basal ganglia , being hypointense on t1-weighted imaging [ figure 1 ] and hyperintense on t2-weighted imaging [ figures 2 and 3 ] . the involved areas were also hyperintense on a fluid inversion recovery ( flair ) images [ figure 4 ] , suggesting a diagnosis of pontine and extrapontine myelinolysis . the patient received supportive treatment for about a month when he succumbed to intercurrent sepsis . series-1 depicts highest daily sodium levels and series-2 represents potassium levels sagittal t1w image showing hypointensity in the pons t2w image showing symmetrical hyperintense signals in basal ganglia bilaterally t2w image showing diffuse hyperintense signals in the pontine region flair image showing hyperintensity in the pons first described in alcoholic and malnourished patients who developed neurological symptoms in association with non - inflammatory demyelination within the pons , the demyelination was then reported in extrapontine areas like basal ganglia , cerebral white matter , peripheral cortex , hippocampi , and lateral geniculate bodies . seen in up to 10% cases of ods , commonly associated with rapid correction of hyponatremia , ( rise in sodium level by > 12 mmol / day ) the pathogenesis of ods is not fully understood . it is speculated that in the face of a depleted adaptive process to protect against brain swelling , the redistribution of solutes upon correction of hyponatremia leads to a corresponding brain shrinkage , which leads to disruption of tight junctions and opening of blood brain barrier leading to oligodentrocyte damage triggering the demyelination of neurons . recently , it has been shown that hyponatremia leads to down regulation of a neutral amino acid transporter that impairs cellular reuptake of amino acids , rendering them more susceptible to injury as hyponatremia is corrected . as normonatremia is restored , mental status improves and may return to normal within 48 - 72 hrs , only to rapidly deteriorate days later . symptoms associated with cpm include dysarthria , dysphagia , flaccid quadriparesis that later becomes spastic , and horizontal gaze paralysis , which is typically followed by coma or delirium . epm is characterized by tremor , ataxia , and other movement disorders including mutism , parkinsonism , dystonia , and catatonia . an important accompaniment of the hyponatremia in our patient was hypokalemia [ figure 1 ] . in a recent study , hypokalemia was found to be a predisposing factor in 7 cases of cpm seen amongst 22 cases of hyponatremia , even when rapid correction of hyponatremia and non - acuteness of hyponatremia were not found to be the risk factors . in another report , 89% of 74 cases of ods had associated hypokalemia at presentation that , in contrast to our patient , had not normalized prior to the rapid correction of hyponatremia . reduced endothelial cell membrane concentration of nak - atpase in hypokalemia may predispose the cell to injury by osmotic stress associated with the rapid rise in the serum sodium concentration . gradual correction of hyponatremia is supposedly the most important step in the management of hyponatremic patients , the rate of correction dictated by the clinical condition of the patient . in asymptomatic patients , plasma na+ should be raised very slowly ( 0.5 - 1.0 mmol per h and up to 10 - 12 mmol / l over first 24 hrs ) . in patients with altered mental status and/or seizures , a relatively rapid correction ( 1 - 2 mmol / l per h for first 3 - 4 hrs or until seizures stop and up to 10 - 12 isolated case reports suggest that steroids , imidazolpyridine tartrate , or plasmapheresis may be helpful in therapy . patients who survive might require extensive and prolonged neurorehabilitation . in a recent study of 34 patients with ods , one - third of the surviving 32 recovered , one - third were debilitated but independent , and one - third were dependent . furthermore , clinical severity or extent of radiological / imaging changes is not predictive of the prognosis . our case illustrates the development of ods in graded correction of hyponatremia and emphasizes the possible pathogenetic role of associated hypokalemia .

a 47-year - old male presented with hyponatremia that was corrected slowly as per the recommended guidelines . the patient improved initially but went on to develop a quadriparesis with a locked - in state due to a central as well as extrapontine myelinolysis and subsequently succumbed to an intercurrent infective illness . the patient had associated hypokalemia . hyponatremia can result in central pontine myelinolysis even when the electrolyte disorder is treated slowly , and the concomitant hypokalemia seems to play a contributory role in the pathogenesis of the neurological disorder .

nutritional status is very important especially in old age population because any imbalance in nutritional status has negative effect on quality of life and causes increase morbidity and mortality . for instance , phytobezoar , a bezoar consist of fruit and vegetable fibers , can lead to small bowel obstruction and has risk factors such as intake of large amount of food with high - fiber content and inadequate chewing ( 1 , 2 ) . furthermore , aging process and some of related physiologic changes can predispose one to phytobezoar formation . we describe a case of small bowel obstruction due to phytobezoar following large amount of pomegranate seeds intake a few days before admission as an example of increased morbidity relating to unusual dietary habit . a 61 year - old man was admitted to emergency department of nemazee hospital , shiraz university of medical sciences , shiraz , iran , in 2015 with bowel obstruction . ct scan showed a mottled - appearing lesion in terminal ileum with air bubbles and dilated proximal bowel loops ( fig . three consecutive ct images show mottled - appearing lesion in terminal ileum five cm before ileocecal valve with air bubbles and dilated proximal bowel loops in favor of phytobezoar ( black arrows ) causing obstruction . note normal non - distended distal ileum just distal to bezoar ( white arrows ) because our patient had consumed large amount of pomegranate seeds five days before admission and with no history of previous abdominal surgery , phytobezoar became first diagnosis as cause and scheduled for surgery . during laparotomy , there were impacted materials in favor of phytobezoar just before ileocecal valve causing complete obstruction of small - bowel . the blockage resolved with pushing the intestinal contents into large bowel . the patient was discharged after passing unremarkable postoperative course and was doing well at two months follow up visit . nutritional status is very important especially in old age population because any imbalance in nutritional status has negative effect on quality of life and causes increase morbidity and mortality . one of the problems relating to dietary habit is phytobezoar formation in the gastrointestinal tract . bezoars are masses produced by accumulation of undigested material such as fruit , hair , and milk in gastrointestinal tract more frequently in stomach ( 3 , 4 ) and one of the most common types of bezoar is phytobezoar ( 5 ) , composed of fruit and vegetable fibers . phytobezoar as a cause of small bowel obstruction has risk factors such as intake of large amount of food with high - fiber content and inadequate chewing ( 1 , 2 ) . inadequate chewing can result of dental problems such as difficult chewing following loss of teeth that frequently seen in older age group ( 6 ) . other factor in aging population is loss of intestinal elasticity , as a physiologic change commonly seen in this group , and resultant constipation ( 6 ) may be considered as another reason for increased chance of intestinal phytobezoar formation . in other words , intestinal phytobezoar formation is a multifactorial entity , involving dietary and alimentary factors ( 7 ) and dental hygiene . therefore , good dietary habit and proper dental hygiene in lifetime are necessary for maintaining a healthy population especially in older adults . small bowel obstruction is another area for consideration that is a common disease and result from many causes such as adhesion , hernia , inflammation , tumor and bezoar . two to three percent of small bowel obstructions are due to bezoar ( 7 ) . in addition , most frequent manifestation of bezoar is complete intestinal obstruction ( 8) and computed tomography is useful in its diagnosis ( 1 ) . findings of bezoar - induced small bowel obstruction on ct scan are intraluminal mass containing air bubbles and dilated bowel loops proximal to mass and normal distal loops ( 1 ) . the dietary habit of having large amount of vegetables and fruit in asian countries can be result in phytobezoar formation as relatively common cause of small bowel obstruction in the absence of previous gastric surgery ( 4 ) . small bowel obstruction due to bezoar may need surgery for treatment and this entity rarely improves with conservative therapy , hence it is important to consider this diagnosis as the reason for obstruction ( 1 ) . in this way , in patients with small bowel obstruction that have history of recent consumption of vegetables or food with high fiber content and no past history of surgery , phytobezoar should be kept in mind with high index of suspicion . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

nutritional status is very important especially in older adults because of its effects on quality of life . phytobezoar , for instance , that can lead to small bowel obstruction has risk factors such as excessive consumption of foods with high fiber content and inadequate chewing . these factors are related to dietary habits . furthermore , aging process and some of related physiologic changes can predispose one to phytobezoar formation . we describe a 61-yr - old man presented to the emergency department of nemazee hospital , shiraz university of medical sciences , shiraz , iran , in 2015 with small bowel obstruction due to phytobezoar following large amount of pomegranate seeds intake a few days before admission as an example of increased morbidity relating to unusual dietary habit .

drug - coated balloon has been developed as an alternative to drug - eluting stents ( des ) . results of several preclinical and clinical studies indicate that short - term exposure of injured arteries to paclitaxel eluted from regular percutaneous transluminal angioplasty and ptca balloons may be sufficient to reduce late lumen loss and restenosis rates during a critical period of time after angioplasty of diseased coronary and peripheral arteries.- we present a case of particularly proliferative instent restenosis treated with a new type of drug eluting balloon . a 68-year - old man with severe silent ischemia was admitted to our center for elective coronary angiography and percutaneous coronary intervention . the patient had bypass grafting of left anterior descending ( lad , with mammary artery ) , first obtuse marginal branch and right coronary artery ( rca ) 6 years before . three years after the surgical procedure , he developed unstable angina and angiography showed occlusion in both vein grafts . he underwent percutaneous transluminal coronary angioplasty with des in the obtuse marginal branch and left main and with a bare metal stents vision 3.5 18 mm in the proximal and 3.0 23 mm ( abbot vascular , abbott park , illinois , usa ) in the distal dominant rca ( figure 1a and 1b ) . after one year , he had recurrent angina and a complete occlusion of previous bare - metal stents of rca was noted . the patient underwent repeated coronary angioplasty with des and extensive reconstruction of the rca was accomplished using two promus ( boston scientific , usa ) 3.5 28 mm and a 3.5 15 mm followed by another 3.0 12 mm from the proximal to the distal portion of rca with excellent angiographic results ( figure 1c ) after high pressure over- dilation with 4.0 12 mm sprinter nc balloon ( medtronic , minneapolis , minnesota , usa ) . nevertheless after 8 mo the patient developed severe stress myocardial ischemia in the inferior territory associated with mild effort angina . the coronary artery angiography revealed diffuse proliferative and subocclusive in - stent restenosis of previous des ( figure 1d ) . the patient was considered at risk for repeated bypass surgery , so a percutaneous ballaoon angioplasty with a medicated balloon was scheduled . because the in - stent restenosis was too long to treat with a coated balloon , that usually can be used only one time for each inflation , an infusion balloon such as the genie ( acrostak ag , stegackerstrasse 14 , winterthur , switzerland ) was selected . the device is composed of a balloon with two heads at each distal extremity which allow for stopping the blood flow for at least 80 s ( ideally 120 s ) and a central chamber with micro - holes which is filled up with liquid paclitaxel ( 130 - 170 mol ) ( figure 1e ) , and can be implanted at a low pressure ( 2 atm ) . thus , the rca was wired and dilated with multiple inflation of a standard 3.0 30 mm sprinter balloon and then , four dilatation along the entire rca was accomplished with a 3.5 28 mm genie catheter . the immediate final ( figure 1f ) as well as 6 mo follow - up coronary angiographic results ( figure 1 g ) were excellent . the patient is free from symptoms and silent ischemia at 9 mo clinical and instrumental follow - up . the presented case suggests that drug - infusion balloon can offer an effective therapeutic option in selected patients with very extensive in - stent restenosis after des implantation . although the number of published trials and patients treated with drug eluting - balloon is still limited , and its effectiveness in treating in - stent restenosis , and in particular in the treatment of restenosis after des has been only suggested but not yet proved , there is some promise for drug - coated stent for such purpose . most drug - coated balloon can not be used for more than one inflation and thus resulted useless in long segment treatment . the genie catheter has been used in in - stent restenosis after bare - metal stent implantation . however , to the best of our knowledge , this is the first report about its use in very long proliferative and occlusive in - stent - restenosis after des treatment .

drug - coated balloon has been developed as an alternative to drug - eluting stents for in - stent restenosis but the performance of drug infusion balloon in such setting has not been previously described . we present a case of particularly aggressive in - stent restenosis after drug eluting stent implantation treated with a new kind of drug infusion balloon developed in order to overcome the impossibility to inflate regular drug - coated balloon for several dilatation .

intraosseous ganglion cyst ( igc ) is a benign , no neoplastic bone lesion with histological similarity to the soft tissue ganglion cyst.1 , 2 intraosseous ganglion contains mucoid viscous material with no epithelial or synovial lining . the radiolucent carpal lesions are usually symptom - free found incidentally on radiographs of the wrist performed for other reasons . detecting a single radiolucent lesion in the lunate accompanied by pain is rare , and detecting a pathological fracture of the lunate revealing an intraosseous ganglion cyst is exceptional . isolated rare cases of intraosseous ganglion cysts in the carpal bones have been reported , most commonly in the lunate and the scaphoid.5 , 6 , 7 , 8 , 9 their etiology remains largely unknown ; however trauma , herniation of the joint capsule , mucoid degeneration , intramedullary metaplasia of mesenchymal cells , and congenital rests of synovial producing cells have been suggested to play a part . we report a case of a pathological fracture of the lunate revealing an intraosseous ganglion cyst . a 42-year - old female , with a history of right distal radius fracture , presented with right wrist pain following a fall on the palm of the right hand . clinical study revealed a moderate swelling over the mid - section of the palmar face and pain through extreme ranges of motion of the wrist . radiographic studies of the right wrist revealed a round - shaped defect with a fracture of the lunate ( fig . 1 ) . ct scan confirmed a cystic lesion of the lunate and was able to localize the lesion and the fracture precisely ( fig . 2 ) . the patient was operated upon using anterior surgical approach with a medial palmar extension ; both the lunate and the distal radius were exposed for harvesting vascularized bone . a soft - tissue ganglion cyst communicating with the lunate intraosseous ganglion cyst was identified through a defect on the anterior side of the lunate . through the cortical defect the cavity was rinsed with saline solution and packed using a vascularized bone graft based on the volar carpal artery , e.g. kuhlman 's vascularized radial bone graft ( fig . 3 ) . after closing the joint capsule , the subcutaneous and cutaneous tissues , a removable wrist cast was applied for six weeks . the content of the cyst was described anatomopathologically as a cystic formation with walls constituted by flattened , synovial - like , fibro - connective tissue cells with no true epithelial lining . after a ten - month follow - up period she was completely relieved of pain without any limitation of the wrist motion . in 1956 , hicks described radiolucencies with a sclerotic margin within bones as synovial bone cysts . in 1966 crabbe first used the term intraosseous ganglion . synonymous terms include synovial bone cyst , ganglionic cystic defect of bone , subchondral bone cyst and juxta - articular bone cyst . radiolucent carpal bone lesions are usually symptom - free found incidentally on radiographs of the wrist performed for other reasons . their differential diagnosis includes igc , osteoarthritic cyst , post - traumatic cyst , simple bone cysts , and aneurysmal bone cyst . when they present themselves as painful wrist , kienbock 's disease , osteoid osteoma and osteoblastoma should be included in a differential diagnosis list . ganglia in the lunate is mostly located near the radiocarpal joint in the proximal part of the bone , and in the majority of cases turned toward the scaphoid . most intraosseous ganglions in the scaphoid are located in the proximal portion near the lunate because about 70% of hand tissue - ganglia arise from the posterior side of the scapho - lunate joint.12 , 13 a lesion was classified as an intraosseous ganglion when histopathology was identical to soft - tissue ganglion cysts . the wall of the cysts consists of fibrous , collagenous fibers similar to flattened histiocytes , partly mucoid - degenerated without epithelial cells and without synovial lining . the cyst wall in general is surrounded by sclerotic bone with necrotic and regenerated bone tissue.6 , 14 the causes of both soft tissue and intraosseous ganglion remain unsettled . there seem to be two fundamental types of intraosseous ganglia : one originating by penetration of an extra - osseous ganglion into the underlying bone , the other being idiopathic . erosion of an extraosseous ganglion through bone is the generally agreed - on mechanism for the penetrating type . it seems that idiopathic type of ganglion cyst originates from modified mesenchymal or synovial cells at the capsule synovial interface in response to repeated minor injury , explaining high prevalence of ganglion cyst in the scapho - lunate site where the motion and force is concentrated . . then proliferation of fibroblasts and histocytes and production of hyaluronic acid with mucoid degeneration during tissue revitalization occur to form a cyst . surgical treatment is indicated if the igc is symptomatic or if its size is growing in imaging findings . growing igc can result in traumatic and collapsing fracture in the lunate with serious complications . when igc has been completely stopped growing and there is no cortical defects or collapsing fractures , regular follow - up with radiography is recommended . increased uptake in lunate area in a painful wrist indicates surgical treatment.17 , 18 treatment of igc consists in the curettage of the cyst , injection of saline solution and packing the cavity with cancellous bone graft . in our case an anterior approach was preferred and a kuhlman 's vascularized radial bone grafting was performed because of the palmar localization of the ganglion cyst within the lunate bone . in addition to this approach , a dorsal approach or some alternative surgical techniques such as excision of the lunate , dorsal flap arthroplasty , prosthetic replacement , radiocarpal or intercarpal fusion are also used . an igc should be suspected when patients present with pain or swelling of the wrist following a trauma along with a cyst with fine marginal sclerosis close to the scapholunate joint . although ct scan shows the bony architecture , mri may better demarcate the tissues surrounding the bones . in conclusion , this case shows an unusual presentation of an intraosseous ganglion cyst of the lunate revealed by a pathological fracture . surgical treatment provided excellent outcome .

intraosseous ganglion cyst of the carpal bones represents a rare cause of wrist pain . we report a case of a 42 year - old , right - handed female , who presented with pain of the right wrist following a fall on the palm of the hand . clinical study revealed a moderate swelling over the mid - section of the palmar face and pain through extreme ranges of motion of the wrist . plain radiographs and ct - scan of the wrist have revealed an intraosseous ganglion cyst of the lunate bone . curetting - filling by kuhlman 's vascularized radial bone graft allowed a good functional recovery . the clinical , radiological and therapeutic aspects are discussed .

a 26-year - old female was admitted to the neurology unit for fever , severe temporal , parietal and occipital headache , paresthesia of the hands and involuntary blinking of the left eye which had started 10 days before . a transient episode of aphasia she had undergone dental procedures some months before without any antibiotic prophylaxis . on physical examination a holosystolic murmur was heard . the erythrocyte sedimentation rate and the c - reactive protein were slightly increased while the white blood count was normal . a computed tomography scan detected two small areas of hyperintensity compatible with subarachnoid haemorrhage in the left parietal lobe ; a smaller area with the same characteristics was detected in the right parietal lobe . magnetic resonance imaging ( mri ) and angio - mri revealed an irregular , nodular image of 4 mm with high flow , in the left parietal lobe , interpreted as a vascular malformation ; two smaller areas with similar characteristics were observed in the left and the right parietal lobe . angiography revealed three small aneurysmal dilatations along the course of the left paracentral lobular artery , the left superior parietal artery and the left angular artery ( figure 1 ) . aneurysms were interpreted as possible mycotic aneurysms and an echocardiography was requested because infective endocarditis was suspected . a trans - thoracic ecocardiography confirmed the mitral prolapse with moderate insufficiency and revealed thickened mitral lembs . a follow up transesophageal ecocardiography documented remarkable reduction of the thickness of the lembs of the mitral valve and an improvement of the mitral regurgitation . a follow up mri of the brain showed hemosiderin deposits as a result of bleeding . a follow up scintigraphy showed the resolution of the accumulation on the mitral valve and at brain level . according to the most recent guidelines of the american heart association , issued in 2007 , antibiotic prophylaxis is no longer indicated in patients with mitral prolapse undergoing dental procedures , as it was in the previous edition . this decision has been criticized by some authors who reported cases of infective endocarditis occurring in patients with such a cardiac defect and undergoing dental procedures without any prophylaxis . though infective endocarditis in these patients can not be attributed to dental procedures for sure , we believe a more prudent approach should be considered . the diagnosis of endocarditis is based on the duke criteria . in our case , the following occurred : one major criteria ( major echocardiographic findings ) and four minor criteria ( fever , embolism , predisposing heart condition and minor microbiological criteria ) . positive leukocyte scintigraphy is not included in the duke criteria ; however , in our case , it was consistent with the diagnosis of endocarditis with cerebral embolism . some data suggests scintigraphy is of little value in the evaluation of patients with suspected endocarditis , since vegetations consist mainly of masses of fibrin , clotted platelets , blood cell debris , bacteria and only a few leukocytes . other studies suggest a positive granulocyte scan correlates with high activity of the inflammatory process and predicts a poor prognosis for the patients concerned . probably , more evidence is needed to define the role of scintigraphy in the diagnosis of infective endocarditis . indications for therapy with daptomycin approved by the fda include staphylococcus aureus bloodstream infections including right - sided endocarditis and daptomycin is also considered as an alternative option for the empirical treatment of endocarditis on native valves and the treatment of endocarditis due to gram positive bacteria . daptomycin is not generally recommended for infections of the central nervous system since there is no adequate evidence on its penetration in the cerebral parenchyma and the cerebrospinal fluid . however , in our case , we considered cerebral mycotic aneurysms as caused by the infection of the vascular side of the wall of the vessels . our report suggests that daptomycin is safe and effective in case of left endocarditis with cerebral embolism .

a young girl was admitted for fever , headache , paresthesia of the hands , involuntary blinking of the left eye and aphasia . imaging revealed mycotic cerebral aneurysms and finally infective endocarditis was diagnosed and successfully treated with daptomycin . she had a history of mitral prolapse and she had undergone dental procedures some months before without any antibiotic prophylaxis , according to the 2007 guidelines of the american heart association .

the british thoracic society have provided guidelines that detail a systematic approach to the investigation of unilateral pleural effusion . our case highlights the potential for serious harm when pleural procedures are performed without bedside pleural ultrasound . pulmonary tuberculosis ( tb ) is a leading cause of death worldwide , especially in developing countries . diagnosis can be made from sputum for microscopy for acid - fast bacilli ( afb ) and tb culture . pleural tb usually presents with symptoms such as pleuritic chest pain , cough , and fever and it is recommended that when pleural tb is suspected , patients should undergo thoracocentesis and a blind closed pleural biopsy ( bcpb ) . in our institution , bcpb is not performed , which posed a dilemma since the patient was deemed too unwell for a thoracoscopy . our patient was an 86-year - old man , never smoker , who presented to a regional hospital with a 4 weeks history of nonproductive cough , dyspnea , and left pleuritic chest pain . he had migrated to australia from korea 40 years ago , and his only significant medical illness was atrial fibrillation for which he was receiving oral digoxin 125 mcg daily . at the time of hospital presentation , blood tests demonstrated leukopenia 3.2 10 9/l and lymphopenia 0.76 10 9/l . c - reactive protein was 145 mg / l ( normal < 5 mg / l ) . however , the medical officer did not use image guidance and mistakenly attempted the thoracocentesis on the right hemithorax instead of the left side . chest x - ray showing moderate amount of left sided pleural effusion in our institution , we performed a bedside pleural ultrasound - guided thoracocentesis . the pleural fluid analysis revealed the fluid to be an exudate ( protein 54 g / l and lactate dehydrogenase 289 u / l ) . since the cause of the effusion was unknown , 1 week later a 2 thoracocentesis was performed which was also nondiagnostic . the patient underwent a computed tomography ( ct ) chest which revealed a moderate amount of left - sided pleural effusion and an irregular left upper lobe linear nodular opacity [ figure 2 ] . our institution does not offer an induced sputum test , and consequently , the patient underwent a bronchoscopy , and bronchial lavage was performed on the left upper lobe . computed tomography chest showing left sided pleural effusion and apical pulmonary nodular opacity clinically , the patient continued to deteriorate and was now bed bound . to obtain a pathological diagnosis , it was decided that a pleural biopsy must be performed as a next step investigation . bcpb equipment was not available in our institution . due to his poor performance status , furthermore , there was no discrete pleural tissue that could be biopsied using ct image guidance . six weeks later the bronchial lavage culture grew mycobacterium tb , which was sensitive to first - line anti - tb agents . hence , he was commenced on standard daily regimen antibiotic treatment consisting of isoniazid 300 mg daily , pyridoxine 25 mg daily rifampicin 600 mg daily , pyrazinamide 1500 mg daily , and ethambutol 800 mg daily were prescribed for 2 months followed by isoniazid and rifampicin for 4 months . over the course of the 6 months , finally , 8 months after he initially presented to hospital , he was discharged from the respiratory clinic after completion of anti - tb treatment . we believe that this case report has highlighted three pertinent issues in the management of patients ' with pleural effusion : wrong side thoracocentesis , lack of equipment to perform bcpb and induced sputum . it is estimated that approximately 178,000 thoracenteses are performed per year in the united states . typically , thoracocentesis is a safe procedure but can result in significant complications including pneumothorax , hemorrhage , and death . despite these efforts , wrong side thoracocentesis can still occur . they found that absence of verification images to be cause in almost 50% of cases . consequently , there has been a trend to the widespread implementation of ultrasonography , training , and restriction of thoracentesis to experienced health care professionals . another reason for the delay in diagnosis was the lack of availability of equipment to perform a bcpb in our institution . however , it has now been demonstrated that if the pleural biopsy is guided by an imaging technique ( ultrasound or computed tomography ) , its yield is even better . the increasing availability of video - assisted thoracoscopy and the low prevalence of tb effusions in developed countries has led to the declining use and experience with bcpb . the third reason for delays in the diagnosis of tb was the lack of availability of induced sputum in our institution . a randomized study previously demonstrated that induced sputum has a greater diagnostic yield and is more cost - effective than bronchoalveolar lavage in detecting active pulmonary tb in patients who can not produce spontaneous sputum . induced sputum is performed with hypertonic saline solution delivered by nebulizer and samples can be obtained readily . this is in contrast to bronchoscopy , where immediate availability is not always possible due to staffing , bronchoscopy suite availability , and time constraints . this case highlights certain health care system deficiencies that resulted in delays and potential harm to our patient with pleural tb . importantly , these deficiencies are readily amenable to correction , and our health care service is currently undertaking reform to rectify these errors .

we report the case of an elderly asian man where a medical error and diagnostic delays obscured the diagnosis of pleural tuberculosis ( tb ) . the patient was hospitalized for evaluation of a unilateral pleural effusion . initially , the patient was subjected to a pleural aspiration on the wrong side due to a lack of bedside ultrasound guidance . subsequently , the patient underwent several investigations but not a blind closed pleural biopsy ( bcpb ) due to a lack of equipment . furthermore , the patient was deemed to be too sick to undergo a thoracoscopic pleural procedure . eventually , a bronchoscopy was performed , and washings from the right upper lobe were cultured , which established the diagnosis of tb . this case highlights the need to use bedside ultrasound in the investigation of pleural effusions , the role of bcpb especially in frail patients and finally the utility of bronchoscopy in establishing a diagnosis of pleural tb .

the report is one of a trilogy of basic international documents which will guide future disability policy . the most important of these documents is the un convention on the rights of persons with disabilities(2 ) which lays out values , especially human rights , and principles such as accessibility . the second and third documents provide support for the convention and guidance to policymakers , researchers and others . they are the international classification of functioning , disability and health ( icf ) ( 3 ) which is a who classification used as a framework for analysis for the report , and the world report itself which provides evidence to support the convention and enlightened policy and practice . the purpose of the world report on disability is to provide robust evidence on which to make well - informed decisions about disability policy and programs . the report is intended to provide governments and civil society with evidence on which recommendations for actions are based in areas of policy development , health systems , action on access and attitudes , gaps in research and capacity building . understanding the numbers of people with disabilities and their circumstances will help national and international policy makers , researchers , professionals , service providers and consumers to improve efforts to remove barriers and provide services . statistics and research data will help advance the un convention on the rights of people with disabilities . efforts to produce a world report on disability began in earnest in may 2005 when the world health assembly adopted resolution 58.23 on disability , including prevention , management and rehabilitation , directing who to produce a world report.(4 ) the development of the report was led and managed within the rehabilitation and disability unit of the violence and injury prevention and disability ( vip ) section of who(5 ) in collaboration with staff at the world bank . the process , which occurred over four years , involved a large number of stakeholders including an advisory and an editorial committee , over 370 contributors and over 70 low , middle , and high income countries . the report is composed of nine chapters covering approaches to disability , prevalence , healthcare , rehabilitation , assistance and support , enabling environments , education , work , and recommendations . the icf provides the conceptual model . findings include a higher estimate of disability than who s former estimate in the 1970 s of 10 percent of the world population . today , one billion people , 15 per cent of the world population , are estimated to have a disability of which 110190 million have very significant difficulties in functioning . not all people are equally disadvantaged with poorer people , women and older people disproportionally affected . these numbers , as well as information about demographic , health and environmental factors affecting trends in disability , can improve efforts to remove barriers and provide services . disabling barriers include inadequate policies and standards , negative attitudes , lack of provision of services , inadequate funding , lack of accessibility and lack of data and evidence . in turn , barriers contribute to poorer health outcomes , lower educational achievement , less economic participation , higher rates of poverty and increased dependency and restricted participation . therefore , recommendations include access to all mainstream policies , systems and services , adopting a national disability strategy , funding , involvement of people with disabilities and support for research . the authors of the rehabilitation chapter of the report recognize that tr is an emerging resource that can enhance the capacity and availability of rehabilitation measures by providing interventions and other important resources remotely , thus reaching a vast underserved population . technologies for service delivery include video and teleconferencing , mobile phones and remote data - collection equipment and telemonitoring . the technology may be used by rehabilitation professionals as well as by people with disabilities , therefore accessibility features are important . the chapter provides a number of examples of remote delivery of services such as remote assessments , training and support of health - care personnel , consultations between hospitals for problems related to prosthetics and orthotics and wheelchair prescriptions and sharing professional expertise . finally , the experts who authored this chapter , like so many others , call for more information on resource allocation and costs to support implementation of tr policy and practice . the content of the information and communication section of the chapter entitled enabling environments departs from the health domain to focus more on the environmental domain . it is particularly sensitive to the relationship between access to communication and information and access to health care , education , local government and justice . the chapter drew from the expertise of agencies and organizations such as the international telecommunication union , the g3ict(6 ) and the un global alliance , the daisy consortium(7 ) and the w3c web accessibility initiative(8 ) to identify web usage figures , barriers , policies , best practices and to provide recommendations . 21st century communications and video accessibility act , and design principles such as universal design are very much a focus of this chapter . many report - related events , often with educational objectives , are on the international calendar . the world bank has initiated webinars on the report.(9 ) launches of and symposia about the report are occurring in countries throughout the world . in the united states , the report was launched on september 1213 , 2011 in the washington , d.c . area.(10 ) the event , sponsored by the center for international rehabilitation research information and exchange ( cirrie ) , featured a number of well - known leaders . kareem dale , special assistant to the president for disability policy made opening remarks , followed by representatives from the world bank , world health organization and the pan american health organization . agency and departmental representatives from the agency for international development , education , health and human services and labor served on panels to discuss the relationship between their work and the content of the report . the u.s . launch program featured a sequence of panels of authors of each chapter of the report and discussants who were distinguished scholars , mainly from the u.s . research community , focusing on the relationship between report content , their work and its impact on their future work . again in the u.s . , the american academy of physical and rehabilitation medicine ( acrm ) featured the report in its recent meeting and the upcoming pacific rim international conference on disability & diversity ( pacrim ) conference will also include a major presentation about the report . while these activities and the report itself are major steps forward in advancing human rights for people with disability , there are issues important to tr that are not addressed in the report . the international framework for health information technology ( hit ) has developed largely independent of the convention , the icf and the report . however , international ehealth documents show increasing sensitivity to the usability of health information technology for end users . an action plan for a european ehealth area was published by the european commission in april 2004 and endorsed by the eu health ministers in june 2004.(11 ) the plan has a code of conduct that includes accessibility criteria , ( i.e. , accessibility sites should be developed to be as user - friendly as possible for all potential visitors).(12 ) there is some indication that individual nations , such as the united states , are beginning to consider the application of accessibility guidelines to hit(13)(14 ) . if countries use the un convention principle of accessibility as a bridge from disability ( and aging ) to hit then resulting regulatory requirements may bring tr and other health technology applications into closer alignment with the needs of the disability community .

in june , 2011 at the united nations ( un ) in new york city , the world health organization ( who ) and the world bank launched the first world report on disability . this short overview of the report provides information about its purpose , development and content , intended audiences , and outcomes . special attention is directed to the sections of the report which address telerehabilitation and information and communication technology .

the highest prevalence is seen in sephardic jews from iran and iraq that is 1:3000 who also often have an associated coagulation factor vii deficiency ( 14 ) . dubin johnson syndrome manifests with an intermittent jaundice in the first two decades of life . pregnancy or intake of oral contraceptive may provoke manifestation of the disease . except for the jaundice the patient is a 22-year old male that came to the office 3 year ago for the first time with fever , jaundice , fatigue and dark urine . he had no history of alcohol intake or any drug use ( herbal or chemical ) . liver function test were impaired and all serological studies was normal but havab igm was positive , the patient was being treated with the suspicion of acute viral hepatitis a ( table 1 ) . paraclinical evaluations from first presentation until present ast= aspartate aminotransferase ; alt= alanine transaminase ; alp= alkaline phosphatase ; inr= international normalized ratio ; alb= albumin ; lkm ab= liver kidney microsome antibody ; asma= anti - smooth muscle antibody ; ana= antinuclear antibody ; ab= antibody ; ag= antigen ; ig= immunoglobulin ; hbs= hepatitis b surface ; hbc= hepatitis b core ; hcv= hepatitis virus type c ; hiv= human immunodeficiency virus ; hav= hepatitis a virus ; tsh= thyroid stimulating hormone ; s.p= serum protein ; ema= endomysial antibody ; p - anca= perinuclear anti - neutrophil cytoplasmic antibody in the recent past 3 years total bilirubin has been fluctuates between 8.9- 13.5 mg / dl and the direct part between 7.4 - 9.5 mg / dl . despite the regression of symptoms and reduction of liver enzymes to the normal levels , the jaundice remained persistent ( table 1 ) . abdominal sonography in 3 years ago revealed nothing significant but mild hepatomegaly with heterogenous echo . recently , liver biopsy was done and containing a specimen consisting of two pieces of small creamy needle - shaped dark brown tissue totally measuring 3 cm in length and 0.1 cm in diameter . individual hepatocytes contain abundant course brown pigment granules especially in perivenular areas portal tracts show mild lymphocytic infiltration . he had one episode of upper gi bleeding that esophagogastroduodenoscopy revealed grade b esophagitis and small duodenal ulcer . in urine djs is listed as a rare disease by the office of rare disease ( ord ) of the national institutes of health ( nih ) ( 6 , 7 ) . in this situation the diagnosis is based on clinical and laboratory findings especially liver biopsy . despite the normal liver enzymes , only the bilirubin is higher than normal level that is mainly conjugated part . in liver biopsy the total coproporphyrin in urine is normal , but 85 - 90% of urinary coproporphyrin is type i , whereas in normal persons 75% of urinary coproporphyrin is type iii ( 7 , 9 , 10 ) . in our patient the jaundice was being provoked after a viral hepatitis and despite comprehensive work up , only direct hyperbilirubinemia was seen .

elevated serum level of bilirubin is a common manifestation which is occurred in several diseases . hyperbilirubinemia can manifest either conjugated or unconjugated . conjugated or direct hyperbilirubinemia usually are caused by hepatocellular diseases or cholestatic liver diseases . merely conjugated hyperbilirubinemia is the main manifestation of two congenital syndromes , including dubin - johnson and rotor syndrome ; however it can be seen in some patients with recurrent benign intrahepatic cholestasis . this article reports a patient with dubin- johuson syndrome as a benign and rare condition .

we administered intravitreal bevacizumab injection to eight eyes of eight patients of various etiologies ranging from retinal vein occlusion to diabetic retinopathy , age related macular degeneration amd , and choroidal neovascular membrane cnvm . the best corrected visual acuity of seven out of eight patients was poor and ranged from 20/120 to finger counting . the details of the procedure , complications were discussed with the patients , and written consent taken . injection bevacizumab was procured by a patient five days prior to the date of appointment and stored under recommended conditions ( i.e. , below 4c ) . on the day of injection , under aseptic precautions , the vial was opened in operation theatres , hood was not used due to its nonavailability . the syringe was then capped with a 30-gauge needle and kept on a sterile tray . best corrected visual acuity of patients and indication for intravitreal injection the eye of each patient was prepared following standard aseptic procedures ( i.e. , lids cleaned sequentially first with spirit and then with 10% povidone - iodine ) . fornices were flushed with normal saline and 1 drop of 10% povidone - iodine was instilled 2 min before the procedure . intravitreal bevacizumab injection was administered into the superotemporal quadrant , 4 mm from the limbus . different needles were used each time after cleaning the surface of vial with spirit , thereby administering multiple pricks in the vial . all of them were asked to come next week for follow - up or earlier if patient experienced severe discomfort . four of the eight patients reported to the hospital on the 3rd day after injection with complaints of pain , watering , and diminution of vision . two patients who did not report by the 4th day were contacted and recalled for an examination . six out of eight patients had absent fundal glow along with presence of cells and flares [ table 2 ] . clinical findings in patients following intravitreal injection of bevacizumab these six patients were clinically diagnosed to have endophthalmitis and were administered intravitreal antibiotics ( injection ceftazidime 2.25 mg in 0.1 ml and injection vancomycin 1 mg in 0.1 ml ) on the same day of presentation . vitreous samples and drug vial were sent for culture sensitivity in two different laboratories which turned out to be sterile . intravitreal antibiotics were repeated after 48 h. all patients were closely followed up and remaining drug was discarded . while pegaptanib and ranibizumab are labeled for intravitreal use , bevacizumab is labeled for use in cancer therapy and is currently being used off - label for the treatment of ocular neovascular diseases . because of its off - label use , bevacizumab is supplied in much larger volumes than those needed for single intravitreal injection . thus , hospitals and compounding pharmacies must divide the larger volume of bevacizumab into smaller units suitable for single - use , individual doses . contaminants could possibly be introduced during the compounding process and compromise the sterility of the aliquoted drug . multiple pricks ( procedure common in india ) were made in vial to prepare administrating dose for eight patients . an alternative protocol suggested is that small aliquot of drug should be prepared using single prick technique , i.e. , 0.5 in . 26 gauge needle should be inserted into rubber cap of vial and drug should be drawn into different 1 ml syringes , every time changing only the syringe , leaving the needle in place . next group should be administered injection after one week , i.e. , after the first follow - up of the previous batch . in this way , we would be able to minimize incidence of cluster endophthalmitis and detect possible contamination in the compounded aliquoted drug before it is administered to the next batch . if required , each eye should be injected using drug from different lots under sterile conditions . six out of eight patients had endophthalmitis , remaining two patients though belonging to different age groups ( 50 and 72 years ) , did not develop endophthalmitis . the possible reason for this could be the inherent immunity against the causative organism or the quantity of causative organism in the inoculums could have been below the threshold required for endophthalmitis . presentation of cases with signs and symptoms of endophthalmitis and response with intravitreal injection of antibiotics led us to assume infective pathology despite the negative culture report . the possibility of tass syndrome in these patients was considered , but review of literature suggests that series of patients , who developed tass syndrome in canada , had reported as early as 24 h. the final visual outcome was poor even with aggressive treatment . all patients had worse visual acuity at the end of follow - up than on injection day . four patients in our study presented on day 3 , while two patients reported on day 4 , after intravitreal injection . three out six patients with endophthalmitis showed improvement in visual acuity with intravitreal antibiotic therapy , as compared to pretreatment level . visual acuity remained same in two cases , while it deteriorated drastically in one case even after aggressive treatment [ table 3 ] . as the approval of intravitreal use of bevacizumab and its subsequent availability in the market in single dose ( 0.05 ml ampoules ) is still awaited , using the single - dose vial and aliquoting into smaller doses for multiple uses , is the call of the day . however , the present incident highlights the risks of microbial contamination and the need to stay vigilant against preexisting contamination within the vial or its access to the drug via multiple pricks . the alternative protocol , as described previously , is recommended to increase the safety margin of the intravitreal injection of bevacizumab .

the risk of endophthalmitis is always a concern when an intraocular procedure is performed . intravitreal injection is a frequently used method for therapeutic management of many diseases , affecting the posterior segment of the eye . hence , it is important to assess the risk of complications , especially endophthalmitis . most studies conducted concentrate on risk assessment from single use from single drug vial . the present article reports the occurrence of cluster endophthalmitis following multiple intravitreal bevacizumab injections from a single vial . intravitreal injection of bevacizumab was administered to eight eyes of eight patients . administered dose was prepared from single 4-ml vial of bevacizumab and was injected in the eye , after patient preparation and under aseptic conditions . the procedure was repeated for the remaining patients , thereby imparting multiple pricks in the same vial . four of the eight patients reported to the hospital on the 3rd day after injection with complaints of pain , watering , and diminution of vision . two patients reported the following day with similar complaints . two patients who did not report by the 4th day were contacted and recalled for an examination . all the patients were thoroughly examined using slit lamp biomicroscopy and indirect ophthalmoscopy . six out of eight were clinically diagnosed to have endophthalmitis and were administered intravitreal antibiotics . the present report highlights possibility of microbial contamination of the drug vial or during compounding process . however , from the present incident , we are encouraged to stay vigilant and wary of contamination

multiple myeloma is a malignant neoplasm that is characterized by a monoclonal proliferation of plasma cells . the clinical manifestations of the disease occur as a result of an expanding plasma cell mass in the bone marrow and other factors produced by these cells such as monoclonal immunoglobulin , bence - jones proteins and osteoclast activating factors . the common clinical signs and symptoms of multiple myeloma include pain in the bone , fatigue , anemia and infectious diseases . oral and maxillofacial manifestations as an initial sign or symptom of multiple myeloma are rare . in 12 - 15% of cases , oral involvement can be apparent as swelling , orofacial pain , mobility of teeth , numbness and paresthesia , hemorrhage , fracture and root resorption . we hereby present a case of multiple myeloma with first clinical manifestation as generalized gingival enlargement . a 58-year - old male patient was referred to our department because of the generalized enlargement of gingiva . the enlargement was first noted by the patient 6 months prior to the referral , and progressed steadily since then . the intraoral examination revealed soft , granular , friable , non - tender , and red / magenta enlargement that bled spontaneously . the enlargements were present on both buccal and lingual / palatal sides [ figure 1 ] . on physical examination , grade iii mobility was observed in 16 , 17 , 18 , 36 , 37 . the medical history of the patient included epilepsy for which he took prescribed medication with no occurrence of seizure for last 10 years . based on clinical presentation , a provisional diagnosis of inflammatory gingival enlargement routine blood investigations were done along with hiv and hepatitis b and sputum examination to rule out any leukemic infiltration and enlargement associated with tuberculosis . orthopantomography was advised , which revealed severe bone loss in 16 , 17 , 18 and 36 , 37 regions . after phase i therapy and consultation with the physician , gingivectomy was performed in anterior mandibular region and excised tissue was sent for histopathological examination . the patient was followed up every week [ figure 2 ] but after 1 month the clinical examination revealed recurrence of enlargement in the anterior mandibular region [ figure 3 ] . the subepithelial zone showed infiltration by sheets of plasma cells mainly mature with few being less differentiated [ figure 4 ] . based on these findings , serum protein electrophoresis and urine analysis for bence - jones proteins was carried out . subsequently , patient was advised to undergo cranial and pelvic radiography [ figures 6 and 7 ] . the patient was diagnosed as a case of multiple myeloma and chemotherapy was started with thalidomide . gingiva 10 days after excisional biopsy was taken recurrence after 1 month of biopsy areas of ulceration and sheets of plasma cells multinucleate and binucleate plasma cells pelvic radiograph showing osteolytic lesions skull radiograph showing osteolytic lesions normal gingiva 1 month after chemotherapy multiple myeloma is the most aggressive plasma cell neoplasia and most common primary malignancy of bone . it has a predilection for areas of active hematopoiesis such as the lumbar spine , ribs , and pelvic bones . jawbone involvement in multiple myeloma is common and often occurs in the advanced stages of the disease . jaw involvement in multiple myeloma was reported by bruce and royer to have a prevalence rate of 28.8% ( 17 of 59 total cases ) . epstein et al . , reported that 14.1% of 783 multiple myeloma cases had oral manifestations . lesions such as swelling , orofacial pain , mobility of teeth , numbness and paresthesia , hemorrhage , fracture and root resorption are more frequently found in the mandible than in the maxilla , especially in the posterior third and angle of the jaw , perhaps because of greater hematopoietic activity in these areas . a radiographic survey of patients with multiple myeloma reveals multiple well - defined punched out radiolucencies involving bone . these radiolucent areas of bone contain the abnormal plasma cell proliferations that characterize the disease . in our case , type 2 bone involvement was seen , which is by far , the most common presentation of multiple myeloma . in conclusion , dental surgeons can play an important role in the early recognition of oral lesions with underlying systemic disease , thus preventing the morbidity and mortality associated with such pathologies .

multiple myeloma is a malignant neoplasm that is characterized by a monoclonal proliferation of plasma cells . oral and maxillofacial manifestations as an initial sign or symptom of multiple myeloma are rare . a 58-year - old male patient presented with generalized gingival enlargement for last 6 months . based on clinical presentation , a diagnosis of gingival hyperplasia was made . after phase i therapy , excisional biopsy was taken in anterior mandibular region and excised tissue was sent for histopathological examination . the histopathology report revealed a lining of stratified squamous epithelium with foci of ulceration . the subepithelial zone showed infiltration by sheets of mainly binucleate and multinucleate plasma cells , few cells being less differentiated . rounded cytoplasmic inclusion bodies were identified in many of these cells . after a series of clinical investigations , a case of multiple myeloma was diagnosed . patient presenting with generalized gingival hyperplasia should be worked up for systemic disease like multiple myeloma .

chest pain is a typical symptom of acute coronary syndrome ( acs ) , of which there are three common types : unstable angina ( ua ) , st segment elevation ( stemi ) of myocardial infarction ( mi ) , and non - st - segment elevation of mi ( nstemi ) [ 1 , 2 ] . symptoms of acs in the absence of chest pain are dyspnea , nausea , sweating , neck or jaw and arm pain . ear pain and sore throat are rare symptoms of acs , which makes diagnosis and treatment difficult and challenging . we present a rare case of a patient presented to the emergency department of our hospital with symptoms of earache and sore throat for cardiac ischemia . a 53-year - old african - american female presented to the ed complaining of earache and sore throat for 3 days . she described the pain as a burning sensation that was worst when she woke up in the morning and got better as the day progressed . the patient denied chest pain , shortness of breath , nausea , vomiting , or dizziness . the patient worked as a telemarketer , described her job as very stressful , and claimed to smoke one to two cigarettes per week . her medical history was significant for dyslipidemia , newly diagnosed type 2 diabetes , and chest discomfort diagnosed 4 months ago at a different hospital as stemi with complete occlusion of the rca . she was treated at the hospital by placement of a bare - metal stent in her rca . current home medications included clopidogrel , aspirin , statin , beta - blocker , metformin , and nitroglycerin sublingually as needed for chest pain . her vital signs on arrival at the ed were : bp of 131/82 mmhg , pulse of 70 beats per minute , respiratory rate of 17 breaths per minute , temperature of 98 f , and oxygen saturation of 98% on room air . because of multiple risk factors , in addition to a symptom that could potentially be a referred cardiac pathology , an ecg , chest radiograph , and cardiac biomarkers were ordered at the triage . cardiovascular , pulmonary , abdominal , ear , nose , and throat examinations were unremarkable . the initial ecg displayed no st segment elevation , but t wave inversion in inferior leads that was unchanged from a previous ecg . a presumptive diagnosis of acs/ nstemi was made on the basis of an elevated troponin combined with the ecg changes . after the acs protocol was initiated , a cardiology consultation was requested , and the patient was admitted to our hospital . on admission , the patient continued to complain of throbbing ear pain that fluctuated now between the two ears , but again denied chest pain or shortness of breath . on the 2nd day it was found that the previous bare - metal stent in the posterolateral branch ( distal rca ) was completely occluded , and no balloon could be advanced beyond that area . a new lesion in the proximal / ostial rca greater than 70% occlusion was opened with a successful placement of a pci at the ostial rca using a drug - eluting stent . following this , her troponin level had declined to 0.63 ng / m on the 3rd day , and the patient was discharged with a referral for cardiac rehabilitation . we concluded on follow - up that otalgia in this patient was an atypical symptom of referred angina pain . the patient was seen 2 weeks later at the cardiology clinic of our hospital and reported no complaints about her condition or recurrence of ear pain . an ecg revealed no changes from the previous one done 2 weeks earlier at the time of discharge . the underlying pathophysiology of the referred otalgia in this patient can be explained by the autonomic dysfunction of the auricular branch of the vagus nerve often termed alderman s nerve . this branch of the vagus innervates the inner portion of the outer ear , and also controls the skeletal muscles including the superior , middle and inferior pharyngeal constrictors . the sinoatrial ( sa ) node we suggest that partial occlusion of the rca promoted damage of the parasympathetic fibers of the right vagus , and was the cause of referred otalgia and pharyngitis in our patient . sensory nerves are affected by type 2 diabetes [ 47 ] , but whether such a preexisting condition predisposes a person to angina - referred otalgia or pharyngitis is not clear . to our knowledge , symptoms of ear pain for cad and acute arterial occlusion in a patient have rarely been discussed in the literature . we found only one report ; in this report the correct diagnosis of cardiac ischemia was missed in two patients who were initially treated for primary ear pain . in conclusion , clinicians should be aware and recognize that ear and throat pain may represent symptoms for cardiac ischemia .

a rare case of a patient with unusual symptoms of earache and sore throat for cardiac ischemia is presented . a diagnosis of non - st - segment elevation myocardial infarction ( nstemi ) was made based on initial elevation of troponin and an abnormal electrocardiograph ( ecg ) . percutaneous coronary intervention ( pci ) performed with stent placement in the occluded coronary vessel was followed by a decrease in troponin level and complete resolution of the ear and throat pain and patient recovery from cardiac ischemia .

intracranial foreign bodies frequently result from trauma , including penetrating injury , and rarely involve wooden materials compared with metallic materials . when intracranial penetrations of wooden objects occur through the transnasal or transorbital route , physical examinations may reveal no abnormalities , and the objects may be difficult to visualize with conventional radiography . we present a case involving the transnasal intracranial penetration of a wooden branch that resulted in a delayed intracranial infection due to initial misdiagnosis . a 48-year - old man presented to the emergency department with complaints of headache the day before . two days earlier , he fell to the ground in a drunken state , and he could not clearly remember the incident . at the emergency department , no neurological or physical abnormalities , such as external contusions or cerebrospinal fluid rhinorrhea , were observed . computed tomography ( ct ) that was performed upon admission showed a round hypodense signal in the left frontal area , which suggested pneumocephalus , and a small amount acute subdural hematoma in the left frontotemporoparietal area ( figure 2 and 3 ) . the patient was admitted to the neurosurgical department for close observation , and prophylactic antibiotics were administered for the pneumocephalus . brain magnetic resonance imaging ( mri ) revealed a fistula from the left nasal cavity to the frontal lobe with enhancement along the tract and ventricular lining ( figure 4 ) . the foreign body was a wooden branch ( 11 cm long and 0.7 cm wide ) covered with brain tissue ( figure 5 ) . after the operation , the patient received intravenous antibiotics ( ceftriaxone plus vancomycin ) for over 2 months . a microbiologic culture study on the foreign body showed gram - positive cocci ( s. aureus ) . intracranial penetrating injuries by foreign bodies represent only 0.4% of all head injuries and usually occur in children because of falls.17 ) intracranial foreign bodies that cause severe intracranial infections can be fatal.8 ) miller et al.7 ) reviewed 42 cases with intracranial penetrating injuries and found that 64% developed central nervous system infections , 45% had additional brain abscesses , and the death rate was 25% . generally , the time from the injury to the clinical intracranial infection presentation is long , but it can vary from a few days to several years.5 ) therefore , careful history taking and thorough physical and radiologic examinations are essential . however , intracranial wooden foreign bodies are difficult to detect with plain radiographic techniques and distinguish from periorbital fat and air in the nasal cavity on ct images.48 ) the ct attenuation values of wooden foreign bodies vary depending on their water content . freshly cut wood has a relatively high physical density because of its high water content ; therefore , it is difficult to distinguish it from soft tissues , such as muscle and vitreous.3 ) conversely , when wood dries , the water is gradually replaced by gas , and its density is difficult to distinguish from that of fat or air.3 ) consequently , intracranial wooden foreign bodies have variable densities over time and are difficult to distinguish from the surrounding structures . tasneem et al.11 ) described a case involving a radiolucent intracranial wooden foreign body and the usefulness of the lung window setting for detecting wooden foreign bodies on ct images . careful review of ct images with the lung window setting can be helpful for detecting a wooden foreign body . unlike ct images , mri is more useful for detecting wooden foreign bodies that appear hypointense on t1- and t2-weighted mri scans and that can be distinguished from air or fat.69 ) in addition , infected lesions exhibit gadolinium enhancement . the initial ct image of the patient showed a single area of air in the frontal lobe . steudel and hacker10 ) reviewed 508 cases with acute head injuries and found that 49 ( 9.7% ) had a pneumocephalus on brain ct scans , with 5 ( 1% ) showing a single air bubble and 6 ( 1.1% ) having an intracerebral or intraventricular location . however , they did not experience a case involving a single air bubble with an intracerebral or intraventricular location . these findings suggest that patients with a pneumocephalus with a rare presentation need to be examined more carefully . patients with retained intracranial wooden foreign bodies frequently develop delayed infectious complications , and surgical removal is necessary , even in the absence of symptoms.178 ) our patient experienced late - onset seizures , which could have been secondary to gradual gliosis , progressive granulomatous changes , or delayed abscess formation , as has been noted in cases with retained foreign bodies.2 ) therefore , if intracranial injury from a wooden foreign body is suspected , careful history taking and imaging are very important . once the diagnosis of an intracranial foreign body is confirmed , surgical removal of the foreign body is required . the present case illustrates the necessity for special attention to patients suspected of having pneumocephalus with a rare presentation during the initial examination . early surgical removal of the intracranial foreign body is necessary to prevent complications .

