Datasets:

anumafzal94

/

pubmed-finetuning

like 0

recent advances in new devices and skills have broadened the indications of percutaneous coronary intervention ( pci ) . however , complications such as dissection , perforation , side branch jail and distal embolization of plaque materials and thrombi remain problems that can result in catastrophic outcomes1 - 3 ) . there may be thrombi and plaque materials present related to the acute coronary syndrome , which have a high risk for embolization of neighboring arterial branches as well as distal small artery branches . the artery supplying the sinus node ( sn ) is very small and difficult to protect from jailing or plaque embolization during pci . acute occlusion of the sn artery can occur during pci of proximal lesions of the right coronary artery ( rca ) or the left circumflex artery ( lcx)4 ) . therefore understanding of the prognosis of ischemic sinus node dysfunction is important for deciding on the need for permanent pacemaker implantation . we describe here the first reported case of transient sinus node dysfunction as a complication of balloon angioplasty in the distal lcx . a 56-year - old male was admitted to the hospital with resting chest pain that developed three days before admission . he had effort - induced chest pain for three years , but did not take any medications and had no prior cardiac evaluations . the coronary angiography revealed a 50% discrete stenosis at the ostium of the left anterior descending artery ( lad ) , an 80% tubular stenosis at the intermedius branch , and a 90% tubular stenosis at the distal lcx ( figure 1a ) . a ramus intermedius angioplasty was successfully performed with placement of a sirolimus - eluting stent ( cypher , johnson & johnson ) . we performed a balloon dilatation with a balloon , 2.25 mm in diameter ( aqua , johnson & johnson ) . a coronary angiography immediately after balloon removal from the lcx demonstrated a patent distal lcx but total occlusion of the sinus node branch ( figure 1b ) . about 1 minute later , the patient complained of dyspnea and chest pain and the ecg showed a junctional rhythm with a heart rate of 40/min and the blood pressure dropped to 90/60 mmhg ( figure 2 ) . a temporary pacemaker was inserted through the right subclavian vein and dopamine was continuously infused ( 10 g / kg / min ) to increase the heart rate and blood pressure . the patient also received nitroglycerin ( 200 g ) and abciximab ( 0.25 mg / kg ) bolus through a guiding catheter ; the abciximab was infused intravenously ( 10 g / min ) for 12 hours . then , an infusion catheter ( microferret , cook ) was placed in the sn artery where nitroglycerin 100 ug and nicorandil 1 mg were infused to rule out coronary spasm . distal flow was not established ; then urokinase 100,000 iu for 5 minutes through the catheter ( figure 3a ) was infused . a coronary angiogram performed shortly after the urokinase infusion showed thrombolysis in acute myocardial infarction ( timi ) . the sn receives its major blood supply from the right coronary artery in 59% of cases , from the left coronary artery in 38% and from both coronary arteries in 3%5 , 6 ) . however , the incidence of duplication of the sn artery varies ( 1.4 - 11%)5 , 7 , 8) . detailed knowledge of the anatomy of the sn artery is beneficial for surgical procedures and angioplasty so that proper precautions can be taken to preserve the blood supply to the sn during pci . actual occlusion of the sinus node artery , as occurred in our case , is not common . procedures that may affect thrombi or vulnerable plaque around the sn artery must be performed carefully due to the possible mobilization of plaque or thrombi . there are several points to consider for prevention of mobilization of plaque or thrombus in the lesions associated with the acute coronary syndrome . first , removal of the balloon must be done only after complete deflation ; this is because if incompletely deflated the bulky balloon may remove some of the plaque or thrombi that could embolize to the proximal side branches . in our case , we were not concerned about embolization because the sn artery was far from the lesion being repaired . however , an incompletely deflated balloon might have moved thrombus or plaque material from the lesion to the proximal sn artery . rapid deflation of the balloon may cause movement of mural thrombi or plaque materials into the vessel lumen . careful angioplasty , especially with an unstable lesion , is the most important measure for preventing mobilization or distal embolization of the thrombi or plaque . the sn is a mass of pace - making cells with higher metabolic requirements than other cells surrounding the atrial myocardium9 ) . the prognosis of acute ischemic injury to the sn is not completely understood in human patients . chronic sn ischemia caused by a coronary artery anomaly or occlusion of the coronary artery can lead to a compromised blood supply to the sinus node , and hence cause the sick sinus syndrome11 , 12 ) . there are few reports on the prognosis in patients with acute ischemic sn dysfunction secondary to sn artery occlusion during pci . previously a report of one case of sn occlusion , following thrombosis of the sn artery during stent implantation , normalized spontaneously after one week in a patient with acute myocardial infarction.4 prolonged sn ischemia can lead to exercise intolerance in young patients12 , 13 ) . in our patient , we suggest that thrombi in the lcx lesion might have embolized to the sn artery during balloon removal . however , we are not sure if this was helpful in the recovery of sn function . although sn function in our patient worsened for two days after the procedure , the function was nearly completely recovered after seven days . more importantly , the patient an active young man did not complain of any symptoms . we have treated five other acute , transient flow disturbances of the sn artery and nodal dysfunction complicated by balloon angioplasty or stent implantation . in all of these cases acute ischemic sn dysfunction may occur as a result of compromise of the sn artery during pci . in addition , after establishing coronary flow , the decision to implant a permanent pacemaker should be delayed for one week after the insult to allow for spontaneous recovery .

we report on a case of ischemic dysfunction of the sinus node as a complication after percutaneous transluminal coronary angioplasty of the distal left circumflex artery . after local thrombolytic therapy in the sinus node artery , sinus node arterial flow was re - established and sinus node function normalized over the period of a week . our experience suggests that immediate reperfusion of a totally occluded nodal artery can be re - established . ischemic dysfunction of the sinus node , as a complication of angioplasty , is generally transient and requires a prolonged period for recovery . therefore the decision to implant a permanent pacemaker should be delayed for at least one week after the ischemic insult .

cognitive treatments using computers , which began with memory training , are being widely used these days1 . computer - assisted cognitive rehabilitation has advantages , in that it provides personalized treatment based on a subject s neuropsychological pattern to stimulate impaired areas2 . a computer - assisted cognitive rehabilitation training program consists of exercises focused on visual reaction , visual scanning , attention , information processing speed , memory , and problem solving . these exercises can not only provide flexibility and adjustment within a treatment regimen , but may also shorten treatment time . they also provide a means for objectively measuring subject s performance as well as providing instant feedback3 . the causes of decreasing cognitive information processing speeds among the elderly include the decrease in the number of brain cells , the weakening of motor nerve cells , and a decrease in general activity4 . cognitive dysfunction begins with memory decline and is accompanied by miscalculation , disorientation , misjudgment , and comprehension disability , all of which greatly affect daily life5 . balance is the ability to maintain the body s center of gravity within the support base with minimal sway6 . the sensory process undertaken during balancing refers to the interaction among the somatic senses , including proprioception , visual sense , and stereotactic input from the vestibular system7 . one study of cognition and balance reported that the reduction of balance ability due to aging is associated with cognitive function8 . furthermore , in a study of senses and balance , with patients divided into different age groups , colledge et al.9 reported that the reduction of balance ability with aging was associated with the slowing of central information processing speed . with the above in mind , this study was conducted to investigate the effects of computer - assisted cognitive rehabilitation training on cognition and balance ability , an area closely related to daily living activities of the elderly , and to present a therapeutic program for reduced cognitive function and a safe therapeutic approach for elderly people who have difficulty engaging in physical exercise . thirty typical elderly people between the ages of 65 and 80 were randomly assigned to a computer - assisted cognitive rehabilitation training group of 15 subjects or a control group of 15 subjects . a description of the purpose and methods of the study was provided to all the participants , and the experiments were conducted after the participants had read and signed an informed consent form . general characteristics of the subjectssex ( n)age ( yr)height ( cm)weight ( kg)training group ( n=15)male : 6 female : 972.8 3.8160.3 7.359.6 8.9control group ( n=15)male : 7 female : 871.7 5.6160.3 8.161.8 9.3mean sd . the intervention used by the computer - assisted cognitive rehabilitation group was the visual interruption training found in the rehacom program and the visual construction ability program of the attention training program . the subjects performed these exercises for 30 minutes per session , three sessions per week , for six weeks . for measurement purposes , their cognitive function was measured using the korean version of the mini mental state examination ( mmse - k ) , and their static balance was measured with the balance measurement system , biorescue ap 153 ( rmingenierie , france ) . data analyses were undertaken using the independent t - test to analyze the characteristics of the subjects and the differences between the two groups . this was done using spss 12.0 for windows . in order to compare the foot pressure training before and after the program , the mmse - k scores and balance ability at the start and end of the intervention are shown in table 2table 2 . comparison of variables between pre- and post - intervention in each groupvariabletraining groupcontrol groupmmse - k ( score)*pre26.0 2.226.1 1.6post29.3 0.7 * 26.6 1.8sway area ( mm)*pre65.6 7.066.5 35.0post43.8 31.3 * 62.9 27.2sway path length ( mm)*pre28.3 5.929.2 5.9post23.8 2.0 * 27.5 5.5mean sd . the mmse - k , sway area and sway path length of the training group had significantly improved after the intervention , compared with their respective values before the intervention ( p<0.05 ) . however , the values of the control group were not significantly different ( p>0.05 ) . a comparison of the variable between the training group and the control group after the training showed a significant difference ( p<0.05 ) ( table 2 ) . the cognitive function of the elderly plays a key role in the independent performance of functional activities including daily living abilities10 . the evaluation and treatment of the reduced cognitive function of typical elderly people due to normal aging , and the cognitive damage due to neurological diseases such as dementia , is critical for the maintenance of independent living and the quality of life of elderly people . damage to a person s attention , concentration , and memory affect his or her problem - solving and inference abilities11 . in general , clinical therapies for the cognitive functions of the elderly include psychological approaches such as music therapy and reminiscence therapy , cognitive aids to compensate for cognitive impairment and computer - assisted cognitive rehabilitation training12 . the effects of computer - assisted cognitive rehabilitation training programs used in clinical settings for cognitive rehabilitation of brain - injury patients , the elderly , and dementia patients have been confirmed in many studies12 , 13 . according to gunther et al.14 , some of the effects that appear immediately after computer - assisted cognitive rehabilitation training continue even after five months , and they proposed the use of computer - assisted cognitive rehabilitation programs to treat and prevent cognitive defects among the elderly . on the other hand , chen et al.15 reported that the application of a computer - assisted cognitive rehabilitation program achieved significant improvement in various cognitive areas of traumatic brain - injury patients , but no difference was found in a control group which received a traditional therapy . in this study , a six - week - long computer - assisted cognitive rehabilitation training program was carried out using elderly subjects , and its effects on the subjects cognition and balance were investigated . the mmse - k score for the period of treatment showed significant differences in the training group , but not in the control group . to sustain the ability to balance , an appropriate response to environmental changes needs be followed instantaneously , and a proper response can be made possible by quick information processing abilities9 , which heavily rely on selective attention . for this reason , the sway area and distance also decreased significantly in the training group , but not in the control group . based on these results , we conclude that a computer - assisted cognitive rehabilitation program can be used as a therapeutic approach restoring the cognitive functions and balance abilities of elderly people who have limitations on their physical activities due to aging . furthermore , this approach can be used as an alternative clinical program for preventing the decline of cognitive function of , and falls by , the elderly .

[ purpose ] the purpose of this study was to investigate the effects of a six - week - long computer - assisted cognitive rehabilitation training program on the improvement of cognition and balance abilities of the elderly . [ subjects ] thirty healthy elderly people , aged 65 to 80 , were randomly assigned either to the training group ( n=15 ) or the control group ( n=15 ) . [ methods ] cognitive functions were evaluated using mmse - k , and the biorescue ap 153 ( rmingenierie , france ) was used to examine subjects changes in static balance . [ results ] the mmse - k score showed a significant change over the course of the treatment period in the training group , but not in the control group . the sway area and sway path length decreased significantly in the training group , but it did not show any changes in the control group . [ conclusion ] computer - assisted cognitive rehabilitation training is an effective intervention method for the improvement of the cognition and balance abilities of the elderly .

henoch - schonlein purpura is one of the most common types of vasculitis in children . henoch - schonlein purpura ( hsp ) is one of the most common types of vasculitis in children . it is a multisystem disorder that involves various joints and organs , and results from a leukocytoclastic vasculitis of small vessels . the characteristic clinical manifestations include non - thrombocytopenic purpura , arthritis or arthralgia , abdominal pain , gastrointestinal hemorrhage and renal abnormalities . although patients with hsp are in a pro - thrombotic state , thrombosis is a rare complication , with only eight previously reported cases of hsp - associated thrombosis in the literature . however , thrombosis is a potentially life - threatening condition , and clinicians should have a high index of suspicion for high - risk patients . here , we present a single case of hsp accompanied by a superior mesenteric vein ( smv ) thrombosis . a 14-year - old boy with no significant past medical or family history was admitted to our hospital complaining of abdominal pain for the previous 14 days . he had passed dark red and black stool for 7 days , and had an erythematous rash over the anterior aspect of the lower legs for 2 days with a day of bilateral ankle arthralgia . on general examination , his vital signs were stable and he had a palpable purpuric rash that predominantly affected the anterior aspect of his lower legs [ figure 1 ] ; the bilateral ankles were swollen . palpable purpuric rash on the legs the laboratory results were as follows : hemoglobin level : 14.5 g / dl ; leucocyte count : 25.27 10/l with 81% polymorphonuclear leukocytes ; lymphocyte count : 13% ; platelet count : 492/mm . serum electrolytes , blood urea nitrogen and creatinine , liver function tests , urine analysis , erythrocyte sedimentation rate , antinuclear antibody and anticardiolipin antibody levels and the coagulation profile were all within their normal ranges . an abdominal computed tomography ( ct ) scan showed thickening of the proximal small intestinal wall with a peritoneal effusion . the mesenteric ct venography was reported as a suspected smv thrombosis with edema of the proximal intestinal wall [ figure 2 ] . mesenteric ct venography revealed heterogeneous contrast within the superior mesenteric vein with a suspected filling defect within the lumen ( arrow ) . a thickened and blurred intestinal wall ( arrowheads ) as a result of edema was observed within the affected segments according to the clinical manifestations , laboratory results and radiological findings , the patient was diagnosed with hsp and suspected smv thrombosis . after 7 days , his abdominal pain resolved and a repeated abdominal ct scan revealed that the intestinal wall edema and peritoneal accumulation had improved . on the 10 day of hospitalization , follow - up ct venography revealed homogeneous contrast throughout the smv and no signs of venous thrombosis [ figure 3 ] . the pat ient had no abdominal pain , no new rash and no swollen joints . he was discharged from hospital on the 12 day of admission . during the 2-month follow - up period , he had no new complaints . homogenous contrast was observed within the superior mesenteric vein ( arrow ) , and the intestinal wall was even and well - demarcated ( arrowheads ) venous and arterial thromboses are rare but potentially life - threatening complications in patients with hsp . we conducted a review of the published literature and found eight other patients with hsp - associated thrombosis [ table 1 ] . the outcomes were good and most patients had no episode of relapse . reported cases of hsp associated with thrombosis hyperactivation of the coagulation system is a common phenomenon along with the impaired activation of the fibrinolytic system in hsp . after prompt treatment with anti - inflammatories and anticoagulation , the symptoms and signs of hsp improved in our case . so the follow - up ct venography showed no signs of thrombosis in the smv . the seventh reported case showed that a high level of plasma factor viii and homocysteine could be a risk factor for thrombosis . higher levels of homocysteine , which could be induced by endothelial injury associated with vasculitis , can cause hypercoagulability in patients with hsp . furthermore , levels of von willebrand factor ( vwf ) antigen , a marker of endothelial injury , are also elevated during the acute stage of hsp . factor viii , homocysteine and vwf antigen could be important risk markers that indicate patients at a higher risk of thrombosis . two other reported cases that showed hsp was associated with antiphospholipid syndrome ( apa ) , which can present with thrombosis . antiphospholipid antibodies can produce a procoagulant state by affecting the function of phospholipid binding proteins that are involved in the coagulation cascade . the combined effect of hsp and apa would cause a greater risk of arterial or venous thrombosis . in one further case hsp - associated thrombosis occurred in the context of behet 's disease , another form of vasculitis . it is likely that endothelial dysfunction combined with a hypercoagulable state could contribute to thrombosis . thrombosis is comparatively rare in hsp patients , but physicians should pay close attention to patients at a higher risk of developing thrombosis as a consequence of its potentially life - threatening outcomes . thrombosis is a rare complication , with only eight previously reported cases of hsp - associated thrombosis .

henoch - schonlein purpura ( hsp ) is one of the most common types of vasculitis in children . the characteristic clinical manifestations include non - thrombocytopenic purpura , arthritis or arthralgia , abdominal pain , gastrointestinal hemorrhage and renal abnormalities . thrombosis has been reported as , a rare complication of hsp . we present the case of a 14-year - old boy who was diagnosed with hsp and suspected superior mesenteric vein thrombosis . we reviewed the relevant literature and found eight similar reported cases . hsp is associated with thrombosis and hsp itself and some risk factors may result in thrombosis . we suggest that physicians should monitor patients with hsp who are at a higher risk of developing thrombosis more closely .

developmental disabilities ( dd ) are a chronic delay in development , including conditions such as cerebral palsy , intellectual development disorder , autism , and mixed type dd . children with dd have problems with physical , cognitive , social , sensory , and communication skills2 . these unique problems have a negative impact on the lives of their family as well as of the children with dd1 . among the problems faced by children with dd , impairment in cognitive function and visual perception causes problems in processing environmental stimuli , which makes it difficult for them to adapt to their environment and live in independently2 . after entering elementary school , due to an increase in demanding activities of daily living , problems caused by impairments of cognitive function and visual perception become more evident3 . as compared to prior to school entry , school - aged children are required to complete tasks within a limited time at school or home and are expected to exhibit sophistication and organization in their activities4 . the literature indicates that there are intervention methods to improve cognitive function and visual perception in children with dd , such as attention training programs , sensory integration , and tabletop activities5 , 6 . these methods are remedial approaches to restore and facilitate the improvement of cognitive function and visual perception caused by dd7 . although various conventional treatment methods for children with dd have been applied in clinical settings , the controversies over the most effective protocol continues8 . in order to compensate for these problems , recently computer - based cognitive rehabilitation ( cbcr ) has been used in clinical settings8 . several studies concluded that cbcr was an effective treatment for recovery of cognitive function and visual perception9 . however , most such studies recruited adults or the elderly with stroke , traumatic brain injury , or dementia10 . few studies have investigated the effects of cbcr on cognitive function and visual perception in children with dd . additionally , the existing cbcr programs have predominantly targeted adults , and there is a lack of cbcr programs for children8 . in 2011 , kim developed a cbcr program for children called cotras - c8 . however , there is still insufficient evidence for the clinical effectiveness of this program . therefore , there is a need to investigate the effectiveness of the cotras - c using objective methods . accordingly , in this study , we conducted a randomized controlled trial to investigate the effectiveness of the cbcr program for children with reference to their cognitive function and visual perception . we screened the participants based on the inclusion criteria used in previous studies on cbcr for children8 , 11 . the inclusion criteria for participation were as follows : ( i ) dd diagnosed by a pediatrician or rehabilitation physician ; ( ii ) children with dd , exhibiting similar symptoms ( children with limited cognitive function and visual perception ) ; ( iii ) presence of dd diagnosed by performance on the korean - developmental test of visual perception-2 ( k - dtvp-2 ) ; ( iv ) a below normal score on the kaufman assessment battery for children ( k - abc ) ; ( v ) ability to use the controller with the upper extremity without spasticity ; and ( vi ) ability to understand instructions within three repeated explanations . parents signed the informed consent form before commencement of the study , according to the code of ethics of the world medical association ( declaration of helsinki , version 2004 ) . the first was the k - dtvp-2 , which comprises 8 sub - tests ( eye - hand coordination , position in space , copying , figure - ground , spatial relations , visual closure , visual - motor speed , and form constancy ) . this test can be used to measure visual perception in children aged 4 to 8 years , and helps to confirm the extent of visual perception disability according to developmental stages12 . it provides an index of motor - reduced visual perception ( mrp ) and visual motor integration ( vmi ) and combines the two indices to interpret the overall level of visual perception ( general visual perception ; gvp)13 . the second measure was the k - abc , designed for use with children aged 2.5 to 12.5 years . it assesses the intelligence quotient and achievement , and entails 2 subscales , the achievement scale ( ach ) and mental processing composite ( mpc ) , and 16 sub - tests . the expected mean raw score is 100 , with a standard deviation of 1514 . the number of sub - tests implemented changes depending on the age of the children tested . therefore , in this study , we used the sub - tests , depending on the age of the subjects . all clinical measurements were administered before and after the intervention by a blinded occupational therapist with 4 years experience . after the baseline session , eligible participants were randomly allocated to either the control group ( cg ) or experimental group ( eg ) by a research assistant who was not involved in the intervention . during the intervention sessions , the eg participants received 20 sessions ( 2 days a week for 10 weeks ) of cbcr with the cotras - c program ( netblue co. , ltd , korea ) . the cotras - c consists of about 4,000 game - based training task on skills including attention , memory , visuo - motor organization , coordination , and others . the cotras - c with a character design and voice suitable for children , makes the training easy by using the touch monitor and cotras - c controller . the difficulty level of all the tasks can be modified to suit the individual participants abilities . training data are automatically stored for accuracy analysis , which helps develop an appropriate treatment plan8 , 11 . in this study , the eg participants received the visual perception training that comprised spatial relations , spatial memory , concentration , eye - hand coordination , eye movement , and figure - ground perception . the duration of intervention for the cg participants was matched to that of the eg participants . the cg participants received a conventional cognitive rehabilitation that focused on visual perception , using pencil and paper activities . all participants received either the eg or cg intervention for 30 minutes per a session . the test and independent t - test were used to compare the differences in the general characteristics of the two groups . the independent t - test was used to compare the between group means and changes in values , while the paired t - test was used to test the differences in the continuous variables within the groups . the 29 participants who fulfilled the inclusion criteria were randomly allocated to the two groups as follows : 15 to the eg and 14 to the cg . all participants characteristics have been summarized in table 1table 1.subjects characteristicseg ( n = 15)cg ( n = 14)gendermale910female64age ( months)69.73 8.3371.93 8.07educationpreschool1010school54main care - givermother118grandmother46mean standard deviation . cg : control group ; eg : experimental group after intervention , the participants in both the groups showed a significant increase in their scores on the k - dtvp-2 , ach of the k - abc , and mpc of the k - abc ( p < 0.001 ) ( tables 2table 2.subjects k - dtvp-2 scores before and after the interventionk - dtvp-2 ( gvp)pre - testpost - testeg ( n = 15)66.80 ( 3.63 ) 79.87 ( 2.92)cg ( n = 14)67.79 ( 2.78 ) 76.43 ( 3.90)*p < 0.05 , * * p < 0.001.mean ( standard deviation ) . cg : control group ; eg : experimental group ; gvp : general visual perception ; k - dtvp-2 : korean - developmental test of visual perception-2 and 3table 3.subjects k - abc scores before and after the interventionsachmpcpre - testpost - testpre - testpost - testeg ( n = 15)494.20 ( 25.46 ) 540.13 ( 23.91)68.60 ( 3.74 ) 75.56 ( 4.09)cg ( n = 14)508.64 ( 17.99 ) 531.42 ( 16.99)70.25 ( 3.18 ) 74.42 ( 3.26)*p < 0.05 , * * p < 0.001.mean ( standard deviation ) . ach : achievement scale ; cg : control group ; eg : experimental group ; mpc : mental processing composite ) . additionally , there were significant differences in the changes in the k - dtvp-2 , ach of the k - abc , and mpc of the k - abc between the two groups ( p < 0.001 ) ( table 4table 4.comparison of change in k - dtvp-2 and k - abc scoreseg ( n = 15)cg ( n = 14)k - dtvp-2 ( gvp)13.07 ( 1.44 ) 8.64 ( 3.15)k - abc ach45.93 ( 4.23 ) 22.79 ( 2.75 ) mpc6.90 ( 0.71 ) 4.18 ( 0.80)*p < 0.05 , * * p < 0.001.mean ( standard deviation ) . ach : achievement scale ; cg : control group ; eg : experimental group ; gvp : general visual perception ; k - abc : kaufman assessment battery for children ; k - dtvp-2 : korean - developmental test of visual perception-2 ; mpc : mental processing composite ) . * p < 0.05 , * * p < 0.001 . mean ( standard deviation ) . cg : control group ; eg : experimental group ; gvp : general visual perception ; k - dtvp-2 : korean - developmental test of visual perception-2 * p < 0.05 , * * p < 0.001 . ach : achievement scale ; cg : control group ; eg : experimental group ; mpc : mental processing composite * p < 0.05 , * * p < 0.001 . mean ( standard deviation ) . ach : achievement scale ; cg : control group ; eg : experimental group ; gvp : general visual perception ; k - abc : kaufman assessment battery for children ; k - dtvp-2 : korean - developmental test of visual perception-2 ; mpc : mental processing composite although studies on the effectiveness of the cbcr program for children are lacking8 , 11 , it is increasingly used in clinical settings because of its advantages15 . therefore , the present study investigated the effectiveness of the cbcr program with reference to cognitive function and visual perception in children with dd . the results of this study indicated that the cbcr program for children may improve cognitive function and visual perception in children with dd . the clinical improvement in the k - dtvp-2 and k - abc scores was greater in the eg after intervention , as compared to that in cg participants , confirming that cbcr is a more effective intervention for children with dd as compared to conventional intervention . most cbcr programs used in korea were developed for adults and these effectiveness has been confirmed by several studies . however , in some parts of cbcr program for adults , the stimuli presented on the screen are not suitable for children and do not sustain interest in them . therefore , it is difficult to use such programs with children8 . to resolve these problems , kim developed a cbcr program for children called cotras - c8 . the effectiveness of cbcr with the cotras - c on cognitive function and visual perception have been proved in several studies8 , 11 . the use of a computer program helps in the cognitive development of children by facilitating their intellectual ability , stimulating curiosity , and allowing for creative thinking16 . in 2014 , park indicated that children with dd who received cbcr with the cotras - c showed increased k - dtvp-2 and k - abc scores , which is consistent with the results of the present study11 . visual perception is the ability to interpret and understand the environment by processing information that is contained in visible light . visual perception is closely related to cognitive function , and therefore , an improvement in visual perception has been found to have a positive impact on cognitive function13 , which was also confirmed in the results of the present study . this study conclude that cbcr with the cotras - c can be used as a rehabilitation approach to improve cognitive function and visual perception in children with dd , which suggests that the cotras - c may be used as an alternative to other existing cbcr programs . although the sample size employed in the present study was small , the findings of this study are significant because cbcr is a novel approach that broadens the scope of clinic based intervention to home - based ones . additionally , children living in a modern society have several opportunities to receive this treatment17 . the present study did not examine the effectiveness of cbcr with the cotras - c on the activities of daily living of children with dd . therefore , in future , studies with a large sample size are needed to investigate the clinical effectiveness of the cotras - c as a rehabilitation program for activities of daily living as well as cognitive function and visual perception .

[ purpose ] this study aimed to investigate the effects of a computer - based cognitive rehabilitation program for children with developmental disabilities . [ subjects ] subjects included 29 children with developmental disabilities . [ methods ] the subjects were randomly allocated to either the experimental group or control group . experimental group subjects received computer - based cognitive rehabilitation using the cotras - c while control group subjects received conventional cognitive rehabilitation . all subjects received 20 sessions ( 2 days a week for 10 weeks ) of the experimental or control intervention for 30 minutes . to compare the two groups , the korean - developmental test of visual perception-2 and kaufman assessment battery for children were performed before and after the intervention . [ results ] both groups showed statistically significant improvement in their scores after intervention . additionally , there were significant differences in the scores between the two groups . [ conclusion ] the computer - based cognitive rehabilitation with cotras - c may be helpful in improving the recovery of cognitive function and visual perception in children with developmental disabilities .

drug hypersensitivity syndrome ( dhs ) is a severe , idiosyncratic multisystem reaction defined by the clinical triad of fever , rash and internal organ involvement ( e.g. , hepatitis , myocarditis or pneumonitis ) , which may occur 1 - 8 weeks after exposure to the drug . the term , dhs is often used interchangeably with another syndrome , drug reaction with eosinophilia and systemic symptoms ( dress ) . however , recent studies have suggested that dress syndrome is a distinct entity and not synonymous with dhs . the diagnosis of dhs is mainly clinical , though currently in vitro tests on isolated peripheral blood lymphocytes and platelets have been introduced , which have a predictive value between 80% and 90% in a population of highly suspected dhs patients . it is relatively well tolerated , although it does have some adverse effects , particularly in high doses . pregabalin has been infrequently associated with angioedema ( swelling of the face , tongue , lips and gums , throat and larynx ) , gynecomastia , impaired liver function . here , we report a case of dhs due to pregabalin , used for the treatment of postherpetic neuralgia . a 40-year - old male patient was hospitalized for sharp , lancinating pain in his left loin , which was disrupting his daily routine for last 2 days . a week ago , the patient developed vesicular rash in the same area and was treated with topical and oral acyclovir for 1 week . the patient also experienced a burning sensation at the site of rash , which responded to etoricoxib 120 mg daily given for 5 days . the patient reported back after 5 days to the out - patient clinic due to persistent and severe left loin pain and was hospitalized . serological tests for hepatitis b virus , human immunodeficiency virus , epstein - barr virus and herpes simplex virus were normal . herpes zoster virus igm titer was 1:40 by immune fluorescent assay ( normal value < 1:10 ) . the patient was diagnosed as a case of post herpetic neuralgia and received intramuscular tramadol 50 mg as and when required . etoricoxib was stopped and pregabalin 75 mg twice a day and paracetamol 1 g 3 times a day was started orally . in view of inadequate pain relief , the dose of pregabalin was increased to 150 mg twice a day . he was advised to continue pregabalin 150 mg twice a day and paracetamol orally whenever necessary . after 2 weeks , the patient came with complaints of low grade fever , itchy skin rash and swelling of lips and face since 3 day . purpuric rash was observed on the face and exfoliative lesions were seen on the hands and feet , without any joint or mucosal involvement . he had raised erythrocyte sedimentation rate , c - reactive protein , peripheral eosinophilia ( absolute eosinophil count of 1400/cm ) and normal leukocyte and platelet counts . liver function tests revealed alanine transferase ( alt ) 250 iu / l and aspirate transaminases ( ast ) 322 iu / l with normal bilirubin , alkaline phosphatase and gamma glutamyl transpeptidase , anti - nuclear antibodies were negative . serum pregabalin was 5 g / ml ; ( n < 10 g / ml ; medtox lab inc . the drug was stopped and patient was treated with topical betamethasone cream and oral prednisolone 40 mg daily for 10 days tapered over a period of 1 months . the casualty assessment by world health organization uppsala monitoring center scale and naranjo 's algorithm ( score 6 ) showed a probable relationship between the drug and the reaction . the above case most likely appears be a hypersensitivity reaction to pregabalin ; which can present as skin rashes , rarely severe exfoliative lesions , steven johnson 's syndrome and toxic epidermal necrolysis . the literature search revealed that among 300 cases of drug induced liver disease in the us from 2004 to 2008 , none were linked to pregabalin . a dose - response pattern in the onset of pregabalin adverse drug reactions ( adrs ) , with certain adrs appearing at lower doses than others , has been noted . there has been recent reports of rhabdomyolysis , hepatotoxicity , both of which are rare . mild increase in alt and ast is more frequent than hyperbilirubinemia in such cases and warrant immediate discontinuation of pregabalin . the low rate of significant hepatotoxicity from pregabalin may be due to its minimal hepatic metabolism and rapid urinary excretion . the case for delayed hypersensitivity reaction to etoricoxib seems less likely as angioedema and exfoliative dermatitis are usually seen as acute reactions . in our case , similarly , the relationship between tramadol and raised liver enzymes seems unlikely and to our knowledge there are no reports of angioedema as a delayed hypersensitivity to tramadol . the adverse reaction to pregabalin is usually dose related , though idiosyncratic , immunologic or metabolic causes are possible . in our case , the serum concentrations were normal and there were no dose related side - effects . in spite of the fact that dhs has been known for many years , it is not possible to clinically test the predictability of such hypersensitivity , due to idiosyncratic nature of the reaction . the combination of angioedema , exfoliative dermatitis , eosinophilia and raised transaminases seen in our patient was rare and warranted discontinuation of the drug . the clinicians must be aware of such a reaction in order to ensure timely diagnosis and treatment .

drug hypersensitivity syndrome is characterized by fever , skin rash and internal organ involvement . it is commonly seen with aromatic group of anticonvulsants viz . phenytoin , carbamazepine and phenobarbitone . here , we report a case of hypersensitivity reaction to pregabalin , used for treating postherpetic neuralgia .

as the demand for adult orthodontic treatment increases and the popularity of esthetic dentistry expands , orthodontists are more likely faced with the problem of placing orthodontic appliances on teeth restored with resin and porcelain fixed prostheses or veneer laminates . when esthetics is a concern , orthodontists will have to depend on the direct bonding technique . numerous methods and materials have been suggested for bonding to ceramic restorations [ 17 ] . the conventional method for optimal bonding of brackets and retainer wires to ceramic surfaces is application of hydrofluoric ( hf ) acid for etching the ceramic surface , because phosphoric acid etching , which is used for the enamel , is ineffective in the preparation of ceramic surfaces for mechanical retention of orthodontic attachments [ 810 ] . however , the in vivo use of hf acid is too hazardous . mucosal or skin contact with hf acid can cause erythema and burning associated with loss of tissue along with intense pain for several days . the purpose of this study was to evaluate tensile bond strength between metal brackets and non - glazed ceramic surfaces with three different surface treatments to evaluate application of phosphoric acid instead of hf acid . we evaluated the non - glazed ceramic surfaces because clinicians sometimes remove the glaze layer of porcelain restorations by a low speed bur in the oral cavity and then apply phosphoric acid instead of hf . forty - two non - glazed , feldspathic porcelain disks , 2.0 mm thick and 8.0 mm in diameter , were used . the disks were fabricated from super porcelain ex-3 body ( noritake , japan ) using a handmade mold . the specimens were washed with water , dried with air , and then divided into three equal groups randomly . in groups i , and ii ; 9.5% hf acid gel ( ultradent , usa ) was applied for 2 minutes , then rinsed with water and dried with oil - free air . subsequently , in group i , a layer of silane ( scotchbond ceramic primer , 3 m unitek , usa ) was applied and dried with light oil - free air spray . then a layer of scotchbond multi purpose plus adhesive ( 3 m unitek , monrovia , calif . , usa ) was applied , thinned with air spray and cured with light ( 500 ) for 10 seconds . in group ii , after etching with 9.5% hf acid , only a layer of bonding agent ( unfilled resin , 3 m unitek , usa ) was used . in group iii , ceramic surfaces were treated with 35% phosphoric acid ( 3 m unitek , usa ) and then silane and adhesive were applied similar to group i. metal brackets for maxillary central incisors ( dyna lock , std . edgewise 018 , 3m - unitek , usa ) were bonded to each conditioned ceramic surface with light - curing composite resin ( transbond xt , 3m - unitek , usa ) . excess composite was removed and then light cured for 40 seconds ( coltolux 75 , swiss ) with an intensity of 500 . the surface areas for the bases of brackets was 16.52 mm which were obtained bfrom the manufacturer . after bonding , all specimens were stored in a water bath in room temperature for 24 hours , then thermocycled 500 times between 5c and 55c with a dwelling time of 60 seconds . all specimens were partially embedded in acrylic resin using a hand - made jig , especially designed for this purpose ( fig 1 and 2 ) . zwick universal testing machine ( z/100 , germany ) was used to measure the tensile bond strength . the machine had an upper jaw that was mounted to a movable crosshead and a lower jaw mounted on the base . the tensile force at a crosshead speed of 0.5 mm / minute was transmitted to the bracket by a steel wire that was placed under the bracket wings . the force required for debonding was recorded and the tensile bond strength in megapascal ( mpa ) was determined from the load at failure and the area of bracket base . after debonding , the specimen surface was examined under magnification 2 to determine how much residual adhesive remained on the ceramic according to the following scale : 1=all the composite remained on the ceramic , 2=more than 90% of the composite remained on the ceramic , 3=more than 10% but less than 90% remained on the ceramic , 4=less than 10% remained on the ceramic , and 5=no composite remained on the ceramic . descriptive statistics including the mean , standard deviation , and minimum and maximum values were calculated for the three groups . then tensile bond strength data were subjected to one - way anova and tukey s hsd post hoc tests . the nonparametric kruskal - wallis test was used to compare the adhesive remnant index ( ari ) score for the three groups . four specimens in group i , three specimens in group ii , and two specimens in group iii did not have a measurement of tensile bond strength because of the operator s mistake . the difference of tensile bond strength between groups i , and iii was not significant ( p=0.999 ) . however , the tensile bond strength of group ii was significantly lower than groups i , and iii ( p<0.001 ) . the ari scores show that in group i specimens , all the composite remained on the ceramic . in group ii , 63.7% of the specimens had an ari higher than 4 , meaning that less than 10% of the composite remained on the ceramic . in group iii , more than half of the specimens had an ari lower than 2 ( i.e. more than 90% of the composite remained on the ceramic ) . the direct bonding of orthodontic attachments has revolutionized and improved the clinical practice of orthodontics . more recently bonding materials have been introduced for bonding to ceramic . however , before clinical experiments , these materials should be evaluated in vitro to find which products and materials seem most valuable to include in supplementary clinical evaluation . although both shear and tensile loading modes are valid tests for studying bond strengths of orthodontic materials , choosing the tensile bond strength test as the more frequently used shear bond strength test needs some explanation . in order to allow the calculation of the true interfacial failure stress , the experiment should be designed so that a uniform stress distribution is created across the interface . production of complex stress distribution in the shear bond strength test may start fracture at sites with high concentration of local stress ; therefore , the adhesive characteristics of the bonded interface are not expressed . the tensile bond strength test used in this study provides a specimen design with a stress distribution across the interface as near to uniform as possible . we used long thin wires under the bracket wings , as suggested by katone and chan . the relatively slow crosshead speed used for bond strength in this study moreover , viscoelastic behavior that is absent in vivo may occur at low strain rates for the adhesive which may be an important area for future investigation . newman stated that 14 kg / cm2 ( 1.5 mpa ) was the maximum force that could be applied to a tooth by an orthodontic appliance . the tensile bond strength in our study exceeded this value greatly , but were still less than reynold s value ( 50 kg / cm5 mpa ) recommended for in vivo success . group i and iii had the closest results to this value with a mean of 3.91 mpa and 3.90 mpa , respectively . olsen et al evaluated shear bond strength between metal brackets and enamel using scotch bond multipurpose adhesive , 37% phosphoric acid and 10% maleic acid . their results were 13.1 mpa ( sd=4.8 ) for phosphoric acid and 10.3 mpa ( sd=3.1 ) for maleic acid . moreover , it is proved in orthodontics that shear bond strength is higher than tensile bond strength [ 2022 ] . thurmond et al found significantly lower shear bond strength with application of phosphoric acid plus silane on ceramic than with hf acid plus silane ( p<0.001 ) , but saygili and sahmali reported that acid etching of the surfaces with hf acid had a weak tendency to improve bond strength . aida et al showed that acid etching of porcelain with hf acid could be eliminated . our finding showed no statistical difference between application of hf acid with scotch bond multipurpose plus adhesive and phosphoric acid with scotch bond multipurpose plus adhesive on non - glazed ceramic ( p=0.999 ) . major et al showed that the site of failure at low bond strength tended to be at the porcelain - adhesive interface . when the bond strengths became greater , the chemical retention was equal or exceeded the mechanical retention provided by the bracket base . therefore , increased bond strengths resulted in failure at the bracket - adhesive interface or a cohesive failure within the composite resin in a way that some composite was left on both the bracket and the porcelain surfaces . in our study , in group i , 100% of the specimens and in group iii , 60% of the specimens had more than 90% composite remaining on the ceramic . however , in group ii , which had a lower bond strength ( 2.70 mpa ) , about 60% of the specimens had less than 10% composite remaining on the ceramic . the tensile bond strength to ceramic surface reported by cochran et al , kocadereli et al and harari et al using the same method were higher than our results . but it should be noted that they did not thermocycle their specimens and they also used different material . eustaquio et al reported a tensile bond strength of bonding brackets to deglazed ceramic using conocise / scotch prime ( 3 m ) comparable with groups i and iii of our study . overall , these differences may be due to variables such as the type of bond strength test , ceramic , adhesive , brackets , storage environment and presence or absence of thermocycling . in some researches , the specimens were stored in 37 degrees and in others ; they were kept in room temperature . we used the second method . regarding the effect of phosphoric acid on porcelain , the results of studies are mixed and confusing . while some researches show that this acid does not have a considerable effect on the porcelain surface [ 810 ] , others show that this effect is clinically acceptable [ 3335 ] . our results showed that by using scotch bond multipurpose plus adhesive on non - glazed ceramic we can use phosphoric acid for treating the ceramic surface instead of hf acid gaining a statistically not different tensile bond strength and also preventing hazard for the oral tissue , skin and the respiratory system .

objective : the aim of this study was to evaluate the bond strength between metal brackets and non - glazed ceramic with three different surface treatment methods.materials and methods : forty - two non - glazed ceramic disks were assigned into three groups . group i and ii specimens were etched with 9.5% hydrofluoric acid . subsequently in group i , silane and adhesive were applied and in group ii , bonding agent was used only . in group iii , specimens were treated with 35% phosphoric acid and then silane and adhesive were applied . brackets were bonded with light - cured composites . the specimens were stored in water in room temperature for 24 hours and then thermocycled 500 times between 5c and 55c.results:the difference of tensile bond strength between groups i and iii was not significant ( p=0.999 ) . however , the tensile bond strength of group ii was significantly lower than groups i , and iii ( p<0.001 ) . the adhesive remnant index scores between the three groups had statistically significant differences ( p<0.001).conclusion : with the application of scotch bond multi - purpose plus adhesive , we can use phosphoric acid instead of hydrofluoric acid for bonding brackets to non - glazed ceramic restorations .