intracranial wooden foreign bodies are rare . in addition , such objects are difficult to identify with conventional radiographic techniques , such as x - ray radiography or brain computed tomography . a 48-year - old man presented to our emergency room with a headache . even though he had a history of trauma , he had no external wounds and showed no neurological deficits at the initial examination . he was initially diagnosed with trauma - related pneumocephalus . he developed a delayed intracranial infection and underwent surgery to remove the wooden foreign body . the present case illustrates the necessity for special attention to patients suspected of having pneumocephalus with a rare presentation during the initial examination . early surgical removal of the intracranial foreign body is necessary to prevent complications .

the retrorectal space is an uncommon area where tumors occur and these include primary tumors of neurogenic , osteogenic , and congenital origin ; in addition to metastatic and inflammatory processes . congenital lesions include chordomas ( remnants of notochord ) , teratomas , anterior sacral meningoceles , and developmental cysts ( dermoid , epidermoid , enteric duplication , and tailgut cysts ( tgcs ) ) . tgcs , also known as retrorectal cystic hamartomas , are a rare congenital lesion thought to arise from the remnants of the embryonic postanal gut . hjermstad and helwig were the first to publish their findings in 1988 , and since then there have been no large case series reported . from review of the literature done by killingsworth and gadacz ( keyword = tailgut cyst or retrorectal cystic hamartoma , limits = english ) , there have been 43 cases with confirmed diagnosis of tgc since their report . a 15-year - old girl presented with the complaints of lower abdominal pain and constipation occasionally . however , on per rectal examination , there was a mass bulging from the posterior rectal wall , firm , and non - tender , with regular surface and smooth mobile rectal mucosa over it . an ultrasonogram ( abdominal ) revealed a large cystic lesion present in the left lower abdomen and the left ovary could not be seen separately . the patient then underwent a contrast - enhanced computed tomography ( cect ) of the abdomen and pelvis which revealed a well - defined 12 13 9 cm multiseptated lesion in the presacral space which was pushing the rectum laterally and urinary bladder superiorly and abutting the sacrum and coccyx posteriorly [ figure 1a and b ] . the lesion was showing peripheral and septal calcification , few hyperdense nonehancing areas and few ossified fragments within it . a provisional diagnosis of mature cystic teratoma was made and the patient underwent exploratory laparotomy wherein a large tubular tense cystic mass resembling fluid - filled intestinal loop filled with thick mucoid material was present in the presacral space [ figure 2 ] . the two ends of the tube were merging at the coccyx . the mass was displacing the sigmoid colon and rectum laterally and urinary bladder anteriorly . en masse removal was done . cect abdomen showing multiseptated pre sacral mass compressing the rectum and displacing bladder superiorly intraoperative picture showing a tubular fluid - filled structure displacing the bowel loops the patient had an uneventful postoperative recovery . the histopathological examination revealed it to be a retrorectal cystic hamartoma with areas of intestinal ( large and small ) and gastric epithelium . a solitary solid area within it had intestinal lining with area of squamous epithelial nests , haphazardly arranged muscle bundles , nerve bundles , and serous acini with few cystic spaces [ figure 3a c ] . histopathological image showing ( a ) gastric mucosa , ( b ) ectopic gastrointestinal gland and ( c ) ectopic pancreatic epithelium the retrorectal space is a potential space developed when a mass displaces the rectum anteriorly . the pelvic peritoneal reflection forms the superior border , and the levator ani and coccygeus muscles form the inferior border . the differential diagnosis of masses within this space is broad and includes primary tumors of neurogenic , osteogenic , and congenital origin ; in addition to metastatic and inflammatory processes . congenital lesions include chordomas , teratomas , anterior sacral meningoceles , and developmental cysts ( dermoid , epidermoid , enteric duplication , and tgcs ) . excluding inflammatory lesions , developmental cysts are the most common masses in the retrorectal space . . only one case of a retrorectal cystic hamartoma occurred in a 2-year - old child and very few cases have been reported in teen aged girls , as in our case . the differential diagnosis for a retrorectal mass can be narrowed using a combination of diagnostic tools to reach a preoperative diagnosis of a developmental cyst . due to their location , almost all retrorectal tumors will be palpable on rectal examination , and developmental cysts will manifest as extrinsic masses . ct and magnetic resonance imaging ( mri ) are useful imaging modalities that help in making a preoperative diagnosis . however , the definitive diagnosis and treatment is through complete surgical excision and pathological examination of the specimen . preoperative biopsy should not be attempted ( unless the mass is surgically unresectable at presentation ) due to risk of spreading dysplastic cells through weakened cyst walls . in addition , tissue obtained from biopsy is often not extensive enough to show all the histology features necessary for diagnosis . dermoid and epidermoid cysts are both lined with stratified squamous epithelium ; however , only dermoid cysts contain dermal appendages ( hair follicles , sweat glands , and tooth buds ) . epidermoid cysts are formed from inclusion of epidermal elements at the time of neural groove closure in the meninges . rectal duplication cysts are lined by typical gastrointestinal epithelium ( often with crypts , villi , and glands ) and are surrounded by two well - formed layers of smooth muscle with nerve plexuses . tgcs , or retrorectal cystic hamartomas , are predominantly multicystic and can contain a variety of epithelia between cysts or even within the same cyst . epithelial types include stratified squamous , transitional , mucinous or ciliated columnar , and cuboidal mucus secreting . in contrast to enteric duplication cysts , tgcs have disorganized smooth muscle fibers within the cyst wall and do not contain neural plexus . retrorectal hamartoma or tgc should be considered as a possible differential in any case of perirectal cyst , irrespective of age and gender .

the retrorectal space is an uncommon seat for neoplastic masses . retrorectal hamartoma or tailgut cyst ( tgc ) is an uncommon developmental cystic lesion occurring in this space which mostly occurs in middle - aged females . we recently cared for a 16-year - old girl who presented with vague lower abdominal pain and occasional constipation . per rectal examination revealed an extraluminal mass bulging from posterior rectal wall . preoperative radiological investigations revealed by suggested it to be a mature cystic teratoma . the patient underwent exploratory laprotomy with en masse excision of the cyst . histopathological examination of the specimen showed it to be a tgc . this case highlights the possibility of a tgc as a differential for retrorectal cystic lesions and the need to completely excise them given the possibility of future malignant transformation .

ewing sarcoma / primitive neuroectodermal tumor ( es / pnet ) , previously thought to be separate tumors , is now treated as the same tumor ; both have similar immunohistochemical characteristics and chromosomal translocation . they are malignant tumors composed of undifferentiated small round cells , usually affecting children , adolescents , and young adults . generally es / pnet affects the bones and deep soft tissues , although other organs such as the pancreas , small bowel , esophagus , kidneys , prostate , ovaries , vagina and rectovaginal septum have been reported ; this is termed as extraskeletal es / pnet . to the best of our knowledge , only 5 cases of gastric es / pnet have been reported in the english language literature . a 31-year - old healthy female patient was admitted to the surgical ward due to upper abdominal pain and coffee ground vomiting of 3 days duration . the patient had no other complaints and was hemodynamically stable . rectal examination revealed melena . a nasogastric tube was inserted and revealed coffee ground secretions . upper endoscopic examination revealed a large ulcerated mass located at the lesser curvature of the stomach , with oozing of blood . biopsy revealed tumor cells showing positive immunoreactivity for cd99 ( fig 1 ) , fli1 , vimentin , and ki67 , and negative immunoreactivity for cytokeratin , s100 , cd20 , cd3 , cd79a , pax5 , cd30 , cd43 , dog-1 , cd68 , cd163 , cd33 , mpox , and desmin . es / pnet was suspected and fluorescence in situ hybridization ( fish ) analysis was ordered , which was positive for the ewsr1 gene rearrangement ( 11 : 22 translocation ) . total body computed tomography ( ct ) showed a hypodense mass measuring 9 cm at the lesser curvature of the stomach , with compression on the splenic vein ( fig 2 ) . positron emission tomography - ct ( pet - ct ) revealed pathological uptake of fluorodeoxyglucose at the gastric mass and lymph nodes at the gastrohepatic ligament ( fig 3 ) . the patient refused neoadjuvant treatment , and thus surgery was performed . on exploration of the abdomen , the mass was adhering to the pancreatic tail and mesentery of the transverse and descending colon , along with abnormal pathological lymph nodes at the greater curvature . histopathological examination revealed the mass measuring 11 cm in diameter to be an es / pnet invading the gastric wall , pancreas , and splenic hilum , without involvement of the left adrenal . three years postoperatively , the patient is doing well , with no evidence of disease recurrence . es , a term used to describe tumors that lack neuroectodermal differentiation , and pnet , used to describe tumors that exhibit neuroectodermal features , are now treated as a single entity . tumor cells are rich in glycogen , and pseudorosette formation characterizes the tumor 's morphological differentiation . the diagnosis can be made by immunohistochemical staining for a monoclonal antibody to cd99 ( hba/71 , 12e7 , and 013 ) , which is positive in almost all cases of es / pnet [ 5 , 6 , 7 ] . another immunohistological reagent that can be used for diagnosis is the intermediate filament vimentin , which is usually positive . markers showing variable immunohistochemical staining include s100 , chromogranin a , synaptophysin , and neuron - specific enolase . for tumors occurring in older patients or at unusual sites , fish or reverse transcription polymerase chain reaction can be used for diagnosis [ 3 , 8 ] . these are used to test for the presence of genetic mutation ( 11 : 22)(q24:q12 ) translocation ( ews / fli1 fusion ) , which is an essential criterion for the diagnosis of es / pnet , although sometimes these tests are negative [ 9 , 10 ] . due to the poor results of surgery alone as a treatment modality for extraskeletal es / pnet , the current recommendation is multimodal treatment including surgery , chemotherapy , and radiotherapy . the chemotherapeutical agents used as standard therapy for es / pnet include vincristine , doxorubicin , cyclophosphamide , ifosfamide , and etoposide . of these 5 cases , 3 were females and 2 males , with an average age of 46.6 years ( range 1468 years ) and an average tumor size of 8.5 cm . most of these patients presented with abdominal pain , and 1 presented with an abdominal mass . two cases had hepatic metastasis , 1 had lymph node and peritoneal metastasis , 1 no metastasis , and 1 was not reported . only 2 patients ( of the 3 with metastasis ) herein , we describe the 6th case of es / pnet of the stomach . due to the patient 's refusal of chemotherapeutical treatment three years postoperatively , the patient is doing well , with no evidence of disease recurrence . primary gastric es / pnet is a very rare tumor , and few cases are reported in the literature . due to its rarity , written informed consent was obtained from the patient for publication of this case report and accompanying images ; it is available for consultation . they confirm that the manuscript has not been published elsewhere and is not under consideration by another journal .

ewing sarcoma / primitive neuroectodermal tumor ( es / pnet ) is a tumor of small round cells arising in skeletal tissues . these tumors rarely arise in the stomach . we present a 31-year - old healthy female patient who was admitted to our surgical ward due to upper gastrointestinal hemorrhage . upper endoscopy revealed a large ulcerated bleeding mass originating from the lesser curvature . biopsy revealed tumor cell immunoreactivity positive for cd99 , vimentin , and ki67 ( an index of proliferation ) . these findings were compatible with gastric es / pnet . the fluorescence in situ hybridization analysis result for the ewsr1 gene rearrangement ( 11 : 22 translocation ) was positive . the patient refused neoadjuvant treatment and thus underwent an operation during which a mass at the lesser curvature of the stomach was found . the mass was adhering to the pancreatic tail and to the mesentery of the transverse and descending colon . total gastrectomy , distal pancreatectomy , splenectomy , and left adrenalectomy were done . the patient refused adjuvant treatment . she is free of disease 3 years after surgery .

hemophilia a is a congenital disease transmitted by the x chromosome with a recessive trait , characterized by a deficiency in the production of factor viii . the hemophilic pseudotumor affects 12% of patients with a severe disease , frequently associated with a traumatic injury . the hemophilic pseudotumor develops from repeated episodes of bleeding , either from fracture sites or bleeding or subperiosteal hemorrhage of any soft tissue . the interior of the pseudotumor consists of blood products at different stages of development , surrounded by a fibrous capsule containing hemosiderin - laden macrophages . it appears as a painless tumor of slow growth that can compress key organs causing bone destruction , muscle and skin necrosis . the objective of case presentation is to describe a patient with a hemophilic pseudotumor of the abdomen , and to review the literature on hemophilic pseudotumor . this is a case of a 31 year old male , diagnosed with severe hemophilia a at 2 years of age , treated with factor vii 2000 iu weekly since , whit a family history of 2 cousins with hemophilia ( no other specified ) . in september 2011 , he underwent drainage of a hematoma of the left pelvic limb . in october 2011 blood transfusion on multiple occasions . in august 2012 had a hematoma in the left thigh surgically removed . in september 2012 presented upper gastrointestinal bleeding requiring hospitalization with remission of the symptoms . an abdominal tumor diagnosed 10 years ago during routine screening that progressively grew to encompass the entire abdominal area , with no associated symptoms . during his last hospital admission , hematology referred him to general surgery due to bowel obstruction symptoms , and to evaluate surgical treatment of a pelvic tumor referred as a possible teratoma . a ct scan of the abdomen ( figs . 1 and 2 ) was performed , showing a tumor in the pelvis with clear borders , 241 mm 192 mm of diameter , from the pelvis and projected into the bladder , rectum and adjacent structures , including the kidneys . the lesion had irregular wall thickness , with a density of 195 houndsfield units in its interior , with heterogeneous enhancement and vascularity present within ; with tomographic diagnosis of abdominal pelvic teratoma . the patient underwent surgery with surgical findings that included a cyst - like tumor of 40 cm 30 cm displacing loops of small bowel , colon and bladder , with adhesions to the great omentum , small intestine , descending colon and bladder . macroscopically appeared as an old , organized , and calcified clots with a volume of 5000 ml . an abdominal tumor diagnosed 10 years ago during routine screening that progressively grew to encompass the entire abdominal area , with no associated symptoms . during his last hospital admission , hematology referred him to general surgery due to bowel obstruction symptoms , and to evaluate surgical treatment of a pelvic tumor referred as a possible teratoma . a ct scan of the abdomen ( figs . 1 and 2 ) was performed , showing a tumor in the pelvis with clear borders , 241 mm 192 mm of diameter , from the pelvis and projected into the bladder , rectum and adjacent structures , including the kidneys . the lesion had irregular wall thickness , with a density of 195 houndsfield units in its interior , with heterogeneous enhancement and vascularity present within ; with tomographic diagnosis of abdominal pelvic teratoma . the patient underwent surgery with surgical findings that included a cyst - like tumor of 40 cm 30 cm displacing loops of small bowel , colon and bladder , with adhesions to the great omentum , small intestine , descending colon and bladder . macroscopically appeared as an old , organized , and calcified clots with a volume of 5000 ml . the hemophilic pseudotumor of the abdomen is a rare but often disabling condition , potentially fatal in patients with severe hemophilia . diagnosing a hemophilic pseudotumor with invasive techniques such as , aspiration and biopsy imaging techniques of which mri is preferred , allows recognition of blood products in various stages of evolution . ultrasonography ( usg ) shows a central anechoic region with increased echoes behind the lesion due to enclosed fluid in the pseudotumor . computed tomography ( ct ) identifies the thick pseudocapsule , but can not differentiate a hematoma from a chronic abscess . ct is particularly helpful in the evaluation of bone , whereas mri is superior to ct for delineating soft tissue . at the moment , however , there are instances where surgical extraction of the lesion is not feasible . in such situations , the decision to operate on this patient was made based on the gradual increase in the tumor size , the symptoms that the displayed by the patient . in this patient this type of procedure is associated with complications such as bleeding , bowel perforation , and damage to nearby structures due to firm vascular , and nervous adhesions . surgical resection after performing arterial embolization to reduce the vascularization of the pseudotumor is a good alternative , thereby reducing the size of the pseudotumor and the risk of bleeding complications during surgery , at best about 2 weeks prior to surgery . it is a rare pathological entity , but it must be considered in the hemophilic patient with a long - standing abdominal tumor and trauma history , to plan appropriate treatment . the abdominal hemophilic pseudotumor is a rare pathological entity , with few reports worldwide , but must be considered in hemophilic patients with a well documented abdominal tumor , as a complication of the hematologic disease . signs and symptoms of compression should be evaluated by ct or mri because its early diagnosis is crucial for evaluation and proper surgical planning , and treatment in conjunction with other specialties . written informed consent was obtained from the patient for publication of this case report and case series and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request . the study conception and design , as well as writing the manuscript works were all equally distributed among all the authors.key learning pointshemophilic pseudotumor etiology.hemophilic pseudotumor management .

introductionhemophilic pseudotumor is a rare complication that occurs in patients with severe hemophilia . results from multiple episodes of bleeding into the bones and soft tissues.presentation of casea 31 years old male patient , with severe hemophilia a. diagnosed with an abdominal tumor 10 years ago during routine screening , that progressively grew to encompass the entire abdominal area , with symptoms of intestinal obstruction.discussionhemophilic pseudotumor appears as a painless tumor of slow growth that can compress vital organs producing bone destruction , muscle and skin necrosis . the tumor may have fistulas or break spontaneously.conclusionthe abdominal hemophilic pseudotumor is a rare pathological entity , with few reports worldwide , but must be considered in hemophilic patients with a well documented abdominal tumor .

a 62-year - old man ( height , 158 cm ; weight , 63 kg ; blood type , a ) with a history of smoking ( 35 pack - years ) was registered for lung transplantation with a diagnosis of idiopathic pulmonary fibrosis . the patient s status was new york heart association functional class iii , and the patient had lost 5 kg over a 6-month period . room air arterial blood gas analysis showed an oxygen partial pressure of 59.1 mm hg , partial pressure of co2 was 39.2 mm hg , and oxygen saturation was 89.4% . a pulmonary function test revealed a forced vital capacity of 1.60 l ( 47% of predicted ) and a forced expiratory volume in 1 second of 1.52 l ( 61% of predicted ) . computed tomography revealed subpleural and peribronchovascular reticulation with macrocystic honeycombing in both lungs ( fig . 1 ) . coronary angiography revealed total occlusion at the mid - right coronary artery , and left ventricular ejection fraction of 61% ( fig . 2 ) . therefore , we concluded that the patient needed bilateral lung transplantation and also required coronary artery bypass surgery . two months after being listed for a lung transplant , a suitable donor lung was matched . the donor was a 49-year - old man ( height , 170 cm ; weight , 52.1 kg ; blood type , a ) who had an intracranial hemorrhage . the total lung capacity of the recipient was 4.755 l , while that of the donor was 6.078 l , which was a donor - to - recipient size match of 127.8% . prior to the lung transplant , the patient s vital signs were stable ( heart rate of 98 beats per minute and arterial blood pressure of 115/75 mm hg ) . after the induction of general anesthesia , a pulmonary arterial catheter was placed via the left internal jugular vein , and the pulmonary arterial pressures were initially 4050/2030 mm hg . the operation was performed as follows : under general anesthesia , a clamshell incision was made and the hila were prepared for lung transplantation . at the same time , the left greater saphenous vein was harvested for coronary artery bypass . following a minimal dissection in both hila , the saphenous vein was anastomosed to the ascending aorta using a heartstring device ( heartstring proximal seal system , guidant , in , usa ) , and the right coronary artery was bypassed to the right posterior descending artery via the off - pump technique using a tissue stabilizer . a venous cannula was placed in the right femoral vein and an arterial cannula was placed into the right femoral artery . each side started with bronchial anastomosis , followed by pulmonary venous anastomosis with a side - biting clamp on the pulmonary veins , and ended with pulmonary artery anastomosis . ecmo was discontinued and decannulated before the patient was transferred from the operating room to the intensive care unit . the total ecmo time was 320 minutes , total operation time was 461 minutes , and total anesthesia time was 565 minutes . on postoperative day ( pod ) 3 , heart rate ranged from 85 to 90 beats per minute , arterial blood pressure ranged from 110 to 120 mm hg/70 to 80 mm hg , and pulmonary arterial pressure ranged from 35 to 37 mm hg/15 to 17 mm hg . the patient required a tracheostomy for recovery due to respiratory failure after tracheal extubation on pod 8 . the patient was transferred to the general ward on pod 16 , the tracheostomy tube was removed on pod 30 , and discharged on pod 37 in good condition . the presence of comorbidities in patients has previously been considered to be a relative contraindication for lung transplantation . in particular , the first lung transplantation was performed at severance hospital in july 1996 , and since then , the number of lung transplantations has increased . at the same time , the inclusion criteria for lung transplantation have been expanded to include patients with higher surgical risk . whether patients with significant coronary artery disease are suitable candidates for lung transplantation is unclear . some reports have described the long - term survival outcomes following lung transplantation in cases with revascularized coronary arteries . one report demonstrated that the long - term survival following lung transplantation in patients with significant coronary artery disease was influenced by whether they received coronary revascularization prior to lung transplantation . however , some studies have reported successful results in the management of patients who simultaneously received coronary artery revascularization and lung transplantation . patel et al . reported successful simultaneous coronary artery bypass and lung transplantation in a small number of carefully selected patients . however , patients with multivessel disease or left ventricular dysfunction were not considered suitable candidates for lung transplantation . in this case , combined bilateral lung transplantation and coronary artery bypass grafting was performed in a patient who had a single vessel disease with normal left ventricular function . in terms of surgical technique and devices , the off - pump technique was possible for the coronary bypass grafting through a clamshell incision . using a saphenous vein graft might have enabled coronary artery grafting to be performed without much difficulty through the usual clamshell incision . in korea at present , almost 50% of coronary graft bypass surgeries are performed via off - pump technique . our previous study indicated that off - pump coronary artery bypass surgeries improved myocardial functioning and favored early and mid - term outcomes in the high - risk group . both single and bilateral lung transplantation procedure selection should be carefully considering the following factors : recipient , donor , and transplant center . although single lung transplantation reduced waitlist time and mortality , the long - term outcomes of bilateral lung transplantation were slightly superior . the benefits of bilateral lung transplantation include better lung compliance , imp roved lung volume , and a voidance of native lung disorders . for these reasons , we performed a bilateral lung transplantation . our center has used both ecmo and conventional cardiopulmonary bypass in the lung transplantation procedure . however , ecmo has been considered the method of choice since 2013 because of its advantages , such as less coagulopathy , less systemic inflammatory response , short postoperative recovery time , and less pulmonary and renal complications . with off - pump coronary artery bypass graft surgery , we could use ecmo for cardiopulmonary support instead of conventional cardiopulmonary bypass . to the best of our knowledge , this case was the first successful bilateral lung transplantation combined with off - pump coronary artery bypass graft surgery in korea , and we reported a satisfactory outcome following surgery .

coronary artery disease has historically been a contraindication to lung transplantation . we report a successful combined bilateral lung transplantation and off - pump coronary artery bypass in a 62-year - old man . the patient had a progressive decline in lung function due to idiopathic pulmonary fibrosis and a history of severe occlusive coronary artery disease .

x - linked dominant chondrodysplasia punctata ( cdpx2 , omim 302960 ) is an inheritable systemic disease and is characterized by skeletal , ophthalmologic , and cutaneous manifestations . in the late seventies , rudolph happle reported a female and brilliantly recognized a group of published patients with chondrodysplasia punctata whose mosaic phenotype and sex rate corresponded with an x - linked dominant pattern of inheritance . in 1999 , the gene emopamil binding protein ( ebp ) was identified and associated with cdpx2 , so called conradi - hnermann - happle syndrome . the ebp gene is located on the short arm of the x chromosome ( xp11.22-p11.23 ) and spans 7 kb of genomic dna , containing five exons coding a mature transcript of 1 kb which is ubiquitously expressed . this protein consists of 230 amino acids and four transmembrane domains , it has a molecular weight of 27 kda and it is implicated in cholesterol biosynthesis . cutaneous lesions in cdpx2 usually start as erythematous scaly plaques following the lines of blaschko that fade over time , and some patients may be born with congenital erythroderma . while cdpx2 may exhibit variable phenotypes , psoriasiform skin lesions are exceptional and histopathologic investigations of psoriasiform skin lesions show epidermal hyperproliferation in addition to ichthyotic retention hyperkeratosis . in this report , a case of a 12-year - old girl diagnosed with x - linked dominant chondrodysplasia punctata with a psoriasiform phenotype is reported with genetical confirmation . we discuss here a rare clinical presentation which helps in better depict this rare genodermatosis and on the lack of correlation between phenotype and genotype in this disease . a 12-year - old girl , who had been born with congenital erythroderma , had a 4-month history of linear and whorled inflammatory cutaneous lesions on her trunk , leg , and arms . extensively distributed thickly adherent scaling had been developed at the age of one , and continued since then . the patient had been born at term following a normal pregnancy and delivery and family history was unremarkable . she displayed growth retardation , bilateral conductive hearing , and unilateral congenital cataract in her right eye . she exhibited short stature with asymmetric shortening of her limbs , being her right arm shorter than her left . dysmorphic facial features with frontal bossing , flat nasal bridge , and a depressed tip of the nose were observed . dermatological examination revealed brown streaky hyperkeratotic plaques with thickly adherent scaling located along blaschko 's lines . also , erythematous scaling and guttate lesions were observed on her trunk , arms , and legs . there were patchy areas of scarring alopecia on frontal and temporal regions of the scalp and lateral regions of eyebrows . dorsal and lumbosacral magnetic resonance imaging showed scoliosis deformity , height losses of the t8 vertebrae left half and l3 , l4 vertebral the right halves ( tethered cord ) . clinical features of the patient with conradi hnermann happle syndrome ( x - linked dominant chondrodysplasia punctata ) genomic dna of the patient was extracted from peripheral blood leukocytes via a conventional phenol - chloroform method . exons 1 - 5 and the intronic splicing regions from the ebp gene were amplified by polymerase chain reaction ( pcr ) as previously described . the reaction was conducted in a 2720 thermal cycler ( applied biosystems , foster city , ca , u.s.a . ) . automatic sequencing was performed with the abi prism 310 genetic analyzer ( applied biosystems ) . we identified a previously reported ebp mutation , c. 440 g > a ( p.r147h ) in the patient , but not in her parents [ figure 2 ] . according to the clinical and laboratory findings , the diagnosis of conradi - hnermann - happle syndrome was established . a skin biopsy of one of the guttate , erythematous , and scaling plaques revealed retention hyperkeratosis , parakeratosis , acanthosis with regular elongation of rete ridges , capillary proliferation , and mononuclear cell infiltration in papillary dermis , being this consistent with a psoriasiform pattern . the pedigree and dna sequencing showed a heterozygous mutation c. 440 g > a resulting in p.r147h in ebp gene in conradi - hnermann - happle syndrome , cutaneous findings are remarkable and characterized by hyperkeratotic lesions on an erythematous background following the blaschko 's lines . bruch et al . described a unique adult patient presenting both with ichthyotic and pustular psoriasiform lesions together . later , in a large spanish series , a patient with ichthyosis in a psoriasiform pattern was reported with the genetic analysis showed c. 187c > t ( p.arg63x ) de novo mutation . we here present an exceptional case of cdpx2 with psoriasiform and ichthyotic skin lesions together in an adolescent , the first case from tunisia . histopathological features of guttate , erythematous , and scaling plaques followed a psoriasiform pattern . in 1999 , the gene ebp was identified and associated with the conradi - hnermann - happle syndrome ( xp11.22-p11.23 ) . to date , about 70 different mutations in the ebp gene have been described related with this disease . we found a c.(440 g > a ) missense de novo mutation in the ebp gene ( p.arg147his ) , placed in the second endoplasmic reticulum domain ( er2 ) of the protein . the unique case of cdpx2 with a similar phenotype to ours displayed a c.(187c > t ) , p.arg63x nonsense mutation , which had also been described in two patients with typical skin phenotype of cdpx2 . the c. 440 g seems to be a nucleotide with particularly high mutational susceptibility within the ebp gene , a hot spot . on the other hand , the clinical phenotype associated with this mutation has been variable , which subscribes the lack of correlation between genotype and phenotype in this disease . although the relationship between the various genotypes and phenotypes in conradi - hnermann - happle syndrome has not been fully elucidated , detailed clinical and molecular analyses are helpful for providing data to be used in genetic counseling . our case expands the clinical phenotypic variation in cdpx2 and further demonstrates the lack of correlation between genotype and phenotype in this disease . unique additional clinical manifestations like plaque - type psoriasis may present with different mutations . conradi - hunermann - happle may represent extensive plaque - type psoriasis in adolescent patients .

conradi - hnermann - happle syndrome ( cdpx2 , omim 302960 ) is an inherited x - linked dominant variant of chondrodysplasia punctata which primarily affects the skin , bones , and eyes . cdpx2 patients display skin defects , including ichthyotic lesions , follicular atrophoderma , cicatricial alopecia , and less frequently ichthyosiform erythroderma , cataracts , and skeletal abnormalities consisting of short stature , asymmetric shortening of the limbs , epiphyseal stippling , and craniofacial defects . cdpx2 results from mutations in emopamil binding protein ( ebp ) gene . the aim of our study is to identify ebp mutation in a unique case of conradi - hnermann - happle syndrome with rare psoriasiform lesions .

although in most cases ( 8090% ) the ingested foreign body will pass uneventfully through the gastrointestinal tract , sharp foreign bodies such as toothpicks are associated with an increased risk of gastrointestinal perforation and bleeding . the most common causes of the accidental ingestion of toothpicks include alcoholism , rapid food intake and decreased palatal sensitivity . although the complications caused by swallowed toothpicks are more likely to be detected and resolved by surgical procedure in selected cases when it is possible to locate the position of the toothpick , endoscopic removal can result in the rapid relief of symptoms [ 3 , 4 ] . a 57-year - old caucasian woman with no previous medical history was admitted to the department of internal medicine , division of gastroenterology , clinical hospital split . she complained of fever and abdominal pain located in right upper quadrant for one week . vital signs were as follows : blood pressure 120/80 mm hg , pulse rate 100 bpm and core body temperature 39.0c . laboratory evaluation revealed a wbc count of 12.5 10/l with a left shift and c - reactive protein concentration of 123.6 mg / l while urinalysis as well as other relevant laboratory data were within reference values . abdominal ultrasound examination was performed because of a clinical presentation mimicking acute cholecystitis , but it was within normal ranges . however , contrast - enhanced computed tomography ( ct ) scan with three - phase protocol showed an unclearly outlined lesion within the liver parenchyma with a longer diameter of 2.1 cm and which could not be clearly separated from eccentric radiopaque thickening of the stomach antrum in an extension of more than 4 cm ( fig . 1 , fig . this finding indicated gastroscopy , which revealed a sharp wooden foreign body protruding from the antrum mucosa and the whole wooden foreign body ( toothpick ) was successfully removed by snare extraction without complications . after the extraction of the foreign body the patient remembered that two weeks earlier when consuming lamb she might possibly have swallowed a toothpick . the patient was also treated with a proton pump inhibitor ( pantoprasole ) , the intravenous administration of crystalloids and ceftriaxone for seven days . impaction , perforation and obstruction most often occur in areas of acute angulation or physiologic narrowing . it is difficult to estimate the incidence of accidental ingestion of toothpicks , mostly because the literature covering this issue is anecdotal . in contrast to this , it is well known that toothpick lesions to the gastrointestinal tract are often associated with significant morbidity and mortality [ 2 , 3 , 4 ] . clinical presentation of toothpick gastrointestinal injury includes generalized or local peritonitis , intestinal obstruction or gastrointestinal hemorrhage . in some cases toothpicks migrated outside the gastrointestinal tract and were found in the pleura , pericardium , ureter or bladder [ 2 , 5 , 6 , 7 ] . ingested toothpicks in the esophagus and small intestines are presented by dysphagia or intestinal colic while foreign objects remaining in the stomach are often asymptomatic . early diagnosis and retrieval of the toothpick is critical for reducing morbidity and mortality [ 3 , 8 , 9 ] . therefore , we think that a patient presenting with gram - positive bacteremia and no sign of free perforation of the gastrointestinal tract is very illustrative because this demonstrates the necessity of thinking of foreign body ingestion as a cause of obscure bacteremias . we would like to emphasize how important it is to make a very careful anamnesis in order to determine swallowed foreign objects , such as a toothpick , as a rare cause of bacteremia . moreover , there are no relevant physical or laboratory findings characteristic for a swallowed toothpick . ct images are useful in acquiring missing clinical information such as toothpick location . in cases without free perforation ,

although most ingested foreign bodies usually pass through the gastrointestinal tract asymptomatically , toothpick injury to the gastrointestinal tract is often associated with significant morbidity and mortality . toothpick perforation of the gastrointestinal tract is frequently reported but , to the best of our knowledge , bacteremia caused by an impacted toothpick within the gastric mucosa has not yet been described . here , we report the case of bacteremia caused by an accidentally swallowed toothpick . the toothpick was impacted deeply in the gastric mucosa and was first seen and localized on contrast - enhanced computed tomography ( ct ) . ct scan is a very useful imaging technique in such situations since we lack typical and relevant physical findings or laboratory studies that go with accidentally swallowed objects , in this case a toothpick . flexible endoscopy was successful in extracting the whole toothpick . in cases without free perforation , flexible endoscopy is the treatment of choice in toothpick removal from the upper gastrointestinal tract .

the q - switched nd : yag laser may cause photodisruption at the injury site , which occasionally results in a macular hole . described 5 eyes of 4 patients with macular holes caused by accidental q - switched nd : yag laser injury . in 1 of these eyes , the macular hole resolved spontaneously . long - term delayed surgery or observation in these cases may result in a poor or limited outcome [ 1 , 7 ] . vitrectomy with gas tamponade has been shown to improve the visual acuity in patients with q - switched nd : yag laser - induced macular holes [ 2 , 5 , 6 ] . we report a case of a macular hole caused by accidental exposure to an nd : yag q - switched laser . we used the following parameters : a fixation target consisting of a single cross , 2 in diameter ; a white , monochromatic background at 4 asb ( apostilb ) , a stimulus size goldman iii , with projection time of 200 ms ; a customized radial grid of 33 stimuli covering 20 ( centered onto the fovea ) . a 4 - 2 - 1 double staircase strategy was used with an automatic eye tracker that compensates for eye movements . the institutional review board approved the retrospective chart review study . a 31-year - old electronics technician who had undergone bilateral laser - assisted in situ keratomileusis surgery 7 years before accidentally sustained a laser injury to his left eye while repairing and aligning a 1,064-nm nd : yag laser . the q - switched laser pulse energy was approximately 10 mj and the pulse duration was 5 - 20 ns . after a single shot of the laser , he immediately noticed a small central blind spot and floaters in his left eye . at the time of examination within 24 h after injury , his best corrected visual acuity ( bcva ) was 20/20 in the right eye and 20/200 in the left eye . the examination of the left fundus revealed a marked white juxtafoveal burn with a small retinal hemorrhage and vitreous hemorrhage ( fig . 1a ) . the optical coherence tomography ( oct ) ( stratus oct 3 ; carl zeiss , dublin , calif . , usa ) examination revealed increased thickness in the foveal area and acoustic shadows caused by the vitreous hemorrhage ( fig . fundus examination revealed a macular hole with pigment clumping at its base and elevated edges ( fig . in addition , the oct demonstrated a full - thickness macular hole of approximately 820 m in diameter with cystoid changes adjacent to the hole ( fig . the mp1-microperimeter demonstrated a retinal sensitivity of 0 db over the macular hole and decreased retinal sensitivity in the adjacent area ( fig . the fixation was relatively unstable with 51 and 97% of the preferred fixation points located within a 2- and 4-circle area centered in the fovea , respectively . the fixation target of a single cross was positioned at the preferred fixation point as the foveal center because the center of the foveal avascular zone could not be determined due to the large macular hole . the central fixation location was poor and 46% of the preferred fixation points were located within the 2-circle area centered in the fovea . surgical intervention was advised because of the unlikely possibility of the spontaneous closure of such a large macular hole . we injected 0.1 ml of indocyanine green ( icg ) at a concentration of 2.5 mg / ml in the temporal macular region without direct staining of the hole . a bent 25-gauge needle was used to create a small temporal incision 2 disc diameters ( dd ) away from the fovea . the internal limiting membrane ( ilm ) was then peeled in the area around the macula ( 2 dd ) , and the eye was filled with a 16% c3f8 mixture . the oct showed a marked thinning of the foveal depression and high reflectivity in the subfoveal area with an acoustic shadow ( fig . his bcva improved to 20/30 in 3 months and to 20/20 in 12 months postoperatively . the mp1-microperimetry 12 months after surgery demonstrated increased retinal sensitivity in the area of the previous macular hole and its adjacent region ( fig . the fixation of the preferred fixation points located within a 2- and 4-circle area centered in the fovea was stable ( 98 and 100% , respectively ) . the fixation location was predominantly eccentric and 0% of the preferred fixation points were located within the 2-circle area centered in the fovea . the postoperative preferred fixation position was located at the base of the previous macular hole and was different from the preoperative position ( fig . surgical intervention was advised in our case because of the unlikely possibility of spontaneous closure due to the size of the macular hole ( approximately 820 m in diameter ) ( fig . yet , an anatomic closure of a macular hole as big in size as noted in our case can be achieved after vitrectomy and peeling of the ilm . however , a marked thinning of the foveal depression was noted after surgery ( fig . 1f ) . the location and severity of the damage of the central fovea tissue may limit the potential improvement in the visual outcome after surgery . in our case , the preoperative visual acuity was 20/60 , which may explain the good improvement of visual acuity of 20/20 after 24 months of postoperative follow - up . the amsler grid examination has been used to evaluate the extension of central scotoma and metamorphopsia caused by a laser - induced macular hole [ 8 , 9 ] . the mp1-microperimeter is a fundus perimeter , which allows for a completely automatic determination of retinal sensitivity and fixation and correlates exactly to the characteristics of the fundus . in this study , mp1-microperimeter after 12 months of postoperative follow - up showed that the retinal sensitivity was increased in the region of the previous macular hole and its adjacent area . the fixation location changed from a poor central fixation to a predominantly eccentric fixation , which may partially be due to the poor preoperative determination of the foveal center and the fixation target positioned at the preferred fixation point as the foveal center preoperatively . however , the postoperative preferred fixation position was different from the preoperative position and was located at the base of the previous macular hole . our results suggest that vitrectomy can improve the visual function when a macular hole is caused by nd : yag laser injury . the improvement in the visual function includes not only visual acuity but also retinal sensitivity and fixation stability that are obtained by using mp1-microperimeter .

a 31-year - old man sustained a 1,064-nm q - switched nd : yag laser injury to his left eye . one month after the injury , the fundus and optical coherence tomography ( oct ) examination demonstrated a full - thickness macular hole of approximately 820 m in diameter . after vitrectomy and internal limiting membrane peeling , oct showed closure of the hole and a marked thinning of the foveal depression . after 12 months of follow - up , his visual acuity improved from 20/60 to 20/20 . the mp1-microperimeter demonstrated increased retinal sensitivity in the area of the previous macular hole and its adjacent region and improvement of fixation from a relatively unstable status to a stable status . the macular hole remained closed 24 months postoperatively with the best corrected visual acuity 20/20 . our results suggest that vitrectomy can improve the visual function when a macular hole is caused by nd : yag laser injury . the improvement in the visual function includes not only visual acuity but also retinal sensitivity and fixation stability that are obtained by using the mp1-microperimeter .

ectopic gastric mucosa and polyps related to brunner 's gland hyperplasia are the most common polyps . serrated polyps are characterized by infolding of the crypt epithelium , resulting in a saw - tooth appearance . a polyp with serrated morphological features has been classified histologically as hyperplastic polyp in the past . until the late 1990s , colorectal polyps were generally divided into two major subtypes : hyperplastic polyps and adenomatous polyps . in 1990 , serrated came from the observation of the saw tooth - shaped infoldings of the surface and crypt epithelium of these polyps that was similar to that of hyperplastic polyps . serrated polyps are now classified into 3 distinct types by histologic and genetic characteristics : hyperplastic polyp , sessile serrated adenoma , and transitional serrated adenoma ( tsa ) . a serrated adenoma is a precursor lesion for colorectal carcinoma ( crc ) . the serrated neoplasia pathway has been associated with carcinogenesis of serrated adenoma , which is different from the traditional adenoma - carcinoma sequence [ 5 , 6 ] . serrated polyps are commonly found in the colorectum but have rarely been described in other parts of the gastrointestinal tract . because of the rarity of identifying such a lesion in the small bowel , the natural history , prognosis , and appropriate management recommendations are unclear . serrated adenomas in the small intestine may represent more aggressive lesions with high malignant potential than those in the colon and rectum , according to some reports . we should consider the existence of serrated adenoma of the duodenum and its higher virulence . we report a case of a slow - growing early adenocarcinoma arising from a traditional serrated adenoma of the duodenum , which was diagnosed and treated by an endoscopic mucosal resection . a 66-year - old man with no significant medical history underwent esophagogastroduodenoscopy ( egd ) for general examination ( fig . 1 ) . he had a 1-cm sized , yamada type iv polyp in the second portion of the duodenum . it was an elevated mucosal lesion with focal white patch and was located at the proximal site of the major papilla . the follow - up egd was done after 2 years ( fig . 2 ) . we recommended the patient to resect the polyp ; however , he preferred regular follow - up examination every year . there was no change in the shape , size , and pathologic finding of the polyp for two consecutive years . he underwent another egd for general medical check - up 3 years later ( 5 years after the first detection ) ( fig . the size of the polyp was slightly increased , but the shape of the polyp was not changed . the lesion was raised by means of a submucosal injection of hypertonic saline tinted with indigo carmine and resected by using a snare . the pathologic result revealed a 0.8 0.5-cm sized , well differentiated tubular adenocarcinoma ( fig . 5 ) . carcinomas are multifocally spread on the traditional serrated adenoma , and the proportion of adenocarcinoma component is approximately 50% . abdominal pelvic computed tomography and positron emission tomography showed no other solid organ involvement or metastasis . he is now in good health and we will perform surveillance follow - up egd after 1 year . benign serrated polyps are commonly found in the colorectum but have rarely been described in other parts of the gastrointestinal tract . histology disclosed an adenomatous growth with unlocked saw tooth - like glands with high - grade dysplasia . tsas were found in the esophagus , the stomach , the duodenum , the pancreas , and the gallbladder . increased awareness of the existence of serrated neoplasms in the upper digestive tract rubio 's review indicated that 53.4% ( n = 39 ) of the 73 tsas of the upper digestive tract showed a simultaneously growing invasive carcinoma . following that original publication [ 13 , 14 , 15 ] , 35 additional cases of tsa of the duodenum appeared in the literature ; 28.6% ( n = 10 ) of the 35 cases showed invasive growth . of 73 cases of tsa of the upper digestive tract reported in the literature so far , 53.4% ( n = 39 ) had invasive carcinoma . although the causes for this aggressive behavior remains elusive , it would appear that not only the degree of cellular severity , but also the histological configuration ( i.e. , with unlocked serrations ) might have played a particular role in their virulence . in rosty et al 's study , high - grade dysplasia was present in six of the serrated adenomas ( 46% ) . one case was an adenocarcinoma resembling a serrated adenocarcinoma of the colorectum , with an adjacent serrated adenoma . this high frequency of high - grade dysplasia suggests that these adenomas may represent aggressive lesions with high malignant potential . serrated adenomas in the small intestine may represent a distinct morphological subtype of adenoma with a biological significance that is different from those in the colon and rectum . in the current case , it is consistent with other reports that serrated adenoma in the small bowel is more virulent than those in the colon . tsas of the duodenum should be radically excised , either endoscopically or surgically to rule out the possibility of a synchronously growing invasive adenocarcinoma or to prevent cancer progression . in conclusion , this present case distinctively showed a slow growth but had adenocarcinoma arising from serrated adenoma of the duodenum . we should consider the existence of serrated adenoma of the duodenum and excise it radically owing to its high virulence .

serrated polyps are classified into 3 distinct types : hyperplastic polyp , sessile serrated adenoma , or transitional serrated adenoma . a serrated adenoma is a precursor lesion for colorectal carcinoma . serrated polyps are commonly found in the colorectum but have rarely been described in other parts of the gastrointestinal tract . serrated adenomas in the small intestine may represent aggressive lesions with high malignant potential , according to some reports . a 66-year - old man with no significant medical history underwent esophagogastroduodenoscopy ( egd ) for general examination . he had a 1-cm sized , yamada type iv polyp , with focal white patch in the second portion of the duodenum . the biopsy result revealed gastric metaplasia and chronic inflammation . he wanted regular follow -up examinations . the follow - up egds were done every year . there were no changes in the shape and size of the polyp . the pathologic findings were unchanged . then , he underwent egd for general medical check - up again 5 years after the first detection . the size of the polyp was slightly increased . the biopsy result revealed serrated polyp , unclassified . endoscopic mucosal resection was done . the pathologic result revealed a 0.8 0.5-cm sized , well differentiated tubular adenocarcinoma . carcinomas are multifocally spread on the traditional serrated adenoma , and the proportion of the adenocarcinoma component is approximately 50% . the tumor had invaded the lamina propria but confined to the mucosa . the resection margins were negative , and no lymphovascular invasion or perineural invasion was seen . abdominal pelvic computed tomography and positron emission tomography showed no other solid organ involvement or metastasis . surveillance follow - up egds were done after 3 months and 1 year . there was no evidence of recurrence .

a 32-year - old healthy caucasian lady presented complaining of recent deterioration of vision in her left eye . at presentation , her best corrected visual acuity ( bcva ) was 20/20 in her right eye and counting fingers in her left eye ( le ) . fundus examination and fluorescein angiography revealed findings consistent with arteriovenous communications of the retina or racemose hemangioma , in the posterior pole of the le with the presence of macular ischemia . complete and systemic examination was unremarkable , excluding the possibility of wyburn - mason syndrome . eight years after presentation , findings and bcva in the le have remained stable , with no extension of the retinal ischemia or development of neovascularization . although extensive retinal ischemia has been reported to result in complications such as retinal or iris neovascularization , in our case the macular ischemia has not expanded further over a period of 8 years . however , due to this macular ischemia the patient unfortunately lost her central vision . racemose hemangioma is rare . the development of extensive retinal ischemia including macular ischemia resulting in rubeosis has been reported . we describe a case of racemose hemangioma which spontaneously developed macular ischemia alone , resulting in poor visual acuity . this finding has remained stable over a follow - up period of 8 years with no further complication . a 32-year - old healthy caucasian lady presented complaining of recent deterioration of vision in her left eye ( le ) . at presentation , her best corrected visual acuity ( bcva ) was 20/20 in her right eye and counting fingers in her le . the anterior segment and intraocular pressures were normal in both eyes . fundus examination and fluorescein angiography revealed findings consistent with arteriovenous communications of the retina or racemose hemangioma , in the posterior pole of the le with the presence of macular ischemia ( figures 1 and 2 ) . complete and systemic examination including mri scan was unremarkable , excluding the possibility of wyburn - mason syndrome with arteriovenous malformations of the optic nerve and midbrain . eight years after initial presentation , findings and bcva in the le have remained stable , with no extension of the retinal ischemia or development of neovascularization . the lesions have been reported either to remain static or regress12 or to enlarge gradually . vision may be affected directly due to macular involvement or by producing hemorrhage or exudation.3,4 based on archer et al the angioma in our case was grade 3 , although there were no systemic findings.5 we present a case of racemose hemangioma which spontaneously developed macular ischemia . although extensive retinal ischemia has been reported to result in complications such as retinal or iris neovascularization,1 in our case the macular ischemia has not expanded further over a period of 8 years . however , due to this macular ischemia the patient unfortunately lost her central vision . it has been postulated that either an enlarged malformation using part of the blood supply of the retina may cause ischemia , or there was a partial thrombosis which caused circulatory stasis within the lesion.6,7

purposeto report a rare case of racemose hemangioma which developed spontaneous macular ischemia.methodsa 32-year - old healthy caucasian lady presented complaining of recent deterioration of vision in her left eye . at presentation , her best corrected visual acuity ( bcva ) was 20/20 in her right eye and counting fingers in her left eye ( le ) . fundus examination and fluorescein angiography were performed . the patient had regular follow - up appointments over a period of 8 years.resultsfundus examination and fluorescein angiography revealed findings consistent with arteriovenous communications of the retina or racemose hemangioma , in the posterior pole of the le with the presence of macular ischemia . complete and systemic examination was unremarkable , excluding the possibility of wyburn - mason syndrome . eight years after presentation , findings and bcva in the le have remained stable , with no extension of the retinal ischemia or development of neovascularization.conclusionalthough extensive retinal ischemia has been reported to result in complications such as retinal or iris neovascularization , in our case the macular ischemia has not expanded further over a period of 8 years . however , due to this macular ischemia the patient unfortunately lost her central vision .

gierke , in 1905 , described a lesion of adrenal gland containing fat and myeloid elements . a 40-year - old man referred to department of endocrinology with adrenal mass and hypertension . he was diagnosed with hypertension 3 years back , initial bp was 180/110 mm hg , was started on anti - hypertensive treatment . on examination , there were no neurocutaneous markers or marfanoid habitus , no features of cushing 's syndrome , 24-hour urine metanephrines level was 3000 micrograms / day ( normal < 900 micrograms / day , the test was done after stopping all interfering drugs ) . ultrasonography revealed 9.8 8.5 cms well - defined predominantly hyperechoic lesion , faint hypoechogenicity originating from right suprarenal region abutting the upper pole of right kidney and lower surface of right lobe of liver suggestive of right adrenal mass . cect of abdomen showed 9.8 8.5 cm well - defined , well - circumscribed heterogenous hypoattenuated mass lesion noted in right suprarenal region and minimal enhancement on contrast with 80 to 100 hf units of attenuation suggestive of myelolipoma of right adrenal gland [ figure 1 ] . abdominal contrasted computerized tomography showing well - defined non - homogeneous mass of right adrenal origin in view of hypertension , adrenal mass , and elevated 24-hour urine metanephrines ( > 3 times ) , possibility of pheochromocytoma was considered . patient underwent surgery , and well encapsulated right adrenal tumor ( weight : 500 gm ) was excised [ figure 2 ] . immuno - histochemistry of specimen revealed positive for chromogranin a , suggestive of catecholamine - secreting granules in the tissue [ figure 4 ] . gross specimen of removed mass h and e staining revealing features of myelolipoma with mature fat cells , suspended with plenty of normal hematopoitic marrow elements with congested blood vessels . ( original magnification , 100 ) immuno - histochemistry of specimen revealed positive for chromogranin a the patient had remission in hypertension . adrenal myelolipomas are uncommon benign tumors of adrenals , composed of adipose and hematopoietic tissue in varying proportions , a result of metaplasia of reticuloendothelial cells . as these tumors are usually more than 5 cms in diameter , they can be easily detected on ultrasound . the lesion is typically seen as a well - encapsulated heterogeneous supra - renal mass of low density with negative attenuation values , interspersed by dense myeloid tissue and with or without specks of calcification . the diagnosis of adrenal myelolipoma in our case was suggested by the established ct scan criteria [ figure 1 ] and the typical histopathological features [ figure 3 ] . functionality of the adrenal mass in this patient was suggested by the presence of hypertension and elevated metanephrines . catecholamine secreting adrenal myelolipoma was confirmed by the absence of any evidence of pheochromocytoma on hpe and documentation of positive staining for chromogranin a on ihc [ figure 4 ] . brogna et al . , reported a giant cortisol secreting adrenal myelolipoma , but our patient was clinically and biochemically eucortisolic . to the best of our knowledge , only two case reports are available on catecholamine - secreting adrenal myelolipoma in the world literature . tamidari et al . have reported a case of a large , right - sided catecholamine , secreting adrenal myelolipoma with increased 24 hours urinary metanephrines . udupa et al . have reported a large adrenal myelolipoma with increased 24 hours urinary vanillylmandelic acid ( vma ) levels . all these patients became normotensive and biochemical abnormalities normalized following surgery similar to the patient in our case . the association of adrenal myelolipoma and hypertension may not be entirely coincidental , as it may be associated with catecholamine secretion , as seen in our case .

co - occurrence of adrenal incidentaloma with hypertension calls for evaluation of endocrine causes including pheochromocytoma , cushing 's disease , and primary aldosteronism . we are reporting 40-years - old man who presented with hypertension and adrenal mass . he had elevated metanephrines , histology of resected adrenal mass revealed adrenal myelolipoma , and immuno - histochemistry was positive for chromogranin a. both his blood pressure and urinary metanephrines returned to normal after surgery . the association of hypertension and adrenal myelolipoma may not be entirely coincidental , as it may be associated with secreting catecholamine . literature on such an uncommon association is reviewed briefly as well .

they are known to become symptomatic as a consequence of enlargement , infection , or rupture , the latter being an exceedingly rare complication traditionally treated with open splenectomy . we herein report a unique case of a giant epidermoid splenic cyst that ruptured spontaneously and was successfully treated with the laparoscopic approach . laparoscopic surgery may be considered an initial treatment option in cases of very large epidermoid cysts even when rupture occurs . laparoscopic splenectomy is an established therapeutic option for the elective treatment of nonparasitic splenic cysts . we herein report a case of a ruptured giant epidermoid splenic cyst that was successfully treated with the laparoscopic method . a 32-year - old woman was urgently admitted to our department with acute onset of pain in the left upper quadrant that radiated to the left shoulder . she had no history of antecedent abdominal trauma ; however , she did have a 2-month history of mild abdominal pain and left shoulder discomfort . on physical examination , tenderness in the left upper quadrant , diminished bowel sounds , and abdominal guarding were noted . computerized tomography of the abdomen revealed a large cystic lesion , evolving from the spleen measuring 16 cm x 14 cm with features indicative of intra- and extrasplenic rupture . also , a significant amount of free peritoneal fluid was present ( figure 1 ) . with the imaging diagnosis of ruptured splenic cyst , the patient underwent a successful laparoscopic splenectomy . computerized tomography of the abdomen , demonstrating the giant ruptured epidermoid splenic cyst and the intraperitoneal fluid . after the induction of general anaesthesia and endotracheal intubation , the patient was placed in the full , right lateral decubitus position with the table tilted at 20 to 30 and in a moderate reverse trendelenburg position . pneumoperitoneum was established with the open method ( hassan technique ) through the umbilicus up to the level of 15 mm hg . four 10-mm trocars were subsequently inserted along the left costal margin , allowing for bimanual operative manipulations . splenic mobilization commenced with division of the splenocolic ligament , ligation of inferior polar vessels and division and ligation of short gastric vessels by using ligasure ( ussc , autosuture co , norwalk , ct ) . the next operative step was the hilar control , which was accomplished by multiple firings of the endogia ( ussc , autosuture co , norwalk , ct ) applied directly to the splenic vascular pedicle . once the hilum was controlled , the ligamentous posterior peritoneal attachments were divided , preserving though the phrenic attachments . subsequently , a specially designed retrieval bag was inserted through the left lower trocar site . after the entry of the spleen into the bag , the end of the bag was brought outside the abdomen through the umbilical trocar site . histologic examination revealed multiple splenic fragments with a total weight of 160 g and dimensions of 18 cm x 14 cm x 7 cm . the bigger splenic fragment contained an empty cyst with dimensions of 9 cm x 6 cm with a fibrotic wall bearing epithelial lining ( figures 2 and 3 ) . this report describes a rare case of a giant epidermoid splenic cyst that ruptured spontaneously and was successfully treated with laparoscopic splenectomy . nonparasitic splenic cysts are rare splenic lesions occurring in all age groups , probably resulting from a developmental anomaly , during which primitive mesothelium becomes entrapped within the splenic parenchyma cysts , in which no lining can be demonstrated . however , the absence of an epithelial lining can be a spurious observation , so failure to identify scant remnants of this lining may lead to erroneous classification of a cyst . of the true splenic cysts , epidermoid cysts comprise 90% , whereas dermoid cysts are less common and comprise the remaining 10% . clinically , true splenic cysts may be completely asymptomatic , constituting an incidental finding during physical or radiologic examination or manifested with minor , non - specific symptoms , such as pain and abdominal distention due to cyst enlargement . complications including infection and rupture are extremely rare ; in a recent review , the reported overall complication rate was 5.2% , involving 6 cases of cyst rupture and 4 cases of cyst infection . therefore , our case of spontaneous rupture of the giant splenic cyst is an exceedingly rare condition . nonoperative treatment is recommended for small cysts , up to 5 cm in diameter , if they are totally asymptomatic and the imaging characteristics are absolutely typical . when a splenic cyst is symptomatic or if the diagnosis is in doubt , operative therapy is warranted . elective treatment options for nonparasitic splenic cysts include total splenectomy or some spleen - conserving variants , such as removal of the cyst in its entirety along with a remnant of adjoining spleen ( partial splenectomy ) or leaving a small remnant of the cyst still affixed to the spleen ( cystectomy or splenic decapsulation or partial cystectomy ) . other limited treatments , such as percutaneous catheter drainage and sclerosis , have also been described ; however , they are associated with high rates of recurrence or infection and have largely been abandoned . total splenectomy is the only method of operative treatment in the reported cases of ruptured epidermoid splenic cysts . interestingly enough , although the application of the laparoscopic method is well documented in elective cases , it seems quite restricted in the urgent setting . actually , no report has been published in the english literature about laparoscopic treatment of a ruptured epidermoid splenic cyst . because our patient was hemodynamically stable , we opted for the laparoscopic approach , which was successfully completed . it seems reasonable that acute rupture of an epidermoid splenic cyst does not constitute a contraindication for laparoscopic repair per se , and laparoscopic splenectomy may be attempted as an initial treatment option .

background : epidermoid splenic cysts are uncommon lesions of the spleen . they are known to become symptomatic as a consequence of enlargement , infection , or rupture , the latter being an exceedingly rare complication traditionally treated with open splenectomy . we herein report a unique case of a giant epidermoid splenic cyst that ruptured spontaneously and was successfully treated with the laparoscopic approach.conclusion:laparoscopic surgery may be considered an initial treatment option in cases of very large epidermoid cysts even when rupture occurs .

air pollution is a risk factor for various diseases including eye irritation , respiratory infections , and heart disease [ 13 ] . conjunctiva is sensitive to environmental particles considering the direct contact of conjunctiva with the outside environment . conjunctiva protects the ocular from outsides deleterious agents , helps lubricate the eye by producing mucus and tears , and contributes to the immune balance of ocular surface . the importance of conjunctiva and a high prevalence of conjunctivitis merit an investigation on the effect of air pollutant on conjunctivitis . the environmental pollution , especially the air quality , has deteriorated in the past decades in china mainly due to the rapid industrialization in the country . overall , no more than 5 cities among the 500 largest cities of china meet the air quality guidelines recommended by the world health organization . recently , seven cities in china were ranked among the 10 most polluted cities in the world . the current study aims to evaluate the effect of air pollution on the occurrence of nonspecific conjunctivitis through analyzing the patients diagnosed as nonspecific conjunctivitis in jinan city and the air pollution level of jinan city . data was collected from two eye centers in jinan city : central area and east area of shandong provincial hospital , shandong university . patients presenting to the outpatients clinic between june 2014 and may 2015 with symptoms and signs of nonspecific conjunctivitis were included . outpatient visits for nonspecific conjunctivitis were selected according to a previously published report and the international classification of diseases ( icd-9 ) diagnostic codes . the following codes were included : 372.00 , 372.01 , 372.10 , 372.11 , 372.20 , and 372.30 ( for nonspecific acute conjunctivitis , serious conjunctivitis except viral infection , chronic conjunctivitis , simple chronic conjunctivitis , blepharoconjunctivitis , and other undefined conjunctivitis , resp . ) . the following cases were excluded : patients with other ocular diseases including corneal abnormalities , conjunctivitis before the initiation of the study , xerophthalmia , and systemic immune disease . air pollution data was harvested from the state environmental protection administration of china and expressed as air quality index ( aqi ) . the aqi was composed by the index of particulate matter ( pm10 and pm2.5 ) , nitrogen dioxide ( no2 ) , sulfur dioxide ( so2 ) , ozone ( o3 ) , and carbon monoxide ( co ) . the linear regression analysis was used to evaluate the relationship between number of clinic visits per day and aqi from the same day up to 4 prior days . the aqi within 1 day , 2 days , 3 days , and 4 days were calculated as the mean of the aqi on presenting day and 1 day , 2 days , 3 days , and 4 days prior to presentation and were expressed as aqi1 , aqi2 , aqi3 , and aqi4 . a total of 15373 patients living in the air - quality - monitoring area of jinan city were enrolled in this study . the average number of patients with nonspecific conjunctivitis per day was 42 ( 2271 ) , and the average aqi was 125 ( 56500 ) ( figure 1 ) . the aqi0 ( p = 0.023 ) , aqi1 ( p = 0.049 ) , and aqi2 ( p = 0.050 ) had a positive relation with the number of patients per day ( figure 2 ) . however , the aqi3 ( p = 0.229 ) and aqi4 ( p = 0.101 ) did not have a significant relation with patient numbers per day ( figure 2 ) . the aqi ( p = 0.001 ) as well as the number of patients per day ( p = 0.013 ) in autumn and winter ( october to march ) was higher compared to that in spring and summer ( april and september ) . in the present study , the aqi was harvested from 15 areas of jinan district covering 3000 km and 4 million people . previous studies have demonstrated the effect of air pollution on respiratory disorders [ 8 , 9 ] . a similar reaction to exogenous stimuli between conjunctival mucosa and respiratory mucosa has been proposed in the past [ 10 , 11 ] . chang et al . reported a positive relation between air pollution and outpatient visits for nonspecific conjunctivitis in taiwan area . the different components of air pollutants have different effects on the occurrence of conjunctivitis . in present study , we reported that the occurrence of conjunctivitis has positive relation with the aqi on presenting day and the aqi within one day before the day of presentation . a limitation of our study is that we did not investigate the effect of different components of pollutants on causation of conjunctivitis . present study observed a variety of conjunctivitis types within icd-9 code but did not predefine various forms of infections and allergic or physiological changes in tear film disorders except with the icd codes . more study should be done to elucidate the correlation between these various types of conjunctivitis and the various air quality measurements that were monitored . present study revealed that the aqi in autumn and winter is higher than that in spring and summer . a high aqi in autumn and winter in jinan may be due to more coal consumption for heating , use of firecrackers consumption from spring festival to lantern festival , and a more difficult spread of pollutants due to low temperature . this study was carried out in an area with heavy air pollution , in which a variety of health disorders are related to pollutants . although present study has revealed a relation between air pollution and conjunctivitis , more detailed investigations should be carried out to elucidate the effect of age and sex on the ophthalmic response to pollutant and the clinical treatment . furthermore , the relationship between conjunctivitis and dry eye [ 12 , 13 ] merits the investigation of effect of air pollution on dry eye and other more severe ophthalmic disorders related to dry eyes dry eye , such as microbial keratitis and the decline in quality of life .

purpose . to investigate the short - term effect of air pollution on occurrence of nonspecific conjunctivitis . methods . data were collected from outpatient visits from cases with conjunctivitis over a period of one year . regression analysis was performed to evaluate the relationship between the number of outpatient visits and the air quality and the lag effect of air quality on conjunctivitis occurrence . results . the air quality index on the day of presentation ( p = 0.023 ) , one day before presentation ( p = 0.049 ) , and two days before presentation day ( p = 0.050 ) had a positive relation with outpatient visits for conjunctivitis . the air quality index ( p = 0.001 ) and outpatient visits number per day ( p = 0.013 ) in autumn and winter ( october to march ) were significantly higher than those in spring ( april ) and summer ( september ) . conclusions . the air quality index within two days before presentation affected the probability of attending the outpatient clinic for nonspecific conjunctivitis . high number of cases can be expected in colder season .

since the first description was more than 20 years ago , arrythmogenic right ventricular cardiomyopathy ( arvc ) is increasingly recognized from pathology to diagnosis . the main pathologic feature is the gradual replacement of the right ventricular myocardium by fibrous tissue and fat . patients with arvc often die at a young age due to the fatal ventricular arrhythmias whereas arvc of an elder person is rare and different from that of young people . in this report , an unusual case of arvc with a long , natural history in a middle - aged woman is presented . a 54-year - old woman was presented with progressive weakness , severe edema , and moderate shortness of breath on exertion for 9 years . subsequently , she was found to have monomorphic ventricular tachycardia ( vt ) with left bundle branch block - type morphology . rest electrocardiogram displayed atrial fibrillation rhythm , epsilon wave , and negative t - waves in leads v1 to v4 [ figure 1 ] . it could be found from the echocardiography that there was severe dilation of the right ventricle , with a poor right ventricular ( rv ) systolic function and severe tricuspid valve regurgitation and an electrophysiological study showed vt of a right ventricular outflow tract or rv apex origin . as a diagnosis of arvc was most likely , the patient underwent a magnetic resonance imaging scan which revealed diffuse areas of fat tissue at the right ventricular wall especially at the free wall [ figure 3 ] . at the same time , multiple small aneurysms were also found . based on the clinical presentation and work -- up , a definite diagnosis of arvc was made . she was treated with various antiarrhythmic agents and angiotensin - converting enzyme inhibitors ( aceis ) , diuretics , and -blockers . despite aggressive medical therapy , her clinical conditions continued to deteriorate , and the tricuspid valve repair was performed because of severe tricuspid valve regurgitation . the general and cardiac biopsy findings demonstrated diagnosis was consistent with arvc [ figure 4 ] . ( b ) 12-lead ecg with inverted t - waves and postexcitation epsilon wave in leads v1 to v4 echocardiography image in the parasternal long axis showing severe dilation of the right ventricle and severe tricuspid valve regurgitation mri showing the dilation of rv and transmural fibrofatty replacement in the rv free wall ( a ) a gross photograph demonstrating the right ventricular with extensive fatty replacement primarily involving the lateral wall . ( b ) typical histologic features of arvc , ongoing myocyte death with early fibrosis and adipocyte infiltration arvc is a heart muscle disease which is characterized by prominent , severe ventricular arrhythmias . however , the criteria have been found to be poorly sensitive and specific , especially in the early stage of the disease . the new criteria continues with these same categories : global or regional dysfunction and structural alternations ; tissue characterization of the wall ; repolarization abnormalities ; depolarization abnormalities ; and arrhythmia and family history . the categorization provides more measurable criteria removing some of the interpretation in the old criteria . arvc is an important cause of sudden cardiac death in people less than 65 years of age . they include chest discomfort , palpitations , presyncope , syncope , and unexplained heart failure . although the right ventricle is mainly involved in arvc , the left ventricle may be progressively affected thus resulting in biventricular failure . the heart muscles of the patient in our case were replaced by fibrous tissue and fat . the electrophysiological study carried out on the patient showed that there were a lot of low - voltage districts in the heart . and this caused the failure of radiofrequency catheter ablation ( rfca ) on vt . so the treatment of arvc is yet focused on icds for the prevention of sudden cardiac death . heart transplantation is unusual in arvc but it has been performed at the end stage of heart failure . because of cardiac myocyte loss ( fat and fibrous tissue replacement ) in the right ventricle , the patient would benefit when she accepted an operation of heart transplantation , not the tricuspid valve repair for her severe heart failure . heart failure may be more obvious in elder patients . although arvc is an inherited disease of the heart muscles involving the right ventricle , the left ventricle may be progressively affected thus resulting in a biventricular failure .

arrhythmogenic right ventricular cardiomyopathy ( arvc ) is a kind of heart muscle disease characterized by the gradual replacement of the right ventricular myocardium with fibrous tissue and fat . it could be the major cause of sudden cardiac death with ventricular tachycardia , and there is a variation in the history of the disease . we reported an unusual case of arvc in a middle - aged woman with congestive heart failure as her first presentation for a long time .

behet 's disease ( bd ) is characterized by recurrent aphthous stomatitis , genital ulcers , and various skin lesions . bd can also involve other systems such as ocular , gastrointestinal , articular , neurological and cardiovascular systems . the frequency of cardiovascular involvement is estimated to be 4 - 46%.1)2 ) common vascular manifestations are thrombophlebitis and arteritis , which occur in as many as one - third of the patients.3 ) aseptic endocarditis is a rare manifestation of bd and is mostly found in the form of intracardiac thrombus or endomyocardial fibrosis.3)4 ) nonrheumatic tricuspid valve stenosis ( ts ) is extremely rare , and to our knowledge , it has never been reported in the english literature in patients with bd . we describe a case of a female bd patient with aseptic tricuspid valve ( tv ) endocarditis presenting as ts . a 39-year - old female was admitted to kyungpook national university hospital with a 3-month history of dyspnea on exertion and abdominal distension . signs of right heart failure such as pitting edema , palpable liver and neck vein distension were noted on physical examination . she had been diagnosed with bd four years ago . although her previous clinical courses fluctuated , she did not show any signs or symptoms of bd since one year before admission . at the time of admission , evidence of bd disease exacerbation was absent ; esr 20 mm / hr ( reference 0 - 20 mm / hr ) , ferritin 71.50 ng / ml ( reference 13 - 150 ng / ml ) . transthoracic echocardiography ( tte ) showed normal left ventricular function , normal aortic and mitral valve function , morphology , and a moderate to large amount of pericardial effusion . however , precise evaluation of right heart was difficult on tte due to poor echo window . transesophageal echocardiography showed severe ts with an ill - margined echogenic mass , and a mild to moderate amount of pericardial effusion ( figs . 1 and 2 ) . any other possible causes of ts , such as cardiac tumors , carcinoid syndrome , marantic endocarditis , and wegener 's granulomatosis were not detected . symptoms of right heart failure gradually progressed despite the appropriate steroid and immunosuppressive therapy.5 ) she was operated for ts . the thickened tv was removed and was replaced with an artificial valve ( edwards - mira 31 mm ) . pathologic examination showed valvulitis consisting of fibrinoid necrotic material and inflammatory cells ( figs . 3 and 4 ) these pathologic findings were consistent with those of previous reports presenting aseptic endocarditis in bd.6)7 ) after the tv replacement , she remained free from symptoms of right heart failure with immunosuppressive therapy and anticoagulant therapy . endocarditis in bd may be limited to the valve leaflets or may spread to the ventricular or atrial wall and can result in serious complications , such as valvulopathy , organized thrombus or endomyocardial fibrosis.3)4)9 ) however , most cases of endocarditis in bd were detected in the form of organized thrombus or endomyocardial fibrosis.3)4 ) not only an intracardiac thrombus but also a massive endomyocardial fibrosis could cause serious functional obstruction of the tv.3)4)9 ) however , overt ts due to valvulitis has not been reported , even though the affected valve leaflets could either be thickened or replaced by fibrous tissues . also , we could not find any evidence of other combined sequelae of endocarditis , such as intracardiac thrombosis , endomyocardial fibrosis or valvulopathy of other valves . mcdonald et al.10 ) reported for the first time , a case of endocarditis involving the normal mitral and aortic valves in a patient with bd . histologic examination of these valves showed mononuclear infiltration with a few polymorphonuclear leukocytes and no fibrin deposits . madanat et al.6 ) reported a case of bd and endocarditis with left atrial thrombosis mimicking myxoma . postoperative pathologic examination revealed yellowish valvulitis involving the mitral valve leaflet with deep ulcerations on the valve surface , covered by fibrinous and necrotic masses with a significant growth of granulation tissue . in other case reports of endocarditis in bd , several granulomas were found within the central portion of the vegetations and polymorphonuclear cells and lymphocytes infiltrated the small vessels near the vegetations.7 ) in our case , the pathologic examination showed vegetations , consisting of fibrinoid necrotic material , granulation tissue , and inflammatory cells , which were predominantly mononuclear cells . therefore , ts was caused due to valvulitis as a possible sequelae of endocarditis in bd . as in this case , the cardiac lesions in bd might progress insidiously in the absence of concurrent signs or symptoms of bd , or they were even diagnosed at autopsy.10)11 ) therefore , it might be difficult to detect endocarditis in the early stage . these findings suggest that screening for cardiac involvement is required for early detection of endocarditis or other heart diseases in patients with bd .

aseptic endocarditis is an uncommon complication of behet 's disease ( bd ) . we describe a rare case of a 39-year - old female who had bd with aseptic endocarditis of the tricuspid valve ( tv ) presenting as tricuspid stenosis . she was diagnosed with bd four years ago . the mucocutaneous lesions were well - controlled with colchicine and short courses of corticosteroids . she remained free of signs and symptoms of bd for one year without any medication . three months before admission , she gradually developed dyspnea on exertion and peripheral edema . echocardiography revealed dilated right atrium and markedly thickened tv with severe stenosis . tv replacement was performed . pathologic examination of the valve showed fibrinoid necrotic material and inflammatory cell infiltration . blood cultures and cultures of the excised valve were negative for microorganisms .

rhabdomyolysis is characterized by muscle necrosis and the release of intracellular muscle contents into the systemic circulation . the spectrum of the syndrome ranges from asymptomatic serum muscle enzymes elevation to life - threatening extreme enzyme elevations , electrolyte imbalances , and acute renal failure . we report an elderly lady with a combination of risk factors who developed rhabdomyolytic acute renal failure . a 65-year - old lady was suffering from type 2 diabetes for the past 30 years , hypertension for the past 20 years , and coronary heart disease for the past 10 years . the medications included clopidogrel 75 mg / day , amlodipine 10 mg / day , frusemide 40 mg bds , and insulin . a week before presenting to us , a cardiologist had added atorvastatin 10 mg / day to her prescription . she presented to us with complaints of severe generalized myalgia , difficulty in assuming upright posture from sitting position , and difficulty in walking of 1 week duration . she also complained of swelling of feet , face , nausea , loss of appetite and noticed decreased urine output , and reddish discoloration to urine for the last 3 days . there was no fever , history of trauma , viral exanthem , severe exercise , seizure , uncontrolled blood glucose , and use of herbal medication preceding the illness . on examination , she was well - built and well - nourished , and had pedal edema and facial puffiness . she was afebrile with pulse rate of 60 beats per min and blood pressure of 160/90 mm hg . neurological examination showed 2/5 power in all four limbs , absent deep tendon reflexes , and muscle tenderness with no sensory involvement . urinalysis showed glucose 2 + , ketone bodies negative , blood positive , red blood cells nil , and white blood cells 1 - 2/hpf . her hemoglobin was 11.4 g / dl , total leukocyte count 18 , 300 per mm , platelet count 5.0 lakh per mm , esr 20 mm after 1 h , electrocardiogram showed tall peaked and widened t waves with proximal limb steeper than distal limb , and the chest radiograph was normal . ultrasound abdomen showed right kidney 9.3 3.7 cm and left kidney 9.2 3.2 cm . the urine and blood cultures were sterile , hiv , hbsag , anti - hcv antibodies , anti - hav igm , and anti - hev igm were negative . myalagia , reddish discoloration to urine , deterioration of renal function , elevated sgot , creatinine kinase , and increased urine myoglobin led to the diagnosis of rhabdomyolysis . levothyroxine replacement was initiated at a dose of 50 g / day , increased after 15 days to 100 g / day . the following three risk factors for the onset of rhabdomyolysis were identified : use of statin , undiagnosed hypothyroidism , and co - administration of amlodipine and clopidogrel . frusemide was stopped as she had hypokalemia before the onset of illness which was again a risk factor for rhabdomyolysis . after seven sessions of hemodialysis the urine output improved and serum creatinine stabilized at 3.2 mg / dl . however , it is difficult to directly compare the incidence of statin myopathy in clinical trials with real world clinical practice given the inconsistent definitions . the common risk factors for the development of a statin - induced myopathy include high dosages , increasing age , female sex , renal and hepatic insufficiency , diabetes mellitus and concomitant therapy with fibrates , cyclosporine , macrolide antibiotics , warfarin , and digoxin . individual statins differ in their risk of inducing rhabdomyolysis , with some patients developing this syndrome when switching from one statin to another . it is probable that genetic factors play a role in the pathogenesis of this syndrome . the temporal relation between statin therapy and the onset or resolution of myopathy is not fully defined . a retrospective study of 45 patients with statin myopathy at a tertiary center revealed a mean therapy duration of 6.3 months before symptom onset and a mean duration of 2.3 months for symptom resolution after discontinuation of statin therapy . patients in primo study developed muscle symptoms after a median of 1 month after initiation of statin therapy , ranging up to 12 months after initiation . hypothyroidism was reported as a predictor of statin - associated myopathy ( or 1.71 ; ci , 1.10 - 2.65 ) in primo study . the likely mechanisms of renal impairment in hypothyroidism are the reduction in glomerular filtration rate due to the lower cardiac output and renal blood flow , thyroxine may mediate tubular secretion of creatinine , hypothyroidism may increase creatinine release from muscle , and rhabdomyolysis . it is possible for two different substrates of the same metabolizing enzyme to compete for catalytic sites on the same enzyme ; through competitive inhibition , one substrate may gain access to these sites whereas the other is excluded . this process results in metabolism of the drug that successfully accesses the catalytic sites of the enzyme , whereas the excluded drug is metabolized at a significantly slower rate . in the present patient the present patient provided a caution that hypothyroidism and interaction with other drugs should be considered when patients were going to be initiated on statins .

rhabdomyolysis is a syndrome characterized by muscle necrosis and the release of intracellular muscle contents into the systemic circulation . we report a patient with chronic kidney disease who had deterioration of renal function due to combination of risk factors like hypothyroidism and interaction of amlodipine and clopidogrel with statins .

because many prenatal disorders involve more than one organ , an important clue of prenatal diagnosis is to look for multiple anomalies . therefore , finding a specific lesion commands detailed examination of the fetus to rule out a possible involvement of other organs . this approach is clinically important as identifying multiple lesions may impact on diagnosis , prognosis , and pregnancy / postnatal management . the aim of the present work was to report on two cases in which digestive tract occlusion or perforation was found to be associated with brain hemorrhage . in one fetus , finding this association modified the prognosis and the outcome of pregnancy , while in the other , it influenced the postnatal management . a 39yearold pregnant woman was referred to our multidisciplinary center of fetal medicine at 26 weeks of gestation for reevaluation of fetal intestinal dilatation and ascites . an amniocentesis performed at 21 weeks due to mother age was normal for a female fetus . on ultrasound ( us ) , a meconial pseudocyst in the left flank of the fetus , ascites , and slight bowel dilatation ( 7 mm ) were found ( fig . the doppler study was normal for the umbilical artery and ductus venosus but it showed slight daily changes in the resistive index of the medial cerebral artery from 0.84 to 0.75 . performed at 31 weeks , a sudden increase in bowel dilatation ( 15 mm ) was observed . the mri performed on the next day , confirmed the presence of meconial pseudocyst , small bowel dilatation , and unused microcolon which likely developed in the context of perforation secondary to small bowel atresia . because the mri reference scan showed an abnormal hyperintense t1 cerebral lesion , a focused brain mri was performed the week after , at 32 weeks . this examination demonstrated intraventricular hemorrhage and extensive intraparenchymal frontoparietal ischemic lesions , consistent with the diagnosis of grade 4 brain hemorrhage ( fig . these lesions had most probably been overlooked at least on the us scan performed on the day before the first mri . a 26week and 4day axial us abdominal scan of the fetus 1 showing the meconial pseudocyst ( between crosses ) and the ascites ( arrow ) . a 31week t2 weighted mri coronal slice of the brain of the same fetus showing the periventricular parenchymal ischemic lesions ( arrow ) , the hemosiderin deposits in the subependymal region ( arrow head ) , and the ex vacuo dilatation of the frontal horn of the lateral ventricle : grade 4 hemorrhage . after multidisciplinary discussion and complete information of the parents , they elected termination of pregnancy at 34 weeks because of the risk of cerebral palsy and poor abdominal prognosis . a 25yearold pregnant woman came to our fetal medicine center for routine second trimester us at 22 weeks . the amniocentesis revealed neither genetic anomalies nor infection . on subsequent us performed at 25 weeks , an intraventricular brain hemorrhage ( fig . , we observed a progressive dilatation of the bowel loops and resolution of the effusions . the colon that should be clearly visible on third trimester us was never seen suggesting proximal bowel atresia . a comprehensive mri performed at 31 weeks investigated both regions , the fetal brain mri confirmed the grade 2 hemorrhage without parenchymal lesions and the abdominal mr sequences demonstrated a distal small bowel atresia with unused microcolon ( fig . the loops dilatation increased to 30 mm diameter with heterogeneous content and slight abdominal effusion suggesting parietal damage . a caesarian delivery was performed on the same day giving birth to a 2620 g baby girl with good apgar score . the neonatal surgery confirmed an isolated distal small bowel atresia , with proximal intact loops , the atretic segment was resected , and a double ileostomy was done . a 25week axial us scan of the head of the fetus 2 showing subependymal hemorrhage ( arrow ) and the hyperechogenic wall of the lateral ventricle ( arrow head ) : grade 2 hemorrhage . a 31week t2 weighted mri coronal scan of the fetus 2 showing normal fluid filled proximal loops ( arrow ) and dilated intermediate and distal loops attesting of the distal small bowel occlusion . we report on two cases of prenatal diagnosis of digestive tract occlusion or perforation that were found to be associated with brain hemorrhage ; this significantly impacted on prognosis in one case and on postnatal management in the other . different theories have been proposed to explain digestive tract atresia : for example , lack of vacuolization of the solid cord stage of intestinal development or ischemic insult to the midgut due to mesenteric vascular accident 1 , 2 . the atresia can be isolated but may also be associated with meconium ileus , apple peel atresia , volvulus , or abdominal wall defect 3 , 4 . cystic fibrosis should be excluded as it is an associated condition in 740% of cases 5 , 6 . concomitant extraintestinal anomalies are less frequent , though one study reported extra abdominal malformations like congenital heart disease , down 's syndrome , anorectal and vertebral anomalies , neural tube defect , microcephaly , and vesicoureteral reflux 7 . to our knowledge , the association of meconial peritonitis or ileal atresia with brain hemorrhage has never been described prenatally . a vascular insult responsible of the gut atresia could be associated with blood flow disturbance leading to cerebral hypoperfusion and subsequent injury 8 , 9 . in case 1 , the appearance of the brain ischemic lesion on mri at 31 weeks was compatible with vascular insult going back to a few weeks earlier . experimental studies in fetal sheep 10 have shown that cerebrovascular immaturity may impair the ability to maintain constant cerebral blood flow over a wide range of changes in arterial blood pressure ; this might also apply to human foetuses . periventricular and subependymal regions that corresponded to the affected zones in our two fetuses are of greater susceptibility because of high metabolism and watershed vascular regions 11 . another hypothesis explaining the rare association of meconial peritonitis and brain hemorrhage may be an intravascular meconial dissemination leading to endovascular occlusions by squamous cells . a neonatal case has been published associating meconium peritonitis , periventricular leukomalacia , and pulmonary hypertension leading to neonatal death secondary to respiratory insufficiency . necropsy disclosed disseminated intravascular occlusions by squamous cells 12 . a case of twintotwin transfusion syndrome has also been reported ; one twin presented meconium peritonitis and intravascular disseminated coagulation that led to intrauterine death of the other twin . these two possible pathogenic mechanisms could cause vascular disruption of the blood supply in multiple organs and hence explain the association we describe in the present report . these two rare cases associating digestive tract occlusion or perforation and brain hemorrhage give us the opportunity to emphasize the need for careful screening of the fetal brain in such acute abdominal conditions . because brain lesions may be delayed , neonatologists and pediatricians should also be vigilant and prescribe transfontanellar us whenever a newborn has a history of bowel ischemia and/or perforation .

key clinical messagewe report two prenatal cases of an exceptional association of digestive tract atresia or perforation with brain hemorrhage . this combination worsens the prognosis leading to termination of pregnancy in one case . we outline the importance of a careful fetal brain examination on imaging in cases of prenatal acute abdominal insults .

the work of wu and colleagues is in accordance with the recent concept of sepsis - induced immunosuppression . there is now agreement that many severe septic patients survive the first critical hours of the syndrome but eventually die later in a state of immunosuppression that is illustrated by patients ' difficulty to fight the primary bacterial infection , decreased resistance to secondary nosocomial infections and reactivation of viral infections normally solely pathogenic in the immunocompromised host . consequently , immunostimulatory therapies might be used to restore immune functions in the most immunodepressed patients . in the absence of any specific clinical signs of immune failure , however , it is beforehand critical to determine the best biological tools ( markers of septic patients ' immune failure ) enabling patient stratification . the most frequently assessed biomarker in the field to date is undeniably the measurement of hla - dr expression on circulating monocytes ( mhla - dr ) . there appears to be general consensus that diminished mhla - dr is a reliable marker for the development of immunosuppression in critically ill patients . indeed , decreased expression of this marker is regularly reported to be associated with higher mortality / risk for nosocomial infections in critically ill patients . more than 100 articles on this topic have been published in different icu conditions , including sepsis , trauma , burns , and stroke . it is becoming increasingly clear that the critical point after injury is the recovery of normal mhla - dr . schematically , mhla - dr rapidly returns to normal values ( generally in less than 1 week ) in injured patients with uneventful recovery , whereas this parameter remains constantly decreased in patients with adverse outcome/ secondary septic complications . in line with this hypothesis , wu and colleagues showed that low mhla - dr was associated with increased mortality in severe sepsis . most importantly , the authors propose that , more than a single value at a given time point , the dynamic change of mhla - dr over time would be a better predictor of mortality . indeed , in their study , single measurements of mhla - dr within the first week after patient admission ( either days 0 , 3 or 7 ) had no predictive value regarding mortality . in contrast , results expressed as dynamic parameters ( that is , between two time points ) provide excellent predictive values , especially calculated between days 0 and 3 or between days 0 and 7 ( areas under the curve of 0.92 and 0.94 , respectively , in receiver operating characteristic analysis ) . most importantly , after multivariate analysis , the authors show that these two parameters remain the sole independent predictors of mortality with an elevated significant odds ratio . overall , the present results confirm the concept that patients who do not start to restore normal immune functions are those who are going to die . these results are in agreement with two recent studies in which a weak slope of mhla - dr recovery was associated with increased risk of secondary infections in a mixed icu population and in trauma . this outcome could have important consequences in patient management , by potentially allowing for the administration of tailored therapies aimed at restoring immune functions based on dynamic changes of immunological parameters . first , the study is monocentric in a small cohort of surgical patients ( that is , not necessarily representative of the whole septic population ) that present with relatively elevated mhla - dr values ( > 50% ) in comparison with results from the literature ( usually below 50% in severe septic patients ) . this moderate severity and the lack of statistical power due to the small size of the cohort may explain surprising results after multivariate analysis ( sequential organ failure assessment and acute physiology and chronic health evaluation ii scores were not significantly different between survivors and nonsurvivors , odds ratio with very large confidence intervals ) . indeed , the standardized recommended method for expressing mhla - dr results is as numbers of antibodies bound per cell and not as the percentage of positive cells . as an example , the authors suggest that a difference of 4.8% in mhla - dr between days 0 and 3 is of significance . although most probably correct from a statistical perspective , this threshold is hardly applicable in routine / technical practice because such a small percentage difference could be due to measurement variability by flow cytometry . overall and beyond these limitations , appropriately acknowledged by the authors , this study confirms that after injury ( for example , severe sepsis ) survivors tend to progressively normalize mhla - dr , contrary to non - survivors . this biologic parameter could thus provide critical information when assessed as a dynamic variable over time . this potential aspect now deserves to be validated in multicentric clinical studies using standardized flow cytometry protocols .

increasing evidence suggests that the secondary phase of sepsis ( that is , after the first proinflammatory hours ) is characterized by the occurrence of a systemic failure of the immune system . in the most immunodepressed patients , therapies could be used to restore normal immune functions . however , biomarkers need to be developed to beforehand specifically identify these patients . of these biomarkers , diminished monocyte hla - dr expression has rapidly become the most popular . herein , novel perspectives regarding monocyte hla - dr assessed as a dynamic parameter in septic patients will be discussed in the context of a recently published study investigating daily evolution of monocyte hla - dr with regard to 28 day - mortality after severe sepsis .

osteonecrosis of the femoral head ( onfh ) is a debilitating disease that can often lead to mechanical failure , with collapse of the articular surface and structural joint deformity.1,2 however , some cases of onfh remain asymptomatic if the necrotic lesion undergoes no collapse . the prognosis of onfh largely depends on the location and width of the necrotic lesion . when this lesion involves over two - thirds of the weight - bearing area of the femoral head , the rate of collapse has been reported to be around 94%.3 on the other hand , necrotic lesions occupying less than the medial two - thirds of the weight - bearing area have low risk of collapse around 19%.3 we herein describe a case of medially located onfh with an associated collapsed medial lesion . the patient was fully informed that her data would be submitted for publication , and she consented . a 60-year - old female ( height , 158 cm ; weight , 58 kg ; bmi , 22 ) presented with gradually worsening left hip pain . hip range of motion was not restricted . a t - score for bone mineral density based on the lumber spine was 1.5 sd , indicating the normal bone mass . a radiograph obtained 12 months after the onset of pain showed vertical sclerosis in the center of the femoral head , and the lesion inside the boundary demonstrated diffuse bony sclerosis ( fig . no collapse was observed at the weight - bearing surface of the femoral head , but joint space narrowing was recognized in the medial portion . t1-weighted magnetic resonance imaging ( mri ) showed a vertical low - intensity band corresponding to the sclerotic rim on the radiograph ( fig . computed tomography ( ct ) showed a subchondral collapse at the medial lesion ( fig . 4 ) was obtained to confirm the diagnosis , using a 6-mm diameter biopsy needle that was advanced from the distal portion of the greater trochanter to the medial lesion of the femoral head . histologically , osteonecrotic bone trabeculae covered by appositional bone formation were seen within the lesion ( fig . 5 ) , and the bone marrow tissue contained vascular - rich fibrous tissues . based on these findings , the diagnosis of onfh was made . the patient was treated with celecoxib 200 mg / day for 4 months , and her hip pain gradually decreased . the latest radiograph 9 months after biopsy showed neither progression of collapse nor joint space narrowing . a high signal intensity on fat - saturated t2 images generally suggests a lesion with a rich vascularity or an edematous area including bone tumor . chondroblastoma is a rare bone tumor , arising from the secondary centers of ossification of long bones . the proximal femur is reported to be a common site of developing the tumor . since a lytic lesion surrounded by sclerotic border is considered to be diagnostic features , some cases may be confused with onfh.4 osteoid osteoma usually occurs near the metaphysis rather than the epiphysis , and appears as a radiolucent nidus showing high signal intensity on t2 images , accompanied by bone marrow edema.5 although the imaging findings of our cases seemed to be less similar to those of the tumors , we were unable to make a diagnosis of onfh due to the atypical imaging findings . then , we decided to perform the bone biopsy to clarify a diagnosis of our case . microscopically , the high - intensity area consisted of abundant vascularized fibrous tissue in combination with thickened trabeculae , indicating the reparative condition of the necrotic lesion . osteonecrotic lesions involving the medially located non - weight - bearing area generally remain asymptomatic . it has been reported that necrotic lesions occupying less than the medial two - thirds of the weight - bearing area have low risk of collapse to be around 19%.3 in addition , such osteonecrotic lesions generally tend to be repaired over time if they do not undergo collapse,6 and repaired necrotic lesions show osteosclerotic changes.7 in our case , most of the necrotic lesion was repaired by prominent appositional bone formation . motomura et al.8 reported that collapse consistently involved fracture at the lateral boundary of the necrotic lesion , at the junction between the thickened trabeculae of the reparative zone and the necrotic bone trabeculae . in the current case , on the other hand , an axial ct slice showed a fracture at the anteromedial junction between the thickened trabeculae and the necrotic bone trabeculae , against the anterior edge of the acetabulum . we speculated that collapse might have been caused by the repetitive mechanical stress between the anterior edge of acetabulum and the anteromedial necrotic lesion adjacent to the thickened trabeculae of the reparative zone . regarding the mechanisms of collapse in onfh , kenzora and glimcher9 reported that a fracture may begin in the region of the resorbed necrotic subchondral plate at the lateral junction between necrotic and viable bone . in our case , ct showed some degree of bone resorption around the collapsed lesion , whereas diffuse bony sclerosis was seen in the necrotic area , indicating that osteonecrotic area has been repaired . further studies are necessary to conclude whether subchondral bone resorption antedates the collapse in onfh.10,11 regarding the distribution of the necrotic area in onfh , several studies have suggested the importance of vessels feeding the femoral head.1215 the superior retinacular artery is known to be the principal source of blood to a large area of the femoral head , including the weight - bearing area of the superior portion.12,13 on the other hand , the inferior retinacular artery ( ira ) has also been reported to contribute to the vascularity of the femoral head.14,15 boraiah et al . reported that the ira feeds 62% of the medial half of the femoral head.14 furthermore , liu et al.15 reported that necrotic lesions tended to occupy the medial two - thirds or less of the weight - bearing area when the ira was damaged . the medial location of the necrotic area in our case might have resulted from a disturbance of the ira .

a 60-year - old female experienced the gradual onset of left hip pain without any triggering event . radiographs showed vertical sclerosis in the center of the femoral head and the lesion inside the boundary demonstrated diffuse bony sclerosis . no collapse was observed at the weight - bearing portion on radiograph . however , computed tomography showed a subchondral collapse at the medial lesion . on t2-weighted magnetic resonance imaging , the necrotic lesion showed diffuse high - intensity signals that indicated a prominent repair process . bone biopsy diagnosed osteonecrosis with associated prominent appositional bone and vascular granulation tissue .

since its inception , cell communication and signaling ( ccs ) has been published by biomed central as an open access journal . biomed central is an independent publisher committed to ensuring high quality publications in the fields of biomedical research . articles published in ccs are freely available to everyone online , and are archived in internationally recognized free repositories . although it is still young , ccs has been moderately successful , as indicated by the several thousand accesses to the manuscripts published throughout 2004 . of course , becoming established will require more years , but the quality of the publications that have been accepted by our editorial board is a sign of good health . thanks to an open access policy , articles that are published become freely and instantly available to any person connecting to the world wide web . because articles are intended to remain available at no cost forever , they can be read , downloaded and printed in perpetuity . copies of the published manuscripts are also archived and searchable in pubmed central , the us national library of medicine 's full - text repository of life science literature , and also in repositories at the university of potsdam in germany , at inist in france and in e - depot , the national library of the netherlands ' digital archive of all electronic publications . since the authors hold coyright for their published work , they can make their articles freely available on their institution 's website . the copyright policy also stipulates that the authors grant anyone the permission to reproduce and disseminate the article , provided that no errors are introduced and that it is adequately cited . as a comparison , several journals now offer free access to their articles on line , but it is generally , either for a limited period of time or only after 6 to 12 month following publication . thus , open access offers several benefits to authors and readers in the scientific community and the general public . first the authors are assured that their work is widely disseminated and that it is likely to be cited more often than when it is published in a journal whose access is limited to subscribers . at a time when politicians in many different countries are urging the scientific community to better communicate with the general public , this aspect is of prime importance . another major consequence is that there is no financial barrier to the dissemination of knowledge . the impact of a country 's economy on access to knowledge is considerable and is often under evaluated or ignored by those who live in wealthy environments . as long as a researcher has internet access , he or she can read open access articles ( although enabling them to get internet access is , admittedly , a big issue ) . contributing to the cost of publishing by paying apcs is comparable to paying a toll for driving safely and more rapidly on good quality highways . multiple clean , fast and safe lanes kept in good condition , with same services provided to all customers . any publishing of quality , traditional or electronic , involves processing that is generally paid by the scientific community ( either as authors , readers or subscribers ) . it may seem to some authors that the requested fee of 525 us$ is exceedingly high but , in truth , it is very low compared to the revenues made per article in the traditional publishing model , which some have suggested were as high as us$3000 , if not higher . the apc pays for the article to be freely accessible , and for the processes required before inclusion in pubmed and archiving in pubmed central , e - depot , potsdam and inist . authors can circumvent the charge by getting their institution to become a ' member ' of biomed central , whereby an annual membership fee covers the apcs for all authors at that institution submitting to any journal published by biomed central in that year . current members include nhs england , the world health organization , the us national institutes of health , harvard , princeton and yale universities , and all uk universities . many funding agencies have also realized the importance of open access publishing and have specified that their grants may be used directly to pay apcs . on behalf of the editorial board of ccs , i wish to reassure readers and authors that we are committed to evaluating manuscripts on the basis of their scientific quality , not on whether author 's can pay article - processing charge . if an author is unable to afford the apc , the editor - in - chief will be able to waive payment , if deemed necessary . , we firmly believe that publishing open access can only help scientific communication and improve results , hence becoming an excellent service to society . we do hope that you will support our effort towards this end by submitting manuscripts to cell communication and signaling .

in this article we briefly review the reasons and advantages that underly our publisher 's decision to introduce article - processing charges ( apc ) for manuscripts submitted to cell communication and signaling . the charge is an attempt to develop a new business model for distributing biomedical information and has been accepted in a number of other journals . apcs will enable biomed central to continue to provide their excellent service and will help to establish our journal .

enterovesical fistula is an abnormal communication between the bladder and the intestine ( 1 ) . it may occur as a result of postoperative complication of radical cystectomy and bladder substitution from the ileum , also called neobladder . . divided ileal loops are side - to - side or end - to - end anastomosed . surgical incisions and the numerous anastomoses that are performed during these complex procedures can cause intestinal or vesical leakage postoperatively . computed tomography ( ct ) , cystoscopy , endoscopy , barium enema , and cystography are the techniques that are recently used for diagnosis of these fistulas ( 1 ) . in some cases ct enterography ( cte ) is a new technique for evaluation of small bowels , surrounding structures , and the entire abdomen ( 2 - 4 ) . cte examination with multi - detector ct ( mdct ) enables us to get excellent quality reformatted images with high spatial resolution ( 3 - 5 ) . we showed the exact location of the fistula and its association with the bowels and neobladder by cte . we demonstrated the location of the leakage with only one technique by cte with no need of an invasive procedure . the aim of this case report is to show that cte can be a new and effective modality in detecting enteroneovesical fistula and to discuss the efficacy of cte in the detection and evaluation of enterovesical fistula referring to the literature . to the best of our knowledge , cte usage in such cases has not been reported before in the literature so far . we think that this case report could be useful for early and correct diagnosis of similar cases . a 64-year - old man presented with feces coming from the transurethral catheter 5 days after radical cystectomy and neobladder operation . the fistula location could not be detected with abdominal ultrasonography ( us ) , ct , cystoscopy , antegrade pyelography , barium enema and cystography ( figure 1 ) . 1250 ml of oral contrast - material solution , which was composed of 500 ml water , 200 ml lactulose ( 667 mg / ml , osmolac , biofarma , turkey ) , and 450 ml dilute - mixed barium sulfate suspension especially designed for ct ( e - z - cat , opakim , turkey ) , was ingested orally over 60 minutes at a steady rate . after administration of oral contrast agent , cte with 2 mm slice thickness was performed with a 64-detector mdct machine ( aquilion 64 , toshiba , tokyo , japan ) . after cte examination , sagittal and coronal reformatted images ( slice thickness : 1 mm ) were obtained by routinely available workstation inside the mdct machine . ileoneovesical fistula ( from the anastomose side ) was determined on cte images ( figure 2 ) . therefore , follow - up with transurethral catheter was recommended . if necessary , operation was planned . enteroneovesical fistula is a rare condition that can be difficult to diagnose ( 1 ) . the most common causes of enterovesical fistulas are crohn disease , enteritis , ulcerative colitis , trauma , postoperative - postradiotheraphy complications , penetrating injuries , bladder carcinomas , pelvic inflammatory disease , foreign bodies , and abscesses ( 6 , 7 ) . in addition , they may occur as a postoperative complication of radical cystectomy and neobladder substitution procedure . the other common findings are pneumaturia and recurrent urinary infections ( 6 , 7 ) . however , classical symptoms are only evident in 50% of patients with confirmed fistulae ( 1 ) . ct , cystoscopy , endoscopy , barium enema , and cystography are mainly used for diagnosis of enterovesical fistulas ( 1 ) . neocystogram examination of the neobladder ( after administration of a diluted contrast agent solution via transurethral catheter ) is the most frequent method used for the diagnosis of enteroneovesical fistula ( 6 , 7 ) . another disadvantage of neocystography is that the diluted contrast agent solution given into the bladder with high pressure and in large amounts can result in a new leakage site iatrogenically . some ct criteria are used for diagnosis of enterovesical fistulas such as presence of air within the bladder , focal bladder - bowel wall thickening , and presence of an associated soft - tissue mass ( 6 , 7 ) . however , the percentages of success in demonstrating the fistulas are not as high as it is expected ( 6 , 7 ) . as a result , another new technique is necessary to demonstrate enterovesical fistulas , their causes , and the communication site . the fact that in our case , the fistula and its localization were not detected by other techniques and were only detected by cte , supports this idea . cte has become a valuable technique in detecting small bowel diseases such as obscure gastrointestinal bleeding , suspected small - bowel tumor and especially inflammatory bowel diseases ( 3 - 5 ) . cte is a well - tolerated imaging technique that unlike ct enteroclysis , does not need nasoenteric intubation ( 8 , 9 ) . the images taken following the ingestion of large amounts of oral contrast material enables us to detect the small bowel lumen and wall more successfully ( 2 - 4 ) . small bowel distension also makes contrast agent leakage from the fistula more prominent . as a result , leakages that can not be detected by routine ct can be detected by cte . cte examination with 64 mdct enables us to get isotropic voxels and excellent quality reformatted images with high spatial resolution that is more easily diagnosed while evaluating the operation site and neobladder ( 2 - 5 ) . cte may be a useful , sensitive , effective , and non - invasive technique for the evaluation of enteroneovesical fistulas , leakage from the anastomose sides in postoperative cases , and other extraintestinal complications such as urinary tract obstruction or abscess formation .

enterovesical fistula is an abnormal communication between the bladder and the intestine . the accurate localization of leakage is important for accurate treatment planning . some imaging techniques can not demonstrate the fistula ; therefore , choosing the appropriate imaging technique is necessary . ct enterography ( cte ) is a new technique for evaluation of the small bowel and the entire abdomen . cte examination with multi - detector ct ( mdct ) enables us to get excellent quality reformatted images with high spatial resolution . we report a patient with neobladder and enteroneovesical fistula . we showed the exact location of the fistula and its association with the bowels and neobladder by cte . the aim of this report is to show that cte can be a new and effective modality in the detection of enteroneovesical fistulas and to discuss the efficacy of cte in the detection and evaluation of enterovesical fistula referring to the literature . in conclusion , cte may be a useful , sensitive , effective , and non - invasive technique for the evaluation of enteroneovesical fistula , leakage from the anastomose sides , and other extraintestinal complications such as urinary tract obstruction or abscess formation .

the common peroneal nerve ( cpn ) injuries are the most common among lower limb nerve injuries because of its fixed attachment in the region of the neck of the fibula . the involvement of cpn following varus displacement of the knee is commonly expected to be traction neuropraxia . the spontaneous recovery is usually expected and the not so favorable results of repair have led to a debatable consensus on its surgical management . closed transaction / laceration of nerve following sports injury is highly uncommon . a 27-year - old male sustained closed avulsion fracture of the fibular head with complete foot drop following a hyperadduction injury to the knee . early operative exploration revealed peroneal nerve laceration which was repaired primarily along with anatomical reduction of the fibular head which yields good results following early repair . this case review emphasizes that severe damage to cpn may occur in spite of closed injuries to the knee . patients presenting with fibular head avulsion fractures at the knee and cpn injury should be subjected to early intervention with repair or reconstruction of the avulsion injuries and exploration of cpn to achieve good clinical outcome . the common peroneal nerve ( cpn ) is susceptible to injury because of its fixed attachment in the region of the neck of the fibula . the associated ligamentous injuries to the knee often guide treatment in this scenario with expectant management of the cpn . laceration of the cpn is reported commonly following sharp injuries or with high - energy knee dislocations along with multiligamentous injury [ 2 , 3 ] . we report an exceedingly uncommon association of cpn laceration along with a closed fibular head avulsion fracture in a 27-year - old male , sustained while playing cricket . early exploration with repair of the cpn and stable fixation of the fibular head lead to good outcome in this case . a 27-year - old male presented to emergency with pain and swelling on posterolateral aspect of the right knee following a varus thrust while playing cricket . clinical examination confirmed the findings along with foot drop and dense hypoesthesia in cpn distribution . radiological examination revealed a displaced avulsion fracture of fibular head ( fig . 1 and 2 ) . magnetic resonance imaging of the right knee showed avulsion fracture of the fibular head with attached lateral collateral ligament and midsubstance tear in the posterolateral capsule of the knee along with edematous soft tissue engulfing the cpn suggestive of its compression . the patient was advised to undergo open reduction and internal fixation of bony avulsion from the fibular head to restore the posterolateral stability of the knee joint along with simultaneous exploration of the cpn . the right knee was examined under anesthesia , and there was grade ii opening on varus stress testing at 30 and 60 flexion . pre - operative x - ray shows avulsion fracture of the fibular head without dislocation of the knee joint . magnetic resonance imaging section shows avulsion of the fibular head with soft - tissue edema around fibular neck . the bony avulsed fragment from the fibular head with attached lateral collateral ligament and popliteofibular ligament was identified . the cpn was found to be lacerated approximately by 50% of the total diameter ( fig . 4 ) . the fibular head avulsion was anatomically reduced and fixed with a single 4 mm partially threaded screw ( fig . neurolysis of cpn was done microscopically , and repair of nerve fascicles was done without tension . post - operative bracing of the knee with intermittent range of motion was started on the 3 day . after 1 year , post - operative knee is stable with grade 3/5 power ( mrc grading ) at the right ankle , and sensations recovered up to 50% over the right foot . the strengthening exercises for quadricep and hamstring group of muscles were also started in the immediate post - operative period . intraoperative photograph shows lacerated common peroneal nerve with retracted avulsed fibular head along with ligaments . a fibular head avulsion fracture is a rare entity . in a retrospective study of 2318 knee injuries the importance of recognition of this injury lies in the fact that it is an important indicator of posterolateral instability of the knee . the lateral collateral ligament and tendon of the long head of the biceps femoris muscle are attached to the lateral margin of the fibular head . the avulsion of this bony fragment with its attached insertion of the posterolateral corner ligamentous structures is referred to as arcuate sign . although rare , it is highly indicative of underlying posterolateral corner injury . in our case , the patients was subjected to operative intervention due to the presence of this injury [ 6 , 7 ] . hyperadduction injury at the knee may lead to extensive damage to the lateral ligamentous structures of the knee and cpn . platt was the first to report the association of posterolateral corner injuries with peroneal nerve injury . watson - jones had noted extensive injury to the cpn in cases with injury to the lateral ligamentous complex of the knee . occasionally , cpn injury can occurs with multiligament knee injuries associated with knee dislocations with incidence of 16 - 40% in patients . we are reporting a case of cpn laceration in a closed posterolateral corner complex injury with avulsion of fibular head which is a rare entity . in literature , there are few case reports showing such type of injuries . in a study of six cases having similar injuries due to varus or adduction strain , only one had complete cpn transaction . in another study of 54 cases of posterolateral corner injuries , only 9 patients had cpn palsy of which 7 cases were associated with avulsion of the fibular head ; however , there is no mentioning of the common peroneal nerve laceration . in a series of six cases , only two patients had complete rupture and rest of the four cases had nerve in continuity ; however , there is no evidence of involvement of avulsion of the fibular head . in another case report , there is cpn traction injury along with ligamentous injuries in the patient while playing rugby in which end - to - end repair was done after removing the damaged part , but there was no mentioning of fibular head avulsion . in general , laceration of the cpn occurred either due to sharp injuries or with knee dislocations along with multiligamentous injury due to high - energy trauma which is well supported by number of studies . in our case , we did primary nerve repair along with fixation of avulsion fracture of fibular head to restore the stability of knee joint , and the patient had an uneventful recovery . we conclude that the cpn laceration in closed hyperadduction injury associated with fibular head avulsion fracture is a rare complex . patients presenting with fibular head avulsion fractures at the knee and cpn injury should be subjected to early intervention with repair or reconstruction of the avulsion injuries and exploration of the cpn to achieve a good clinical outcome . the case report emphasizes on deviating from the usual expectant diagnosis and management of closed cpn injury .