patent foramen ovale , which is necessary in fetal circulation , is a potential route for emboli arising from the venous system to enter the systemic arterial circulation , resulting in paradoxical air embolism syndrome . we report a case of paradoxical air embolism as a complication of percutaneous approach for treatment of calyceal diverticular stone . a 37-yr - old man in good health was referred to us for right calyceal diverticulum with milk of calcium . after induction of general anesthesia , the patient was placed in the lithotomy position . a 6-fr ureteral catheter with ureteropelvic junction occlusion balloon was passed through the right ureter , and the patient was then turned to prone position . after confirming the position of the ureteral catheter under fluoroscopy , the pyelogram was performed by injecting contrast and a small volume of air into the right pelvocalyceal system to locate the diverticulum ( fig . 1 ) . direct puncture of the calyceal diverticulum was attempted several times without success . the total volume of air used during the procedure was about 25 ml . the patient remained cardiovascularly stable throughout the procedure . six hours after the surgical procedure , the patient complained of weakness of his right leg . eight hours after this episode , he had sudden tonic seizure and became unconscious ; he was transferred to the intensive care unit and treated , accordingly . the patient underwent magnetic resonance imaging of the brain including diffusion - weighted imaging , which was negative . twenty - four hours after the procedure , he recovered fully without any neurological deficit and regained consciousness . neurologic evaluation showed that cryptogenic arterial air embolism was the mostly likely cause of the seizure . cardiac workup with transthoracic echocardiogram failed to reveal a cardiac source of emboli . however , transesophageal echocardiography with provocation testing showed air bubbles in the left atrium revealing that the patient had right - to - left shunt due to patent foramen ovale ( fig . 2 ) . in this case , the clinical features were strongly suggestive of paradoxical air embolism during air pyelogram . air embolism , the entry of gas into the vascular structure , is mainly a iatrogenic problem that can result in serious morbidity and even death . venous embolism occurs when air is introduced to the central venous intravascular space and embolizes to the right heart or pulmonary arterial system . arterial embolism results from the entry of gas into the left heart chambers , as with paradoxical air embolism across an intracardiac shunt or during cardiac surgery , or directly into the arteries of the systemic circulation such as during decompression barotraumas or penetrating trauma involving an artery ( 1 , 2 ) . this phenomenon was first described by lopez , who noted the passage of fluid from the calyces into the renal veins ( 6 ) . air embolism as a complication of retrograde pyelography , and air entering the hepatic veins after nephrolithotomy have also been reported ( 7 ) . the factors that influence morbidity and mortality of air embolism include the volume of air entrained , rate of entrainment , position of patient during the event , and the cardiac status of the patient . patent foramen ovale is necessary in fetal circulation to sustain intrauterine life . the closure of the foramen ovale is normally completed by the age of 2 yr . in case of incomplete closure , the foramen ovale is kept sealed by the left atrial to right atrial pressure gradient but may be opened if the right atrial pressure increases and exceeds that of the left atrium ( 8) . a persistent patent foramen ovale is thus a potential route for emboli arising from the venous system to enter the systemic arterial circulation . a patent foramen ovale and paradoxical air embolism syndrome has been increasingly implicated in cryptogenic embolic stroke . the most widely supposed mechanism for a patent foramen ovale related stroke is paradoxical air embolism of venous thrombotic material across the atrial right - to - left shunt ( 9 , 10 ) . the normal collecting system is known to have a capacity of approximately 5 - 10 cc . in this case , retrograde injection of 25 ml of air appeared to be the cause of physiologically significant air embolism , most likely via pyelovenous backflow phenomenon . in addition , clinical features of this case strongly suggested paradoxical air embolism associated with patent foramen ovale . a recent study reported that endoscopic operation under carbon dioxide pneumovesicum is effective and safe ( 11 ) . although gas embolism is usually air embolism , the medical use of other gases such carbon dioxide , nitrous oxide , nitrogen , and helium can also result in embolism . thus , endoscopic operation using carbon dioxide , which is highly water - soluble and relatively safe , carries potential risk of embolism . to our knowledge , this is the first report of paradoxical air embolism associated with patent foramen ovale during percutaneous nephrolithotomy . at present , there are no consensual guidelines on the optimal management of patent foramen ovale in patients who have suffered from cryptogenic embolic stroke ( 12 ) . urologists who prefer to use air during pecutaneous nephrolithotomy under general anesthesia should be aware of the potential risk of air embolism . injection of a smaller amount of air for pneumopyelography is strongly advisable , if necessary .

air embolism is a rare complication of percutaneous nephrolithotomy . patent foramen ovale , which is necessary in fetal circulation , is a potential route for emboli arising from the venous system to enter the systemic arterial circulation , resulting in paradoxical air embolism syndrome . a case of paradoxical air embolism during percutaneous nephrolithotomy is presented . to our knowledge , this is the first report of paradoxical air embolism associated with patent foramen ovale during percutaneous nephrolithotomy .

intellectual disability ( i d ) , previously referred to as mental retardation , is most often associated with other medical and psychiatric conditions such as cerebral palsy , epilepsy , down syndrome , fragile x syndrome , attention deficit hyperactivity disorder ( adhd ) , autism , and other emotional and behavioral disorders . the study of intellectual disability falls within the field of psychiatry , in which dual diagnoses have historically been common . however , specifically investigating the coexistence of psychiatry disorders among people with i d has only recently begun [ 13 ] . compared with the general population , people with i d have a higher prevalence of psychiatry disorders [ 4 , 5 ] , ranging from 10% to 80% [ 6 , 7 ] . for the past few decades , the psychiatric community in developed countries , like england and australia , has done more to identify the psychiatric needs of people with i d , which has allowed doctors to provide these patients with appropriate mental health services [ 7 , 1416 ] . in india dual diagnosis of psychiatric disorders in people with i d has gradually become more common since implementation of the persons with disabilities act in 1995 . however , making further efforts to identify people in india with i d who also suffer from psychiatric disorders is necessary to plan for and provide comprehensive intervention for their well - being . identifying psychiatric disorders in people with i d is a highly specialized area for professionals because the symptoms of psychiatric disorders in people with i d do not always resemble the symptoms of the same psychiatric disorders in the general population . furthermore , poor cognitive abilities may overshadow other psychiatric disorders in children with i d , preventing accurate diagnoses of coexisting conditions [ 18 , 19 ] . objective . to determine the prevalence of coexisting psychiatry disorders in children with i d ranging in age from 3 to 18 years in barwani . the prevalence of coexisting psychiatric disorders among children with i d identified in a cross - sectional study as part of a community - based rehabilitation project in the barwani block of barwani district in madhya pradesh . ashagram trust ( agt ) is a nongovernment organization located in barwani that provides medical and rehabilitation services to the people of barwani and its surrounding districts . of the entire district , 53% of the population lives below the poverty line . in general , the tribal population is more disadvantaged in the district than the nontribal population . with financial help from action aid , agt implemented a community - based rehabilitation ( cbr ) project , spanning from 1999 to 2010 , in 63 villages of the barwani block . in 2001 , a total of 10,909 households , comprising 63,789 people ( 2001 census ) , in 51 villages were surveyed door - to - door to identify children with i d . all identified children were recruited so that they could receive proper medical , rehabilitation , educational , and vocational support . first , consent to conduct the screening survey was obtained from each village 's politically elected leader ( sarpanch ) . consent was also obtained from the heads of each family ( parents or grandparents ) to assess the child for i d and coexisting disorders and receive comprehensive intervention under the cbr project . an ethical committee comprising members of the funding organization action aid , agt , and the community approved the study . from this survey , 262 children ranging in age from 3 to 18 years were identified as having i d . children with i d who developed psychiatric disorders during the course of the study were also included in the study . children identified in the cross - sectional study were further evaluated by two professionals specializing in the assessment of mental retardation ( mr ) . these professionals were employed by the cbr project at the time ( one is the author of this paper ) . diagnoses of i d were made according to iq classification , following the criteria outlined in the icd-10 . the icd-10 criteria are popular and widely used across member countries of the world health organization to diagnose people with mental and behavioral disorders . two tests , a developmental screening test ( dst ) developed by the national institute for the mentally handicapped ( nimh ) in india and an indian adaptation of the vineland social maturity scale ( vsms ) , were used in the first round of assessment . the dst provided the developmental quotient ( dq ) value , while the vsms provided the social quotient ( sq ) value . the average of these two values ( dq and sq ) is considered a person 's iq . most of the study participants were also given an adaptation of the stanford - binet intelligence test , called the binet - kamat test , which better reflects conditions in india . a number of previous studies have supported the value of these tests , concluding that their psychometric properties are appropriate for making diagnoses [ 25 , 26 ] . furthermore , the nimh in india recommends these tests for diagnosing people with i d . all cases evaluated by mr professionals were referred to a psychiatrist for psychiatric evaluation and a physician for physical examination . laboratory testing was also done to determine chromosomal abnormalities . in each case , psychiatrists used clinical observations , mental state examinations , parental interviews , and reviews of previous consultations to make a psychiatric diagnosis , incorporating the icd-10 criteria . because epilepsy shares characteristics of both neurological and psychiatric disorders , we categorized it with other psychiatric disorders in this study . children with i d who developed psychiatric disorders during the time frame of the project were also included in the study . occasionally , communication barriers arose because of the tribal dialect . most professionals on the cbr team were able to understand tribal dialect , but they were unable to respond in a dialect that could be understood . communication was also difficult with some nontribal parents . in situations where communication was a problem , community - based rehabilitation workers ( cbrws ) interpreted between psychiatrists , mr professionals , and parents . most cases were brought to the agt psychiatric clinic , but a few could not reach the clinic because of inadequate transportation . in these situations , children were evaluated in rural camps within their own or nearby villages . statistical analysis . the prevalence of psychiatry disorders in the study 's 262 children with i d was reported using frequencies and percentages . chi - square tests were performed to compare the prevalence of psychiatric disorders with independent variables , such as the severity of i d ( severe intellectual disability ( sid ; iq 49 ) and mild intellectual disability ( mid ; iq 50 ) ) , gender , poverty level , and population group ( tribal and non - tribal ) . because the psychiatric group disorders had expected count values less than five , the chi - square test was performed with the yates correction . of the total i d population ( n = 262 ) , 17 ( 6.5% ) were found to have adhd , 11 ( 4.2% ) were autistic , 7 ( 2.7% ) showed anxiety , 3 ( 1.1% ) had bipolar affective disorder , 2 ( 0.8% ) had delusional disorder , 6 ( 2.3% ) had depression , 2 ( 0.8% ) had obsessive - compulsive disorder , 5 ( 1.9% ) had schizophrenia , 27 ( 10.3% ) had enuresis , 62 ( 23.7% ) had epilepsy , and 212 ( 80.9% ) showed behavioral problems . . however , children with profound i d appeared to only have epilepsy and behavioral problems . the number of disorders per child in each i d category was also examined . in the borderline however , the mild and moderate i d categories both had a ratio of 1.27 disorders per child , while the severe i d group was calculated to have 1.65 disorders per child . overall , behavioral problems were considerably more prevalent than other psychiatric disorders in all i d categories except borderline i d . for comparison purposes , the rarely occurring psychiatric disorders of adhd , autism , anxiety , bipolar disorder , delusional disorder , depression , obsessive - compulsive disorder , and schizophrenia were grouped together for analysis ( psychiatric group ) . all cases of i d were grouped into categories of sid and mid . upon comparing the sid and mid groups , we found that the prevalences of psychiatric group disorders = 0.3 * , p = .03 ) and epilepsy ( = 27.6 , p < .001 ) were significantly higher in children with sid , while the prevalences of enuresis ( = 0.5 , p = .31 ) and behavioral problems ( = 1.3 , p = .25 ) were not statistically different between the two i d groups . the prevalences of psychiatric group disorders ( = 0.2 * , p = .54 ) , enuresis ( = 1.7 , p = .13 ) , and behavioral problems ( = 0.1 , p = .47 ) were not statistically different between male and female participants , but epilepsy was found to be more prevalent among male participants than females ( = 7.4 , p = .005 ) . enuresis was found to be statistically more prevalent among poor children ( = 4.1 , p = .03 ) , but no differences in prevalence were found for psychiatric group disorders ( = 0.1 * , p = .91 ) , behavioral problems ( = 0.0 , p = .57 ) , and epilepsy ( = 0.8 , p = .45 ) between poor children and children who were not poor . the prevalences of enuresis ( = 7.2 , p = .006 ) and behavioral problems ( = 4.1 , p = .03 ) were higher among the tribal population , but psychiatric group disorders ( = 0.2 * , p = .50 ) and epilepsy ( = 0.1 , p = .43 ) showed no significant difference in prevalence between tribal and nontribal populations ( table 2 ) . in this study , we found a higher prevalence of psychiatric disorders in children with i d having an iq 49 , an outcome that is consistent with the findings presented in gillberg et al . ( 1986 ) . among children with an iq 49 , those with iq between 49 and 35 had the highest rates of psychiatric disorders . other than epilepsy and behavioral problems , none of the disorders from psychiatric group were found in children whose iq 20 . one possible explanation for this result is that diagnostic difficulty increases with the severity of a person 's i d [ 6 , 12 , 13 , 29 ] . the findings of our study related to psychiatric disorders in the tribal population are consistent with a prior study conducted on an indian population by kishore et al . that study found that children living in poor families and children belonging to the tribal community have a higher prevalence of enuresis , which may arise from improper care , improper training about personal care , activities of daily living , social exposure , and a lack of stimulation . our study also showed that behavioral problems are higher in the tribal population group , indicating that behavioral problems and enuresis could have similar contributing factors within this population . the prevalence of enuresis between males and females in this study was not found to be different . however , a previous study from 1986 indicated that males are likely to have a higher prevalence of enuresis than females , with 16% of males having the condition in that study , compared with 12% of females ( p < .01 ) . enuresis is approximately twice as common in boys as in girls in the normal population . family history of enuresis , lower socioeconomic status , poor self - image , and diminished academic achievements are considered to be risk factors for enuresis . in our study , factors like less gender discrimination , poverty , and simple lifestyles may have contributed to the equal prevalence of enuresis between boys and girls in the study population . the prevalence of epilepsy was not found to be affected by poverty level ( poor versus not poor ) and population group ( tribal versus non - tribal ) , but it was found to be significantly higher in males than females . this finding is consistent with the normal population , in which studies have reported a marginally lower prevalence of epilepsy in females . in our study , a significantly higher rate of epilepsy was found in children with severe and profound i d ( iq 49 ) , which has previously been reported as the most common disorder in people with severe i d . when people with i d have additional psychiatric disorders , they become even more dependent on others and may urgently require mental health services . treating coexisting psychiatric disorders may favorably affect rehabilitation intervention in people with i d . therefore , it is important to assess people with i d to identify any coexisting psychiatric disorders . a study by mohr et al . ( 2002 ) highlighted the benefits of diagnosing these coexisting conditions : they reported successful social rehabilitation of people with i d that had been concurrently diagnosed and treated for psychiatric disorders . in addition standardized tests were used for i d diagnoses , but in some cases standardized tests were not used to diagnose psychiatric disorders , resulting in diagnoses made solely on the basis of clinical judgments by psychiatrists . senior - level psychiatrists and lower - level trainee psychiatrists both provided their services in evaluating i d cases . however , the individual clinical abilities and biases of each psychiatrist might have impacted the results . furthermore , the language barrier between clients and professionals was also a potential factor , which might have affected the clinical decisions made by professionals . another limitation of the study was that the psychiatric unit could not maintain proper records in all cases ; some of the case files did not contain complete information about the subjects or their clinical examinations . thus , there exists the potential that some people who had psychiatric disorders were excluded in the study analysis . thus , it is very important to properly diagnose any coexisting psychiatric disorders so that the appropriate services can be provided .

background . the coexistence of psychiatric disorders in people with intellectual disability ( i d ) is common . this study determined the prevalence of psychiatric disorders in children with i d in barwani , india . method . a total of 262 children with i d were evaluated for psychiatric disorders using the diagnostic criteria outlined in the international classification of diseases ( icd-10 ) . results . psychiatric disorders appeared in study participants at the following rates : attention deficit hyperactivity disorder ( adhd ) , 6.5% ; autism , 4.2% ; anxiety , 2.7% ; bipolar disorder , 1.1% ; delusional disorder , 0.8% ; depression , 2.3% ; obsessive - compulsive disorder , 0.8% ; schizophrenia , 1.9% ; enuresis , 10.3% ; epilepsy , 23.7% ; and behavioral problems , 80.9% . the prevalence of psychiatric disorders was statistically higher in severely intellectually disabled children ( iq 49 ) than mildly intellectually disabled children ( iq 50 ) . conclusions . there is a higher prevalence of psychiatric disorders in children with i d when their iq 49 compared with i d children whose iq 50 .

even nowadays , it happens too often that an optic neuritis is misdiagnosed for something else . this is due in part to the misconception that a young woman with acute visual loss in one eye has most probably a disease of the optic nerve ; difficulty in pupil examination , incomplete collection of key points in past history , and lack of knowledge of other entities are other factors . here , we present a case of multiple evanescent white dot syndrome ( mewds ) misdiagnosed as optic neuritis . a 25-year - old female presented to a local hospital for acute onset of a central scotoma in the left visual field . the neurologist collected a visual acuity ( va ) of 20/20 in od and 10/20 in os ; pupil examination as well as optic nerve examination by direct ophthalmoscopy was normal . a retrobulbar optic neuritis was suspected so that a contrast brain magnetic resonance imaging scan was requested . her past ocular history was positive for mild myopia ( 1.75 sf ou ) ; she denied smoke , trauma , or drug consumption , but to specific questioning , the patient reported a flu - like illness 1 month before the onset of her symptoms . pupils were equal a briskly reactive to light with no relative afferent pupillary defect ( rapd ) . ishihara test was full od ( 12/12 ) but abnormal in os ( 7/12 ) ; anterior segment examination and intraocular pressure were within normal limits in ou . on fundus examination , a granular appearance of the macula [ figure 1 ] was evident in os with some residual white spots in the posterior pole [ figure 2 ] . . optical coherence tomography scan of the macula was positive for a disruption of outer retinal layers [ figure 3 ] well matching the granular appearance of retinography . autofluorescence [ figure 4 ] revealed a major number of white spots as compared to fundus examination . granular appearance of the macula is pathognomonic of the condition retinography of the left eye . arrows indicate residual white dots optical coherence tomography scan of the fovea outer segment shows disruption at the inner segment / outer segment junction of photoreceptor layer in the macula posterior pole autofluorescence outer segment shows multiple white dots concentrated in the peripapillary area mewds is an uncommon entity first described in 1984 by jampol et al . as a unilateral va loss notable for white dots of the the retinal pigment epithelium ( rpe ) or deep retina and a granularity of the fovea . an infectious etiology is thought to be involved in the pathogenesis of mewds since frequently , but not always , there is a viral prodrome . the white dot syndromes produce yellow - white retinal lesions located at the rpe or outer retina level and are found primarily in young patients . within this diagnostic group are mewds , acute posterior multifocal placoid pigment epitheliopathy , multifocal choroiditis and panuveitis , punctate inner choroiditis , birdshot retinopathy , acute zonal occult outer retinopathy , and serpiginous choroidopathy . since mewds is unilateral , causes visual loss , and occurs predominantly in young women , it may be confused with optic neuritis . key points in the differential diagnosis are : lack of eye pain exacerbated by eye movements in mewds as compared to optic neuritispredominant color vision and contrast loss as compared to va in optic neuritisan rapd is evident in optic neuritis ( some trace can be seen in mewds but uncommon)chief complaints of patients : blurred vision and color vision impairment in optic neuritis , delineated central / paracentral scotoma in mewdsthe characteristic features of mewds are multiple retinal white dots and foveal granularity on fundus examination . lack of eye pain exacerbated by eye movements in mewds as compared to optic neuritis predominant color vision and contrast loss as compared to va in optic neuritis an rapd is evident in optic neuritis ( some trace can be seen in mewds but uncommon ) chief complaints of patients : blurred vision and color vision impairment in optic neuritis , delineated central / paracentral scotoma in mewds the characteristic features of mewds are multiple retinal white dots and foveal granularity on fundus examination . the condition is usually self - limiting , with excellent recovery . rarely , it recurs or is associated with complications ( e.g. , choroidal neovascularization ) . the neurologist should be aware of this condition , and in doubt , schedule the patient for a detailed ophthalmic examination after pupil dilatation .

a 25-year - old female presented to a local hospital for acute onset of a central scotoma in the left visual field . she was visited by the neurologist , and a diagnosis of left retrobulbar optic neuritis was made . magnetic resonance imaging scan was normal . ophthalmic examination revealed a multiple evanescent white dot syndrome . after a description of the case , a brief differential diagnosis between these two entities is made . the neurologist should be aware of this uncommon condition .

juvenile idiopathic arthritis ( jia ) is the most common chronic rheumatic diseases in the pediatric population . worldwide prevalence of jia varies between 16 and 150 per 100,000 ; frequency of different subtypes vary with location and ethnicity . it is divided into seven categories by international league of association for arthritis as systemic , oligoarthritis , polyarthritis ( rf positive ) , polyarthritis ( rf negative ) , psoriatic , enthesitis - related and idiopathic . all children with jia require a multi - disciplinary approach along with regular orthodontic evaluation . a 14-year - old girl reported to department of oral medicine and radiology for management of multiple carious teeth and temporomandibular joint evaluation . patient had micrognathia and presents with posterior or downwards mandibular rotation , a steep mandibular plane and mandibular retrognathia . examination of temporomandibular joints revealed limited excursion and protrusion of jaw , with absence of translation of joint and microgenia . a provisional diagnosis of condylar hypoplasia associated with any syndrome was made and patient was referred for investigations . articulating surface of the temporal component appears to be flattened [ figure 1b , c ] . ( b - c ) trascranial radiographs of right and left temporomandibular region showing elongation of condylar surface . articulating surface of the temporal component appears to be flattened radiographs of hands and feet showed severe osteopenia , with fixed flexion deformities at distal phalanges . radiographs of elbow and hip joint revealed severe osteopenia and joint space appeared to be obliterated [ figure 2a d ] . ( a - d ) radiographs of hands and feet showing osteopenia , with fixed flexion deformities at intermediate and distal phalanges . dexamethasone ( dxa ) bone densitometry scan which reveals bone mass density ( bmd ) score is less in comparison to reference data of same age and gender [ figure 3a c ] . ( a - c ) dexamethasone bone densitometry scan shows bone mass density is less rheumatoid factor ( rf ) a final diagnosis of polyarticular jia was made and classified as polyarticular ra positive according to international league of associations for rheumatology classification based on inclusion criteria of onset at late childhood or adolescence ; more than five joints were involved and serological tests showing igm as rf - positive . patient was treated in pediatric ward with tab naproxen 250 mg , tab shelcal , tab osteoplus 35 mg . an early treatment with a functional splint appliance , a distraction splint , with the purpose of increasing function of the joint and ensuring continuous growth of the mandible should ideally be suggested , but due to low bone mass density , as well as considering the age of the patient any pre - surgical orthodontics and orthognathic surgery was to be considered only after completion of growth spurt . systemic effect of chronic disease also has a great impact on oral health . juvenile idiopathic arthritis ( jia ) , a broad term that describes a clinically heterogeneous group of arthritides of unknown cause . the term jia has replaced previous terms such as juvenile chronic arthritis or juvenile rheumatoid arthritis . temporomandibular arthritis in children with chronic arthritis was first reported by still in initial case series in 18975 . manifestations include limited mouth opening with progressive open bite , retrognathia , microgenia and bird - like appearance . effect on upper limb function leads to difficulty with fine motor movements required for brushing and flossing . mean dmft ( decayed , filled , missing teeth ) index scores in patients with jia was almost twice that of normal population . as seen in presented case , reported prevalence of radiographic changes in temporomandibular joint varies between 17% and 63% ; about 45% cases can be diagnosed from changes in panoramic radiograph . radiographic changes manifest in children with severe refractory disease or those who received rheumatology care late in course of disease . anti - nuclear antibody positive , early onset of disease , presence of polyarticular involvement are risk factors for temporomandibular joint arthritis . as seen in case of 14-year - old , who failed to receive early intervention presented with radiographic features including shortening of mandibular body and ramus , flattening of condyle and increased antegonial notching . temporomandibular joint involvement may be subclinical , identified with ultrasound and magnetic resonance imaging ( mri ) . commonly used drugs for treatment are nsaids like ibuprofen , naproxen , paracetamol and disease modifying anti rheumatic drugs ( dmards ) like methotrexate , sulphasalazine , cyclosporine to control pain , stiffness , swelling , minimize functional disability and prevent joint damage . etanercept is effective for patients who have polyarticular disease and resistant or intolerant to methotrexate . another cause of dental morbidity leading to dental caries and periodontal disease is prolonged administration of drugs . in order to increase the palatability and acceptability by young children the present case has interstitial lung disease , neck and cervical spine instability and osteoporosis . it becomes essential to assess workup prior administrating sedation and general anesthesia for orthognathic surgeries and minor surgical procedures . it is important to identify children who are at risk and propose interventional strategies that are effective . the purpose of presenting this case is to alarm dental personnel about significant dental morbidity , which is preventable on timely intrusion .

juvenile idiopathic arthritis ( jia ) is the most chronic musculoskeletal disease of pediatric population . the chronic course of disease has a great impact on oral health . temporomandibular joint is involved in jia causing limited mouth opening with progressive open bite , retrognathia , microgenia and bird like appearance . joints of upper and lower extremities are also involved . effect on upper limb function leads to difficulty with fine motor movements required for brushing and flossing . this increases incidence of caries and periodontal disease in children . the cause of jia is still poorly understood and none of the available drugs for jia can cure the disease . however , prognosis has improved as a result of progress in disease classification and management . the dental practitioner should be familiar with the symptoms and oral manifestations of jia to help manage as multidisciplinary management is essential .

although clinically recognized metastatic thyroid cancer is rare , data from autopsy show that thyroid metastasis findings range from 1.9% to 24.2% , with the common sources of primary cancer being skin , lung , and breast.1,2 however , of the clinically recognized metastases to the thyroid , more than 50% of the time the primary cancer is renal cell carcinoma ( rcc).3 rcc represents 3% of all adult malignancies.4 the presentation and behavior of thyroid metastases from renal cancer are variable.5 here , we report a very unusual case of metastatic rcc to the thyroid gland in a patient who had undergone right nephrectomy for rcc 14 years earlier . a 77-year - old man was referred to our department from another hospital for thyroid masses detected about 1 month previously . he had no subjective symptoms , such as stridor , dyspnea , hoarseness , or dysphagia . his medical history was remarkable in that he had undergone right nephrectomy for stage i rcc 14 years previously . the pathologic type of rcc was revealed as clear cell . he had type 2 diabetes mellitus and essential hypertension for the past 5 years . medications for chronic diseases as prescribed by his primary care physician were as follows : felodipine 5 mg , losartan 50 mg / hydrochlorothiazide 12.5 mg , glimepiride 2 mg , and metformin 750 mg , each daily . a soft and painless 7.05.0 cm sized mass was palpable on the left thyroid , and a smaller 3.5 cm soft mass was palpable on the right thyroid . fine needle aspiration ( fna ) cytology showed a few atypical follicular cells with nuclear atypia , suggesting papillary thyroid carcinoma . a computed tomography ( ct ) image of the neck showed two large cystic and degenerating thyroid masses : a 7.25.5 cm sized mass on the left thyroid and a 3.83.8 cm sized mass on the right thyroid without lymph node ( ln ) metastasis ( fig . no apparent extrathyroidal invasion or enlarged lns were observed during the operation . on gross inspection of the resected specimen , two large , well - circumscribed , mixed cystic and solid masses were found , one in each thyroid lobe , with hemorrhagic changes in the left mass ( fig . the histopathologic findings of the thyroid masses were small nests of clear cells separated by a prominent sinusoidal network ( fig . 2b ) with abundant optically empty cytoplasm , sharply outlined boundaries , and moderately atypical nuclei ( fig . these microscopic findings were similar to those of the previous renal cell carcinoma , clear cell type ( fig . immunohistochemical ( ihc ) studies were performed for thyroglobulin ( tg ) , thyroid transcription factor-1 ( ttf-1 ) , cd10 , cytokeratin , vimentin , and epithelial membrane antigen ( ema ) . the clear cells displayed strong immunoreactivity for cytokeratin , vimentin , cd10 , and ema and were negative for tg and ttf-1 ( fig . , these microscopic and ihc findings confirmed that the thyroid masses were metastatic rcc , clear cell type . an abdominal ct scan revealed a 3.7 cm sized mass on the right nephrectomy site with a normal left kidney . metastatic carcinomas to the thyroid gland are rarely found in clinical practice.5 rcc is well - known for its highly variable clinical presentations and courses , being called the " internist 's tumor".6 rarely , a thyroid mass can be an initial clinical sign of relapse of rcc after a surgical treatment or can even appear as an initial clinical presentation of rcc before the detection of primary cancer.5 possible reasons for the low frequency of clinical metastatic thyroid carcinoma are not known , although some explanations have been proposed : rich blood supply , high oxygen tension , and high iodine content in the thyroid.7 in the absence of a detailed clinical history , the initial presentation of a thyroid nodule in an otherwise healthy subject makes the diagnosis of metastatic disease challenging . this is complicated further by histologic similarities between metastatic foci and primary thyroid tumors.5 there are no specific clinical features attributable to metastases to the thyroid.3,5 our patient had no subjective symptoms associated with the thyroid masses , and his thyroid function was normal . also , the initial fna cytology suggested primary papillary carcinoma of the thyroid . the true metastatic nature of the tumor is usually recognized after tumor sampling with pathologic assessment . distinguishing primary from metastatic thyroid tumors the use of negative ttf-1 staining or positive periodic acid - schiff staining in conjunction with negative tg staining can accurately lead to the diagnosis of metastatic disease.8,9 the majority of rccs are immunoreactive to keratin and ema.5,7,10 the microscopic examinations of the resected lesions in our patient showed small nests of clear cells separated by a prominent sinusoidal network with abundant optically empty cytoplasm . the clear cells were immunohistochemically positive for cytokeratin , vimentin , cd10 , and ema and were negative for tg and ttf-1 . these microscopic and ihc findings were consistent with those of metastatic rcc to the thyroid in our patient . about 20% to 30% of cases of rcc patients experience cancer relapse distantly after curative nephrectomy.6 furthermore , unusual sites of metastases are characteristic of renal cancer , and virtually any organ site can be involved , including the thyroid.6 although there have been reports of rcc metastasis to the thyroid , and although it is well - known that rcc has variable natural histories , this was a very unusual case of metastatic rcc in the thyroid gland detected 14 years after curative nephrectomy . the mean time before a relapse in the thyroid gland after initial nephrectomy was previously reported to be 9.4 years.5 in conclusion , our case experience and literature review suggest that long - term follow - up including physical examination of the thyroid gland is required after initial nephrectomy for patients with rcc .

metastasis to the thyroid gland from distant cancer is rare , and , in some cases , is a diagnostic challenge . here , we report a case of metastatic renal cell carcinoma of the thyroid gland . a 77-year - old man presented with a neck mass detected about 1 month previously . he had undergone a right nephrectomy owing to renal cell carcinoma 14 years previously . fine needle aspiration cytology showed a few atypical follicular cells with nuclear atypia . under a tentative diagnosis of papillary thyroid carcinoma , a total thyroidectomy was performed . the histologic and immunohistochemical studies of the surgical specimens indicated that the thyroid masses were metastatic renal cell carcinoma to the thyroid .

selective strengthening of the shoulder muscles , particularly the rotator cuff muscles , has been emphasized as improving shoulder stability and preventing shoulder injuries in clinical and sports - related settings1 , 2 . among the rotator cuff muscles ( which include the subscapularis , teres minor , supraspinatus , and infraspinatus ) , the infraspinatus functions as a stabilizer muscle as well as a prime mover during shoulder external rotation - related activities1 , 3 . however , during shoulder external rotation , the posterior deltoid is activated together with the infraspinatus4,5,6 . because hyperactivation of the posterior deltoid often induces anterior translation of the humeral head and consequently increases the instability of the glenohumeral joint7 , many researchers have focused on the selective activation of the infraspinatus when designing strengthening exercises for the infraspinatus5 , 6 . closed kinetic chain ( ckc ) or open kinetic chain ( okc ) shoulder exercises are frequently performed to strengthen the shoulder muscles5 , 6 , 8,9,10 . compared to okc exercises , ckc exercises have greater proximal joint stability , enhanced joint compression and reduced shear force8,9,10 . moreover , clinicians prefer ckc exercises to okc exercises in the early stages of rehabilitation because axial loading through ckc exercises helps to restore proprioception9 , 10 . despite the benefits of ckc exercises , most exercises for infraspinatus strengthening reinold et al.4 found that shoulder external rotation in the side - lying position elicits the greatest electromyographic ( emg ) activity in the infraspinatus . findings by kim et al.6 show that shoulder external rotation while sitting maximizes the contribution of the infraspinatus , compared to the shoulder abduction with external rotation in the prone position , shoulder external rotation with abduction while sitting , and shoulder external rotation while side - lying . considering their clinical efficacy , it is important to know whether ckc exercises can selectively elicit infraspinatus muscle activity better than okc exercises . however , no previous study has yet examined differences in infraspinatus and posterior deltoid muscle activities under ckc and okc conditions . therefore , the aim of the present study was to examine changes in emg activities in the infraspinatus and posterior deltoid , as well as the ratio of the infraspinatus to posterior deltoid activity , during external rotation exercises under ckc and okc conditions . the findings of this study will provide clinicians with useful information for designing infraspinatus strengthening exercises . for this study , 15 healthy males ( mean age : 24.33 1.54 years , mean height : 175.00 5.12 cm , and mean weight : 69.00 6.93 kg ) were recruited from a local university in gimhae , south korea . none of the subjects had a history of shoulder impingement , rotator cuff tear or other shoulder injuries . subjects who experienced shoulder or neck pain in the last 6 months were excluded from this study . all the subjects provided their written informed consent prior to participation in this study , which was approved by the inje university ethics committee for human investigations . a surface emg system ( delsys inc . , boston , ma , usa ) with a sampling rate of 2,000 hz and a bandwidth of 20450 hz was used to record the muscle activities of the infraspinatus and posterior deltoid muscles on the dominant side during shoulder external rotation . the raw data of emg activities of the infraspinatus and posterior deltoid were converted into the root mean square ( rms ) and processed for analysis . prior to attachment of the electrodes , the skin area at the placement sites of the electrodes was shaved and cleaned by rubbing with alcohol . the placements of the electrodes for the infraspinatus and posterior deltoid on the dominant side were determined as recommended by criswell11 . the muscle activity was normalized using the maximum value of voluntary isometric contraction ( mvic ) . for the mvic of the infraspinatus , subjects in the prone position maintained the end - range of external rotation of the shoulder against manual resistance from an examiner , while the examiner stabilized the humerus of the subject in the glenoid cavity ; the resistance was applied to the wrist joint . to test the posterior deltoid , subjects in the prone position performed horizontal abduction of the shoulder with slight external rotation while manual resistance was applied to the distal part of the humerus12 . the mvic of each muscle was measured for 5 sec and repeated three times . the mean value of the middle 3 sec was used for normalization . all subjects performed external rotation of the shoulder on the dominant side under the okc and ckc conditions . under the okc condition , subjects in the standing position arranged their forearm supination and shoulder internal rotation so that the medial and lateral epicondyles of the humerus were parallel in the sagittal plane . subjects were asked to perform a shoulder external rotation and maintain the end - range of this external rotation for 5 sec . for the ckc condition , the starting position of the upper limb was the same as that in the okc condition ; however , the tested upper limb was supported on a height - adjustable table13 . to provide constant weight support for the subjects , a pressure biofeedback unit ( chattanooga group , hixson , tn , usa ) was placed between the palm surface and the table , and inflated to 20 mmhg . the height of the table was adjusted so that the extended elbow and wrist could be maintained without shoulder elevation or depression . subjects were instructed to press the pressure biofeedback unit until it read 40 mmhg , and then perform shoulder external rotation while the wrist and palm were fixed on the pressure biofeedback unit . the subjects maintained external rotation of the shoulder at the end - range for 5 sec . the mean value of the middle 3 sec of emg activity of each muscle while the subject maintained the end - range of shoulder external rotation under both conditions was normalized as a percentage of the mvic for data analysis . significant differences in emg activities of the infraspinatus and the posterior deltoid , and the ratio of the infraspinatus to the posterior deltoid were assessed using the paired t - test with the level of significance chosen as 0.05 . the infraspinatus muscle activity was significantly greater under the ckc condition than under the okc condition ( p = 0.001 ) , while the emg activity of the posterior deltoid was significantly decreased under the ckc compared to the okc condition ( p = 0.002 ) . a significantly higher ratio was observed in the infraspinatus to posterior deltoid ratio under the ckc condition than that under the okc condition ( p < 0.001 ; table 1table 1 . electromyographic ( emg ) activity of the infraspinatus and posterior deltoid during shoulder external rotation under open kinetic chain ( okc ) and closed kinetic chain ( ckc ) conditionsmusclemean sd ( % mvic)okcckcinfraspinatus20.26 8.8828.22 9.28*posterior deltoid5.55 3.513.22 1.67*infraspinatus / posterior deltoid4.30 1.8410.47 5.44*mvic , maximum voluntary isometric contraction . * current shoulder external rotation exercises have focused on minimizing the contribution of the posterior deltoid to shoulder external rotation for selective strengthening of the rotator cuff muscles , especially the infraspinatus5 , 6 . the present study found that ckc shoulder external rotation exercise is more effective at selectively strengthening the infraspinatus than okc shoulder external rotation exercise . in this study , the infraspinatus muscle activity was significantly increased with less activity of the posterior deltoid during shoulder external rotation exercise under the ckc condition compared to the okc condition ( p < 0.05 ) . it has been stated that excessive activation of the deltoid muscles or decreased infraspinatus activity might potentially increase the translation of the humeral head7 , 14 . conversely , it is possible that translation of the instantaneous center of rotation of the humeral head facilitates the activation of the posterior deltoid with lesser infraspinatus activity during shoulder external rotation exercises . from this point of view , increased translation of the instantaneous center of rotation of the humeral head may be associated with muscle imbalance between the rotator cuff ( e.g. , infraspinatus ) and the scapulohumeral ( e.g. , posterior deltoid ) muscles . when performing shoulder external rotation exercise under the okc condition , it is difficult to maintain the instantaneous center of rotation of the humeral head during exercise because shoulder abduction or extension movements often accompany shoulder external rotation under the okc condition . bitter et al.5 suggested that unnecessary shoulder abduction movements during shoulder external rotation may lead to overactivation of the deltoid muscle and translation of the humeral head . under the ckc condition , however , the humerus may be rotated externally with minimal compensatory movement , e.g. shoulder abduction , or extension due to the fixation of the distal part of the upper limb . we suggest that reduced compensatory movements in ckc shoulder external rotation may lead to decreased translation of the humeral head , which consequently elicits muscle activity of the infraspinatus while decreasing the posterior deltoid muscle activity . the ratio of the infraspinatus to the posterior deltoid activity was significantly greater under the ckc condition than under the okc condition ( p < 0.001 ) . for selective strengthening of the infraspinatus , it is important to identify the contribution of the infraspinatus with respect to the posterior deltoid to shoulder external rotation6 . the ratio of the infraspinatus to the posterior deltoid activity might illuminate the contribution of the infraspinatus to shoulder external rotation without excessive posterior deltoid activity . our present findings suggest that the ckc exercise condition is more appropriate for maximizing the contribution of the infraspinatus during shoulder external rotation exercises . first , all subjects were healthy males ; therefore , future studies should evaluate the differences in emg activities of the infraspinatus and posterior deltoid during okc and ckc shoulder external rotation exercises using patients with shoulder pain . second , the humeral head translation during shoulder external rotation under okc and ckc conditions was not identified . future studies should investigate the path of the instantaneous center of rotation of the humeral head during shoulder external rotation under okc and ckc conditions .