introduction : the common peroneal nerve ( cpn ) injuries are the most common among lower limb nerve injuries because of its fixed attachment in the region of the neck of the fibula . the involvement of cpn following varus displacement of the knee is commonly expected to be traction neuropraxia . the spontaneous recovery is usually expected and the not so favorable results of repair have led to a debatable consensus on its surgical management . closed transaction / laceration of nerve following sports injury is highly uncommon.case report : a 27-year - old male sustained closed avulsion fracture of the fibular head with complete foot drop following a hyperadduction injury to the knee . early operative exploration revealed peroneal nerve laceration which was repaired primarily along with anatomical reduction of the fibular head which yields good results following early repair.conclusion:this case review emphasizes that severe damage to cpn may occur in spite of closed injuries to the knee . patients presenting with fibular head avulsion fractures at the knee and cpn injury should be subjected to early intervention with repair or reconstruction of the avulsion injuries and exploration of cpn to achieve good clinical outcome .

mitchel 1892 first reported presence of an anomalous structure and described as a process of horn like shape , curving from the base downward to cutting edge . mellor and ripa in 1970 coined the term talon cusp because of its resemblance to an eagle 's talon . its prevalence has an ethnic variation ranging from 0.06 in mexican children to 7.7% in north indian children . it originates as a result of outward folding of inner enamel epithelial cells ( precursor of ameloblasts ) and transient focal hyperplasia of peripheral cells of mesenchymal dental papilla ( precursor of odontoblasts ) during the morpho - differentiation stage of tooth development . it shows a predilection for permanent dentition ( 77% ) with a higher incidence in maxillary teeth ( 94% ) . maxillary lateral incisors are the most commonly affected ( 55% ) followed by central incisors ( 33% ) and canines ( 4% ) . maxillary lateral incisors susceptibility could be related to compression of tooth germ by external pressure from adjacent central incisor and canine , which develops about 7 months earlier . hattab et al . , classified the anomalous cusp based on the degree of their formation and extension as : type 1 talon : a morphologically well - delineated additional cusp that prominently projects from the palatal or labial surface of primary or permanent anterior tooth and extends at least half the distance from cementoenamel junction to the incisal edge . type 2 semi talon : an additional cusp of a millimeter or more but extending less than half the distance from cementoenamel junction to the incisal edge . type 3 trace talon : enlarged or prominent cingula and their variations , i.e. , conical , bifid , or tubercle - like . radio graphically , it is visible as v - shaped radiopaque structure superimposed over the normal image of the crown , in which enamel , dentin , and occasionally pulp space extension can be seen . early diagnosis and management of talon cusp is essential as it results in compromised esthetics , occlusal and tongue interferences , accidental fractures , increased caries susceptibility leading to pulpal and periodontal involvement . a 12-year - old boy reported to out patient department with a chief complaint of irregular teeth . clinical examination showed mal - aligned teeth with diastema between maxillary central incisors [ figure 1 ] . an anomalous pyramidal shaped structure was detected on the palatal surface of the left maxillary central incisor extending from the cervical margin of the tooth toward the incisal edge [ figure 2 ] . an intraoral periapical radiograph of tooth revealed a typical v - shaped radiopaque structure arising from cingulam of central incisor with its pulpal extension superimposed over the image of an affected crown without any signs of periapical pathology [ figure 3 ] . a 5-mm deep pulpotomy was performed at the exposure site with a sterile # 2 round bur . mineral trioxide aggregate ( mta ) ( dentsply maillefer , ballaigues , switzerland ) was mixed as per manufactures instructions and placed directly onto exposed pulp [ figures 4 and 5 ] . cavity was restored with glass ionomer cement at the same appointment . at 4-year follow - up , mineral trioxide aggregate pulpotomy clinical photograph immediate post - operative x - ray 4-year follow - up x - ray talon cusp usually occurs on the lingual surface of incisors , although there are case reports of their occurrence on the supernumerary , geminated and fused teeth . jowhari et al . , documented a case of facial talon and suggested altering definition of talon cusp to indicate possible projection from either lingual or facial surface of a tooth . a case of labial and palatal talon cusp on same tooth was reported by abbott in 1998 . the extent of pulp horn is difficult to distinguish on a radiograph because of its superimposition over the main pulp chamber . siraci et al . , suggested the use of cone beam computed tomography cbct in determining pulpal extensions into talon cusp . treatment requires careful clinical judgment and depends on the size and shape of talon cusp . prophylactic sealing of deep developmental groove has been advocated to prevent the development of caries . in cases of teeth with immature apices , gradual reduction of talon cusp followed by application of desensitizing agent and sealing has been advocated to preserve pulp vitality . grinding on side of the cusp is recommended to initiate reparative dentin deposition because of the location of most of the odontoblasts along the length of cusp . formation of secondary dentin at lateral walls led to constriction of pulp and total obliteration of pulp horn can not be achieved . however , this can not be applied predictably in all situations because of chances of sensitivity development , multiple visits , longer duration of treatment and requires patient compliance . when occlusal interference is severe , a complete reduction of cusp followed by vital pulp therapy or endodontic therapy can be completed in a single visit . vital pulp therapy has a higher success rate compared to endodontic treatment , irrespective of the size of exposure . success rates of 91% for pulpotomy was seen in comparison to 80% in direct pulp capping when performed under aseptic conditions and has been attributed to removal of inflamed pulp and reduction in bacterial load . mta has replaced calcium hydroxide because of its biocompatibility , excellent sealing ability , antibacterial properties and property to induce hard tissue formation in pulpal tissue . histological examination of mta pulpotomies showed a rapid , continuous , thicker dentin bridge with no tunnel defects or imperfections and more frequent presence of odontoblastic layer when compared with calcium hydroxide based materials . koh et al . , suggested use of mta as an alternative to existing materials in prophylactic treatment of dense evaginatus . this paper presents a case of type 1 talon cusp with a 4-year follow - up , successfully managed by mta pulpotomy . use of mta pulpotomy can be a possible single - sitting treatment option for management of talon cusp .

to use mineral trioxide aggregate ( mta ) in prophylactic management of talon cusp . talon cusp is an endodontic oddity that possesses a treatment challenge to the clinician , especially when it causes esthetic and functional problems . management ranges from periodic gradual reduction to radical removal followed by vital pulp / endodontic therapy . mta has replaced calcium hydroxide as pulp capping material because of its superior properties . a 12-year - old boy reported with a complaint of irregular teeth . clinical and radiographic examination revealed talon cusp on maxillary left central incisor . radical removal of talon cusp and mta pulpotomy was performed . the 4-year follow - up showed the positive pulp vitality test without any radiographic changes , emphasizing the use of mta pulpotomy in successful management of talon cusp .

accordingly , the number of reports of laparoscopic pancreaticoduodenectomy ( lap pd ) has gradually increased . although the feasibility and safety of lap pd have been established in institutes particularly experienced in the skilled performance of this technique ( hereafter referred to as experienced institutes ) , the benefit of lap pd beyond conventional surgery has not yet been shown . the management of concomitant abdominal aortic aneurysm ( aaa ) and intra - abdominal malignancy is controversial . three issues must be considered in the development of a treatment technique in such cases . the first is mutual interference because of operative fields that are in close vicinity to one another , resulting in adhesions or collateral injuries . the last is postoperative complications , especially intra - abdominal abscessation with graft infection . in particular , the pancreas is the organ that is most resistant to resolution of these issues because of its anatomical proximity to the aorta and severity of pancreatic fistulae as a postoperative complication . the feasibility and safety of endovascular repair ( evar ) for aaa have been established . in addition , laparoscopic colectomy and evar for aaa were successfully performed in a patient . similarly , lap pd and evar for aaa could have some benefits for patients . however , to the best of our knowledge , concomitant treatment by lap pd and evar has never been reported . a 70-year - old japanese man was referred from vascular surgery for investigation of a pancreatic tumor , which was identified as a cystic tumor of the pancreas head by computed tomography ( ct ) . within 1.5 years he had a previous history of percutaneous coronary intervention for acute myocardial infarction when he was 66 years old and aortic stent grafting for an aaa when he was 68 years old . the aaa was located on the infrarenal aorta with a thrombus of 52 mm ( fig . the height , weight , and body mass index of the patient were 163 cm , 67.3 kg , and 25.3 , respectively . a ct scan showed a cystic tumor of 31-mm diameter in the pancreas head without dilatation of the main pancreatic duct ( fig . 2 ) , but contrast - enhanced endoscopic sonography revealed a nodule among the cyst mucus ( fig . thus , we diagnosed the enlarging tumor as a branched - type ipmn with a nodule and planned to perform a resection . to avoid disturbing the aaa or stimulating a residual aaa , we intended to perform lap pd . open laparoscopy was performed at the umbilicus , and an additional five ports were placed ( fig . the patient had severe visceral steatosis , and the abdominal cavity was filled with omental fat . for mobilization around the ligament of treitz and the fourth portion of the duodenum , an additional port was placed at the middle of the inferior abdomen ( fig . 3 ) . during this procedure , neither duodenal adhesion to the aorta nor other inflammatory changes due to the previously placed stent graft were observed . after mobilization , an upper - middle incision of 15 cm was made , and the pancreas head was excised and removed . a pancreato - jejunal anastomosis was created by hand - suturing between the pancreatic duct and the jejunal mucosa . although the patient required medical therapy for pancreatic fistulae ( grade b according to the international study group on pancreatic fistula [ isgpf ] ) , his postoperative recovery was uneventful . the pathological diagnosis was intraductal papillary mucinous adenoma with small foci of carcinoma in situ ( fig . lap pd after evar for aaa was safely performed with both rigorous preoperative planning and a meticulous operation . although lap pd is one of the most complicated procedures in laparoscopic surgery , its safety and feasibility have been reported in experienced institutions . pancreatic cancer , as a representation of pancreas head tumors , has a poor prognosis . thus , the indications for lap pd in patients with pancreatic cancer are very limited . this case involved an ipmn , and the patient was thus a good candidate for lap pd . there are few operative indications for this type of neoplasia , and reported cases have shown a poor prognosis . when pancreatic cancer and aaa are simultaneously present , pancreatectomy is first recommended , including determination of the stage of the cancer . second , mutual interference between the two conditions is undeniable because of the proximity of the pancreas to the aorta . deiparine advocated division of the retroperitoneal dissection procedure : right - sided dissection for pd and left - sided dissection for abdominal aortic bypass . the last is the severity of the postoperative complications after pancreatectomy . in the present case , laparoscopic dissection of the pancreas head was safely performed without interference of the residual aaa because the axis of the laparoscopic procedure was located apart from the aaa ( fig . moreover , laparoscopic procedures require smaller operative fields using magnified visualization . these are benefits of the laparoscopic approach for patients with aaa . after the resection , an upper abdominal incision was made and reconstruction of the pancreas stump was performed through the incision . this reconstruction involved wirsung anastomosis , which represents the usual manner of standard pd in our institute . total lap pd has been reported in experienced institutes ; however , other reconstruction methods and no reconstruction have also been reported . thus , we performed reconstruction by hand as usual because laparoscopic reconstruction had not replaced hand sewing at that time in our institute . the additional upper incision is adequately located apart from the aaa ; therefore , the reconstruction procedure is safely performed without interference by the aaa . the isgpf grade b pancreatic fistulae healed with medical therapy and without graft infection . the pancreatic tumor was detected during follow - up of the aaa after evar . increased performance of evar for written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request . norihiko ishikawa , mari shimada , and hideki moriyama performed the lap pd with the corresponding author .

introductionmost gastroenterological surgeries , even pancreatic surgery , can now be performed laparoscopically . however , the management of concomitant abdominal aortic aneurysm ( aaa ) and intra - abdominal malignancy is controversial . the performance of endovascular repair ( evar ) for aaa has been increasing ; however , there is no report of laparoscopic pancreaticoduodenectomy after evar.presentation of casea pancreatic tumor was detected during follow - up after evar for aaa . the enlarging tumor was diagnosed as an intraductal papillary mucinous tumor with a nodule . laparoscopic pancreaticoduodenectomy was safely performed . after laparoscopic dissection around the pancreas head , an additional incision was made in the upper abdomen , and pancreatic reconstruction was performed through the incision . in spite of grade b pancreatic fistulae , the patient recovered with medical therapy . the pathological diagnosis was intraductal papillary mucinous adenoma with small foci of carcinoma in situ . the patient has been well with neither recurrence of the tumor nor any cardiovascular events for 18 months.discussionthe management of concomitant malignancy and aaa is challenging , especially in patients with a pancreatic tumor . the reasons for the rarity of treatment include prognosis , anatomical vicinity , and postoperative complications . evar reduces retroperitoneal adhesions . a laparoscopic approach provides a small operative field and decreases mutual interference with aaa . moreover , reconstruction is performed through an upper abdominal incision apart from the aaa . hand - sewing provides more reliable stability of the anastomosis.conclusionthe increasing frequency of performance of evar for aaa and subsequent computed tomography may help to detect malignancy . laparoscopic surgery appears to be a valid approach to malignancy after evar .

baseline flt imaging in this patient with metastatic malignant melanoma demonstrated splenic ( s ) , peritoneal ( p ) and bm metastases . after 14 days of treatment with a novel antiangiogenesis agent the upper abdominal peritoneal deposit ( vertical arrow ) had substantially decreased activity while the lower abdominal focus could no longer be visualised . uptake at sites of baseline abnormality in the spleen ( horizontal arrow ) and right femoral bm ( oblique arrow ) were relatively photopaenic compared to adjacent normal tissues . fdg pet scanning ( not shown ) demonstrated no change over the same period . most clinical studies of hypoxia imaging have utilized the nitroimadozole , [ f]fluoromisonidazole ( fmiso ) . slow blood pool clearance and high lipophilicity contribute to significant background activity and relatively low contrast between hypoxic and normal tissues . a new agent [ f]fluoro - azomyacinarabinofuranoside ( faza ) has lower lipophilicity as demonstrated by low brain uptake in the left panel . more rapid blood clearance with similar absolute uptake in hypoxic tissue leads to higher contrast as demonstrated in this comparative study of faza ( left ) and fmiso ( right ) scans in a patient with locally advanced retropharyngeal cancer .

despite the excellent clinical performance of fluorodeoxyglucose ( fdg ) as a cancer - imaging agent for positron emission tomography ( pet ) , false positive and false negative results can be problematic in some clinical settings . radiopharmaceutical development has recently focussed on the search for new pet tracers that could complement or replace fdg in such settings . due to the general availability and favourable physical properties of fluorine-18 , much effort has been directed to fluorinated compounds . the most promising of these are discussed .

tuberculosis , one of the oldest diseases known to affect human being , is caused by bacteria belonging to the mycobacterium tuberculosis complex . transmission usually takes place through airborne spread of droplet nuclei produced by patients with infectious pulmonary tuberculosis . oral mucosa is a rare location for tubercular infection , and it may either be primary or more often secondary infection . different areas of oral cavity like floor of mouth , soft palate , gingiva , lips , hard palate can be involved ; however , hard palate and tongue are the commonest sites of involvement for oral tuberculosis . a 40-year - old male patient presented to our outpatient department because of difficulty in swallowing solid food for two months . this patient also complained of a painless ulceration in his soft palate , malaise , and weight loss since last two months . there is no history of rise of temperature , cough , hemoptysis , hoarseness of voice , regurgitation of food . clinical examination revealed an irregular area of 3 2 centimeters over the soft palate and uvula . hard palate , tonsil , tongue , pharynx were within normal limit [ figure 1 ] . the regional cervical group of lymph nodes was not palpable when the patient presented to us . palatal ulcer before treatment erythrocyte sedimentation rate was raised ( 77 mm / hour ) . nasal endoscopy , fiberoptic laryngoscopy , barium swallow x - ray of esophagus , and x - ray paranasal sinus ( water 's view ) were within normal limit . punch biopsy was taken from the ulcerated lesions over the soft palate under topical anesthesia ; bleeding controlled by application of local pressure . histopathological examination of the tissue revealed presence of epithelioid cells , mononuclear inflammatory cells , langhans type of giant cells forming granulomas with focal caseous necrosis [ figure 2 ] . staining for acid - fast bacillus granulomatous inflammation pattern on histology ( h and e , 400 ) in accordance with the existing guidelines , the patient was administered anti - tubercular medication ( cat 1 four drugs for two months followed by two drugs for four months ) . his difficulty in swallowing reduced rapidly ; his ulceration regressed within one and half months of chemotherapy . although tuberculosis has definite affinity for lungs , it can affect any part of body including oral cavity . oral manifestation of tb tuberculous involvement of the oral cavity is extremely rare , with incidence ranging from . 05 - 5% . an intact and healthy mucosa seems to provide a sufficient barrier to mycobacteria , with saliva also helping to control the organisms . although oral tuberculosis has been well - documented , tuberculous lesions of the upper aerodigestive tract have become rare . oral tuberculosis most commonly results from contact of infected sputum with oral mucosa or hematogenous dissemination in an older individual with pulmonary disease . in contrast , cases of primary infection arising through direct mucosal invasion by mycobacteria are uncommon and typically are seen in young patients , who often present with cervical lymphadenopathy with or without cutaneous sinus formation . the sites demonstrating the most frequent involvement with primary tuberculosis are the gingivae , vestibular mucosa , and extraction sockets . mucosal lacerations and dental extractions have been implicated as predisposing an individual to the development of oral tuberculosis . traditionally , the diagnosis of tuberculosis has been made on the basis of clinical , radiographic findings , and sputum examination . the diagnosis of oro - facial tuberculosis can be quite challenging , mainly because of a lack of definite signs and symptoms . according to pandit et al . , ( 1995 ) , when considering the overall prevalence of tuberculosis of indian population , the presence of epithelioid cell granuloma is indicative of disease unless proven otherwise . 1991 ) reported two cases of primary tb of the oral cavity where smears and culture for afb , from the oral lesion and the sputum , were negative . they confirmed the diagnosis solely on the basis of history and histopathological examination , which only revealed giant cells and epithelioid cells . oral ulceration can be a manifestation of primary syphilis and fungal diseases , and non - infectious processes such as chronic trauma and squamous cell carcinoma . multinucleated giant cells of langhans type are frequently seen in various granulomatous lesions such as tuberculosis , leprosy , syphilis , sarcoidosis , crohn 's disease , eosinophilic granuloma , and certain fungal diseases . lepromatous leprosy lesions are associated with the involvement of superficial nerves leading to anesthesia and paresthesia , which may cause unrealized trauma leading to ulcers and secondary infection . crohn 's disease manifests itself as granulomatous nodules and ulcers in the oral cavity along with associated gastrointestinal symptoms . fungal lesions such as histoplasmosis , blastomyosis , and coccidiodomycosis should also be considered during diagnosis of an oral lesion . microscopically , organisms can be identified with stains such as hematoxylin and eosin ( h and e ) , periodic acid - schiff ( pas ) , or methenamine silver . sporangia may be found free within necrotic tissue or within the epithelioid cells and giant cells of the granuloma . fungal cultures can be an aid in identification of specific fungal species . in our patient , we got epithelioid cell granuloma , also the giant cells and caseous necrosis in histopathologic examination ; his mantoux test elicited a strongly positive reaction with an induration of 14 18 mm after 72 hours , and patient was managed solely with anti - tubercular chemotherapy .

a 40-year - old male patient presented to our clinic with history of dysphagia and ulceration in the palate for two months . after history - taking and thorough clinical examination , investigations like routine blood parameters , chest skiagram , sputum for acid - fast bacilli , ultrasonography of the abdomen , and biopsy from the palatal lesion were performed . no evidence in support of pulmonary or abdominal tuberculosis was found . histopathological examination of the biopsy revealed granulomatous inflammation with langhans giant cells and caseation necrosis . diagnosis of primary tuberculosis of soft palate was made . anti- tubercular regimen ( cat i ) for 6 months was prescribed , and we got a dramatic response noted within 15 days . as isolated tuberculosis of soft palate is a very rare entity , one should , therefore , consider it in any case of chronic ulcer of the soft palate . response to cat 1 was excellent in our case .

presence of associated anomalies suggests a developmental origin of the arachnoid cysts . we present a case of a 6-year - old boy who presented with paraparesis and a brief review of the etiology and pathogenesis in relevance to clinical decision making is also presented . a 6-year - old boy presented to us with complaints of recent onset difficulty in walking and dribbling of urine . on examination he had grade 3/5 power in both lower limbs and absent reflexes . an mri spine was performed which revealed a clearly defined intradural cystic lesion extending from l2 to s2 which was hypointense on t1-weighted images [ figure 1 ] and hyperintense on t2-weighted images [ figure 2 ] with tethering of cord . a tentative diagnosis of lumbosacral arachnoid cyst was made and the patient was taken up for surgery . multiple level laminectomies were performed and on opening the dura a tense cyst was found [ figure 4 ] along with short and thickened filum terminale . there were no other associated lesions . postoperatively the child 's motor power began to improve though his bladder was kept catheterized . postoperative mri was done which showed complete resolution of cyst [ figure 5 ] . at follow - up of 2 months patient t1-weighted mri showing hypodense intradural cystic lesion extending from l2 to s2 t2-weighted image showing hyperintense lesion syrinx in the cervicodorsal spine intra operative photograph showing tense cyst on opening the dura postoperative mri showing complete decompression of cyst arachnoid cysts of the spine are collections of cerebrospinal fluid ( csf ) within protrusions of arachnoid that can occur in a perineural , extradural , intradural , or intra - extradural site . these lesions are most often located posterior to the spinal cord but have also been identified anteriorly . the thoracic spine is the most common location followed by lumbosacral and cervical spine . spinal arachnoid cysts are equally prevalent in men and women usually presenting in the fourth and fifth decades of life . rarely they may present in children with other anomalies thus lending support to congenital etiology of spinal arachnoid cysts . idiopathic arachnoid cysts in children are associated with neural tube defects and in adults with spinal deformities . type 1 included extradural cysts , type 2 included cysts involving nerve root also known as tarlov perineural cyst and type 3 consisted of intradural cysts . intradural cysts are outpouchings of arachnoid that , regardless of size , lie entirely within the dural space . lumbosacral arachnoid cysts are believed to occur as a disorder of secondary neurulation . while patients with arachnoid cysts / meningoceles are usually neurologically normal , 90% of patients with meningocele have associated occult spinal lesions such as tight filum terminale , split cord malformation , and epidermoids . alterations in the arachnoid trabeculae that overlie the spinal cord are probably the root cause . these alterations may be a congenital or may be caused by inflammation from previous trauma , surgery , or subarachnoid hemorrhage . in some cases no cause can be established , it has been hypothesized that these lesions develop from the septum posticum of schwalbe which is an arachnoid membrane dividing the midline posterior cervical and thoracic subarachnoid space . but such a hypothesis does not explain cysts occurring anterior to the cord . according to the hydrodynamic theory normal pulsations of the csf dilate weak areas of arachnoid which then progressively enlarge and form a cyst . a ball valve effect at the neck of the diverticulum is probably responsible for the progressive enlargement of the cyst . these pockets of fluid lead to further disruption of normal pulsatile csf flow and are capable of expanding and developing into cysts . most spinal arachnoid cysts are asymptomatic and are discovered incidentally on magnetic resonance ( mri ) . mri is the most sensitive and specific study for detecting a spinal arachnoid cyst and for assessing the extent of the cyst wall . the signal intensity of arachnoid cyst fluid is the same as csf on t1 and t2 images . sometimes higher signal intensity is seen on t2 which maybe related to increased protein content of sequestered fluid or absence of motion effects . diffusion - weighted mri not only helps differentiate the arachnoid cyst from epidermoid cyst , abscess , or tumors but also evaluates spinal cord atrophy and inflammatory changes . although ct myelography has been used to establish or refute communication between the intraspinal subarachnoid space and the arachnoid cyst , it is more sensitive in determining whether a communication exists rather than locating the communication . 12 kinematic mri ( cine - mri ) helps locate the communication which appear as pulsating turbulent flow voids . the presentation of sacral arachnoid cysts varies from long standing low back pain to neurological deficits such absent deep tendon reflexes or bowel bladder abnormalities . radicular pain if present is relieved by lying down which pushes fluid out of the cyst . the treatment decision needs consideration of the extent of the cyst , the point at which the spinal cord is maximally compressed and presence or absence of communication between cyst and subarachnoid space . aspiration under mri guidance is advised for small cysts which have no communication with subarachnoid space . for moderate - sized cysts complete excision is advised and multiseptated cysts extending over several segments , cyst fenestration can be done to avoid extended laminectomy . percutaneous cyst drainage can be tried as a temporary measure to decrease symptoms or as a test of success of operative management . the success of the treatment modality employed ultimately depends on the degree of correlation of the mri findings with the patient 's symptoms . on histopathology , the walls of arachnoid cysts are usually seen as fibrous and lined by meningothelial cells . these cells are usually negative for gfap , s-100 , transthyretin ( prealbumin ) , and cea staining thus differentiating them from epithelial cysts . surgery typically results in excellent outcomes in terms of resolution of symptoms , and is effective across a large range of cyst sizes . arachnoid cysts of the spine may occasionally be encountered in the work up of neurological symptoms or incidentally . it is important to be aware of the possibilities of other congenital anomalies of the spine and investigate for the same . for good surgical outcome

arachnoid cysts are cerebrospinal fluid collections in the spine that can present with neurological symptoms or be discovered accidentally . intradural location of such cysts especially in the lumbosacral region is relatively rare . the association of such cysts with other congenital anomalies such as tethered cord lends evidence to the developmental origin of arachnoid cysts . we report a case of lumbosacral arachnoid cyst with tethered cord in a 6-year - old male child and discuss the etiopathogenesis and management options .

a 17-year - old male was referred to emergency department immediately after a gsi . on arrival , he was conscious , the vital signs were within normal limits , and no neurological deficit was noted . the right globe was ruptured and light perception was negative on the right eye . on physical examination , a single bullet entry hole on the right posterior scapular area was detected [ fig . ( a ) particular appearance of skin wound including small contusion , skin introflection , and simple ecchymosis with frayed margins in the right posterior scapular area . ( b and c ) the preoperative appearances of the globe in emergency and operation room the only detectable exit wound was the right orbit . the route of the bullet was identified by computed tomography ( ct ) scans obtained in several projections and signs of the damage along the path of the bullet entering from the right scapular region and leaving the body from the right orbit were confirmed [ fig . identified route was ; entrance from the right posterior scapular region , passing neighboring to right lung , moving upward to the cranium by side of the carotid artery and the vein , fracturing lateral and posterior wall of the maxillar sinus , entering the orbit fracturing the orbital floor , and leaving the body through the orbit perforating the right eye [ fig . orbital computed tomography , sagittal section ; along the path of the bullet , there were signs of emphysema and hematoma in the soft tissue and at the right parapharyngeal , the masticator and the inferiotemporal muscles due to penetrating injury . furthermore , bone fracture fragments were observed along this path , especially in the lateral and the posterior wall of the maxillar sinus primary reparation under general anesthesia was performed . however , as the double perforation was so severe no postoperative visual function was preserved . unusual presentations of bullet trajectory in gsi can create surgical and/or medico - legal diagnostic problems . since the face and neck region is packed with the vital structures in a relatively small volume of space , even the smallest of movements by a penetrating missile may injure a major vein , artery , and main nerve trunk simultaneously . moreover , especially the injuries to the neck and maxillofacial region could end with high morbidity and mortality . gsi to the orbit , especially the ones penetrating the globe could have devastating effects on all intra- and peri - orbital structures . as the bullet has both forward and rotatory movements , it possesses much higher amounts of kinetic energy to cause more damage in the eye . the energy is dissipated as the bullet slows within the soft tissues or the orbit . high - velocity injuries also cause secondary damage due to the fragmentation of bone , which is shattered by the missile on impact and enhance the injury . nature and severity of the damage and preservation of visual function depends on the direction of impact and the part of globe involved . in case of perforating injury , loss of vision is common as in our case or even loss of eyeball and late enophthalmos in many cases . primary evisceration may be needed in cases with severely ruptured globe if reconstruction is not possible . on the other hand in closed injuries , globe concussion , retinal detachment , optic nerve avulsion , or chorioretinal lacerations some unusual routes of bullet in gsi are reported in the literature . in these awkward injuries , the prediction of the trajectory is very difficult without additional radiological investigations . especially in case of any high velocity projectile wounding , the physician must be aware of the fact that the bullet 's course will not be a linear but most probably a complicated one . the entry wound and the exit wound should be both carefully explored . over - concern with the entry wound ct is the procedure of choice to detect any hemorrhage , air , bullet , bone fragments , hemothorax , nerve lesion , musculoskeletal lesions , and vessels injuries . ct imaging is also useful for assessing the missile path and the anatomical structures at risk . prognosis of the injury depends on the course of the bullet or shrapnel fragment and the multidisciplinary team approach . moreover , even the crime investigation might be enlightened by the demonstration of the bullet 's route . herein , a very unusual route of a bullet entering from the scapular area , passing through the neck and ending with eye perforation is reported . the accurate detection of entrance and exit wounds , path and extent of tissue damage were difficult . although the area pierced by the bullet was rich in neurovascular structures - many of which are extremely important - by chance the patient did not suffer any life - threatening injury . as the dynamics of the shot was investigated , he was thought to be injured with a trajectory from below to above while he was running away from the gunshot . the knowledge of the path of the missile , an open - minded approach , interdisciplinary care , and close clinical observation of the patient are critical for the assessment of management in atypical gunshot wounds .

herein , an awkward case of globe perforation with a bullet - entering from the right posterior scapular region and leaving the body from the right orbit through the eye - is reported . route of the bullet could be devastating - as it passed through the neck and the maxillofacial region - however by chance no vital damage occurred . its path was assessed by plain radiography and computed tomography scans . sometimes prediction of the trajectory is very difficult without additional radiological investigations . especially , in the case of any high velocity projectile wounding , physician must be aware of the fact that the bullet 's course will not be a linear but most probably a complicated one . prognosis of the injury depends on the path of the bullet or shrapnel fragment , close clinical observation , an open - minded approach , and the multidisciplinary care . moreover , even the crime investigation might be needed .

a 26-year - old man was admitted to the emergency department with a 24-hour history of diffuse abdominal pain that had started in the epigastric area , then localized at the right lower quadrant ( rlq ) , followed by nausea and vomiting . physical examination revealed a mcburney incision scar . tenderness and rebound tenderness were noted in the rlq during palpation . white blood cell ( wbc ) count was 17400 cells / mm with a neutrophil percentage of 78% , whereas c - reactive protein ( crp ) was in normal reference ranges . contrast - enhanced computed tomography ( cect ) scan of abdomen and pelvis showed pericecal free pelvic fluid , cecal inflammation and inflammatory changes in the rlq with a dilated tubular structure extending from the base of the cecum ( figure 1 ) . yellow arrow : periceceal free pelvic fluid , cecal inflammation ; red arrow : right lower quadrant with a dilated tubular structure ( stump appendicitis ) . after adhesiolysis , a remnant suppurative appendiceal stump 5 cm . in size was noted . the postoperative period was uneventful and the patient was discharged on the seventh postoperative day . histopathological examination confirmed stump appendix 5 cm in size with features of local peritonitis ( figure 2 ) . on surface epithelium ulceration , all the layers of appendix wall leukocyte infiltration ( hematoxylin and eosin 100 ) . most patients diagnosed with stump appendicitis present with typical symptoms and findings of acute appendicitis , including pain that starts periumbilically and migrates to the rlq with anorexia , nausea and vomiting . leukocyte count and crp levels tomography scan is more useful than ultrasound to diagnose stump appendicitis , as ultrasonographic findings are not characteristic [ 2 , 4 ] . cect scan can reveal findings that support the diagnosis of stump appendicitis , such as inflammatory changes in pericecal region , thickening of cecal wall , abscess formation , presence of fluid in right paracolic area , and air - filled tubular structure [ 5 , 6 ] . clinical diagnosis of stump appendicitis may be difficult due to underlying conditions like mental retardation , pregnancy , immune suppression and steroid use . medical history of appendectomy can also lead to delay or even missed diagnosis of stump appendicitis . therefore , stump appendicitis should be considered in differential diagnosis of patients with acute abdomen indication , appendectomy or mcburney s incision scar . cecal diverticulitis should also be considered in differential diagnosis of stump appendicitis since cecal diverticulitis is clinically indistinguishable from acute appendicitis . it has been reported that almost 70% of patients with cecal diverticulitis underwent surgery based on preoperative diagnosis of acute appendicitis , and correct preoperative diagnosis was made in only 5.3% of 318 patients . it is also reported that time interval from initial appendectomy to stump appendectomy may vary from 2 months to 50 years [ 1 , 9 ] . in the present case , rate of perforation for stump appendicitis ( detected during surgery ) approaches 68% and length of hospital stay increases due to delayed diagnosis . appropriate stump length to be left after appendectomy is 35 mm to prevent stump appendicitis . stump appendicitis has been reported after both open and laparoscopic appendectomy ; there is very little difference between various surgical techniques in terms of increase in incidence of stump appendicitis . in both open and laparoscopic appendectomy , a longer stump can be obstructed with fecalith , which may lead to chronic inflammation causing ischemia of appendiceal wall and eventually perforate and/or suppurate . while some authors do not support this idea , incidence of stump appendicitis has increased relative to the increase of laparoscopic appendectomy . in an open or laparoscopic approach , careful appendix artery dissection of taenia coli appendiceal cecal junction identification is very important , especially for subserous appendix . in the present case , retrospective examination of patient s medical records of first appendectomy revealed multiple abscesses and adhesions in right iliac fossa ( rif ) . it is important to understand that a history of appendectomy is , by itself , insufficient to exclude diagnosis of appendicitis . presence of mcburney scar may be a warning for surgeons to consider stump appendicitis during an emergency examination . identification of appendiceal base by tracing taenia coli to appendix is very important to prevent stump appendicitis . appendiceal stump of less than 5 mm in length can minimize incidence of stump appendicitis . careful evaluation of clinical and computed tomography ( ct ) scan findings may prevent delay in diagnosis , and decrease morbidity and length of hospital stay .

stump appendicitis is an acute inflammation of remnant appendix , a rare complication of incomplete appendectomy . it may present as acute abdomen with history of appendectomy , which may cause delay in diagnosis . therefore , incomplete appendectomy should be considered as a differential diagnosis of acute abdomen in patients with medical history of appendectomy . the present case is one of stump appendicitis 6 months after appendectomy . stump appendectomy was performed and the patient was discharged 7 days after the operation without any complication .

tracheobronchopathia osteochondroplastica ( to ) is a rare benign airway disease typically characterized by the presence of multiple rock - garden - like nodules in the lower trachea and upper main bronchi ( 1 ) . because of the absence of cartilage in this region of the airway , these nodules involve the anterior and lateral walls of the trachea and the bronchus , sparing the posterior membranous wall ( 2 ) . several reported cases have demonstrated successful surgical intervention and bronchoscopic laser therapy for advanced symptomatic patients ( 2,3 ) . we herein report the successful bronchoscopic resection of a symptomatic localized polyp due to to using a high - frequency snare . an 80-year - old japanese man was admitted to our hospital for the evaluation and management of multiple tracheobronchial polyposis and right middle lobe atelectasis . he had a history of polyarteritis nodosa and had been treated with corticosteroids ( prednisolone 6 mg / day ) . chest computed tomography ( ct ) revealed diffuse calcified lesions throughout the cartilaginous regions of the trachea and bronchi , right middle atelectasis , and airway polyps ( 4 - 9 mm ) in the left trachea and the left main bronchus ( fig . 1 ) . the bronchoscopic findings showed diffuse edematous mucosal lesions with polyposis on the left side of the trachea , the right middle bronchus and the left main bronchus ( fig . 2 ) . a spirometric analysis demonstrated an obstructive impairment , and the forced expiratory volume in one second ( fev1 ) was 1.36 l , and fev1% was 43% . a transbronchial biopsy to make a diagnosis of the airway polyp was performed , and endoscopic mucosal resection was also carried out using a high - frequency snare to improve ventilatory insufficiency . to was pathologically confirmed in the resected submucosal cartilaginous tissue , and mature ossifications were also observed in the tissue ( fig . after resecting the airway polyp , the spirometric data of the fev1 and fev1% improved from 1.36 l to 1.69 l and from 43% to 93% , respectively . a : a coronal view of the chest mediastinal window shows diffuse calcified lesions throughout the cartilaginous regions of the trachea and bilateral bronchi . noncalcified endobronchial airway polyps are also seen on the left side of the trachea and the upper side of the left main bronchus ( white arrows ) . b : a transverse view of the chest mediastinal window demonstrates right middle lobe atelectasis and an endobronchial airway polyp with small calcified lesions ( white arrow ) in the right middle lobe bronchus . there are no remarkable abnormal findings in the trachea ( a ) and carina ( b ) , however , bronchoscopy showed a diffuse edematous mucosa with polyposis in the trachea ( a ) , carina ( b ) , right middle bronchus ( c ) and left main bronchus ( d ) . a : an endobronchial polyp lesion obtained from the left main bronchus demonstrated submucosal calcification , ossification and cartilage formation surrounded by chronic airway inflammatory cells . b : an enlarged view shows the polyp lesion to consist of submucosal ossification and inflammatory cells . the comprehensive etiology of to remains to be elucidated , however , chronic airway infections , irritant exposure , several metabolic disorders and genetic factors have been proposed to be causative factors of to ( 3,4 ) . this patient showed typical chest ct findings ( fig . 1 ) and unusual bronchoscopic features ( fig . long - term corticosteroid administration might be a potential explanation for the atypical bronchoscopic findings . tajima et al . reported that bone morphogenetic protein-2 ( bmp-2 ) played an important role in nodule formation and might synergistically act with transforming growth factor 1 ( tgf-1 ) to promote an inductive cascade of to nodules ( 5 ) . the airway polyp in our patient did not include mature ossifications in contrast to the previously reported cases ( 2,4 ) , and the long - term corticosteroid administration in this patient might be related to these pathological atypical findings , such as the suppression of calcified lesion formation . however , there has so far been no report describing the effects of corticosteroids on initiating and enlarging airway polyp formation ; thus , further studies are necessary to clarify the mechanism of airway polyp formation and effective treatment . reported that chronic airway inflammation might be an important factor in the formation of to , and they discussed the potential clinical effects of inhaled corticosteroids to improve the symptoms in patients in the early stage of this disease ( 3 ) . no guidelines have yet been established for the management of to , and systemic or inhaled corticosteroid treatment might be one of treatment choices for to without any problematic clinical symptoms , as seen in the present patient . in conclusion , we herein reported a rare case of to accompanied by unusual bronchoscopic features , such as multiple tracheobronchial polyposis , which was successfully treated using a high - frequency snare . to is a benign disorder , however , to may cause various clinical symptoms and spirometric impairments that necessitate the resection of airway polyps . physicians should therefore be aware of this disease and its clinical symptoms and include it in the differential diagnosis .

tracheobronchopathia osteochondroplastica ( to ) is a rare benign airway disease that is characterized by the presence of multiple rock - garden - like nodules on bronchoscopy . to is a slowly progressive disease of the trachea and major bronchi , which is typically characterized by such symptoms as a persistent nonproductive cough , dyspnea and wheezing . the clinical features of to are variable , and asymptomatic patients may incidentally be diagnosed during the work - up for other diseases . we herein report a rare case of to accompanying multiple tracheobronchial polyposis in which bronchoscopic resection of the airway polyp using a high - frequency snare was successfully performed .

we sequenced 12 bat brains positive for lyssavirus antigen detected by immunofluorescence and reverse transcription the 400-bp 5 variable extreme of the nucleoprotein gene of these eblv-1 strains was amplified by specific eblv-1 nested rt - pcr and sequenced by using the following primers : seqvar1f 5-1acgcttaacaaccagatcaaag22 - 3 , seqvar2f 5-51aaaaatgtaacacyyctaca70 - 3 , eblvseqvar1r 5-596cagtctcaaagatctgttccat575 - 3 , and eblvseqvar2r 5-552tagttcccagtattctgtcc533 - 3. all rabies - positive serotine bats came from southern spain ( huelva , seville , murcia , and badajoz ) and were molecularly identified as e. isabellinus ( 8) . an alignment was performed by using clustalx ( www.clustal.org ) to combine the obtained sequences and other available eblv-1 sequences from genbank , including a duvenhage virus used as the outgroup ( table a1 ) . before conducting further analyses , we used jmodeltest ( http://darwin.uvigo.es/software/jmodeltest.html ) to select the best fitting substitution model for our sequences according to the corrected akaike information criterion . maximum - likelihood phylogenies were reconstructed by using phyml ( http://atgc.lirmm.fr/phyml ) software and by using a generalized time - reversible model and the parameter estimated in the analyses . maximum - parsimony analyses were conducted by using paup * 4.0b10 ( http://paup.csit.fsu.edu/ ) weighting transversions 15 according to the transitions / transversion ratio estimated in the jmodeltest analyses . confidence in the topologies for the maximum - likelihood and the maximum - parsimony analyses was established with 1,000 bootstrap replicates . a bayesian phylogenetic inference was obtained by using mrbayes version 3.1 ( http://mrbayes.csit/fsu.edu/ ) with random starting trees without constraints . two simultaneous runs of 10 generations were conducted , each with 4 markov chains , and the trees were sampled every 100 generations . net p - distances between groups were calculated by using mega4 ( www.megasoftware.net ) ( figure 1 ) . european bat lyssavirus 1 ( eblv-1 ) phylogenetic reconstruction based on the first 400 bp of the nucleoprotein gene . the tree was obtained by bayesian inference run for 10 generations ; trees were sampled every 100 generations . bootstrap supports after 1,000 replicates for each node are also shown for maximum - parsimony ( green numbers ) and maximum - likelihood ( blue numbers ) analyses . net p - distance values ( as percentages ) between groups are indicated by arrows . a parsimony - based network is presented for each major lineage ; sizes of yellow circles are proportional to the number of individuals sharing a given haplotype , and reconstructed haplotypes ( median vectors ) are shown in red . duvv , duvenhage virus . the genetic structure and relationships between haplotypes were examined within the main lineages through a parsimony - based network built with a median - joining algorithm implemented in the network 4.5.1 program ( 11 ) . to evaluate and compare genetic variability and polymorphism among lineages , we estimated the number of haplotypes , mutations , and segregating sites as well as haplotype diversity and nucleotide diversity by using dnasp version 4.5 ( 12 ) for the major clades ( table ) . finally , to investigate population dynamics across lineages , the fu fs and tajima d statistics were calculated ( table ) . these 2 statistics are considered to be the most powerful tests for detecting expansion events ( 13 ) . * eblv , european bat lyssavirus ; n , no . sequences ; s , no . segregating sites ; eta , no . mutations ; hap , no . haplotypes ; hd , haplotype diversity ; varhd , haplotype variance ; pi , nucleotide diversity ; thetanuc , estimated population mutation rate per site ; k , average no . all phylogenetic analyses , regardless of the reconstruction criterion used , formed a monophyletic cluster of the eblv-1 strains from spain ( only the bayesian inference reconstruction is shown ) . the bayesian inference , maximum - likelihood , and maximum - parsimony analyses identified the cluster from spain and eblv-1a and eblv-1b as being monophyletic ( figure 1 ) , although only maximum - likelihood and maximum - parsimony analyses suggested a closer relationship between eblv-1a and the cluster from spain . the genetic differentiation of the eblv-1 strains from the iberian peninsula matches their association with another bat species ( figure 2 ) , which suggests that the host bat s evolutionary history plays a major role in eblv-1 molecular epidemiology , as has been proposed for rabies virus in bats in north america ( 14 ) . geographic distribution of eptesicus serotinus bats ( red ) , e. isabellinus bats ( blue ) , and cases of rabies in bats ( green dots ) , europe , 19902009 . obtained from rabies bulletin europe ( www.who-rabies-bulletin.org/ ) . the low genetic diversity and the fu fs and tajima d statistics ( table ) all suggest rapid population expansion of eblv-1a , which is consistent with the star - like structure of the network for this lineage ( figure 1 ) . conversely , haplotype and nucleotide diversity descriptors ( table ) have the highest values for eblv-1b and a complex network structure with differentiated subnetworks . the lineage from spain also has low diversity and a star - shaped network , but neutral evolution can not be rejected on the basis of the fs and d statistics . net distances are similar within and between lineages , except for eblv-1a , which is slightly more differentiated ( figure 1 ) . consequently , the suggested eblv-1 expansion from spain into europe ( 15 ) is not supported by our results , which record the highest variability and most complex phylogenetic structure for france and the netherlands ( figure 1 ) . this complex structure suggests either a longer evolutionary history in these areas or a recent contact of distinct bat lineages in this zone . the results of this study show that the strains from spain do not belong to subtype 1b because of their association with a different reservoir ( e. isabellinus bats ) . moreover , what is currently considered to be eblv-1b seems to include at least 4 lineages that are more genetically diverse and have a complex history . eblv-1a , however , has low genetic diversity despite its extensive geographic distribution , suggesting a relatively recent and successful expansion of this lineage . these results call into question the current classification of eblv-1 into 2 single subtypes . to provide a better understanding of eblv-1 molecular epidemiology in europe , additional studies that consider different genes should be conducted and the current classification should be revised accordingly .

to better understand the epidemiology of european bat lyssavirus 1 ( eblv-1 ) in europe , we phylogenetically characterized lyssavirus from eptesicus isabellinus bats in spain . an independent cluster of eblv-1 possibly resulted from geographic isolation and association with a different reservoir from other european strains . eblv-1 phylogeny is complex and probably associated with host evolutionary history .

redox biological signaling has significantly developed over the last couple of decades with small molecules such as no , co , h2s , and h2o2 being identified as competent signaling agents . nitroxyl ( hno ) , the oneelectron reduced / protonated form of no , has been discussed as a signaling agent , but the lack of specific & selective detection methods hampers a better understanding of its biology . significant advances in hno detection have occurred with the development of new copper and phosphinebased fluorescent probes and new electrochemical & mass spectrometric methods . with these mechanistically different ways to detect hno , questions regarding hno 's biology and endogenous formation can be approached . the most significant result is that the azaylide intermediate generated from the reaction of these probes and hno rapidly and reliably undergo a staudinger ligation resulting in fluorescence and a stable amide byproduct . reaction of these probes with rsno gives a similar azaylide , but in this case , the staudinger ligation does not occur or proceeds inefficiently . flow cytometry experiments show that these reactions also occur in cells and that these probes only detects hno in cells . one of the challenges starting this project was to not let our previous ideas about the chemistry dictate what experiments to do . we knew that rsno reacts with phosphines to yield azaylides that should undergo ligations and yield fluorescence . should we continue if we were going to see that our probes were not selective ? zhengrui miao noticed that no one had ever really directly compared the response of these probes to hno and rsno . he did this comparison and found fluorescence generation from hno treatment was greatly enhanced compared with rsno , and these findings initiated the study . the overall lesson is to keep an open mind and do n't plan the outcome of your experiments !

abstract invited for this month 's cover picture is the group of prof . s. bruce king at the department of chemistry of wake forest university . the cover picture shows a prefluorescent phosphinebased probe reacting with nitroxyl ( hno ) and s nitrosothiol ( rsno ) , nitrogen oxidederived biological signals . both species react with the prefluorescent probe , but only the product from the hno reaction can complete a further chemical ligation pathway that results in fluorescence , indicating the presence of hno . the product of the probe with rsno does not complete this ligation and does not generate a fluorescent species . these phosphinebased probes thus demonstrate a selectivity for hno over rsno based on their chemical reactivity and can be used in biological systems to differentiate these species . for more details , see the communication on p. 110 ff . read the full text of the article at 10.1002/open.201500200

premature ovarian aging ( poa ) is defined by elevated age - specific basal follicle stimulating hormone ( fsh ) cut - off levels with menstruation . the age - specific cut - off level under the age of 33 years ( our patient 's age ) is 7.0 miu / ml . there are four main causes for pof , namely , idiopathic , genetic , autoimmune , and viral causes . can we extend causes of pof to poa ? if causes are similar and we evaluate women for poa , can we delay the process of pof ? with these thoughts , we evaluated this patient and we are reporting the case . a study by gleicher et al . titled concluded that presumed underlying etiologies of poa follow a similar distribution pattern as reported for pof . they proved the hypotheses that poa is a precursor stage of pof and hence requires similar evaluation . she had an elevated basal fsh level of 28 miu / ml 3 months back . her height was 1.68 m and she weighed 50 kg with a body mass index of 19 kg / m . a transvaginal ultrasound scan showed a normal - sized uterus but ovaries were not visualized . the repeat basal fsh level ( after 6 weeks ) was 27 miu / ml . since the basal fsh level was above the age - specific cut - off level ( 7 miu / ml for 33 years of age ) , diagnosis of poa was considered and karyotype was requested . jacobs et al . described the first association of triple x syndrome with pof in 1959 . a total of 21 cases of pof with triple x syndrome have been reported in the literature , but to the best of our knowledge , this is the first case report of poa with triple x syndrome . genetic causes comprised approximately 16% of the total in the study conducted by gleicher et al . both autosomes and x chromosomal involvement they are turner mosaicism , partial x chromosome deletion , x chromosome mosaicism , x chromosome inactivation , and fmr 1 ( fragile site mental retardation x gene ) . x chromosome partial deletions are more common , while balanced x chromosome to autosome translocation of xq13q26 is rare , but documented . autosomes involved are at the following gene loci : 3q , 13q , 14q , 17q , 15q , and 11p . genetic defects are proposed to cause poa and pof by increasing atresia of ovarian follicles due to apoptosis or failure of follicle maturation and thus decreasing the pool of primordial follicles . triple x syndrome women also suffer from psychiatric disorders like schizophrenia , eeg abnormalities , scoliosis , and genitourinary malformations . poa with triple x syndrome and primary infertility is treated with ovulation induction by gonadotrophins , because of elevated basal fsh values . prenatal diagnosis for pregnant women with triple x syndrome is definitely required as there will be 25% chance of x chromosomal abnormalities in the offspring . hence , we conclude that it is essential to consider karyotyping for all cases of poa , and age - specific basal fsh values will help us detect cases of poa .

genetic aberrations comprise one - third of women with premature ovarian aging ( poa ) . x chromosome abnormalities are seen in these women . we report a case of a 29-year - old lady with primary infertility and poa . she was phenotypically normal and her basal follicle stimulating hormone level was above the age - specific cut - off . karyotype was triple x syndrome .