[ purpose ] this study investigated the changes in electromyographic ( emg ) activities of the infraspinatus and posterior deltoid muscles during shoulder external rotation under open kinetic chain ( okc ) and closed kinetic chain ( ckc ) exercise conditions . [ subjects ] in total , 15 healthy males participated in this study . [ methods ] subjects performed shoulder external rotations under ckc and okc conditions while standing with and without weight support provided by a height - adjustable table . pressure biofeedback was used to ensure a constant amount of weight support . the activities of the infraspinatus and posterior deltoid muscles during shoulder external rotation were measured using a wireless surface emg system . the paired t - test was used to compare the emg activities of the infraspinatus and the posterior deltoid muscles and the ratio of the infraspinatus to the posterior deltoid during shoulder external rotation under okc and ckc conditions . [ results ] the emg activity of the infraspinatus and the ratio of the infraspinatus to the posterior deltoid activities were significantly increased , whereas the posterior deltoid activity was significantly decreased under the ckc condition compared to the okc condition . [ conclusion ] clinicians should consider the ckc shoulder external rotation exercise when they wish to selectively strengthen the infraspinatus .

cementodentinal junction ( cdj ) is the area at the interface between cementum and dentin . the attachment of cementum to dentin is said to be due to the presence of adhesive proteoglycans primarily and secondarily due to fiber intermingling fortified by mineralization . studies on cdj have proved that this junctional tissue is a distinct tissue in its own right . the tissue is atubular , has a unique organic matrix and is more mineralized than either cementum or dentin . this junctional tissue plays an important role in periodontal regeneration and it is therefore imperative to develop a detailed understanding of its architecture . pathologic granules have been reported at or near the cdj in periodontally exposed root surfaces . sites at or near the cdj are said to be rich in unmineralized collagen and degradation of this collagen by bacterial toxins penetrating the surface of roots is said to be the etiology of the observed pathologic granules . pathological granules , which are vacuoles due to collagen degradation , are purely light and electron microscopic observations of undemineralized teeth . studying the collagenous architecture of demineralized teeth is likely to throw more light on the pathological alterations of exposed root surfaces at cdj . scanning electron microscopy ( sem ) is superior to transmission electron microscope ( tem ) when extended sections of root are to be examined because , with tem , a sample can be viewed not as whole but at one point only , and therefore , we chose sem over tem in our study . the collagenous architecture of cdj of healthy teeth under a sem has been described in a few studies and in the first phase of our study . cdj appears as a fibril poor groove under sem and the width of a healthy cdj is 24 m . a pubmed search revealed no studies pertaining to pathological alterations of fibrous architecture of cdj as observed under sem . the aim and objective of this study was to observe and report the pathological alterations of the fibrous architecture at the cdj in periodontitis - affected teeth under sem . the compositional differences of this tissue in disease are beyond the scope of this study . twenty healthy and periodontitis - affected noncarious teeth were collected and processed . the periodontitis samples comprised teeth with a hopeless prognosis from patients with either chronic or aggressive periodontitis with no prior history of treatment for periodontitis . healthy teeth samples comprised teeth extracted for orthodontic reasons . all extractions were done in department of periodontics . one - half of sample was processed for light microscopy and the other half for sem . extent of demineralization was checked periodically by taking radiographs . when adequate demineralization was confirmed by radiography , the samples were immersed in 2.5% glutaraldehyde in 0.06 m cacodylate buffer ( ph 7.4 ) for a week . the samples were then taken up for sodium hydroxide ( naoh ) maceration using 10% naoh for 23 days . we followed the methodology that was suggested by yamamoto et al . in their studies . the macerated specimens were treated with 2% tannic acid ( to enhance electron density of elastin and collagen apart from being a fixative and mordant ) , postfixed in 1% osmium tetroxide ( to stabilize proteins during alcohol dehydration ) . then , they were dehydrated in graded series of alcohol , critical point dried , coated with palladium and examined under a scanning electron microscope . sem was chosen over tem as samples can not be viewed as a whole but are viewed at one particular point only and findings in one point can not be generalized to the whole length of the root . in the first phase of the study , the observations of healthy cdj were reported . the identification of dentinal tissue was possible due to the presence of numerous dentinal tubule openings that were circular in shape [ figure 1a ] . the collagen fibers appeared to be inadequately demineralized and ran parallel to dentin surface ( in all periodontitis samples ) . the contact of fibers from dentin and cementum at cdj was mostly point - like in nature . ( periodontitis sample ) d : dentin , c : cementum , cdj : cementodentinal junction ( sem , x750 ) ( b ) cementum showing unusual honeycomb appearance ( periodontitis sample ) ( sem , 1000 ) . ( c ) width at cdj - 8 m ( sem , 750 ) . * inner surface of cementum ( e ) fiber intermingling ( sem , 1500 ) . ( f ) mean width measured ( sem , 1500 ) fiber intermingling between dentin and cementum is point - like . extensive criss - cross intermingling of fibers were not observed in both periodontitis samples [ figure 1a f ] healthy samples [ figure 2a and b ] and . it was observed that the point - like contact was more frequently observed in healthy samples as compared to periodontitis samples . numerous dentinal tubule openings seen , dentin ( d ) and cementum ( c ) in close approximation with fiber intermingling . width measured is 4.5 m at cementodentinal junction ( cdj ) : ( a ) sem , 1000 , ( b ) sem , 2000 : in all images , collagen fiber architecture was better appreciated in cementum compared to dentin probably because demineralization was uniform and complete in cementum compared to dentin . both the extrinsic and intrinsic fibers and the surface of cementum appear coarser than that in dentin . more fibers from cementum crossed over to dentin [ figure 1a e ] . in one sample , we observed an unusual honeycomb - like pattern of collagen architecture [ figure 1b ] . the detachment along the entire surface of the root can be appreciated in lower magnifications [ figure 3a d ] . width measurement not possible ( sem , 120 ) ( b ) detachment of cementum present . ( d ) cementum detachment ( sem , 190 ) the cdj appeared to be a fibril poor groove due to demineralization of the interfacial proteolytic substance . width measurements were possible only in samples where detachment was absent and was measured along two to three sites along the length of the root [ figure 1b and e ] . the mean width of the cdj in periodontitis samples was 7.1 as compared to 3.4 in health . the inner surface of cementum could be observed in some samples [ figure 1e ] . the identification of dentinal tissue was possible due to the presence of numerous dentinal tubule openings that were circular in shape [ figure 1a ] . the collagen fibers appeared to be inadequately demineralized and ran parallel to dentin surface ( in all periodontitis samples ) . the contact of fibers from dentin and cementum at cdj was mostly point - like in nature . ( periodontitis sample ) d : dentin , c : cementum , cdj : cementodentinal junction ( sem , x750 ) ( b ) cementum showing unusual honeycomb appearance ( periodontitis sample ) ( sem , 1000 ) . ( d ) arrow denotes fiber intermingling ( sem , 1000 ) . * inner surface of cementum ( e ) fiber intermingling ( sem , 1500 ) . . extensive criss - cross intermingling of fibers were not observed in both periodontitis samples [ figure 1a f ] healthy samples [ figure 2a and b ] and . it was observed that the point - like contact was more frequently observed in healthy samples as compared to periodontitis samples . numerous dentinal tubule openings seen , dentin ( d ) and cementum ( c ) in close approximation with fiber intermingling . width measured is 4.5 m at cementodentinal junction ( cdj ) : ( a ) sem , 1000 , ( b ) sem , 2000 : in all images , collagen fiber architecture was better appreciated in cementum compared to dentin probably because demineralization was uniform and complete in cementum compared to dentin . both the extrinsic and intrinsic fibers and the surface of cementum appear coarser than that in dentin . more fibers from cementum crossed over to dentin [ figure 1a e ] . in one sample , we observed an unusual honeycomb - like pattern of collagen architecture [ figure 1b ] . the detachment along the entire surface of the root can be appreciated in lower magnifications [ figure 3a d ] . the cdj appeared to be a fibril poor groove due to demineralization of the interfacial proteolytic substance . width measurements were possible only in samples where detachment was absent and was measured along two to three sites along the length of the root [ figure 1b and e ] . the mean width of the cdj in periodontitis samples was 7.1 as compared to 3.4 in health . the inner surface of cementum could be observed in some samples [ figure 1e ] . periodontally affected teeth undergo significant changes on the root surface as well as at cdj . penetration of bacteria and its products into cementum causes alterations in organic and inorganic contents both on cemental surface and at cdj . on the external root surface of periodontally exposed root surfaces areas of remineralization and necrotic bays are observed . at cdj due to seepage of bacterial products ( endotoxins ) , denaturation of collagen at the cdj the interface at cdj is rich in unmineralized collagen which gets easily denatured and degraded . when collagen and other proteins are lost at the interface , there is a possibility of increase in the width of cdj and subsequent weakening of the junction . it is therefore necessary to understand the pathologic changes at the junction and the probable clinical implications of a weak junctional tissue . the objective of this study was to observe and report the pathological alterations of the collagenous architecture that occurred at cdj in disease . the fibrous architecture of cdj of healthy teeth as observed under scanning electron microscope was described by yamamoto et al . and they reported the width of healthy cdj as ranging between 2 and 4 which was in accordance with the first phase of our study comprising of healthy samples where the mean width of the samples was 3.9 . in this study , we observed an increase in width at cdj throughout the root surface of exposed portions . the mean width of periodontitis samples in our study was 7.1 as compared to 3.9 in healthy samples . frequent detachment of cementum from dentin was another significant observation in our study as compared to healthy samples . of 20 samples , 7 had detached cementum and dentin whereas no detachment was observed in healthy samples for the same period of naoh maceration . the reasons we propose for the detachment observed are : increased denaturation and destruction of unmineralized collagen fibers at interface manifesting as increased width at interfacethough detachment of cementum from dentin is expected to occur in prolonged naoh maceration ( r ) , in our study , detachment was present only in periodontitis samples for the same period of naoh maceration in both healthy and periodontitis samples . the only reason could be the pathologic alterations at cdj in periodontitis samples causing detachmentcementum resorption could have caused thinning of cementum which could have contributed to frequent detachment in periodontitis samples . increased denaturation and destruction of unmineralized collagen fibers at interface manifesting as increased width at interface though detachment of cementum from dentin is expected to occur in prolonged naoh maceration ( r ) , in our study , detachment was present only in periodontitis samples for the same period of naoh maceration in both healthy and periodontitis samples . the only reason could be the pathologic alterations at cdj in periodontitis samples causing detachment cementum resorption could have caused thinning of cementum which could have contributed to frequent detachment in periodontitis samples . a pubmed search revealed no studies describing the pathological alterations of fibrous architecture of cdj using a scanning electron microscope and it was not possible to compare our results with similar studies . based on the observations of our study , the possible clinical implications of a weakened cdj could be as follows . root planing on periodontally affected root surfaces , which attempts to remove diseased and necrotic cementum , could result in complete removal of cementum from root surfaces . with the removal of cementum , are lost cementum attachment proteins that are being increasingly implicated in periodontal regeneration and the barrier function that is being attributed to this interfacial tissue . for regeneration of acellular cementum during these important properties and functions of this junctional tissue at cdj should be kept in mind during mechanical procedures such as root planing . furthermore , the optimal pressure for root planing that removes only necrotic cementum without the risk of complete cementum removal is still to be ascertained . it appears that it is required to develop pressure sensitive curettes for root planing to avoid overzealous root planing which can have a detrimental effect on cdj . we like to propose that it is time to revisit the root planing procedure , as inadvertent root planing can remove this important biological link between the cementum and dentin the interfacial tissue at cdj .

background : the cementodentinal junction ( cdj ) forms a biological and structural link between cementum and dentin . this biological link is regarded as a distinct tissue in its own right . certain important proteins responsible for periodontal regeneration are said to be present in this tissue . few studies have described the structure and composition of this layer by light and electron microscopy . scanning electron microscopic studies pertaining to cdj in health and disease are few and documentation of periodontal pathological changes of cdj is unclear . in the first phase of our study , the collagenous architecture of cdj of healthy teeth has been reported.aim:the objective of this study is to observe and report periodontal pathological changes in the fibrous or collagenous architecture of cdj of periodontitis - affected teeth and discuss the probable clinical implications of cdj in disease.materials and methods : twenty periodontitis - affected teeth were collected and processed for observing under a scanning electron microscope.results:the results are as follows : increased width of interface at cdj in periodontitis samples ( 7.1 ) compared to that of healthy samples ; fewer areas of fiber intermingling at cdj in periodontitis samples as compared to healthy samples ; frequent detachment of cementum from dentin during sodium hydroxide maceration of samples.conclusion:it may be inferred from results that there is a possibility of a definite weakening of cdj in periodontally affected root surfaces and we believe that clinical procedures such as scaling and root planning may have a detrimental effect on the cementodentinal attachment of periodontally involved root surfaces .

silver is a naturally occurring element with various physical properties , such as high thermal and electrical conductivity , ductility , hardness , malleability , and even antimicrobial ability . silver was known and used by ancient people as early as 4000 bc , along with gold and copper.1 silver now has a wide variety of applications , including in photography , soldering , metallurgy , medicine and dentistry , water sanitation , jewelry , coins , silverware , and mirrors.2,3 silver nitrate ( agno3 ) is a soluble silver salt used in medications to treat intestinal and oral ulcers as well as to control gingival bleeding . another relatively common use of silver nitrate is water purification , as in the case reported here . silver - containing compounds should be used with caution , given the risk of toxicity.3 generalized argyria is a rare dermatological disorder caused by silver granule deposits in the skin and mucous membranes , due to chronic exposure of patients to silver - containing compounds.4 persistent respiratory , topical , or oral exposure can lead to deposition of silver in the eye and periocular tissue , and a condition known as ocular argyrosis.5 this pathology has been described previously.58 the clinical presentation includes gray - blue discoloration of the periorbital skin , bulbar and palpebral conjunctiva , and lacrimal sac , as well as cornea opacities and cataracts.58 the latter are the main causes of specialist referrals.8 findings at the posterior pole include a leopard spot pattern of the macula and a dark choroid , observed by means of red - monochromatic fundus pictures and fluorescein angiography , respectively.9 although there are no visual symptoms in most reported cases , there are a few case reports in which patients complained of nyctalopia.5 however , patients undergoing electrophysiologic testing did not demonstrate functional deficits in scotopic or photopic electroretinography , nor were there any abnormalities on color vision testing.5 in the following case report , we describe a patient who developed ocular argyrosis after chronic ingestion of silver nitrate in his personal water supply . in order to expand the available data regarding this condition an 86-year - old caucasian male with a previous medical history remarkable for normal pressure hydrocephalus after ventricular shunt placement , early dementia , and skin argyria ( 2 years ) was seen at the ophthalmology clinic , complaining of slowly decreasing visual acuity and nyctalopia in both eyes ( ou ) . according to the primary caretaker , the patient had been drinking water from a well and purifying it with silver nitrate compounds for a period of at least 13 years , on the basis of advice from an alternative medicine professional , who recommended their use as antimicrobial agents and as a water purification method . the patient was subsequently advised by dermatology to suspend his silver nitrate intake 2 years prior to presentation to us . during the initial consultation , the patient s appearance was remarkable for a generalized gray - bluish hue of the skin and fingernails , more pronounced on the face , periorbital area , and forearms ( figure 1 ) . best corrected visual acuity was right eye ( od ) 20/40 and left eye ( os ) 20/50 . there was no afferent pupillary defect and confrontational vision fields were full in both eyes . conjunctiva had a purple - blue hue , but were normally vascularized and showed no epithelial defect . the palpebral portion of the main lacrimal gland also had a purple - bluish hue . fundus examination was remarkable for retinal pigment epithelium ( rpe ) changes and drusen formation on macula ou , consistent with age - related macular degeneration ( figure 2 ) . fluorescein angiography showed choroidal blockage with completely dark choroid in later phases in both eyes . areas of dot hyperfluorescence in the macula were present , corresponding to the drusenoid deposits . spectralis domain optical coherence tomography showed multiple excrescences of rpe in both eyes , most likely representing drusen from age - related macular degeneration ( figure 3 ) . an electroretinogram was obtained because of the patient s symptoms of nyctalopia , and revealed normal scotopic and photopic amplitudes and latency , as well as normal oscillatory potentials and 30 hz flicker testing ( data not shown ) . in this case report , we describe the clinical and ancillary test findings in a patient with ocular argyrosis . it is important to mention that , although there are previous reports and clinical descriptions of the anterior segment alterations and periocular skin deposits , there are relatively few descriptions of involvement of the posterior pole . the interesting finding of dark choroid , which occurs when the normal choroidal background fluorescence is blocked , was made in our patient on fluorescein angiography . silent choroid is most commonly associated with stargardt s disease and other posterior retinal dystrophies.9 the pathophysiology in patients with silver accumulation which leads to this angiographic finding is not understood as yet . wislocki and ladman conducted an experiment in albino rats involving giving them water containing silver nitrate for a period of 6 months to a year and trying to demonstrate the blood - ocular barrier . they reported histopathologic data showing that silver accumulated in two regions of the eye , ie , the ciliary processes and bruch s membrane.10 they also noted that the longer silver nitrate was administered , the greater the amount that accumulated . spencer et al performed a histopathologic examination in a patient with systemic argyrosis and found that brown - black silver pigment was present in three locations of the eye , ie , bruch s membrane , bowman s membrane , and descemet s membrane , with the majority of deposition occurring in bruch s membrane.11 therefore , the question arises as to how systemic argyrosis causes findings of dark choroid on fluorescein angiography , as in our patient . one of the mechanisms proposed is that accumulation of silver pigment deposits in large amounts in bruch s membrane causes absorption of short - wavelength light during fluorescein angiography , which could be responsible for the phenomenon of dark choroid.911 furthermore , in the same study series , red light monochromatic pictures were taken , which utilize a long wavelength to bypass rpe and visualize the choroidal vasculature in normal subjects . however , the choroidal vasculature could not be visualized in any of the six cases from that study utilizing red light pictures , meaning that the long wavelengths were blocked as well . thus , it has been proposed that silver deposits block all light , from short to long wavelengths.911 given the results above , it is reasonable to question whether silver might accumulate not only in bruch s membrane but also in rpe cells . however , a previous histopathologic study in albino rats did not show any accumulation of silver deposits in rpe cells,10 and furthermore , the fundus autofluorescence images from our patient did not show any signs of rpe damage . to our knowledge , there is only one previous report describing choroidal and retinal changes in patients with ocular argyrosis by means of fundus photographs and fluorescein angiography.9 in this case report , we expand the available information regarding changes in the retina and rpe . our patient underwent noninvasive evaluation for retinal pigment abnormalities with fundus autofluorescence , which uses a confocal scanning laser ophthalmoscope to detect accumulations , typically of lipofuscin granules , in rpe cells . . ophthalmologist and retinal specialists should be aware that conditions other than stargardt s disease can cause findings of dark choroid on fluorescein angiography .

this case report describes the clinical , autofluorescence , and optical coherent tomography findings in a patient with panocular argyrosis secondary to chronic intake of diluted silver nitrate salts in his water supply . an 86-year - old caucasian male with a distinctive gray - bluish hue of the skin presented to our clinic , having developed a slow decrease in visual acuity in both eyes and nyctalopia for the past 2 years . based on the patient s history of chronic intake of silver nitrate salts and a positive skin biopsy ( performed by the dermatology department , data not shown ) , a diagnosis of panocular argyrosis was made . fluorescein angiography showed choroidal blockage with a completely dark choroid . fundus autofluorescence was within normal limits . optical coherent tomography showed multiple excrescences of retinal pigment epithelium in both eyes . although the drusen - like changes on fundus examination and retinal pigment epithelium changes may account for the diminished vision , the presence of concomitant nyctalopia suggests underlying damage of the photoreceptors .

kidney epithelium in collecting duct contacts with hypotonic fluid which osmolality varies significantly and the cells continually expose to osmotic stress . alterations in luminal osmolality would influence cell volume . to avoid damage and perform their functions , these processes , termed regulatory volume decrease ( rvd ) , occur through activation of specific transporters in the plasma membrane that mediate net fluxes of osmotically active molecules . despite its importance , very little is known about cell - volume regulation inkidney outer medulla collecting duct ( omcd ) cells . cells recruit special mechanisms to correct acute swelling in hypotonic medium [ 1 , 2 ] . cell swelling has the effect of increasing k efflux , this occurs through channels distinct from those responsible for basal k conductance . obviously , both k and cl concentrations play key roles in governing these volume - regulatory responses . the predominant pathway for rvd is the opening of k channels which are usually large conductance [ 3 , 4 ] . these transporters can be quite nonselective and can include more than one type of channels . in cells containing na channels like collecting duct principal cells , na fluxes can influence the volume - regulatory response but the role of intracellular sodium in rvd is almost unstudied . from another hand , the mechanism by which cells sense changes in cell volume and activates it is important to study the changes of cell volume and [ na]i during the process of rvd for better understanding of the mechanisms involved in this reaction . the current study was undertaken to investigate the time course of changes in cell volume and sodium concentration during the volume - regulatory response after acute swelling in hypotonic medium . wistar rats weighting 150200 g ( breeding laboratory of experimental animals , institute of cytology and genetics , novosibirsk , russia ) were kept in individual cages and received standard diet . before the experiments , the rats were anaesthetized with pentobarbital ( 50 mg / kg i.p . ) , the kidneys were extracted and placed in ice - cold pbs , and a suspension of collecting duct fragments was prepared . a superfusion chamber was constructed as an acrylic block mounted on the objective of the upright microscope ( water immersion 65 magnification , numerical aperture 1.1 ) . the perfusate flow rate was generally 20 ml / min , which gave complete solution exchange in under 200 milliseconds . fluorescence measurements of cell volume were performed as it was described [ 6 , 7 ] . fragments of outer medullary collecting duct ( omcd ) on glass plate were loaded with calcein by incubation with calcein - am ( molecular probes inc . , ore , usa ) ( 5.0 m ) for 25 minutes at 23c . the glass plate bearing the fragments of the omcd was positioned on the stage of a microscope ( lomo - r8 , st . calcein fluorescence was measured continuously with halogen light source , calcein filter set ( 480 nm excitation , 490 nm dichroic mirror , 535 nm emission ) , photomultiplier detector has pinhole diaphragm to select the cells of interest at the end of fragment where cells expose apical surface to bath solution , and 14-bit analog - to - digital converter . loading conditions and filter set for fluorescence measurements were the same as for calcein . tissue from the outer medulla zone was cut from the isolated kidneys and squeezed through a needle ( 0.45 mm i.d . ) in the ice - cold calcium - free pbs . the resulting suspension was filtered through nylon mesh , diluted 10 times with eagle mem culture medium and centrifuged ( 100 g , 10 minutes , 4c ) . sediment containing the tubules was diluted with culture medium to an appropriate concentration of about 10 fragments per microliter . the solutions used were based on pbs ( 137 mm nacl , 4.7 mm na2hpo4 , 2.7 mm kcl , 1.5 mm kh2hpo4 , 0.5 mm mgcl2 , 0.05 mm cacl2 , 280 mosm / l , ph = 7 , 27 , 1 ) and contained 1.0 mg / ml glucose . this solution was chosen so as to be able to degas it without affecting its ph . to create osmotic challenges , bath solutions were changed from normal pbs to pbs diluted with distilled water ( 1:1 ) . isotonic solutions with decreased [ na]o were prepared by substitution part of sodium in pbs by nmdg ( n - methyl - d - glucamine , sigma - aldrich , moscow , russia ) . for measurements of sodium efflux in isotonic medium fluorescent measurements were calibrated plotting the relative values of fluorescence as an x value , against synchronized data of microscopic image analysis , obtained by the method published before . a perfusion chamber , described above , was mounted on the objective of the microscope ( water immersion 65 magnification , numerical aperture 1.1 , 1.6 magnification photo adapter ) . the glass plate bearing the fragments of the omcd was positioned on the stage of a microscope for acquisition of transmitted light images by a ccd camera . twelve - bit monochrome images were captured at a rate of 15 frames per second , stored on a personal computer . cell volume was calculated from measurements of calcein fluorescence according this calibration . in vivocalibration of sodium green was accomplished by exposing the fragments to various extracellular [ na ] ( [ na]o ) in the presence of 0.1 u/l nystatin . the solutions with various [ na]o were prepared by substitution part of sodium in pbs by nmdg . for calibration were used solutions with 138 , 14 , and 5 mm [ na]o . a calibration was performed at the end of each experiment ( see figure 2 ) . ion fluxes that appeared during cell swelling seem to be critically involved in the regulation of cell volume . however , the nature of the channels and the mechanism of their activation are poorly understood . it is also not clear to what extent this activation can explain the regulatory volume decrease . the goal of this study is to examine the time course of cell volume changes and concomitant variations in [ na]i after hypotonic shock . in hypotonic medium , principal cells in omcd fragments swell very fast , and the volume increases more than 60% ( see figures 2 and 3 ) . the evaluation of characteristic time of swelling ( 1 ) gives the value 0.65 0.05 seconds ( n = 12 ) , which is in a good agreement with our previous results . in our experiments , basolateral and apical surfaces of the cells on the end of microdissected fragment are in contact with medium . fast swelling of the principal cells is the consequence of the high water permeability determined by the water channels that are expressed in basolateral and apical membranes [ 8 , 9 ] . it was shown that abundance of water channels correlates with faster rvd [ 10 , 11 ] . probably the water channels are part of the mechanism , which is activated in cell volume decrease response . after cell volume reaches the peak of swelling , the rvd begins without lag period . the kinetics of this process is slower than swelling , and the characteristic time of volume decreasing to steady - state level ( 2 ) is 8.9 1.1 seconds ( n = 12 ) ( see figure 4 ) . the published data show that cells in cell lines derived from kidney epithelia , rccd , cos-7 , a6 have a significantly slower rate of rvd , and 2 is at least one order more [ 1113 ] . there is a discrepancy of results obtained on microdissected fragments of omcd and published data obtained on cell lines . most probably the difference is due to the loss of some ion transporters , which could not be activated by hypoosmotic shock in cultured cells . after restoration of the medium osmolality to normotonic , the cells shrink and the volume stabilizes on significantly lower level in comparison with control level ( see figure 4 ) . this decrease probably is due to the loss of cellular osmolites during rvd . salt withdrawal procedure could result in responses that depend on the type of cation removed . in this study , we reduced the osmolality by diluting pbs with water or removing nacl from the bath . the procedure causes drastic changes in ionic strength that could interfere with the mechanisms involved in volume recovery . hypotonic medium causes decrease of [ na]i and stabilization on the low level ( see figures 2 and 5 ) . the established level of [ na]i during the hypotonic shock is the result of interaction of three main processes : dilution of osmolites with water that enters the cell , activity of na , k - atpase , and ion flux into the cell through channels activated by swelling , which could be permeable for sodium . comparing the rates of normalized cell volume and [ na]i shows that cell volume grows about two times faster than [ na]i decreases ( 0.72 0.05 and 0.30 0.02 s correspondingly , p < .01 ) . this could be explained if during swelling water enters the cell accompanied by sodium . to block cell swelling and water entry , we created the transmembrane sodium gradient with normotonic pbs where 69 mm of na was substituted by nmdg . in the absence of cell swelling with virtually zero water entry , the of [ na]i decrease is significantly faster in comparison with the same parameter in hypoosmotic shock ( 2.6 0.26 and 8.9 0.98 seconds , n = 8 and n = 12 , correspondently , p < .01 ) . these results could be accepted as evaluation of sodium efflux through na , k - atpase . the evaluation of sodium content per cell , made by multiplication of synchronized measurements of calcein and sodium green fluorescence , shows that peak of cell volume correlates with the temporary increase of this calculated parameter ( see figures 2 and 5 ) . these results indicate that the water comes into cell during the swelling together with sodium . this could happen if swelling activated several types of channels which could pass ions with high conductivity and probably there are some channels which could pass water . probably , this sodium flux aggravates the cell swelling in the hypotonic medium if [ na]o is higher than [ na]i but during the phase of cell volume decreasing these channels being active could promote the outcome of potassium from the cell . the outcome of the ions , mainly potassium , should be facilitated by partial depolarization which could happened in these cells during swelling . one of the most probable transporters active in normal conditions and which probably takes a part in volume regulating response is epithelial sodium channel ( enac ) . this channel is expressed in apical membranes of principal cells , and there are data that indicate that enac could be involved in rvd [ 15 , 16 ] . to evaluate the putative influence of enac on [ na]i during hypoosmotic challenge , we blocked it with amiloride . the addition of amiloride to the concentration of 10 m in bathing solutions caused decrease of control steady - state level of [ na]i ( see figure 6 ) , but did not influence this parameter in hypotonic medium and after returning the normotonic pbs . amiloride did not influence significantly the relative swelling during hypoosmotic challenge ( 0.65 0.01 control , 0.77 0.05 amiloride , ns ) . the ineffectiveness of amiloride means that contribution of enac in sodium entry in our model of hypotonic shock is negligible and can not be detected in our experiments . the results of these experiments indicate that in principal cells hypoosmotic shock causes activation of the transporters , which have high permeability for water and probably provide sodium and potassium transport across cell membrane in dependence of the ion electrochemical gradient which is forming during swelling .

the purpose of this study was to investigate the time course of the volume - regulatory response and intracellular sodium concentration ( [ na+]i ) in the principal cells of rat kidney outer medulla collecting duct ( omcd ) epithelia during acute swelling in hypotonic medium . hypotonic shock was created by pbs diluted with 50% of water . changes in cell volume were measured with calcein quenching method . intracellular sodium concentration was studied with fluorescence dye sodium green . principal cells of microdissected omcd fragments swelled very fast . the characteristic time of swelling ( 1 ) was 0.65 0.05 seconds , and the volume increased more than 60% ( 92.9 5.6 and 151.3 9.8 m3 control and peak volumes correspondently , p < .01 ) . after cell volume reached the peak of swelling , the rvd began without lag period . the characteristic time of volume decreasing to new steady - state level ( 2 ) was 8.9 1.1 seconds . in hypoosmotic medium , cell volume stabilized on higher level in comparison with control ( 110.3 8.3 m3 , p < .01 ) . after restoration of the medium osmolality to normotonic , cell volume stabilized on significantly low level in comparison with control level ( 71.4 6.1 m3 , p < .01 ) . during the hypoosmotic shock , [ na+]i decreased from control level in isotonic pbs to the low level in hypoosmotic solution ( 27.7 1.4 and 5.8 0.23 mm , p < .01 ) . calculation of sodium content per cell has shown the significant sodium entry into the cells , which caused a temporary increase correlated with the peak of cell volume caused by swelling . the conclusion is made that in our model of hypoosmotic shock , swelling activates transporters with high permeability for na+ that provides sodium flux into the cells .

today s children are valuable human resources for future ; and how they are raised today guarantees the quality of human resources in future ( 1 ) . in april 2005 , the world health organization ( who ) chose the motto let s care for all mothers and children s health , which implies the vast interest of nations as well as governments toward children ( 2 ) . children and mothers are actually the vulnerable groups of the society and include almost 70% of the population in developing countries . studies reveal that nearly 25% of children under 5 years old in our country suffer from different degrees of underweight condition ( 3 ) . the easiest way to understand growth pattern children and evaluate their health is to monitor growth pattern as the first step the malnutrition for both mothers and children should be investigated at the same time , enables them to timely ( 4 ) what follows includes the steps which should be taken toward the growth monitoring : engaging mothers in weighing their children . identifying the children with growth retardation . questioning the mothers about the affordable food as well as the quality food they consume . making the mothers aware of the nutrition provided for their children ( 5 ) . therefore , mothers are highly important since they are considered as the target group to be trained in order to monitor their children s growth regularly and prevent growth retardation , and they must be aware of the issues ( 6 ) . health education is defined as the knowledge and the art of directing people s attention toward learning process to develop the desirable behavior to reach health ; therefore , it is considered as a helpful method in creating motivation and modifies the incorrect functions ( 7 ) . the first step in designing an educational program is selecting a health education model which starts the program on the right way and guides it to the evaluation phase . in the present study , possible outcomes of an educational program are projected by this model , so planning is from a whole to the details . nonetheless , before selecting a model for the health education program , its objectives as well as components must be studied . the precede model emphasizes the process of designing the program ( 8) . the precede model was unique since it starts by the active involvement of the target community in order to identify its final results and then goes back to identify the factors which were prior to those results ( 9,10 ) . salehi et al showed that nutritional behaviors could be improved using education based on precede model ( 11 ) . improvement in breast feeding behavior using education based on precede model was reported by baghianimoghadam ( 12 ) . other study also reported that this method could increase nutritional knowledge of preschool children ( 13 ) . based on what was mentioned above , the precede model was used in the present study in order to achieve more effective results .. the present study , therefore , aims to determine the effect of mothers training program on growth adjusting and monitoring based on some components of the precede model on the mean weight in children(6 - 12 months ) at health centers in shiraz , fars province . mothers and 6 - 12 months old children who had referred to health centers in shiraz participated in this interventional study in 2011 . the inclusion criteria were the children s being single , benefiting exclusively from breast feeding , and not having any specific diseases such as : congenital and genetic diseases . in addition , the exclusion criteria were the mothers not being interested in taking part in training classes , the children s being fed by formula , having chronic diseases , being hospitalized , and having accidents . the population under study included 120 mothers who had 6 - 12 months old children . four health centers were randomly selected from all health centers located in shiraz , iran . the samples were chosen by referring to the lists provided by the office of child care . of the four selected health centers , two were considered as the control and two as the experimental group . in order to gather the data , a questionnaire , this model provided a framework which clarifies the factors affecting the behavior , such as the predisposing factors ( knowledge , attitude , etc . ) , enabling factors ( availability of resources , and skills ) , and reinforcing factors ( the effect of others , family members , peers , etc . ) , in identifying a training program . the questionnaire consisted of 6 sections including demographic characteristics , questions on knowledge , attitude , enabling factors , and reinforcing factors , questions on maternal function , and measuring the children s weight . also , it was checked by the specialists in health education , and then their opinions on the validity of the questionnaire were applied ( evaluated by two dieticians , an epidemiologist and two health education specialist for the assessment of face and content validity ) . moreover , in order to measure the reliability index the questionnaire was completed by 20 mothers and alpha cronbach s coefficient of 84% obtained ( a pilot study was also performed on 30 subjects ) . twenty six questions regarding knowledge were scored from the lowest to the highest level from 1 to 5 . there were also 14 questions about attitude with responses ranged from completely disagree to completely agree which scored from 1 to 5 , respectively . responses to questions regarding capability and reinforcing factor and maternal functions were also scored from 1 to 4 . then , based on the gathered data , the selected mothers in the experimental group underwent the educational intervention . this intervention was conducted in 6 sessions each of which lasted for 55 - 60 minutes . each session included giving speeches , question and answer , showing movies as well as slides , and practical teaching for preparing supplementary food . mothers were also trained on the nutrition by food additives , appropriate pattern of nutrition , gradual variation in food , and growth monitoring . the children in both groups were weighed before and four months after the educational intervention . descriptive statistics was used to describe the characteristics of the subjects and distribution of variables involved in the study . based on the type of explanatory and outcome variables chi - squared test , independent and matched t - tests were used for data analysis in this study . descriptive statistics was used to describe the characteristics of the subjects and distribution of variables involved in the study . based on the type of explanatory and outcome variables chi - squared test , independent and matched t - tests both groups under study were not significantly different regarding age and household size ( table 1 ) . patients education level was categorized as secondary and high school and patients job was housewife or employee . education and job were not also different between the two groups under study ( table 2 ) . the results of the present study revealed that , before the intervention , no statistically significant difference was found between the two groups regarding the means obtained for knowledge , attitude , enabling factors , reinforcing factors , and maternal functions to prevent the growth retardation , and to evaluate the mean of the children s weight . four months after the educational intervention , however , the results of the matched t - test revealed both a great increase and significance difference in the mean of knowledge scores obtained by the experimental group ( p<0.05 ) . moreover , the mean of the mothers attitude to monitor growth and preventing the growth retardation revealed a significant difference four months after the educational intervention ( p<0.001 ) . this shows the great impact of education on mothers attitude . regarding the enabling and reinforcing factors , also , a significant difference was found between the two groups after the intervention ( p<0.05 ) . the results of the t - test also depicted that the maternal function on growth monitoring and preventing the children s growth retardation four months after the educational intervention was significantly different in comparison to the period before the intervention ( p<0.05 ) . ( table 3 ) in addition , four months after the educational intervention , the mean of the children s weight increased in both groups ; however , the increase revealed to be more significant in the experimental group compared to the control group ( p<0.05 ) ( table 4 ) . in general , a significant increase in the mean of the overall knowledge was observed in the experimental group , which shows the great impact of the educational intervention . the results of the present study are in line with the results obtained by hazavehei on the relationship between increasing the mothers knowledge and ida in 1 - 5 year - old children ( 14 ) , soltani on preventing the growth retardation among children in tabriz ( 15 ) , sharifiraad on increasing the students knowledge of intestinal parasitic diseases ( 16 ) , and shakouri on controlling ida in high school girl students ( 17 ) . shojaeizadeh et al . conducted a study about ida conclusion that a qualified educational program which is accompanied by group discussions leads to the increase in the knowledge score . moreover , sufficient amount of knowledge about an issue can result in the importance as well as the belief toward that issue and , consequently , develop a positive attitude ( 18 ) . in general , after the educational intervention , the mean of attitude scores has increased in the experimental group , which reveals the effect of the precede model on increasing the positive attitude . the results are in line with the results obtained in the studies conducted by hazavehei ( 14 ) , sabzmakan on the increase of the patients attitude scores after the coronary heart bypass surgery ( 19 ) , and shakouri ( 17 ) . in the precede model , predisposing factors such as attitude are prior in behavior and , at the same time , are considered as behavior s stimulating factors . in the present study , also , the positive attitude has resulted in appropriate maternal function for health monitoring and preventing the growth retardation . the results of the present study depicted a significant difference between the two groups regarding the enabling factors . similar results were obtained in the studies conducted by sharifiraad on the relationship between increasing the enabling factors and decrease in the intestinal parasitic diseases ( 16 ) and zigheimat on the effect of educating the epileptic patients ( 20 ) . the results of the present study , also , revealed a significant difference between the two groups regarding the reinforcing factors , which shows the effect of utilizing the precede model on increasing the reinforcing factors . this is in line with the studies conducted by zigheimat on epilepsy ( 20 ) , shakouri on controlling ida in high school girl students ( 17 ) , and hazavehei on controlling ida in 1 - 5 year old children ( 14 ) . regarding the maternal function in monitoring health and preventing the growth retardation , the present study revealed a significant difference between the two groups , which proves the effect of knowledge , attitude , and reinforcing as well as predisposing factors on the rate of maternal function . the study conducted by baghianimoghadam et al . in yazd province ( 12 ) as well as a study in chile ( 21 ) , also , revealed that education based on the precede model increases the mothers breast feeding behavior . therefore , growth monitoring can encourage the mothers to perform positive activities . in order to achieve this aim , sufficient amount of time cooperation of the mother and the family has a major role in the child s growth . it is also quite important to strengthen the mothers , increase their motivation , discuss the child s growth with them , and receive their opinions ( 22 ) . in a study which was conducted by emami and aref on the rate of maternal function in using iron as well as supplementary vitamins for infants , it was shown that the mothers had a moderate function regarding this issue ( 23 ) . the mean of the scores obtained for the maternal function significantly increased after the educational intervention in hazavehei s study on controlling ida in 1 - 5 year - old children using the precede model ( 14 ) . performed studies in england and reached similar results ; i.e. conducting the iron supplementation program by mothers leads to success in ida control strategy . his aim can be achieved by developing an effective relationship between the mothers and the health staff ( 24,25 ) . dabagh and green , also , conducted a study on the application of theprecede and the proceed models as the framework of designing the programs as well as policies in preventing diarrhea in children in arab countries.in line with the objective of the study , the precede model was utilized as a diagnostic instrument for identifying and emphasizing the factors which affect the causes as well as controlling diarrhea in children in rural areas ( 26 ) . the results of the present study revealed a significant difference between the control and the experimental group regarding the increase of weight . although the increase in weight was observed in both groups , the experimental group revealed more increase in weight in comparison to the control group . kilaru conducted an interventional study which included growth monitoring consultation accompanied by teaching nutrition to mothers and came to the conclusion that the children in the experimental group gained more weight after the intervention ( 5 ) . in his study , kumar considers starting the breast feeding 6 hours after birth and inappropriate supplementary food as the risk factors for underweight ( 27 ) . this might be due to the fact that the mothers had not been educated in this respect . in a study which was conducted on children in india , 60% of the children had underweight , which had happened because of the mothers lack of knowledge about nutrition , their unhealthy habits , and undesirable cultural functions ( 28 ) . the effectiveness of the precede model was also confirmed in a study which was conducted in vietnam in order to evaluate the need for educational interventions with respect to children s nutrition , breast feeding , and growth monitoring ( 29 ) . these results , all , prove the effectiveness of the precede model in educating the mothers on the children s gain of weight . one limitation of this study is that we did not have control over the study subjects regarding their contacts . any contact between individuals in intervention and control group can affects their behaviour and the final outcome of the study . educational programming based on the precede model positively affects different aspects of mothers behavior in children s growth monitoring . the results of this study indicated that mothers training program based on the precede model was highly effective on the prevention of growth retardation in the study population .

background : growth retardation in children is a result of nutritional ignorance , inappropriate care , and inadequate monitoring of growth monitoring . this study was performed to assess the effect of mothers education program based on the precede model on the mean weight of children ( 6 - 12 months ) at health centers in shiraz , fars province . methods : this quasi experimental study was conducted on 120 mothers ( 60 in the experimental and 60 in the control group ) with single child and exclusively on breast feeding who were cared by health centers in shiraz , fars province . the data were gathered through a questionnaire which included demographic characteristics , the components of the precede model ( knowledge , attitude , enabling as well as reinforcing factors , and maternal function ) and child weight . educational intervention was performed during 6 sessions each of which lasted for 55 to 60 minutes . the questionnaire was completed by the experiment a land control group before and 4 months after the training program . results : the results showed that the educational intervention program in the experimental group caused significant increase in the means of knowledge ( p<0.001 ) and attitude scores ( p<0.001 ) . this study showed that enabling and reinforcing factors ( and training sessions ) , performance score of mothers as well as weight of children among experimental group were significantly higher than control group ( p=0.01 ) . conclusion : the results of this study can be used as a guideline prevents growth retardation in health centers and other related organizations .

isolated foot drop of a single leg is the weakness of the dorsiflexor muscles of the foot , and this usually arises painlessly due to peripheral neuropathy , such as peroneal nerve damage or radiculopathy . here , we introduce a case presenting sudden isolated foot drop caused by a small cerebral cortical infarction in the anterior cerebral artery territory , which mistaken for a condition from radiculopathy . a 71-year - old man visited hospital with lower back pain , paresthesia , and weakness in his left foot that had been present for one week . when presented in clinics , the paresthesia had disappeared , but he still could not move his left ankle . the sensory exam was normal , as were his deep tendon reflexes ( dtr ) , superficial reflexes , and pathologic reflexes . in the neurologic exam , he was alert and oriented , and his cranial exam responses were intact . previously , he had undergone surgery for a varicose vein in his right leg ten years ago and endoscopic surgery for a gastric adenoma three years ago . he did not have a history of peripheral neuropathy or systemic diseases , such as hypertension or diabetes . a lumbar spine magnetic resonance imaging ( mri ) showed a ruptured disc , which was compressing the nerve root on the left side of l4/5 , and degenerative spondylosis in l5/s1 ( fig . the electromyography ( emg ) and nerve conduction study ( ncs ) showed decreased amplitude and prolonged latency in the left peroneal and tibial compound muscle action potential and normal sensory findings . the brain ct and plexus mr did not show any specific findings . with several days of daily rehabilitation physiotherapy , , the deep tendon reflex was increased on the left ankle and ankle clonus was noticed . the whole spine mri and brain mri were immediately executed , and they revealed a small area of restricted infarction in the right parietal cortex with anterior cerebral artery ( aca ) and posterior cerebral artery ( pca ) stenosis on the left side ( fig . 3 ) . for a detailed stroke investigation , electrocardiography and echocardiography were performed , and the results showed no specific problems . the patient was treated with a daily antiplatelet and adjuvant physiotherapy for foot drop . a month later , his motor deficit had improving , up to grade iii . cerebral impulses are conducted via the corticospinal tract to target muscles , and this enables us to move our extremities . an arising problem in this pathway is being unable to move the extremities , which is called paresis . isolated foot drop of a single leg is the weakness of the dorsiflexor muscles of the foot , and this usually arises painlessly due to peripheral neuropathy , such as peroneal nerve damage or radiculopathy17 ) . isolated painless foot drop is also caused by central origin , but this is rare , and there are only several reports of acute infarction mimicking peroneal neuropathy45910 ) . these cases of painless foot drop were reported to be caused by lumbar disc disorder and treated surgically . these reports are cases presenting sudden isolated foot drop caused by a small cerebral cortical infarction in the anterior cerebral artery territory . the results of the examination for the lumbar spine were consistent with the peripheral cause of foot drop , including weakness below the level of the ankle , and the lumbar spine mri , ncs , and emg included initial and follow - up results except the lack of sensory deficit or disappearing of paresthesia in the dorsal surface of the left foot . this prompted us to evaluate the brain with mri , which revealed a late subacute stage of infarction in the right paracentral lobule and the parietal medial cortex . this lesion is considered consistent with the somatotopic ankle and toe topography in the motor homunculus . anterior cerebral artery territory is most commonly reported to affect leg monoparesis268 ) . in our patient , aca infarction via artery - to - artery embolism was considered the main cause of the acute foot drop , although the exact pathogenesis of the stroke was unclear . unlike previously reported cases , this patient showed similar symptoms , but had a peripheral lesion in the lumbar spine with a simultaneous central lesion in the primary motor cortex . in this case , the lesion of the upper motor neuron was masked by the lower motor neuron lesion . physicians could be confused when diagnosing this condition . as far as we are aware , this is the first report of isolated foot drop caused by a cortical infarction that was masked by a peripheral lesion . in conclusion , central nervous system lesions that also affect the monoparesis of the extremities have to be considered , especially when atypical findings for peripheral lesions are present .

although they usually originate from peripheral problems , foot drop is caused by lesions affecting the neural pathway related to dorsiflexor muscles , whether of central or peripheral origin . we present a patient with sudden isolated foot drop caused by a small infarct in the primary motor cortex mimicking a peripheral origin . this report indicates that patients presenting isolated foot drop should be managed carefully and the possibility of both central and peripheral causes should be considered . to our knowledge , this is the first report of sudden isolated foot drop caused by a cortical infarction mimicking lumbar radiculopathy .

routine cardiac surgery is associated with a low risk of mortality . however , patients undergoing cardiac surgery are increasingly older , with greater comorbidities and consequently the proportion and absolute number of patients at high - risk of postoperative adverse outcomes is increasing [ 2 , 3 ] . as well as increased short - term mortality , high - risk patients also have a significantly increased incidence of perioperative acute myocardial infarction , cardiac failure , acute kidney injury and stroke . postoperative major morbidity is associated with increased longer - term mortality , cost and reduced quality of life [ 8 , 9 ] . the optimal management of high - risk patients remains uncertain and has been identified as a research priority by several leading organisations [ 10 , 11 ] . in a recently updated cochrane systematic review of high - risk patients undergoing coronary artery bypass graft ( cabg ) surgery , prophylactic intraaortic balloon counterpulsation ( iabc ) significantly reduced postoperative mortality ( odds ratio 0.18 , 95% confidence interval 0.08 - 0.41 ) . despite this , preoperative iabc use is variable and employed in only a small proportion of high - risk patients in australia and new zealand and worldwide [ 14 , 15 ] . current low and variable use may reflect the strength of the available data upon which individual management decisions are based . in addition , there may be difficulties in identifying appropriate high - risk patients preoperatively , contraindications to intraaortic balloon pump ( iabp ) placement , lack of time , or surgical preference for alternative management strategies . further prospective research , including a randomised controlled trial ( rct ) of prophylactic iabc in selected high - risk patients , would help to clarify the role of this intervention but is contingent on first understanding current management strategies and attitudes towards this program of research amongst key stakeholders . the aim of this study was to conduct a questionnaire - based survey of cardiothoracic surgeons in order to determine self - reported management strategies of high - risk patients and attitudes towards further research in this area . first , the current strategies for identifying and managing high - risk patients ( defined as a perioperative mortality or major morbidity > 5% ) undergoing cardiac surgery . second , the attitudes and beliefs towards research priorities in high - risk cardiac surgery and third , the individual and institutional characteristics of respondents . survey item were generated around these three domains and continued until redundancy . the draft survey was pilot tested by several senior cardiothoracic trainees using a one page assessment sheet . the draft survey was assessed for flow , salience , clarity , acceptability , face validity and content validity . the survey was distributed electronically through the email list of the australian and new zealand society of cardiac and thoracic surgeons ( anzscts ) to all practicing cardiothoracic surgery fellows . the email included a cover letter detailing the aims of the survey and a link to allow one - time , anonymous , online completion of the questionnaire using an internet - based commercially - available survey sponsor ( www.surveymonkey.com ) . the survey was sent a total of three times over a period of five weeks . the response rate was determined by comparing the number of current fellows in the anzscts database with the number of responses . normally distributed data were presented as means , non - normally distributed data as medians . the study was conducted after approval by the northern sydney local health district human research ethics committee ( reference : 1201 - 032 m , lr ) . more respondents work in both public and private hospitals ( 48% ) compared with public ( 35% ) or private ( 17% ) hospitals alone . respondents performed a mean of 188 ( standard deviation ( sd ) 92 ) cardiac surgical procedures a year of which 48% were elective compared with 40% urgent ( not routine , medical reason for operating this admission ) and 12% emergency ( unscheduled , on same day ) . the proportion of their patients identified as high - risk was 14.3% ( sd 11 ) . explicit identification of high - risk patients in order to provide specific preoperative interventions was reported by 93% of respondents . the methods and characteristics used to identify high - risk patients preoperatively are presented in table 1 . the percentage of high - risk patients already receiving an iabc at time of surgery for a therapeutic indication was reported to be < 5% for the majority ( 53.3% ) of respondents and more than 20% of patients for only 13.3% of respondents . the reported frequency of prophylactic iabc and prophylactic levosimendan for patients with various preoperative risk factors is described in table 2 . the reported frequency of prophylactic intraaortic balloon counterpulsation and prophylactic levosimendan for patients with various preoperative risk factors . prophylactic iabc for patients with two or more risk factors ( left main disease > 70% , redo sternotomy , left ventricular ejection fraction < 30% and unstable angina in the 24 hours prior to surgery ) was reported to be used never ( 13.8% ) , occasionally ( 31.0% ) , sometimes ( 31.0% ) , usually ( 20.7% ) and always ( 3.4% ) . the most frequently chosen characteristic to identify patients who may benefit from prophylactic iabp was low ejection fraction ( 86.7% ) , followed by unstable angina in the 24 hours prior to surgery ( 56.7% ) and significant left main disease ( 40.0% ) ( table 3 ) . when prophylactic iabc is placed , this was reported to occur primarily before arriving in the operating theatre ( 53.3% ) compared with pre - induction ( 3.3% ) , post - induction ( 26.7% ) pre or post - induction ( 13.3% ) or never placed ( 3.3% ) . in considering contraindications to iabc , moderate aortic incompetence , severe peripheral vascular disease and severely calcified aorta no respondents considered mild aortic incompetence , mild peripheral vascular disease or therapeutic anticoagulation absolute contraindications . finally , the degree of agreement that prophylactic iabc may improve outcome in selected patients undergoing high - risk cardiac surgery was 3.4% strongly agreed , 69.0% agreed , 20.7% neutral , 6.9% disagreed , 0% strongly disagreed . attitude towards further research . the most frequently cited reason for high - risk patients currently not receiving prophylactic iabc was lack of data to support its use ( table 4 ) . when asked to rate the degree of agreement to enrolling selected patients undergoing high - risk cardiac surgery to a randomised controlled trial of prophylactic iabc , 3.4% strongly agreed , 48.3% agreed , 17.2% were neutral , 17.2% disagreed and 13.8% strongly disagreed . agreement that an intervention showing benefit would alter management depended on the outcome measure chosen ( table 5 ) . respondent agreement on whether management of high - risk patients undergoing cardiac surgery would be altered on the basis of an intervention demonstrating selected outcomes . the greatest barriers to a randomised controlled trial of prophylactic iabc versus usual care were : too few suitable patients ( 37.9% ) , no major barriers ( 31.0% ) , a strong view that iabc is already indicated in such settings ( 24.1% ) , equally efficacious alternatives e.g. levosimendan ( 13.8% ) , lack of ethical acceptability of the intervention ( 10.3% ) , too difficult or time consuming to ensure timely placement ( 6.9% ) and other ( 6.9% ) . a majority of respondents ( 79.3% ) indicated an interest in taking part in a rct of iabc in high - risk cardiac surgery , 82.8% indicated that their unit would be interested in taking part and 86.2% that their unit had the skills and resources to do so . this survey of australian and new zealand cardiothoracic surgery fellows found that high - risk patients were identified by surgeons at a rate that is consistent with the national and international literature , and that in spite of being identified as high - risk , prophylactic iabc is not being instituted for these high - risk patients largely because of a perceived lack of data supporting the efficacy of this intervention . a clear majority of the surgeons who responded to this survey would support a randomized trial to provide further evidence regarding the efficacy of prophylactic iabc in this population . there have been 6 rcts and a cochrane meta - analysis , all suggesting a large reduction in mortality when iabc is commenced prior to surgery in high - risk patients , however the use of this therapy is very limited . less than 10% of patients who might benefit from this intervention in anz currently receive prophylactic iabc . this survey found that the most common barriers to implementation of prophylactic iabc are the lack of clear selection criteria and the lack of sufficient data to support the intervention . although not explored in the survey , these beliefs are likely due , at least in part , to the small number of total participants enrolled in rcts of prophylactic iabc ( n=255 ) , high baseline mortality in the control group and single centre origin of 5 out of 6 of the studies . reported methods to identify high - risk patients and their subsequent management varied considerably amongst respondents . substantial practice variation in the management of high - risk patients has previously been reported , although not in the australian and new zealand context . whilst individual patient factors and differences in case mix and institution may be partially accountable and were not investigated in this study , such wide practice variation is likely to occur in the setting of a lack of solid evidence to guide practice . in a recent retrospective study of australian and new zealand patients undergoing cabg , 4 simple preoperative characteristics used in previous rcts of iabc , identified a group of patients at significantly increased risk of severe adverse postoperative outcomes including acute kidney injury , myocardial infarction and death . the results of this survey suggest that alteration in these outcomes would change management of high - risk patients . further prospective studies are warranted to ascertain the true serious adverse event rate and potential magnitude of benefit associated with iabc in selected high - risk patients . first , although the response rate was similar to other studies surveying surgical opinion [ 24 , 25 ] , the response rate was relatively low ( 28% ) and therefore potentially subject to response bias . it should be noted though that the survey population was the entire population of cardiothoracic surgeons in australia and new zealand , rather than a sample of them . the willingness to participate in further research depends more on the absolute number of favorable responses rather than the proportion . second , as with all surveys , the results may be limited by differences between reported behavior and actual clinical practice . in addition , given the magnitude and consistency of responses , the favorable response in conducting research in the use of prophylactic iabc is likely to be a true reflection of the desire of the respondents to advance evidence - based practice and improve patient outcomes . reported use of prophylactic iabc by practicing australian and new zealand cardiothoracic fellows was low and varied by indication and respondent . the most frequently cited reason for not using prophylactic iabc in a high - risk patient undergoing cardiac surgery was lack of clear data to support its use . encouragingly , a majority of respondents reported being interested in taking part in a rct of prophylactic iabc . further prospective data is required in order to ascertain whether additional barriers to an rct , such as inadequate patient numbers and lack of clear selection criteria , can be overcome .

introductionpatients undergoing cardiac surgery increasingly have greater comorbidities and subsequently are at higher risk of adverse postoperative outcomes . despite some evidence suggests that prophylactic intraaortic balloon counterpulsation reduces mortality in selected high - risk patients , its use remains low . the aim of this study was to investigate reported management strategies of high - risk patients and attitudes towards further research in this area.methodsa 22-question survey was developed and distributed electronically to all practicing cardiothoracic fellows through the email list of the australian and new zealand society of cardiac and thoracic surgeonsresultsthe response rate was 28% ( n=31 ) . reported use of prophylactic intraaortic balloon counterpulsation varied depending on the specified preoperative indication . prophylactic intraaortic balloon counterpulsation was used occasionally or never by the majority of respondents for their patients with characteristics similar to those of previous trials . the most frequent reason given for not using prophylactic intraaortic balloon counterpulsation was lack of data ( 42.9% ) , with a willingness to consider participation in an randomised controlled trial of prophylactic intraaortic balloon counterpulsation by a large majority of respondents ( 79.3%).conclusionsthe majority of surgeons who responded to this survey do not routinely use prophylactic intraaortic balloon counterpulsation for high - risk patients . further prospective data is warranted to ascertain whether potential barriers to a randomised control trial of prophylactic intraaortic balloon counterpulsation , such as adequate patient numbers and clear selection criteria , can be overcome .

most commonly , they present with genital ambiguity . however , the phenotype may vary from normal female to normal male appearance . here , we are describing a case of 46 xy ovotesticular dsd who presented as primary amenorrhea . the index case , a 21-year - old female came to gynecology opd with complaint of primary amenorrhea ( pubarche : 15 yrs and thelarche : 18 yrs ) . general physical examination was within normal limits ( no features suggestive of hypothyroidism , cushing 's syndrome , or acromegaly ) . external genitalia examination revealed clitoromegaly ( 5 cm ) , separate vagina , and urethra openings . she was born out of non - consanguineous marriage and ante - natal history was not contributory . there was no similar complaint in the family . in view of primary amenorrhea with clitoromegaly , serum total testosterone , lh , fsh , 17-oh progesterone , dheas , thyroid profile , and prolactin were measured . all of the above hormone investigations were normal except raised serum total testosterone [ 4.78 ng / ml ( 0.15 to 0.81 ) ] , lh [ 20 miu / ml ( 0.80 to 7.6 ) ] , and fsh [ 30 miu / ml ( 0.7 to 11.1 ) ] . ultrasound pelvis revealed hypoplastic uterus ( 4.8 cm 1.65 cm 0.847 cm ) and bilateral ill - defined gonad like structures high up in pelvis . at this point of time , mosaic turner 's syndrome ( 45 x/46 xy ) was kept as the first possibility . but the karyotype revealed 46 xy , so the clinical diagnosis was changed to partial gonadal dysgenesis . anthropometry revealed : height : 168 cm , weight : 75 kg , bmi : 26.60 kg/ m , upper segment : 74 cm , lower segment : 94 cm , and arm span : 180 cm . hormone investigations revealed a decrease in serum total testosterone from 4.78 to 0.93 ng/ ml and a further increase in gonadotrophins ( lh : 31.4 miu / ml and fsh : 53.3 miu/ ml ) . intra - operatively , vaginal length was 10 cm , cervix and uterus were hypoplastic with b / l normal fallopian tubes in situ , left side showed tubular gonad and right side had spherical gonad . histopathology of left and right gonad revealed ovarian follicle with flattened cuboidal lining epithelium [ figure 1 ] and hyalinized seminiferous tubules with leydig cells [ figure 2 ] , respectively . , she was started on estrogen replacement and the plan was to add progesterone after breakthrough bleeding . left gonad showing ovarian follicles ( h and e , 20 ) right gonad showing seminiferous tubule ( h and e , 40 ) the disorders of sex development ( dsd ) is an uncommon disorder with an incidence of 1:4500 to 1:5000 live births . true hermaphrodite ( ovotesticular dsd ) is responsible for 4% to 10% of cases of dsd , but this is the most common type of intersex disorder among south african blacks . the frequency of different karyotype found among true hermaphrodite are 46 xx ( 60% ) , 46 xx/46 xy ( 30% ) , and 46 xy ( < 10% ) . in a study by bhansali et al . from a tertiary care center in india , only one case of 46 xy ovotesticular dsd was detected among seven true hermaphrodite patients over 10 years . patients with ovotesticular dsd are classified according to the type and location of the gonads . lateral cases ( 20% ) have a testis on one side and an ovary on the other . bilateral cases ( 30% ) have testicular and ovarian tissue present bilaterally , usually as ovotestis . unilateral cases ( 50% ) have an ovotestis present on one side and an ovary or testis on the other . the ovary is more frequently found on the left side , whereas the testis is found more often on the right like in our patient ( lateral variety of ovotesticular dsd ) . a majority of true hermaphrodite patients present with genital ambiguity with or without palpable gonads and most of them are reared as males . however , the appearance of external genitalia varies from normal female with mild clitoromegaly to normal male . this feature is suggestive of more severe dysgenesis of gonad and is also supported by the presence of mullerian structures adjacent to testicular tissue ( rt . an unusual feature of this patient was the absence of hirsutism in spite of increased serum testosterone level and clitoromegaly . this can be explained by the differential sensitivity of pilo - sebaceous units ( psus ) to serum androgen in different patients . another interesting finding in our patient was the progressive decrease in functional testicular tissue over time ( a decrease in serum testosterone from 4.78 to 0.93 ng / ml with mild regression of clitoromegaly over 3 years ) . similar reports have been described in the literature . because of this phenomenon , the gonads which were initially visible in ultrasound could not be localized in mri after 3 years . the important issue related to intra - abdominal testicular tissue is the risk of development of gonadal tumor , e.g. gonadoblastoma . the risk is more in case of gonadal dysgenetic syndromes compared to true hermaphrodite ( 15% to 35% vs. 02% to 04% ) . as the true hermaphrodite is itself a rare disease and most of the cases have 46 xx karyotype , the exact risk of development of gonadal tumor among 46 xy ovotesticular dsd ( e.g. the index case ) is not known . in most of the patients with true hermaphrodite , however , it is important to retain at least the ovarian tissue in case of true hermaphrodite patients with uterus as few cases with successful pregnancy are there in the literature . in summary , true hermaphrodite should be kept as one of the differential diagnosis of primary amenorrhea particularly in the presence of hyperandrogenism . not all patients develop cutaneous manifestations of androgen excess , e.g. hirsutism because of differential sensitivity to androgens . detailed physical examination and step - wise investigations including karyotype will pick up these cases . various factors including the possible diagnosis ( gonadal dysgenesis vs. true hermaphrodite ) , presence of y - chromosome , sex of rearing and the scope of fertility should be taken into consideration before doing gonadectomy .

true hermaphrodite is one of the rare variety of disorders of sex development . most of them are genotypically females ( 46 xx ) and present as under virilized males . features of hyperandrogenism are present in those reared as females . the commonest histological variety of gonad found in them is ovotestis , which is at risk for malignancy . we report a girl with 46 xy true hermaphrodite without ovotestis presenting as primary amenorrhea and isolated clitoromegaly in the absence of any other features of virilization .

infection related glomerulonephritis ( irgn ) is an immunologically mediated glomerular injury triggered by extrarenal infection . in the past , the majority of irgn cases were related to infection with nephritogenic streptococcal strains [ 1 , 2 ] . as the prevalence of streptococcus pyogenes disease in developed countries has declined , other causative pathogens are recognized more frequently . a recent review of 86 patients with renal biopsy - confirmed irgn identified streptococcus spp . in 27.9% and staphylococcus spp adults over 55 years accounted for 54.6% of the cases , in contrast to previous studies ( 1974 and before ) , which reported irgn to be a disease predominantly of children . emerging risk factors for irgn identified in the recent studies include diabetes mellitus , alcoholism , hiv infection , malignancy , and injection drug use [ 1 , 2 , 4 ] . whereas poststreptococcal gn typically occurs 14 weeks following a cutaneous infection , the majority of nonstreptococcal irgn cases occur concurrently and at times precede the diagnosis of the infection . more accurately describes this pathology compared to the old term of postinfectious gn . staphylococcus epidermidis is a well - established cause of shunt nephritis , accounting for 75% of cases . herein , we describe a case of irgn in the setting of severe spine infection with s. epidermidis , which occurred in the absence of foreign body . a 72-year - old male with a history of type 2 diabetes mellitus and hypertension presented to the hospital with a 2-week history of progressive lower back pain and generalized weakness which culminated in inability to arise after a mechanical fall . on presentation he had a temperature of 36.7c , bp 153/73 mm hg , pulse 73 bpm , and respiratory rate 24/min . pertinent physical exam findings included tenderness to palpation of the spine and left upper arm edema and tenderness . initial laboratory results were notable for leukocytosis ( wbc 16,900/mm with 92.6% neutrophils ) , acute kidney injury ( creatinine 1.6 mg / dl [ 144 mol / l ] baseline 0.9 mg / dl [ 80 mol / l ] and , bun 57 mg / dl ) , hyponatremia ( sodium 128 mmol / l ) , rhabdomyolysis ( ck 3760 u / l ) , and abnormal urinalysis ( specific gravity 1.025 , large blood with sediment showing 610 rbc / hpf , wbc 1120/hpf , moderate bacteria , and protein 100 mg / dl ) . ultrasound of the left arm disclosed a 7 cm subcutaneous fluid collection , which was drained . admission blood , urine , and left arm aspirate cultures grew methicillin - sensitive s. epidermidis . magnetic resonance imaging of the spine revealed large subdural empyema and phlegmon extending from mid - thoracic to lumbar spine , nerve root inflammation , marked canal stenosis , and cord compression . he underwent emergent surgery for debridement of the infectious collections and t4-t5 , t8-t9 , and l4-l5 laminectomies . his postoperative course was complicated by acute blood loss anemia and hypotension attributed to hemorrhagic and septic shock requiring vasopressors and blood transfusion . he developed oligoanuria ( responding to diuretics ) and progressive increase in serum creatinine up to 5.7 mg / dl ( 504 mol / l ) , presumptively from acute tubular necrosis ( atn ) , necessitating initiation of renal replacement therapy . light microscopy ( lm ) ( figure 1 ) of the kidney specimen showed flattening of the tubular epithelium ( figure 1(a ) ) with tubular necrosis and edema suggesting acute tubular necrosis ( atn ) . additionally , diffuse and nodular mesangial expansion ( figure 1(b ) ) as well as arteriolar hyaline were present consistent with an underlying diabetic nephropathy ( dn ) . mild patchy interstitial inflammatory cell infiltrates , predominantly mononuclear cells , were seen suggesting an underlying inflammatory process . electron microscopy ( em ) ( figure 2 ) showed mesangial and scattered subepithelial humps with electron dense immune type deposits ( figure 2(a ) ) , moderate podocyte effacement , and thickening of the glomerular basement membrane at 506 95 nm ( normal 371 56 nm ) ( figure 2(b ) ) . direct immunofluorescence ( if ) ( figure 3 ) showed mild mesangial staining of c3 , iga , and igm . there was gradual improvement of his renal function and after 6 weeks he was no longer hemodialysis ( hd ) dependent . s. epidermidis infection was aggressively treated with 8 weeks of ceftriaxone followed by 12 months of oral minocycline . at 12-month follow - up , staphylococcus epidermidis , typically considered a low - virulence microbe , is a well - recognized cause of irgn in association with prosthetic material , such as central venous catheters and shunts . however , severe s. epidermidis infection in the absence of prosthetic material is distinctly unusual . we hypothesize that our patient acquired the infection following a difficult peripheral venipuncture , which resulted in an infected hematoma . immunosuppression , due to advanced age and underlying diabetes mellitus , facilitated hematogenous dissemination of s. epidermidis to the spine resulting in multifocal vertebral osteomyelitis as well as evolution of irgn in the absence of prosthetic material . in addition to dn , superimposed irgn delayed recovery from atn and prolonged his dependence on hd . the distribution of these deposits varies depending on the stage of the disease but most commonly are found in the mesangium [ 1 , 7 ] . subepithelial deposits , classically seen in s. pyogenes irgn , are also identified in s. aureus irgn , however not as frequent in cases with comorbid dn . on if , predominant c3 and igg deposits with minimal iga , c1q , and igm are seen . predominant iga deposition mimicking iga nephropathy is an emerging entity described with s. aureus and must be differentiated from primary iga nephropathy [ 9 , 10 ] . codominant iga deposition is commonly seen in irgn but is usually of mild to moderate intensity . the kidney biopsy of our patient disclosed mesangial hypercellularity with electron dense immune deposits consistent with a mesangial pattern , likely representing a late stage of disease when the biopsy was performed . only trace iga was identified that was codominant with c3 and igm , a finding consistent with reported cases of s. aureus associated irgn . atn was the major finding on biopsy and appears to be the predominant cause of acute renal failure in this patient . the mainstay therapy for irgn is aggressive management of the infection and complications of nephritis . our patient 's good outcome was likely result of the aggressive surgical and medical treatment of his infection despite significant risk for poor outcome . this case highlights the change in epidemiology of irgn . clinicians should consider irgn when renal injury occurs in the course of s. epidermidis infection even in the absence of prosthetic material , especially when risk factors such as advanced age and diabetes mellitus type 2 are present . aggressive treatment of infection is warranted and may lead to full recovery of renal function .

we report a case of a 72-year - old diabetic male who developed infection - related glomerulonephritis ( irgn ) in the setting of severe staphylococcus epidermidis infection . he required renal replacement therapy for 6 weeks , but had full recovery of his kidney function with aggressive treatment of the infection . while this pathogen has been previously implicated as the cause of shunt nephritis , it is exceptionally rare to be associated with irgn in the absence of a shunt or other prosthetic material .

the intrauterine existence of fetus is dependent on one vital organ the placenta . placenta is essential for maintenance of pregnancy and for promoting normal growth and development of fetus . it forms the morphological record of anatomical condition , intrauterine events and intrapartum events of gestation . pregnancy - induced hypertension ( pih ) is the leading cause of maternal mortality and is an important factor in fetal wastage . pregnancy complications like hypertension are reflected in placenta in a significant way both macroscopically and microscopically . several studies have shown that utero - placental blood flow is decreased in pih due to maternal vasospasm . this leads to constriction of fetal stem arteries and has been associated with the changes seen in the placenta of preeclamptic women . maternal vasospasm leads to fetal hypoxia and accordingly it may lead to fetal distress and fetal death . present study has been undertaken to record the data on the morphology , morphometry , and histology of placenta from mothers with pih and correlate the findings with the birth weight of the new born babies . this study was done to find out the morbid changes of the placenta of hypertensive mothers in comparison to normotensive mothers . as placenta is the mirror of maternal and fetal status , it reflects the changes due to maternal hypertension . the study was done in the department of anatomy in collaboration with the department of obstetrics and gynaecology , s.v.s medical college , a tertiary care hospital , mahabubnagar , andhra pradesh , during the period from october 2009 to october 2011 . the study was done in 100 placentas , which were collected from obstetrics and gynecology department . out of the 100 placentas collected , another 50 placentas were collected from preeclamptic and eclamptic cases and served as study group . the cases were divided into three groups , namely , normal , preeclampsia , and eclampsia group . the placenta with attached membranes and umbilical cord was collected soon after delivery , washed in running tap water , labeled , and then fixed with 10% formalin for 4 - 6 weeks . the size , shape , weight , thickness at centre , number of cotyledons , and site of insertion of umbilical cord were noted down . the birth weights of newborn babies were documented and feto - placental weight ratio was calculated . histo - pathological study of placenta was done and the slides were studied under light microscope . the statistical significance between the means of the control group and study groups were analyzed by using students unpaired the placenta with attached membranes and umbilical cord was collected soon after delivery , washed in running tap water , labeled , and then fixed with 10% formalin for 4 - 6 weeks . the size , shape , weight , thickness at centre , number of cotyledons , and site of insertion of umbilical cord were noted down . the birth weights of newborn babies were documented and feto - placental weight ratio was calculated . histo - pathological study of placenta was done and the slides were studied under light microscope . the statistical significance between the means of the control group and study groups were analyzed by using students unpaired from the study , it was observed that the weight of the placenta was less in preeclampsia and eclampsia when compared with normal placenta . the majority of placenta were oval ( 73% ) followed by round placenta ( 27% ) [ table 1 ] . the insertion of the umbilical cord central in 18% of cases and eccentric in 82% of cases . the number of cotyledons varied from 18 to 23 in all groups . comparison of morphological features of placenta in different groups the mean neonatal birth weight was more in normal pregnancy ( 3.14 kg ) . it was less in preeclamptic and eclamptic cases ( < 2.5 kg ) . the feto - placental weight ratio was significantly higher in the hypertensive group than in the control group [ table 1 ] . histological study of placenta showed significant number of syncytial knots , fibrinoid necrosis , areas of calcification and hyalinisation and areas of medial coat proliferation of medium sized blood vessels in the hypertensive group , whereas the control group showed normal histological features . in the present study , the weights of the placenta in study groups were below 500 g. the least weight recorded being 200 g. in the control group , majority of the placenta weighed more than 500 g , the heaviest being 650 g. the observations correlate well with the previous studies done by various workers . reported five cases of toxemia with placental weight less than 300 g. nobis and das , in their study , observed that the placental weight in toxemic cases varies from 279 to 407 g. bhatia et al , in their study , have shown reduced placental weight in severe toxemia , the lowest recorded was 280 g. the change in placental weight observed in the present study between the control group and study groups were statistically significant [ table 1 ] . a significant increase in syncytial knot formation in placental villi indicates the disturbance in the hormonal factors , which may probably lead to altered blood flow . according to robertson , the cause of reduction in blood flow is due to vasculopathies of spiral arteries , which in turn causes reduction in the weight of placenta . it has been recorded that maternal utero - placental blood flow is decreased in preeclampsia because of maternal vasospasm . reduced maternal utero - placental blood flow indirectly leads to constriction of fetal stem arteries . the preeclamptic women will have a lower mean gestation , so the proportion of fetal capillaries will be lower . this relative increase in fetal capillary volume with decrease in proportion of connective tissue will lead to smaller parenchymal volume leading to decrease in placental weight . in the present study , the average diameter of placenta in control group was 18.62 cm , in preeclamptic cases it was 17.33 cm , and in case of eclamptic cases it was 16.24 cm . cibils reported that placenta from pih cases were smaller than normal indicating an underlying pathological process interfering with the normal growth of placenta . the majority of cases showed eccentric insertion ( 82% ) and few showed central insertion ( 18% ) in both the control and study groups . whereas in the earlier studies by nobis and das , the pattern of cord insertion was central in 44.19% , eccentric in 42.17% , and battledore in 1.26% . the neonatal weight was significantly less in study groups when compared with control group ( p < 0.01 ) . the average weight was 3.14 kg in normal pregnancies , 2.44 kg in preeclampsia , and 2.29 kg in eclampsia cases . an earlier study by palaskar had shown the reduced mean weight of the neonates in cases of pih . the arrangement of intracotyledon vasculature is altered in hypertension resulting in low birth weight of the babies . also the reduction in the villous population will interfere with fetal nutrition and growth , leading to decrease in neonatal weight . in the present study , the average feto - placental weight ratio in normal pregnancy was 5.72 0.93 , 6.35 2.05 in preeclamptic cases , and 6.44 2.02 in eclamptic cases . the values corelate with the earlier study by majumdar et al . in the study group , the histology revealed various structural changes such as significant number of syncytial knots , areas of fibrinoid necrosis , areas of medial coat proliferation of medium sized blood vessels , areas of calcification , and areas of hyalinization [ figure 1 ] . a significant increase in syncytial knot formation in placental villi indicates the disturbance in the hormonal factors , which may probably lead to altered morphometry of placenta resulting in pih in the mother and to low birth weight babies . microscopic findings of localized fibrinoid necrosis , medial coat proliferation of arteries , and hyalinization depict the mosaicism of placenta and probably the aftermath of hypertension . again the mosaicism of the placenta probably leads to placental insufficiency and ultimately to fetal growth retardation , thus creating a vicious cycle . pih significantly affects the placenta by reducing its weight and dimensions . however , it does not have any effect on placental shape , umbilical cord insertion , and number of cotyledons on maternal surface . it induces histological changes such as , areas of syncytial knot formation , fibrinoid necrosis , calcified areas , hyalinised areas , and areas of medial coat proliferation of the blood vessels . these changes compromise utero - placental blood flow and significantly reduce the neonatal birth weight .

background : hypertension is one of the most common complication during pregnancy . it contributes significantly to maternal and perinatal morbidity and mortality . this study was designed to investigate the morphological and histopathological changes in placenta from pregnancies complicated with hypertension.objectives:to study the morbid changes in placenta in cases of pregnancy - induced hypertension ( pih ) and to correlate the findings with birth weight of new born babies in comparison with normotensive mothers.materials and methods : the study was done on 100 placentas , out of which 50 were collected from normotensive mothers and the remaining 50 from pih cases . all the placentas were studied morphologically and histologically . the birth weight of neonates was recorded.results:in the present study it was observed that weight and dimensions of placenta was less in study group when compared with control group . the mean neonatal birth weight was more in normal pregnancy and feto - placental weight ratio was significantly high in hypertensive group . histopathological study showed significant number of syncitial knots , areas of fibrinoid necrosis , hyalinization , calcification , and medial coat proliferation of medium sized blood vessels in hypertensive group.conclusion:pih significantly affects the placenta by reducing its weight and dimensions . these changes may cause placental insufficiency as a result of compromised utero - placental blood flow . therefore has an adverse affect on the neonatal birth weight . pih has definite influence on morphology , histology of placenta , and thus affects the growth of the fetus .

the frequency of such malocclusions is 4080% in modern societies , 4379% in nordic countries and 89.9% in turkish population . therefore , changes in facial musculature can give rise to skeletal irregularity . facial remodeling and growth the majority of brain maturation happens in the first 2 years of life . during this period for example , growing individuals exposed to different climate conditions , radiation may develop disorders related to brain damage . this view implies that the birth method could also affect the craniofacial skeleton . in the literature , there are limited number of studies evaluating the effect of the different forceps procedures on the different dental malocclusion types including dental arch dimensions , height of the hard plate , maxillary unilateral or bilateral cross - bite , overjet , open bite , mandibular protrusion , and labiolingual spread . a few studies used angle 's classification to evaluate the effects of birth trauma on dental malocclusion . since results of the study by cattaneo et al . include only descriptive statistic , they concluded that better understanding of the connections among osteopathic theory and the outcomes upon dental occlusion , more rigorous and meaningful evaluations are required . although many studies have been made about this issue , there are no studies on cephalometric evaluation of different birth types . so the theory of if patients born with cesarean and normal delivery might have different cephalometric values is still unclear . the objective of this study was to test the hypothesis that cephalometric variables of subjects with normal births are different from cesarean births . ninety patients were equally divided into normal and cesarean groups according to the birth method reported by their mothers . to eliminate the negative effects of age and gender , the clinical research ethical committee of gaziantep university approved the study ( november 5 , 2013 , approval number 364 ) and informed consent forms were taken from individuals . six measurements representing sagittal and vertical relationships were evaluated from pretreatment cephalograms in dolphin imaging software version 10.5 ( dolphin imaging and management solutions , charsworth , ca , usa ) by a single orthodontist ( m.g . ) : sella - nasion - a point angle ( sna ) : anteroposterior relationship of the maxilla with the anterior cranial basesn - b point angle ( snb ) : anteroposterior relationship of the mandible with the anterior cranial basea point - nasion - b point angle ( anb ) : anteroposterior relationship of the mandible with the maxillagonion - gnathion - sn plane angle ( gogn - sn ) : inclination of the mandibular plane in relation to the anterior cranial basefrankfort horizontal - mandibular plane angle ( fma ) : indicator of vertical growth . the increasing of this value indicates vertical growth pattern and also decreasing indicates horizontal growth patternwits value : indicator of anteroposterior disharmony between the maxilla and the mandible . sella - nasion - a point angle ( sna ) : anteroposterior relationship of the maxilla with the anterior cranial base sn - b point angle ( snb ) : anteroposterior relationship of the mandible with the anterior cranial base a point - nasion - b point angle ( anb ) : anteroposterior relationship of the mandible with the maxilla gonion - gnathion - sn plane angle ( gogn - sn ) : inclination of the mandibular plane in relation to the anterior cranial base frankfort horizontal - mandibular plane angle ( fma ) : indicator of vertical growth . the increasing of this value indicates vertical growth pattern and also decreasing indicates horizontal growth pattern wits value : indicator of anteroposterior disharmony between the maxilla and the mandible . student 's t - test and mann whitney u - test were used for normally and abnormally distributed variables , respectively . intraclass correlation coefficient ( icc ) and 95% confidence interval were used to test harmony of values and intrarater reliability . icc ranged from 0 to 1 , where 0 represented no agreement and 1 indicated perfect agreement . the mean age in both the groups was 13.98 2.19 years ( p = 1.000 ) . each group was composed of 21 ( 46.6% ) female and 24 ( 53.4% ) male ( p = 1.000 ) [ table 1 ] . age and gender characteristics of normal delivery and cesarean section groups anb angle and wits values were higher in the normal group , while sna angle , snb angle , fma , and gogn - sn angle values were higher in the cesarean group [ table 2 ] . the icc value of 0.855 suggested a high level of harmony between the anb angle and the wits values . the regression formula for this relationship was anb = 3.04 + 0.663 wits value ( estimated success rate of anb angle value = 0.796 ) . the big dilemma for prospective mothers and gynecologist is the decision of normal delivery or cesarean section . when analyzing studies in the literature , it was observed that normal delivery and cesarean deliveries have some advantages and disadvantages . some authors do not recommend normal vaginal delivery because of the possibility of intracranial hematoma , whereas others do not advocate cesarean delivery because of delayed lung liquid absorption . in addition , although there are many risks of these approaches , according to indications , both methods are routinely performed . recently , even numbers of cesarean section , depending on patient and doctor preferences , are higher than normal delivery . according to the world health organization , the worldwide cesarean rate is 15% , and even 3545% in countries such as australia , new zealand , and canada . the turkish society of obstetrics and gynaecology reported the cesarean rate as 5.7% in 1988 , 21% in 1998 , and over 45% in 2010 . previous studies have shown important of age and sex matching to eliminate the negative effects of a wide range of variations in terms of age and gender among the parameters , so the control and patient groups were also matched in this study . factors strictly related to the causes of the malocclusion are several ; finger sucking , biting or chewing foreign objects , cheek biting , prolonged pacifier sucking , traumas , genetic factors , dental hypodontia or hyperdontia , etc . according to the functional matrix hypothesis , the neurocranium and tongue are primarily responsible for malocclusion by altered muscular dynamics . season of birth , parental age , birth order , birth weight , characteristics of pregnancy , and type of delivery have been considered as secondary causes . forceps delivery arising from natality variables may cause an assumable disorder in two ways : alteration of cranial growth and alteration of suction - deglutition pattern . studied the effects of difficult forceps delivery on dental arch dimensions and occlusal development of children using dental models and concluded that this procedure is associated with later asymmetric occlusion . schoenwetter examined a group of patients with crossbite and found a high incidence of this malocclusion among those who had a forceps - assisted birth . contrarily , janerich and carlos found no association between occlusal characteristics and complications of pregnancy or delivery , including forceps delivery . although cattaneo et al . , who studied sagittal malocclusion and birth methods , stressed that none of their subjects with malocclusion had a normal birth , they did not examine the relationship between birth trauma and malocclusion cephalometrically , diminishing the clinical significance of the finding . this study did not reveal significant differences in cephalometric variables related to sagittal and vertical skeletal growth between the normal and the cesarean groups . it consists with this theory that pressure , which is occurred during delivery , may affect the craniofacial skeletal system . however , the results showed that there was no significant difference between different types of birth . wits and anb angle values , used to determine sagittal malocclusion , sometimes show different results of the anteroposterior relationship of the jaws . anb angle , defined by riedel in 1952 , was commonly used until wits value was determined by jacobson in 1976 . as the angle depends on cranial references points previous studies of the relationship between anb angle and wits value revealed varying results of their reliability . oktay found a high correlation but zamora et al . reported only a slight correlation . the present study has several limitations , especially the method of classification , ignoring birth duration and forceps delivery . further , the classification was based on maternal reports , and the sample size was small . future controlled trials conducted with larger samples are needed to support and extend the findings . this study seems to be the first - one to evaluate some cephalometric variables according to the birth method . according to results of this study ; the birth method does not seem to have a considerable effect on the development of the craniofacial skeletal system .

objective : the aim of this study was to compare cephalometric variables of subjects with normal and cesarean births.materials and methods : ninety age- and gender - matched patients , who were treated in gaziantep university , faculty of dentistry orthodontics department were equally divided into normal and cesarean groups according to the birth methods reported by their mothers . to eliminate the negative effects of being different in terms of age and gender among parameters , control , and patient groups were matched in the present study . pretreatment cephalometrics radiographs were used . six measurements representing sagittal and vertical relationships were evaluated from pretreatment cephalograms using dolphin imaging orthodontics software was used in this issue by an orthodontist . kolmogorov smirnov test , student 's t - test , and mann whitney u - test were used for statistical comparisons.results:a point - nasion - b point angle ( anb ) and wits values were higher in the normal group , while sella - nasion - a point angle , sella - nasion - b point angle , frankfort horizontal - mandibular plane angle , and gonion - gnathion - sn plane angle values were higher in the cesarean group . however , the groups showed no significant differences ( p > 0.05 ) . anb angle and wits values showed high correlation.conclusions:within the study limitations , the results suggest that the birth method may not have a considerable effect on the development of the craniofacial skeletal system .