although various prostheses have been used for anterior chest wall reconstruction , selection of the procedure depends on the surgeons experience . the case of a patient who underwent reconstruction of the anterior chest wall using a titanium plate sandwiched between two polypropylene mesh sheets is reported . a 79-year - old woman was referred to our department with a diagnosis of recurrent chondrosarcoma . the first operation for sternal chondrosarcoma included sternal resection and reconstruction with polypropylene mesh and a musculocutaneous flap . however , 18 months after the first operation , computed tomography revealed five tumors located on the anterior chest wall and another tumor located in the subcutaneous tissue on the right chest wall . the tumors were considered metastatic lesions , with no evidence of enlarged mediastinal lymph nodes or distant metastases on radiographic examination . thus , it was judged that complete resection was possible , and the patient underwent subtotal sternectomy , total resection of the body and partial resection of the manubrium sternii , together with partial resection of the 1st5th ribs and costal arch , with a surgical margin of more than 1.0 cm for each tumor . this resection left a defect measuring 17 14 cm on the anterior chest wall . reconstruction of the defect was undertaken with a titanium plate ( titanium mini mesh sheet , 01 - 13155 , 132 82 mm ; thickness 0.5 mm , stryker leibinger & co. , germany ) sandwiched between two polypropylene mesh sheets . the lowermost and the uppermost layer consisted of a polypropylene mesh , and the sheet was fixed to the manubrium and each rib with absorbent suture . the middle layer was a titanium plate , which was fixed to the manubrium and costal arch directly by absorbable # 2 polyfilament braided suture and pulled toward each rib stump ( fig . 1 ) . . no paradoxical movement of the rib cage was noted during respiration in the postoperative period . twelve months after operation , the patient had maintained excellent range of motion without instability or lordosis ( fig . b chest wall defect after subtotal sternectomy and resection of the 1st5th ribs and costal arch . c the middle layer consists of a titanium plate fixed to the manubrium and costal arch , pulled to each rib stump . the lowermost layer is a polypropylene mesh sheet . d the uppermost layer consists of a polypropylene mesh sheet fixed to the manubrium and each ribfig . 2postoperative chest x - ray and computed tomography scans showing the titanium plates secured to the manubrium and ribs surgical images . a local recurrent tumors on the chest wall . b chest wall defect after subtotal sternectomy and resection of the 1st5th ribs and costal arch . c the middle layer consists of a titanium plate fixed to the manubrium and costal arch , pulled to each rib stump . the lowermost layer is a polypropylene mesh sheet . d the uppermost layer consists of a polypropylene mesh sheet fixed to the manubrium and each rib postoperative chest x - ray and computed tomography scans showing the titanium plates secured to the manubrium and ribs sternal tumors are uncommon ; however , they are of different pathological types , such as sarcoma and metastatic tumors of the breast , thyroid , kidney , and colon . king et al . recommended a 4-cm free margin for highly aggressive primary tumors and 2-cm margins for metastatic , benign , or low - grade malignancies to avoid local recurrences . in any case , complete resection of the sternal tumor results in a wide defect on the anterior chest wall . the ideal prosthetic material should be easily available , durable , easily usable , adaptable , rigid , resistant to infection , translucent to radiographs , and of low cost . generally , polypropylene mesh sheets or polytetrafluoroethylene patches ( e - ptfe ) covered with a musculocutaneous flap are used . however , their rigidity is insufficient to protect intrathoracic organs . various prostheses have been used , with sufficient rigidity , such as sandwiched polypropylene mesh and stainless steel mesh , methyl methacrylate sandwiched between polypropylene mesh , titanium plate - supported methyl methacrylate sandwich , titanium plate with gore - tex dual mesh , and composix mesh . however , methyl methacrylate is not easy to handle and is difficult to adapt to the shape of the patient s chest . titanium mini mesh sheet has strong rigidity , no plasticity , translucency to radiography , magnetic resonance imaging ( mri ) compatibility , and biocompatibility . we think that the combination of a metal material and a mesh is an appropriate prosthesis , because of its durability , ease of use , adaptability , rigidity , and translucency to radiography . the advantages of the present procedure are based on the easy use of the titanium plate , irrespective of the shape of the defect and the physiological nature of the material . the titanium plate is used to provide protection for intrathoracic organs , while the polypropylene mesh is flexible in both vertical directions and thus allows movement of the chest wall during breathing . in conclusion , the procedure with the titanium plate sandwiched between two polypropylene meshes achieved good fixation and flexibility . in patients who require extensive anterior chest wall and sternal resection ,

extensive sternal resection carries the risk of difficult reconstruction and surgical complications . a 79-year - old woman underwent sternal resection and reconstruction for sternal chondrosarcoma . however , 18 months after the first operation , she developed six metastatic tumors on the anterior chest wall . she underwent subtotal sternectomy and rib resection , leaving a defect measuring 17 14 cm . reconstruction of the anterior chest wall using a titanium plate sandwiched between two polypropylene mesh sheets is described . this method is potentially applicable to extensive anterior chest resection , and its advantages compared with conventional prostheses are rigidity , flexibility , and usability .

asphyxiation by an inhaled foreign body is a leading cause of accidental death among children younger than 4 years . in a recent series of 103 children with foreign body aspiration ( fba ) , 64% of the patients were boys and the majority ( 73% ) was younger than 3 years of age . the most common symptoms were sudden choking crisis ( 74% ) and paroxysms of cough ( 73% ) . the most sensitive and specific clinical features were choking ( 86% ) and witnessed aspiration episode ( 89% ) , respectively . available chest radiographs revealed radio - opaque objects in 27% of patients . in another series , fba was suspected by the parents in 59% of patients while witnessing of choking episode was the most important historical event to pinpoint an early diagnosis of fba in children . most aspirated foreign bodies are organic materials ( 81% ) , nuts , peanuts ( 59% ) , seeds , and fruits being the most common . although jellies may also be aspirated in the lungs of small children consuming sweets , there are no reports describing characteristics of gummy or jelly sweets fba in the literature . today , haribo0 is the biggest manufacturer of gummy and jelly sweets in the world , with its products mainly consisting of gummi bears , other jelly sweets and liquorice . we present a case of chewing gummi bear particles aspiration in a 5-year - old child . this is the first time that an extended haribo lung is described after a secret a previously healthy 5-year - old girl presented with a 24-hour history of sore throat , chest pain , and shortness of breath at the pediatric intensive care unit , university hospital , heraklion , greece . on physical examination a posteroanterior chest radiograph revealed right lung collapse and emphysema of the left lung , with tracheal deviation and mediastinal shift [ figure 1 ] . thoracic computed tomography scanning showed extensive multiple obstructions of the distal airways of the right lung which were initially suggestive of disseminated fba [ figure 2 ] . emergency bronchoscopy was performed and multiple small chewing gummi bear ( haribo ) particles impacted in the orifices of the right main bronchus and right lobar and segmentalinic bronchi were successfully removed and aspirated . next day chest radiograph result was normal and the patient was discharged uneventfully without any complication . chest radiograph showing tracheal deviation ( black arrows ) , mediastinal shift ( white arrow ) , left - sided hyperinflation , and low lung volumes and diffuse haziness on the right consistent with atelectasis ct scan displays multiple obstructed lobar and segmentalinic bronchi ( black arrows ) in the atelectatic right lung . sudden onset of cough ( 72% ) , dyspnea ( 64% ) , and wheeze ( 60% ) are the predominant symptoms and signs . the majority of foreign bodies ( 88% ) lodge in the bronchial tree ( right - sided 52% ) , with the remainder catching in the larynx or trachea . only 11% of the foreign bodies are radio - opaque on radiograph , with chest radiographs being normal in 17% of children . obstructive emphysema ( 53% ) and normal chest radiograph ( 34% ) are the most frequent radiological findings . clinical and radiological findings of pneumonia and atelectasis are significantly more common in the groups with negative bronchoscopy or with delayed diagnosis . however , in toddlers with unexplained acute respiratory distress with refractory parenchymal infiltrates , unrecognized fba should be considered . although rigid bronchoscopy is the traditional diagnostic gold standard , the use of computerized tomography , virtual bronchoscopy , and flexible bronchoscopy is increasing . aspiration of gummi bears may cause a silent choking episode leading to life threatening severe respiratory complains , even in children older than 4 years . in a recent healthy lifestyle in europe by nutrition in adolescence ( helena ) cross - sectional survey girls selected more fruit juice , water , herbal infusions , and sweets . gummy and jelly sweets have become a clear favorite , attracting a loyal fanbase which is constantly growing throughout the world . the chewing gummi bear ( haribo , bonn , germany ) , a dancing bear molded from fruit gum [ figure 3 ] , has inspired a million different variant innovations in size , animal , shape , color , and flavor . this is the first time that a lung filled with gummi bears is described after fba in a child ( medline search ) . the gummi / gummy bear is a dancing bear molded from fruit gum foreign body asphyxiation and ingestion needs a focus on education of parents and child caregivers regarding age , appropriate food , risk of play with small items , but also of older children consuming gummy or jelly sweets . legislation for gummy sweets could be extended to children up to the age of 6 years , and to similar products marketed for children . in conclusion , we have reported our experience with a first case of a haribo lodged in the right main bronchus and right lobar and segmentalinic bronchi . aspiration of gummy or jelly sweets may cause a silent choking episode leading to life threatening severe respiratory complains . clinicians should keep a high index of suspicion for silent asphyxia episodes in children consuming gummy or jelly sweets , even in those older than 4 years old . labels on these products should now include warnings for the danger of suffocation in all age 's children .

inhalation of foreign bodies , a leading cause of accidental death , is most common in preschool children . in this article we report our experience with a 5-year - old greek girl who presented with a 24-hour history of sore throat , chest pain , and shortness of breath . emergency bronchoscopy was performed and multiple small chewing gummi bear ( haribo ) particles impacted in the orifices of the right main bronchus and right lobar and segmentalinic bronchi were successfully removed and aspirated . aspiration of gummi bears , which is for the first time reported , may cause a silent choking episode leading to life - threatening bronchi obstruction at multiple sites , even in children older than 4 years .

a 53-year - old man presented with transient acute onset of left - sided numbness and speech disturbance one week prior to admission . transient ischemic attack or acute cerebral infarction were possible diagnoses , so mri and mr angiography were performed , showing an occlusion of his right mca at the proximal m1 segment without any acute ischemic lesion or infracted area on mri , including diffusion - weighted images . the next day , a conventional angiogram was taken and revealed a tapered occlusion at proximal m1 segment of right mca , collateral pathways through perforating arteries , rich pial collateralization from distal anterior cerebral artery , and a shift of the watershed zone ( fig . these findings were compatible with the long - standing stage of the occlusion of mca rather than the acute occlusion . he also has an incidental saccular aneurysm at left posterior communicating artery ( p - com ) origin . the brain single photon emission computed tomography ( spect ) showed mildly decreased perfusion in right middle cerebral artery territory and the vascular reserve was also decreased mildly after acetazolamide injection ( fig . an echocardiogram and myocardial spect excluded cardiac embolus as the etiology of the occlusion . although the patient had no past medical history , untreated hypertension and diabetic mellitus were found during evaluation . in this setting of presumably chronic occlusion the patient was initially treated with antiplatelet and circulating drug and carefully observed for two weeks . after two months , the left p - com aneurysm was managed by the microsurgical aneurysmal neck clipping and there were no developing or new neurologic symptoms after surgery . immediate postsurgical computed tomography angiogram ( cta ) showed persistent right mca occlusion and complete aneurysm clipping ( fig . the brain cta of 21 months after neck clipping developed recanalization of the previously occluded right mca . a subsequent conventional angiogram confirmed nearly complete patency of the right mca with focal mild stenosis , normal blood flow through mca , and the normalization of the shift of watershed zone ( fig . our patient experienced late spontaneous recanalization and restoration of blood flow by an unknown mechanism within 21 months , without any neurologic deficit . spontaneous recanalization of the occluded mca has been a common finding in acute ischemic stroke . several studies demonstrated that most recanalization may occur in the acute phase of stroke , within approximately 48 hours after onset [ 2 , 5 ] . a recent meta - analysis of thrombolytic therapy attempted to quantify spontaneous recanalization in ischemic stroke . spontaneous recanalization occurred in 21.4% of patients within 24 hours and in 52.7% of patients by a week . although the analysis of these data had limitations , including the variety of times examined , but the suggestion is that the natural history of cerebral embolus is dissolution and spontaneous recanalization over a period of time . like these studies , spontaneous recanalization of mca , in which occlusion is apparent in the acute phase have occasionally occurred in the subacute phase of stroke . but late recanalization in the chronic phase has not been reported to the best of our knowledge . unlike recanalization of occluded artery in acute stroke , the spontaneous recanalization of a long - standing occlusion of extracranial artery has been only anecdotally reported [ 7 - 9 ] . the mechanism by which recanalization of chronically occluded carotid arteries occurs is still little known . in 1999 , suggested the possibility of occlusions resulting from ulcerated plaque thrombosis presenting long - term recanalization by thrombolysis . colon et al . , in 1999 , published a series of four cases of spontaneous recanalization of the internal carotid artery , which through imaging examinations and intraoperative finding , proved to be a hypertrophy of vasa vasorum , causing reperfusion of the distal to the occlusion . another possible mechanism is that , in the case of myointimal hyperplasia or atherosclerotic disease , the neovascularization is induced , which in the long term can allow perfusion distal to vessel occlusion . persistence of some embryonic vessels can also account for the complete non - occlusion of the whole internal carotid artery segment , allowing action of varied mechanisms for vessel recanalization . nowadays some groups have been following patients with carotid occlusions , with the aim of better evaluating the natural history of such lesions . verlato et al . , in 2000 , published a cohort study including 41 patients with carotid occlusion . the mean follow up periods were 44.5 months . in one case with asymptomatic carotid occlusion of 41 patients , spontaneous recanalization was identified at three years after the diagnosis , remaining without symptoms for the whole period . the mechanism of late recanalization of chronic occlusions of mca could be one as remarked above or not . unlike the extracranial carotid artery , the intradural cerebral artery has a little chance to the hypertrophy of vasa vasorum or the revascularization within a plaque due to the nature of intracranial artery , including the lack of vasa vasorum and the smaller caliber . in our case , we cautiously speculate that the recanalization process could be that the repeated embolic formation and accumulation were progressed to complete obstruction for some period of time in focal thrombotic area . after antiplatelet therapy , the thrombolysis occurred gradually instead of repeated embolic accumulation . finally , spontaneous recanalization occurred at this late stage . the angiographic changes in our patient illustrate that the chronic mca occlusion were spontaneously recanalized by an unknown mechanism within 21 months , with a good clinical outcome . the incidence , mechanism , and ideal management of this extraordinary finding remain unclear . through this rare case , further investigation and studies into the underlying mechanism of spontaneous recanalization should be performed .

early spontaneous recanalization of the middle cerebral artery in acute ischemic phase artery is not uncommon , whereas the late spontaneous recanalization of chronic occluded artery is a very rare phenomenon and exact incidence and the timing of this event have not been quantified . we present a case in which late spontaneous recanalization of long - lasting middle cerebral artery occlusion occurred in the absence of surgical , endovascular and thrombolytic treatments .

epidermoid and dermoid cysts are benign lesions developing from abnormal epithelial components of ectodermal tissue formed during the fetal period , or implanted epithelium arising after trauma or surgery . these lesions , which can be seen anywhere in the body , occur in the head and neck area in approximately 7% of cases . those in the oral cavity are mostly in the floor of the mouth ( in the sublingual , submental or submandibular areas ) and in various other localizations including the labial , lingual or buccal mucosa . their incidence in the oral cavity makes up for 1.6% of the total occurrences and they constitute less than 0.01% of all the cystic lesions of the oral cavity . these cysts are termed epidermoid if they are enclosed in epithelium only , if they comprise skin appendages and teratoid if they include other tissues like muscle , cartilage or bone . surgical excision is sufficient for cure . even though reports of epidermoid cysts in the head and neck , especially those in the floor of the mouth , soft palate , lips , or the lingual and buccal epithelium can be found in the literature , but there is no report of an intratonsillar epidermoid cyst . we intend to report the case of a patient who underwent tonsillectomy for diagnostic purposes because of an epidermoid cyst arising from the tonsil and confirmed by histology . a 42-year - old female came to our clinic for sore throat and difficulty in swallowing . ent examination showed marked hypertrophy of the right tonsil in comparison with the contralateral one , and a smooth - surfaced mass near the upper pole of the tonsil [ figure 1 ] . a magnetic resonance imaging ( mri ) examination was performed , which evidenced a protrusion of the clearly hypertrophic tonsil into the nasopharynx [ figure 2 ] . a right tonsillectomy was performed for diagnostic purposes after having obtained the patient 's informed consent . it was interesting to note that these cavities contained keratin in a lamellar arrangement and their epithelium was of a squamous character [ figure 3 ] . the patient was discharged on the first post - operative day in excellent condition ; her follow - up , reaching 10 months , was entirely uneventful . view of the asymmetrical hypertrophy of the right tonsil with a mass arising in its upper pole view of the hypertrophic right palatine tonsil in t2-weighted mri cystic cavity within the tonsillar tissue lined with keratinized epithelium . dermoid cysts have been classified by meyer in 1955 as true dermoid cysts , epidermoid cysts and teratoid cysts . a true dermoid cyst is lined with keratinized epithelium and contains skin appendages that could be described as hair follicles or sebaceous glands . an epidermoid cyst , on the other hand , is lined with simple squamous epithelium and its wall does not contain fibrous structures or skin appendages . a teratoid cyst may contain tissues ranging from simple squamous epithelium to ciliated cylindrical respiratory epithelium ; its contents may be of ectodermal , mesodermal or endodermal in origin . a theory widely accepted today on the etiology of these lesions is their development from the epithelial remnants remaining isolated during the closure of the first and second branchial arches in the midline . another theory is the development of cysts from abnormal inclusion of cells during surgery or trauma . even though the fact that our patient was aged 42 years would seem to favor the latter mechanism , she presented no history of surgery or trauma . a study on 1495 cases by new and erich shows that their location is most frequently anal ( 44.5% ) and ovarian ( 42.1% ) . cases of cysts in the head and neck area are only 7% of the total body . in a study of 103 patients with diagnosis of epidermoid and dermoid cyst of the head and neck , 46.6% of these were orbital , 23.3% buccal and submental , 12.3% nasal , 10.7% cervical and 2.9% labial . various publications also report epidermoid cysts of the oral cavity in the soft palate , the uvula and the sublingual area . the male / female ratio of the patients with a diagnosis of epidermoid cyst is 3/13 and the age range of the large majority is 10 - 35 years . especially the latter fact leads to the thought that cyst formation could be stimulated by hormonal influence during puberty . the fact that our patient was a 42-year - old female would also support such an idea . the appearance of epidermoid cysts on mri is variable according to their fluid contents and protein density . often , though , they exhibit a low signal intensity with t1a sequences and a high signal intensity with t2a sequences . the mri performed in our patient showed a marked hypertrophy of the right tonsil , which was protruding into the nasopharynx . the fact that the appearance of the cyst in the mri examination was not cystic could be due to the high protein density of its contents . . it should be excised without opening because its contents could have an irritating effect on the surrounding fibrovascular tissue . a malignant evolution has only been seen in the teratoid type and was reported to have an incidence of 0.5% . a tonsillectomy was performed in our patient ; the cyst was excised within its capsule and the follow - up during 10 months was entirely uneventful . while the expansion of lymphoid follicles within the tonsil is the most frequent cause of their hypertrophy , asymmetric hypertrophy must lead to the suspicion of diseases like tonsillar tumor , atypical infection , granulomatous disease or tumors of the parapharyngeal area . in a series of 49 patients with asymmetrical tonsils with normal neck examination and normal overlying mucosa , only two ( 4.8% ) a diagnostic tonsillectomy is indicated as asymmetrical tonsillar hypertrophy carries a potential risk of neoplastic transformation . our patient also had an asymmetrical appearance of the tonsils . also , the mass covered by normal mucosa and arising from the upper pole was suspicious for the presence of tumor and the patient was subjected to diagnostic tonsillectomy . in conclusion , epidermoid cysts , a rare occurrence in the head and neck area , can also be found inside the palatine tonsils and cause asymmetrical hypertrophy .

epidermoid and dermoid cysts are benign , developmental lesions that can be encountered anywhere in the body . our literature search did not result in a finding of any report of an epidermoid cyst located in the palatine tonsils . this is a report of a 42-year - old female patient who underwent a tonsillectomy for diagnostic purposes because of an epidermoid cyst arising from the tonsil which was confirmed by histology .

a renal leiomyosarcoma is an uncommon neoplasm of the kidney , accounting for approximately 1% of all malignant renal tumors , and has a poor prognosis [ 1 , 2 ] . its symptoms , such as nonspecific abdominal discomfort , dull pain , and oliguria , are common in other conditions ; therefore , a renal leiomyosarcoma is difficult to diagnose preoperatively . in this case , the condition had been preoperatively misdiagnosed four years earlier as a renal cell carcinoma before it was diagnosed as a primary renal leiomyosarcoma . furthermore , it took several months to diagnose a recurrent renal leiomyosarcoma in the same patient because of the ambiguous , nonspecific symptoms . she visited our clinic complaining of diffuse abdominal pain , and colonoscopy showed a submucosal tumor or an extrinsic mass involving the descending colon . there are no reported cases of a renal leiomyosarcoma invading the retroperitoneal colon and mimicking a submucosal lesion . a 57-year - old woman visited our gastroenterology department complaining of diffuse lower abdominal discomfort . the preoperative diagnosis was a renal cell carcinoma , but she was subsequently diagnosed with a primary renal leiomyosarcoma on pathologic examination ( fig . regular follow - ups with a urologist and abdominal computed tomography ( ct ) showed no recurrence for three years . after another year , she returned to the hospital complaining of diffuse abdominal discomfort . at that time the findings of a general physical examination were unremarkable , except for diffuse abdominal sensitivity . the laboratory test results were as follows : leukocyte count , 6,770/mm ; hemoglobin level , 12.0 g / dl ; and platelet count , 276,000/mm . the levels of aspartate aminotransferase ( 12 iu / l ) , alanine transaminase ( 10 iu / l ) , alkaline phosphatase ( 82 iu / l ) , and total bilirubin ( 1.2 mg / dl ) were within the reference range . colonoscopy revealed a hemispheric lesion similar to a submucosal tumor in the descending colon , approximately 30 cm above the anal verge ( fig . the larger lesion was located in the peritoneum , adjacent to the anterior portion of the descending colon , and the smaller lesion was located in the retroperitoneum , adjacent to the posterior portion of the descending colon . pet - ct showed a large omental mass on the left side of the abdomen , with a small solid area of increased glucose metabolism and hypermetabolism ( maximum standardized uptake value of 13.7 ) , in the posteromedial portion of the mid - descending colon ( fig . 4 ) . a laparoscopic tumorectomy and segmental resection of the descending colon were performed . examination of the gross specimen revealed a firm white mass approximately 10 9 cm and a 2 2 cm mass invading the descending colon ( fig . the number of mitoses was between 10 and 19 in each of 10 high - power fields ; hence , the histologic grade was high . the microscopic examination ( 20 magnification ) of a section stained with hematoxylin and eosin revealed a solid tumor mass , well demarcated by a capsule with a peripheral zone . fascicles of spindle cells with elongated and blunt - ended nuclei were visible at 100 magnification ( fig . the patient then received two cycles of mesna , adriamycin , ifosfamide , and dacarbazine ( maid ) chemotherapy at the oncology department . leiomyosarcomas are cancers of the smooth muscle cells , which can arise at any location . the uterus , the retroperitoneum , and the intra - abdominal cavity are common primary sites . this tumor is most commonly seen in the fifth and the sixth decades of life , and the male - to - female ratio is 1:2 . high - grade leiomyosarcomas frequently metastasize , and the most commonly affected organ is the lung . prognosis is poor , and the five - year survival rate is 29 - 36% . in most reported cases , presentations are nonspecific and the results of physical examinations are normal . radiologic features are nonspecific ; therefore , it is difficult to diagnose this cancer preoperatively . four years earlier , our patient had also been diagnosed preoperatively as having a renal cell carcinoma based on radiologic examination , the physical examination findings having been nonspecific . leiomyosarcomas are distinguished from leiomyomas by cellular pleomorphism , an increased mitotic rate , and the presence of cellular necrosis . furthermore , in this case , our pathologist conducted immunohistochemical staining , which is useful in the diagnosis of leiomyosarcoma . immunohistochemical staining revealed positive findings for vimentin and smooth muscle actin and desmin . if a leiomyosarcoma specimen is found to have a pleomorphic component on immunohistochemical staining , it is difficult to distinguish it from a malignant fibrous histiocytoma . however , such heterologous differentiation was not observed in this case [ 6 , 7 ] . a good prognosis can be expected only with complete surgical excision ( the treatment of choice ) [ 8 - 10 ] . irradiation therapy and chemotherapy do not alter the course of the disease and are not successful in metastatic lesions . a tumor size of less than 5 cm , low histological grade , absence of lymph node metastasis , and radical excision of the mass are all associated with an improved prognosis . to have ensured a better prognosis in this particular case , a radical nephrectomy should have been performed as the first operation . unfortunately , as the patient had been thought to have a renal cell carcinoma in the preoperative state , she instead underwent a simple left nephrectomy . a submucosal tumor is defined as an elevated or polypoid mass covered with normal mucosa . several colorectal diseases , such as lipoma , leiomyosarcoma , lymphangioma , and carcinoid tumor , can be detected as lesions mimicking submucosal tumors . we also confirmed the lesion in the descending colon as being caused by extrinsic compression by performing a ct scan . as observed in this case , recurrence of a leiomyosarcoma in the retroperitoneum needs to be considered in the differential diagnosis of submucosal tumors in the colon . thus , we report this unusual , but interesting , case of recurrence of a rare renal leiomyosarcoma .

a primary leiomyosarcoma of the kidney is a rare , but highly aggressive , neoplasm , accounting for only 0.1% of all invasive renal tumors . local or systemic recurrence is common , but a leiomyosarcoma is difficult to diagnose preoperatively . we recently encountered an interesting case of an unusual recurrence of a renal leiomyosarcoma . a 57-year - old woman visited our hospital complaining of lower abdominal pain . four years previously , she had undergone a left nephrectomy . she had a primary leiomyosarcoma of the kidney that had been misdiagnosed as a renal cell carcinoma . colonoscopy revealed the presence of a lesion similar to a submucosal tumor in the descending colon . postoperative pathologic examination confirmed that the mass was a recurrent leiomyosarcoma . we report this unusual case and present a review of the literature .

sciatic hernias are one of the rarest types of hernia and often pose diagnostic difficulty to clinicians . imaging is often required to confirm the diagnosis and usually involves computed tomography ( ct ) or magnetic resonance imaging ( mri ) . to our knowledge , we report the 115th case of sciatic hernia in the literature who had a falsely negative ct but had the diagnosis confirmed using ultrasonography . an 80-year - old lady was referred to the on - call surgical team by her gp with a 3-week history of a right - sided swelling of the buttock . she had a past medical history of hypertension , osteoarthritis and pemphigus vulgaris and a past surgical history of a perianal abscess requiring incision and drainage . she was allergic to penicillin and took regular oral betamethasone , xylometazoline nasal spray and topical aqueous cream . she did not consume alcohol , was a non - smoker and lived in warden - controlled accommodation . on examination , her cardiac , respiratory and abdominal examinations were normal . digital rectal examination revealed a non - tender stool - filled rectum with no palpable masses . on standing , a swelling on the medial aspect of the right buttock became apparent which was easily reducible , had audible bowel sounds and a positive cough impulse . she was reviewed by the on - call consultant who discharged her with a working diagnosis of possible obturator hernia , with a plan for an outpatient ct of her pelvis and follow - up in clinic . ct scan of the pelvis did not identify a cause for the swelling ( fig . 1 ) . due to the positional nature of the swelling , a gluteal ultrasound was organized , which revealed a large colonic sciatic hernia ( fig . 2 ) . as the patient had minimal symptoms and was not keen for surgical intervention , a plan for conservative management was agreed and the patient was discharged from clinic . figure 1:ct of the patient 's pelvis demonstrating a normal right sciatic foramen ( arrowed ) . us hip rt : confirms reducible herniation of colon in the right sciatic region into the buttock. ) ct of the patient 's pelvis demonstrating a normal right sciatic foramen ( arrowed ) . hip rt : confirms reducible herniation of colon in the right sciatic region into the buttock. ) sciatic hernias are one of the rarest types of hernia and often pose diagnostic difficulty to the clinician . a sciatic hernia is defined as herniation of intraperitoneal contents through either the greater or lesser sciatic foraminae ( fig . the majority of sciatic hernias are found in women ( 77% ) with more than one - third of these being aged 60 or over . the contents are variable and hernias containing ovaries , ureters , bladder , small and large intestine , omentum and dermoid cysts have been reported [ 16 ] . half of patients report non - specific abdominal or pelvic pain and one third have a mass on clinical examination . sciatica , intestinal obstruction , urinary sepsis and hydronephrosis have also been described [ 15 ] . diagnostic laparoscopy or laparotomy is often required to fully evaluate the sac contents and to repair the defect [ 2 , 3 , 5 ] . in symptomatic patients , surgical repair is indicated due to the high risk of bowel strangulation [ 1 , 3 ] . figure 3:pelvis demonstrating the greater ( red ) and lesser ( green ) sciatic foraminae . diagnosis by clinical examination alone is possible in only the minority of cases and imaging is frequently used to confirm the suspicion of sciatic hernia . commonly used imaging modalities are computerized tomography ( ct ) [ 25 ] and mri [ 3 , 4 ] , particularly if the sciatic nerve is thought to be involved . currently , the most commonly used imaging modality of choice is a ct scan with the patient supine . however , if the hernia is only apparent in a dependent position , this can produce a false - negative result , as in our case . the benefit of ultrasound is that it allows for real - time positional assessment of the region of interest , to reduce the risk of missing this rare but significant hernia . due to their rarity , sciatic hernias are often not considered in the differential diagnosis . the authors recommend that all patients presenting with non - specific abdominal or pelvic pain associated with a gluteal swelling should have sciatic hernia considered amongst their differential diagnosis . for patients in which there is a high degree of clinical suspicion for a sciatic hernia and a negative ct , the use of ultrasonography for positional defects may be a useful aid to confirming the suspected diagnosis .

sciatic hernias are one of the rarest types of hernia and often pose diagnostic difficulty to clinicians . we report a case of an 80-year - old lady with a sciatic hernia who had a falsely negative computed tomography ( ct ) but was found to have a colonic hernia on ultrasonography . the authors recommend that for patients in which there is a high degree of clinical suspicion for a sciatic hernia and a negative ct , ultrasonography may be considered as a useful imaging modality to confirm the diagnosis .

encouragingly , the boolean model was able to make highly accurate predictions on spatial and temporal gene expression patterns . indeed , only several predictions among the 2,772 time - space - gene combinations were at odds with experimental data . this may not seem surprising because the grn is based on interpretations of huge masses of expression data , perturbation data and cis - regulatory data . proceeded to perform more stringent tests of the model by asking how it would respond to four perturbations : extinction of the expression of the delta gene , global expression of the pmar1 gene , extinction of hox11/13b expression , and most challengingly , the transplantation of four cleavage skeletogenic micromeres into the animal pole of an otherwise normal embryo that possessed its own set of four micromeres at the vegetal pole . ( the intra - embryo transposition of blastomeres harkens back to the classical era of experimental embryology . ) the authors emphasized that except for the hox11/13b test , the perturbation results they sought to reproduce were not used in building the grn . ( transplanted micromeres could of course not have been part of the grn , which is for a normal embryo . ) the results of these perturbation tests were in nearly perfect agreement with the experimental data , which led the authors to two conclusions : the grn contained sufficient information to provide a system - level causal explanation for sea urchin development , and the boolean computational model was a useful tool for in silico testing of grn and making predictions upon perturbations . the test of blastomere transplantation demonstrated the critical role of intercellular signaling between the different spatial domains in development . the cells in these domains obviously need to work cooperatively to ensure precise and robust developmental progression and thus information on the regulatory state of each cell must be able to diffuse spatially . we enjoy so many examples of such events in development , e.g. , the wnt pathway in drosophila development to mention just one of many examples , but we have no case in which a paracrine signaling pathway amidst a developmentally determinative cluster of cells can be put into the context of a grn as detailed as the one peter et al . have defined . from the information theory perspective , intercellular thus , the developmental process is also a diffusion process of the genomic regulatory information . related domains of this emerging field include molecular information theory and information networks in the data mining field from both of which the modeling of intercellular signaling may benefit . went so far as to suggest that the gene regulatory models could sufficiently explain all the gene expression patterns in sea urchin development , without considering non - coding rnas . for example , a recent study identified long noncoding rnas ( lncrna ) in zebrafish embryogenesis and revealed that lncrnas were specifically enriched in early - stage embryos . ironically , davidson and his longtime partner roy britten were the first to postulate such a role . is there any information loss from the continuous data to boolean data , from gene regulatory logic to boolean logic ? what would be a good cutoff for converting the expression level to on or off ? if a grn is not available in a given case , can a boolean model be directly inferred and tested using raw experimental data ? if so , what kinds of experimental data are most suitable and in what way can the causal structure be best captured in the boolean model ? theoretical frameworks of causal inference from observational data have been studied in machine learning for decades . possibly the established causal inference algorithms can expand this newest chapter in grn - ology from the pioneering davidson lab into more general settings . can this work provide insights into other animal development , e.g. , mouse , human or into human embryonic stem ( es ) cell differentiation ? is it possible to apply the general computational framework to test grn models derived from biological processes in addition to development , such as immunology and postnatal neurogenesis in the subventricular zone of the brain to mention only two of many frontiers before us that beckon for the grn approach ? with the advances of next generation sequencing technology and its cost now rocketing downward , a large amount of data will soon be in hand for various biological processes across diverse phyla . much of this momentum now comes from the sea urchin embryo and from the scientific mind of eric davidson .

eric davidson at caltech has spent several decades investigating the molecular basis of animal development using the sea urchin embryo as an experimental system1,2 although his scholarship extends to all of embryology as embodied in several editions of his landmark book.3 in recent years his laboratory has become a leading force in constructing gene regulatory networks ( grns ) operating in sea urchin development.4 this axis of his work has its roots in this laboratory s cdna cloning of an actin mrna from the sea urchin embryo ( for the timeline , see ref . 1)one of the first eukaryotic mrnas to be cloned as it turned out . from that point of departure , the davidson lab has drilled down into other genes and gene families and the factors that regulate their coordinated regulation , leading them into the grn era ( a field they helped to define ) and the development of the computational tools needed to consolidate and advance the grn field .

acute obstructive suppurative pancreatic ductitis ( aospd ) is a rare complication of chronic pancreatitis that has been described in only seven previous case reports since 1995 . aospd is defined as suppuration from the pancreatic duct ; however , in contrast to the pancreatic infections that typically complicate chronic pancreatitis , it is not associated with pancreatic pseudocyst , abscess or necrosis . a 33-year - old female presented in july 2015 , with complaints of pain in epigastric region and multiple episodes of vomiting . pain was dull aching and radiating to back associated with multiple episodes of bilious vomiting . on per abdomen examination , there was tenderness in epigastrium and right hypochondrium . laboratory investigations revealed an elevated total leukocytes count ( 10 000/cumm ) , with normal serum amylase ( 41.9 units / l ) and serum lipase ( 29.4 units / l ) . , multiple radio - opaque shadows were seen corresponding with distal part of pancreas ( fig . ultrasonography was suggestive of hyper - echoic and atrophic pancreas with main pancreatic duct dilated upto 1 cm and 6 mm calculus in the main pancreatic duct at the level of pancreatic head . on computed tomography ( ct ) , multiple , conglomerated calcifications were noted in the head and tail of pancreas and just proximal to ampulla of vater resulting in dilatation of the common bile duct , common hepatic duct and main pancreatic duct ( fig . 2 ) . figure 1:radiograph showing multiple radio - opaque shadows corresponding to the distal part of pancreas . intra - operative photograph showing frank pus on opening of pancreatic duct . on august 2015 , patient underwent endoscopic retrograde cholangio - pancreatography ( ercp)-guided stone removal with common bile duct ( cbd ) stent placement at other center . two months later , patient came back with fever and pain in epigastric region with multiple episodes of bilious vomiting . on examination , there was tenderness all over the abdomen . patient was taken for exploratory laparotomy . on exploration of pancreas main pancreatic duct aspiration revealed frank pus ( fig . the presence of a stone was noted at the tail of pancreas , which was crushed and extracted . longitudinal pancreaticojejunostomy with roux - en - y jejunojejunostomy was done . on microbiological examination of pus she was started on pancreatic lipase 25 000 iu twice daily for additional 3 months . chronic pancreatitis is an inflammatory and fibrosing disease of the exocrine pancreas characterized by irreversible morphological changes and permanent loss of function . according to the marseille rome classification of 1988 , chronic pancreatitis is used to refer to recurrent or persistent abdominal pain that is associated with irreversible and ongoing inflammatory destruction of exocrine parenchyma and , eventually , islets . a new clinical entity termed as aospd was described by weinman et al . , defining it as a rare complication of chronic pancreatitis with suppuration of the pancreatic duct not associated with pancreatic pseudocyst , abscess or necrosis . aospd has been described in only seven previous case reports since 1995 . while the pathogenesis of aospd is not completely understood , chronic pancreatitis , prior sphincterotomy , pancreatic stasis secondary to pancreatic duct obstruction and diabetes mellitus patients undergoing biliary sphincterotomy have a common or shared biliary and pancreatic sphincter ; duodenal contents might also reflux into the pancreatic duct , in effect seeding the pancreatic duct . if pancreatic duct stones were obstructing the outflow of the duct , a ductal infection could result . this would be analogous to calculus obstruction of the biliary tree resulting in acute bacterial cholangitis . the normal pancreas is usually resistant to infection , presumably because of the presence of bacteriostatic and bacteriocidal agents elaborated in pancreatic secretions . a chronically diseased pancreas may be much more susceptible to infection because these same antibacterial agents may be significantly impaired or diminished . a pancreatic duct contaminated by duodenal reflux and obstructed by intraductal stones , in the setting of chronic pancreatitis , would seem a sufficient setting for the development of acute suppuration of the pancreatic duct . diabetes mellitus , while not present in our patient , predisposes patients to a variety of uncommon infections and may play an additive role in infection with klebsiella . this bacterium is usually contracted by oral route and one can only speculate that during previous instrumentation of the ampulla of vater , duodenal contents contaminated with this unusual organism may have refluxed into the pancreatic duct resulting effectively in seeding of the pancreatic juice . however , the presence of bacteria in the pancreatic duct is not by itself sufficient to cause suppuration . fujimori et al . reported a case of aospd in the setting of peripheral blood stem cell transplantation for acute myeloid leukemia and subsequent chronic leucopoenia . tajima et al . described aospd in the setting of pancreatic cancer ; as it can predispose to infection from biliary or pancreatic obstruction . in all the reported cases the diagnosis of aospd was made on identification of pus in the pancreatic duct on ercp . in our case , the diagnosis was made on exploring the main pancreatic duct before performing a pancreaticojejunostomy . in all previous cases , patients complaints resolved post - ercp stent . here , the definite treatment was a longitudinal pancreaticojejunostomy with roux - en - y jejunojejunostomy ( modified puestow procedure ) . surgery results in opening of the pancreatic capsule , which alleviates interstitial pressure , whereas longitudinal anastomosis ensures full drainage of the whole pancreatic duct length . as aospd is a rare complication of chronic pancreatitis it should be kept in mind while coming across cases with dilated main pancreatic duct and chronic pancreatitis . once diagnosed , aospd should be treated with prompt intravenous antibiotic treatment with pancreatic duct decompression , which can be achieved either through ercp stenting or surgical decompression specifically longitudinal pancreaticojejunostomy with roux - en - y anastomosis . surgical management should be preferred as ercp stenting can further lead to biliary reflux into the pancreatic duct after ercp sphincterotomy , which lead to further infection of the pancreatic duct . however , as only seven cases have been reported since 1995 , there appears to be some other factors contributing to its pathogenesis . thus , further study into this rare entity shall help provide more information in the near future .

abstractacute obstructive suppurative pancreatic ductitis ( aospd ) is a rare complication of chronic pancreatitis that has been described in only seven previous case reports since 1995 . we report a case of a 33-year - old female a known case of chronic pancreatitis with computed tomography suggestive of dilated main pancreatic duct with multiple calcifications . on exploration , pancreatic duct aspiration revealed frank pus . pus was drained after opening the pancreatic duct and longitudinal pancreaticojejunostomy was done . patient was relieved of her symptoms after surgery . in conclusion , aospd should be considered in long standing cases of chronic pancreatitis . aospd appears to respond quickly after drainage procedure like longitudinal pancreaticojejunostomy and should be considered the treatment of choice .

the definition of a gerbode defect , according to the society of thoracic surgeons congenital heart nomenclature and database project is true left ventricular ( lv ) to right atrial ( ra ) communication . however , no sources provide a definition encompassing congenital right ventricular ( rv ) to left atrial ( la ) communication . zacharkiw and stimpson recently described this pathology as a mirror - image gerbode defect in a patient following atrioventricular ( av ) septal defect repair . in the present study , the case of a congenital la - rv shunt in an adult is presented and the classification of such defects is discussed . a 74-year - old woman was referred to our center with a worsening history of orthopnea , paroxysmal nocturnal dyspnea , and peripheral edema . transthoracic echocardiography revealed lv hypertrophy , a dilated left atrium , severe mitral valve insufficiency , and pulmonary hypertension ( 60 mmhg ) . a careful review of the preoperative transesophageal echocardiography ( tee ) revealed a clear jet across a small defect between the rv and la ( figs . 1 , 2 ) . the pericardium was entered through a midsternal incision and a patch was fixed using glutaraldehyde . following the establishment of cardiopulmonary bypass ( cpb ) , a vertical cleft separating the anterior leaflet into two hemileaflets was observed on the mitral valve ( fig . aspirator - guided inspection showed that the defect was located between the la and the rv ( fig . the cleft was closed without tension after resection of the abnormal chordae attached to its edges . direct suture was not technically possible due to the fibrous reaction of the edges of the cleft with an area lacking valvular tissue . instead , the edges of the cleft were resected and the anterior leaflet of the mitral valve was reconstructed using an autologous pericardial patch . however , the saline test revealed regurgitation at both commisures . the patch was then replaced with a 27-mm porcine bioprosthetic valve ( biocor ; st . paul , mn , usa ) which was implanted in a supra - annular fashion with the use of interrupted , pledgeted , 20 everting mattress sutures . rewarming was initiated , the atriotomy was closed , the heart was de - aired , and the cross - clamp was removed . the av junctions are the area of the heart where the atrial myocardium is inserted into the base of the ventricular mass . partial av septal defects are malformations with two av valve orifices and no interventricular communication , whereas complete av septal defects have a common av valve orifice and extensive interventricular communication . lv to ra atrial communications , known as gerbode defects and lv - ra shunts , are encountered from time to time and are caused by surgical mishaps , trauma , and endocarditis . however , we could find only three cases of mirror - image gerbode defects ( la - rv shunts ) that have been reported to date in the literature [ 2,46 ] . of those cases , only one was congenital , while in the other cases , the defect emerged after the repair of an av septum . the previously reported congenital case was a 39-year - old woman with a common av junction and partially separated right and left av orifices , and the shunt was exclusively from the la to the rv due to overriding of the left av valve . however , in our case , each atrium was connected to its own ventricle through separate leaflets . additionally , a cleft in the anterior mitral leaflet existed , which may have been linked developmentally , on the basis of different degrees of failure of fusion of the av endocardial cushions . a literature review demonstrated that it is virtually impossible to categorize the spectrum of av septal defects into satisfactory and noncontroversial subgroups with regard to patients such as ours . we believe that diagnosis and surgical treatment strategy will become easier if case - specific morphologic and functional variables are analyzed .

gebode defect , that can accurately be treated surgical repair , is defined as a true communication between left ventricle and right atrium . a 74-year - old woman with a worsening history of ortophnea and peripheral edema was hospitalised . a communication between right atrium and left ventricle was diagnosed using transeusophageal echocardiography . the defect was repaired and mitral valve was replaced with a biologic valve . it would be beter to tailor surgical strategy for each case with atrioventricular canal defect after preoperative transeusophageal echocardiography and peroperative direct sight .

its effect is mediated via interactions with several receptors in the central nervous system and results from a combination of antidopaminergic , anticholinergic , antihistaminic , and weak antiadrenergic actions . the therapeutic effects of chlorpromazine are frequently accompanied by unwanted side effects that include sedation , autonomic , endocrine , and neurological effects . to date tinnitus is a common adverse reaction ( adr ) to several drugs and may occur during long - term therapies or after a single drug administration . even though not life threatening , tinnitus may be discomforting ; it may also be irreversible despite drug withdrawal . to date , over 130 drugs have been described to be potentially ototoxic , among which the most common inducers of tinnitus are aminoglycosides and other antimicrobials . we report on a suspect adr to chlorpromazine that occurred in a 12-year - old boy , affected by severe generalized anxiety disorder . he received initially a benzodiazepine therapy , which was switched to chlorpromazine ( 6.25 mg / day orally ) because of the absence of a significant clinical response . ten days after treatment with chlorpromazine , the patient experienced an enhanced sensitivity to sounds accompanied by perception of noises of the buzzing or ringing type . information about the patient 's medical history did not report conditions that may have predisposed to the onset of the disturbance manifested . moreover , the patient was in overall good health and had never suffered from hearing disorders . in view of the medical history , the inability to discontinue therapy with chlorpromazine resulted in an objective worsening of the patient 's symptoms , which are still present to date . the naranjo adr probability scale identified the relationship between the patient 's development of adr and the drug as possible . this is the first report on a case of tinnitus related to the administration of chlorpromazine . chlorpromazine is an antagonist of several dopamine cochlear receptors that play an important role in the sensory process by modulating afferent auditory nerve activity . dopamine , released from the terminals of lateral olivocochlear efferent fibers , is protective against acoustic trauma , hypoxia , and ototoxicity . in this context , the dopamine antagonist activity of chlorpromazine may result in a higher risk of ototoxicity . it controls the cochlear blood flow , acting on the precapillary sphincters and increasing the microcirculatory flow . clinical evidence indicates that h1 histamine agonists are effective in reducing tinnitus via improving vestibular compensation of the microcirculation . chlorpromazine antagonism on h1-receptors may thus play a role in counteracting the vessel modulatory effect of histamine and by this means have contributed to tinnitus development in our patient . acetylcholine is the major neurotransmitter in the olivocochlear efferent pathway , which is a feedback control system to the inner ear comprising a medial olivocochlear pathway projecting to outer hair cells and a lateral olivocochlear pathway projecting to dendrites of cochlear nerve fibres . in this context , the anticholinergic effects of chlorpromazine may have inhibited efferent signalling via the 9/10 nicotinic acetylcholine receptor complex in the outer hair cells which is known to be protective against acoustic injury . another action of chlorpromazine that may have contributed to generate tinnitus in our patient is its antagonism of serotonergic receptors . serotonin is one of the neurotransmitters acting on the auditory pathways ; in particular it is involved in sound detection , location , and interpretation . serotonin is currently believed to be one of the most important neurotransmitter involved in the perception of tinnitus . indeed , serotonin reuptake inhibitor drugs reduce the intensity of tinnitus acting directly on nerve conduction of the auditory stimulus , particularly in the central auditory pathways . in this scenario , it is thus conceivable that antagonism at serotonin receptor levels caused by chlorpromazine causes auditory disorders leading to tinnitus . finally , a role for an action of chlorpromazine on gamma amino butyric acid ( gaba ) can not be excluded . gaba inhibits auditory system and systemic administration of a gaba transaminase inhibitor improves tinnitus by suppressing hyperactivity in the auditory system . the neurotransmitter serotonin , involved in a large variety of physiological functions , behaves as a neuromodulator by strengthening the gaba system . chlorpromazine , by decreasing the availability of serotonin , may lead to decreased gabaergic activity and this action may have contributed to tinnitus development . we can not establish which among the actions of chlorpromazine described above has been predominant in the tinnitus - inducing action we observed , and the most likely possibility is that tinnitus resulted from a synergism among these different actions . a predisposition of the patient to develop tinnitus following chlorpromazine can not also be ruled out . receptors for serotonin , histamine , dopamine , and gaba are polymorphic and the presence of specific single nucleotide polymorphisms that acted as predisposing factors may be present in this specific patient . in addition chlorpromazine is substrate of cytochrome p4502d6 ( cyp2d6 ) , a highly polymorphic isoform of cytochrome . genetically determined functional variations of this cytochrome may be present in the patient and may also have contributed to the onset of tinnitus . to our knowledge , this is the first report on the development of tinnitus following chlorpromazine administration . although there is no information on dechallenge and rechallenge , the inability to discontinue therapy with chlorpromazine resulted in an objective worsening of the patient 's symptoms . this clinical case is of great clinical interest as chlorpromazine is not currently included among potentially ototoxic drugs ; paradoxically phenothiazines can be prescribed to alleviate symptoms related to disorders of the vestibular system .

chlorpromazine is a well - known antipsychotic agent that binds with a variety of receptors in the central nervous system . to date , chlorpromazine has never been associated with onset of hearing disorders and tinnitus . we report on an unexpected suspect adverse reaction to chlorpromazine that occurred in a 12-year - old boy , affected by severe generalized anxiety disorder . after treatment with chlorpromazine , the patient experienced an enhanced sensitivity to sounds accompanied by perception of noises of the buzzing or ringing type . this clinical case is of great clinical interest as chlorpromazine is not currently included among potentially ototoxic drugs .

measurement of cardiac output ( co ) requires use of invasive or minimally invasive devices ; the use of noninvasive and minimally invasive devices has gained popularity in recent years . the bioreactance technique is a relatively new , continuous , totally non - invasive technique for measuring co that is easily implemented . this new technique involves analyzing phase shifts of a delivered oscillating current that occur when the current traverses the thoracic cavity , and differs from traditional bioimpedance techniques that rely on analysis of changes in signal amplitude . most validation studies in critically ill patients have shown good correlation and/or agreement of bioreactance values compared with co values obtained using other devices in patients admitted after cardiac surgery [ 2 - 4 ] . however , validation in critically ill patients is lacking . as part of the internal evaluation of a bioreactance device before its implementation in the unit ( evaluation of new non - invasive monitoring systems before introduction in the unit does not require the approval of the ethics committee in our institution ) , we compared co values obtained using the bioreactance technique ( nicom system ; cheetah medical inc . , portland , or , usa ) with those measured using semi - continuous cardiac output by thermodilution ( cco ) with a pulmonary artery catheter ( vigilance , edwards lifesciences , irvine , ca , usa ) . in 11 patients the co values were compared at study inclusion and each time a relevant change in hemodynamics and/or in therapeutics ( for example , fluid challenge , inotrope or vasopressor infusions ) was observed ( table 1 ) . patient characteristics data in parentheses represent maximal dose , range ( g / minute for norepinephrine and g / kg.min for dobutamine ) . we recorded bioreactance co ( average of five values over a 5-minute period ) just after obtaining the pulmonary artery catheter cco ( average of five cco values over a 5-minute period ) . we collected 141 pairs of measurements ( 3 to 23 per patient ) ; the duration of monitoring was at least 3 hours but never exceeded 24 hours . there was poor correlation between the two techniques ( correlation coefficient r = 0.145 ) ( figure 1 ) . to limit the time effect , we randomly selected one pair of measurements for each patient - but this did not improve the results ( r = 0.13 ) . bland and altman analysis with correction for multiple measurements showed wide limits of agreement ( figure 2 ) . the time course of co was not well tracked either , sometimes with opposite trends between the two devices . correlation between pulmonary artery catheter semi - continuous cardiac output by thermodilution and bioreactance cardiac output . pulmonary artery catheter semi - continuous cardiac output by thermodilution and bioreactance cardiac output : bias and agreement . co , cardiac output ; pac - cco , pulmonary artery catheter semi - continuous cardiac output by thermodilution . the bioreactance technique is dependent on diffusion of electrical current , so interstitial edema may interfere with measurements ; we believe this is the most probable explanation for the poor correlation . whatever the reason , these data suggest that caution should be applied when using bioreactance devices in critically ill patients .

measurement of cardiac output ( co ) using minimally invasive devices has gained popularity . in 11 patients we compared co values obtained using the bioreactance technique - a new continuous , totally non - invasive co monitor - with those obtained by semi - continuous thermodilution using a pulmonary artery catheter . we obtained co measurements at study inclusion and after any relevant change in hemodynamic status ( spontaneous or during fluid challenge , inotrope or vasopressor infusions ) . there was a poor correlation between the two techniques ( r = 0.145 ) . these data suggest that caution should be applied when using bioreactance devices in critically ill patients .

takayasu s arteritis is a granulomatous vasculitis of unknown etiology that affects mainly the aorta and its branches . as a result of intimal fibroproliferation , segmental stenosis , occlusion , dilatation , and aneurysmal formation of the involved vessels it is an uncommon disease , with an approximate incidence of 23 cases per year per million individuals and usually affects young female of asian ascendance during their second and third decades of life . we describe a case of a previously healthy caucasian female whose takayasu s arteritis presented as an association of aortic and main left coronary aneurysms with severe aortic insufficiency . a 26-year - old caucasian female was admitted to our hospital with a 3-week history of fatigue , malaise , exertion dyspnea , ortophnea and paroxysmal nocturnal dyspnea . there was a marked difference on the blood pressure measurement between the arms ( 140/90 mmhg on the right arm and 90/60 mmhg on the left ) . the brachial pulse could not be felt on the left arm and a systolic murmur was heard on the left infraclavicular area . on cardiac auscultation , a diastolic murmur ( + + + + /vi ) was heard on the aortic area , and there were some crackles in the basal regions of both lungs . her erythrocyte sedimentation rate ( esr ) was 64 mm on the first hour and the result of the serum c - reactive protein ( crp ) was 24 mg / dl ( normal : 06 mg / dl ) . based on the 1990 american college of rheumatology criteria , a diagnosis of takayasu s arteritis was made . a high - resolution thorax computed tomography ( ct ) showed a 4-cm aortic aneurysm spanning the ascending and the proximal descending portions , as well as the aortic arch . cineangiocoronariography confirmed the findings of the ct and also revealed a severe aortic insufficiency and a large main left coronary aneurysm ( figure 1 ) . a three - day course of intravenous high - dose methylprednisolone ( 1000 mg ) was administered , as well as medications for the management of the heart failure ( diuretics , digoxin , angiotensin - converting enzyme inhibitor ) , which resulted in a remarkable improvement in general symptoms . methotrexate was started at 15 mg / week as a steroid - sparing medication . takayasu s arteritis is primarily a chronic inflammatory vasculitis characterized by stenosis of large and medium sized arteries . the coronary arteries are involved in about 10% of cases , but aneurysm formation , especially affecting the main left coronary , is a very rare finding . destruction of the elastic fibers in the media of the vessel is the leading pathogenic mechanism of aneurysms formation . in some situations of massive aortic regurgitation coronary aneurysms predispose to thrombus formation and acute myocardial infarction , even in patients receiving aspirin and/or warfarin . on the other hand , revascularization under inflammatory circumstances carries a higher risk of complications , such as stenosis , suture line dehiscence and pseudoaneurysm formation . a case of successful surgical resection of a giant right coronary artery has been reported , even though the best surgical timing in takayasu s arteritis still remains controversial , as long as even when asymptomatic and with no serological evidence of current inflammation ( normal esr ) , up to 44% of these patients show some degree of histologic active disease . to our knowledge , this is the first report of an association of aortic and coronary aneurysms with severe aortic insufficiency in a takayas s arteritis patient . the complexity of this case , allied to the absence of previously described medical interventions specific to this situation , certainly turns it into a therapeutic challenge . proper follow - up is warranted , to get nearer to an accurate decision about the best moment to choose for a surgical approach , considering its costs and benefits when dealing with vasculitic vessels and its inner complications .