interspinous devices ( isds ) are motion preservation systems that are claimed to alter favorably the movement and load transfer of a spinal - motion segment and to increase the space in the lateral recess and foramina.1,2,3,4,5 initial clinical results were promising;4,5 however , in recent studies mixed results have been reported.1,2 to assess the outcome and complication rate of a cohort of patients who underwent a diam isd implantation ( medtronic sofamor danek , switzerland ) in the short and intermediate postoperative periods . study design : retrospective cohort of all patients followed - up for 2 years or more after surgery . inclusion criteria : all patients with spinal claudication or radiculopathy , caused by spinal stenosis who were implanted with the diam isd ( medtronic sofamor danek , switzerland ) during 20062008 . other isds were excluded as a mean to reduce variability , as the insertion process is different for each isd and the methods of fixation are also different . 1 ) : sixty - eight patients with spinal claudication or radiculopathy due to spinal stenosis who underwent insertion of a diam isd ( total 91 isds ) were included in the study . patients ' comorbidities were documented ( ie , hypertension , osteoporosis , diabetes mellitus , and so on ) . the isd was implanted in 1 level for 52 patients ; 2 levels for 16 patients ; and 3 levels for 1 patient . forty - eight patients underwent an insertion of isd following a decompression procedure ( laminotomy , flavectomy , recess decompression , or foraminotomy ) . the isd was implanted according to published guidelines.6 outcomes : patients walking time ( in minutes ) before and after the procedure was assessed ( patients were asked how long can you walk until your back and leg symptoms make you stop or sit down ? ) . patient back and leg pain was assessed via a 010 cm visual analog scale ( vas ) before and after surgery . placement of isd was verified with a postoperative standing ap and lateral x - rays . descriptive statistical methods were used on the microsoft excel spreadsheet software for counts , rates , means , and standard deviations of demographic and disease - related data . a paired t test was used for comparing preoperative and postoperative vas scores and walking distance ; p < .05 was considered significant . for vas scores , improvements beyond accepted minimal clinically important difference ( 1.8 points ) were considered significant.7 regression analysis was performed to find any comorbidity as a predictor of failure . mean age was 57 years ( range , 4375 years ) . in 20 cases isd was implanted without decompression . average follow - up was 34 months ( range , 2352 months ) . in all but one case , mean vas back pain score decreased from 6.14 before the procedure to 2.87 after the procedure ( p < .05 , and significant according to mcid values ) , and vas leg score decreased from 8.9 to 1.45 after the procedure ( p < .05 , and significant according to mcid values ) . mean walking improved from 14.1 minutes before surgery to 125.77 minutes after surgery ( p < .05 ) . of 68 patients implanted with interspinous devices , 21 ( 32% ) had complications ( fig . nine complications ( 75% ) were unrelated to isd and 12 were directly related to isd ( table 2 ) . the average time to revision surgery was 21.6 months ( range , 638 months ) . the average age of patients who suffered from isd - related spinous process ( sp ) fractures was higher ( 69 years ) . regression analysis did not find any significance in any comorbidity toward failure of diam . x - rays of ap lumbar spine of a 78-year - old man before surgery . severe degenerative changes are seen and instability at the l3/l4 intervertebral disc ( 2b ) . a sagittal postoperative computed tomographic scan of the same patient indicating a fracture of the l4 spinous process between two diams that were placed in the l3/4 and l4/5 . arrow indicates the fracture ( the patient underwent decompression of these heights as well ) . sagittal views of a magnetic resonance imaging showing recurrent spinal stenosis ( arrows ) after the fracture . x - ray of ap lumbar spine of the patient after a revision surgery ; he had the diams removed and underwent formal transforaminal lumbar interbody fusion l3l5 . b lateral view of the lumbar spine of the same patient after transforaminal lumbar interbody fusion l3l5 . after 2.5 years , two - third of the patients who had surgery reported pain reduction and improved walking time . complications related to the decompression part of the procedure and wound infections were similar to other published data 9 . spinous process fractures were the most common complication related to isd ( 7.5% ) . at maximal follow - up , 40% of patients with sp fractures underwent revision surgery , compared with 10% in the whole series and 8% who did not have a fracture of the sp . the sp fractures occurred in older patients , and were most probably related to weaker bone and stiffer motion segments , reflecting an incorrect patient selection for the insertion of diam isd . the second- and third - year follow - up six patients developed recurrent claudication symptoms , most should not have been implanted with isd . the complication rate in other studies varies from 3.8% to close to 40% ( table 3 ) depending on follow - up duration . the current series identifies older patients at risk for sp fractures ; diam is contraindicated in these cases . strengths : this study consists of a large number of patients that underwent a specific isd implantation ( diam ) . limitations : intermediate - term study and lacking long - term outcome . only one isd device was evaluated , therefore results can only be generalized to this device . there was no control group receiving an alternative treatment , so this data does not establish efficacy or comparative safety of isd compared with alternative treatments . a long - term prospective outcome study comparing decompression with decompression with isd implantation is warranted . in most patients who underwent an implantation of diam isd had improved short - term outcome . six percent developed recurrent claudication symptoms in the second - year follow - up , 10.5% underwent revision surgery . in an older population other solutions , such as decompression surgery with or without fusion , should be sought for these patients . this study on interspinous devices has two shortcomings : it has no control group and it uses a retrospective format for data gathering . there also appeared to have been some selection bias as other interspinous devices were used during the same time frame at the study site . moreover , the decision to perform formal decompression surgery in addition to placement of the device seems to have been left to surgeon discretion . that stated , the study benefits from a relatively well - sized and followed - up cohort with no reported losses to follow - up . the authors were praised for their diligence in reporting complications and studying their impact on the patients thus raising the credibility of the study effort . in the end , the patients seemed to benefit reasonably well from surgeries reported in this series to warrant further investigation and not outrightly condemn the device . clearly , spinous process fractures in elderly patients with osteopenia seem to be noteworthy in the surgical decision - making process . based on the vast body of the literature , it appears reasonable to conclude that in suitably selected patients ( those without major instability , previous decompression surgery , and with adequate bone stock ) it is reasonable to conclude that there appears to be therapeutic equipoise regarding treatment consisting either of decompression and placement of interspinous spacer(s ) or suitable decompression surgery alone . this conclusion leads to the charge for investigators to start formal prospective testing of patients who receive a decompression surgery for stenosis alone or decompression in conjunction with placement of an appropriately selected interspinous spacer following neural element decompression . also , the time seems ripe for comparative testing of different devices and their respective complications for example , rigid devices and those that by virtue of their material design allow for a cushioning effect between the spinous processes .

study design : a retrospective cohort of 68 patients who underwent insertion of the diam ( medtronic sofamor danek , switzerland ) interspinous device ( isd ) during 20062008 at one medical center.objectives : to assess the short- and intermediate - term outcomes and complications associated with isd.methods : evaluation of files and all patients who underwent insertion of a diam isd was performed . patients walking distances and pain ( visual analog scale score ) were compared with data gathered before surgery . outcome and all complications related to isd have been identified and analyzed.results : all 68 patients were available for follow - up . mean follow - up was 34 months ( 2352 months ) . the average age was 57 ( 13 ) years . walking distance increased by 890% and patient 's pain score improved by 3.27 points on visual analog scale . twenty - one ( 32% ) of the 68 patients had perioperative or late complications . nine complications ( 75% ) were unrelated to isd and included 5 dura tears , 3 wound - related complications , and 1 transient ischemic attack . spinous process fractures occurred in 5 cases , leading to revision in 2 cases . in total , 7 of the patients required revision surgery . these patients were older , with an average age of 69 years.conclusion : the outcome of patients who had an implantation of the diam isd is good . in this cohort , 6% developed recurrent claudication symptoms in the second postoperative year . in an older population , the combination of softer bone and rigid stenosis increase the risk of spinous process fracture , resulting in failure and leading to revision surgery . other solutions should be sought for these patients.final class of evidence ( coe)-treatmentyesstudy design : rct cohort case control case seriesmethods concealed allocation ( rct ) intention to treat ( rct ) blinded / independent evaluation of primary outcome f / u 85% adequate sample sizecontrol for confoundingoverall class of evidenceivthe definiton of the different classes of evidence is available on page 55 .

multiplex pcr ( esensor respiratory viral panel ; genmark dx , carlsbad , ca , usa ) for patients seen at a major teaching hospital in alachua county indicated that > 95% of illnesses were caused by h3n2 strains . influenza a(h3n2 ) virus ha , neuraminidase ( na ) , and matrix ( m ) gene sequences from 5 specimens collected from patients in november 2014 were directly sequenced from the specimens , and corresponding first - passage viruses were isolated in mdck cells by using previously described primers ( 6,7 ) . these viruses were designated as a / gainesville ( h3n2 ) isolates 59 from 2014 ( e.g. , a / gnvl/05/2014 ) ( table 1 ) . for all , the consensus viral genomic sequences determined directly from clinical specimens and their matched virus isolates were identical . * the deduced ha major antigenic epitopes a and b1 of the 5 viruses isolated had some amino acids not found in the ha protein of vaccine strain a / texas/50/2012 ( h3n2 ) ( table 1 ) . no changes were observed for major antigenic epitopes b2 , c1 , c2 , d , and e. changes at the major antigenic epitopes included n144s , n145s , f159y , k160 t , n225d , and at other epitopes l3i and q311h ; those changes are characteristic of ha gene clade 3c.2a viruses ( 4 ) . substitutions at residues 144 and 160 have been associated with the loss and the gain , respectively , of possible n - linked glycosylation sites of the ha protein ( 8,9 ) . an h3n2 virus isolated in february 2014 in gainesville , designated a / gnvl/01/2014 ( h3n2 ) , was from a different ha gene clade ( table 1 ) , suggesting that the clade 3c.2a viruses were introduced locally later . the na proteins of the 5 viruses from november 2014 also differed from those of the northern hemisphere h3n2 vaccine strain at 3 amino acids , whereas the m proteins were identical . data on frequency of medically attended influenza - like illness ( ili ) for the 201415 influenza season were obtained from florida s electronic surveillance system for the early notification of community - based epidemics ( essence ) for alachua county ; the 13-county florida department of health region 3 ( 2010 population : 2.2 million ) , which includes alachua county ; and the state of florida ( 10,11 ) . ili - associated emergency department ( ed ) visits were defined as visits for which a chief complaint contained the word influenza or region 3 and florida are comparison areas , so they exclude alachua county data . for the 201415 influenza season ( september 28 , 2014may 23 , 2015 ) , the rate of reported ili for alachua county residents was 499 cases per 100,000 population . sixteen percent of cases were among children < 17 years of age , a significant increase over 201314 , when 11% of cases were among children in this age group ( p = 0.001 , pearson test , 2-tailed ) . the pattern for laboratory - confirmed influenza cases in our hospital ed was similar ; although the rate of confirmed influenza cases among adult ed patients did not increase , the rate of confirmed cases among pediatric ed patients increased significantly from 6/1,000 unique ed patients in 201314 to 43/1,000 in 201415 ( p<0.0001 , ) . alachua county has a nationally recognized school - based influenza vaccination program that administers live attenuated influenza vaccine ( flumist ; astrazeneca , wilmington , de , usa ) ; parenteral influenza vaccine is administered by private physicians ( 12 ) . since 2010 , the average overall influenza vaccination rate for children 017 years of age in alachua county has been approximately 45% . as previously reported ( 11 ) , this rate has correlated with a reduction in rates of ed visits for ili ( as reported through the florida essence surveillance system ) among children in alachua county , compared with those in florida region 3 and the state of florida . corresponding estimates of vaccine effectiveness ( relative reductions in risk ) in alachua county , by year , are shown in table 2 . accompanying the increase in cases among children for 201415 was a small but significant decrease in estimated effectiveness of vaccination for children in florida region 3 ( table 2 ) . * estimates are based on reports of influenza - like illness from emergency departments reported through florida s electronic surveillance system for the early notification of community - based epidemics . region 3 and florida are comparison areas , so they exclude alachua county data . as a marker of disease severity , we identified the number of patients at our hospital admitted to the medical intensive care unit ( micu ) because of influenza by querying the university of florida health integrated data repository for patients with international classification of diseases , ninth revision , diagnostic codes for influenza ( 487 ) or novel influenza ( 488 ) listed in the first 10 diagnoses . in the 201415 influenza season , 1.8% of micu patients carried the diagnosis of influenza , a significant reduction from the 4.8% of micu admissions in 201314 , when an h1n1 dominated ( p<0.0001 , fisher exact test , 2-tailed ) . the mean age for persons admitted to micu with influenza in 201415 was 60 years , compared with 50 years for 201314 ( p = 0.006 , mann - whitney u test , 2-tailed ) . seven of these micu patients died ; all were > 50 years of age ( mean 70 years ) . patient ages were significantly higher than for persons with fatal cases in 201314 ( mean 48 years ) ( p = 0.04 , mann - whitney u test , 2-tailed ) , with a significantly higher charleston co - morbidity index ( 4.9 vs. 2.4 , p = 0.04 , mann - whitney u test , 2-tailed ) . the predominant influenza strain in this community in 201314 was an h1n1 variant bearing the d225 g polymorphism , which was associated with more severe disease outside of elderly age groups ( 10 ) . rates of illness severe enough to warrant micu admission with the h3n2 clade 3c.2a strain circulating in 201415 were significantly lower than those with h1n1 in 201314 and occurred in a significantly older age group with a higher rate of co - morbidities , more closely matched observations from in the 201213 h3n2 influenza season . these findings highlight the substantial strain - related differences in virulence that occur from year to year and the importance of ongoing genetic monitoring of strains circulating within communities . we noted an increase in influenza incidence in children < 17 years of age in alachua county during 201415 . this increase was probably due , at least in part , to a decrease in vaccine effectiveness with the clade 3c.2a strain in this highly vaccinated population of children . our hospital - based ed and micu data use laboratory - confirmed cases , whereas the regional and state data and vaccine effectiveness calculations are based on ili data from the florida essence system , which are potentially less reliable . although we found data trends in the 2 systems to be consistent , our findings underscore the need for expanded surveillance of laboratory - confirmed cases statewide , particularly with the increasingly widespread distribution of clade 3c.2a strains in the americas and europe ( 13 ) . these issues might be particularly relevant in light of the recent world health organization recommendation to substitute the ha gene clade 3c.3a virus a / switzerland/9715293/2013 ( h3n2 ) ( rather than a clade 3c.2a virus ) for a / texas/50/2012 ( h3n2 ) in the 2015 vaccine for the northern hemisphere .

influenza a(h3n2 ) strains isolated during 201415 in alachua county , florida , usa , belonged to hemagglutinin gene clade 3c.2a . high rates of influenza - like illness and confirmed influenza cases in children were associated with a decrease in estimated vaccine effectiveness . illnesses were milder than in 201314 ; severe cases were concentrated in elderly patients with underlying diseases .

they include low dietary intake , conditions associated with decreased absorption or increased urinary phosphate excretion , and conditions associated with shifts in phosphate from the extracellular to intracellular fluid . the latter include various cellular uptake syndromes , in which hypophosphatemia develops as a result of phosphate consumption by rapidly proliferating cells.1,2 the association between hypophosphatemia and cytokines has recently been investigated , and some authors have reported that hypophosphatemia can be induced directly by certain cytokines.3,4 the eshap ( etoposide , methylprednisolone , cytarabine , and cisplatin ) protocol is an effective treatment for hodgkin s lymphoma,5,6 and the effect of this protocol on serum electrolytes has been reported previously in some individual observational studies . other electrolyte imbalances are seen mainly in patients receiving cisplatin . in a study published in 2012 , there was a significant decrease in serum electrolytes including magnesium , potassium , phosphorus , and calcium , following use of this agent.7 hypophosphatemia induced by eshap is not well described , and is rarely considered as a side effect of the chemotherapeutic agents in this protocol . herein , we report a case of severe hypophosphatemia concomitant with administration of the first cycle of the eshap protocol to a patient with hodgkin s lymphoma . a 51-year - old woman ( weight 55 kg , height 160 cm ) with a history of hypertension , hepatitis c infection , chronic liver disease with ascites , esophageal varices , and mild renal impairment , was admitted electively to the national centre for cancer care and research , doha , qatar , on april 22 , 2012 to receive her first cycle of salvage eshap protocol for treatment of recently relapsed hodgkin s lymphoma . her medications consisted of entecavir 1 mg once daily , propranolol 20 mg twice daily , spironolactone 50 mg once daily , allopurinol 100 mg once daily , furosemide 40 mg once daily , and lactulose 30 ml twice daily . on april 23 , 2012 she was started on the first dose of cycle 1 of the intravenous eshap protocol as follows : etoposide 40 mg / m / day on days 14 ; methylprednisolone 500 mg / day on days 14 ; cytarabine 2000 mg / m on day 5 ; and cisplatin 25 mg / m / day as a continuous infusion on days 14 . her laboratory values prior to , throughout , and 24 hours after finishing this cycle of chemotherapy were essentially normal ( table 1 ) , and she was discharged home on april 28 , 2012 ( day 6 of chemotherapy ) . two days later ( day 8 of chemotherapy ) she was readmitted with a temperature of 38.9c . at this time she had a normal complete blood count and electrolyte levels ( table 1 ) , and was started empirically on intravenous vancomycin 1 g every 12 hours and piperacillin - tazobactam 4.5 g every 8 hours . on day 10 ( 5 days after completion of treatment ) , she developed leukopenia and neutropenia ( white cell count 900/l and absolute neutrophil count 800/l ) , and her phosphorus level was 0.73 she was started on granulocyte colony - stimulating factor ( filgrastim 300 g subcutaneously once a day for 8 days ) , at which time her white cell count continued to drop and reached 200/l on day 13 ( 8 days after completion of treatment ) , and then started to recover , as shown in table 1 . the phosphorus level continued to drop , and on day 17 ( 12 days after completion of treatment ) reached a critical level of 0.34 mmol / l ( asymptomatic hypophosphatemia ) and potassium dropped to 2.4 mmol / l , although renal function and serum calcium were normal . she was given a 20 mmol intravenous potassium phosphate infusion on two successive days and was started on neutral phosphate 250 mg orally three times daily . her serum phosphate returned to normal after 4 days , and was maintained at 1.35 mmol / l after discontinuing supplementation . this report describes a patient with severe hypophosphatemia after administration of the first cycle of the eshap protocol and granulocyte colony - stimulating factor started on day 10 ( 5 days after completion of treatment ) to treat the chemotherapy - induced leukopenia and neutropenia . eshap is an effective salvage strategy for hodgkin s lymphoma , and is associated with an overall response rate of approximately 70%80%.8,9 the effect of this protocol on serum electrolytes has been reported previously by some individual observational studies , and magnesium has been the electrolyte most commonly mentioned . further , hypophosphatemia has been reported as a complication of cisplatin therapy , although has been usually asymptomatic.10 being infrequent complications , the exact cause of cisplatin - induced hypophosphatemia and hypobicarbonatemia is not known , but significant hypophosphatemia was observed in 67% of patients in one study , particularly in female patients.11 another phase ii study examined the effect of fludarabine , cytarabine , cyclophosphamide , cisplatin , and granulocyte macrophage colony - stimulating factor in patients with richter s syndrome and refractory lymphoproliferative disorders , and hypophosphatemia was reported in 10% of cases.11 the association between hypophosphatemia and cytokines has recently been investigated , and some authors have reported that hypophosphatemia can be induced directly by certain cytokines.3,4 cytokines are low molecular weight proteins and glycoproteins that are secreted principally by activated lymphocytes and macrophages , and have a wide range of functions in the hematopoietic and immune systems . it has been postulated that characteristic clinical and histopathological features of malignant lymphomas may be due to activation of cytokines . however , there are some conflicting and unreliable trends in interleukin-6 levels after chemotherapy , with persistently elevated levels seen in patients in clinical remission.12 various cytokines are associated with the development of hypophosphatemia . recent research has evaluated the interrelationship between cytokine release , rise in white cell count , and development of hypophosphatemia.4 the median time taken to reach the minimum phosphate level was 8 days . there was a significant correlation between day of the minimum phosphate level and day of maximum white cell count , and a significant correlation between the decrease in phosphate level and the increase in white blood cells.3,4 in the present case report , our patient developed asymptomatic hypophosphatemia starting on day 10 ( ie , 8 days after receiving chemotherapy and granulocyte colony - stimulating factor , which is known to be associated with release of cytokines and an increase in white cell count ) and showed a significant correlation between day of minimum phosphate level and day of maximum white cell count , along with a significant correlation between the decrease in phosphate level and increase in white cell count ( table 1 ) . cytokine levels were not measured , but the clinical findings in our patient were consistent with previously reported data . serious manifestations of hypophosphatemia were prevented by phosphate infusion , and recurrence of hypophosphatemia was prevented by oral supplementation , and addressing other factors that might have contributed to development of hypophosphatemia ( vitamin d , urinary phosphate excretion , parathyroid hormone , arterial blood gas analysis , or any other drug which might have aggravated the effect of cisplatin ) . using the naranjo scale for adverse drug reactions , we obtained a score of 7 ( probable adverse drug reaction , see table 2).13 based on this score and our clinical and investigation findings , we considered the possibility of severe hypophosphatemia being induced after the first cycle of the eshap protocol . in view of the critical level of hypophosphatemia seen in our patient , close monitoring of phosphate levels and consideration of supplementation is warranted with the eshap protocol , especially when it is used in combination with granulocyte colony - stimulating factor and diuretics . this is a novel finding in the sense that , to the authors knowledge , this side effect has not been reported previously . health care providers should be aware of this potential toxicity , and appropriate monitoring of patients should be implemented . patients receiving this protocol should have their serum phosphate levels monitored throughout treatment , because some would require phosphate supplementation in the second and third weeks after chemotherapy , taking into consideration the need to evaluate other potentially contributing factors , including concomitant medications , vitamin d levels , urinary phosphate excretion , parathyroid hormone , and arterial blood gas analysis .

the effect of the eshap ( etoposide , methylprednisolone , cytarabine , cisplatin ) salvage protocol on serum electrolytes has been previously reported by individual observational studies . the most commonly described electrolyte affected by the eshap protocol is magnesium . in addition , hypophosphatemia has been studied and reported as a complication of cisplatin therapy , although it is usually asymptomatic . this is a case report of a 51-year - old woman with relapsed hodgkin s lymphoma who developed severe hypophosphatemia following administration of the first cycle of the eshap protocol . the patient started to develop gradually decreasing phosphate levels 2 weeks after receiving chemotherapy , which needed to be corrected by phosphate supplementation . this case report raises concern regarding hypophosphatemia as a possible side effect of the eshap protocol and points to a need for close monitoring , taking into consideration vitamin d levels , urinary phosphate excretion , parathyroid hormone levels , and arterial blood gas analysis to rule out other contributing factors . health care providers should be made aware of this possible toxicity . critical monitoring of phosphate levels and considering supplementation is warranted with the eshap protocol , especially when it is used in combination with granulocyte colony - stimulating factor and diuretics , to prevent such possible hypophosphatemia . further investigations may be required to confirm and evaluate the significance of this type of toxicity .

polymorphonuclear leukocytes ( pmns ) play an important role in host defense against microbial infections . the microbicidal mechanism consists of phagocytosis of pathogens , production and subsequent release of reactive oxygen species ( ros ) and bactericidal proteins to phagosomes . the process involves activation of nadph oxidase ( nox ) , which catalyzes the reduction of oxygen molecular to o2 at the expense of nadph in phagocytes [ 13 ] . noxs are a group of plasma membrane - associated multicomponent enzymes consisting of at least two components bound to plasma membrane ( gp91 and p22 that together form the flavocytochrome b558 ) , and three cytosolic components ( p47 , p67 , and p40 ) , and a small gtpase rac . in resting pmns , noxs are dormant and their components separately exist in the membrane and in the cytosol . once pmns are primed by appropriate stimuli , noxs are activated to produce o2 by association of these cytosolic components with the plasma or phagosome membrane components [ 58 ] . besides the bactericidal action as a beneficial effect , the uncontrolled production of ros by phagocytic granulocytes may lead to crippling disorders such as shock and inflammation . phorbol 12-myristate 13-acetate ( pma , fig . 1 ) , a potent activator of protein kinase c ( pkc ) , induces the phosphorylation of p47 and subsequent o2 production by the assembled nox components . more in detail , phosphorylation of proteins plays an essential role in the regulation of nox activity , and the activation of pkc with pma promotes the phosphorylation of serine and threonine residues of the p47 and its translocation to the plasma membrane [ 1113 ] . the respiratory burst is accompanied by tyrosine phosphorylation in cytosolic and membrane proteins , and it is also well known that tyrosine phosphorylation of proteins occurs during priming of pmns . as shown in fig . 1 , a side chain group of pma is myristic acid ( mya ) , a 14-carbon , straight chain saturated fatty acid . mya is mainly contained in vegetable oils such as coconut oil and palm oil , and likely affects lipid metabolism such as hypercholesterolemia [ 1618 ] , i.e. mya causes high ldl cholesterol and apob levels and low hdl to ldl ratios in healthy men and women , a positive regression between the plasma cholesterol level and the dietary level of mya was observed in hamsters , and incorporation of trimyristin in the oil resulted in marked rise in serum cholesterol of rats . in term of oxidative metabolism of pmns , it was reported that mya has an ability to stimulate the generation of o2 from human neutrophils . it was reported that mya induces the hydrolysis of phosphatidylcholine leading to generation of arachidonic acid ( aa ) . aa when added with membrane protein separated from bovine pmns can activate nox of bovine pmns . in addition , it was reported that apocynin ( a specific inhibitor of nadph oxidase ) suppressed this stimuli ( including mya ) -dependent ros generation of undifferentiated hl-60 cells . thus , mya may prime pmns through two routes , one is nox activated by aa from phosphatidylcholine and the other is direct effect on nox . thus , to assess the effect of mya , when absorbed into the circulation , on ros generation , we need to estimate the potency of aa to generate ros in addition to the potency of mya itself . these findings tempted us to compare the stimulative effect of mya to release ros with that of pma , and to examine the stimulative effect of aa as an indirect effect of mya . in this study , we examined stimuli - dependent ros release from human pmns by applying electron paramagnetic resonance ( epr)-spin - trapping method . reagents were purchased from the following sources : dextran , pma , mya and diethylenetriamine - n , n , n',n'',n''-pentaacetic acid ( dtpa ) from wako pure chemical industries ( osaka , japan ) , aa from icn biomedicals , inc . ( costa mesa , ca ) , superoxide dismutase ( sod from bovine erythrocytes ) and 4-hydroxyl-2,2,6,6-tetrametylpiperidin-1-oxyl ( tempol ) from sigma - aldrich ( st . lous , mo ) , ficoll - paque plus from amersham biosciences ( buckinghamshire , uk ) and 5,5-dimethyl-1-pyrroline - n - oxide ( dmpo ) from labotec inc . pmns were prepared from the blood by density gradient centrifugation using a ficoll - paque plus ( d = 1.077 ) following dextran sedimentation as previously described . after the pellet of pmns were subjected to rapid hypotonic lysis of erythrocyte , the cells were suspended in hank s balanced salt solution ( hbss ) to be 1.0 10 cell / ml . pma and mya were dissolved in dimethyl sulfoxide ( dmso ) to be 0.80 to 4.0 mm . dtpa was dissolved in 0.1 m phosphate buffer solution ( pb , ph 7.4 ) to be 20 mm , sod was to be 5000 u / ml in pb , and dmpo was to be 2.25 m in hbss . one hundred and twenty l of cell suspension was mixed with 16 l of dmpo and 16 l of dtpa solution . after addition of 8 l of pma , mya or aa , the resultant mixture was transferred to a quartz flat epr cell within 40 s. epr spectra of dmpo spin adducts were recorded at given times . the measurement conditions for epr ( jes - fa100 , jeol , tokyo , japan ) were as follows : scan rate , 10 mt / min ; scan field , 335.5 5 mt ; modulation width , 0.1 mt ; modulation frequency , 100 khz ; time constant , 0.03 s ; microwave power , 8 mw ; and microwave frequency , 9.5 ghz . peak areas of epr spectra of dmpo spin adducts , which are compensated by the peak area of mn , were compared with those of the given concentrations of tempol standard . statistical significances between the two mean values of each time point were assessed by student s t test or welch t test following analysis of variance . reagents were purchased from the following sources : dextran , pma , mya and diethylenetriamine - n , n , n',n'',n''-pentaacetic acid ( dtpa ) from wako pure chemical industries ( osaka , japan ) , aa from icn biomedicals , inc . ( costa mesa , ca ) , superoxide dismutase ( sod from bovine erythrocytes ) and 4-hydroxyl-2,2,6,6-tetrametylpiperidin-1-oxyl ( tempol ) from sigma - aldrich ( st . lous , mo ) , ficoll - paque plus from amersham biosciences ( buckinghamshire , uk ) and 5,5-dimethyl-1-pyrroline - n - oxide ( dmpo ) from labotec inc . pmns were prepared from the blood by density gradient centrifugation using a ficoll - paque plus ( d = 1.077 ) following dextran sedimentation as previously described . after the pellet of pmns were subjected to rapid hypotonic lysis of erythrocyte , the cells were suspended in hank s balanced salt solution ( hbss ) to be 1.0 10 cell / ml . pma and mya were dissolved in dimethyl sulfoxide ( dmso ) to be 0.80 to 4.0 mm . dtpa was dissolved in 0.1 m phosphate buffer solution ( pb , ph 7.4 ) to be 20 mm , sod was to be 5000 u / ml in pb , and dmpo was to be 2.25 m in hbss . one hundred and twenty l of cell suspension was mixed with 16 l of dmpo and 16 l of dtpa solution . after addition of 8 l of pma , mya or aa , the resultant mixture was transferred to a quartz flat epr cell within 40 s. epr spectra of dmpo spin adducts were recorded at given times . the measurement conditions for epr ( jes - fa100 , jeol , tokyo , japan ) were as follows : scan rate , 10 mt / min ; scan field , 335.5 5 mt ; modulation width , 0.1 mt ; modulation frequency , 100 khz ; time constant , 0.03 s ; microwave power , 8 mw ; and microwave frequency , 9.5 ghz . peak areas of epr spectra of dmpo spin adducts , which are compensated by the peak area of mn , were compared with those of the given concentrations of tempol standard . statistical significances between the two mean values of each time point were assessed by student s t test or welch t test following analysis of variance . fig . 2 shows the typical epr spectra of dmpo spin adducts of oxygen radicals generated from human pmns stimulated by pma or mya . as shown in fig . 2a , multiple - lines of epr spectra of human pmns primed by pma were detected . the hyperfine coupling constants ( hfcc ) of a = 1.48 and a = 1.48 mt ( closed circle ) at the four - line spectrum were typical dmpo spin adducts of oh ( dmpo - oh ) [ 22 , 23 ] , and those of a = 1.425 , a = 1.145 and a = 0.124 ( open circle ) were dmpo spin aducts of o2 ( dmpo - ooh ) [ 21 , 22 ] . 2b shows the representative epr spectra obtained from human pmns primed by mya . as is the case with fig . 2a , spin adducts of dmpo - oh and dmpo - ooh were observed , suggesting that mya can stimulate human pmns to release o2 and oh . to confirm that the dmpo - ooh was derived from o2 , the pmns were treated with sod , a potent o2 scavenger , prior to pma and mya stimulation . 2c and d show characteristic epr spectra of dmpo - oh obtained from pmns primed with pma and mya following sod treatment , respectively . since the twelve - line spectrum with the hfcc of a = 1.425 , a = 1.145 and a = 0.124 ( open circle ) was completely disappeared in either of fig . 2c and d , these spectra was derived from spin adduct of dmpo and o2 . 3a shows time course changes in dmpo - ooh production after the addition of pma , and of mya to be a concentration of 81 m . apparently mya stimulated pmns to produce o2 more strongly than did pma when the same concentrations were added . 3b shows time course changes in dmpo - oh production after the addition of pma , and mya to be a concentration of 81 m , indicating that oh production was time - dependently increased by either pma or mya . similar to the case of o2 , mya stimulated pmns to produce oh more strongly than did pma when the same concentrations were added . these results clearly showed that mya has an ability to prime human pmns to produce oxygen radicals such as o2 more potently than pma . it was reported that mya induces chemiluminescence of human promyelocytic leukemia cells with a luminol analogue l-012 . however , qualitative analysis of ros has not been conducted yet because chemiluminescence is induced by various ros . on the other hands , the epr spin - trapping method could detect o2 and oh simultaneously as dmpo - spin adducts as shown in our study . 4 shows the typical epr spectra of dmpo - ooh and dmpo - oh by human pmns with 81 m mya , 150 m aa , and 1.5 mm aa . the epr spectra were observed at 8 min after additions of mya or aa . these findings show that aa can also prime human pmns to relerase o2 and oh , even though the potency is weaker than that of mya . as for the mechanism by which aa primes pmns , it was reported that aa activates nox and proton channels of dormant neutrophils . 5 . unlike c5a and n - formyl - l - methionyl - l - leucyl - l - phenylalanine , both of which can stimulate pmns to produce o2 by inducing calcium ( ca ) influx , mya - functions , like pma - functions , bypass ca influx since it has been reported that mya induces o2 production from human neutrophils in the absence of ca and magnesium [ 19 , 26 ] . although the potency of aa to stimulate the release of ros is much weaker than that of mya , the possibility of involvement of aa to the effect of mya when absorbed into the circulation should be considered . our study shows that mya is a more potent activator of pmns than pma , and this fact calls attention that too much intake of mya can lead to crippling effect through uncontrolled production of ros . we found that mya is a stronger inducer of o2 and oh generation by pmns than pma . mya is mainly contained in vegetable oils and likely affects lipid metabolism [ 1618 ] . too much intake of mya - rich vegetable oil may work as an inducer of pmns activation , which may lead to undesirable conditions of the body . in the future study

myristic acid ( mya ) , which is a saturated fatty acid ( c14:0 ) and a side chain of phorbol 12-myristate 13-acetate ( pma ) , was examined if mya stimulates human polymorphonuclear leukocytes ( pmns ) to release oxygen radicals comparable to pma by applying electron paramagnetic resonance ( epr)-spin - trapping method . when mya was added to isolated human pmns , spin adducts of 5,5-dimethyl-1-pyrroline - n - oxide ( dmpo)-oh and dmpo - ooh were time - dependently observed . the amounts of these spin adducts were larger than those of pmns stimulated by pma . these results clearly show that mya is more potent agent to prime human pmns than pma , in a point of view of not only o2 but also oh production . this fact calls attention that too much intake of mya that is known to be contained vegetable oils can lead to crippling effect through uncontrolled production of reactive oxygen species .

persistent left superior vena cava ( plsvc ) is one of the most common venous anormaly of the thorax . however , the incidence is in less than 0.5% in the general population but occurs in approximately 4% of patients with congenital heart disease.1 ) sinus venosus atrial septal defect ( svd ) accounts for 4 - 11% of all atrial septal defect ( asd ) and partial anomalous pulmonary venous connection ( papvc ) is present in about 90% of patients with svd . anomalies of systemic venous connection are usually found incidentally in asymptomatic patients , but their identification is sometimes crucial especially when cardiac or abdominal aorta surgery is planned . we present a case of a complex anomaly of systemic and pulmonary venous return associated with svd which was detected by computed tomography ( ct ) pulmonary angiography and echocardiography . modern imaging techniques are not only useful for detecting congenital cardiac defects but also for detecting systemic and pulmonary venous connection anomalies . this case demonstrates the importance of knowledge of the anatomical basis of venous connection and identification of one lesion should prompt an appropriate investigation of other potential anomalies that may be less obvious . a 41-year - old man was admitted to the hospital because of palpitation and exertional dyspnea . on auscultation , fixed splitting of the second heart sound and a systolic murmur over the pulmonary valve area were heard . transthoracic echocardiography ( tte ) showed enlargement of the right ventricle and an extremely dilated coronary sinus with normal function of both ventricles ( fig . 1a ) . on the second day of admission , we performed a ct pulmonary angiography . ct also revealed an asd with anomalous return of the right superior pulmonary vein to the right superior vena cava ( svc ) ( fig . a right arm peripheral vein was injected with agitated saline , and normal opacification was noted in the right atrium , followed by opacification of the right ventricle ( fig . next , the left arm peripheral vein was injected with agitated saline and abnormal opacification of the coronary sinus was first noted , followed by opacification of the right atrium and then right ventricle ( fig . coronary ct angiography with 3-dimensional reconstruction demonstrated a more detailed structure of plsvc drainage into the right atrium via a dilated coronary sinus ( fig . five months later , follow - up transthoracic echocardiography showed near - normalization of the right ventricular and coronary sinus size . plsvc occurs in approximately 0.3 - 0.5% of the general population and characteristically drains into the coronary sinus . during and after embryonic development of svc , svc develops on the right side from a portion of the right anterior cardinal vein . on the left side , part of the left anterior cardinal vein undergo normal regression to form the ligament of the left vena cava.1 ) plsvc results from the persistence of the left anterior cardinal vein . usually , plsvc is asymptomatic and discovered incidentally during imaging study and pacemaker implantation or central catheterization but sometimes their elucidation is crucial especially during cardiovascular surgery.2 ) plsvc should be considered whenever a dilated coronary sinus is identified at echocardiography and the diagnosis could be confirmed by saline contrast echocardiography.3 ) other modern imaging modalities such as ct or magnetic resonance imaging ( mri ) can be used to confirm the diagnosis . in our case , we could not consider the presence of plsvc before performing ct pulmonary angiography just because of the focus on volume overload of right - sided heart chambers . we performed a contrast echocardiography based on the information obtained from ct pulmonary angiography . in our case , it is estimated that 10 - 15% of patients have an asd and approximately 85% of papvc are associated with svd.4)5 ) usually , the diagnosis of papvc can be made by echocardiography , and cardiac catheterization along with angiography is often performed for confirmation of the diagnosis . nowadays , ct , mri and tee with contrast examination are considered as sensitive methods for the detection of papvc.6 ) in our case , the diagnosis of papvc was missed on routine tte , and a definitive diagnosis of papvc could be made on ct pulmonary angiography . some authors have previously reported a combined anomaly of systemic and pulmonary venous return associated with svd.7)8 ) these authors especially emphasized the importance of new imaging modalities in diagnosing complex anomaly of systemic and pulmonary venous return associated with svd . also in our case , ct made a definitive diagnosis of the anomaly and provided more detailed structural information . however , this case report also illustrated that careful echocardiographic examination should be performed using several windows and even contrast for diagnosing the anomalies of systemic and pulmonary venous return combined with congenital heart disease . and consideration is required when the case has accompanying cardiac abnormalities besides plsvc such as an asd , when coronary sinus is extremely dilated and it is coexisting with enlargement of right ventricle .

we present a case of persistent left superior vena cava , anomalous right pulmonary venous connection to the right - sided superior vena cava and sinus venosus atrial septal defect detected by computed tomography ( ct ) pulmonary angiography and echocardiography . these defects were surgically corrected using a double - patch technique . in fact , ct can provide anatomical information about a complex anomaly in the systemic and pulmonary vasculatures . though modern imaging techniques are useful for detecting complex cardiovascular disease , careful echocardiographic examination should be performed to diagnose complex cardiac anomalies .

first , a person must have symptoms severe enough for medical care ( multiplier 1 ) . second , the physician must collect patients specimens ( multiplier 2 ) and forward them for testing by bacterial culture ( multiplier 3 ) . third , the sample test result must be positive ( multiplier 4 ) , and the confirmed case must be reported ( multiplier 5 ) ( 2,7,8 ) . to obtain multiplier 1 , we conducted a 12-month population - based household survey during march 1 , 2012february 28 , 2013 ( approved by the ethics committee of guangdong cdc ) . respondents were randomly selected from 4 districts in western , eastern , and central guangdong province . we used a standard questionnaire to collect information about diarrhea in the previous 4 weeks . the incidence rate of diarrhea was 0.1081 ( 95% ci 0.10040.1158 ) episodes / person - year ; 38.6% of the household survey respondents with diarrhea sought medical care . multipliers 2 and 3 were based on data from sentinel hospitals and comprised the overall number of diarrhea cases , samples collected , and samples submitted for culture during the year . a total of 75,583 ( 45.3% ) samples of 166,729 registered diarrhea cases in the sentinel hospitals were collected , of which 22,577 ( 29.9% ) were tested . laboratories of sentinel hospitals cultured samples for salmonella in accordance with standard protocol provided by the national reference laboratory by using macconkey agar as plating medium . according to a proficiency testing program , the numbers of salmonella isolates identified and reported to nndrs as nts infectious diarrhea by all sentinel hospitals yielded the proportion of cases reported ( 648/1,061 , 61.1% ) ( multiplier 5 ) . based passive surveillance system , multiplier 1 was the same as for active surveillance . according to a comparison with samples from the submission proportion in a survey of physician - diagnosed diarrhea in guangdong province during 2009 ( mann - whitney test , p = 0.246 ) ( 11 ) , and a comparison between medical institutions that charged and did not charge for testing ( kolmogorov - smirnov test , p = 0.837 ) , the proportion of samples submitted and tested from active surveillance were also used as estimates of passive surveillance . the average test sensitivity of sentinel laboratories before active surveillance began was used as an estimate of all medical institutions ( i.e. , the sensitivity of passive surveillance [ 48.2% ] ) . using numbers of salmonella isolates in guangdong province from laboratory data , and number of reported nts cases by all medical institutions , we determined the proportion of reported nts was 9.6% ( 991/10,360 ) . thus , for each reported nts case under passive surveillance , 414.8 cases actually occurred . multipliers of 5 age groups also were presented ( table 1 ) . to generate a more robust estimate , we conducted uncertainty and sensitivity analyses ( online technical appendix , http://wwwnc.cdc.gov/eid/article/22/4/15-1372-techapp1.pdf ) on passive surveillance data using monte carlo simulation ( @risk 6.0 ; palisade , ithaca , ny , usa ) ( 12 ) . we used distribution to describe the uncertainty of proportions and negative binominal distribution to estimate the number of cases . the uncertainty analysis model predicted a 411.9 ( 95% ci 308.4592.7 ) overall multiplier and estimated that 408,499 ( 95% ci 302,899591,901 ) salmonella cases occurred per year when the overall multiplier was applied to the 991 reported nts cases , resulting in 391.6 ( 95% ci 290.3567.4 ) cases/100,000 persons in 2012 . the rank correlation of various factors in the model showed that patients seeking medical care provided the highest uncertainty in the overall estimate ( influence rate 96% ) ( figure ) . rank correlations for the total number of nontyphoidal salmonella cases in the population ( tornado diagram ) , guangdong province , china , 2012 . our estimated nts incidence was lower than the incidence in china as determined from a literature review ( 626.5 cases/100,000 persons ) ( 13 ) but close to that in the united states ( 352.1 cases/100,000 persons ) ( 3 ) . however , incidences for persons < 5 years of age and 524 years of age in our study were higher than those for persons in china and the united states , highlighting that salmonella represents a major health problem in guangdong province , especially among younger persons . our estimated active surveillance rate ( 35.8 ) of nts infections per reported case is similar to estimates in the united states ( 38.6 and 39 ) ( 2,10 ) but different from those for england ( 3.2 ) , jordan ( 278 ) , and japan ( 63 ) ( 7,8,14 ) . such differences might be due to differences in methods used and to actual differences in salmonella infections . with fewer missing cases and less underestimation , active surveillance has lower overall multipliers than passive surveillance , indicating smaller surveillance artifacts and more accurate incidence estimate and presents remarkable advantages over passive surveillance . the estimate for active surveillance also showed that if we seek to reduce uncertainty in the overall estimate , we should first focus on encouraging patients to seek medical care . our study provides policymakers in china with a reference for the importance of salmonella incidence and calls for balanced surveillance on both foodborne infections and foods and enlarging active surveillance scales . more surveillance guidelines need to be developed to help physicians identify timing of sampling , tests , and performance . laws requiring reporting of foodborne diseases and pathogens need to be enacted to increase quantity and quality of reporting . the result suggests that to increase care seeking and sample submission , government health insurance schemes should be further developed to cover diagnostic tests and treatments of diseases of public health significance . uncertainty and sensitivity analysis and study limitations for a study of nontyphoidal salmonella infection , guangdong province , china , 2012 .

we used active and passive surveillance to estimate nontyphoidal salmonella ( nts ) infection during 2012 in guangdong province , china . under passive surveillance , for every reported nts infection , an estimated 414.8 cases occurred annually . under active surveillance , an estimated 35.8 cases occurred . active surveillance provides remarkable advantages in incidence estimate .

the enzymes that synthesize pe in yeast , worms , and flies have mammalian counterparts . first , lodged in the inner membrane , the enzyme phosphatidylserine decarboxylase converts phosphatidylserine to pe ( fig . 1 ) . pe synthesized in mitochondria can spread via mitochondrial associated membranes to other cellular compartments . second , the kennedy pathway consists of 3 enzymes that convert the metabolite ethanolamine into pe ; the last enzyme in this pathway is embedded in the membranes of the endoplasmic reticulum ( er ) ( fig . phosphatidylserine decarboxylase may synthesize most of the pe , whereas in other cells the kennedy pathway may synthesize the most of the pe . figure 1.scheme for phosphatidylethanolamine ( pe ) synthesis in mitochondria and the endoplasmic reticulum ( er ) in yeast . cdp , cytidine diphosphate ; cho , choline ; eta , ethanolamine ; p - eta / p - cho , phosphorylated eta / choline ; pm , plasma membrane . eki1 , eta kinase ; ect1 , eta - phosphate cytidylytransferase ; ept1 , eta / cho phosphotransferase . scheme for phosphatidylethanolamine ( pe ) synthesis in mitochondria and the endoplasmic reticulum ( er ) in yeast . cdp , cytidine diphosphate ; cho , choline ; eta , ethanolamine ; p - eta / p - cho , phosphorylated eta / choline ; pm , plasma membrane . eki1 , eta kinase ; ect1 , eta - phosphate cytidylytransferase ; ept1 , eta / cho phosphotransferase . we found that the psd1 deletion mutant has low pe , intense er stress , and a slight growth defect compared to wild - type cells . when -synuclein is expressed in these pe - deficient cells , -synuclein forms intracytoplasmic foci , the level of -synuclein is 3-fold higher than identically treated wild - type cells , and growth is severely inhibited . treating such cells with exogenous ethanolamine boosted the level of pe through the kennedy pathway , which eliminated these various defects due to initially low pe . these findings were replicated in transgenic c. elegans worms in which -synuclein was expressed in each of the worm 's 6 dopaminergic neurons . such worms exhibit a gradual age - dependent loss ( t1/2 = 3.6 d ) of the dopaminergic neurons due to the expression of -synuclein . rnai depletion of psd-1 in neurons that express -synuclein accelerated the age - dependent cell loss ( t1/2 = 2.3 d ) , whereas rnai depletion of psd-1 in neurons lacking a - syn expression did not affect cell loss over time . ethanolamine rescued cell loss due to the expression of -synuclein in the neurons with psd-1 depleted ( t1/2 = 7.9 d ) . ethanolamine even rescued the age - dependent degeneration that occurs in worms that express -synuclein but without rnai depletion of psd-1 . given that stimulating pe synthesis through the kennedy pathway ameliorates -synuclein toxicity in worm neurons , we asked whether the kennedy pathway might be associated with other neurological diseases . a class of drosophila mutants that exhibit a transient paralysis following a brief mechanical shock was identified in a behavioral screen and reported in 1971 . subjecting eas flies to a brief mechanical shock ( bang or vortex ) triggers a transitory seizure that persists for several seconds , but then the flies recover . tanouye and colleagues later characterized the eas mutant and showed that the paralytic phenotype was due to a mutation in the gene for ethanolamine kinase , which phosphorylates ethanolamine to yield phosphoethanolamine ( fig . 1 ) . biochemical analysis of whole fly lipid extracts showed that the eas flies lacked ethanolamine kinase activity and had a deficit of pe compared to wild type flies . low pe in the eas mutant might cause membrane leakiness or decrease ion channel activity , which in either case leads to the transient paralytic phenotype . we suggest that chronically low pe in the membranes of the endoplasmic reticulum will likely lead to chronic stress in this compartment , which , over time , can lead to neuronal failure.table 1 shows the effects of low pe on different organisms . table 1.low pe harms membranesgenecommentsreferencephosphatidylserine decarboxylaseyeast : deletion of psd1 causes intense er stress , -synuclein foci , protein trafficking defects , pe / pc ratio decreases by 70% ( vs wild - type ) . eta rescues.worms : knocking down psd-1 with rnai enhances the toxicity of -synuclein expressed in worm neurons ; eta rescues . eta also protects from -synuclein - induced neurodegeneration in the absence of psd-1 knockdown.ref . 6ethanolamine kinaseflies : i ) null - activity mutant of eas : a brief mechanical shock induces transient paralysis . pe decreases , and the pe / pc ratio decreases by 18% ( vs wild - type ) . ii ) null - activity mutant of eas : increases triglycerides and causes tachycardia , cardiac relaxation problems , and srebp activation.i ) ref . 8 ii ) ref . if lipid disequilibrium is indeed a problem for pd and/or epilepsy , then one would expect that lipid - related genes would be identified from sequencing studies . mutations in fasn ( fatty acid synthase ) and plcb1 ( phospholipase c isoform 1 ) were recently identified from a small number of individuals with a severe form of childhood epilepsy . mutations in gba ( codes for enzyme that cleaves glucose from glucocerebroside ) have been linked to a higher risk of pd , and single nucleotide polymorphisms in pla2g6 ( calcium - independent phospholipase a2 ) and in srebp-1 ( sterol - regulatory binding protein ) have been identified in large genome - wide association studies of individuals with pd . curiously , the enzymes coded by plcb1 and pla2g6 degrade phospholipids to yield important lipid second messengers . while these sequencing results are tantalizing , clearly more sequencing needs to be done to establish whether mutations in lipid metabolism genes are significant risk factors for epilepsy and pd . in conclusion , how a disruption in phospholipid homeostasis alters the function of the endoplasmic reticulum and how it triggers protein aggregation are relatively unexplored areas . a deeper understanding of the role of phospholipid homeostasis can come about from lipidomic profiling by mass spectrometry of postmortem brain tissue and from magnetic resonance imaging of the brain to detect phospholipid metabolites combined with other imaging techniques to detect the proteins such as aggregated -synuclein .

we recently reported that knocking down the enzyme phosphatidylserine decarboxylase , which synthesizes the phospholipid phosphatidylethanolamine ( pe ) in mitochondria , perturbs the homeostasis of the human parkinson disease ( pd ) protein -synuclein ( expressed in yeast or worms ) . in yeast , low pe in the psd1 deletion mutant induces -synuclein to enter cytoplasmic foci , the level of this protein increases 3-fold compared to wild - type cells , and the mutant cells are severely sick . the metabolite ethanolamine protects both yeast and worms from the deleterious synergistic effects of low mitochondrial pe and -synuclein . here we highlight a drosophila mutant called easily shocked thought to be a model of epilepsy that can not use ethanolamine to synthesize pe . we also highlight recently identified mutated genes associated with defective lipid metabolism in pd and epilepsy patients . we propose that disruptions in lipid homeostasis ( synthesis and degradation ) may be responsible for some cases of pd and epilepsy .

a 15-year - old female developed fever , stinging eyes and headache , followed one day later by sudden appearance of flaccid blisters on the face with subsequent dissemination to more than 70% of the whole integument and development of mucosal erosions . thirty days before , she had been operated on the nose and medicated with cefuroxime ( for 8 days ) , paracetamol ( for approx . 10 days ) and metamizol ( for approx . 10 days ) , the latter of which was later identified by lymphocyte transformation test as the most likely causative compound . four days before admission , she had taken acetylsalicylic acid and paracetamol for flu - like symptoms including conjunctival irritation and rhinitis . upon physical evaluation , disseminated flaccid blisters filled with serous liquid were present on 70% of her skin surface . her eye- , mouth- , pharyngeal- and genital mucosae were also affected by erosive lesions . she received intravenous immunoglobulins ( ivigs ) , in total 3 g / kg body weight over three consecutive days , hydration and nutritional support as well as careful wound care . topical therapy included silver - coated dressings on erosions , and after reepithelialization , skin washes with water and wax emulsion were performed , followed by the application of hydrocortisone 0.5% in hydrophilic unguent . from day 1 after onset of ivig therapy onwards , no new development of blisters was observed . during the clinical course , desquamation of dusky areas of skin leaving an intact epidermis below was observed . we noted frequent spontaneous bleeding upon changes of the silver - coated dressings during reepithelialization period in the second week . the remaining detached skin fragments that overlied the progressively regrowing epidermis as of day 7 were progressively shed between day 7 and day 28 . the patient was discharged from the intensive care unit ( icu ) at day 28 after admission , with almost complete skin reepithelialization . at the last follow - up control 6 months later , the patient showed full recovery , except for residual alopecia and dry eyes . to date , no specific treatment with a high evidence level of efficacy has been reported for ten . the standard of care consists of best supportive therapy in an icu setting , and includes hydroelectrolytic and nutritional support as well as regular wound care and the appropriate detection and treatment of infectious complications . whereas best supportive care is an accepted standard of care for ten patients , none of the specific treatment strategies described to date , including ivig ( adequately dosed at 3 g / kg body weight ; there is an apparent dose dependence , as the reduction in mortality appears to be greatest for doses of 3 - 4 g / kg ) , corticosteroids , and infliximab , has shown solid evidence in support of a survival advantage in ten patients . to date , only one prospective , randomized - controlled clinical trial has been reported in ten , demonstrating no therapeutic benefit for thalidomide in the treatment of ten . ivig is a safe therapeutic modality that has been shown in several case series to potentially provide a benefit in ten . controversy as to the exact efficacy does , however , exist . in the recently established guideline for the use of high - dose immunoglobulins in dermatology , early administration of high - dose immunoglobulins ( 3 g / kg ) indeed , several published studies reporting the use of ivig for the treatment of ten have shown this therapy to potentially provide a survival benefit . the studies published to date are unfortunately heterogeneous , and often of limited size , retrospective nature , and noncontrolled . on the other hand , ten is a rare disease , and randomized prospective controlled studies analyzing the effect of ivig are very difficult to perform , and do not exist to date . eight of the 11 studies published to date reporting the use of ivig in ten suggest a positive effect of ivig on mortality if compared to the mortality predicted by scorten where applied , or the 25 - 35% average mortality rate for ten reported in the literature ( table 1 ) . it must be kept in mind , however , that as for many other therapies , the total dose ( in g / kg body weight ) of ivig administered may have an effect on the therapeutic outcome . indeed , a recent publication by trent et al . , analyzing in detail the studies published to date , showed that a dose - response relationship likely exists : per 1-g / kg increase in ivig dose , there was an observed 4.2-fold increase in patient survival . moreover , no mortality was observed amongst the 30 patients that had received 3 g / kg ivig or more . taking into account the lack of a proven specific therapy , the severity of ten , the safety of ivig , and the data to date concerning the efficacy of ivig in ten , we are of the opinion that in the absence of proven superior therapies , ivig therapy should be considered in patients with ten .

toxic epidermal necrolysis is a rare but clinically well - described dermatological pathology . however , clinical pictures of this disorder in text books do not reflect its dynamic evolution . usually , the desquamative post - bullous stage is represented , neglecting the initial bullous stage as well as the skin healing . with one clinical case , we provide a day - after - day illustration of the evolution of a patient suffering from toxic epidermal necrolysis . during one month , a skin area of a limb was regularly photo - documented .

arachnoid cysts in the brain usually have an indolent course unless complicated by headache , seizures , increasing head circumference , behavioral disturbances , ocular , motor , speech disorders , and sudden cyst changes such as acute cyst expansion , sudden hemorrhage into the cyst , subdural hematoma , or subdural hygroma . rupture of arachnoid cyst causing subdural hygroma is very rare , with few case reports . we herein present a clinical case , radiology , and discussion of asymptomatic middle cranial fossa arachnoid cyst in a 15-year - old male child who presented with raised intracranial features following a trivial trauma . a 15-year - old male child presented with complaints of headache , visual blurring , and projectile vomiting for 20 days duration . the child had a history of trivial fall about 10 days prior to onset of headache , with no loss of consciousness . on examination , the child had bilateral florid papilledema and right lateral rectus palsy . there were no other focal deficits or signs of meningeal irritation . computed tomography ( ct ) scan of the brain showed a left middle fossa , galassi type 3 arachnoid cyst , with bilateral subdural hygroma / hematoma ( chronic ) , bilateral diffuse cerebral edema , and mass effect causing compression of both frontal horns [ figure 1 ] . magnetic resonance imaging ( mri ) of the brain showed bilateral collection in the subdural space , hypo on t1w [ figure 2 ] and hyper on t2w [ figure 3 ] images , matching with the intensities of cerebrospinal fluid ( csf ) with widened sylvian fissure on the left side and a compressed temporal lobe on the left side , suggestive of arachnoid cyst with subdural hygroma and mass effect . computed tomography scan plain , axial section showing hypodense region compressing the temporal horn with bilateral subdural hygroma magnetic resonance imaging brain t1w image showing subdural hypointensity in the temporal region and bilateral convexities compressing temporal and frontal lobes on the left side suggestive of arachnoid cyst with subdural hygroma and mass effect magnetic resonance imaging brain t2w image showing subdural hyperintensity in the temporal region and bilateral convexities compressing temporal and frontal lobes on the left side suggestive of arachnoid cyst with subdural hygroma and mass effect left pterional craniotomy , evacuation of hygroma , fenestration of cyst into suprasellar cistern , and marsupialisation of the cyst was performed . the patient developed pseudomeningocele , which was managed with lumbar csf drainage for 5 days and was discharged without any deficits . the postoperative imaging showed resolution of the subdural hygroma with small extradural and subgaleal collection of the csf [ figure 4 ] . the postoperative imaging showed resolution of subdural hygroma with small extradural and subgaleal collection of cerebrospinal fluid arachnoid cysts are considered intra - arachnoidal in location and account for 1% of the intracranial mass lesions . they can develop anywhere in the cerebrospinal axis but have a predilection toward the middle cranial base . they are usually asymptomatic , but may present with raised intracranial pressure , focal neurologic deficits , or seizures . being indolent and slowly growing , most of the arachnoid cysts can be managed conservatively , reserving surgical intervention for symptomatic lesions . intra - cystic hemorrhage and subdural rupture of the veins running over the surface of the cyst are well described . subdural rupture of the arachnoid cyst per se,[46 ] either traumatic or spontaneous , is sparingly reported with about 21 cases documented in literature . even a minor trauma can cause rupture of the cyst as seen in the present case , where the patient fell down while playing , without any loss of consciousness . the gradual seepage of the csf from the cyst into the subdural space , probably through a flap- valve effect , caused a gradual rise in the intracranial pressure . ruptures are usually asymptomatic in areas other than the cysts in the middle cranial fossa . however , immediate operative intervention was warranted in view of raised intracranial pressure and progressive neurologic deterioration .

intracranial arachnoid cysts developing in relation to the cerebral hemispheres and middle cranial fossa are usually incidental or asymptomatic . however , most of the clinically active cysts present with seizures because of chronic compression . presentation as raised intracranial pressure due to cyst rupture into the subdural space is a rare clinical entity . we herein present a case of an asymptomatic arachnoid cyst with rupture into the subdural space bilaterally and presenting as raised intracranial pressure .

primary central nervous system ( cns ) lymphoma is a relatively uncommon malignancy , accounting for approximately 6% of all malignant cns neoplasms . they typically occur in middle - aged and older adults , although it can be seen more commonly in younger patients with human immunodeficiency virus ( hiv ) or transplant recipients . more than 90% of primary cns lymphomas are of the diffuse large b - cell variety . most of these lesions appear hyperdense on a non - contrast enhanced computed tomography ( ct ) scan and tend to demonstrate restricted diffusion on magnetic resonance imaging ( mri ) , given their high cellularity . this is the eighth reported case of cns lymphoma involving the pineal gland in the literature . a 65-year - old male presented with a 2-week history of worsening headache and double vision . initial non - contrast head ct demonstrated a homogeneous hyperdense mass in the pineal gland region with mild hydrocephalus , but no calcification or hemorrhage [ figure 1 ] . contrast mri was performed , which demonstrated a homogeneously enhancing mass involving the pineal gland , with increased perfusion with corresponding low apparent diffusion coefficient values [ figure 2 ] . the mass was hypointense on t1-weighted images and isointense to mildly hyperintense compared to brain parenchyma on t2-weighted images . leptomeningeal enhancement was identified near the supraoptic recess and along the cerebellar velum [ figure 3 ] . 65-year - old male presented with headache and was later diagnosed with pineal gland lymphoma . axial non - contrast ct of the head demonstrates a homogeneously hyperdense mass ( arrow ) in the pineal gland region . 65-year - old male presented with headache and was later diagnosed with pineal gland lymphoma . ( a ) axial t1 post - contrast mri image of the head demonstrates a homogeneously enhancing mass ( arrow ) in the region of the pineal gland . ( b ) axial mri diffusion - weighted imaging ( dwi ) sequence demonstrates increased signal ( arrow ) . ( c ) the corresponding axial apparent diffusion coefficient ( adc ) map demonstrates low adc values ( arrow ) . 65-year - old male presented with headache and was later diagnosed with pineal gland lymphoma . ( a ) axial t2 flair mr image demonstrates the pineal gland mass ( arrow ) as isointense to mildly hyperintense to brain parenchyma . ( c ) sagittal t1 post - contrast mr image again shows the enhancing pineal gland mass ( arrowhead ) as well as leptomeningeal enhancement near the supraoptic recess ( arrow ) and cerebellar velum . the histopathology showed a hypercellular tumor with high nuclear / cytoplasmic ratio , but no pineocytomatous or homer wright rosettes or papillary architecture [ figure 4 ] . tumor cells exhibited vimentin , cd45 , extensive cd20 , cd79a , and nuclear pax 5 reactivity . in situ hybridization showed kappa , but no lambda light chain hybridization . there was focal granular synaptophysin , but no neuron specific enolase ( nse ) , glial fibrillary acidic protein ( gfap ) , beta tubulin , cam 5.2 , thyroid transcription factor ( ttf-1 ) , cd99 , pancytokeratin , myogenin , or neurofilament immunoreactivity . 65-year - old male presented with headache and was later diagnosed with pineal gland lymphoma . ( a ) hematoxylin and eosin staining at magnification ( 40 ) demonstrates malignant lymphoma with coarse chromatin , nucleoli ( arrow ) , and mitoses . ( b ) diaminobenzidene chromagen at magnification ( 40 ) demonstrates tumor cells ( arrow ) extensively exhibiting cd20 reactivity . ( c ) diaminobenzidene chromagen at magnification ( 40 ) demonstrates tumor cells ( arrow ) exhibiting extensive cd79a , but no neural , myogenic , or epithelial marker immunoreactivity . at the time of biopsy , staging chest , abdomen , and pelvis ct exams revealed no other areas of lymphomatous involvement . the patient was discharged home in stable condition , but presented to the emergency department 1 week later with worsening hydrocephalus and headache . at this time , the patient underwent ventriculoperitoneal shunt placement for management of his hydrocephalus and received one cycle of high - dose methotrexate . however , he developed severe hypotension and acute kidney injury 2 months after his diagnosis and was re - admitted to the hospital , with repeat non - contrast head ct showing enlargement of the mass . given his multiple medical comorbidities and evidence of disease progression , the patient and his family elected to pursue comfort care measures . they can affect both immunocompetent and immunocompromised patients , although patients who are immunocompromised typically present at a younger age . there is a predilection for the periventricular white matter and basal ganglia , and they can present as either solitary or multiple mass lesions . on non - contrast ct , most masses are hyperdense , given the high cellularity , and surrounding edema is common . contrast enhancement is typically homogeneous , but can have a more variable appearance in immunocompromised patients . on mri , although these lesions can appear hypointense to gray matter on t1-weighted imaging and hypointense to isointense on t2-weighted imaging , the hallmark is restricted diffusion due to the increased cellularity . primary cns lymphoma has rarely been found to involve the pineal gland , with seven cases reported in the literature . headache was one of the most common presenting symptoms in these patients , although symptoms include cranial nerve and cauda equina syndrome , focal neurologic deficits , fever , diplopia , altered mental status , and seizure . the average age at diagnosis was 40 years , and only one female patient has been reported . b - cell lymphoma has been the most common pathologic diagnosis , with cases including large b cell lymphoma , malignant b cell lymphoma , immunoblastic lymphoma , and anaplastic lymphoma kinase positive anaplastic large cell lymphoma ( alk-1 positive alcl ) . there has been a single case of malignant t cell lymphoma and one case providing no additional detail to the diagnosis of lymphoma . imaging features in these cases most commonly included hydrocephalus and relatively homogeneously enhancing lesions identified on mri . the imaging findings in this particular case were typical of highly cellular tumor with leptomeningeal involvement , given the hyperdense mass on non - contrast ct and restricted diffusion with contrast enhancement on mri . a histologic diagnosis is essential prior to beginning invasive treatment , as the imaging characteristics of pineal lymphoma are not necessarily pathognomonic . other differential considerations for a tumor in the pineal region with these imaging characteristics include pineoblastoma , germ cell tumor , and metastatic disease . pineoblastoma is a pediatric diagnosis with masses typically appearing more heterogeneous and with peripheral calcifications . germ cell tumors are also typically diagnosed at a younger age and are associated with calcification . while metastatic disease may fit the imaging pattern and patient age seen in our case , a primary malignancy was not identified . our patient was treated with high - dose methotrexate , which has been shown to increase survival in patients with primary cns lymphoma . the addition of rituximab to this regimen has also been shown to improve remission rates and progression - free survival ; however , our patient decompensated and progressed prior to initiation of this therapy . primary cns lymphoma is an uncommon primary cns malignancy , and rarely involves the pineal gland . however , in the appropriate clinical context and with relevant imaging findings , lymphoma should be in the differential diagnosis of a pineal gland mass .

a 65-year - old male presented to our institution with acute - onset headache . imaging studies demonstrated a mass in the region of the pineal gland , with subsequent histopathology findings being consistent with large b cell lymphoma . the patient was treated with methotrexate , but ultimately did not survive . primary central nervous system ( cns ) lymphoma rarely involves the pineal gland , but should be considered in the differential diagnosis of pineal gland tumors in the appropriate clinical setting .

chronic granulomatous disease is a hereditarily determined illness , characterized by inability of the body 's phagocytic cells to destroy certain microorganisms . as a consequence , patients with cgd have an increased susceptibility to infections caused by certain bacteria and fungi ( frequently staphylococcus aureus , and aspergillus species , respectively ) . this insufficiency in microbial killing is usually caused by a defect in the nicotinamide adenine dinucleotide phosphate ( nadph ) oxidase enzyme complex . nadph is the enzyme that generates the microbicidal respiratory burst [ 2 , 3 ] . the deficiencies of oxidative metabolism are usually detected with either the nitroblue tetrazolium ( nbt ) dye test or the dihydrorhodamine ( dhr ) oxidation test . these tests are based on the ability of products of oxidative metabolism to alter the oxidation states of reporter molecules so that they can be detected microscopically ( in the case of nbt ) or by flow cytometry ( in the case of dhr ) . however , nbt test , although more conventionally used , is sometimes not sufficiently sensitive . therefore , many investigators have preferred the use of the dhr test . in cgd , phagocytes manage to ingest bacteria normally ; however they can not destroy them . patients usually have an elevated incidence of mucosal inflammatory disorders such as colitis , enteritis , and gastric outlet obstruction . cgd is an extremely rare disease that occurs in about 1 in every quarter of a million live births . a libyan boy first presented to the pediatrics department of tripoli medical centre ( libya ) when he was 3 months old suffering from loose stool with streaks of blood . he also had frequent episodes of fever at first presentation to the hospital ; later , he developed persistent cervical lymphadenitis and failed to gain weight . the boy is the 3rd child ( of 4 children ) from related libyan parents . he was born in the 35th week of gestation with a birth weight of 2400 grams . the first child of the family ( a girl ) had a similar medical history , with persisting pneumonia , suspected tuberculosis , and anemia . however , his younger sister was found to be a carrier of the disease ; but otherwise healthy and has no significant susceptibility to infections up to the present date . the patient presented to the university children 's hospital of bonn ( germany ) at the age of 10 months ; and because of a positive tuberculin skin test and previous history of bcg vaccination , an infection with bcg was suspected . the patient was later transferred to charite children 's hospital of berlin to continue his treatment , and further investigations were carried out . a lymph node of the left axilla was surgically removed , and a culture from the biopsy grew bacteria . these findings have lead to a suspicion of a primary immune deficiency disorder . at the age of 12 months , he again showed recurrent episodes of pneumonia , diarrhea and enlargement of lymph nodes . a few months later , following an immunological profile for his case , a negative nbt and dhr assay was detected . the final diagnosis of chronic granulomatous disease was confirmed by molecular analysis , which revealed a defect in the p22-phox component of the cyba gene . the results of his investigations were as follows : stool analysis revealed the presence of clostridium difficile ; however , no parasites were found . the excised cervical lymph nodes ( ln ) yielded the growth of enterococcus faecalis and klebsiella pneumoniae on culture . there was no growth of mycobacteria on culture of fluids from the bronchial lavage performed . gastroduodenoscopy and coloscopy showed redness and swelling of the mucous membrane of the stomach and the colon , respectively . serum antibody levels were as follows : igg 1697 mg / dl , iga 161 mg / dl , igm 100 mg / dl . indicating that humoral immunity of the patient was functioning normally . normal values were detected for sodium , potassium , calcium , chloride , creatinine , transaminases , ldh and alkaline phosphatase . ultrasound imaging ( usi ) showed enlarged cervical ln ( maximum diameter 22 mm ) , and slightly enlarged mesenteric ln ( 11 mm ) . furthermore , the liver was moderately enlarged ( figure 1 ) . ultrasound image showing a mild hepatomegaly . x - rays of the chest showed that the left diaphragm was lower than the right , and the left lung was smaller than the right , with central infiltrates on both sides . a high - resolution computed tomography ( ct ) scan of the chest confirmed the x - ray readings and showed hypoplastic left lung with diffuse dystelectasis ; however , no other specific infiltrates were found ( figure 2 ) . high - resolution ct - scan showing a left hypoplastic lung . magnetic resonance imaging ( mri ) of the chest confirmed the usi findings and revealed multiple enlarged cervical ln , and one large mediastinal ln on the right side in addition to a nonspecific mass situated on the right paravertebral area at the level of chest vertebral body number 11 and 12 . positron emission tomography ( pet ) showed focally intense signals of the upper lobe of the right lung ( paravertebrally ) and in the glandula submandibularis ( cervical ln ) , and a less intense signal in the inferior lobe of the left lung ( figure 3 ) . pet image showing intense signals on the upper lobe of the right lung ( yellow arrow ) . pet - ct fusion technique which allows accurate correlation of great anatomic details ( from the ct scan ) and informative metabolic information ( from the pet scan ) was used , and it confirmed the ct scan findings ( figure 4 ) . genetic analysis of the patient 's nadph oxidase revealed a deletion of 7 base pairs ( bp ) in exon 5 on both alleles of the p22-phox gene . the bp deleted were from 323 to 329 ( the investigation was done in dresden , germany ) . pet - ct fusion scan showing the location of the focally intense signals from the upper lobe of the right lung paravertebrally , and the less intense signals from the left lung , indicating a hypoplastic left lung . , it is estimated that cgd affects approximately one infant per quarter of a million live births [ 6 , 8 ] . worldwide , however , the incidence of the disease varies among the populations studied , with variations from 1 case per 160 thousands individuals to 1 case per 1 million people . surprisingly , for libya , and after a thorough literature search , we confirm that this is the first reported case of cgd . four genes have been connected to cgddthe cybb gene , encoding the gp91-phox subunit ; the cyba gene , encoding for p22-phox ; the ncf1 gene , encoding p47-phox ; and the ncf2 gene which encodes for p67-phox . cgd is frequently inherited ( 60% of cases ) in an x - linked recessive manner where most patients are boys , who have hemizygous mutations on the x - linked gene coding for gp91-phox . however , among the other subtypes of cgd , the autosomal recessive forms ( 40% of cases ) may be associated with milder disease . the extent to which environmental factors and secondary genetic defects may influence the course of the disease a wide variety of molecular defects have been described in the genes for the gp91-phox component , the p22-phox component , and the p67-phox component . these defects include frame shifts ; deletions ; and nonsense , missense , spliceregion , and regulatory region mutations . the protien , p40-phox , has been involved in the regulation of the nadph oxidase , but no individual with a mutation in this protein has been found so far . a new variant of cgd has been described ; this form is caused by an inhibitory mutation in rac2 , which regulates activity of the neutrophil respiratory burst and actin assembly . mutations in the genes for p67-phox ( ncf2 ) and p22-phox ( cyba ) are usually the rarest , accounting for fewer than 10% of cases of cgd . morbidity due to infections remains significant , particularly in those with the x - linked type . currently , the yearly mortality rate is a little more than 1.5% per year for persons with autosomal recessive cgd and over 5% for those with x - linked cgd the long - term survival rates of patients who present with symptoms after the end of their first year of age is significantly better than that of patients whose illness starts in infancy . fortunately , since the introduction of prophylactic antibacterials and anti - fungals the prognosis for patients with cgd has greatly improved , with patients frequently living to see their 30th and 40th birthdays [ 12 , 13 ] . in our case and because of the detection of clostridium difficile in stool and enterococcus faecalis and klebsiella pneumoniae in the excised cervical lymph node the patient 's condition has improved greatly and the degree of inflammation ( as monitored by the level of crp and leukocyte count ) has decreased . although generally , the patient became better , nevertheless , fresh blood spots were still noticeable in stools . because nonspecific colitis was assumed to be associated with his condition , he was treated with oral prednisone at an initial dose of 1 mg / kg body weight ( bw ) however , the two anal fissures which were found on physical examination , might explain the fresh blood streaks of the stool in some of the instances . while in germany , the patient was vaccinated with pneumococcus vaccine and with the measles , mumps and rubella ( mmr ) a few months later . therefore , with the previous vaccines he took ( in libya ) his vaccination status is now considered complete . in view of the fact that patients with cgd usually have recurrent bactarial and fungal infections , which may lead to abscess formation in the skin , lymph nodes and viscera , our patient was put on a lifelong antibiotic ( cotrimoxazole , 5 mg tmp / kg bw ) and antimycotic ( itraconazole 10mg / kg bw ) prophylaxis plan . the last respiratory system examination revealed a clear chest with normally breathing lungs devoid of infections . his parents are pleased with the outcome of the treatment so far , and are constantly monitoring his condition with regular follow - up visits to the hospital . alternative methods of treating cgd include interferon - gamma injections , white blood cells ( wbc ) infusions , and bone marrow transfusion ( bmt ) . gammainterferon , although widely used in the usa , in europe it is usually preserved for the difficult and persistent infections . the route of administration ( an injection given twice weekly ) is also a drawback . transfusion of wbc from healthy donors is sometimes used but not preferred for its obvious side effects in the form of transfusion reactions that can occur especially after repeated transfusions . gene therapy is also an option for cgd cases , where patients own stem cells are removed and the defective genes replaced with normal genes before reinjecting them back to the patient . by presenting this typical case of cgd , the authors advise that primary immune deficiency diseases , particularly cgd , should be considered in cases of chronic unresponsive infections , especially in children . after confirming the diagnosis , all cases of cgd should be put on a life - long aggressive antibiotic and antifungal prophylaxis treatment ; and for infections , special antibiotic and antifungal therapy regimes should be started for periods up to 3 times longer than that for patients with other similar conditions . early detection and treatment of such congenital disorders will certainly decrease the many complications that may arise in the course of the disease . furthermore , cgd patients should have frequent and regular consultations with their health care providers , and have access to cgd resources for information in the form of booklets and websites dedicated to the disease .

chronic granulomatous disease ( cgd ) is a primary immune deficiency disorder of the phagocytes . in this disorder , phagocytic cells ( polymorphonuclear leukocytes and monocytes ) can not produce active oxygen metabolites and , therefore , can not destroy the ingested intracellular bacteria . clinically , patients with cgd usually have recurrent bacterial and fungal infections causing abscess and granuloma formation in the skin , lymph nodes and visceral organs.in this report , we present a boy from libya with a rare autosomal recessive trait of cgd ( defect of p22-phox ) who has chronic lung disease following multiple severe pneumonia attacks . the case we present suffered from bloody diarrhea since the third month of his life . he also had recurrent episodes of fever , and later , developed persistent cervical lymphadenitis and failure to gain weight . cgd is a very rare condition worldwide . it is also not recognized here in libya , and usually not in the list of differential diagnosis for chronic pulmonary infections . we advise that pediatricians and general practitioners who treat chronic cases of lung diseases ( with or without chronic diarrhea ) should consider primary immunodeficiency disorders in the hope that early diagnosis and treatment may prevent chronic complications especially of the respiratory tract . furthermore , we state that , to the best of our knowledge , this is the first documented case of cgd from libya .

a 55-year - old male underwent implantation of a secondary prevention dual chamber boston scientific incepta implantable cardioverter - defibrillator ( icd ) . a dual coil df-4 lead ( endotak reliance llhh 64 cm ) was positioned at the right ventricular apex ( rva ) with normal intracardiac electrograms ( egm ) . parameters were satisfactory ( r - wave sensing of 7.9 mv , impedance of 960 , threshold of 0.6 v @ 0.5 ms , and a high voltage impedance of 39 ) and defibrillation threshold testing ( dft ) was acceptable . subsequent to defibrillation testing , unusual low amplitude and medium frequency signals were observed on the ventricular egm ( fig . 1 ) and detected on the marker channel during pacing threshold testing ( fig . fluoroscopic review of set - screw positioning was unremarkable and manipulation of the device did not influence the signals . no further intervention was performed at that stage and pacing threshold testing the next day demonstrated no over sensing recurrence and he proceeded to have an event free six - week follow - up . a 42-year - old female underwent implantation of a secondary prevention dual chamber medtronic maximo ii df-4 icd with a dual coil ( sprint quattro secure 6947 m 64 cm ) ventricular lead at the rva . after multiple attempts at positioning the lead , the best r - wave sensing obtained was only 6.8 mv , while other pacing parameters were satisfactory ( v - lead impedance of 684 , v - lead threshold of 0.5 v @ 0.5 ms , high threshold impedance of 42 and a dft test of < 25 j ) . she represented one day after with lead integrity alerts due to high ventricular impedance ( > 3000 ) . chest x - ray demonstrated the pin beyond the set - screw ( fig . 4 ) . during pocket revision , whilst the lead was still connected , only tapping the header reproduced similar noise , while traction of the lead and movement of the generator were unremarkable . a moderate hematoma was evacuated and lead testing unconnected to the header was also unexceptional . interrogation after the header was cleaned and reconnected showed normalized function with no further over - sensing . in this report , we present two unusual cases of intermittent ventricular over - sensing in the new df-4 connector system . in both cases , causes of inappropriate sensing of physiologic signals such as myopotentials , t waves , p waves , r - wave double counting , after potentials , and far - field physiologic signals were not present . these include electromagnetic interference from an external source , lead / connector problems ( loose set screw , adapter , or header ) , and lead failure ( insulation defect or conductor coil fracture ) . both of our cases share several similar characteristics : ( 1 ) the over - sensing occurred acutely post implantation ( within 24 h ) ; ( 2 ) the over - sensing was intermittent and did not have a constant relationship to the cardiac cycle ; ( 3 ) although the over - sensing could be reproduced with specific maneuvers ( during pacing in case 1 , and only with tapping of the header in case 2 ) , manipulation of the leads and generator did not recreate the over - sensing ; ( 4 ) the over - sensing had resolved spontaneously ( as in the first case ) or on reconnection without replacing the lead or the device ( as in the second case ) ; ( 5 ) peri - procedural lead function was normal ; ( 6 ) there was no evidence radiographically to suggest incomplete lead advancement ; and ( 7 ) no sources of electromagnetic interference , including electro - cautery were present . these features seem to make an obvious lead - connector problem or lead failure unlikely . case 1 likely relates to the improper venting of the grommet seal plug ( and similar issues have been previously reported with is-1 systems ) . the seal plug is a polymer plug with a narrow slit through which the set - screw torque wrench is inserted through to the grommet . it is designed to allow access of the wrench to the set - screw and maintain electrical isolation afterwards by preventing body fluids from entering the header ports once the wrench is removed . at wrench insertion , care should be exercised to locate the pre - slit depression of the seal plug and carefully guide the wrench through the slit to the set - screw cavity beneath prior to insertion of the lead into the port . this will open up the seal plug , relieving any potential pressure build - up within the lead port by providing a pathway to release trapped fluid or air during lead insertion . if this is not performed adequately , or if damage occurs during wrench insertion or faulty from manufacturing , the trapped air ( an electrical insulator ) is able to intermittently escape the header , altering the baseline contact between the normally separated extracellular fluid and the conductive elements of the connector causing transient alterations in the voltage input to the sense amplifier and resulting in make - break potentials . once the air has fully escaped , there is equilibration of charge and the over - sensing ceases , . in our case , it is likely that the wrench was not adequately engaged prior to lead insertion into the header considering that gross review of the seal plugs revealed no clear abnormality , and that the signals resolved spontaneously without the need for generator replacement . the resulting signals , however , had occurred post dft testing only , and over - sensed during ventricular threshold testing . during defibrillation testing chest wall movement or transient pressurization from the shock or both , could also have encouraged air - bubble release . curiously , the over - sensing had only occurred during instances when the signals were located just after the post - pacing blanking period . after a paced ventricular event , all icds have the ability to adjust sensitivity dynamically , beginning from the end of the blanking period , with the threshold starting at a more sensitive setting . our second case , however , raises some novel risks that may need to be considered with this new generation lead - connector system . this technology encompasses a combined single port cavity with four contacts of which both high- and low - voltage applications can be placed within the same cavity which result in compromised space for insulation and sealing . furthermore , contact pressure of the seals and the pins has to be limited to allow for easy insertion and retraction of the lead connector . this was achieved by alterations in the design with integration of the sealed rings within the header itself ( instead of being mounted on the lead ) as well as the development of a unique torque wrench activated levering of the spring loaded pin contacts . consequently , df-4 lead plugs have to go through four seals with three intermediate spring contacts while its predecessor , the is-1 lead connectors , have only one seal on the lead and no spring contacts . this raises potential issues with sealing failures , which may cause sensing problems or short circuits . in case 2 , we hypothesize that blood from the hematoma may have entered the header via a grommet punch - out post wrench removal ( which has been previously reported in medtronic df-1 header connections ) or forced into the header through imperfections of the more complex - designed sealed rings . the silicone rubber used for seal plugs has a shape memory . however , during the re - bonding process after wrench removal , they may require a short time to reseal . until the seal fully closes , it is possible that the header may be infiltrated by body fluid . this could have been further compounded by issues with trapped air that were mentioned earlier in the manuscript . the extracellular fluid in the header from case 2 could then have contributed to minute misalignment of the newly developed spring contacts with the lead , causing the observed increase in impedance and the intermittent non - physiological ventricular over - sensing . this hypothesis was supported by the resolution of the noise when the system was cleaned and simply reconnected without changing the device , as well as by the lack of any macroscopic appearance of lead - connecter or set - screw issues . to the best of our knowledge , cases of non - physiological ventricular over - sensing have rarely been reported involving the new df-4 system . the advantages of this standard over its predecessor mainly relate to procedural ease and patient comfort by reducing the risk of lead - to - port mismatch , reduced risk of lead - to - can abrasion ( because of fewer connectors ) , a reduced size of device header and subsequently a much less bulky pocket . however , these design changes may have several potential risks as we have highlighted as well as some logistical drawbacks . the compact system is also likely to be less flexible like in instances where there may be a need for the addition of pace / sense leads ( in cases of sensing problems ) or additional shock leads ( e.g. subcutaneous arrays ) . currently , a single post - market study has demonstrated that the df-4 lead has performed well at a 36-month follow - up period in 1701 cases with complication rates reported to be at a low 0.015 per patient - year of follow - up with no adverse set - screw events . however , it is important to note that there have been two previous adverse event reports found in the manufacturer and user facility device experience ( maude ) database run by the fda . they both relate to noise and inappropriate therapy , and were put down to lead - connection issues but with no conclusive evidence of set - screw problems . the df-4 connector system is becoming industry standard but our current cases underscore that potential problems regarding lead header attachment , that were seen with the older connector systems , continue to remain an identifiable cause for over - sensing . furthermore , they highlight certain concerns over novel lead - connector problems that need to be adequately tackled to reduce improper delivery of device therapies and increased patient morbidity . unanticipated problems with df-4 icd leads are likely to accumulate . in a comprehensive review on this topic in europace in april 2012 , sticherling and burri express concern that the complex design of the header / lead interface could lead to sensing or electrical isolation problems . correct torque wrench technique continues to be an important aspect in device implantation , but it is clear that further research and development is required to address any other potential newer causes of non - physiological over - sensing whose magnitude of risk may not yet be fully evident at the present time .

the df-4 is a new defibrillator lead technology . we present two cases of non - physiological transient ventricular over - sensing in patients who underwent implantation of an icd for secondary prevention . case 1 had ventricular over - sensing during pacing threshold evaluation post defibrillation testing while case 2 had the lead integrity alert triggered immediately post discharge with transient over - sensing . no lead - connector issues were found . case 1 was likely due to improper venting of the header and trapped air . case 2 was hypothesized to be due to intermittent header pin non - contact secondary to blood in the header . these cases reveal that df-4 leads are subject to both reported and potentially novel causes of transient acute ventricular over - sensing .