takayasu s arteritis is a granulomatous vasculitis of unknown etiology that affects mainly the aorta and its branches . as a result of intimal fibroproliferation , segmental stenosis , occlusion , dilatation , and aneurysmal formation of the involved vessels may develop . it is an uncommon disease and usually affects young asian female patients during the second and third decades of life . coronary arteries are exceptionally affected and coronary aneurysm formation is a very rare finding . we describe a case of a previously healthy 26-year - old caucasian female whose takayasu s arteritis presented as a previously undescribed association of aortic and main left coronary aneurysms with severe aortic insufficiency .

in the previous issue of critical care , rhodes and colleagues report on significantly increased levels of circulating dna in patients admitted to the intensive care unit ( icu ) in comparison with healthy controls . they show plasma dna levels to be an independent predictor of mortality and the development of sepsis in these patients . in sepsis and trauma , circulating nucleosomal dna is positively correlated with disease severity and adverse outcome . in cancer , interestingly , in systemic lupus erythematosus , an autoimmune disease in which nucleosomal dna functions as autoantigenic target , no correlation of circulating nucleosomal dna with disease severity can be found ; instead there is a correlation with anti - nucleosomal dna antibodies . dna in plasma most probably circulates bound to proteins in the form of mononucleosomes and/or oligonucleosomes and is released after the cleavage of easily accessible linkage sites of cellular dna by endonucleases after cell death . a mononucleosome consists of a core particle composed of an octamer of two copies each of histones h2a , h2b , h3 and h4 , around which a stretch of helical dna 146 base pairs in length is wrapped . oligonucleosomes are composed of variable amounts of mononucleosomes connected by intact linker dna with a variable length of 15 to 100 base pairs containing a ' linker ' histone h1 . once released into the circulation , nucleosomes seem to be protected by their structure from further degradation by endonucleases . in healthy individuals , the concentration of circulating dna is low , because dead cells are removed efficiently from circulation by phagocytes . circulating dna has a short half - life ( 10 to 15 minutes ) and is removed mainly by the liver . accumulation of dna in the circulation can result from an excessive release of dna caused by massive cell death , inefficient removal of the dead cells or a combination of both . rhodes and colleagues demonstrate that increased circulating dna not only predicts the development of sepsis but also mortality in patients admitted to the icu . moreover , they show that patients requiring renal support have significantly higher values of circulating dna than patients with sufficient renal function . unfortunately , the authors provide no information on liver function , because most nucleosomal dna is efficiently cleared by the liver and only a small fraction is eliminated by the kidney . our recent study in patients with sepsis showed that nucleosomal dna increased with disease severity , but we found no difference in nucleosome levels in patients with severe renal insufficiency and normal renal function , respectively . other studies in patients with trauma and stroke showed that increased circulating dna levels were correlated with morbidity and mortality . hence , assessment of circulating dna offers a useful tool for predicting mortality and morbidity of patients admitted to the icu . further studies on circulating dna in icu patients , including more patients and other scoring systems for illness severity such as saps ii ( simplified acute physiology score ii ) , logistic organ dysfunction and apache ii ( acute physiology and chronic health evaluation ii ) scores , are needed to establish circulating dna as a predictor for mortality and morbidity in patients admitted to the icu . quantification of circulating nucleosomes can be assessed either by real - time quantitative pcr ( rq - pcr ) or immunological assays . however , contamination of a sample with nucleated cells can affect the apparent concentration of circulating dna . chiu and colleagues showed that a two - step procedure of sample centrifugation ( 800 g or 1,600 g ) followed by either high - speed centrifugation or filtration was superior to a single centrifugation step only . nevertheless , a 13.5-fold variation in circulating dna levels over 3 days can be detected in female volunteers . therefore , even though an appropriate sample preparation protocol may be used , notable variation requires a careful interpretation of circulating dna levels . nucleosomal dna can also be assessed by elisa technique as recently described by different groups . in our laboratory we developed an elisa with the use of a mouse monoclonal anti - histone 3 antibody ( clb - ana/60 ) as a catching antibody and a monoclonal mouse antibody recognizing an epitope exposed on complexes of histone h2a , histone h2b and double - stranded dna , present only on nucleosomes , as a detection antibody . this technique renders quantitative determinations reliable and reproducible . also with elisa , careless blood withdrawal and delayed centrifugation can result in false positive results , and insufficient storage conditions can lead to false negative results . moreover , sandwich elisas are vulnerable to false positive results resulting from xenoantibodies , c1q , rheumatoid factors and anti - nucleosome antibodies ( l aarden , unpublished work ) . a comparison of rq - pcr and elisa methods revealed a high concordance in the quantification of circulating dna in plasma and serum . quantification should preferably be performed in plasma because , probably as a result of the clotting process , higher levels of circulating dna can be measured . however , determination of circulating dna by rq - pcr seems to be more sensitive than by elisa . the lowest circulating dna level measured by rq - pcr in the present study was 14 ng / ml , which corresponds to 2,121 genome - equivalents / ml ( assuming a dna content of 6.6 pg per cell ) . however , circulating dna can be detected by rq - pcr up to 2 genome - equivalents / ml . in our recent study on nucleosome levels assessed by elisa , we reported a detection limit of 35 units / ml , which corresponds to 3,500 cells / ml . further improvement of the assay improved the detection limit to 1,000 cells / ml . fully automated systems in dna isolation , pcr mixture preparation and rapid thermal cycling profile offer a quick and sensitive tool for quantifying circulating dna in plasma . however , these systems require considerable amounts of plasma : reliable dna extraction for rq - pcr requires at least 200 l of plasma , whereas only 25 l suffices for elisa . assessment of circulatory dna is a useful tool for predicting morbidity and mortality in patients admitted to the icu . elisa = enzyme - linked immunosorbent assay ; icu = intensive care unit ; lod = logistic organ dysfunction ; rq - pcr = real - time quantitative polymerase chain reaction .

in various diseases , such as cancer , autoimmune disease , sepsis or myocardial infarction , elevated levels of circulating dna can be measured . however , its predictive value is under debate . circulating dna in plasma is protein - bound ( nucleosomal ) dna . quantification of circulating dna can be performed by real - time quantitative pcr or immunological methods such as elisa . the diagnostic value of both methods can be impaired by inappropriate handling of the samples . assessment of circulating dna in patients admitted to the intensive care unit offers a tool for predicting morbidity and mortality .

samples of stem , root , and leafy branches preserved in 70% ethanol were collected from a population near saipipi , savaii , samoa . a healer preparation from falealupo prostratin ( 1 ) was detected in each sample , and these materials were used for method development and validation . another collecting expedition was made to the island of savaii , samoa , in january 2005 . thirty - six samples , consisting of vouchers and ethanol - preserved pharmaceutical grade collections , were taken from three natural populations near the villages of saipipi , tafua , and falealupo . six trees were sampled from each population , and gps coordinates , elevation , dbh , height , petiole color , and surrounding vegetation were recorded for each tree sampled . from three plants at each site three different morphological samples were collected : roots ( bark + wood ) , stem ( bark + wood ) , and leafy branches , with fruit and/or flowers if present . only stem samples were collected from the other three trees at each site for a total of 12 samples per site . nine stem samples were collected on additional expeditions to the island of tutuila in american samoa in may and november of 2005 for a total of 45 samples including 27 stemwood samples . samples were shipped in vacuum - sealed aluminum vessels in 70% ethanol ( except for the tutuila island collections , which were shipped in 70% 2-propanol ) . the alcohol fractions were separated and the plant material air - dried in a fume hood . vouchers were deposited at the herbarium of the california state university fullerton s department of biological science . plant material was finely chopped then pulverized with a coffee grinder , and approximately 1 g of dry sample tissue was suspended in 25 ml of acetone in a 55 c bath for 10 min . 4 disk , dried in a savant aes1000 speedvac , suspended in 500 l of 80% ethanol in hplc grade water , and then filtered with a 0.22 m millipore ultrafree mc centrifugal filter device . nontarget organics were removed from the alcohol fraction with a waters sep - pak c18 cartridge using reversed - phase elution ( conditioning : sequential washes of 5 ml of 52% acetonitrile , 5 ml of 26% acetonitrile , and 2.5 ml of 100% hplc water ; loading : 100 l of sample ; separation : 1 ml of hplc water , 2.5 ml of 26% acetonitrile , and 2.5 ml of 40% acetonitrile ) ; the last fraction was filtered with a 0.22 m ultrafree mc centrifugal filter , dried , and suspended in 40 l of 80% ethanol for injection . the ethanol or 2-propanol fractions and the acetone extract for each of 45 samples were analyzed by hplc in triplicate to measure prostratin ( 1 ) concentration in g per g. prostratin was separated by reversed - phase elution using a waters nova - pak c18 column , 4 m bead , 300 3.9 mm , on a gradient hplc system ( waters 717 automated injector , waters 1525 binary solvent delivery system , and empower data analysis system ) at 30 c . identification was using a waters 2487 dual - wavelength uv absorbance detector using an authenticated standard ( icn mp biomedicals ) at 254 nm . aliquots of 10 l of each sample were injected , eluted over 15 min with a linear gradient mixing from 32% to 40% acetonitrile using filtered and degassed hplc grade water ( fisher ) and hplc grade acetonitrile ( sigma chromasolv ) , with a flow of 1.0 ml / min . method validation was completed in compliance with the specifications in the united states pharmacopoeia ( usp ) , general chapter 1225,(33 ) and meyer.(34 ) ruggedness was evaluated by calculating the precision of biweekly triplicate injections at one concentration during the entire range of the study ( rsd 5.21% ) . linearity was evaluated by plotting peak area as a function of analyte concentration , and regression analysis was performed : slope = 207.78 ; intercept = 1468.70 ; correlation coefficient = 0.9997 ; residual sum of squares = 716 109 646.17 . the limit of detection ( lod ) and limit of quantification ( loq ) were determined as 2.5 and 25 pmol , respectively , with a range to 30 nmol . accuracy ( recovery = 96% ) was calculated by spiking blank matrix with known amounts of 1 in triplicate at five concentrations . repeatability was assessed with triplicate injections at five concentrations on two consecutive days ( rsd 1.81% ) . intermediate precision was calculated biweekly over the range of the study with triplicate injections at three concentrations ( rsd 5.87% ) . the observed concentrations of 1 were ranked , and 95% confidence limits for the distribution of these concentrations around the median were constructed using eq 8.2.2 in snedecor and cochran.(35 ) to determine if the median prostratin ( 1 ) concentrations of all populations were equal , statistical hypotheses were tested using a kruksalwallis h test , the nonparametric analogue of anova . the resultant h statistic was tested for statistical significance at the p < 0.05 level using standard tables . a chi - square test for independence was employed to ascertain if the occurrence of exceptionally high concentration plants was equal between populations and also to determine if the falealupo population had a greater than expected number of exceptionally high - yielding prostratin plants . we used a similar chi - square procedure to test the tafua and tutuila populations to see if they had a higher than expected number of exceptionally low - yielding 1 plants . spearman s rank correlation coefficient was calculated to assess the correlation between prostratin concentration and diameter at breast height ( dbh ) . a kruskalwallis h test was employed to establish if 1 was equally distributed throughout plant parts ( leafy branches , stem , and root ) ; to determine if plants with high stem concentrations also have high concentrations in the leaf or roots , we calculated a spearman s rank correlation coefficient and tested for significant correlation at the p < 0.05 level .

homalanthus nutans , used by samoan healers to treat hepatitis , produces the antiviral compound 12-deoxyphorbol 13-acetate , prostratin ( 1 ) . prostratin is being developed as an adjuvant therapy to clear latent viral reservoirs , the major obstacle to eradication of hiv - aids within the human body . a validated reversed - phase hplc method was developed to assay concentrations of 1 in h. nutans . a survey of four distinct populations on two different samoan islands revealed significant variability in content . the stem tissue ( range 0.252.6 g / g 1 ) , used by healers in indigenous therapies , gave a higher median concentration of prostratin ( 3.5 g / g ) than root or leaf tissues ( 2.9 and 2.5 g / g , respectively ) . the high variability and skewness of these data indicate that cultivar selection for drug production will be important for this species . the reversed - phase hplc assay will allow plants to be selected for agricultural development and genetic analysis by identifying those individuals above and below a 95% confidence interval for the median concentration .

there is an increase in the use of angiotensin ii type 1 receptor antagonists ( at ii antagonists ) and angiotensin - converting enzyme inhibitors ( ace - inhibitors ) as prophylactic treatment of migraines , in addition to their use as antihypertensives . these drugs pass the placenta and have highly adverse effects on the renal organogenesis , leading to maldevelopment firstly of the renal system and secondarily of the lungs [ 1 , 2 ] . the fetus is autopsied without conclusive diagnosis . in the woman s next pregnancy , only 6 weeks later one week later , the midwife finds a declining symphysis to fundus increment , and the woman is therefore immediately referred to the hospital . , she had three to four attacks every week of unilateral , throbbing pain associated with nausea , vomiting and photophobia , lasting 648 h , preceded by transient scintillating scotomas . during pregnancy , , she has been taking candesartan ( 16 mg / day ) , pramipexole ( 0.18 mg 3 ) and amitriptyline ( 25 mg / day ) as prophylaxis against migraines , in addition to zolmitriptan and metoclopramide during attacks . candesartan treatment was initiated more than a year before her first pregnancy by an experienced neurologist who was also consulted during pregnancy . the medication was known to her general practitioner and the doctors who conducted the ultrasound examinations . the hospital obstetricians documented the medication in the admission notes in both pregnancies . nonetheless , the fetus is 33 weeks before doctors become aware that the medication is fetotoxic . when the baby is born , he has renal tubular dysgenesis , hypoplasia of the skull and the lungs , and hyaline membranes of the lungs . medline and the norwegian database of adverse effects were searched for descriptions of fetal injuries related to at ii antagonists ace - inhibitors . information about the extent of use of these drugs in norway was obtained from the national prescription database . angiotensin ii receptor antagonists and ace - inhibitors reduce blood pressure by blocking the renin - angiotensin system . they also have a positive , prophylactic effect against migraines , although the mechanisms are poorly understood . the colocalization of at1 , glutamate and gaba receptors on medullary rostral ventromedial neurons suggests a nociceptive modulatory . unfortunately , these drugs cross the placenta and affect the circulation of the fetal kidneys , and , more importantly , reduce stimulation of at ii receptors . this has a highly adverse effect on the renal organogenesis in the second and third trimesters . the kidneys develop abnormally and are unable to produce urine ; there is oligohydramnion and thereby , inter alia , maldevelopment of the lungs [ 1 , 2 ] . the summary of product characteristics in the technical brochures clearly states that these drugs are fetotoxic and should not be used during pregnancy . more than 20 cases of fetal injury / maldevelopment after exposure to at ii antagonists and ace - inhibitors have been reported in the literature [ 1 , 2 ] . 1.2% of women aged 3039 years were dispensed drugs in 2007 that affect the renin - angiotensin system , an increase compared to 2004 . more than 50% of childbearing women in norway are more than 30 years old . the mean age at delivery is increasing and will thus cause the number of pregnant women with hypertension requiring medical treatment to increase . in addition , there is reason to believe that there is an increase in the use of these drugs against migraines . they are well tolerated , and several studies have demonstrated their positive prophylactic effects [ 711 ] . in american and european guidelines , candesartan is listed among second- and third - line agents , respectively , for migraine prophylaxis [ 1214 ] . in australia it is not yet listed as an appropriate agent , but is widely used by the neurologists . this also appears to be the case in norway , although it is difficult to document , as these are not approved drugs against migraines in this country . a variety of drugs from diverse pharmacological classes are in use for migraine prevention . at ii antagonists and ace - inhibitors are traditional antihypertensives that have proved to be effective also in migraine prophylaxis . their fetotoxic effects have been demonstrated in humans [ 1 , 2 ] and well documented in animal research . when administered to rats , mice or piglets during renal development these drugs induce severe renal histological abnormalities , including papillary atrophy , tubulointerstitial fibrosis and tubular atrophy and dilatation [ 16 , 17 ] . nonetheless , there is reason to believe that an increasing number of women of reproductive age will use these drugs . they should be advised of the possible hazards , and treatment should be stopped as soon as pregnancy is planned or detected .

a pregnant young woman with a severe migraine is prescribed candesartan , an angiotensin ii type 1 receptor antagonist ( at ii antagonists ) . this has a positive effect except for severe maldevelopment of her fetus . there is an increase in the use of the fetotoxic drugs , at ii antagonists and angiotensin - converting enzyme inhibitors , as prophylactic treatment of migraines , in addition to their use as hypertensives .

a healthy 15-year - old woman was admitted to the department of neurosurgery of our institution with a chief complaint of a 1-month history of headache and dizziness . 1 ) demonstrated a 6.85 cm - sized , solid and cystic intra - axial mass in the right temporooccipital area , compressing the posterior horn of the right lateral ventricle . the solid portion of the mass included a calcification , thus presumably partly infiltrating into the brain parenchyma . differential diagnoses based on radiology include astroblastoma , ependymoma , pleomorphic xanthoastrocytoma and supratentorial primitive neuroectodermal tumor . postoperatively , the patient received a focal fractionated radiotherapy with a total dose of 5,040 cgy . a follow - up mri was taken on postoperative month 5 , which revealed no recurrence or progression of the tumor . most of the small- to medium - sized cells with papillary structures had hyperchromatic nuclei and coarse chromatin . they had a round - to - oval shape and contained hyperchromatic nuclei , eosinophilic cytoplasm and prominent eosinophilic intranuclear inclusions . considering the cytologic features along with the clinical and radiological data , we made an intraoperative frozen diagnosis of ependymoma . with a retrospective review of the slides , we identified a perivasculasr pseudorosettes - like lesion . the surgical specimens consisted of multiple pieces of soft red - to - grey tissue . then , the specimens were sectioned at a thickness of 2 m and then stained with a hematoxylin and eosin dye . for immunohistochemistry , we used antibodies against glial fibrillary acidic protein ( gfap ) , epithelial membrane antigen ( ema ) , cytokeratin , ki-67 , synaptophysin , and cd99 ( mic2 ) . 3 , a histopathologic examination showed that the tumor had perivascular pseudorosettes ; this is one of the characteristic features of ependymoma . the tumor cells had histopathological findings that are consistent with squash smear ones described above . this was also accompanied by the frequent presence of bizarre pleomorphic giant cells with prominent intranuclear eosinophilic inclusions . according to the who criteria , it had features of an anaplastic tumor , including a marked cellularity , abundant mitoses , vascular proliferation and necrosis . that is , it had a high intensity , a dot - like expression of cd99 and that of ema . in addition , the tumor cells had a ki-67 labeling index of about 10% ( fig . a rare variant of ependymoma , gce poses a diagnostic challenge for the pathologists on the intraoperative frozen section as well as the permanent section . but pseudorosettes are not present in all the case of gce . according to zec et al.,2 who first described two cases of gce in 1996 , the absence of perivascular pseudorosettes in gce might reflect the failure of the neoplastic cells to elaborate perivascular process . this often leads to the misdiagnosis of gce as glioblastoma multiforme,11 anaplastic astrocytoma,6 subependymomal giant cell astrocytoma or tanycytic ependymoma5 on intraoperative frozen section . in addition , gce should also be differentially diagnosed from anaplastic oligodendroglioma , clear cell ependymoma , pleomorphic xanthoastrocytoma and giant cell glioblastoma.10 despite these diagnostic challenges , there has been an increase in the demand for rapid intraoperative diagnosis . this is particularly case with the neurosurgical practice . a simple , reliable , and rapid method , the squash smear technique is useful to present detailed cytologic features of lesions . it is useful in making an intraoperative diagnosis of central nervous system lesions.14 to our knowledge , however , there are no reports about the cytologic features of gce . we performed a review of literatures about gce , focusing on the cytologic features seen on the tissue sections , whose results including our case are summarized in table 2 . the cytologic features are classified based on the cellularity , hyperchromatic nuclei , binucleation or multinucleation , eosinophilic cytoplasm , intranuclear inclusion / pseudoinclusions , perivascular pseudorosettes , brisk mitosis , necrosis and fibrillary background . basically , all the 14 cases showed hypercellularity , mitosis and necrosis . of the total cases , 93% ( 13/14 ) had eosinophilic cytoplasm and perivascular pseudorosettes ; 71% ( 10/14 ) did hyperchromatic nuclei ; 57% ( 8/14 ) did intranuclear inclusions / pseudo - inclusions ; and 50% ( 7/14 ) did binucleation or multinucleation . it is noteworthy , however , that these features are based on tissue sections of gce rather than cytology specimens such as the squash smear preparations . it is , therefore , a matter of course that there is no consistency in the cytologic features between the tissue sections and the cytology specimens . in our case , there were perivascular pseudorosettes on the tissue sections , but not found on the squash smear preparations . but both diagnostic modalities showed such findings as mitosis and necrosis , giant cells and intranuclear inclusions / pseudoinclusions . further comparative descriptions are warranted to define the cytologic features of gce between tissue sections and cytology specimens . in making an intraoperative frozen diagnosis based on squash smear preparations featuring the mitosis and necrosis , as well as the high cellularity , and the presence of giant cells showing hyperchromatic nuclei with eosinophilic cytoplasm and intranuclear inclusions / pseudoinclusions would be key histologic features that are helpful for establishing a diagnosis of gce . this is particularly true to our case ; the presence of giant cells with intranuclear inclusions and papillary structures was a critical clue to intraoperative frozen diagnosis . in addition to the cytologic features , the clinical and radiologic findings are helpful for improving the diagnostic accuracy . due to a relatively smaller number of reported cases , we failed to establish the relationship between the histological pattern of gce and its prognosis . in patients with anaplastic gce , however , a poor prognosis is expected with a relatively higher rate of recurrence ( table 1 ) . in our patient , there was no disease progression or recurrence . due to a shorter length of follow - up , however , further long - term follow - up studies are warranted to predict clinical outcomes of anaplastic gce

here , we present a case of anaplastic giant cell ependymoma ( gce ) occurring in a 15-year - old woman . squash smear slides for intraoperative frozen section diagnosis revealed oval to round cell clusters with a papillary structure in a fibrillary background . this was occasionally accompanied by the presence of bizarre pleomorphic giant cells with hyperchromatic nuclei and prominent intranuclear inclusions . these intranuclear inclusions were a key clue to diagnosis of ependymoma . histologic analysis revealed features of a high - grade tumor with perivascular pseudorosettes and bizarre pleomorphic giant cells , which established the diagnosis of gce . we performed a review of literatures about the cytologic features of gce , including our case , thus proposing that intraoperative frozen diagnosis of gce would be established by squash smear preparations featuring the mitosis and necrosis , as well as the high cellularity , and the presence of giant cells showing hyperchromatic nuclei with eosinophilic cytoplasm and intranuclear inclusions / pseudoinclusions .

it is well known that uvci could happen post acd / f [ 17 ] . an incidence of 24.2% has been reported in one prospective study when including the clinically unapparent injury . only two cases of bilateral vocal cord injury ( bvci ) have been described in the english literature . one was after a whiplash injury which , by itself or in combination with the very extensive procedure , could explain the bilateral involvement . in the other case the patient has a history of cardiac surgery that could have been the cause of a silent uvci [ 1 , 8 ] . we are presenting a case of bvci with no indication of preoperative uvci in order to alert practitioners to this possibility . a 46 year old male with a history of smoking , hypertension and alcoholism with no significant surgical history or other medical problems scheduled for acd for c 6 - 7 herniated discs . after establishing intravenous access and applying standard monitors , after a dose of 0.5 mg vecuronium , anesthetic induction was successfully achieved using fentanyl 250 mcg , thiopental / propofol , 140 mg/70 mg and succinylcholine 100 mg . atraumatic endotracheal intubation ( eti ) was accomplished with size 8 tube inserted to 23 cm and secured at the lips uneventfully . the surgery was preformed to the right side using a microscope for the dissection followed by the graft placement under fluoroscopy . as the patient was awakened at the end of the surgery , the endotracheal tube was removed and the patient was taken to the recovery room in a stable condition with no abnormal neurological signs and oxygen saturation ( spo2 ) of 99% on 3l / m nasal oxygen . the patient was noted to develop inspiratory stridor with sternal retraction and had a hoarse / whispering voice . 0.5 ml of racemic epinephrine ( 2.25% ) was administered by inhalation as well as 100 mg of intravenous hydrocortisone . we entertained the possibility of vocal cord paralysis ( vcp ) and accordingly gave 1 mg of midazolam . considering the risks of aspiration , the risks of trauma to the neck if the airway had to be established urgently without proper preparation for neck protection , which may lead to paralysis from spinal cord injury , and the severity of the patient 's symptoms ; all these facts alone with the need for a permanent airway device for ventilation favored performing a tracheostomy . following the tracheostomy , immediate postoperative evaluation could not identify any pathology for the bvcp . in a follow up visit six weeks later , it was found that the tracheostomy had been properly placed , the patient was able to eat and drink without difficulty , and he could also speak well . laryngoscopy revealed that his vocal cords continued to be in a paramedian position ; therefore , it was not considered safe to remove the tracheostomy tube at that time . a voice analysis study ( va ) indicated that his left vocal cord had some tone and some movement but his right vocal cord remained atonic . a follow up visit for the removal of the tracheostomy tube was arranged with a local otolaryngologist in his home town . . some proposed mechanisms of this surgical complication includes direct surgical trauma , nerve division or ligature , pressure or stretch induced neuropraxia , and postoperative edema [ 2 , 9 ] . a uvci occurs mostly on the right vocal cord due to the fact that the right approach is the preferred one to avoid injury to the thoracic duct , which resides on the left side [ 2 , 4,9 ] . while this would explain the recurrent laryngeal nerve injury on the right side , it would not explain the left side paralysis noted in our patient . mark kriskovich et al . reported a vocal cord paralysis rate of 6.4% in 250 consecutive patients undergoing acd . this was done by deflating the endotracheal tube cuff after placement of the surgical retractors and then re - inflating the cuff to a pressure of 15 mm hg . when the paralyzed cord is near the midline ( paramedian ) , the voice may appear near normal although most of those patients may complain of voice fatigue . this fact indicates that a patient may have normal voice but still have an underline injury . we hypothesize that our patient could have had an unrecognized preexisting uvci . without a preoperative electromyographic study , it would be hard to determine if one of the paralyzed cords was an older injury . another explanation for our bvci is the endotracheal tube , which has been shown to lead to uvcp or bvci [ 11 , 12 ] . vocal cord paralysis ( vcp ) as a complication of eti was reported to be 10 - 15% of all causes of vcp . although it most commonly affects the left vocal cord , cases of bvci have been described from eti . also postoperative vcp has been reported even in patients who had a laryngeal mask airway during surgery [ 1517 ] . other causes that should be considered includes , but are not limited to , upper respiratory tract infection , thoracic tumor , stroke , diabetes neuropathy , and paradoxical vocal cord dysfunction [ 1 , 13 , 14 ] . before a definitive diagnosis could be made , conservative treatment included : oxygen by mask , systemic steroids , racemic epinephrine , as well as sedation . after the diagnosis a permanent airway should be established if needed and that was our patient 's treatment . given these occurrences , one should stay on guard for vcp postoperatively in their acd patients . the addition of the technique of maintaining a specific cuff pressure and deflating followed by re - inflating it when the retractor is applied could be helpful in preventing vcp [ 2 , 3 ] . we can not on the base of this one case report recommend a preoperative voice analysis study on every patient undergoing an acd simply because this would not be cost effective ; however , we do recommend a more detailed airway exam to include a voice exam with specific questioning about voice fatigue in order to identify patients at risk . most importantly , we hope that this case presentation would alert the practitioners to the possibility of this rare complication after anterior cervical spinal surgeries .

we present a rare case of bilateral vocal cord injury ( bvci ) following anterior cervical discectomy with fusion ( acd / f ) in a 47 year old man . the patient experienced post - extubation stridor and whispering voice in the recovery room . clinical assessment led to the diagnosis of bvci . the patient was treated by tracheostomy and made a full recovery . what is unique about this case is that the patient had no reason for a preexisting unilateral vocal cord injury ( uvci ) prior to this surgery . there have been only two similar cases in the english literature in which the patients had a preexisting unilateral vocal cord paralysis ( uvci ) . we recommend a more detailed preoperative airway exam to include a voice exam with specific voice fatigue questioning on all patients coming for acd / f . such detailed assessment may uncover hidden uvci and allow a safer perioperative period .

a 9-month - old female patient was brought to a health institute with complaints of coughing persisting for 2 weeks . her hematologic tests revealed the presence of hyperleucocytosis ( 107.000/mm ) , and consequently she was referred to us with the initial diagnosis of leukemia . her history revealed the presence of vomiting , and diarrhea in addition to her complaints of coughing within the first week . she had nt been vaccinated . her oropharynx was hyperemic , and crepitant rales were heard bilaterally over basal lobes of her lungs . some of her laboratory values were as follows : hemoglobin : 10.6 gr / dl , wbc : 102.900/mm , platelets : 797.000/mm , normal hepatic , and renal function test results ; uric acid : 2.5 mg / dl , and ldh : 386 u / l . results of peripheral smear analysis were as follows : neutrophils : 26% , lymphocyte : 72% , monocyte : 2% , absence of atypical cells , and blast cells . dimensions of mediastinum were within normal limits , and infiltration in the right paracardiac region was seen . polymerase chain reaction ( pcr ) performed with throat swab , and respiratory tract panel realized for adenovirus infection yielded positive results . pcr test could not detect any evidence of pertussis infection . respiratory tract infection caused by an adenovirus , and hyperleucocytosis day of her hospitalization wbc was 66.680/mm . during follow - up of the patient , her respiratory symptoms , and complaints of coughing regressed at the end of the first week of her hospitalization . on 7 . whole blood cell counts , and results of her peripheral smear are shown in table 1 . complaints of the patient regressed , and her clinical problems resolved during her follow - up , and consequently she was discharged with prescription of a vacination plan . whole blood cell count , and peripheral smear results of the patient x wbc : whole blood cell . classical whooping cough infection courses with paroxysmal fits of coughing , vomiting after coughing , deep inspirium , and intermittent symptoms of coughing lasting longer than 28 days up to 3 months . adenovirus infections most frequently present with manifestations of respiratory tract infections , and gastroenteritis . in our patient coughing episodes lasted for 3 weeks , and in the first week diarrhea , and vomiting accompanied complaints of coughing . in the pediatric age group acute leukemias are the most frequent causes of hyperleukocytosis . apart from leukemias , infections , drugs , bleeding , hypersensitivity reactions , splenectomy , and solid tumors induce leukemoid reaction leading to development of hyperleukocytosis . however hyperleukocytosis secondary to absolute lymphocytosis is seen in pertussis , tuberculosis , and viral infections . among viral infections , whole blood cell count of our patient demonstrated hyperleukocytos , anemia , and reactive thrombocytosis . apart from bordetella pertussis infection the manifestations of pertussis - like coughing can be encountered during the course of infections caused by chlamydophila pneumoniae , chlamydiae trochomatis , mycoplasma pneumoniae , adenoviruses , and bordetella bronchiseptica . in a study on 149 patients who presented with clinical manifestations of pertussis , the most frequently detected infectious agents , apart from bordetella pertussis were adenoviruses , parainfluenza , mycoplasma pneumoniae , and rsv . in this study , adenoviruses , and mycoplasma pneumoniae were detected in 3 , and 1.3% of the cases , respectively . in patients presenting with clinical manifestations of pertussis where bordetella pertussis can not be isolated or can not be confirmed serologically , investigation for infectious agents as mycoplasmae , chlamydiae , and adenoviruses has been recommended . gold standard for the diagnosis of pertussis is detection of bacterial growth on culture which has a 100% specificity . its sensitivity changes depending on many factors as stage of the disease , initiation of antimicrobial treatment , sampling method , quality of the material used for sampling , conditions of delivery of the sample to the laboratory , and experience of the laboratory , and ranges between 12 , and 60 percent . the world health organization recommends combined use of antibiograms , and pcr technique for the diagnosis of pertussis . sensitivity , and specificity of pcr method have been indicated as 7099% , and 86100% , respectively . in our patient bacterial growth pcr respiratory tract panel revealed presence of adenovirus , and absence of mycoplasma pneumoniae , and rsv . although the patient presented to our clinic with pertussis - like coughing , complaints of vomiting , and diarrhea at the beginning of the disease , shorter duration of the coughing when compared with whoopig cough , and in consideration of laboratory test results , presumptive diagnosis of pertussis - like syndrome secondary to adenovirus infection , and hyperleucocytosis were made . since all her necessary vaccinations were not performed , and diagnostic laboratory methods were not 100% sensitive , bordatella infection could not be ruled out conclusively . in conclusion , in patients presenting with clinical manifestations of pertussis , and hyperleucocytosis , if especially etiologic agent can not be cultivated , then adenovirus infections should be considered in the differential diagnosis , and relevant investigations should be carried out .

adenovirus is an infectious viral agent that causes variety of clinical presentations such as respiratory disease , conjunctivitis , and gastroenteritis . hepatitis , pancreatitis , myocarditis , encephalitis , and disseminated infection are primarily seen in immunocompromised patients . rarely , adenovirus infection can present with pertussis - like syndrome . described here is case of pertussis - like syndrome associated with adenovirus presenting with hyperleukocytosis .

after the increasing use of laparoscopy , robotic surgery has provided a new era in minimally invasive surgery . safety and clinical outcomes have been reported in various fields . the most common complications include ileus , deep vein thrombosis , and pulmonary embolism [ 1 , 2 ] . however , postoperative acute renal failure ( arf ) is a rare complication in laparoscopic surgery and has not been reported in robotic surgery . herein we report a case of postoperative acute renal failure in a patient who had undergone robot - assisted prostatectomy . a 63-year - old man presented with adenocarcinoma of prostate , clinical stage t1c , preoperative serum psa level 7.21 ng / ml , gleason score 3 + 2 , and serum creatinine level 1.3 mg / dl and underwent a robot - assisted prostatectomy . the patient was placed in the trendelenburg position at an angle of 30 from the horizontal with the legs split . the operation time was 400 min and intraoperative blood loss was less than 100 ml . throughout the operation the end - tidal carbon dioxide ( co2 ) level was maintained between 37 and 38 mmhg . there was a mild increase in abdominal drainage levels to 500 ml per day . bilateral percutaneous nephrostomy tubes were placed , and patent ureters without urine extravasation found in antegrade pyelography . the serum creatinine level rose to 3.8 mg / dl 12 h after operation . pulmonary edema developed on the first postoperative day and the patient received hemodialysis and intensive care . acute respiratory distress syndrome developed and consequently resulted in duodenal ulcer bleeding despite the use of antacid . renal function recovered after comorbidity was controlled 2 months after surgery while serum creatinine level was 2.0 mg / dl . serum creatinine level was 2.0 mg / dl and psa level was less than 0.01 ng / ml after one - year follow - up . robotic surgery adds a new dimension to this field and provides three - dimensional visualization and allows advanced freedom of instrumentation motion . currently there are four systems being used to treat patients and the numbers are increasing . the physiological effects of robotic surgery on the human body are similar to those of laparoscopy assisted surgery [ 1 , 2 ] . deterioration of renal function after laparoscopic surgery has been reported in various fields , including cholecystectomy , nephrectomy , and bariatric surgeries [ 47 ] . the common mechanisms of complications are related to : ( 1 ) increased intra - abdominal pressure ( iap ) , ( 2 ) co2 insufflation and ( 3 ) rhabdomyolysis syndrome . to obtain adequate working space , maintaining pneumoperitoneum status the increased iap is associated with decreased urine output and deterioration of renal function in animal models and humans [ 69 ] . the major physiological effects of increased iap are direct renal parenchymal and vessel compression and decrease of renal arterial supply and venous drainage [ 8 , 9 ] . this consequently stimulates the renin , aldosterone , and angiotensin systems , enhances renal vasoconstriction and decreases renal blood flow . insufflation with co2 may depress myocardial contractility through blood absorption effects and increase systemic vascular resistance , which results in a decrease in cardiac output and activates the renin - angiotensin system . both iap and insufflation with co2 increase plasma renin and angiotensin ii and subsequently cause reduction of renal blood flow and deterioration of renal function . in our case , oliguria was found 6 h postoperatively at a rate of 20 ml / h . concluded that the predisposing risk factors included diabetes , hypertension , exaggerated surgical position , body shape character ( muscular frame or morbid obesity ) , hypovolemia , operation time of more than 5 h , and preexisting renal dysfunction . in their study , they found the serum creatinine kinase ( ck ) level to be elevated to more than 5,000 u / l in all seven patients . compared to our patient , the ck level was 1,831 there is no strong correlation between ck and arf from literature review , and the possibility of rhabdomyolysis in this patient should still be considered . in conclusion , we report the first case of acute renal failure after robot - assisted radical prostatectomy . the treatment outline included fluid balance , electrolyte correction , and prevention of secondary complication . patients with prolonged surgery ( > 5 h ) , morbid obesity , and pre - existing renal function impairment are at higher risk of the development of rhabdomyolysis . minimizing the operation time , adequate patient padding , and intraoperative circulation maintenance are helpful in the prevention of postoperative acute renal failure .

robot - assisted surgery has been used widely in urological surgery since 2000 . in taiwan , robotic surgery started in 2004 and progress has been ongoing since this time . herein we report a case of acute renal failure post robot - assisted radical prostatectomy . the patient received postoperative hemodialysis and intensive care . the renal function recovered to a serum creatinine level of 2.0 mg / dl 2 months after surgical intervention . the renal function was still normal and the psa level was nadir after one - year follow - up . the outcome is encouraging from the point of view of oncology . to our knowledge , this is the first report of postoperative acute renal failure in robotic surgery .

an 18-year - old male transferred to the emergency department presented loss of consciousness , cyanosis , and deteriorated vital signs . according to the rescue team transfer records , he called the control center himself because he was home alone . he complained of aggravating dyspnea after eating dinner and of sudden onset vomiting . during ambulance transfer the patient could not remember what happened after the arrival of the rescue team at his house and had no memory of his stay at the emergency room and intensive care unit ( icu ) . upon arrival to the emergency room , the patient presented with a cyanotic lip , stupor or semi - comatose mental state , and severe tachyarrhythmia . endotracheal intubation was performed immediately . after drawing blood for an emergency laboratory study and portable chest x - ray , 1 ) , a large bore needle ( 16 g ) was inserted into the second intercostal space of the mid - clavicular line to decompress intrathoracic pressure . immediately after insertion of the needle , percutaneously checked sao2 increased dramatically to higher than 95% . closed bilateral thoracostomy followed , using a 24 fr chest tube . the patient was transferred to the icu for close monitoring of the patient 's mental state and other parameters related to tension pneumothorax . the abga results upon arrival and after insertion of the chest tube were a ph of 7.272 , pco2 of 56.1 mmhg , po2 of 78.6 mmhg , and sao2 78.6% , and a ph of 7.373 , pco2 of 42.7 mmhg , po2 of 171.3 mmhg , and a sao2 of 99.3% , respectively . within several hours after admission into the icu , the patient 's mental state and vital signs were restored to within normal limits . two hours after admission into the icu , endotrachial intubation was removed and spontaneous breathing was maintained with an adequate sao2 level . the possibility of hypoxic brain damage was evaluated by a neurosurgeon , who confirmed that there were no significant sequela . on the second day at the hospital , bilateral pneumothorax recurred during the application of continuous negative wall suction ( -18 cmh2o ) . the operation was performed under general anesthesia with double - lumen endotracheal intubation . to avoid hemodynamic instability during the operation , the patient was positioned with the head elevated 30 degrees ( semifowler 's position ) and with the legs slightly elevated , with both upper arms extended . during the operation , to improve the operation field view , the operation table was tilted to the contralateral side ( fig . a large bullae on the left lung and single giant bulla on right upper lung were resected with an endo - gia linear stapling device . one long thoracic drain ( 28 fr ) was inserted bilaterally into the thoracic cavity after mechanical abrasion of upper portion of the parietal pleura . the incidence of simultaneous bilateral primary spontaneous pneumothorax has been reported to be as low as 1.4% to 7.6% . simultaneous bilateral primary spontaneous pneumothorax can result in a severely deteriorated condition , usually requiring intubation or resuscitation . the reported causes of bilateral pneumothorax include trauma , tumor , and iatrogenic causes [ 1 - 3 ] . other more rare causes have been reported , including catamenial pneumothorax , sarcoidosis , pregnancy , and radiation . simultaneous spontaneous bilateral tension pneumothorax is defined as when no tracheal shift occurs and when the degree of bilaterally lung collapse is similar in a chest x - ray . patients with simultaneously developed bilateral tension pneumothorax may deteriorate rapidly , and immediate decompression is recommended . a vicious cycle may occur , leading to a deteriorated condition , with a chain reaction consisting of lowered venous return , lowered preload , lowered cardiac output and so on . the patient under study experienced a critically life threatened state , loss of consciousness , cyanosis , and tachyarrhythmia . the treatment methods include needle aspiration , percutaneous catheter drainage , and tube thoracostomy [ 1 - 4 ] . indication for surgical management of pneumothorax include continuous air leakage after insertion of chest tube , recurring pneumothorax on the same side , simultaneous bilateral pneumothorax , pneumothorax developed after pneumonectomy , and having an occupational cause . at present , video - assisted thoracic surgery ( vats ) is the most frequently used form of surgery for treating pneumothorax . kim et al . reported a series of 66 patients that were randomized to treatment with either transaxillary minithoracotomy ( tamt ) or vats . first , a smaller incision was required when compared with tamt , which generally resulted in less pain . second , the cosmetic effect is superior to that of tamt . finally , most procedures are possible ( mechanical pleurodesis , chemical pleurodesis , etc . ) . prospective studies of simultaneous bilateral spontaneous pneumothorax management are rare . generally , cases of bilateral pneumothorax require definitive surgical therapy to reduce the risk of recurrence . this can be done either through vats or open thoracotomy , depending on the surgeon 's preference . our case presented the rare clinical situation of simultaneous bilateral tension pneumothorax , and a decision was made to treat with immediate large size needle decompression at the emergency room by a properly trained doctor . the procedure was a critical step which restored this patient from life - threatening tension pneumothorax .

spontaneous pneumothorax is a common clinical problem in emergency care . however , the overall incidences of primary spontaneous pneumothorax has been reported from as low as 1.4% to 7.6% . the clinical findings of simultaneous bilateral spontaneous pneumothorax can be variable . clinical presentation is variable , ranging from mild dyspnea to tension pneumothorax . bilateral tension pneumothorax can defined as cases where no tracheal deviation is detected in chest x - ray , and symptoms may be equal bilaterally . herein , we present a case with simultaneous bilateral tension pneumothorax , severely deteriorated ( i.e. with loss of consciousness , cyanosis , and hemodynamically unstable ) , that was successfully treated with immediate large - size needle decompression .

physical mixtures of benfotiamin at three different mass ratios ( 1:1 , 1:2 , 1:3 and 1:4 ) were prepared . the prepared mixtures were then filled in glass bottles , sealed and stored in a dessicator until further use . a mixture of drug and polymers in three different mass ratios were wetted with water and kneaded thoroughly for 30 minutes in a glass mortar . the dissolution study of pure drug , physical mixture and solid dispersion was carried out by using usp dissolution apparatus ( type 2 ) at 100 rpm at temperature of 37 0.5c using 900 ml volume of ml p. 1.2 and p. 7.4 the volume withdrawn was replaced by fresh volume of dissolution medium to maintain constant volume of medium . the filtered samples were analyzed spectrophotometrically at 226 nm and the drug release was determined . the phase solubility studies were performed to determine stoichimetric proportions of benfotiamin and carriers- pvp k-30 and hpmc . the effects of polymers concentration at room temperature on solubility are shown in figure 1 . results of concentration of carriers on solubility of benfotiamin the plot of drug solubility against polymer concentrations at room temperature indicated a linear relationship between drug and polymer solution . both the type shows al type of plot i.e. the solubility of benfotiamine increased with increasing carrier concentration . dissolution of the pure drug , physical mixtures as well as solid dispersions of benfotiamin with pvp k-30 ( equivalent to 40 mg ) was tested in acidic buffer ( ph 1.2 ) and phosphate buffer ( ph 7.4 ) for a period of 60 minutes . dissolution of the pure drug , physical mixture and solid dispersion prepared by kneading method in ratio of 1:4 was found to be 36.63% , 41.63 and 99.72% in 50 minutes in acid buffer medium . pure drug and physical mixtures shows almost same release , whereas the solid dispersion ( 1:4 ) shows 00% drug releases in one hour . the solid dispersion prepared using ratio 1:1 , 1:2 and 1:3 showing corresponding drug releases that is 79.29% , 83.30% and 95.12% in 60 minutes as shown in figure 2 . in - vitrodissolution profile of benfotiamin with pvp k-30 in ph . increasing the drug carrier ratio from 1:1 to 1:4 improved drug release profiles observed in for all formulations in case of kneading method with pvp k-30 and hpmc but the drug release rate was higher in 1:4 ratio for both the polymers . the drug release was found to be better in solid dispersions prepared with pvp k-30 as compared to those prepared with hpmc .

the present study was aimed to increase the solubility of the poorly water soluble drug benfotiamine using hydrophilic polymers ( pvp k-30 and hpmc e4 ) . solid dispersions were prepared by kneading method . phase solubility study , in - vitro dissolution of pure drug , physical mixtures and solid dispersions were carried out . pvp and hpmc were found to be effective in increasing the dissolution of benfotiamine in solid dispersions when compared to pure drug . ft - ir , differential scanning calorimetry and x - ray diffractometry studies were carried out in order to characterize the drug and solid dispersion . to conclude that , the prepared solid dispersion of pvp-30 may to effectively used for the enhancement of solubility of poorly water soluble drugs such as benfotiamine .

it is postulated that these cause luminal obstruction resulting in subsequent acute inflammation of the mucosa . appendicoliths are composed of inspissated faecal material , mucus with trapped calcium phosphate and inorganic salts . dropped appendicoliths from appendicectomy are rare , but the surgeon and radiologist ought to consider them as a potential source of intra - abdominal complications . until recently , the presence of an appendicolith was considered 100% specific for the diagnosis of acute appendicitis . however , 13% of patients without acute appendicitis showed an appendicolith on ct ( 2 ) . presence of an appendicolith is also associated with a high incidence of perforation , particularly in children . appendicoliths can be detected by plain abdominal radiographs in 10 to 15% of patients with acute appendicitis . with the recent popularity of ultrasound and the appendicoliths can drop at the time of resection of the appendix , during forceful extraction through the umbilical port or if the appendix perforates . complications associated with retained faecoliths following appendicectomy are becoming more prevalent with the increased use of the laparoscopic technique , similar to the increase in dropped gallstones following the introduction of laparoscopic cholecystectomy ( 2 ) . the time between laparoscopic appendicectomy and representation with abscess ranged from 2 months to 4 years ( 2 ) . the natural history of dropped appendicoliths is not yet known but there is some early evidence that they have a significant association with abscess formation , with the appendicolith acting as a nidus for infection . ct - guided percutaneous drainage of intra - abdominal abscess secondary to retained appendicoliths is only successful in the short term . formal surgical drainage and removal of the appendicolith is required for long - term success ( 2 ) . ultrasound has been described as a useful adjunct for intra - operative localisation of the appendicolith ( 4 ) . a 17-year - old female presented to the emergency department , with intermittent right upper quadrant pain , nausea and vomiting . she was previously fit and well , with her only background history being a laparoscopic appendicectomy for perforated appendicitis the previous year , aged 16 . abdominal examination revealed tenderness to palpation in the right upper quadrant and no palpable masses . bloods tests revealed raised inflammatory markers . computed tomography of the abdomen was performed and revealed a 43 cm structure of low attenuation posterolateral to segment 6 of the liver with surrounding irregular wall and a central 15 mm high density lesion , suggestive of a peritoneal foreign body , possibly a retained appendicolith from previous surgery ( figure 1 ) . abdominal ct scan showing a radio - opaque faecolith in the right upper quadrant ( arrowed ) it was felt that this could be removed via ultrasound guidance through a small intercostal incision under local anaesthetic . this was attempted but failed secondary to an iatrogenic pneumothorax and failure to localise the lesion . once the peritoneum was opened purulent fluid discharged and on exploration of the cavity the faecolith was found ( figure 2 ) . the patient s post - operative course was uneventful and she was discharged home the following day in a stable condition , afebrile and with normal serum inflammatory markers . appendicectomy , especially in cases of perforated appendicitis , is associated with postoperative abscess formation in up to 20 per cent of cases ( 1 ) . though this treats the abscess , it does not necessarily treat the root cause and nidus of infection the appendicolith . in cases of retained appendicolith , failure to do so may result in recurrent intra - abdominal abscesses , wound infection and occasionally fistula formation ( 5 ) . retained appendicolith has been reported in different sites including the pelvis , gluteal region , hepatorenal pouch ( of morrison ) and subhepatic region . it can be detected by ultrasound or computed tomography scan as fluid collection containing a focus of high attenuation which may be single or multiple . occasionally , plain radiograph film may show these retained appendicolith , though the sensitivity is only 10% ( 1 ) . the literature reveals few cases of subhepatic abscesses due to retained appendicolith and most of them required operative intervention , whether laparoscopic or via the open approach . a high index of suspicion ought to be maintained in patients presenting with recurrent intra - abdominal sepsis and a history of appendicectomy . the risk of retained appendicolith may be reduced by ensuring that the distal end is intact after division of the appendix . the authors advise gentle manipulation when handling an acutely inflamed appendix to avoid appendicolith spillage . in the event of spillage , the appendicolith ought to be retrieved , as failure to do so may lead to subsequent complications . definitive treatment depends on removal of appendicolith , and the authors advocate that this can be safely accomplished via the laparoscopic method .

appendicectomy is one of the commonest emergency operations performed worldwide . in cases of perforated appendicitis , the prevalence of post - operative abscess formation is up to 20 per cent ( 1 ) . most cases can be managed with drainage and antibiotics . however , a minority of these will leave a retained appendicolith.we present a case of a 17 year old female patient who presented 1 year after laparoscopic appendicectomy for perforated appendicitis , with right upper quadrant pain and sepsis.computed tomography ( ct ) of the abdomen was performed and revealed a retained appendicolith with perihepatic abscess formation in the right upper quadrant . she underwent laparoscopic drainage of this perihepatic abscess and removal of the faecolith . she was discharged home the following day and remains well .

patients of sarcomatoid carcinomas of adrenal can present with non - functional adrenal swellings with pressure symptoms by themselves or the result of their metastatic damage to other organs . diagnostic modalities include endocrine as well as radiological evaluation of the patient , but the definitive diagnosis is by histopathological and immunohistochemical examination postoperatively after excision . we present a case of sarcomatoid carcinoma of right adrenal gland for which open adrenalectomy was done . however , she succumbed after 4 months as she had developed similar swelling in left adrenal gland along with metastases to para aortic nodes . a 62-year old female presented with complaints of on and off episodes of pain in the right upper quadrant of abdomen since 4 months . computed tomography ( ct ) scan of abdomen and pelvis suggested 4.32.5 cm well defined moderately enhancing right adrenal mass with central necrosis ( figure 1 ) . histopathology suggested it to be tumor composed of spindle cells and permeated by intense inflammatory infiltrate chiefly neutrophils . the tumor cells showed strong immunopositivity for vimentin and focal immunopositivity for epithelial membrane antigen . ct scan of pelvis and thorax was done to search for the primary focus of malignancy but both suggested no obvious focus except patient having a 60% thrombosis of distal arch of aorta . the surgery was completed uneventfully . on gross examination , specimen was brown and nodular measuring 6.55.53.5 cm and weighed 55 g. its cut surface showed an unencapsulated firm greyish white tumor ( figure 2 ) . on microscopy the tumor showed pleomorphic tumor cells with epithelial and spindle cell morphology with evidence of foci of necrosis and intense inflammatory infiltrate with neutrophils and lymphocytes ( figure 3 ) . focal immunopositivity for pancytokeratin ( figure 5 ) and bcl-2 . the tumor cells were immunonegative for synaptophysin , chromogranin , melan - a and inhibin and described as sarcomatoid carcinoma of right adrenal gland . follow up after 3 months showed recurrence with involvement of left adrenal and para - aortic nodes on ct scan . it is broadly classified into : i ) conventional adrenocortical carcinomas , and ii ) adrenocortical carcinoma variants . variants of adrenocortical carcinomas include : i ) oncocytic adrenocortical neoplasms ; ii ) myxoid adrenocortical neoplasms ; iii ) adrenocortical carcinomas with a sarcomatous or sarcoma - like component ; iv ) adrenocortical blastoma . the tumor has been reported in relatively common organs such as the respiratory tract , gastrointestinal tract , and mammary gland . sarcomatoid carcinomas of the adrenal glands are extremely rare and extremely malignant tumors known with 1 year mortality of 100% . patients usually present with complaints of vague abdominal pain , abdominal lump in the flanks , loss of weight and generalized weakness . if the tumor is functional patients may present with the corresponding endocrine abnormalities like hypercortisolism causing cushing s syndrome , hyperaldosteronism causing severe hypertension , muscle cramps , testosterone secretion in women causing deepening of voice , acne , balding , hyperestrogenemia in males causing gynaecomastia , impotence and in females causing irregular menses , menorrhagia . in the review of literature , six out of 9 patients diagnosed with sarcomatoid carcinoma of adrenal , presented with flank or abdominal pain or discomfort as in present study . tumours tend to be very large at the time of presentation ( mean size 13 cm , weight 1113 g ) ( table 1 ) . these tumors are notoriously known for their metastasis at the time of presentation and the routes of metastasis include hematogenous , lymphatic or transcoelomic spread . the tumor cells on microscopy show dual line of differentiation into mesenchymal ( sarcomatous ) and epithelial ( carcinomatous ) elements . the mesenchymal differentiation may be towards muscle ( rhabdomyosarcoma ) , bone ( osteosarcoma ) , fibrosarcoma etc . or just undifferentiated spindle cell type . there are many theories proposed to explain the dual line of differentiation of these tumors . they are : i ) the composition tumor theory ( paradoxically requiring a non - malignant non - epithelial component as a reactive proliferative response induced by the epithelial component via paracrine secretion ) ; ii ) the collision or biclonal tumor theory ( a collision between two synchronous , histogenetically independent , biclonal tumors ) ; iii ) the conversion tumor theory ( neoplastic transformation within a monoclonal tumor recapitulating the naturally occurring event of conversion of epithelial to mesenchymal cells during embryogenesis ) ; and iv ) the combination or divergent tumor theory ( deriving from a common monoclonal stem cell precursor ) , molecular genetic evidence of monoclonality supports the single pluripotential stem - cell - divergence hypothesis and the epithelial - to - mesenchymal transition as well . adrenal cortical carcinosarcomas tend to be aggressive tumours , with locoregional recurrence and rapid metastases from sarcomatoid component . endocrine assays and ct are the modalities available to diagnose as well as to rule out primary focus from elsewhere . dynamic enhanced scan with multi - detector row ct may show the compositions and the blood supply of a tumor . ct scan shows heterogenous enhancement which may raise the suspicion of sarcoma , however further studies are required to confirm . the best available treatment option is surgical excision of the tumor with clearance of metastasis . in radical resection adrenal sarcomatoid carcinoma seems to be a highly malignant tumour and has very poor prognosis . adrenal sarcomatoid carcinomas even though are operable on early presentation , may present with metastases quite early and be fatal .

adrenal sarcomatoid carcinomas are extremely rare tumors presenting with extensive locoregional spread at the time of diagnosis . patients succumb to metastases within a couple of months . as a result , very few cases are reported in the literature until now . we present a case of a 62-year old female with non - functional sarcomatoid carcinoma of the right adrenal gland . there was no radiological evidence of locoregional metastases . patient underwent right adrenalectomy . follow up after 3 months showed para - aortic lymphadenopathy and similar left adrenal mass on computed tomography . patient refused further treatment and succumbed to the disease . a brief case report with review of literature is presented .

the herd comprised approximately 550 dairy cows of the israeli - holstein breed raised in a zero - grazing management system . heifers were transferred at the age of 2 months to another farm and returned pregnant 14 months later . all the cows and heifers were observed at least twice daily by the herd s personnel and at least twice weekly by the attending veterinarian . cases of bnvv were observed during january through march 2002 . clinical signs of bnvv developed in 32 of the 39 heifers . other age groups and heifers before calving were not affected . treatment consisted of vaginal rinses with potassium permanganate or h2o2 daily from calving for as long as clinical symptoms persisted ( 9 ) . local antimicrobial therapy was not attempted since it was ineffective during the outbreaks on the other farms . a penicillin / streptomycin combination was given to 12 cows with temperatures > 39.5c , to provide broad - spectrum protection and prevent sepsis and limit economic losses ( metronidazole is the drug of choice to treat infections caused by anaerobic bacteria , but its use is prohibited in israel ) . five of these cows developed metritis and peritonitis and had to be slaughtered , whereas the temperature of the remaining seven cows returned to normal . no difference between convalescence periods of cows treated with potassium permanganate or h2o2 was observed . eighteen cows recovered within 4 weeks after onset of infection ; in 9 , a more chronic infection , characterized by a mucopurulent vaginal discharge lasting up to 10 weeks , developed . the swabs were kept in amies transport medium ( copan , italy ) and processed within 5 hours from sampling . swabs for mycoplasma and ureaplasma were taken in mycoplasmal transport medium and hayflick s medium , respectively ( 10 ) . swabs for virologic examination were placed in eagle s medium supplemented with antimicrobials and fetal calf serum and chilled . after vortexing , the medium was used for polymerase chain reaction ( pcr ) assays and virus isolation . vaginal biopsies were suspended directly in 10% formalin and stained with hematoxylin - eosin in the laboratory . bacteriologic examination included aerobic , microaerophilic , and anaerobic cultures , and resulting microorganisms were identified by standard methods ( 10 ) . samples were examined for chlamydia by direct immunofluorescence ( cellab , australia ) and for coxiella burnetti by the stamp ( 11 ) staining method . the only microorganisms cultured consistently from affected cows but not from healthy ones were pigmented , gram - negative , non spore - forming , anaerobic rods . the number of pigmented colonies was directly related to the severity of the vulvovaginal lesions , and they were not cultured from cows after their recovery . the pigmented bacteria were weakly saccharolytic ; negative for indole , catalase , esculin hydrolysis , -fucosidase , and -galactosidase ; and positive for -galactosidase and n - acetyl--glucosaminidase positive ( as determined by the api rapid i d 32a kit , [ biomrieux , france ] ) . identification of pigmented isolates as p. levii was done according to the manual of clinical microbiology ( 12 ) . since susceptibility to vancomycin distinguishes porphyromonas spp . from other gram - negative anaerobic rods ( 12 ) the mic of the isolates to this antibiotic was determined by the etest method ( ab biodisk , sweden ) and was found to be 3 g / ml , indicating susceptibility . other potentially pathogenic bacteria isolated occasionally included arcanobacterium pyogenes , -hemolytic streptococci , and several enterobacteriaceae , but they could not be correlated with either the clinical signs or the presence of p. levii or bovine herpesvirus 4 ( bohv-4 ) . for the virologic examination , samples were added to confluent monolayers of madin - darby bovine kidney cells , observed daily for cytopathic effect , and passaged every 7 days . bohv-4 was detected in samples from 27 cows with bnvv and from two cows in which the syndrome did not develop . association of the bacteriologic or virologic findings and the clinical status of the cows was assessed statistically by the mantel - haenszel test ( statistix , analytical sotware , tallahassee , fl ) . the test indicated a significant association between cows with bnvv and the presence of p. levii , adjusted for bohv-4 ( p = 0.0006 ) . no statistically significant association between bohv-4 , adjusted for p. levii , and bnvv was found ( p = 0.2359 ) . previous publications ( 13 ) also reported difficulties establishing a clear relationship between the presence of bohv-4 and , among other syndromes , bovine metritis , vaginitis , and abortions . uterine biopsies were not taken , as injuring the mucosa in the presence of vaginal lesions could increase the risk for metritis . bacterial colonies were seen in the section of vaginal biopsies , but typical changes of bohv-4 infection ( 13 ) were absent . the single necropsied cow showed peritonitis , resulting from rectal rupture , the cause of which could not be determined . the lesions affected the vulva and caudal part of the vagina but not the uterus ( figure 2 ) . histopathologic examination of the vaginal lesions showed extensive necrosis of the epithelium and severe infiltration with a large number of mostly degenerative neutrophils and foamy macrophages . in the submucosa , since p. levii was isolated from all bnvv cases and very few healthy cows , it likely caused the lesions . all the cases observed during this outbreak occurred in primiparous cows in a restricted geographic area ( within a radius of 20 km ) during a limited period of time , indicating that one or more risk factors , alone or in conjunction , predisposed cows to infection . outbreaks were observed after a large number of cattle were introduced , affecting primarily the animals introduced into the host farm . transportation and social conflict may have acted as stressors ( with stress immunosuppressive effects ) ( 14 ) and predisposed the introduced cows to infection , with only social conflict affecting the local cattle . calving is a well - known stressor ( 15 ) , especially in primiparous cows ( 16 ) . moreover , lesions of the genital tract caused by calving tend to be more severe in primiparous cows , thus making them more prone to infection . after bnvv was described and its putative etiologic agent was identified , several sporadic cases were diagnosed on other farms , indicating that it might be underdiagnosed , and further studies of the syndrome may be warranted .

an outbreak of bovine necrotic vulvovaginitis associated with porphyromonas levii , an emerging animal and human pathogen , affected 32 cows on a dairy farm in the northeast of israel . five animals had to be culled . this report appears to be the first that associates p. levii with bovine necrotic vulvovagnitis .

stress cardiomyopathy ( scm ) , a disease with many names like the broken heart syndrome , takotsubo cardiomyopathy , and apical ballooning syndrome , is characterized by regional myocardial dysfunction , typically occurring in the wake of a significant physical or emotional stressor . the pathophysiology of the condition remains incompletely understood , yet the effects of catecholamines on select portions of myocardium are thought to play an integral role . the degree of cardiac dysfunction in this condition is variable , and in the largest contemporary registry of patients with scm , only 9.9% developed cardiogenic shock . although uncommon , this severe presentation of the disease is critical to appreciate , and we present a case of the disease at its extreme , with a patient in cardiogenic shock . a 79-year - old woman with a history of an infratentorial meningioma was admitted to the coronary care unit in cardiogenic shock . the morning of admission her past medical history was significant only for modest essential hypertension and no known coronary ischemia or dysrhythmias . following routine induction of anesthesia with securement of the airway and institution of mechanical ventilation , sinus bradycardia associated with profound hypotension ( 70/40 mm hg ) ensued , and this hemodynamic perturbation subsequently progressed to cardiac standstill with absence of peripheral pulses . cardiopulmonary resuscitation ( cpr ) was initiated and return of spontaneous circulation ( rosc ) was achieved after 90 s with one round of cpr and 1 mg of intravenous epinephrine . after rosc , her vital signs were notable for sinus bradycardia with a systolic blood pressure initially between 140 and 170 mm hg , which quickly declined to less than 90 mm hg despite continuous infusions of high - dose norepinephrine ( 3 g / kg / min ) and dopamine ( 20 g / kg / min ) . the surface electrocardiogram post - rosc revealed new t - wave inversions in the precordial leads . intra - operative transthoracic echocardiography shortly after cardiac arrest demonstrated a left ventricular ejection fraction ( lvef ) of 15 - 20% with severely hypokinetic mid and distal segments and a hyperkinetic left ventricular base consistent with scm ( fig . 1 and supplementary video 1 , www.cardiologyres.org ) . in the setting of her continued hemodynamic instability , left heart catheterization was performed and an intra - aortic balloon pump was placed . the coronary anatomy was notable for only mild , non - obstructive disease ( fig . the right coronary artery has minimal disease , and supplies the posterior descending artery ( c ) . in the subsequent 6 h serum troponin i levels peaked at 1.67 ng / ml and a newly prolonged qt interval developed ( fig . 3 ) . inotropic and mechanical supports were rapidly weaned off over the following 6 h and she was successfully extubated . repeat echocardiography 12 h after the initial study revealed a lvef of 75 - 80% , near cavity obliteration during systole , and no regional wall motion abnormalities ( supplementary video 2 , www.cardiologyres.org ) . at 6-month follow - up , the patient denied any symptoms of heart failure and her ef normalized to 55% . note the low voltages , inferior and lateral precordial lead st segment depressions , and the prolonged qt interval . this case highlights many of the classic elements of scm : a post - menopausal female with a primary neurologic disease ; a temporal correlation with significant stress and exposure to catecholamines ; prolongation of the qt interval ; low - level cardiac enzyme elevations ; and reversible , often transient left ventricular dysfunction , which at the extreme , results in cardiogenic shock . although reversal of left ventricular dysfunction is the norm in scm , the time course of this patient s improvement is remarkable . most studies of scm cite echocardiographic and symptom improvement occurring within days to weeks of diagnosis , and to our knowledge , the earliest reported echocardiographic resolution occurred 5 days following diagnosis in these case series [ 2 , 3 ] . scm has been associated with administration of catecholamines ( i.e. dobutamine during stress testing or epinephrine for treatment of anaphylaxis ) , and has occurred in the wake of cpr , which we believe occurred in this case . from a pathophysiological standpoint , a catecholamine surge , iatrogenic or otherwise , can impair myocyte contractility , particularly at the apex where the highest concentrations of adrenergic receptors are localized . in summary , we describe a case of transient , albeit severe scm that reversed rapidly . to our knowledge , this is the fastest recovery ever reported . this case highlights the role of catecholaminergic excess , one of the proposed mechanisms underlying the disease s pathophysiology , and also reinforces the need of aggressive supportive therapy early in the disease . the authors declare that there are no conflicts of interest regarding the publication of this paper .

we report the case of a 79-year - old woman who presented to our hospital for elective removal of an infratentorial meningioma and suffered a periprocedural cardiac arrest . shortly after uncomplicated induction of anesthesia prior to the surgery , the patient became hypotensive and bradycardic , culminating ultimately in a cardiac arrest with pulseless electrical activity . return of spontaneous circulation occurred within 90 seconds of arrest , but the patient remained dependent on maximal doses of epinephrine and dopamine for hemodynamic support . echocardiography performed on the day of cardiac arrest revealed a newly depressed left ventricular ejection fraction ( lvef ) of 15 - 20% with an apical ballooning pattern . left heart catheterization showed no obstructive coronary lesions to explain her depressed ejection fraction . a diagnosis of stress cardiomyopathy ( scm ) was made given the echocardiographic findings and absence of concomitant coronary disease . within the next 24 hours , the patient was liberated from inotropic support , and at 6-month follow - up , her lvef returned to 55% and she had no heart failure symptoms .

we report a case of iga pemphigus with iga antibodies to desmoglein 1 ( dsg1 ) and desmoglein 3 ( dsg3 ) . we report the case of an 60-year - old man with intraepidermal neutrophilic iga pemphigus with iga antibodies to dsg1 and dsg3 . the disease was not effectively controlled by conventional therapeutic regimens ( colchicine , dapsone ) . systemic treatment with isotretinoin 25 mg / d and prednisone 20 mg / d achieved only a slight effect after six months . our case confirmed the recalcitrant nature of iga pemphigus in response to distinct therapies , indicating that further research focusing on therapeutic approaches for this type of pemphigus is needed . an otherwise healthy 60-year - old man was referred to our department with a one - year history of recurrent pruritic vesiculo - pustular lesions on both axillae and groin . the lesions improved after topical application of steroids but reappeared and gradually spread to trunk and extremities . examination revealed a symmetric eruption on the proximal extremities and trunk with prominent involvement of the axillae and groin . it was composed of grouped vesiculo - pustular lesions mostly on well - circumscribed erythematous patches ( figure 1 ) . direct immunofluorescence microscopy ( dif ) of perilesional skin detected intercellular deposits of iga throughout the epidermis ( figure 3 ) . igg - elisa for desmogleins ( dsg ) showed no igg antibodies to either dsg1 or dsg3 . iga - elisa for dsgs was then performed and the results indicated that the patient s serum was positive for iga anti - dsg1 and anti - dsg3 antibodies . colchicine , 0.5 mg 3 times daily was begun , but this had no effect after one month so it was substituted by dapsone 100 mg / d , which also failed to produce any improvement and his disease remained active . subsequently , isotretinoin 25 mg / d and prednisone 20 mg / d were initiated achieving only a slight effect after six months . based on pathology and dif findings , iga pemphigus can be further divided into two subtypes , namely , subcorneal pustular dermatosis ( spd ) and intraepidermal neutrophilic dermatosis ( ien ) types . clinically , as seen in our patient , both subtypes of iga pemphigus present with small blisters and pustules overlaying well - circumscribed erythemas . a herpetiform appearance has also been reported . the whole body can be involved , with a predilection for flexures , such as axilla , groin and submammary area . while spd - type iga pemphigus shows subcorneal pustules , the ien type is characterized by pustule formation throughout the entire epidermis . in dif , spd - type iga pemphigus involves cell surface iga binding only in the upper epidermis , where as ien - type iga pemphigus shows binding throughout the epidermis . although the histological features of our case are consistent with those of the spd type of iga pemphigus , ien - type iga pemphigus was diagnosed in the present patient because of iga deposits throughout the epidermis . in contrast , in the ien type no reactivity of auto antibodies with desmocollin 1 , 2 , and 3 has been found , whereas desmoglein 1 and 3 were suggested as putative target antigens of ien type in single case reports . the result of immunoelectron microscopic study revealed that the antigen of ien type may not be a desmosomal component . in our patient , iga - elisa for dsgs showed reactivity with dsg1 and dsg3 , suggesting that his pemphigus most likely belongs to the ien type . iep should be performed because iga pemphigus has been reported to be associated with monoclonal iga gammapathy . treatments of iga pemphigus are performed based on the disease pathomechanism and on anecdotal reports . dapsone is commonly the drug of choice due to its effect in suppressing neutrophilic infiltration . recently , adalimumab and mycophenolate mofetil , have also been reported to be useful in treating iga pemphigus . our case confirmed the recalcitrant nature of iga pemphigus in response to distinct therapies , indicating that further research focusing on therapeutic approaches for this type of pemphigus is needed .

backgroundiga pemphigus is a rare autoimmune vesiculo - pustular skin disease . only approximately 70 cases have been reported to date . we report a case of iga pemphigus with iga antibodies to desmoglein 1 ( dsg1 ) and desmoglein 3 ( dsg3).case reportwe report the case of an 60-year - old man with intraepidermal neutrophilic iga pemphigus with iga antibodies to dsg1 and dsg3 . histologic examination revealed subcorneal neutrophilic pustules with few acantholytic cells . the disease was not effectively controlled by conventional therapeutic regimens ( colchicine , dapsone ) . systemic treatment with isotretinoin 25 mg / d and prednisone 20 mg / d achieved only a slight effect after six months.conclusionsour case confirmed the recalcitrant nature of iga pemphigus in response to distinct therapies , indicating that further research focusing on therapeutic approaches for this type of pemphigus is needed . physicians should keep iga pemphigus in mind when approaching patients with bullous eruption .

perinatal depression is a major public health problem , affecting up to a quarter of all pregnant women in rural countries . it is associated with profound physical and emotional changes and associated risks for the onset or exacerbation of several mental disorders such as depression . in addition to its effects on the mother 's well - being , perinatal depression is associated with adverse outcomes of pregnancy . relevant effective interventions are being developed , but their effectiveness in low- and middle - income countries may be limited by various factors . exercise can provide a viable treatment options for depressed patients , whether as an alternative treatment strategy to conventional treatments or as a supplemental strategy , either in the short - term or long - term . research to date by low numbers to support the use of exercise in some form as a positive treatment option for individuals suffering from depression . all married women aged 1740 years with low socioeconomic status in their second trimester of pregnancy , who had depression , were considered . women with a diagnosed medical condition , pregnancy - related illness , significant physical or intellectual disability , post par tumor other form of psychosis , and severe depressions were excluded . during the pre - intervention assessment , both groups were asked to attend post - intervention assessment 4 and 8 weeks following the start of the program to complete the questionnaire . subjects in this group had 4 weeks exercise program , cycle 4 sessions a week for 4060 min / session . the exercise in each session were including : 10 min heating with walking , stretching and flexibility , and three sets of moderate intensity cycling in 6 min with 6065% of maximum heart rate . subjects in the control group were given a patient handout which is in gujarati explaining about the procedures to do as home based program . the hand out consist of five criteria such as stay active , do something that you think is fun each day , spend time with people who help or support you , relaxing and set simple goals . inter group analysis was done using wilcoxon - mann whitney test and intra group analysis was done using one - way anova . during the pre - intervention assessment , subjects have undergone kuppuswamy 's socioeconomic status scale and the physical health questionnaire-9 . both groups were asked to attend post - intervention assessment 4 and 8 weeks following the start of the program to complete the questionnaire . subjects in this group had 4 weeks exercise program , cycle 4 sessions a week for 4060 min / session . the exercise in each session were including : 10 min heating with walking , stretching and flexibility , and three sets of moderate intensity cycling in 6 min with 6065% of maximum heart rate . subjects in the control group were given a patient handout which is in gujarati explaining about the procedures to do as home based program . the hand out consist of five criteria such as stay active , do something that you think is fun each day , spend time with people who help or support you , relaxing and set simple goals . inter group analysis was done using wilcoxon - mann whitney test and intra group analysis was done using one - way anova . of 146 subjects , 80 ( 55% ) met the inclusion criteria and 60 ( 41% ) agreed to enroll . four subjects were excluded from the analysis in the exercise group ( group 1 ) and 2 subjects were excluded from analysis in the control group ( group 2 ) . no significance differences between groups were found at baseline on outcome variable such as depression level . analysis of depression level shows significant changes within and between exercise and control group . at baseline , the mean depression score was 15.96 ( 3.09 ) and 16.23 ( 3.38 ) for the exercise group and the control group , respectively . after the 4-weeks intervention , the mean score fell to 6.10 ( 2.44 ) for the exercise group ( 43.54% ) and to 10.60 ( 2.74 ) for the control group ( 21.25% ) . at the 8 weeks follow - up , the mean score was 1.34 ( 1.09 ) for the exercise group ( 72.81% ) and 5.03 ( 1.50 ) for the control group ( 42.50% ) . exercise has been shown in a number of studies to prove beneficial in the treatment of depressive symptoms especially in perinatal and post natal conditions . bartholomew showed that a single incidence of exercise can have a positive effect on mood . maintaining the intensity and frequency of exercise recommended by most public health agencies were sufficient to provide a significant reduction in major depressive disorder ( mdd ) symptoms . the additional benefits of exercise to individuals suffering from depression include stress reduction , better attitude , improved outlook , self - confidence , and mental well - being . our intervention , the physical exercises was developed to provide a culturally appropriate , feasible , and evidence - based physical therapy intervention for women living in very poor communities in rural india . these results suggest that supervised physical exercise provides better improvement in depression status in perinatal subjects .

background : perinatal depression is a major public health problem , affecting up to a quarter of all pregnant women in rural asean countries and often leads to psychologic symptoms , lower quality of life , and higher health care costs . the purpose of this study was to assess the impact of supervised physical exercise on depression level of perinatal subjects.subjects/intervention:60 subjects who fulfill the selection criteria were randomly assigned to exercise ( group-1 , n=30 ) and control group ( group-2 , n=30 ) . participants completed general screening form and physical health questionnaire-9 ( phq-9 ) before their intervention and again 4 weeks and 8 weeks later . group-1 underwent aerobic training with 60 - 65% maximum heart rate and group-2 was prescribed with handouts for 4 weeks.statistics:repeated-measures analysis of variance ( anova ) was use to analyze group differences over time while controlling for baseline differences.results:demographic and the baseline values show homogenous population ( p>0.05 ) . patients in both groups experienced significant reduction in depression level . group a showed reduction of 91.70% ( p=0.00 ) as compared to group b 69.01% ( p=0.00).conclusion : these results suggest that supervised physical exercise provides better improvement in depression status in perinatal subjects than providing handouts alone .

depending on the location of the perforation , signs of peritoneal irritation may be evident in cases of intra - peritoneal free perforation but hidden in cases of retroperitoneal perforation . the abscess or colonic gas may spread via various anatomic pathway when perforation of diverticulitis in the retroperitoneum occurs , and diverse atypical clinical symptoms may be present . thus , the atypical manifestation of retroperitoneal perforation of diverticulitis can cause difficulties when making the diagnosis . the delayed diagnosis and treatment could result in high morbidity and mortality . pneumomediastinum is initiated by many precipitating factors or diseases . however , it is rarely associated with colonic perforation , particularly in patients with no history of colonoscopic procedure [ 3 - 6 ] . here a 59-year - old man was referred to the emergency department because of persistent abdominal and left flank pain . the left flank pain had started 30 days before this visit as an acute nephrolithiasis . he had visited the local clinic and presumptive impression was left ureter stone because left costovertebral angle ( cva ) tenderness was apparent although radiologic study was not performed . however , the left flank pain worsened and was accompanied by abdominal pain 1 week ago . on physical examination , the patient looked ill and had a temperature of 38.2 , the blood pressure was 90/40 mmhg , the pulse rate was 101 beats / min , and the respiratory rate was 24 breaths / min . the abdomen was slightly distended and tender over the lower abdomen , without signs of generalized peritoneal irritation . laboratory results were within the normal range , except for the white blood cell count of 21,000/l . chest x - ray showed scanty bilateral pleural effusion without pneumomediastinum or free air in the peritoneal cavity ( fig . however , a computed tomography scan showed an infiltrative mass in the descending colon involving the left para - renal space . in addition , it showed massive air bubbles in the left retroperitoneum with diffuse infiltrates into the soft tissue ( fig . an emergency operation was performed because of suspected diverticulitis or colon cancer perforation with abscess formation . during the operation , a colonic diverticulitis perforation over the posterior wall of the sigmoid descending junction and a retroperitoneal abscess with necrosis of the parietal peritoneum were found . a segmental resection of the diseased colon and end colostomy were performed ( hartmann 's procedure ) . post - operative culture of the drain revealed enterococcus faecalis , which were sensitive to various antibiotics including penicillin , vancomycin , erythromycin , ciprofloxacin , and gentamicin . thus , we added vancomycin instead of metronidazole to the previous empirical antibiotics ( 1st generation cephalosporin , gentamicin , metronidazole ) on the 4th post - operative day . however , the condition of the patient deteriorated progressively after operation . colonic diverticulosis is a common disease , and its incidence increases with aging . among the patients with colonic diverticulosis , approximately 20% may develop diverticulitis as a result of infection and inflammation of the diverticuli . the perforation of diverticulitis is one of the most serious complications that require an urgent operation . the perforated lesion is usually covered and leads to abscess formation , whereas free perforation into the peritoneal cavity leading to diffuse peritonitis is relatively rare . in cases of free perforation , the diagnosis of diverticulitis perforation may be difficult depending on the location of the perforation , e.g. , perforation into the retroperitoneal space . in such cases , its manifestation can be presented with various conditions , including thrombophlebitis of the leg , inguinal abscess , hip and buttock pain , subcutaneous emphysema , and shortness of breath [ 1,3 - 6 ] . these various pathologic conditions caused by diverticulitis perforation can be explained by considering the anatomy . meyers reported that if gas is present in the para - renal space , which can be caused by sigmoid diverticulitis perforation , its progression from the posterior para - renal space through the diaphragm hiatus results in pneumomediastinum and cervical subcutaneous emphysema . reported that the soft tissue compartment of the neck , thorax , and abdomen contains four regions defined as the subcutaneous tissue , prevertebral tissue , visceral space , and previsceral space . the visceral space extends from the neck through the mediastinum to the retroperitoneum , forming an anatomic connection between these areas . therefore , an abscess or colonic luminal gas caused by diverticulitis perforation into the retroperitoneal space can spread to the other areas , resulting in unusual manifestations , similar to those observed in our case . the unusual complications of diverticulitis perforation have been reported , e.g. , subcutaneous emphysema , cellulitis , necrotising fasciitis , pneumopericardium , pericarditis , pneumothorax , and pneumomediastinum [ 1,3 - 6 ] . it can be caused by traumatic injury , intrathoracic infections , excessive coughing , sneezing , and in rare cases , colonic perforation , which is associated with a complicated colonoscopic procedure . to the best of our knowledge , there have been 5 cases of pneumomediastinum as a sequence of diverticulitis perforation in english literature ( table 1 ) . in these cases , the main symptoms were abdominal pain and fever , which were often accompanied with subcutaneous emphysema [ 3 - 6 ] . the symptoms and clinical signs of retroperitoneal diverticulitis perforation may be unclear and nonspecific at an early stage , and complications may occur without any previous symptoms of diverticulitis . therefore , making the correct diagnosis could be delayed and difficult , like in our case . in concusion , pneumomediastinum caused by retroperitoneal diverticulitis perforation is a very rare manifestation , and the symptoms are unclear . this leads to a delayed diagnosis , which can cause a life - threatening condition , particularly in patients without signs of peritonitis . it is necessary to consider the possibility of a colonic origin in patients presenting with abdominal pain and showing findings of pneumomediastinum for the prompt management of this condition .

a 59-year - old man presented with abdominal and left flank pain . the symptom had started 30 days before as an acute nephrolithiasis , which had worsened despite conservative management . the abdomen was slightly distended and tender over the lower abdomen , without signs of generalized peritoneal irritation . a computed tomography ( ct ) scan showed an abscess in left para - renal space up to the subphrenic space and an unexpected pneumomediastinum . an emergency operation was performed , which showed retroperitoneal diverticulitis perforation of the sigmoid descending junction with abscess formation . a segmental resection of the diseased colon and end - colostomy was performed ( hartmann 's procedure ) . however , the patient 's condition progressively deteriorated , and he died of sepsis and multi - organ failure on the 5th postoperative day . although pneumomediastinum caused by colonic diverticulitis perforation is extremely rare , it could be a life - threatening condition in patients without signs of peritonitis because of delayed diagnosis .

psychiatric and psychological morbidity has been reported in patients with genital warts . even though , genital warts are generally not associated with severe symptoms , they have profound adverse impact on quality of life of patients . if patient with genital warts , complains of severe and unusual symptoms are often considered psychological . we report a case of giant genital warts where the patient complained of formication ( insect - crawling sensation ) which was subsequently found to be due to maggot infestation in the warts . a 23-year - old married woman presented with large exophytic growth arising from perineum , vulva , introitus of the vagina , and inner aspect of thighs for past 4 months [ figure 1a ] . patient developed severe itching and formication in the lesions for 1 week , though she had never seen or recovered any insect . sexual history of the patient and her husband was unremarkable . in view of giant genital wart , serum enzyme - linked immuno sorbent assay ( elisa ) for hiv and venereal disease research laboratory ( vdrl ) test for syphilis was done for both husband and the wife but were negative . ( c ) three months after complete excision using a radiofrequency device cutaneous examination revealed an approximately 10 5 cm hyperpigmented , pedunculated growth with verrucous surface over both the labial folds symmetrically , completely obliterating the introitus . on per speculum examination , a diagnosis of giant condylomata acuminata was made and it was thought that patient 's unusual complaint about the the hpv viral genotyping using linear array ( roche ) showed hpv 6 and 11 . histopathology from the warts did not show any evidence of bushke lwenstein tumor or squamous cell carcinoma . on histopathological examination hyperkeratosis , papillomatosis , koilocytosis and dilated and congested capillaries in the dermis were found . within few days of presentation , she started complaining of paroxysms of severe perineal scratching consequent to increased sensation of crawling insects . but thinking that the disease was causing immense psychological stress hence leading to the strange symptoms , serial excision of the warts with a radiofrequency device ( ellman , oceanside , ny , usa ) was planned . during the procedure , local anaesthetic ( 2% lignocaine with adrenaline ) was infiltrated in the lesion and the procedure was started . suddenly , perhaps due to irritation caused by radiofrequency current , multiple live maggots were seen coming out of verrucous masses [ figure 1b ] . the procedure was abandoned and thick white petrolatum was applied to the area . approximately 20 live maggots were then removed with the help of forceps [ figure 2 ] and few of them were sent for entomological examination . the patient was given intravenous antibiotics ( ceftriaxone and amikacin ) in view of some denuded area produced due to radiofrequency excision of few warts . a magnetic resonance imaging ( mri ) of abdomen and pelvis was done to rule out deeper soft tissue infestation and damage by the maggots which turned out to be normal . patient 's symptoms completely resolved with few more sessions of extraction of maggots over the next 2 days and subsequent examination did not reveal any maggots . some of the removed maggots later , external genital warts were completely excised with radiofrequency [ figure 1c ] . there was no recurrence of excised warts in 4-month post - operative follow - up . warts inside the vagina are being treated with imiquimod and at the time of writing this report , they have reduced substantially in size and this treatment is being continued . myiasis is a parasitic infestation of human or animal skin , necrotic tissues and natural cavities by fly larvae or pupa . human myiasis is caused by fly larvae capable of penetrating body orifices as well as healthy or necrotic tissue . patton divided myiasis - causing flies into three parasitologic categories : obligatory , facultative , and accidental . cochliomyia hominivorax , chrysomya bezziana , and wohlfahrtia magnifica are the most common flies worldwide that cause human wound myiasis . chrysomia bezziana is the most common cause of cutaneous myiasis in india but usually infests wounds and mucous membranes . predisposing factors for human wound myiasis include open wounds , poor hygiene , advanced age , psychiatric illness , diabetes , vascular occlusive disease , and physical handicap . the clinical manifestations of wound myiasis vary according to the affected body area and the extent of the infestation . patients may present with fever , pain , bleeding from the infested site or may be complicated by secondary infection and tetanus . as far as ascertained , there is only one report in literature on myiasis in genital warts from brazil in which the patient was pregnant and after removal of maggots the pregnancy ended in spontaneous abortion . myiasis in our case was unusual in view of its site and its occurrence in the absence of the usual risk factors . due to rarity of condition , and our unfamiliarity we did not consider infestation by maggots though patient complained of crawling sensation and severe itching in the genital warts . the lesson learnt is to examine and investigate the patient thoroughly before dismissing patient 's complaints as irrelevant , psychogenic or functional , however unusual and unexplainable they are for the disease . the simplest treatment for myiasis is application of an occlusive agent such as white soft paraffin , wax , glue , adhesive tape or chewing gum followed by physical removal of maggots .

a 23-year - old woman presented with large exophytic genital wart arising from perineum , vulva , introitus of the vagina , and inner aspect of thighs . patient developed severe itching and formication ( insect - crawling sensation ) in the lesions for past 1 week , though careful examination did not reveal any insects . considering that the disease was causing psychological stress and physical symptoms , radiofrequency excision was planned . however , during the procedure , several maggots appeared from the crypts . the procedure was abandoned and maggots were removed manually . subsequently external giant warts were removed using radiofrequency device . there was no recurrence of excised warts during 3 month follow - up . to our knowledge , this is the second reported case of maggots in genital warts .

a packet was sent to the clinical microbiology laboratories of the 77 hospitals in the area . it included a letter describing the project , a questionnaire on hospital characteristics and laboratory testing methods , and a request for existing antibiograms from the most recent period for which completed data were available . the numbers of isolates tested and number of susceptible isolates were added for each antimicrobial agent from all hospitals for each region ( table a1 ) and for all regions combined . data from 10 hospitals were excluded , 7 because the aggregated antibiograms did not include the number of isolates tested and 3 because the antibiogram data predated january 2001 . thirty - one hospitals that were included in the final analysis represented the 4 regions as follows : 16 ( 42% ) of 38 hospitals in the central region , 6 ( 43% ) of 14 in the west , 4 ( 40% ) of 10 in the south , and 5 ( 33% ) of 15 in the southwest . of the hospitals included , 16% did not send a cumulative antibiogram but instead sent their data as a monthly report for a period from 3 months to 1 year . the proposed guidelines for analyzing and presenting cumulative antimicrobial susceptibility data were published by the clinical and laboratory standards institute ( formerly nccls ) in 2002 . the m39-a document provides a standardized means of data extraction for all drugs tested and outlines the most appropriate way to present the data ( 2 ) . in our discussions with laboratory personnel , we found that many laboratories are unaware of these guidelines , and laboratories that use the document find that adhering to all recommendations is difficult . many laboratories lack a microbiology supervisor with insight into the clinical relevance of the results they generate . for example , a laboratory reported 4% vancomycin resistance in streptococcus pneumoniae , but the laboratory staff was not able to explain this finding or recognize the clinical implications . also 2 of the hospitals reported 2 vancomycin - intermediate staphylococcus aureus in their antibiogram . however , the isolates were not available for verification , and the laboratory staff was not aware of the implications of this finding . the staff did not know that such findings should be reported to the illinois department of public health and the centers for disease control and prevention . in all regions , coagulase - negative staphylococci , pseudomonas aeruginosa , and enterococcus faecalis were among the 5 most frequently reported species ( tables a1 and a2 ) . the 10 most frequently reported species in our study are generally comparable to those found in the sentry survey conducted by pfaller et al . isolates tested in the central , west , south , and southwest regions , 27% , 53% , 34% , and 42% , respectively , were resistant to methicillin . of the hospitals that reported speciation of enterococci , e. faecalis was susceptible to vancomycin at 91%99% . however , hospitals from the southwest area reported enterococci other than e. faecalis as enterococcus spp . only . the unusually low susceptibility of e. faecium in our study may be attributed to specimen duplication . in the central illinois region , the susceptibility of s. pneumoniae to penicillin was 64%75% , and 52%77% of isolates were susceptible to erythromycin . the susceptibility of common gram - positive bacteria in our study appears to be lower than reported national averages ( 3 ) . although antibiogram surveillance and active surveillance yield comparable results ( 4 ) , national data may not be directly comparable to our findings because national data used for comparison results from active surveillance with different reporting periods . in spite of expertise and resources available in the united states , the use of antimicrobial drugs in day - to - day practice is suboptimal and directly responsible for multidrug resistance in a number of common pathogens . the factor that converts antimicrobial therapy from " empiric " to " rational " is in vitro susceptibility testing and reporting . however , if these tests are either not conducted or conducted poorly , they are not useful clinically and may create a false sense that therapy is rationally guided . given the differences and shortcomings we reported among laboratories in a region , national recommendations are either unknown or not followed . use of expertise , cooperation , and collaboration at the regional levels may be the simplest and most useful public health measures to optimize the usefulness of diagnostic microbiology in managing infectious diseases . antimicrobial drug use guidelines , if they are based on consistent , reproducible , and comparable data between different laboratories , will produce better outcomes . a master antibiogram for a region would allow a tertiary care institution to consider resistance patterns in hospitals referring patients and to select appropriate " presumptive " antimicrobial therapy or change drugs in nonresponding patients . we hope that the concept of " empiric antimicrobial therapy " would be changed to that of " presumptive antimicrobial therapy " based on host factors , common pathogens , and known susceptibility patterns in any given region . this study has helped us identify serious shortcomings in susceptibility testing methods and reporting , and we hope to address these issues through a regional advisory group . even if following all the recommendations in m39-a are not possible , the second best option may be to have all regional laboratories adhere to the same subset of recommendations . antimicrobial resistance data generated by this approach will have better day - to - day application than will data generated by large national databases . the data will also be useful in monitoring resistance trends in a region over time and assessing the effects of interventions to reduce antimicrobial resistance . we recognize the shortcomings of the data presented in this article but believe them to be the basis for improvement at a fundamental level .

we used hospital antibiograms to assess predominant pathogens and their patterns of in vitro antimicrobial resistance in central illinois , usa . we found a lack of information about national guidelines for in vitro antimicrobial susceptibility testing and differences in interpretation among laboratories in the region .

the dentigerous cyst is a common non - inflammatory odontogenic cyst of the oral cavity . it 's pathogenesis involves the accumulation of fluid between the unerupted tooth crown and surrounding follicle , giving rise to the characteristic clinical and radiographic finding of a cystic lesion surrounding the neck of the tooth ( latin : dens , tooth + gerere , to bear ) . treatment involves surgical enucleation or marsupialization with or without preservation of the impacted tooth , followed by histopathological evaluation to rule out an odontogenic keratocyst ( okc ) , ameloblastoma , or rarely , malignant transformation . we report an unusual histopathological variant of the dentigerous cyst , the keratinizing dentigerous cyst , which has been reported only once previously in literature . the present case is about a 21-year - old male patient of indian origin reported with a complaint of mild pain and swelling in the lower front region of the jaw for the past 1 year . intra - oral examination revealed a diffuse swelling in the lower anterior vestibule extending from the region of 43 to 36 . on palpation , the swelling was firm in consistency and egg shell crackling was elicited in some areas . the panoramic radiograph showed a well - defined unilocular radiolucency extending from the mesial aspect of 44 to the mesial root of 36 , extending to the mental foramen on the left side . 43 was impacted and the cystic lesion surrounded the crown of the tooth and extended for some distance along the mesial aspect of the root ( circumferential variant ) . cone - beam computed tomography was also performed and revealed involvement of roots of 42 , 41 , 31 , 32 , 33 , 34 , 35 and mesial root of 46 [ figure 1 ] . cone - beam computed tomography shows a unilocular lesion surrounding the crown of impacted 43 and extending along the mesial aspect of the root ( circumferential type ) an excisional biopsy of the lesion was performed under general anesthesia with conventional pre - operative medication cover and endotracheal intubation . a mucoperiosteal flap was raised from 44 to 37 region and the lesion was detached from the soft - tissue using blunt dissection and curetted out from the bony walls . root canal treatment was carried out for 41 , 42 , 31 , 33 , 34 and 35 . the specimen was sent for histopathological examination to rule out an okc or an ameloblastoma . the patient was called for review and a post - operative osteoprotegerin after 1 month . macroscopically , a cyst in - toto with a tooth , measuring 40 30 40 mm in size [ figure 2 ] and four bits of tissue curetted from the surgical site were sent for histopathological evaluation . the cyst was sectioned in half and processed along with the four bits of curetted tissue . gross finding of a tooth within a cystic bag filled with keratinaceous material microscopically , a fibrous connective tissue capsule in association with a non - keratinized cystic lining epithelium of varying thickness was observed . the four bits of curetted tissue microscopically showed the presence of hematoxyphilic substance , suggestive of keratin . we report a case of keratinizing dentigerous cyst which , to the best of our knowledge , has been reported only once previously in the literature . philipsen in 1956 suggested the term okc for all odontogenic cysts , regardless of type , showing keratinization of the epithelium . more recently , an okc is defined by other characteristics of the epithelium such as basal palisading , hyperchromatism of nuclei and cell thickness of the epithelium and not merely the presence of keratinization . the term keratinizing odontogenic cyst has been suggested for any cyst , regardless of the type , that shows keratinization . characteristically , the epithelial lining of a dentigerous cyst is not keratinized and most of those that have been described as keratinized have been ascribed to adjacent okcs . however , taking into consideration the established criteria , the present case did not show any of the features that currently define okcs . the patient was followed up after 1 year [ figure 4 ] and showed no clinical or radiographic signs of recurrence . ( a ) intra - oral - labial aspect of the patient 1 year postoperatively ( b ) intra - oral - lingual aspect of the patient 1 year postoperatively ( c ) orthopantamograph ( opg ) of the patient 1 year postoperatively the significance of keratinization in odontogenic cysts is not fully known . however , dentigerous cysts , thought to arise from reduced enamel epithelium , are products of end cells , i.e. cells that have completed synthesis ( enamel formation ) . considering the age of the patient , it is possible that the dentigerous cyst is a primordial variant , arising from more primitive cells of the developing enamel organ . long term follow - up of patients presenting with a keratinizing dentigerous cyst is advised to observe its potential for recurrence or malignant transformation since very little is known about this unusual entity .

keratinizing dentigerous cyst is a rare entity . this article reports a case of keratinizing dentigerous cyst associated with an impacted mandibular canine . clinical and radiological features , cone - beam computed tomography findings and histological features of the case are reported along with a discussion on keratinizing odontogenic cysts and the need for follow - up .

halorhodospira halochloris is an anoxygenic photosynthetic halophile that was isolated from the hypersaline wadi natrun lakes in egypt , residing in the mats near the sediments 8 . the genus halorhodospira was formed by separating species h. halophila , h. halochloris and h. abdelmalekii from genus ectothiorhodospira based on their 16s rrna sequences 4,6 . its cells are vibroid , motile by bipolar flagella and have internal photosynthetic membranes as lamellar stacks 13 . h. halochloris exhibits growth over an unusually wide range of medium nacl concentrations and is capable of growth down to 5% nacl , which is unusual for extremely halophilic bacteria . halophilic bacteria employ two differing strategies to protect their cytoplasmic volume against osmotic movement of water to the hypersaline environment 12 . , organic compounds are accumulated in the cytoplasm - these osmoprotectants are known as compatible solutes . the second biochemically , more radical adaptation involves the selective influx of k ions into the cytoplasm . h. halochloris accumulates glycine betaine ( n , n , n - trimethylglycine ) , a compatible solute as its osmoprotectant 5 . in addition to its osmoprotectant activity , glycine betaine also provides protection against mutagenic compounds and radiation - induced damage 9 . glycine betaine can either be taken up directly from the environment , or be synthesized de novo 11 . we recently used isoelectric focusing of total cell proteins to demonstrate that h. halochloris does not exhibit an acidic proteome , matching its inability to accumulate k 2 . in striking contrast we found that a closely related organism h. halophila accumulates molar concentrations of kcl when grown in high salt medium and has an acidic proteome . comparative genomics of h. halochloris and h. halophila promises to provide insights into this issue , which has implications both for genome - wide evolutionary processes and the mechanisms of halophilic adaptations . these considerations led us to determine the genome of h.halochloris , which we report on here . recently we reported the complete genome of h. halophila 1 . in this study , we report the draft genome sequence of h. halochloris , which was obtained through standard roche 454 pyrosequencing using the roche 454-junior instrument . the raw data obtained were trimmed at either end based on the quality score analysis performed using fastqc tool . poor or bad quality bases , probably originating from sequencing mis - calls , were trimmed off before subjecting it to the assembly software . we performed genome assembly using three different assemblers , namely newbler 16 , mira 17 and phrap 18 , with the default set of parameters . after comparisons of these assembly attempts based on contig sizes , genome representation and its functional elements , the output of mira 3.4.1 was selected to proceed with further analysis . the final output had some low quality contigs in terms of length and average coverage . all contigs of length less than 1kbp and average coverage < 10 were removed as being uninformative , from annotation point of view , and subjected to an individual annotation check using blast 14 . most of these individual contigs yielded relatively high e - value or no scores with halophiles . processed contigs were mapped against a distant reference genome ( thioalkalivibrio sulphidophilus ) , as no true known reference genome is currently available , based on 16s analysis , using contiguator 15 . the assembled scaffold comprises 137 contigs , 3,460,134 bases at 20 fold coverage and has a gc content of 63% . for comparison the genome of h. halophila is 2.7 mb in size and has gc content of 67% 1 . the jgi img / er annotation pipeline ( http://img.jgi.doe.gov/er ) was employed for gene annotation with img submission i d and img project i d , 15725 and 50543 respectively . the numbers of trna and rrna genes were predicted as 46 and 8 , respectively . a total of 3,301 putative protein coding genes ( cdss ) or open reading frames ( orfs ) were predicted with a total gene count of 3,376 . the genome has been submitted in public databases , ncbi , genbank ( gi number : 589289709 , genbank accession number : cp007268 ) . the draft genome information reported here provides opportunity for further research into the mechanism involved in halophilic adaptations and allow organisms to thrive in hyper saline environments , how these evolve and how they differ for bacteria and archaea 10 .

halorhodospira halochloris is an extremely halophilic bacterium isolated from hypersaline wadi nantrun lakes in egypt . here we report the draft genome sequence of this gammaproteobacteria ( gi number : 589289709 , genbank accession number : cp007268 ) . the 3.5-mb genome encodes for photosynthesis and biosynthesis of organic osmoprotectants . comparison with the genome of h.halophila promises to yield insights into the evolution of halophilic adaptations .

a medication error can be defined as a failure in the treatment process that leads to , or has the potential to lead to , harm to the patient. the use of the term failure signifies that the process has fallen below an attainable standard . as per the us institute of medicine 's report ( 1999 ) to err is human , every year 7000 preventable adverse drug reactions in usa were due to medication errors . to the best of our knowledge , this is the first report on the adverse event of intradermal hypersensitivity testing with cloxacillin resulting in pain and skin necrosis as a result of medication error . we describe a case report of cloxacillin - induced skin necrosis which occurred following intradermal skin testing for screening of hypersensitivity response . intradermal skin testing for diagnosing hypersensitivity response to cloxacillin was done for three patients who were admitted in the surgery ward of a tertiary care hospital . this included a 12-year - old boy diagnosed with cryptorchidism and admitted for inguinal exploration , a 28-year - old male admitted for bilateral breast mass reduction , and a 52-year - old male who was admitted for inguinal mass exploration . the test dose was given in the forearm of each patient , one after the other , using the same diluted preparation of cloxacillin . the nurse who prepared the test dose solution had apparently mixed 500 mg of cloxacillin sodium in 2 ml of distilled water , and had used 0.1 ml of the solution for intradermal injection in each of the three patients . however , the institute protocol for intradermal skin testing was only 0.5 mg per test dose . all three patients complained of intense pain , itching and rash over the site of injection within 30 min of receiving the test dose intradermal . this was followed by darkening of skin over the injected area which progressed to necrosis within 6 to 12 h and was associated with persistent pain [ figures 1 and 2 ] . after 12 h of receiving the test dose , pain subsided spontaneously in all three patients . skin necrosis at the site of intradermal test dose skin necrosis at the site of intradermal test dose adverse drug reactions are one of the important causes for significant morbidity and mortality among patients . among various causes for adverse drug reactions , medication errors include administration of a drug which is inappropriate for the condition or at an inappropriate dose . a study by kopp et al . , on medication errors in intensive care patients showed that around 17% of medication errors resulted in adverse drug reactions which were preventable . further , 83% of medication error had the potential to cause adverse drug reactions . in a study by bates , approximately 28% of adverse drug events were due to medication errors which were preventable . further , studies had also shown that the most common cause of medication error ( 36% ) was due to overdose followed by selection of wrong drug and wrong route of drug administration . this article highlights the seriousness of the reaction which could potentially occur with cloxacillin due to medication error . since the drug was given at 50 times the dose recommended for intradermal testing as per the institute protocol , the patient faced a serious risk of developing serious adverse events such as anaphylaxis . there had been reports of patients developing anaphylaxis even with the low dose used for penicillin hypersensitivity intradermal skin test . many of the medication errors occurred due to oversight or negligence during the process of prescribing , dispensing , storage and administration of drug . in a hospital setup , this could occur due to oversight by the nursing staff responsible for administering the drug . some of the common reasons could be overtime working , under trained staff , unsupervised nursing interns , complicated and unclear protocols , interpersonal communication gap between health care professionals and also poor availability of ideal resources . in this report , the drug was diluted in a wrong way by an unsupervised nursing intern . there is an important role for pharmacovigilance centers that can contribute to the detection and prevention of medication errors and increasing the safety of patients . these centers must alert health care professionals about the importance of reporting medication errors through bulletins and journals .

medication error is one of the important causes of preventable adverse drug reactions . it can occur in the form of administration of a wrong drug , in the wrong dose , to the wrong patient , in an unsuitable dosage form , for the wrong duration or by using an inappropriate route of administration . intradermal skin testing for cloxacillin hypersensitivity is done at low doses to check for drug allergy . in this report , three patients were given 50 times higher dose of cloxacillin than recommended for skin testing , resulting in pain and necrosis at the site of injection . the error occurred due to wrong dilution of the drug as done by a nursing intern . some reasons for this could be overtime working , under trained staff , unsupervised nursing interns , complicated and unclear protocols , interpersonal communication gap between health care professionals and also poor availability of ideal resources . pharmacovigilance centers must alert health care professionals about the significance of reporting medication errors through bulletins and journals .

currarino syndrome ( cs ) is a hereditary pathology that is characterized by a triad of malformations : sacrococcygeal bone defect , presacral mass , and anorectal malformation . radiologic imaging modalities such as ultrasonography ( us ) , computed tomography ( ct ) , and magnetic resonance imaging ( mri ) play a vital part in diagnosis and follow - up of this pathology . in this report , we aim to present the magnetic resonance imaging ( mri ) findings of a case with complete cs recognized in adulthood . a 20-year - old male patient who underwent anal atresia operation in childhood was referred to our department for evaluation of anal sphincter status with transrectal us . calibration of one - third of the inferior rectum was observed to be very thin , while one - third of the superior and middle segments of the rectum was seen to be dilated . the left half of s2 and s3 vertebrae , more distal sacral vertebrae , and coccyx were not seen . we also detected anterior meningocele related to spinal canal that originated from the neural foramen of s2 and s3 vertebrae . the lesion was isointense with cerebrospinal fluid in all of the sequences and its size was 4.5 3.5 cm . 20-year - old man with anal atresia operation history in childhood diagnosed with currarino syndrome . ( a ) t2-weighted sagittal magnetic resonance image shows calibre of one - third of inferior rectum is very thin ( thick white arrows ) , while superior and middle segments of the rectum are dilated ( arrowheads ) . also , the images demonstrate anterior meningocele ( asterisk ) at the posterior of the rectum related to spinal canal that originated from the neural foramen of s2 and s3 vertebrae . ( b ) fat - saturated t2-weighted axial magnetic resonance image shows partial cleft at l5 vertebra corpus ( thin white arrow ) and dilated rectum in front of it . on ( c ) t1-weighted and ( d ) fat - saturated t2-weighted axial magnetic resonance images , left half of the sacrum is not seen . in this part , spinal canal relationship of anterior meningocele ( asterisk ) and its indentation to the adjacent rectum is also observed . ( e ) t2-weighted coronal magnetic resonance images demonstrate the contiguity of the sacral defect and anterior meningocele ( asterisk ) more clearly ( r = rectum , b = bladder ) . currarino syndrome is a rare inherited disorder that is characterized by sacrococcygeal bone defect , presacral mass , and anorectal malformation . the complete form of this syndrome shows all three abnormalities and is rarer than the incomplete form which includes one or two of the disease components mentioned above . although the patients with this syndrome may present with complex conditions like recurrent urinary system infections or meningitis , chronic constipation is the most common finding . some of the cases are asymptomatic and can be diagnosed during adulthood only on x - rays and us examinations that are performed for different reasons . in addition to rectal digital examination , x - rays , us , ct , and mri are very helpful in the diagnosis of the syndrome . sacrococcygeal bone defect is a prerequisite for the diagnosis of cs and its spectrum changes from mild lateralization of the coccyx to multilevel hypoplasia of the sacral segments ( scimitar sacrum ) . in our case , there was partial cleft at l5 vertebra corpus and s1 vertebra was partially deformed . also , the left half of s2 and s3 vertebrae , more distal sacral vertebrae , and coccyx were absent . rectal and/or anal stenosis which may be fistulized to ascending spinal canal is the most common anorectal malformation which is seen in cs . anal atresia or ectopy , imperforated anus , rectal duplication , and rectourethral , rectovaginal , and rectovesical fistulas may be also associated with the syndrome . in our patient , there was heterogeneity of the cutaneous and subcutaneous soft tissue around the anus secondary to earlier anal atresia operation . enteric cyst , lipoma , hamartoma , dermoid and epidermoid cysts may be seen as well . us , ct , and mri are frequently used for diagnosing the mass lesion and determining its nature . mri is an invaluable technique to recognize accompanying additional pathologies like tethered cord , syringomyelia , and intradural lipoma . in our patient , we detected a 4.5 3.5 cm size anterior meningocele related to the spinal canal . cloacal malformation with anal atresia , double vagina , rectovesical fistula , urogenital sinus , neurogenic bladder , vesicoureteral reflux , and multicystic kidney are other related pathologies of cs . mri is a very useful imaging modality to diagnose cs and accurately detect all the three components . besides , it can show the different aspects of other cloacal malformations including the uterus , vagina , maldeveloped puborectalis , and external anal sphincter . although these anomalies are not surgically correctable , early detection almost always provides better prognosis and helps in patient management . another major advantage of mri over other imaging modalities is the ability to detect associated anomalies of anorectal malformations , especially of the spinal cord , spine , and urogenital system . kassir et al . , also reported that mri is a specific and sensitive non - invasive diagnostic tool in patients with anorectal malformations . mri provides excellent information about the postoperative anatomy of anorectal malformations . due to its superior soft tissue characterization , multiplanar imaging ability , and lack of ionizing radiation exposure these unique features make mri a very appropriate modality in follow - up of patients treated for anorectal abnormalities . the treatment strategy changes based on the type of pathology . the management of the anorectal anomaly and presacral mass may be performed with single - stage surgical procedure . if the mass is a meningocele , a staged operation must be preferred due to the risk of meningitis . cs should be obviously considered in patients with sacrococcygeal bone defect , presacral mass , and anorectal malformation . mri may be used safely in diagnosis of the syndrome , in detecting the accompanying mass lesions and other pathologies , and in the follow - up investigations after treatment in patients with cs .