amyand 's hernia is an extremely rare condition in which the inguinal hernia sac contains the appendix . this unusual situation is estimated to occur in approximately one percent of adult inguinal hernia cases . we describe a case of acute appendicitis in the inguinal hernia sac with an incarceration in the external ring ; this led to distal appendicitis even though the appendix had a healthy body and base . our report includes a review of the literature and further evaluation of predisposing factors in this case . an 85-year - old - male arrived at our hospital in 2006 presenting a right groin mass . his history included hypertension , coronary artery disease , and transient infarction accident , of which all were receiving regular medical treatment . additionally , he had recently experienced urinary frequency and nocturia . a right groin mass had been protruding for 1 month prior to hospital admission , which increased in size when standing and before stool passage , but decreased in size after stool passage or lying down . the patient was scheduled for elective surgery . the oblique conventional incision between external and internal rings swelling and induration protruded outside the external ring toward the scrotum , leaving a mark on the vermiform organ ( fig . the body and base of the appendix was healthy and a moderate amount of clear ascites was found in the hernial sac . the distal portion of the appendix was attached to the distal portion of the hernial sac , which lay outside the external ring of the right groin . the mobilized cecum and ascending colon were far away from the paracolic space , apparently sliding until occupying the neck of the hernial sac . the patient 's postoperative condition was uneventful and he was discharged on the next day . he was followed up at our opd one week later and the right groin looked good . pathology revealed an acute suppurative appendicitis with mixed inflammatory cells in the appendiceal wall , presenting many eosinophils and small foci of granulomatous lesion ( fig . this rare condition was named after the first surgeon to perform appendectomy , claudius amyand , an english surgeon of the 18th century who first described a case of acute appendicitis in a hernial sac in an 11-year - old child . the first appendectomy ever to be performed in the usa , more than a century later , was also a case of amyand 's hernia in which an abscess with gangrenous appendicitis was found inside the hernial sac . the incidence of amyand 's hernia is estimated to occur in approximately one percent of adult inguinal hernia repair cases . acute appendicitis occurs much less frequently , and perforated appendix and periappendicular abscess formation within an inguinal hernia sac is an extremely rare clinical entity . ryan presented 11 of 8,692 cases of acute appendicitis occurring in external hernia of all forms . reviewed seven cases of acute appendicitis in a series of external hernia ( three inguinal ) collected in 8 years . a detailed description of the historical background and the management of amyand 's hernia was presented by r. hutchinson in 1993 . other investigators have infrequently presented case reports and literature reviews [ 7 , 8 ] . the incidence of acute appendicitis occurring in a hernial sac varies between the 0.13% reported by ryan et al . in 1937 and the 1% reported by carey in 1967 . more recently , c. d'alia and his colleagues reported their unique case of acute appendicitis within the hernial sac in 1,341 inguinal hernia operations performed over 13 years in messina university hospital in 2003 . most reported cases of amyand 's hernia have occurred in the right inguinal region and only a few reported cases have occurred in the left inguinal region [ 8 , 11 ] . the present case , diagnosed during surgery , is the first case of amyand 's hernia in our hospital , a 40-year - old district hospital with 800 beds . acute appendicitis only occurred over the tip of the appendix located outside the external ring . the blood supply was affected by the narrowed external ring and distal appendicitis developed subsequently . the body and base of the appendix appeared to be healthy ; the wide base of the hernial sac in the internal ring caused the vermiform organ to have a strange appearance . neither turbid ascites nor pus formation was found inside the hernial sac , making an excellent prognosis . we preferred to perform the repair via the traditional procedure ( bassini 's method ) to prevent the possibility of infection by the insertion of a foreign body ( mesh ) . treatment procedures have been well discussed in many recent case reports , including mesh hernioplasty , endoscopic hernioplasty or the traditional method of hernioplasty , although controversy still exists . sharma et al . briefly discussed the management of amyand 's hernia among 18 patients in a 15-year period , including appendectomy followed by bassini 's repair , mesh hernioplasty after reduction of a normal appendix , and bassini 's hernia repair plus a lower midline laparotomy for pelvic washout . discussions in recent reports emphasized the incidence and management of amyand 's hernia , highlighting the rarity and causes of the abnormality . abu - dalu and urca have suggested that the appendix becomes more vulnerable to trauma in amyand 's hernia and is ultimately retained by adhesions . its blood supply may subsequently be cut off or significantly reduced , resulting in inflammation and bacterial overgrowth . contraction of the abdominal muscles and other sudden increases in intra - abdominal pressure may cause compression of the appendix , resulting in further inflammation . apart from the above opinions , we found a mobilized cecum and ascending colon in our case , allowing facile advancement of the appendix into the hernial sac . the tip of the appendix proceeded through the narrowed external ring and incarceration developed , followed by adhesion and non - reducibility of the segment . the cecum was pulled close to the internal ring . the congenital anomaly ( mobilized ascending colon and cecum ) is considered to be a predisposing factor for developing amyand 's hernia . in addition , our pathology revealed many eosinophils in the inflamed appendix . most often , the stained white cell differential in acute appendicitis is neutrophil - predominant . the situation may be the result of an incarceration but no strangulation of the distal appendix for one week ( prolonged reduction of blood supply without complete interruption ) , leading to a subacute inflammation of the organ . computed tomography scans may be useful in diagnosis , but are typically not performed routinely . we did not order abdominal ct scanning for our patient because he did not present as an emergency and strangulation was not considered during the preoperative period . differential diagnosis should include strangulated hernia , strangulated omentocele , richter 's hernia , testicular tumor with hemorrhage , acute hydrocele , inguinal adenitis , and epidydimitis . the treatment for hernial appendicitis is appendectomy through the herniotomy with primary hernia repair using the same incision . only lyass et al . reported a delayed wound closure due to a retroperitoneal abscess secondary to the appendicular inflammation . mesh is not suggested in the contaminated abdominal wall defects because of greater risk of wound infection and appendiceal stump fistula . laparoscopic reduction of amyand 's hernia has been described previously [ 15 , 16 ] . amyand 's hernia is a rare condition that has been frequently diagnosed accidentally during a hernioplasty , and especially an incarcerated inguinal hernia diagnosed in the emergency room . it is closely linked to peritoneal spread of the septic process and may be life - threatening , with an incidence of mortality varying between 14 and 30% [ 9 , 17 , 18 ] ; mortality risk is most likely associated with perforated appendix with or without periappendicular abscess formation , or even peritonitis . consequently , our recommendation is that acute appendicitis should be considered as a potential cause for increasing morbidity in patients with incarcerated hernias . awareness of this clinical entity would be useful in the preoperative evaluation of patients with non - reducible or incarcerated inguinal hernias .

amyand 's hernia is an extremely rare condition in which the appendix is positioned in the inguinal hernia sac . acute appendicitis is much less common in this situation and few reports are found in the literature . we report a case of acute appendicitis with the tip of the appendix incarcerated outside the external ring of the right groin . a mobilized cecum and ascending colon were noticed during surgery . we conducted a review of the literature , emphasizing possible causes and suggesting a predisposing factor for the condition .

human respiratory syncytial virus ( rsv ) is the leading viral cause of acute lower respiratory tract illnesses in infants and young children worldwide1 and is associated with annual or biannual epidemics.2 rsv isolates can be classified into two genetically and antigenically distinct groups , a and b , within which further diversity is reported.3 rsv repeatedly re - infects individuals throughout life , and the strains involved are often genetically distinct.4 the differences occurring both between and within the groups are most pronounced at the attachment ( g ) protein gene , which encodes a surface - expressed protein of the virus known to be targeted by the host neutralizing antibody response.1 in the last two decades , sequencing and phylogenetic analysis of the g gene have allowed identification of several genotypes within the two groups.3 it has also been noted that the circulating diversity within the groups is dynamic , and new genotypes periodically emerge , but also some previously circulating genotypes appear to have become extinct.3 locally , over successive epidemics , predominant genetic variants within the groups become replaced.3 continued observation of the dynamics of circulating rsv genetic and antigenic diversity is essential for the design of better rsv control approaches . a new group b strain with a 60-nucleotide duplication within the g gene was first observed in buenos aires , argentina , in 1999 ( named ba genotype ) and spread around the world in 34 years.5 interestingly , the ba genotype appeared to replace all the other group b genotypes in rsv epidemics that occurred in the second half of the last decade.6 the cause of the remarkable ba genotype epidemiological success remains unknown.7 few non - ba cases were observed after 2005,810 these occurring in cambodia , brazil and china between 2007 and 2009 . the epidemiological dynamics of the ba genotype have indicated that ( i ) new rsv strains can transmit to all parts of the world in a relatively short time period , and ( ii ) there is ongoing within - group competition between rsv genotypes . monitoring the transmission and evolutionary dynamics of group b rsv strains after the ba genotype emergence allow the study of an rsv genotype from emergence to , potentially , its extinction . hospital - based rsv surveillance at coastal kenya , 2002to date , was established with the objectives of documenting rsv disease burden and rsv molecular and immuno - epidemiology11 within the region . the surveillance period overlaps with the period when changes have been observed in circulating rsv b genotypes around the world . here , we report the results from sequencing and genotyping of all group b rsvs that we identified over the 11 years of the surveillance , and the results of analysis of novel non - ba strains we observed in three patients infected in early 2012 . the samples analyzed were obtained from under five - year - olds admitted with pneumonia to the kilifi district hospital11 and span the period between january 2002 and mid-2012 ( the latter marking the end of the 20112012 epidemic ) . either a parent or a guardian provided informed consent on behalf of each child . the specimens ( nasal washings , aspirates , or swabs ) were screened for rsv using an immunofluorescence assay ( ifat ) , and samples positive for rsv were subtyped into groups a and b using a conventional multiplex rt - pcr or a multiplex real - time pcr assay . group b rsv - positive samples were sequenced in the ectodomain region of the g gene as previously described.4 sequences were aligned using bioedit software ( http://www.mbio.ncsu.edu/bioedit/bioedit.html ) . the dates to the most recent common ancestor ( mrca ) between sequence clusters were estimated using bayesian methods within the beast software version 1.74,12 and convergence was confirmed in tracer program version 1.5 . representative strains of previously identified group b genotypes were included in the analysis to help classify the kilifi strains . over the period january 1 , 2002 , to june 31 , 2012 , 574 group b rsvs were identified among the rsv ifat - positive samples , and 488 ( 850% ) of these were successfully sequenced in the g ectodomain region . early in the surveillance , ba strains were detected as a rare genotype , making only 73% ( 3 of 41 ) of the sequenced group b genotypes between january 2002 and june 2004 . the prevalence of ba strains dramatically increased to 973% ( 108 of 111 ) in the 20042005 epidemic , and thereafter , all the group b samples identified and sequenced between june 2005 and december 2011 possessed the ba duplication . however , in sequencing b specimens from the first half of 2012 , three lacked the ba duplication . this was an unexpected finding occurring after multiple epidemics of non - ba genotypes absence ; thus , we undertook further analysis of these three sequences to ascertain their possible origin and phylogenetic relationship with other rsv sequences deposited in public databases . the distribution of the different group b genotypes at kilifi during the 11 consecutive epidemics of the surveillance numbers in brackets represent the proportion of group b rsv - positive samples that were sequenced of all those that were identified and subtyped as group b. numbers in brackets represent percentage of the sequenced group b genotypes that genotyped into ba . the three patients were admitted on march 1 , on march 23 , and on may 16 , 2012 , and were aged 145 , 17 , and 55 months , respectively , at the time of admission . two of the patients were admitted with severe pneumonia , and the third patient had very severe pneumonia ( see ref.11 for syndromic definitions ) . all three nucleotide sequences ( ken/201/mar/2012 , ken/202/mar/2012 and ken/203/may/2012 ) obtained from the three patients were identical across the entire 633 nucleotides sequenced . a blast search to track their ancestry ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) querying the second hypervariable region of g gene found that these three non - ba sequences were closely related to strains from brazil collected in between 2004 and 2007 with the top matches being those isolated in 2007 . these brazilian 2007 strains were non - ba type and have been classified under the gb3 genotype in their genbank annotation . the phylogenetic relationship of the kilifi 2012 non - ba sequences , the other group b genotypes identified at kilifi ( ba and sab1 ) , the top 25 of the blast hits , and representative sequences of all previously described group b genotypes around the world is given in figure 1 . the kilifi 2012 non - ba sequences and the previously circulating non - ba sequences at kilifi ( sab1 ) fell on separate branches that were distant from each other . the kilifi 2012 non - ba sequences and the non - ba sequences that were isolated in cambodia ( 20082009 , designated sab49 ) and china ( before 2005 ) alongside the brazilian sequences ( 20042007 ) fell into one cluster but with only moderate support ( bootstrap value 50% ) although clearly separated from the other group b rsv genotypes , figure 1 . a maximum - likelihood tree of 53 sequences including the top 25 blast hits , the 3 new non - ba kilifi sequences , 10 sequences representative strains previously collected at kilifi ( both ba and non - ba ) , and 15 representative sequences of all the previously described group b genotypes . the tree is derived from an alignment of the carboxy terminus region nucleotide sequences of the rsv g protein gene [ 264-nt - long region ( 324 for ba ) ] . the nodes of branches with exclusively kilifi sequences are indicated with a red - filled square box , and the associated branches of these kilifi sequences are also colored in red . the nomenclature of the taxa is a three - letter code for the country of sequence origin / genbank accession number / strain name . the average between - group genetic distances between the kilifi 2012 non - ba sequences and the brazilian , chinese , and cambodian non - ba viruses were 28% , 64% , and 94% , respectively . these distances imply significant diversification between these sequences despite the relatively close relationship on the tree . the mrca analysis predicted the kilifi 2012 non - ba viruses and that the brazilian viruses diverged from june 2007 ( 95% hpd , january 2002february 2012 ) , while the divergence with the cambodian 2008 - 2009 non - ba viruses was predicted to have occurred much earlier august 2000 ( 95% hpd , february 1985may 2009 ) . however , these estimates should be interpreted with caution as the hpd confidence intervals are very wide and overlapping . within the carboxy terminus region of the encoded g protein , the brazilian 2007 viruses and the kilifi 2012 non - ba viruses differ by six amino acids , figures 2 and 3 . interestingly , three of these changes affect sites that were previously shown to be under positive selection in group b rsv,13,14 that is , positions 223 , 251 , and 258 . studies with rsv a strains have previously noted that multiple epitopes lie in this region of the rsv g gene recognized by human convalescent sera , and changes affecting some particular positions , some of which were identified as positively selected , can have profound effect on the overall antibody recognition.3 thus , these substitutions in the 2012 non - bas could be of considerable significance . the figure shows an alignment of partial g - protein - predicted amino acid sequences for the brazilian , chinese , and cambodian non - ba sequences that were identified in the second half of the last decade and the kilifi non - ba sequences [ both the new 2012 and the old ( sab1 strains ) ] . the sequences are compared with gb1 strain ( usa / ch10b ) given at the top of the alignment as a reference strain . where the amino acid sequence is similar to the gb1 strain sequence the asterisks denote stop codons . at the bottom of the columns , positions previously identified as positively selected in group b rsv are indicated with a plus ( + ) symbol.13,14 gray - highlighted columns show amino acid sequence positions that changed and were also identified to be positively selected . the taxa nomenclature is a three - letter code for the country of sequence origin / genbank accession number / strain name . panel ( a ) shows a maximum - likelihood tree from 232 sequences comparing 599 nucleotide positions of the rsv g protein gene . this includes all unique ba sequences observed at kilifi between 2003 and 2012 ( 224 sequences ) , the 3 kilifi 2012 non - ba strains ( marked red ) , and 5 of the close brazilian non - ba sequences collected in 2007 that span this length ( marked green ) . in the alignment used to generate this tree , the 60-nucleotide insertion of the ba strains was removed to investigate whether the remaining nucleotide positions were highly similar to ba , which could then suggest that the new non - ba strains emerged by spontaneous deletion of this region from ba genotype . however , we observe that these new kilifi non - ba strains cluster far away on the tree from the current ba strains and are close to the brazilian non - ba strains boxed in ( a ) with a dashed rectangle and expanded as panel ( b ) . panel ( c ) shows the seven amino acid changes in the kilifi 2012 non - ba strains from the brazilian 2007 strains and their respective positions that they were observed ( six of the seven changes occur in the second hypervariable region ) . we have previously reported the detection of minority genomes within two patients sampled in 2008 that showed a 60-nucleotide deletion at the exact position where the insertion occurred in the ba variant , and we speculated this as a potential mechanism by which strains without the duplication could re - emerge.15 our phylogenetic analysis comparing the new non - ba strains with the circulating ba strains at kilifi from which the 60-nucleotide duplication sequence was excised found the new strains were only distantly related to ba ; that is , they do not represent ba strains that have recently lost their duplication ( figure 3 ) . this observation of wild - type non - ba viruses still in circulation provides a mechanism for replacement of the ba strains if the ba selective advantage diminishes . in conclusion , we report the total dominance of the ba genotype at coastal kenya among group b isolates over six epidemics and re - appearance of non - ba strains during the first half of 2012 . these new non - ba strains appear to have been circulating globally , albeit as a minority genotype , for several years and are not emerging de novo from the ba genotype . compared with their closest relatives in genbank , the new strains were found to have undergone changes at positions believed to be located in immune epitopes , and it will be interesting to observe whether these variants will increase in prevalence over time and succeed in dominance over the ba genotype . these observations raise questions on the amount of undetected rsv diversity existing and the mechanisms driving changes to population - level rsv diversity . the g sequences of the kilifi strains reported in this study are deposited into genbank under the accession numbers kc263040kc263051 .

respiratory syncytial virus ba genotype has reportedly replaced other group b genotypes worldwide . we report the observation of three group b viruses , all identical in g sequence but lacking the ba duplication , at a coastal district hospital in kenya in early 2012 . this follows a period of six consecutive respiratory syncytial virus ( rsv ) epidemics with 100% ba dominance among group b isolates . the new strains appear only distantly related to ba variants and to previously circulating sab1 viruses last seen in the district in 2005 , suggesting that they were circulating elsewhere undetected . these results are of relevance to an understanding of rsv persistence.please cite this paper as : agoti et al . ( 2013 ) identification of group b rsvs that lack the 60-nucleotide duplication after 6 consecutive epidemics of total ba dominance at coastal kenya . influenza and other respiratory viruses 7(6 ) , 10081012 .

serum samples were obtained from 4 areas in peru : chiclayito and salitral ( piura department ) ; la merced ( junin department ) ; and cusco ( cusco department ) ( figure ) . chiclayito is a small village ( population 6,133 ) 30 m above sea level on the outskirts of the city of piura in the northern coastal desert . salitral is a small rural village ( population 1,503 ) 162 m above sea level in a more temperate region of the salitral district ( morropon province , piura department ) 3 h by car from chiclayito . la merced is the capital of the chanchamayo district ( chanchamayo province , junn department ) and located 751 m above sea level 350 km east of the peruvian capital city of lima , on the eastern side of the andes . cusco ( population 260,000 ) is located 3,350 m above sea level in the southern peruvian andes 1,089 km southeast of lima . sera from patients representing the 4 surveillance sites were tested for antibodies against sfg rickettsiae after written informed consent was provided by each patient ( department of defense institutional review board no . patients enrolled had a fever 38c and at least 2 other signs or symptoms including headache , myalgia , arthralgia , rash , and bleeding . patients with a positive blood film for malarial parasites or obvious disease such as diarrhea or upper respiratory illness were excluded . paired ( acute- and convalescent - phase ) patient serum samples were evaluated for immunoglobulin ( ig ) g antibodies reactive with r. rickettsii antigen by either an indirect immunofluorescence assay ( ifa ) or enzyme immunoassay ( eia ) . serum specimens were also tested by ifa for typhus group rickettsial antibodies and were uniformly negative . ifa analysis was conducted according to directions provided by the manufacturer ( panbio , indx , inc . , baltimore , md , usa ) . endpoint titers were recorded as the reciprocal of the last dilution exhibiting specific fluorescence . patients with confirmed spotted fever were those who showed a 4-fold increase in r. rickettsii igg titer from acute phase to convalescent phase of illness . the eia was conducted by using a 4-step indirect immunoassay to detect r. rickettsii igg , as described ( 8) . a positive serum dilution exceeded the mean plus 3 standard deviations between the absorbance of r. rickettsii antigen and the negative control antigen of 5 control serum specimens . serum samples were titrated to endpoint and the highest dilution found positive was recoded as the r. rickettsii igg titer . serum from a serologically confirmed case - patient showed a 4-fold increase in antibody titer from the acute to the convalescent phase . a total of 170 patients , 50 from chiclayito and the salitral health centers ( piura department ) , 67 from cusco hospital ( cusco department ) , and 53 from la merced hospital ( junin department ) , were tested for antibodies to sfg rickettsiae . ifa testing was done at the peruvian national institute of health , while eias were conducted at naval medical research center detachment . of the 170 patients tested , 30 ( 18% ) yielded results that suggested that sfg rickettsial infections were the most likely cause of their illnesses ( table 1 ) . patients from all 4 study sites in 3 departments of peru had evidence of sfg rickettsiae infections as the cause of illness . frequencies of confirmed patients in the 3 departments did not differ significantly ( p > 0.52 ) . table 2 shows the frequencies of spotted fever by age and sex for the 164 patients for whom data were recorded . the frequency of spotted fever was 27% in female patients and 10% in male patients ( p < 0.005 ) . * by enzyme immunoassay ( eia ) or indirect immunofluorescence antibody assay ( ifa ) . febrile patients from whom acute- and convalescent - phase serum specimens were available for testing . criterion for confirmation was a 4-fold increase in r. rickettsii immunoglobulin ( ig ) g antibody titer from acute to convalescent phase of illness by eia . criterion for confirmation was a 4-fold increase in r. rickettsii igg antibody titer from acute to convalescent phase of illness by ifa . the signs and symptoms of patients with confirmed spotted fever who came to the treatment facility included fever and malaise ( 100% ) , chills ( 94% ) , weakness ( 94% ) , shortness of breath ( 94% ) , prostration ( 81% ) , arthralgia ( 62% ) , abdominal pain ( 62% ) , cough ( 56% ) , nausea ( 56% ) , and runny nose ( 56% ) . none of the patients died , and most patients had a relatively mild febrile illness . there were no clear clinical differences in patients with confirmed cases of spotted fever compared with febrile patients who did not have spotted fever . evidence of sfg rickettsial infection was observed in samples taken from febrile patients in cusco , junin , and piura departments . the etiologic agent or agents responsible for the spotted fever illnesses remain unknown . appropriate samples from these patients were not available for isolation or molecular identification by a polymerase chain reaction . host inflammation may partly contribute to the pathogenic sequelae with intra - endothelial cell infection in more severe sfg infection ( 9 ) . patients infected with r. akari typically experience a mild and or asymptomatic disease characterized by low - grade fever , sweats , headache , and a vesicular eruption over the trunk and extremities ( 10 ) . r. akari is maintained transovarially in the mite vector and transmitted to humans by the house mouse mite ( liponyssoides sanguineus ) . infections have generally been reported among higher risk populations such as intravenous drug users ( 11 ) , or within the densely populated inner city ( 12 ) . the concentration of humans in close proximity to house mice and their mites are factors that could contribute to an increase in rickettsialpox in the region . sporadic cases of rickettsialpox may be confused with chickenpox , a common illness associated vesicular rash . however , none of the confirmed sfg rickettsia - infected patients had vesicular rashes typical of rickettsialpox . cat flea typhus , caused by r. felis , is a mild disease similar to murine typhus ( 13 ) . the clinical manifestations of patients infected with sfg rickettsiae are similar to those described for cat flea typhus . however , recent discoveries of novel rickettsioses caused by distinct sfg rickettsiae in europe , africa , australia , asia , and north america during the last 25 years ( 14,15 ) suggest that the infections reported in this study may be the results of a novel sfg rickettsial agent . future work is needed to identify the agent involved and to clearly link clinical signs and symptoms with diagnoses . the higher frequency of cases in women suggests occupational exposure since in these areas of peru women are generally more involved with domestic activities near the home . possibilities for increased exposure of women may include more frequent work in the fields , thus exposing them to arthropod vectors ; closer contact with domestic animals that may be involved in maintaining the sfg rickettsial agent ( although no evidence was collected to support this ) ; or exposure to house mouse mites in the home . serologic evidence suggests that sfg rickettsiae were responsible for causing febrile illnesses in these 4 study sites of peru , which demonstrates that sfg rickettsia result in human disease in peru . further studies are needed to document the species of sfg rickettsiae and to determine the vectors of these rickettsial infections . in addition , epidemiologic studies are needed to identify the risk factors , document the clinical spectrum , and suggest public health recommendations for prevention .

serum specimens from patients at 4 sites in peru were tested for evidence of spotted fever group rickettsial infection . results showed that 30 ( 18% ) of 170 patients had spotted fever group rickettsial infections , which likely caused their illnesses . these findings document laboratory - confirmed spotted fever from diverse areas of peru .

vascular malformations ( vms ) of the hand are rare and can have a variable clinical progression . such lesions may expand with the growth of the patient or progressive ectasia , but they do not proliferate . similarly , they do not undergo spontaneous resolution . they can be classified as simple ( capillary , lymphatic , venous , or arteriovenous ) , combined ( defined as two or more vms found in one lesion ) , or in association with other anomalies . arteriovenous malformations ( avms ) , including arteriovenous fistulas ( avfs ) , can present as congenital vascular lesions arising from errors in embryonic vasculogenesis or acquired in life secondary to trauma . avms are characterized by high - velocity turbulent blood flow from an artery to a vein , bypassing a normal capillary bed and can be clinically staged according to shobinger . high - flow avms of the upper limb can be classified as type a : anomalies with either single or multiple avfs , aneurysms , or ectasias of the arterial side of the circulation ; type b : anomalies with micro- or macro - fistulas that were localized to a single axial artery of the limb , hand , or digit ; type c : diffuse arteriovenous anomalies with macro- and micro - fistulous connections involving all tissues of the limb . angiography is the current gold standard imaging modality and in majority of avms displays a central core , or nidus , of abnormal connections from enlarged feeding arteries to draining veins . surgical or endovascular treatment can be complex with risk of uncontrollable bleeding , incomplete resection , and recurrence including rapid collateralization of adjacent arteries . this may be complicated by skin necrosis leading to amputation and associated loss of function . thermal imaging is a non - invasive , non - contact technology that does not require intravenous contrast agents . it has been used experimentally in various areas of plastic surgery including free - flap monitoring , perforator and perforasome mapping , and burn depth assessment . the infrared radiation that is emitted is a surrogate measure of blood flow and can be objectively quantified . the majority of thermal imaging cameras measure infrared radiation in the 115 m range , with most clinical applications focusing on the long - wave infrared from 7 to 14 m . recent smartphone - based systems have brought low - cost thermal imaging to the clinic as high - resolution industrial systems may be cost - prohibitive . we present the case of a patient with an avm affecting the hand in which thermal imaging has been used as an adjunct to capture baseline images to allow monitoring of progression . a 39-year - old female was referred to our regional peripheral vascular anomalies clinic with a 24-year history of a lesion affecting the left nondominant hand which started as a pea size mass , progressing to involve the palm , digits , and forearm . she underwent a surgical debulking procedure at the age of 17 , but the lesion continued to expand . schooling and work were unaffected till the age of 21 ; however , due to pain , weakness , and coordination difficulties , she was not able to return to employment . on examination , an extensive vascular anomaly was noted to involve the palm , index and middle fingers , and distal forearm and wrist [ figure 1a ] , with bruit and a palpable thrill . an ultrasound doppler scan and magnetic resonance angiography confirmed the diagnosis of a high - flow avm , and digital subtraction angiography was used to define the anatomy of the malformation and shows features of a type - a avm [ figure 1b ] . nerve conduction studies showed no evidence of compression neuropathy but some axonal loss , presumably due to mild ischemic changes secondary to the avm . 39-year - old female with a 24-year history of a lesion affecting the left nondominant hand diagnosed as a congenital arteriovenous malformation of the left hand and wrist . ( a ) photograph of the hand shows the arteriovenous malformation visibly involves the radial aspect of the palm and index finger and ( b ) digital subtraction angiography confirms a type - a arteriovenous malformation of the radial artery , palmar arch , and digital arteries of the index and middle fingers . there is minimal contrast agent seen in the thumb , ring or little finger digital arteries ( black arrow ) . steal affecting the thumb , ring and little fingers ( white arrows ) , and ( d ) thermal image of the unaffected right hand for comparison . to monitor the steal phenomenon affecting the thumb and ulnar - sided digits , a thermal image was recorded in the clinic using an flir sc660 thermal imaging camera ( flir systems inc . , images were recorded at 22c and 50% relative humidity at a distance of 70 cm after exposure of the hand for 3 min to allow surface cooling of the skin . baseline images of the affected [ figure 1c ] and unaffected hand [ figure 1d ] were recorded for future monitoring of the avm with regards to progression of the lesion or of the steal phenomenon . to date , the patient has declined any radiological or surgical intervention to date and is managed with a compression garment and simple analgesia for pain relief . avms of the hand are more likely to cause functional impairment than those at other sites , and surgical and/or embolization may have catastrophic consequences to the digits . a comprehensive review by upton et al . , noted that only 12% of the upper limb vms were avms ( 4 type a , 15 type b , and 14 type c ) . although avms are rare , they exhibit more aggressive and unpredictable clinical behavior than other forms of vms . the fast turbulent flow created between the directly connected arterial and venous systems is responsible for a destructive hemodynamic effect that determines clinical symptoms and potentially high recurrence rates . complete surgical excision in conjunction with embolization sometimes may be impossible without threatening the viability of the digits , and limited debulking may lead to recurrence . avms can be located in various anatomic areas and sometimes occur simultaneously in several regions . in a study by vainyte et al . , extracranial avms were analyzed , of which 80.4% were located in the extremities and the gluteal region , allowing easy access for thermal imaging . at present , progression of avms there is no non - invasive objective test that can determine the evolution or expansion of the lesion , or associated distal vascular steal that may occur in the extremities . although upton et al . , included distal vascular steal in the type - c avm classification , we have shown that this may still occur in type a lesions and could lead to symptoms requiring surgical intervention . although no skin or trophic changes have been noted in the reported case , a combination of angiography and thermal imaging has indicated the presence of markedly reduced distal perfusion , which may be subclinical at present . the natural history of avms of the hand can be variable , and thermal imaging provides an objective measure of progression that can determine the optimum time for surgery and/or embolization , balancing the risk of iatrogenic digital ischemia versus inherent vascular steal . we suggest that thermal imaging is an adjunct that can be used in addition to clinical examination and/or angiography for the diagnosis and follow - up of arteriovenous malformations , to monitor progression or vascular steal , and also for recording recurrence after surgical excision . with the advantage of being a non - invasive imaging modality that does not require intravenous contrast , or ionizing radiation exposure

vascular malformations of the hand are rare . angiography is the current gold standard imaging modality . thermal imaging is an emerging noninvasive , noncontact technology that does not require intravenous contrast agents . we present the case of a patient with an arteriovenous malformation affecting the hand in which thermal imaging has been used as an adjunct to capture baseline images to allow monitoring of progression . we suggest that thermal imaging provides an adjunct that can be used in addition to clinical examination and/or angiography for the diagnosis and routine follow - up of conservatively managed arteriovenous malformations , to monitor progression or vascular steal , and also for recording recurrence after surgical excision for which there is known to be a significant incidence . with the benefit of being a noninvasive imaging modality that does not require intravenous contrast , or ionizing radiation exposure , office - based thermal imaging may become commonplace .

her blood counts were as follows : hemoglobin , 18.2 g / dl ; hematocrit , 55.1% ; platelets , 36110/l ; and leukocytes , 6.8210/l . serum chemistry values were as follows : creatinine , 0.9 mg / dl ( normal range , 0.5 - 1.3 ) ; albumin , 5.4 g / dl ( 4.0 - 5.2 ) ; ldh , 359 iu / l ( 180 - 460 ) ; alp , 62 iu / l ( 104 - 338 ) ; calcium , 12.6 mg / dl ( 8.6 - 10.4 ) ; and phosphate , 1.9 mg / dl ( 2.5 - 4.4 ) . her serum level of intact parathyroid hormone ( ipth ) was increased to 221 pg / ml ( normal range , 10 - 65 ) and her intact parathyroid hormone - related protein ( pthrp ) was below 1.1 pmol / l ( normal range , < 1.1 ) . the concentration of 1,25-dihydroxyvitamin d3 was 63.54 pg / ml ( normal range , 18.7 - 47.7 ) , calcitonin was below 1.0 pg / ml ( normal range , 1.0 - 4.8 ) , and erythropoietin was 4.3 miu / ml ( normal range , 3.22 - 31.90 ) . the 24-h urinary concentration of calcium was 820 mg / day and urine output was 3,150 ml . the patient underwent an operation , and intraoperative exploration of the neck and mediastinum revealed a nodular lesion on the left lobe at the location noted by the parathyroid ultrasonography and scintigraphy . postoperatively , the patient 's pth dropped to 34 pg / ml and her calcium level was 9.8 mg / dl at 1 month after the operation . moreover , her hemoglobin and hematocrit dropped dramatically to 15.5 g / dl and 46.7% , respectively ( table 1 ) . hypercalcemia in myeloproliferative disorders such as polycythemia vera is usually thought to be related to malignancy , especially renal cell carcinoma.1 other secondary causes of increased red cell mass are various and include chronic lung disease , smoking , renal artery stenosis , hepatocellular carcinoma , and hydronephrosis.2 however , an association between hyperparathyroidism and polycythemia vera has rarely been reported . in a previous cohort - based study,3 the co - incidence of primary hyperparathyroidism and polycythemia vera was significantly increased , and it was unlikely that this was explained completely by bias or chance . the parathyroid tumor may have produced or induced production of a growth factor that can stimulate pancytosis . moreover , a previous report suggested that the calcium - pth axis is important for the activation of erythropoiesis,4 but the cause - effect relationship between pth and myeloproliferative disorders is not yet completely understood . , the differential diagnosis of polycythemia and hypercalcemia should also include the possibility of a parathyroid tumor in addition to other neoplasms .

a 59-year - old female with diabetes mellitus presented with hypercalcemia and polycythemia . her serum calcium and intact parathyroid hormone ( ipth ) levels were increased , and tc-99 m sesta - mibi scanning showed hot uptake in the lower portion of the left thyroid lobe . after parathyroidectomy , her calcium , ipth , and polycythemia were normalized . in conclusion , the differential diagnosis of polycythemia and hypercalcemia should also include the possibility of a parathyroid tumor in addition to other neoplasms .

renal cell carcinoma ( rcc ) also known as hypernephroma or adenocarcinoma of renal cells is the most common type of kidney tumour found in adults . it originates in the proximal convoluted tubules , typically affecting men with a peak incidence in 5070 year olds . the tumour is recognized to metastasize to common sites which include the lungs , liver , bone , adrenal glands and the brain . the authors present a case of a gentleman with rcc metastasis to the lower lip after a recent nephrectomy . a 64-year - old male was referred by his general practitioner with concerns over an increasing swelling on his lower lip following unsuccessful control with antibiotics and antifungal treatment . at presentation he reported a 3-week history of an asymptomatic growth on his lower right lip , which he originally attributed to trauma whilst shaving . the lesion was 4 cm in diameter , soft , erythematous with overlying crusting ( see fig . 1 ) . pre - operative rapidly growing tumour in the lower right lip . at the time of presentation the provisional diagnosis based on history and appearance was of a rapidly growing squamous cell carcinoma or keratoacanthoma . an initial biopsy however showed features consistent with a metastatic adenocarcinoma consistent with the previously removed rcc ( see fig . 2 ) . figure 2:photomicrograph of a specimen from the lower lip demonstrating the presence of rcc cells . further staging with a computed tomography of the chest revealed a 15 mm pulmonary nodule in the right upper lobe anterior segment also consistent with metastatic disease . the patient was discussed at the head and neck multidisciplinary team meeting with consultation from his urology team . a decision was made to resect the rapidly growing lip metastases as part of local control of disease for functional and aesthetic reasons . the lip metastasis was excised using a wedge excision with 1 cm clearance margins ( see fig . 3 ) . the lung nodules were later treated with chemotherapy and the patient is still under regular review . figure 3:post - operative following resection and repair of the lower lip . rcc metastasis to the skin can present before diagnosis of the primary site but are typically found after the initial primary tumour identification [ 3 , 4 ] . as in this case metastases can develop after initial nephrectomy . it is reported that 2050% of patients having had a nephrectomy for rcc will develop distant metastases in the future . this potential for distant metastases after primary treatment of rcc is one of the reasons for the poor prognosis in this type of tumour . rcc metastases have been documented in the nasal cavity , lower lip , hard palate , tongue and maxillary sinus . presentation of skin lesions can be varied and lead to a wide variety of differentials . these could include pyogenic granuloma , haemangioma , melanoma , basal cell carcinoma and other vascular lesions . imaging is of little use for skin lesions but can help locate other sites of metastases . one review of cutaneous metastases in rcc showed 90% of patients had secondary tumours in non - cutaneous sites such as the lungs and bones . treatment of skin lesions can vary depending on the site ; however , excision is recommended if the scalp or face is involved . multi - disciplinary team discussion is critical in deciding the mode of treatment of other secondary sites of metastasis , e.g. lung and bone . skin metastases from rcc are rare but some cases have been documented . they can present before or after rcc diagnosis and despite removal of the primary tumour metastases can present many years later . a high index of clinical suspicion is needed and a thorough history and examination should be obtained . patients with known rcc should be monitored due to the likely appearance of metastases at multiple secondary sites .

we present a case of a 64-year - old gentleman who developed a renal cell carcinoma ( rcc ) metastasis to his lower lip following successful treatment of the primary tumour . rcc is a common kidney tumour but skin metastases are considered rare . the authors describe the findings of this case and discuss the presentation , investigations and management of rcc skin lesions .

fibromyalgia ( fms ) is a chronic pain syndrome in which pathogenesis is complex and cure is not known . it affects approximately 10 million adults in the united states with an estimated 90% of diagnoses being reported in women . sequelae of fms include physical and psychological distress , loss of work productivity , reduced quality of life , and increased use of health resources . annual expenditures for the diagnosis and treatment of fms are estimated at approximately $ 20 billion , thus presenting a significant burden to patients , their families , and society [ 2 , 3 ] . a major theory is that inflammatory mediators lead to complex neuroendocrine aberrations of the hypothalamic - pituitary - adrenal ( hpa ) axis . altered levels of cytokines have been associated with symptoms of pain , fatigue , and distressed mood in multiple conditions including painful peripheral neuropathies , hepatitis c , cardiovascular disease , and cancer [ 3 , 5 , 6 ] . thus , it is theoretically plausible that these nonspecific inflammatory mediators may also contribute to the symptoms of pain , fatigue , and distressed mood in fms . to date , results of studies examining the association of cytokine alterations with fms and its symptoms have been mixed [ 79 ] . although researchers have suggested fms as being an inflammatory state related to a dysregulated immune system or altered stress response , the pathophysiological role of cytokines continues to remain unclear [ 9 , 10 ] . because there are no diagnostic markers for fms as well as no identified etiology for the development of fms , researchers are still searching for mechanistic signs to identify those who already have or those who are at risk for developing fibromyalgia . t helper lymphocytes are defined by expressing the cell surface molecule known as cd4 and are subdivided further based on the cytokines that they produce . the discovery of the th1 and th2 paradigm was a pivotal breakthrough in the field of immunology . this balance and counterbalance of inflammatory mediators were delineated and ultimately led to fundamental additions to the knowledge base of cytokine biology we understand today . although th subsets have expanded far beyond the initial discovery to include th17 , th9 , tfh and others probably yet to be discovered , we can still use the th1 and th2 paradigm to better understand inflammation at both the bench and bedside . th1 immune responses are historically associated with antitumor and antiviral responses , whereas th2 are associated with humoral immune responses . however , for example these helper t cell derived cytokines are being examined in disease states such as schizophrenia , depression , and chronic pain . the purpose of the secondary data analysis in this study was to examine cytokine profiles in women in diagnosed with fms and to determine if relationships existed among the secreted cytokines detected in the plasma and to determine if any unique cytokine patterns that emerge correlate with disease symptoms . two separate studies were conducted : one preliminary and one for validation . both were approved by the institutional review board of virginia commonwealth university . our preliminary study involved 42 females , whereas the validation study was comprised of 63 females . inclusion criteria included age 18 , female , diagnosis of fms as defined by the 1990 american college of rheumatology ( acr ) criteria , no known major psychiatric or neurological conditions that would interfere with study participation , and an ability to understand and sign the consent form . the 1990 acr criteria for fibromyalgia require that an individual has both a history of chronic widespread musculoskeletal pain ( more than 3 months ) and the finding of 11 of 18 possible tender points upon physical examination . both studies were completed prior to the publication of the 2010 revised fms diagnostic criteria . exclusion criteria included presence of other systemic rheumatologic conditions , being immunocompromised ( e.g. , diagnosis of hiv / aids ) , receiving corticosteroid treatments , being treated for cancer , and/or being pregnant . self - reported diagnosis of fms was confirmed by the participant 's primary physician or rheumatologist . in both studies , study participants completed self - report form to collect data regarding age , race / ethnicity , marital status , length of time since diagnosis of fms , socioeconomic status and psychiatric , medical and medication history . the 10-item pss measures the degree to which the individual perceived events in her life over the previous month to be stressful . the bpi assesses pain severity ( bpi - s ) and pain interference ( bpi - i ) using 010 numeric scales for item rating ; higher scores indicate increased pain / interference . pain severity indicates the intensity of the pain experienced , while pain interference measures the degree to which pain interferes with activities of daily living . in widespread testing , the cronbach 's alpha reliability ranges from 0.71 to 0.91 . fatigue was measuredusing the brief fatigue inventory ( bfi ) , a simple , 9-item scale that taps into a single dimension of fatigue severity and the interference fatigue creates in daily life . the bfi has demonstrated excellent reliability in clinical trials , ranging from 0.82 to 0.97 . depression was measured using the center for epidemiological studies depression scale ( ces - d ) . the ces - d is a 20-item self - report instrument comprised of four factors assessing cognitive and affective components of depression . this instrument has very good construct validity , internal consistency , and test - retest reliability . blood was centrifuged for separation of plasma , and all specimens were aliquoted immediately , frozen , and stored at 80 until all samples were collected . plasma levels of cytokines such as interleukin ( il ) 1beta ( il-1 ) , il-2 , il-4 , il-5 , il-6 , il-7 , il-10 , il-12p70 , il-13 , il-17 , g - csf , gm - csf , ifn- , and tnf as well as chemokines such as cxcl8 ( il-8 ) , ccl2 ( mcp1 ) , and ccl4 ( mip1 ) were analyzed using the 17-plex bio - rad ( bio - rad ; hercules , ca ) cytokine , chemokine , and growth factor assay kit per manufacturer 's protocol . all data are presented as the mean + / standard error of the mean ( sem ) . post hoc analysis of plasma cytokine levels was performed to determine if patterns appeared that were not specified a priori . given the fact that the patients were of only two races , analysis was first performed to determine if differences existed in the cytokine levels of caucasian women with fms versus african american women with fms . using mann - whitney u tests , 16 of the 17 cytokines assayed displayed no statistical difference among race ( data not shown ) and were thus used for further analysis . power analysis was performed to ensure a 95% confidence level with a confidence interval of 15% . results from this analysis indicated that an appropriate n for cytokines would be equal to or greater than 21 . we then eliminated three more cytokines for further analysis given that the n of patients with detectable levels was below 21 . the values for our fms patients are presented in table 2 . due to the fact that at study initiation normal controls were not collected , we used plasma values reported in the literature [ 2230 ] . while we acknowledge this weakness , we are confident that the analyses are still powerful and will warrant further examination into cytokine deviations present in fms . in order to move forward in the study , we only looked at cytokines that were at least 2x greater in difference than 2sems of the mean . thus , il-4 , il-5 , il-13 , and gcsf were further examined . upon further scrutiny of the remaining 4 cytokines , a stark pattern began to emerge in that these cytokines are associated with th2 immunity . to confirm these findings , these patients were recruited for a different study and thus were completely independent of the subjects enrolled in the initial study . given the drastic differences observed in the original data set for il-4 , il-5 , il-13 , and gcsf , these cytokines were further scrutinized in the independent validation data set . using the aforementioned criteria , we confirmed that il-4 , il-5 , and il-13 are indeed suppressed in patients with fms ( table 4 ) . upon the observation that patients with fms had suppression in th2 cytokines , we began to explore the potential relationship between th2 immunity and the psychometrics obtained from the individuals . while no correlations proved significant among cytokine levels and fatigue , depression , or stress ( data not shown ) , there is a trend towards significance when we compared th2 cytokine levels and pain ( p = 0.07 , spearman 's ) as shown in figure 1 . although not classified as an immune disease by nature , our group as well as others has reported cytokine and immune alterations in patients with fms [ 3 , 7 , 9 , 15 , 23 ] . given the fact that disease etiology is still uncertain , further research is needed in the field to help uncover exact disease pathology in hopes to provide better therapeutic options the millions of fms patients worldwide . the purpose of this analysis was to examine cytokine alterations in patients with fms that were not determined a priori . comparing the observed cytokines in the plasma of these patients we noticed a stark decrease in the amount of th2 cytokines produced ( il-4 , il-5 , and il-13 ) as those values reported by other groups in the literature . we extended our analyses to include a secondary , independent data set and once again this unique cytokine signature was observed . to examine a potential underlying cause for the th2 suppression , we then correlated cytokine levels to pain , stress , fatigue , and depression which are all symptoms shared in the fms spectrum . when pain and th2 levels were compared we observed a trend that approached statistical significance . interleukin 4 , the classic th2 cytokine has been shown to have both anti - inflammatory and analgesic properties in murine models of mechanical as well as having lower gene expression and serum levels in patients with widespread pain syndromes . il-13 exhibits analgesic properties in a murine model of l. major infection , whereas little is reported in regard to il-5 's ability to combat pain . thus , our preliminary findings suggest that further research into the th1-th2 imbalance in fms and its implication in pain are certainly warranted .