currarino syndrome is a hereditary pathology that is characterized by sacrococcygeal bone defect , presacral mass , and anorectal malformation . sacrococcygeal bone defect is almost always a part of the syndrome . the complete form of this entity displays all three abnormalities and is very uncommon . in this report , we present the magnetic resonance imaging findings of a case with complete form of currarino syndrome recognized in adulthood .

ureteritis cystica ( uc ) is usually suspected when defects of filling are seen in the ureter in contrasted images of the urinary tract . although is the condition is usually an incidental finding during the evaluation of the urinary tract , it presents occasionally with acute flank pain . a urinalysis showed a ph of 6 , was positive for haemoglobin and leukocyte esterase ( + + ) . bilateral renal morphology and function were normal including a normal left ureter . in the distal right ureter cytology of the ureteral washings was also negative for malignant cells . to further refine the diagnosis computerized axial tomography ( ct ) and urological magnetic resonance ( mru ) both studies showed that the right ureter was occupied from the crossing of the iliac vessels to the bladder by material with characteristics soft tissue . there was no evidence of retroperitoneal , iliac or inguinal lymphadenopathy , or hepatic lesions ( figs . 2 and 3 ) . in view of these findings a biopsy was negative for cancer . with the presumptive diagnosis of ureteritis cystica , we opted for observation with annual follow - up . the patient remains asymptomatic and free of urinary tract infections , haematuria or renal pain . ureteritis cystica is defined as the cystic transformation of the epithelial nest of brunn , with the appearance of numerous cysts containing clear fluid with sizes between 1 and 10 mm with flattened epithelial walls . it is considered of the result of irritation in nonspecific chronic inflammations.1 other etiological factors that have been postulated include bilharziasis , vitamin a excess and increased immunoglobulin a. none of these factors have been proven to play a specific role.2 ureteritis cystica is an infrequent condition which is predominantly found in adults females,3 but also reported to occur in men and children . although usually unilateral , bilateral cases have been described.4 the location of the cysts is predominantly in the proximal ureter , but they can be found at any level of the urothelium . the lesions are benign with low potential for degeneration , although occasionally it has been associated with bladder carcinoma or renal carcinoma.4 the clinical presentation is variable . ureteritis cystica is usually detected during the evaluation of urinary tract infections ( 82% ) , lithiasis ( 53% ) or haematuria ( 52%).57 the most commonly used imaging techniques are excretory urography and retrograde pyelography . in these imaging studies one can observe numerous defects of filling with well - defined , rounded smooth contours often with a scalloping appearance.7 in cases where the diagnosis is uncertain , as was the case in our patient , ct scan and mru can be used to better define the nature of the lesions , their extent , the presence of other abnormalities . other lesion that can have a similar appearance include , ( radiolucent stones , clots , veins , air bubbles , tuberculous ureteritis).8 when the imaging studies are not conclusive , ureteroscopy plays a fundamental roll in the ability to directly visualize the cystic formations and to take biopsies in order to realize an anatomo - pathological analysis.7 in fact , many authors consider endoscopic diagnosis as the most appropriate in these cases.6 the treatment consists of eliminating the process which is causing the inflammation ( infection , lithiasis ) , although in those cases in which obstruction other measures may be appropriate . in table 1 imaging studies should be complemented with ureteroscopy and biopsy when indicated when tumour is suspected .

ureteritis cystica is an uncommon cause of acute renal pain . the aetiology remains unclear and the diagnosis may be difficult to establish . we report the case of a 29 year old woman with a history of repeated urinary tract infections presenting with acute renal colic in the absence of lithiasis . we review the diagnostic tools available to make the diagnosis and the recent pertinent literature .

gastroschisis is a right - sided , small , and full - thickness paraumbilical defect of the abdominal wall that occurs in 1 of 4000 births . unlike an omphalocele , theories concerning the etiology of gastroschisis are usually considered to be the result of a vascular insult . cardiac and genitourinary abnormalities have been associated with gastroschisis , but presence of extra - gastrointestinal anomalies warrants search for alternative diagnosis . in the presented case , gastroschisis associated with spinal and lower limb anomalies in early age group mother ( primiparous ) has been presented . a 22-years - old full - term primiparous patient underwent an ultrasound examination , we found large paraumbilical defect with herniation of stomach , small and large bowel loops , liver , gallbladder , and right kidney . herniated stomach and bowel loops were rest over internal os [ figure 1 ] . amount of liquor was very less and fetus looked flexed and twisted in breech presentation . spinal anomalies were observed block cervical vertebrae with spina bifida of cervical and lumber spines . in lower limbs anomalies , mildly short , thin left femur and left tibia with very thin fiber - like left fibula were seen . both feet were rudimentary , especially left foot , with no defined toe while right foot was with four abnormal toes . usg image of fetal abdomen showing herniated bowel loop , right kidney , and fetal liver resting on maternal internal os usg image of fetus showing two vessel cords after delivery , we took photographs of dead abnormal newborn . stomach , intestinal loops , liver , gallbladder , and right kidney were herniated through the large abdominal defect [ figure 3 ] . both lower limbs were mildly short ; left leg being thinner with deformed feet and small three buds of toes while right foot presented with four abnormal toes [ figure 4 ] . left side hip was small with kypo - scoliotic curvature of vertebral column photograph of newborn showing herniated bowel loops and liver with intact umbilical cord photograph of newborn showing small and thin left leg with deformed both feet ct scan and radiograph of newborn were also obtained [ figures 5 - 7 ] and the above said findings were corroborated by the images . ct vrt image of newborn showing blocked cervical vertebrae with cervical and lumbosacral spina bifida ct vrt image of newborn showing short , thin left femur and tibia with thin fiber - like fibula and rudimentary left iliac bone anterioposterior radiograph image of newborn showing blocked cervical vertebrae with cervical and lumbosacral spina bifida , short and thin left femur , thin tibia and rudimentary left iliac bone gastroschisis is a congenital anterior abdominal wall defect , adjacent and usually to the right of the umbilical cord insertion . this differentiates it from an omphalocele , which usually is covered by a membranous sac and more frequently is associated with other structural and chromosomal anomalies . in addition , however , gastroschisis may be associated with gastrointestinal anomalies such as intestinal atresia , stenosis , and malrotation . by the study of stoll c et al . of omphalocele and gastroschisis and associated malformations , they assessed these associated malformations ascertained between 1979 and 2003 in 334 262 consecutive births . these included patients with chromosomal abnormalities ( 25 , 29.0% ) and non - chromosomal syndromes . malformations of the musculoskeletal system ( 31 , 23.5% ) , urogenital system ( 27 , 20.4% ) , cardiovascular system ( 20 , 15.1% ) , and central nervous system ( 12 , 9.1% ) were the most common , other congenital malformations in patients with omphalocele and non - syndromic multiple congenital anomalies ( mca ) . performed an international study to identify malformation patterns and to evaluate the role of maternal age in non - isolated cases of gastroschisis and associated defects . case - by - case information from 24 registries , all members of the international clearinghouse for birth defects surveillance and research ( icbdsr ) were evaluated . their results showed that of 3 322 total cases , 469 non - isolated cases were registered ( 14.1% ) : 41 chromosomal syndromes , 24 other syndromes , and 404 mca . among mca , four groups of anomalies were most frequent : cns ( 4.5% ) , cardiovascular ( 2.5% ) , limb ( 2.2% ) , and kidney anomalies ( 1.9% ) . no similar patterns emerged except two patterns resembling limb - body wall complex and omphalocele - exstrophy - imperforate anus - spinal defects ( oeis ) . in both of them , the gastroschisis could be misclassified . chromosomal trisomies and possibly non - syndromic mca are associated with an older maternal age more than isolated cases . on consideration of their data and the most valid studies published in the literature , the best estimate of the proportion of gastroschisis associated with major unrelated defects is about 10% , with a few cases associated to recognizable syndromes . recognized syndromes with gastroschisis seem to be so exceptional that the well documented and validated cases are worth being published as interesting case report . an appropriate case definition in etiological studies should include only isolated gastroschisis after an appropriate definition of isolated and non - isolated cases and a thorough case - by - case review . reported a rare case of a newborn baby with an abdominal wall defect , together with multiple congenital abnormalities and diagnosed as gastroschisis . there were multiple defects seen as spinal deformity , imperforate anus , esophageal fistula , and lower limb deformity ( congenital talipes equinovarus ) along with the webbing of neck . there were also ischemic changes present over the left upper limb in the form of cyanosis . the diagnosis made was gastroschisis and omphalocele along with spinal deformity . in the presented case , head , face , neck , thorax , and both upper limbs were normal . although gastroschisis has rare associated malformations , but if present , pentalogy of cantrell , limb - body wall complex , etc . other birth defects are associated with gastroschisis , most commonly , abnormalities of the cardiac and genitourinary . the present case was not completely considered within any known alternative diagnosis of gastroschisis - associated complex , non - syndromic and syndromic anomalies . the presented case of gastroschisis , therefore , highlight the associations of both spinal and lower limbs anomalies in primiparous , which was proven to be a rare case .

gastroschisis is not a very rare congenital deformity , but extragastrointestinal association is rare , if any present , in that condition , an alternative diagnosis should be considered , like pentalogy of cantrell , limb - body wall complex , etc . , other birth defects are always associated with gastroschisis , most commonly , abnormalities of the cardiac and genitourinary . the present case is one of the gastroschisis to highlight the associations of spinal and lower limbs anomalies , with two - vessel short umbilical cord and severe oligohydramnios in primiparous .

toxocara canis ( t. canis ) , a common dog roundworm , is one of the causative agents of visceral larva migrans ( vlm ) . when infective eggs of t. canis reach the human gastrointestinal tract , they enter the portal system and reach the liver . some larvae then migrate from the liver to the lung and the heart through the systemic circulation . myocarditis may occur in 10 - 15% of cases of vlm , and in those cases , myocarditis is accompanied by an increased level of circulating eosinophils . there have been approximately 10 cases of myocarditis associated with toxocara infection and only 2 cases were found in english publication since the year 2000 . this is the first report in korea . here , we present case of myocarditis associated with eosinophilia caused by t. canis vlm . a 41-year - old woman presented at our hospital complaining of chest discomfort and pain . she had been healthy with no significant preceding symptoms , allergic history or past medical history . the initial examination showed the following findings ; body temperature 37.8 , blood pressure 94/60 mmhg , heart rate 100 beats / min and a cardiac gallop rhythm . laboratory data on admission revealed decrease in the total white blood cell count ( 1040/mm ) , elevated enzymes ( creatinine phosphokinase 236 iu / l , aspartate aminotransferase 112 iu / l , alanine aminotransferase 87 iu / l , lactic dehydrogenase 588 iu / l , troponin - i 4.070 ng / ml , ck - mb 12.32 ng / ml and probnp 8760 pg / ml ) . electrocardiogram ( ecg ) showed a regular sinus rhythm with low voltage in all limb and precordial leads ( fig . transthoracic echocardiogram ( tte ) showed marked edematous left ventricular ( lv ) myocardium and global hypokinesis ( fig . 2a ) , resulted in mild left ventricular systolic dysfunction ( lv ejection fraction = 48% ) ( fig . there was no significant valvular dysfunction and small pericardial effusion without tamponade physiology was noted . empirical treatment such as intravenous antibiotics injection , bed rest , pain control and close vital sign monitoring were performed . on the tenth day of admission , total white blood cell count ( 17160/mm ) and eosinophil count ( 8430/mm ) markedly increased ( 49% of her total white blood cell count ) . we started oral administration of prednisolone 1 mg / kg for 3 days and performed ventricular endomyocardial biopsy . the antibody test against parasitic infection demonstrated that toxocara immunoglobulin g ( igg ) was positive . taken together , we diagnosed that she had myocarditis caused by t. canis vlm . we started oral administration of albendazol 400 mg twice a day for two weeks after oral prednisolone 1 mg / kg administration for 3 days . tte finding showed that echogenicity of lv myocardium was markedly decreased and wall thickness was normalized ( fig . 2c ) . after the completion of the treatment , physical examination , laboratory tests , ecg and echocardiogram showed no abnormal findings and she was able to return to work . human toxocariasis is a helminthozoonosis due to the migration of toxocara species larvae through human organism . many reviews from western countries indicated that children under 12 years old , who often play outside , are the most affected age group for toxocariasis.1)2 ) they are accidentally infected with t. canis eggs , which expelled in feces puppies and fully develop in the surrounding environment within two to four weeks . human become infected by ingesting either embryonated eggs from soil ( geophagia , pica ) , dirty hands or raw vegetables , or larvae from undercooked giblets . when embryonated eggs of t. canis reach the human gastrointestinal tract , they hatch and enter the portal system , reaching the liver . some larvae then migrate to the lungs and heart through the systemic circulation.3 ) in this case , we could not find obvious source for t. canis infection . we assumed that she infected by ingesting embryonated eggs or larvae from raw vegetables , such as lettuce . a definitive laboratory diagnosis of human toxocaral infection can be achieved by pathology examination of various organ specimens . however , such a direct parasitologic assessment is awkward and uncommon , serologic methods are the mainstay for the diagnosis . the most commonly utilized diagnostic serologic test is the enzyme - linked immunosorbent assay with toxocara excretory secretory antigen . but when interpreting a serologic result , it should be kept in mind that the numerous seropositive individuals detected through screening of large populations in epidemiological surveys probably represent past rather than recent infection . immunologic testing therefore , should be accompanied by a blood eosinophil count and if possible , by determination of serum total immunoglobulin e.4 ) a finding of both a peripheral eosinophilia and a positive serologic test result is indicative of active toxocariasis.5 ) myocarditis in vlm may result from direct larval invasion to the myocardium and/or hypersensitivity reactions to the parasites.6 ) it has been suggested that there are 3 clinical stages of eosinophilic myocarditis : acute necrotizing phase , thrombotic phase and endomyocardial fibrosis phase . loffler 's endomyocarditis is considered to correspond to the second stage of eosinophilic endomyocardial disease . the third stage probably corresponds to restrictive myocarditis.7 ) differential diagnoses include other types of myocarditis , churg - strauss syndrome , hypersensitivity reaction , malignant diseases , parasitic infection or hypereosinophilic syndrome . tte finding shows diverse feature including diffuse severe hypokinesia or left ventricular focal asynergy.8 ) in our case , lv diastology did not showed significant dysfunction except abnormal relaxation . we think mild decreased lv systolic function , ( left ventricle ejection fraction = 48% ) was the reason . thrombus also can occur and according to its characteristics , not only anticoagulation therapy but also surgical removal of the thrombus should be considered to prevent systemic embolism.9)10 ) therapy is primarily based upon administration of anthelmintics . currently , 5 days or more use of albendazole 800 mg / day or 10 mg / kg / day are recommended for treatment of t. canis infection . the mechanism of its anthelmintic action is inhibition of tubulin polymerization and microtubule - dependent glucose uptake inhibition . in this case , for the control of aggravated eosinophilia , we started administration of prednisolone . because she did n't have cardiac tamponade , cardiogenic shock or pulmonary edema , prednisolone was administered at 1.0 mg / kg / day.8 ) and as soon as we confirmed toxocara igg positive , albendazole was added to the medication . when a patient who has myocarditis with eosinophilia occurs , toxocara infection should be considered for possible cause .

a 41-year - old woman who was diagnosed with myocarditis presented eosinophilia . since the antibody against toxocara canis ( t. canis ) was positive , we diagnosed that she had visceral larva migrans due to t. canis associated with myocarditis . she was treated with oral albendazole and prednisolone for two weeks , eosinophil count and hepatic enzymes were normalized after completion of treatment . this is the first report of myocarditis caused by t. canis infection in korea .

ovarian stromal tumor with minor sex cord elements was first described by young and scully in 1983 . only 11 cases of ovarian stromal tumor with minor sex cord elements have been reported till date . only three cases of ovarian stromal tumors with minor sex cord elements with coexistent endometrial carcinoma have been reported . we report a case of a 79-year - old female who presented with post - menopausal bleeding and an ovarian tumor which was post - operatively diagnosed as ovarian fibroma thecoma with minor sex cord elements . patient was also found to have well - differentiated endometrioid adenocarcinoma of uterus and underwent surgical staging for it . a 79-year - old woman presented with post - menopausal bleeding and pain in lower abdomen for 2 months . the obstetric history of the patient was p2l2 and the patient had attained menopause 30 years back . a firm mass was palpable in lower abdomen extending upto umbilicus . on vaginal examination , uterus size could not be made out and a large abdomino pelvic mass was palpable . abdominal ultrasonography revealed a normal - sized uterus with endometrial thickness of 7 mm and a 20 10 cm solid mass in pelvis and lower abdomen . patient underwent endometrial aspiration and it was reported as endometrioid adenocarcinoma ( grade 1 ) . patient underwent staging laparotomy which revealed a 20 10 cm solid left ovarian tumor . the right ovary was normal and there was minimal ascites which was sent for cytology . on exploration , intestines , liver and biliary tract , pancreas , omentum , and fallopian tubes the patient underwent total abdominal hysterectomy with bilateral salpingo - oophorectomy , infra - colic omentectomy , and pelvic lymphadenectomy and the specimen was submitted for histopathological examination . left ovary measured 21 14 10 cm and the cut section was homogenously fleshy with areas showing yellowish discoloration . cut section of the uterus revealed a 4 3 cm exophytic fundal growth in the endometrial cavity infiltrating less than one - third of the myometrium . the right ovary , omentum , and bilateral fallopian tubes were grossly normal . on microscopic examination , left ovary showed features of a stromal tumor with minor sex cord elements [ figure 1 ] . the tumor comprised mainly of fibroma - thecoma component ( more than 90% ) with few aggregates of granulosa cells [ figure 2 ] . these granulosa cell aggregates were immunoreactive for inhibin [ figure 3a ] and calretinin [ figure 3b ] . stromal tumor with minor sex cord elements , fibroma with intermingled sex cord structures sex cord structures show scant cytoplasm and a round to ovoid nucleus with a longitudinal groove resembling granulosa cells granulosa cells showing positive immunostaining for ( a ) inhibin and ( b ) calretinin multiple sections from the endometrial growth showed features of a well - differentiated endometrioid adenocarcinoma ( grade i ) . the patient did not receive radiotherapy post - operatively and she is on regular follow - up . ovarian bromas with minor sex cord elements are rare tumors and only 11 such cases have been reported . the predominant component in such tumors is generally broma or thecoma with sex cord elements dispersed randomly and occupy less than 10% of area of the total area of the tumor on any slide . these patients usually present with bleeding per vaginum , pain abdomen , or abdominal mass . the tumor size can range from 1 to 10 cm or ovary may be of normal size . in our patient , the gross appearance of such tumors resembles broma or a thecoma , which are solid , rm , whitish - to - yellow neoplasm . on microscopy , they are composed of spindle - shaped cells , arranged in intersecting fascicles with variable amount of collagen and intermingled sex cord elements . sex cord components vary in appearance between fully differentiated granulosa cells and indifferent tubular structures resembling immature sertoli cells . differential diagnoses include ovarian fibromatosis , brenner tumor , and adenofibromas . in ovarian fibromatosis , there is a proliferation of spindle - shaped cells with abundant collagen formation and focal areas of edema . the epithelial aggregates of brenner tumor are composed of transitional cells or mucinous cells . in adenofibroma , the glands are abundant , larger , and tubular and more variable in size when compared to uniform tubules of minor sex cord elements . in 1983 , young and scully reported seven cases of fibromatous tumors of the ovary , of which five cases were ovarian fibroma with minor sex cord elements and the other two were luteinized thecoma and stromal - leydig cell tumor with minor sex cord elements . two out of these seven cases also had well - differentiated adenocarcinoma in the endometrium . zhang et al . reported 50 cases of luteinized thecomas and stromal leydig cell tumors . they found the presence of sex cord elements with granulosa cell morphology in only two of 50 cases . a case of mucinous cystadenoma coexisting with stromal tumor with minor sex cord elements was reported by yang et al . ovarian stromal tumor with minor sex cord elements is a rare tumor , which may be hormonally active predisposing to carcinoma endometrium . meticulous histopathological examination is essential for identication of the sex cord elements even if potential source of estrogen like the coma is present . patients diagnosed with such tumors need regular follow - up as the clinical behavior and risk of recurrence in these patients require further evaluation .

ovarian stromal tumor with minor sex cord elements is a rare tumor . it is composed of predominantly fibrothecomatous tumor with scattered minor sex cord elements in less than 10% of the tumor area . these tumors may be hormonally active and predispose to carcinoma endometrium . a case of ovarian fibroma thecoma with minor sex cord elements in which coexistent endometrial carcinoma was also discovered is being reported . though thecoma may be a predisposing factor for endometrial cancer , meticulous histopathological examination of the ovary may reveal additional sources of estrogen like granulosa cell aggregates as in our patient . such patients would require long - term follow - up to detect any recurrence of granulosa cell tumor .

the past and present periods of large - scale genome sequencing have brought an enormous wealth of protein sequences that makes managing , navigating and mining the data an area of research in its own right . mutations , insertions and deletions create sequence diversity inside a domain family . on a higher level , recombination events combine domains in different architectures to give the single- or multi - domain proteins we observe . various invaluable tools exist to reduce the diversity of proteins into a reduced set of protein domain families . semi - automated methods such as pfam ( 1 ) , prosite ( 2 ) or smart ( 3 ) extrapolate the information gained from known members of protein domain families by matching sequences to libraries of hidden markov models ( hmms ) , profiles or patterns . integrative projects such as interpro ( 4 ) combine various primary sources to yield a summary view on protein sequences . fully automated methods such as prodom ( 5 ) or domo ( 6 ) apply algorithms to achieve a classification based on first principles . previously , we have introduced the automatic domain decomposition algorithm ( adda ) ( 7 ) , a method for clustering very large sets of protein sequences . adda first splits sequences into domains and then organizes these domains into protein domain families . the classification is constructed in an entirely automated fashion from first principles and thus is not biased by human curation , but only limited by the applied algorithms . we have applied adda to the set of all known protein sequences that are available in the major public databases . using all sequences for clustering has the advantage of drawing the boundaries between protein domain families in a globally consistent manner . this is in contrast to scanning methods such as pfam and smart , where novel or hypothetical sequences are scanned against a library of hmms or profiles . matches at the borderline of significance can be due to a newly discovered remote relative or to spurious similarity . in such events , , we describe a database with a web interface that allows scientists to download and browse the results . the web interface lets a scientist explore the context of a protein sequence in the protein universe : its immediate neighbours as determined by pre - computed sequence similarity searches , and its remote homologues as determined by its domain composition . alternatively , a scientist can browse the domain families to hunt for domain families of interest . the database contains more than 1.5 million sequences from uniprot / swiss - prot , uniprot / trembl ( 8) , ensembl ( 9 ) , ncbi genomes ( 10 ) and other sources of protein sequences . the clustering yields 2.7 million domains , which are grouped into 123 000 families . of these , 40 000 the domain and domain family definitions result from an automated clustering procedure applied to the set of all protein sequences in the major public databases . the process starts by removing sequences with > 40% sequence identity to any other sequence from the input set ( 11 ) . the remaining representative sequences are then aligned in an all - versus - all manner using the blast ( 12 ) program . domains are defined so that a minimum number of alignments are intersected by domain boundaries and these alignments cover domains as much as possible . after splitting protein sequences , the resultant domains are grouped into families of related sequences by a single - linkage clustering algorithm . domains joined by alignments are grouped into a family if their domain boundaries are consistent . finally , domain boundaries are mapped from the representative sequences onto all sequences in the database . quality control monitors two aspects of the clustering by comparing adda domains to curated databases of domain families like pfam and scop ( 13 ) . the correspondence of domain boundaries is checked by computing the relative overlap between adda and reference domains . adda tends to split conservatively ; adda domains are , on average , larger than reference domains . the correspondence of domain families is measured by matching each adda family to the best matching reference family and counting the relative frequency of other reference families in the adda family ( selectivity ) and the relative frequency of reference domains assigned to different adda families ( sensitivity ) . on average , an adda domain family unifies 93% of the members of a pfam family while containing only 5% contamination . in multi - domain proteins , domains of different protein families co - occur . based on the observed architecture of protein sequences , domain families can be divided into two groups : mobile modules and associated families . associated families either always occur in single - domain proteins or are always associated with the same domain family . in the present release , there are 9252 mobile modules and 49 455 associated families ( figure 1a ) . while the latter tend to be specific to a single kingdom ( archaea , bacteria and eukaryota ) , mobile modules have a larger taxonomic range ( figure 1b ) . a domain family is declared to be structurally covered if one of its domains can be mapped onto a structure in the pdb database of protein structures ( 14 ) . for each adda domain , we register the sequence overlap with domains from curated domain databases ( pfam , scop and interpro ) . an adda domain family is classified as novel if < 5% of its domains overlap with domains from the curated domain databases . adda contains 3828 novel mobile modules that are not known to curated domain databases and for which there is no structural information available ( figure 1c ) . novel domain families tend to have fewer members ( < 200 ) than well - known domain families . the number of novel domains in associated families is even larger comprising 40 505 domain families . the interface allows the user to query for protein sequences by identifier , accession number or sequence similarity . links allow the user to browse similar sequences in the direct neighbourhood of a query sequence ( multiple alignments pre - computed using blast and psi - blast ) and to switch to the domain families to get all related sequences beyond the immediate neighbourhood . attributes available for querying are the size of the family , its taxonomic spread , its structural coverage , the number of associated domains ( querying for mobile modules ) , the overlap with other domain classifications ( querying for novel domain families ) and others . the domain family view includes a summary overview over the protein family and links to other domain classifications . the sequences of all domains in a domain family can be downloaded for local analysis . if structures are known in the family , the domain boundaries are mapped onto the structures for visualization with rasmol ( 15 ) . in the browsing section , the user finds links to precompiled domain sets of interest , e.g. all exclusively eukaryotic mobile domains or a list of domain families without known structures ( structural genomics targets ) . in addition , a genome browser allows access to all or a selection of domain families occurring in a genome . for example , adda is linked to by the dali domain database ( 16 ) and vice versa . links and attributes can be queried in numerous ways . one application of the database interface is to hunt for novel domain families . for example , typing sapiens into the genome browser lists 28 791 domain families in human protein sequences . the result set can be restricted to exclude domain families that have domains from archaea or bacteria and/or are not novel and not a mobile module giving 7933 domain families . modifying the query to include only domains with more than 20 members produces 108 novel domain families that occur in human protein sequences , are specific to eukaryotes and have at least 20 members . our aim is to push the functional annotation of proteins as far as possible using only automated methods . we are currently testing methods to split domain families into groups of orthologous proteins and automated methods to define functionally important residues in a family .

we used the automatic domain decomposition algorithm ( adda ) to generate a database of protein domain families with complete coverage of all protein sequences . sequences are split into domains and domains are grouped into protein domain families in a completely automated process . the current database contains domains for more than 1.5 million sequences in more than 40 000 domain families . in particular , there are 3828 novel domain families that do not overlap with the curated domain databases pfam , scop and interpro . the data are freely available for downloading and querying via a web interface ( http://ekhidna.biocenter.helsinki.fi:9801/sqgraph/pairsdb ) .

methamphetamine ( ma ) is used as a recreational drug for its properties which cause sense of energy and euphoria . the same amount of ma may not cause harm in some individuals , however , it also may be seriously toxic for some other individuals . ma may cause hepatotoxicity , rhabdomyolysis , cardiotoxicity , nephrotoxicity , and neurotoxicity separately or sometimes together as multisystem toxicity , mostly as a serious condition requiring hospitalization . nephrotoxicity generally presents as acute kidney injury , hyponatremia , and hypertension 1 , 2 , 3 . a 32yearold male was admitted to our facility with muscle weakness , pain , and a 1 day history of oliguria . he had a history of ma abuse 3 years ago and used the same substance orally 1 week prior to admission . physical examination revealed acidotic breathing , paleness and bruises of the skin in the lumbar region . laboratory findings on admission included creatinine kinase ( ck ) 15,000 u / l , lactate dehydrogenase ( ldh ) 1509 u / l , urea 284 mg / dl , creatinine 8.06 mg / dl , aspartate transaminase 456 u / l , alanine transaminase 753 u / l , and sodium 131 mmol / l , potassium 6.7 meq / l . he was diagnosed with rhabdomyolysis and acute kidney injury , and intravenous hydration treatment with isotonic saline solution was begun , based on urine output . however , because of his continuing uremic status and hyperkalemia , he underwent five rounds of hemodialysis ( hd ) . following bed rest , carbohydrate predominant diet , adequate fluid resuscitation , and hd , the clinical status and laboratory parameters improved significantly over the next 12 days of hospitalization ( fig . 1 ) . creatinine kinase and lactate dehydrogenase survey of the patient during follow up . many systems , including especially the nervous system , may be pathologically affected due to these substances . ma generally damages dopaminergic and serotonergic nerves in central nervous system and this contributes its high abuse potential 4 . in addition to cardiovascular and neurological effects , ma abuse may result in hyperpyrexia , hyponatremia , rhabdomyolysis , disseminated intravascular coagulopathy , gastrointestinal bleeding , hepatic failure , and renal failure . mainduced renal injury possibly occurs due to traumatic rhabdomyolysis , necrotizing vasculitis , urinary tract obstruction , hypertension , proximal tubule dysfunction , and volume depletion 5 , 6 . in our case , rhabdomyolysis , acute kidney injury , hepatotoxicity , and neurotoxicity emerged after the use of ma in the acute period . after the discontinuation of the agent and appropriate treatment with hydration and hd , our patient improved significantly . in conclusion , physicians should be aware that multisystem toxicity may develop as a result of ma use and clinical suspicion , early diagnosis , and appropriate treatment may be life saving .

key clinical messagemethamphetamine ( ma ) may cause hepatotoxicity , rhabdomyolysis , acute kidney injury , and neurotoxicity separately or together . we report a patient admitted with muscle weakness , pain , and oliguria 1 week after ma use ; requiring repeated hemodialysis ( hd ) . multisystem toxicity may develop as a result of ma use and appropriate treatment may be life saving .

adenomatoid odontogenic tumor ( aot ) is a benign , slow - growing , and noninvasive odontogenic lesion associated with an impacted tooth . the presence of so - called unique duct - like structures under microscope imparts the tumor a glandular , i.e. , adenomatoid appearance . the tumor is also known as two third 's tumor because about 2/3 cases occur in maxilla , about 2/3 cases are diagnosed in young females during the second decade , 2/3 cases are associated with an impacted tooth and in 2/3 cases , impacted tooth is canine . we present a case of unusually large aggressive aot in the maxilla associated with impacted third molar . a 19-year - old male reported with a chief complaint of painless mass over the left side of face and upper left back tooth region since 6 months . initially , pea - sized and asymptomatic swelling appeared in upper left back tooth region . three months later , swelling also appeared below left eye , initially pea - sized . he gave h / o exfoliation of multiple teeth from the same region within these 6 months . on examination , solitary , smooth , roughly spherical - shaped swelling was present on the left side of face below eye . swelling extends from infraorbital region until malar prominence and from medial to lateral corner of left eye measuring approximately 5.0 cm 5.0 cm in maximum dimensions . there was marked obliteration of palpebral fissure of the left eye [ figure 1a ] . intraorally , there was a solitary roughly oval - shaped growth in the left maxillary region , obliterating the buccal vestibule . growth was extending from canine region till retromolar area along alveolar ridge measuring approximately 7 cm 4 cm . overlying mucosa was erythematous , edematous , and inflamed . both extraorally and intraorally , swelling was firm , noncompressible , nonfluctuant , nontender , nonreducible , and nonpulsatile . ( b ) intraoral photograph showing lesion involving palate , alveolar ridge , and buccal vestibule orthopantomogram revealed a huge , diffuse radiolucent lesion extending throughout left maxilla from canine till retromolar region . the lesion was associated with an impacted permanent upper left third molar , which was found to be present below floor of the orbit . computed tomography scan [ figure 3a c ] demonstrated a large cystic expansile radiolucent lesion with flecks of calcification of varying sizes . the buccal and palatal bony expansion was remarkable , and resorption of bone with perforation was evident . maxillary sinus was completely opaque . on the basis of these radiological findings , aot and pindborg tumor orthopantomogram showing a large radiolucent lesion involving left maxilla , and impacted upper left third molar teeth displaced below floor of orbit by the lesion ( red circle ) ( a - c ) computed tomography scan revealing the expansile radiolucent lesion with few radio - opaque flakes . there is remarkable bony expansion and thinning and discontinuity of the palatal and buccal cortices . having accessed the tumor extraorally as well as intraorally , subtotal maxillectomy was performed , and the involved teeth were also removed [ figure 4b ] . the surgical defect was simultaneously reconstructed using temporalis myofascial flap [ figure 4d ] healing was uneventful . six months after surgery , computed tomogram was done which revealed complete eradication of the lesion [ figure 5a c ] . there was no evidence of any recurrence 1 year after the surgery [ figure 6a and b ] . ( a - d ) operative photographs ( a - c ) six months postoperative computed tomogram shows normal healing and no signs of recurrence ( a ) one year follow - up photograph . ( b ) one year follow - up intraoral photograph with normal healing histological examination revealed a partially cyst - like cavity lined with the fibrous capsule . rounded and rosette - like aggregates of odontogenic epithelial cells with sparse areas of eosinophilic material could be visualized . the characteristic rounded and rosette form lined with a single layer of polarised cuboidal or columnar epithelium cells giving it the adenomatoid appearance ( h and e , 400 ) aot has three clincopathological variants , namely intraosseous follicular ( 73% ) , intraosseous extrafollicular ( 24% ) , and peripheral ( 3% ) . the intraosseous follicular type is associated with an impacted tooth as in our case , whereas the intraosseous extrafollicular type has no association with an impacted tooth and the peripheral variant is soft tissue component , attached to the gingival structures . the lesion often leads to the expansion of the involved bone and the displacement of the adjacent teeth . owing to the slow growing and painless nature of the tumor , the patients tolerate the swelling for a long duration , sometimes years until it produces an obvious esthetic deformity . it may rarely show aggressive nature such as gaining unusually large size or extending into the intracranial space . radiographically , the lesion often demonstrates as a unilocular radiolucency associated with an impacted tooth . in certain cases , small radiopaque spots ( calcifications ) differential diagnosis of aot includes dentigerous cyst , calcifying odontogenic cyst ( coc ) , calcifying odontogenic tumor ( cot ) ( pindborg tumor ) , and odontogenic keratocyst . radiolucency with multiple radiopaque foci ( particularly when the radiolucency surrounds a portion of the root or entire tooth ) is suggestive of an aot rather than a coc / cot . histologically , aot is mostly surrounded by a well - developed fibrous connective tissue capsule . the tumor is usually composed of spindle - shaped or polygonal cells forming sheets , rosettes or whorled masses in a sparse connective tissue stroma . the amorphous eosinophilic material is present between the epithelial cells as well as in the center of these rosette - like structures . the large size of this lesion has been attributed to a higher growth rate in younger patients and a delay in seeking treatment . however , in our case , the lesion was extremely large in size and expansile . therefore , subtotal maxillectomy with simultaneous reconstruction of surgical defect with temporalis myofascial flap was planned and carried out . the case presented is rare in occurrence because of certain atypical features such as unusual large size , aggressive behavior , the involvement of maxillary third molar , third molar present below floor of orbit , significant bony expansion , and cortical perforation . under general anesthesia , the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .

adenomatoid odontogenic tumor ( aot ) is a rare tumor comprising only 3% of all odontogenic tumors . it is a benign , encapsulated , noninvasive , nonaggressive , slowly growing odontogenic lesion associated with an impacted tooth . these lesions may go unnoticed for years . the usual treatment is enucleation and curettage , and the lesion does not recur . here , we present a rare case of an unusually large aggressive aot of maxilla associated with impacted third molar . the authors also discuss clinical , radiographic , histopathologic , and therapeutic features of the case . subtotal maxillectomy with simultaneous reconstruction of the surgical defect with temporalis myofascial flap was planned and carried out .

epidermolysis bullosa ( eb ) refers to a group of inherited disorders that involve the formation of blisters following trivial trauma . eb pruriginosa is a type of dystrophic eb caused by type vii collagen gene mutation , with distinctive clinico - pathological features . it is characterized by nodular prurigo - like lichenified lesions , nail dystrophy , and variable presence of albopapuloid lesions . most cases are sporadic , but a few show autosomal dominant or autosomal recessive pattern of inheritance . in india , very few cases of eb pruriginosa have been reported . here a 52-year - old lady presented to our outpatient department with complaints of itching and blackish discoloration of skin of both the lower limbs for more than 35 years and fluid filled lesions over the lower limbs since two years . there was no history of drug intake before the onset of lesions nor any seasonal exacerbation . patient was a known case of diabetes since five years and on regular treatment . on examination , multiple lichenified papules to nodules were present over the lower limbs extending from the knee to the ankle joint . lichenified papules to nodules over the shin with depigmentation and scarring on histopathological examination , epidermis showed subepidermal and intraepidermal bulla with degeneration of keratinocytes . foci of cellular infiltrate consisting of fragmented neutrophils with occasional mononuclear cells and hemorrhage [ figures 2 and 6 ] . h and e , 40 lichenoid papules over both shins extending on to the knee subepidermal bulla filled with fibrin and rbcs . h and e , 40 close up photomicrograph of the second patient close up photomicrograph of first patient a 34-year - old female patient came to the outpatient department with complaints of skin lesion over both the lower limbs associated with intense itching was noted since 15 years . cutaneous examination revealed lichenoid papules over both shins extending on to the knee [ figures 3 and 7 ] . dermis showed perivascular mixed inflammatory cell infiltrate and cyst lined by stratified squamous epithelium [ figures 4 and 5 ] . close up of first patient the patient was started on topical steroids with systemic antihistamines with minimal response after one month . a 52-year - old lady presented to our outpatient department with complaints of itching and blackish discoloration of skin of both the lower limbs for more than 35 years and fluid filled lesions over the lower limbs since two years . there was no history of drug intake before the onset of lesions nor any seasonal exacerbation . patient was a known case of diabetes since five years and on regular treatment . on examination , multiple lichenified papules to nodules were present over the lower limbs extending from the knee to the ankle joint . lichenified papules to nodules over the shin with depigmentation and scarring on histopathological examination , epidermis showed subepidermal and intraepidermal bulla with degeneration of keratinocytes . foci of cellular infiltrate consisting of fragmented neutrophils with occasional mononuclear cells and hemorrhage [ figures 2 and 6 ] . h and e , 40 lichenoid papules over both shins extending on to the knee subepidermal bulla filled with fibrin and rbcs . h and e , 40 close up photomicrograph of the second patient close up photomicrograph of first patient a 34-year - old female patient came to the outpatient department with complaints of skin lesion over both the lower limbs associated with intense itching was noted since 15 years . cutaneous examination revealed lichenoid papules over both shins extending on to the knee [ figures 3 and 7 ] . dermis showed perivascular mixed inflammatory cell infiltrate and cyst lined by stratified squamous epithelium [ figures 4 and 5 ] . close up of first patient the patient was started on topical steroids with systemic antihistamines with minimal response after one month . eb pruriginosa is a type of dystrophic eb termed by mcgrath in 1994 , though a number reports of similar condition have appeared in literature since 1946 . in the one original series of eight cases reported by mcgrath , three had family history of similar skin disease , with two showing an autosomal dominant and the other an autosomal recessive pattern of inheritance . in our cases genetic linkage studies in families with dominant and recessive dystrophic eb have confirmed tight linkage to the type vii collagen gene . structural protein abnormalities of type vii collagen either in the helical portion or the globular end domains suggesting the possible influence of type vii collagen gene , along with some other factor , might be responsible for causing a variety of abnormalities in the collagen helix assembly dimer formation or lateral aggregation , thus resulting in a diversity of clinical features . recent molecular analysis studies have revealed a glycine substitution within the triple helical collagenous domain of the type vii molecule , to be exclusively associated with the dominant dystrophic eb , and eb pruirigunosa . eb pruriginosa presents either at birth with mild acral blistering and erosions , or during infancy or childhood . in adults , the lesions are chiefly lichenified plaques . in both of our cases the lesions presented in early adolescence . the condition is characterized by extremely pruritic linear lichenified or nodular prurigo - like lesions predominantly over legs , occasional trauma - induced blistering , excoriations , milia , nail dystrophy and in some case albopapuloid lesions on the trunk . possibly , the exposure of type vii collagen is known to trigger the activation of the kinin cascade . histopathology of the lesion of the original series showed hyperkeratosis , mild acanthosis , disruption of the dermoepidermal junction and frank subepidermal blister formation in some areas . ultrastructurally , there were alterations in the number and structure of anchoring fibrils in the lesional and perilesional skin consistent with a diagnosis of dystrophic epidermolysis bullosa . treatment is symptomatic and is aimed at controlling pruritus and halting the progression of cutaneous lesions . potent topical steroids and intralesional triamcinolone have been reported to reduce the pruritus in some cases , but do not produce sustained improvement . however , successful results have been achieved with topical tacrolimus and thalidomide , as well as cyclosporine . oral administration of cyclosporine has been reported in one case as controlling the cutaneous lesions and decreasing the pruritus . genetic counselling and gene therapy probably remain the most promising approaches . as in other forms of dystrophic eb , a prenatal diagnosis is possible by finding a cleft / blister formation at dermo - epidermal junction by light microscopy or more precisely by electron microscopy in fetal skin biopsy taken at 15 to 18 weeks of gestation . similarly , rapid prenatal diagnosis may be possible by using lh 7:2 monoclonal antibody staining of skin samples obtained from 18 weeks fetus at risk .

epidermolysis bullosa ( eb ) pruriginosa is a very rare pattern of dystrophic eb caused by type vii collagen gene mutation , with distinctive clinico - pathological features . it is characterized by nodular prurigo - like lichenified lesions , nail dystrophy , and variable presence of albopapuloid lesions . we report two such cases .

a 70-year - old male patient presented with painless , gradually increasing swelling in the right lower bulbar conjunctiva for 6 months followed by redness and watering for last 3 weeks . ocular examination revealed a 14 mm 7 mm red fleshy mass in the lower bulbar conjunctiva in the right eye [ fig . 1 ] . clinical photograph showing 14 mm 7 mm red fleshy mass in right lower bulbar conjunctiva the conjunctival mass was clinically diagnosed to be a squamous cell carcinoma in situ , lymphoma or amyloidosis . histopathology revealed a localized granulomatous inflammation with histiocytes around a homogeneous material along with giant cells and chronic inflammatory cells [ figs . 2 and 3 ] . van gieson stain demonstrated the complete absence of elastic tissue at the center of the granuloma [ fig . 4 ] . h and e stain 100 microphotograph showing giant cells , inflammatory cells , and histiocytes in the granuloma . [ h and e stain 400 ] microphotograph showing the absence of elastic tissue in the centre of granuloma . annular elastolytic giant cell granuloma is a condition characterized histologically by damaged elastic fibers surrounded by numerous giant cells and absence of necrobiosis , lipid , mucin , and pallisading of the granuloma . it almost always occurs on sun exposed skin , such as face , neck , dorsum of hand , forearm , and arm and hence the previous name actinic granuloma ; however there are few reports occurring in sun - protected sites . the term actinic granuloma was coined by o brien in 1975 , who described similar histological features in cutaneous lesions of patients with sun - damaged skin . subsequently this concept was disputed by ragaz and ackerman , who believed that actinic granuloma was a variant of granuloma annulare . mcgrae postulated that actinic granuloma represented a cell - mediated immune response to actinically altered elastotic fibers with a preponderance of helper t cells in the lymphocytic infiltrate . the occurrence of conjunctival actinic granuloma in isolation is a rare entity . in the past four decades all the previous cases were females , our case being the first such lesion occurring in a male patient . the size of all the previous lesions varied between 2 and 3 mm occurring in nasal or temporal bulbar conjunctiva . in those cases the clinical differential diagnoses were pinguicula , pinguiculitis , bowens disease , and conjunctival nevus . in our case 14 mm 7 mm , a fleshy mass involving the whole of the lower bulbar conjunctiva . the clinical differential diagnoses were squamous cell carcinoma in situ , mucosa associated lymphoid tumor ( maltoma ) , amyloidosis , and leukemic deposit . the absence of caseous necrosis excludes tuberculosis and the prominent eosinophilic response invited by fungal and parasitic lesions was not present in this case . the noninfectious granulomatous inflammation includes foreign - body giant cell reaction , granuloma annulare or pseudoheumatoid nodule , and necrobiosis lipoidica . granuloma annulare presents with abundant mucin , partial loss of elastic fibers and radial arrangement of epithelioid histiocytes ( pallisading granuloma ) . in necrobiosis the complete loss of elastic tissue in the central zone as documented by connective tissue stain is used as the primary basis for separating annular elastolytic giant cell granuloma from granuloma annulare and necrobiosis lipoidica . thus actinic granuloma of conjunctiva is a distinct clinical , histological , and immunological lesion . though rare , the clinician should consider the possibility of actinic granuloma presenting as a fish flesh mass in the conjunctiva and pathologist should consider the possibility of granulomatous inflammation in association with elastolysis and does not necessarily imply the presence of foreign bodies or infection . regarding medical treatment hydroxychloroquine , clofazimine , dapsone , intralesional , and systemic steroid has been used in annular elastolytic giant cell granuloma ( aegg ) of skin .

annular elastolytic giant cell granuloma is a condition characterized histologically by damaged elastic fibers associated with preponderance of giant cells along with absence of necrobiosis , lipid , mucin , and pallisading granuloma . it usually occurs on sun - damaged skin and hence the previous name actinic granuloma . a similar process occurs on the conjunctiva . over the past three decades only four cases of conjunctival actinic granuloma have been documented . all the previous patients were females with lesions in nasal or temporal bulbar conjunctiva varying 2 - 3 mm in size . we report a male patient aged 70 years presenting with a 14 mm 7 mm fleshy mass on right lower bulbar conjunctiva . clinical differential diagnoses were lymphoma , squamous cell carcinoma in situ and amyloidosis . surgical excision followed by histopathology confirmed it to be a case of actinic granuloma . this is the first case of isolated conjunctival actinic granuloma of such a large size reported from india .

dental ectopia is characterised by the change in the normal pathway of a tooth eruption , which may occur in any region of the alveolar and basal bone . in fact , it is a rare developmental anomaly whose aetiology is unknown and controversial . one can suppose that such an eruption process can be altered by genetic factors [ 28 ] , physical obstacles [ 9 , 10 ] , or multiple causes [ 3 , 10 , 11 ] . it has been demonstrated that dental ectopia is more frequently seen in girls [ 8 , 12 , 13 ] . the occurrence of ectopic eruption is usually unilateral [ 1 , 4 , 13 , 14 ] , but bilateral cases have been reported [ 13 , 15 ] , and mandibular lateral incisors are the most affected teeth , representing 30% of all cases [ 16 , 17 ] . ectopic eruption of mandibular permanent lateral incisors can result in both advanced root resorption and precocious exfoliation of the deciduous canines and first molars [ 1 , 15 , 17 ] . prolonged retention of deciduous canines and lateral incisors can occur as well [ 4 , 10 , 15 ] . clinically , the ectopically erupted lateral incisor shows marked distal inclination and rotation achieving up to 180 [ 1 , 4 , 7 , 17 , 18 ] . the diagnosis of such dental anomaly is crucial for establishing the treatment plan and should be carried out through both clinical and radiographic exams , although other exams such as volumetric computerised tomography and study models can be employed [ 1820 ] . if not treated early , this dental anomaly may develop into partial or complete transposition of the permanent canines [ 7 , 18 , 20 ] . therefore , the objective of the present paper is to report a case of male paediatric patient with bilateral ectopia of the mandibular permanent lateral incisors and discuss both implications regarding such an anomaly and treatment outcomes . caucasian male patient of 11 years old was brought by his mother to the paediatric dentistry clinic complaining that the child 's two mandibular teeth appeared to be tilted . during the interview the mother reported no relevant previous medical history and no cases of ectopia in the family as well . on facial examination , convex facial profile and a mild mandibular retrusion were also observed ( figure 1 ) . on intraoral examination , it was observed absence of carious lesions , and all the maxillary teeth had been erupted except the third molars whereas permanent right and left lateral incisors were buccally rotated and dislocated . mandibular arch had all the permanent teeth erupted except the third molars whereas primary left lateral incisor and right lateral incisor and canine had prolonged retention . permanent right and left lateral incisors were found to be ectopically erupted , with crown transposing the permanent canine on the left side and positioning lingually on the right side ; both lateral incisors and canines were rotated and the mandibular right second premolar was impacted . both maxillary and mandibular dental arches had parabolic shapes with 100% overbite , overjet of 3 mm , and no crossbite . a class ii division 2 subdivision left anteroposterior relationship was diagnosed ( figure 2 ) . on radiographic examination , the presence of third molar germs in all quadrants was observed . ectopic eruption of the permanent mandibular right lateral incisor and partial transposition of permanent mandibular left lateral incisor and left canine had been also diagnosed since the apices of the lateral incisors and canines were correctly positioned , but the coronal position was altered due to inclination of the lateral incisor ( figure 3 ) . also , they were informed on the need for corrective orthodontic treatment in association with extraction of deciduous teeth and premolars ( maxillary and mandibular ones ) for aligning and levelling the dental arches as well as for correcting both ectopia and class ii division 2 relationship . dental ectopia is characterised by abnormal or even aberrant eruption of one or more teeth , thus resulting in root absorption of the adjacent teeth . transposition of the teeth is the more severe effect , which consists of positional switch between two adjacent teeth or eruption of one tooth into normal position already occupied by another nonadjacent tooth [ 5 , 16 , 20 ] . as can be seen in figure 4 , such a transposition can be complete , when crowns and roots are found to be transposed and paralleled , or partial , when crowns are found to be transposed and root apices are in relatively normal positions [ 1 , 20 , 21 ] . no past history of ectopia was found in the patient 's family whereas the meckel 's cartilage remaining in the alveolar region of the canines , which may obstruct physically the normal eruptive pathway of the tooth , is another possible aetiology . the present case was particularly interesting because it reported two conditions , namely , ectopia of the mandibular lateral incisor on the right side and partial transposition of the mandibular lateral incisor on the left side . the differential diagnosis was achieved by localising the root apices of the left teeth , which had virtually normal proximal positioning despite the transposed crowns . in general , ectopic lateral incisors display both distal inclination and marked rotation [ 7 , 13 , 17 ] . in the present case , the left mandibular lateral incisor had 90 rotation whereas the right mandibular lateral incisor had 30 rotation , with distal inclinations of 30 and 20 , respectively , in relation to the occlusal plane . deviation in the eruption axis of lateral incisors provokes prolonged retention of the deciduous lateral incisors and even the canines [ 4 , 13 , 18 ] , as could be seen in the present case . when ectopia is detected early , the ectopic mandibular lateral incisors can be corrected by extracting the mandibular deciduous canines and vertically positioning the affected teeth . this orthodontic movement should be retained as long as possible since tooth tends to retake their wrong position . consequently , transposition between ectopic lateral incisor and the developing canine germ is prevented from occurring [ 7 , 9 , 15 , 17 , 18 , 23 , 24 ] . radiographic examination is recommended for 68-year - old children so that the dental malpositioning can be precociously diagnosed . if treatment is delayed , as the case presented herein , there is general agreement that transposition should not be corrected in the mandibular arch because the buccal - lingual space is not enough for accommodating tooth movements , which might provoke root interference resulting in root absorption as well as damage to the supporting tissues [ 9 , 10 , 18 , 20 , 2527 ] . treatment interventions include either alignment of the teeth in their transposed order [ 18 , 2527 ] or extraction of the ectopic lateral incisor [ 9 , 14 , 15 , 27 ] , which can be prosthetically replaced if space still exists . due to the importance of the early diagnosis in those cases of eruptive alteration , dentists should take into account the followup of both tooth eruption and formation of permanent dentition so that any change in the normal dental development can be diagnosed and readily treated .

dental ectopia is a rare clinical finding characterized by a change in the normal tooth eruption pathway . in more severe cases , nontreated ectopia may develop into either partial or total transposition . the early diagnosis is of crucial importance for establishing a treatment planning correctly . therefore , the present paper is aimed at reporting an unusual case of a 11-year - old boy with ectopic eruption and partial transposition of mandibular permanent lateral incisors as well as the diagnosis and therapeutic outcomes involving such an anomaly .