fibromyalgia ( fms ) is a chronic pain syndrome with a complex but poorly understood pathogenesis affecting approximately 10 million adults in the united states . the lack of a clear etiology of fms has limited the effective diagnosis and treatment of this debilitating condition . the objective of this secondary data analysis was to examine plasma cytokine levels in women with fms using the bio - plex human cytokine 17-plex assay . post hoc analysis of plasma cytokine levels was performed to evaluate patterns that were not specified a priori . upon examination , patients with fms exhibited a marked reduction in th2 cytokines such as il-4 , il-5 , and il-13 . the finding of this pattern of altered cytokine milieu not only supports the role of inflammation in fms but also may lead to more definitive diagnostic tools for clinicians treating fms . the th2 suppression provides strong evidence of immune dysregulation in patients with fms .

mucormycosis is an acute opportunistic infection usually seen in immunocompromised patients , particularly those with uncontrolled diabetes and leukemia12 . the disease is caused by a saprophytic fungus , mainly mucor or rhizopus , which is considered the most deadly and rapidly progressive form of fungal infection in humans4 . although decaying fruits and vegetables are the main sources of fungal infection , spores of fungi can also be inhaled from dust or air from air conditioners affecting paranasal sinuses567 . patients may also develop cellulites , fever , headache , necrotic turbinates , and nasal discharge . healthy individuals are rarely affected by mucormycosis and those affected have predisposing risk factors such as a history of tooth extraction , pneumonia , severe burns , and gastrointestinal or rhinocerebral infections . mucormycosis is generally observed after the third decade of life891011 . until now there have been no cases reported in patients below the age of five years . the present case report outlines the classical oral manifestations and dental management of mucormycosis in an 18-month - old male . an 18-month - old boy reported to our department with a complaint of extensive ulcer on the hard palate for three days , nasal regurgitation of food , and a foul smell . after one month , the family of the patient noticed a small palatal ulcer for which he was again hospitalized . within three days thereafter the child was referred to our department for palatal prosthesis to prevent nasal regurgitation and aspiration pneumonia . the past medical history was not significant , particularly for uncontrolled juvenile diabetics or hematologic malignant conditions . intraoral examination revealed an extensive palatal ulcer with exposed bone that extended from the mid palatine raphe to the soft palate , leading to palatal perforation.(fig . 1 ) the floor of the mouth , tongue , buccal mucosa , lips , and nasal septum were normal . the primary maxillary central and lateral incisors , primary maxillary left first molar , primary mandibular central incisors , and primary mandibular left first molar were partially erupted.(fig . 1 ) an occlusal radiograph of the maxilla showed a diffuse radiolucency of approximately 34 cm in size in the mid - palatine region . the radiograph also showed a change in position of the tooth bud of the permanent maxillary central incisors.(fig . the histological examination showed a broad , non - septate fungal hyphae with obtuse angle branching and necrotic blood vessels suggestive of mucormycosis.(fig . 3 ) thereafter , the patient was referred to a medical hospital for treatment of mucormycosis . intravenous amphotericin ( 5.5 mg ) was given to the patient for 31 days . during this period , the overall physical health of the patient was weak as he was unable to eat . to facilitate swallowing and to prevent aspiration pneumonia palatal maxillary jaw impression was made using irreversible hydrochloride ( zelgam ; dentsply detrey gmbh , konstanz , germany ) . to prevent aspiration of irreversible hydrochloride ( palatal perforation ) , a thin piece of gauge ( 22 cm ) was placed over the mixed irreversible hydrochloride . the impression was poured in gypsum ii material ( dental plaster ; kalabhai karson , mumbai , india ) . a special tray was fabricated using cold cure resin ( dpi rr cold cure ; dental products of india , mumbai , india ) and the final impression was made using medium body polyvinyl siloxane elastomer ( examix nds ; gc america inc . , alsip , il , usa ) and poured with gypsum ii material to obtain the final cast . in the area of erupting teeth , a spacer of 2 mm was given . next , a palatal prosthesis was fabricated using heat cured acrylic resin ( lucitone 99 ; dentsply international , york , pa , usa ) . thereafter , a 19-gauge wire with right angle bends as shown in fig . 4 , 5 was acralized to the palatal prosthesis using cold cure acrylic resin to avoid trauma to the commissures . as there were no fully erupted teeth , retention of palatal prosthesis was obtained using elastic thread tied to the 19-gauge stainless steel wire.(fig . 4 , 5 ) initially , the child was asked to wear the palatal prosthesis for 30 minutes at an interval of 2 hours for a week . after a week after 15 days , the child was comfortable with the palatal prosthesis and was able to eat properly.(fig . as the child was not fit for general anesthesia , a surgical procedure was postponed . the patient was evaluated every month to assess the palatal prosthesis in terms of erupting teeth . after three months , the patient once again developed foul smell from the infected area . follow - up visits were planned for trimming palatal prosthesis to facilitate eruption of teeth . inhalation of fungi spores or direct wound contamination are the two most common causes for oral mucormycosis . palatal mucormycosis is usually observed when the infection spreads through the nose and paranasal sinuses . when wound contamination is the source of infection , it can manifest in any part of the oral cavity12 . although mucormycosis of the maxilla is more common , it is difficult to predict the source of infection because saprophytic fungus can be cultured from the oral cavity of healthy humans and it is possible that these opportunistic organisms can be implanted into the maxilla during any oral surgical procedure , such as extraction , periodontal surgeries , and abscess drainage5 . in such circumstances , a history of a recent surgical procedure can be used as a diagnostic tool to determine the cause of infection . in the present case , inhalation was the source of infection because there was no history of oral surgical procedure , although the patient had a past hospitalization for pneumonia . there may have been spread of infection through the nasal cavity or sinuses , leading to maxilla involvement via blood . this occurred mainly through the internal maxillary artery or descending palatine artery by thromboembolic processes413 . these opportunistic organisms have an affinity for invading blood vessel walls by direct extension and produce vascular thrombosis1415 . within no time , the tissue supplied by the thrombous vessel undergoes widespread tissue necrosis , exposing the underlying bone413 . the majority cases of oral mucormycosis have been found in the fourth to sixth decades of life891011 . this is because oral mucormycosis mainly target immunocompromised patients such as those with uncontrolled diabetic , leukemia , lymphoma , and aids12 . the same is not always true because healthy humans are also , but rarely , affected by mucormycosis ; this might be due to exposure to various predisposing risk factors . the risk factors could be systemic ( burns , protein energy malnutrition , pneumonia ) or local ( teeth extraction , periodontal surgeries ) . in the literature , huang et al.16 reported a 40-year - old patient with oral mucormycosis and extensive maxillary osteonecrosis secondary to dental extraction . fogarty et al.17 reported a 74-year - old male patient with chronic obstructive pulmonary disease who developed mucormycosis of the maxilla following dental extraction . kumar et al.18 reported mucormycosis of the maxilla in a 65-year - old diabetic and immune - compromised male patient managed with a removable prosthesis . there are other reports of two cases by bakathir19 , in which one case was a 14-year - old male patient with oral mucormycosis of the maxilla and mandible undergoing chemotherapy for acute myeloid leukemia . the second case involved the mandible of a 49-year - old male patient recently diagnosed with type 2 diabetic mellitus with ketoacidosis and underlying undiagnosed acute lymphoblastic leukemia . to the best of our knowledge , this case represents the first report of oral mucormycosis in a healthy 18-monthold child with a predisposing risk factor of pneumonia . can enter the sinuses or lungs and predispose children to sinusitis , middle ear infection , pneumonia , and ultimately death . however , when children are not fit for surgery , palatal prosthesis is the choice of treatment . palatal prosthesis helps with chewing , swallowing , mastication , phonetics , and esthetics , and also prevents regurgitation or aspiration of food or fluids2021 . shah et al.22 reported a case of a 42-year - old female with an acquired maxillary defect as a result of surgical treatment of mucormycosis . the palatal prosthesis given to this patient not only helped with chewing and swallowing but also assisted in improving phonetics and esthetics . gowda et al.23 reported a case of maxillary mucormycosis in which the implant supported a magnetic retentive prosthesis that was given to the patient . the implant supported magnetic unit offered a practical method of improving retention . in the present case , retention of the palatal prosthesis was complicated by two reasons : i ) missing posterior teeth and ii ) compliance from the child , as he was 18 months old . prosthetic rehabilitation of oronasal fistula offers several advantages , such as opportunity for immediate dental restoration without the need for further surgery and its cost effectiveness . however , a study conducted by genden et al.24 documents that mastication , speech , oronasal refluxes , and functional quality of life was superior in patients rehabilitated with vascularized bonecontaining free flap than with palatal prosthesis . rehabilitation of the oronasal fistula using palatal prosthesis should not be the replacement for reconstructive surgeries . however , it can be recommended as an interim treatment option until patients are fit for reconstructive surgeries . rapid necrosis of the maxilla can be either due to infection or may be iatrogenic in nature . the most common oral infections leading to necrosis of bone are bacterial , followed by viral ( herpes zoster ) and fungal ; whereas radiation and trauma are iatrogenic causes2526 . while unlikely in the setting of fungal infections , herpes zoster infection usually presents with a painful rash with vesicular eruptions along the sensory nerve resulting in facial nerve palsy representing ramsey hunt syndrome . more importantly , in herpes zoster infections the teeth rapidly exfoliate , following osteonecrosis in a dermatomal pattern that does not cross the midline . secondly , patients with herpes zoster would have past history of exposure to chicken pox , which is absent in a patient with oral mucormycosis252627 . while immunity after chickenpox infection is thought to be lifelong , a study by weatherall et al.28 showed that antibodies may not be detected after a particular age , which may be a reason why reactivation of herpes zoster usually occurs in older patients . it is assumed that sympathetic nerves that accompany the vasculature cause intense vasoconstriction , leading to ischemia and necrosis of the maxillary bone2930 . bacterial infections may cause rapid necrosis and osteomyelitis , leading to rapid necrosis of bone resembling mucormycosis . however , in bacterial infection , patients usually show erythema , abscess , swelling , pain , discomfort , and loss of function of the affected part , which are rarely observed in mucormycosis31 . if it occurs , the tissue surrounding the affected / necrosed bone is swollen , while erythematous and micro abscesses show discharge of sulphur granules3233 . an iatrogenic cause was ruled out because the patient did not have a history of radiation therapy and did not have a history of recent trauma such as dental extraction . histologic specimens of the necrotic wound surface can diagnose mucormycosis , but the final diagnosis must always be confirmed using molecular pathologic examination . there is a close histopathological resemblance between mucormycosis and aspergilliosis . microscopically , aspergilliosis has septa branching hyphae that can be distinguished from mucormycotic hyphae by a smaller width and prominent acute angulations of branching hyphae34 . despite early treatment , the mortality rate of patients with mucormycosis is very high , ranging from 16% to 100% . cutaneous mucormycosis has a mortality rate of 17% , whereas rhinocerebral , pulmonary , and gastrointestinal mucormycosis have mortality rates of 67% , 83% , and 100% , respectively . however , early medical ( systemic administration of amphotericin b ) and surgical ( radical surgical intervention ) treatment limits the spread of fungal infection to vital regions of the body and improves patient survival by 80%35 . however , as multiple teeth were missing , intraoral retention of the feeding plate was a major problem . , palatal prostheses can be an interim treatment modality to prevent nasal regurgitation and aspiration of food or fluids in patients with palatal perforation . it also assists in swallowing , mastication , and phonetics until the final treatment is provided to the patient .

oral mucormycosis is a fungal infection observed mainly in elderly immunocompromised patients . in rare instances , the disease occurs in healthy individuals and those patients that are below preschool age . although this condition mainly involves the maxilla , it may also manifest in any part of the oral cavity based on the source of infection . mucormycosis of the maxilla spreads rapidly , leading to necrosis of the palatal bone and palatal perforation . such patients are usually rehabilitated using bone grafting or free flap surgeries . however , when surgeries are delayed , palatal prosthesis is an interim treatment modality that can prevent nasal regurgitation and aspiration of food or fluids . palatal prostheses also help with mastication , speech , and swallowing . the present case describes a rare case of oral mucormycosis in an 18-month - old male involving the maxilla that was managed by palatal prosthesis .

mucoepidermoid carcinoma ( mec ) is a malignant epithelial tumor first studied and described by stewart , foote and baker in 1945 . rarely , it may occur intraosseously from the epithelial lining of the odontogenic cyst and/or epithelial remnants of ectopic salivary glands . mec is the most commonly occurring malignant salivary gland neoplasm , comprising 2.815% of all salivary gland tumors . aberrant salivary gland neoplasms arising within jaws as primary central bony lesions are extremely rare , comprising 24.3% of all mecs reported . most primary central mec lesions occur in the mandible , but are rare in the maxilla . here , we report a rare case of a primary intraosseous mucoepidermoid carcinoma ( pioc ) in the posterior palatine region in a 18-year - old male patient , which was challenging because of the clinical presentation as a cystic lesion . an 18-year - old male patient reported to the outpatient department ( opd ) of the hospital with a chief complaint of swelling in the left maxillary posterior region since 2 years . swelling was small in size initially and asymptomatic but gradually increased in size and was painful . also complains of pus drainage for which antibiotics were prescribed , which temporarily relieved symptoms . on examination , soft , fluctuant , tender swelling of approximately 3 2 cm in the left palatal region opposite the permanent maxillary premolar molar region was observed [ figure 1 ] . occlusal view radiograph revealed a well - defined unilocular radiolucency in relation to premolar molar region with sclerotic margins [ figure 2a ] . reformatted computed tomography ( ct ) image revealed palatal bone perforation extending to the alveolar process between permanent maxillary first and second maxillary molar on the left side [ figure 2b ] . preoperative view showing swelling of about 3 2 cm in left palatal region opposite premolar molar region ( a ) occlusal view showing a well - defined unilocular radiolucency in the left posterior palatal region extending from left first premolar to molar , with smooth , corticated margins ( b ) reformatted computed tomography ( ct ) image axial view showing palatal bone perforation extending to alveolar process between first and second molar on left side on evaluation of clinical and radiographic features , a provisional diagnosis of a cystic lesion mainly a radicular cyst was considered . histopathological examination revealed large number of haphazardly dispersed cystic ( duct like ) spaces filled with eosinophilic material ; surrounded by tumor nests ; composing of mucous and squamoid ( epidermoid ) cells in variable combinations ; scanty and hyalinized stroma ; and in few areas extravasated mucin pools [ figure 3a ] . cystic spaces were lined by mucus cells in single or double rows and contained eosinophilic material which was periodic acid schiff pas - positive [ figure 3b ] . stratified squamous epithelium of varying thickness with intraepithelial clefts and pas mucous cells in superficial layer could also be appreciated [ figure 3c ] histopathological diagnosis of a central low - grade mec of the left posterior palatal region was made . ( a ) photomicrograph showing sheets of epidermoid cells and mucus - secreting cells , a few areas of cystic cavities lined with mucussecreting cells ( h&e stain , 100 ) ( b ) photomicrograph showing cystic spaces that are lined by mucus cells in single or double row and were containing eosinophilic material which was pas positive ( h&e stain , x400 ) ( c ) photomicrograph showing cystic cavity lined by stratified squamous epithelium of varying thickness with intraepithelial clefts and superficial layer of mucus cells ( h&e stain , x40 ) a planned treatment of the lesion was done , which included right maxillectomy with neck dissection . the patient has been on regular follow - up for more than a year without any evidence of recurrence . primary intraosseous mec is an uncommon lesion which was first reported and described by leep in 1939 . waldron and mustoe suggested that intraosseous mec be included in the primary intraosseous carcinomas of the jaws as type 4 . primary central mec has been reported to be present in the first to seventh decade ; however , cases occurring in the fourth and fifth decades are most common , but in the present case , the patient was of 18 years . in children , gender ratio and the mandible to maxilla ratio is 1:1 , whereas in adults , mec is slightly more common in females and occurs in the posterior mandible , but in this case the patient was a male and the site was the posterior palate . pain , paresthesia , numbness and tooth mobility are usually occasional and late findings . according to the criteria of seifert and sobin and auclair et al . , the tumors are graded for malignancy as follows : ( 1 ) low grade : highly differentiated neoplasia with a predominance of macro and microcysts . presence of intermediate and mucin - producing cells , ( 2 ) intermediate grade : predominance of intermediate cells and a few cysts . presence of mucin - producing cells and islands of epidermoid cells , ( 3 ) high grade : poorly differentiated neoplasia with predominance of intermediate and epidermoid cells in solid blocks . histopathologically , low - grade mec s are composed of cuboidal to columnar mucus secreting cells arranged around microcystic structure with intermingling of epithelial or intermediate cells with few epidermoid cells . coalescence of small cysts into large cystic spaces is typical of a low - grade malignancy . the pathogenesis of the central mec has been discussed extensively and various possible origins have been considered , including : ( 1 ) entrapment of the retromolar mucous glands within the mandible , which later undergo neoplastic transformation , ( 2 ) embryonic remnants of the submandibular and sublingual glands trapped within the mandible during development , ( 3 ) neoplastic transformation and invasion from the lining of the maxillary sinus , ( 4 ) neoplastic transformation of the mucus - secreting cells from the epithelial lining of the dentigerous cyst associated with impacted third molars , ( 5 ) neoplastic transformation of entrapped minor salivary glands within the maxilla . however , central mec of the maxilla is a rare lesion and the pathogenesis has not been extensively discussed . the possibilities of the origin of the central mec in this case may be : ( 1 ) neoplastic transformation and invasion from the lining of the maxillary sinus , ( 2 ) neoplastic transformation of entrapped minor salivary glands within the maxilla . radiographic examination is important to develop a differential diagnosis , evaluate categorization as a central jaw lesion , the extent of the lesion and involvement or encroachment of adjacent vital structures . brookstone and huvos suggested a three - grade classification for intraosseous mec : grade 1 , without expansion and rupture of cortical plate ; grade 2 , with expansion but without rupture of cortical plate ; and grade 3 , with rupture of cortical plates or presence of regional metastasis . the primary treatment modality for patients with central intraosseous mec is surgery , including curettage , enucleation , marsupialization and wide local excision . as a rule , even as low - grade tumors , mec should be managed by wide local resection , en bloc resection , or hemimandibulectomy , or hemimaxillectomy . neck dissection is usually part of the treatment in cases where metastasis to the cervical nodes is suspected . these tumors usually show a good overall prognosis , but central mec cases should be followed up for a longer period up to 10 years , due to the possibility of late recurrence or regional metastasis . however , death may occur as a result of extension into vital structures such as the base of the brain . very little information is available in the literature about the recurrence rate of central mec . due to rare occurrence of central mec , we lack systematic data and criteria for diagnosis . in 1974 , alexander et al . introduced the following criteria for diagnosing central mecs include : ( a ) presence of a radiographic distinct osteolytic lesion ; ( b ) positive mucicarmine staining ; ( c ) absence of rupture of one or more cortical plates ; ( d ) clinical and histological exclusion of a metastasis or an odontogenic lesion ; ( e ) exclusion of the origin from a soft tissue salivary gland ; ( f ) histologic confirmation , which was similar to brookstone and huves criteria . there are still some contradictions in these criteria as cases have been diagnosed with cortical plate perforation and invasion of nearby tissue . in conclusion , treated cases of central mec should be followed up for a longer duration to detect late local recurrence and regional metastasis .

primary intraosseous mucoepidermoid carcinoma ( pioc ) of the jaw bones is an extremely rare malignant salivary gland tumor , comprising 23% of all mucoepidermoid carcinomas reported . it is commonly seen in the posterior part of the mandible ; its occurrence in the maxilla is rare . they have been reported in patients of all ages , ranging from 1 to 78 years , with the overwhelming majority occurring in the 4th and 5th decades of life . they are histologically low - grade cancers and radiographically seen as uniocular or multiocular lesions . we report a rare case of pioc in posterior palatal region in 18-year - old male .

genitourinary tuberculosis ( tb ) is the second most common extrapulmonary form of tb after lymphadenopathy . genitourinary tb accounts for 27% ( range 1441% ) of nonpulmonary cases and is usually a late complication of pulmonary tb . renal damage due to caseous destruction of renal parenchyma or obstructive uropathy is well known . made the first clinical description of granulomatous interstitial nephritis ( gin ) as the only manifestation of renal tb . overall , data on gin as the only manifestation of renal tb is limited to case reports and the most common clinical presentation is chronic renal insufficiency . interestingly , most patients of gin express active extrarenal foci , often pulmonary or peritoneal . we report a case of tuberculous gin associated with active cervical lymphadenitis and review the pertinent literature on gin due to tb in immunocompetent individuals . a 24-year - old previously healthy man developed fever and left cervical lymphadenopathy for which he was prescribed antibiotics ( erythromycin ) and antipyretics ( paracetamol ) for 2 weeks . he was also prescribed two antihypertensive drugs and advised further evaluation for proteinuria , which he deferred . two weeks later , he was referred to our center for fever , lymphadenopathy and recently detected renal failure . there was no history of treatment or contact with tb , loss of weight , red urine , skin rash , joint pains or use of native medicines . physical examination revealed pallor , bilateral pedal edema , pulse rate 92/min , blood pressure of 160/100 mmhg , temperature 38c and respiratory rate 15/min . g / l ) was decreased and erythrocyte sedimentation rate was elevated to 94 mm / h . white blood cell count of 10.9 10/l ( 410 10/l ) with neutrophils 72% , lymphocytes 23% , eosinophils 3% and monocytes 2% , platelet count 205 10/l ( 150400 10/l ) and reticulocyte count 1.2% were normal . serum creatinine was increased to 660 mol / l ( 44140 mol / l ) and the estimated four - variable modification of diet in renal disease- glomerular filtration rate was 9.59 ml / min/1.73 m . serum uric acid , calcium , inorganic phosphorus , liver function tests and lipid profile were within normal limits . there were 01 white blood cells per high power field , 810 red blood cells per high power field and no evidence of casts on microscopic examination of the urine sediment . antinuclear antibody ( negative ) , anti - dsdna ( 12.25 , 030 iu / ml ) and anti - gbm titers ( <3 cervical lymph node aspiration cytology showed granulomatous necrotizing inflammation with acid - fast bacilli ( afb ) suggestive of tb . he was initiated on antitubercular treatment ( att ) , maintenance hemodialysis and ultrasound - guided percutaneous renal biopsy were done to identify the cause of rapidly progressive renal failure ( rprf ) . on light microscopy , 19 of the 22 glomeruli were normal and 3 showed global sclerosis . interstitium showed lymphoid aggregates with well - formed epitheloid granulomas along with intense mononuclear infiltrate comprising of lymphocytes , histiocytes and plasma cells ( figures 1 and 2 ) . immunofluorescent micrography revealed absence of specific immunoglobulin or complement ( c3 , c1q ) deposits . afb were not seen on ziehl nielsen staining and cultures for tubercle bacilli in renal biopsy were negative . on further evaluation , three samples of urine microscopy and culture for mycobacterium were negative and bone marrow examination was unremarkable . mantoux test was negative . however , urine dna - polymerase chain reaction ( pcr ) for mycobacterium tuberculosis was positive . he was started on steroid ( oral prednisolone 1 mg / kg / day ) together with att . six months since the onset of illness , his lymphadenopathy resolved but renal failure did not recover . steroids were tapered and withdrawn after 3 months and the patient is now on att and maintenance hemodialysis through radial arteriovenous fistula . renal biopsy showing epithelioid cell granuloma ( a ) , sclerosed glomerulus ( b ) , atrophic tubules ( c ) and interstitial inflammation ( d ) ; ( hematoxylin and eosin stain ; 20 magnification ) . ( a , b ) epithelioid cell granuloma surrounded by mantle of lymphocytes ( hematoxylin and eosin stain ; 40 magnification ) ( epithelioid cell marked with arrow in figure 2b ) . the interesting features in our patient were ( i ) coexistence of active renal and cervical lymph node tb in a 24-year - old male , ( ii ) gin presenting as rprf and nephrotic range proteinuria and ( iii ) diagnosis was made by positive urine pcr for m. tuberculosis , when afb could not be demonstrated in urine or renal biopsy . renal tb is rarely present in patients < 25 years of age and can occur during primary infection or pulmonary reactivation . if there is a history of pulmonary infection , the latency period from the time of the initial infection to diagnosis with renal disease ranges from 5 to 40 years . coexistence of active renal and cervical lymph node tb is a deviation from the normal time frame for development of renal tb . similar case reports of gin with pulmonary and peritoneal foci are described , but to the best of our knowledge , this is the first report of cervical adenitis in a patient with gin due to tb . it is possible that our patient had a primary infection involving the lymph node and the kidneys . another remarkable feature is the clinical presentation of hypertension , rprf and nephrotic range proteinuria , mimicking a glomerular disease . similar presentation of gin has so far been reported in only one other patient and there is no possible explanation for the nephrotic proteinuria seen in these patients . such presentations may be seen with non - steroidal anti - inflammatory drug - induced acute interstitial nephritis but in our case , detailed evaluation for other causes of gin like drugs , infections and systemic conditions like sarcoidosis , wegener s granulomatosis revealed negative results . urine cultures ( three to five samples ) of the first urine of the day are considered gold standard in diagnosis of genitourinary tb but are often negative . in comparison to urine cultures , pcr primers and probe derived from m. tuberculosis species - specific dna insertion sequence , is6110 has an overall sensitivity of 95.59% and specificity of 98.12% in the diagnosis of genitourinary tb . summary of case reports with gin due to renal tba esrd end - stage renal disease ; na not available ; neg negative ; cr complete recovery ; pr partial recovery . other diagnostic techniques . gin is seen in only in 0.50.9% of renal biopsy and of this 5% is caused by infections [ 1113 ] . often , features on biopsy do not help to determine the cause of gin . afb may be demonstrated in the renal biopsy tissue with ziehl nielsen or auromine - o stain but is positive only in 3243% of specimens . we suspected tb as the cause of gin due to the presence of afb in the cervical lymph node and subsequently , a positive urine dna pcr for m. tuberculosis helped to confirm the diagnosis . att ( two , three or four drugs of isoniazid , rifampicin , pyrazinamide and ethambutol ) has been used to treat all these patients . it has been observed that concomitant use of steroids bring about favorable recovery in these patients . since granulomatous inflammation heals by fibrosis ; steroids may decrease the inflammation and thereby reduce the amount of interstitial fibrosis . reported a similar case presenting as rprf with nephrotic proteinuria and obtained complete renal recovery with a combination of att and steroids . remarkably , the majority of these ( rare ) cases were observed in patients from india or black africans or african - americans . this could be due to a genetic predisposition causing varied host immune response or due to variations in phage type of m. tuberculosis , tb must be considered as a cause of gin particularly in patients with asian or african origin . urine pcr can have a significant role in the diagnosis of culture negative renal tb . steroids in combination with att should be considered as the first - line treatment for gin due to tb .

granulomatous interstitial nephritis ( gin ) is a rare manifestation of renal tuberculosis ( tb ) . we report a case of rapidly progressive renal failure ( rprf ) , granulomatous inflammation of cervical lymph node and gin as presenting manifestations of tb . aspiration cytology of cervical lymph node showed granulomatous necrotizing inflammation with acid - fast bacilli ( afb ) . the renal biopsy and urine specimen did not show afb . urine polymerase chain reaction ( pcr ) for mycobacterium tuberculosis was positive . we observe that gin due to tb can present as rprf and emphasize the value of pcr - based techniques in making a correct diagnosis .

the use of emerging technologies such as smartphones and tablets offers researchers and coaches opportunities to undertake physical performance assessments in the field , rather than the sports science laboratory . current smartphone technology includes advanced computing capacity , inertial sensors , a global positioning system , and high speed video capacity . recently developed smartphone applications ( apps ) for sport have capitalised on these advances and are shown to be valid and reliable tools to assess lower limb functional performance during countermovement jump [ 2 , 3 ] , drop jump , balance [ 4 , 5 ] , and maximal strength tests . however , while the assessments of jumping performance and muscular strength are important characteristics of human performance , sprint speed is critical for success in a range of activities including football and netball . yet unlike other physical performance characteristics , the assessment of sprinting capacity has received relatively less attention in the peer - reviewed literature . although fully automated timing systems using pressure sensitive starting blocks or photo finish recording systems remain the gold standard for the assessment of sprint running performance , such systems are rarely found outside athletic venues . they lack portability and are cost prohibitive to many teams , coaches , and athletes . dual beam photocell systems are increasingly used due to their lower cost , portability , and capability to wirelessly send data to a handheld receiver . dual beam systems exhibit greater accuracy compared to single - beam systems and have been recommended over single - beam systems . recent developments in error detection algorithms to address some of the shortcomings associated with single - beam systems have shown promising results . for example , the smartspeed ( fusion sport , coopers plains , australia ) , single - beam system with error detection , has been shown to comply with australia 's national sport science quality assurance standards , which require sprint testing systems to achieve a maximal typical error of 0.05 seconds over 30 m. d'auria and colleagues showed that the smartspeed system achieved a typical error of 0.03 seconds at distances of 5 , 10 , and 20 m. studies also show that video analysis of running performance has been shown to closely match fully automated timing systems and dual beam photocell systems , even when recorded at 50 or 100 hz . therefore , even low - speed video capture may represent a low - cost and portable option to assess running performance . recent innovations in smartphone technology have seen video capture speeds up to 240 hz on iphone 6 . coupled with improved image detection algorithms and computing power , smartphone apps have been developed to allow coaches and researchers to determine running speed using these popular and low - cost tools . speedclock uses the ios device camera to detect and record motion and , with the user input of a reference distance , calculates speed . speedclock can be used on a single standalone device , with the reference frame defined by the edges of the image detection field , or connected via bluetooth with a second ios device to record time over longer distances . although apps such as speedclock are purported to accurately record sprint performance , to the best of our knowledge , there are currently no studies which demonstrate the validity of speedclock . such studies are important in confirming the usefulness of emerging technologies and are of great interest to athletes , coaches , and researchers . therefore , the purpose of the present study is to examine the validity of the speedclock app using timing lights as a reference . participants were a convenience sample of 24 recreationally active females ( > 18 years ) recruited via personal discussion with investigators . an information sheet outlining the purpose , risks , and benefits of participation prior to inclusion in the study , participants were screened for musculoskeletal , neurological , or cardiorespiratory concerns which would contraindicate the performance of maximal sprinting , using stage one of the adult preexercise screening system . written informed consent was obtained from all participants prior to the commencement of data collection . participants stature was measured using a seca 213 portable stadiometer ( seca gmbh , hamburg ) and weight determined using a seca robusta 813 portable scale ( seca gmbh , hamburg ) . all participants underwent a standardised warm - up comprising five minutes of light jogging , static and dynamic stretching , and a series of submaximal sprints . participants then performed four maximal effort 20 m sprints , separated by five minutes of passive rest . participants started on a line between the first set of timing lights and commenced the sprint in their own time . standardised instructions were provided regarding maximal effort and to decelerate only when past the final set of timing lights . all sprints were performed in an indoor sports stadium ( ~26c , 50% rh ) on a suspended timber floor . sprint times were recorded using smartspeed pro timing lights ( fusion sport , coopers plains , australia ) , with gates at zero , 10 , and 20 metres . this system uses a single - beam design to improve battery life and ease of setup , however , incorporates novel error detection algorithms to reduce false triggers . in the event of multiple triggers , sprint times were converted to mean sprint velocity ( m / s ) for 010 m , 1020 m , and 020 m using a standard linear motion equation ( v = d / t ) . to examine the validity of the speedclock ios application , the app was installed on an iphone 5c running ios version 9.2.1 ( apple corporation , cupertino , ca ) , which records video at 60 frames per second . in speedm ( motion ) mode , the app incorporates motion detection zones at each edge of the image which trigger and terminate data collection ( figure 1 ) . for the present study , to ensure repeatability of the method and to minimise movement of the device , iphone was mounted in a plastic tripod mount on a velbon ex 330 tripod ( velbon corporation , tokyo , japan ) , with the camera lens 1.0 m from the ground . the tripod was positioned 10.5 m perpendicular to the midpoint between the timing lights at 10 and 20 m , such that the motion detection zones of the application were aligned with the 10 and 20 m timing lights . the tracking sensitivity on the app was set to 0.92 ( arbitrary units ) to avoid false triggers from background movement . in this manner , as the participant ran through the timing lights at 10 m , motion detection triggered data acquisition . similarly , as the participant ran through the timing lights at 20 m , motion detection terminated data acquisition . mean velocity ( m / s ) for the flying 10 m sprint was displayed on - screen and manually recorded for later analysis . all four flying 10 m sprints recorded simultaneously using timing lights and the speedclock application were used for analysis . independent sample t - tests ( two - tailed ) were used to identify differences in average velocity obtained from the timing lights and speedclock app . between - device agreement was examined using intraclass correlation coefficients ( icc 2,1 ) with 95% confidence intervals ( 95% ci ) and interpreted according to munro . bland - altman plots were then constructed using microsoft excel ( microsoft corporation , redmond , usa ) to visualise the level of agreement between average velocity obtained from the timing lights and the speedclock app . with the exception of bland - altman plots , all statistical analyses were performed using statistical package for the social sciences ( spss ) , version 22 ( ibm corporation , chicago , ill ) . twenty - four recreationally active females ( mean age 26.6 5.4 years , mean body mass index 25.0 3.1 kgm ) provided informed consent and participated in the study . independent samples t - test showed no statistically significant difference in mean flying 10 m sprint velocity between data from the timing lights ( 6.47 0.49 sec ) and the speedclock app ( 6.31 0.48 sec ) ( t(190 ) = 1.83 , p = 0.07 ) . intraclass correlations ( icc 2,1 ) showed excellent agreement in mean flying 10 m sprint velocity between data from the timing lights and the speedclock app ( icc ( 2,1 ) = 0.93 , p = 0.00 , 95% ci 0.640.97 ) . bland - altman plots to visualise the difference between mean flying 10 m sprint velocity determined by timing lights and speedclock app are shown in figure 3 . a small systematic bias ( mean difference = 0.13 seconds ) shows the app consistently gave slightly lower values compared to the timing lights . to the best of our knowledge , no other studies comparing app - based measures of sprint running speed have been published in the peer - reviewed literature . as such this study makes an important contribution to the exercise and sports science domain . the findings from the present study suggest that the speedclock app installed on an iphone 5c recording video at 60 frames per second is a valid measure of average flying 10 m sprint velocity in recreationally active females . a number of other studies have examined the use of video technology in determining sprint running performance . for example , haugen and colleagues reported no systematic variation between brower dual beam infrared timing and dartfish - based video analysis of 40 m sprint times in national level male and female track athletes . in another study , harrison and colleagues reported the validity of video recorded at 50 hz and at 100 hz , to determine mean sprint velocity over 3 m. no statistically significant differences and excellent iccs were observed between a laser sports measurement system and video recorded at either frame rate . however , at medium to fast sprinting velocities , video recorded at 100 hz compared more favorably with laser - derived measures than video recorded at 50 hz , due to the higher sampling rate . in the present study , mean flying 10 m sprit velocity recorded using the speedclock app was not significantly different to that recorded using dual beam timing lights . moreover , iccs showed excellent agreement with bland - altman plots indicating only a small degree of systematic bias , with a mean difference of 0.13 seconds ( 1.97% ) . although this level of mean difference may be significant with respect to changes in sprint performance over time , these values are likely within expected test - retest reliability of sprinting performance , and researchers should examine the smallest worthwhile change in performance to determine if a real change has occurred . one notable difference between the timing lights and the speedclock app is that the timing lights report data to three decimal places , while the speedclock app reports data to two decimal places . therefore , we reran our icc analysis using velocities based on timing light data under similar conditions , firstly truncated and then rounded to two decimal places . the resultant analyses were not substantially different from our initial findings ( icc ( 2,1 ) = 0.92 , p = 0.00 , 95% ci 0.680.97 , and 0.93 , p = 0.00 , 95% ci 0.640.97 , resp . ) and do not change our interpretation of the validity of this app . emerging technologies such as the use of smartphone applications in sport have the potential to provide athletes , coaches , and researchers with additional data not otherwise available with a single laboratory based system . for example , when using speedclock , an image of the participant can be captured midway through the image capture field . this may provide valuable data to assess running technique , and , since the image is stamped with the mean velocity , it serves as a permanent record of the attempt . unlike gps - based system , speedclock is video - based and therefore can be used indoors . finally , unlike manual stopwatch timing , the data is not affected by parallax error when standing at the start or finish line , and in the case of speedclock , two devices can be used together in a manner not unlike timing gates . in general , smartphone - based apps for sprint performance assessment offer low - cost , portability , and ease of use , not otherwise available with laboratory based systems , and their widespread applicability to training , rehabilitation , and research warrants further investigation . a strength of the present study is the use of bland - altman plots to examine systematic bias between methods used to determine sprint velocity . however , a potential limitation is the use of the iphone 5c , which records video at 60 frames per second . future studies should examine the use of high speed video on newer ios devices as the increased resolution afforded by the higher frame rate may improve accuracy and reduce systematic bias . future studies should also examine other speed recording apps on android operating systems , since , at the present time , speedclock is only available on ios and , although ios devices are widely utilised , they are not the sole software platform . finally , future studies should examine the validity of the speedclock or similar apps over shorter and longer distances and in clinical populations . speedclock for ios devices is a low - cost , valid tool for the assessment of mean flying 10 m sprint velocity in recreationally active females . further studies are required in different populations and settings to generalise the findings from the present study .

recent innovations in smartphone technology have led to the development of a number of applications for the valid and reliable measurement of physical performance . smartphone applications offer a number of advantages over laboratory based testing including cost , portability , and absence of postprocessing . however , smartphone applications for the measurement of running speed have not yet been validated . in the present study , the ios smartphone application , speedclock , was compared to conventional timing lights during flying 10 m sprints in recreationally active women . independent samples t - test showed no statistically significant difference between speedclock and timing lights ( t(190 ) = 1.83 , p = 0.07 ) , while intraclass correlations showed excellent agreement between speedclock and timing lights ( icc ( 2,1 ) = 0.93 , p = 0.00 , 95% ci 0.640.97 ) . bland - altman plots showed a small systematic bias ( mean difference = 0.13 seconds ) with speedclock giving slightly lower values compared to the timing lights . our findings suggest speedclock for ios devices is a low - cost , valid tool for the assessment of mean flying 10 m sprint velocity in recreationally active females . systematic bias should be considered when interpreting the results from speedclock .

rectal varices are not an uncommon manifestation in cirrhosis with portal hypertension . however , serious bleeding from rectal varices is uncommon . because of its rarity , several authors have reported the utility of transjugular intrahepatic portosystemic shunt ( tips ) placement to control such bleeding when local therapy , such as endoscopic sclerotherapy or banding , fails [ 2 , 3 , 4 , 5 ] . however , we experienced a case of massive bleeding from large rectal varices that could not be controlled by tips placement , despite normalization of the portosystemic pressure gradient . furthermore , we observed rapid decompensation of the cirrhosis that led to severe encephalopathy and death after the tips placement . we report this case to highlight and discuss potential pitfalls of tips placement when using this technique to treat rectal variceal bleeding . a 59-year - old man with a history of alcoholic cirrhosis was hospitalized at an outside facility for massive hematochezia and fainting . he underwent upper endoscopy and tagged red blood cell scan , both of which were negative for active bleeding . a computed tomography of the abdomen was performed and did not reveal the source of the gastrointestinal bleeding ; a nodular liver with splenomegaly consistent with liver cirrhosis was seen , and a markedly dilated inferior mesenteric vein was also noted . during his 5-day hospitalization , he had approximately 1015 bloody bowel movements and received a total of 6 units of packed red blood cells and 2 units of fresh frozen plasma . the patient was then transferred to our institution for further management of his persistent hematochezia . his admission laboratory tests showed a hemoglobin level of 8.3 g / dl , a serum ammonia level of 45 g / dl , a total bilirubin level of 2.8 mg / dl and a model for end - stage liver disease ( meld ) score of 18 . however , he had another episode of massive hematochezia on the following day , with a decrease in hemoglobin level to 5.0 g / dl . therefore , the decision was made to proceed with emergent tips placement . a tips was successfully created with a 10 90 mm viatorr stent - graft ( gore & associates , flagstaff , ariz . this resulted in a decrease in the portosystemic pressure gradient from 12 to 6 mm hg . after the tips placement , brisk hepatopetal flow through the tips was seen on the portogram . despite the successful normalization of the portosystemic pressure gradient , he had another episode of massive bleeding on the following day . an angiogram of the superior rectal vein was performed , which showed tortuous large rectal varices with brisk hepatofugal flow ( fig . 2 ) . flow into the internal iliac vein branches was observed , confirming portosystemic shunting . embolization of the rectal varices was then performed , which necessitated multiple coils , 1 ml of n - butyl cyanoacrylate glue , 5,000 units of thrombin and several sheets of gelfoam ( fig . 3 ) . after the procedure , the patient did not have any further bleeding episodes , and the serial hemoglobin levels remained stable . the remaining hospital course was significant for rapid decompensation of cirrhosis , with an increase in the total bilirubin level to 8.7 mg / dl , the ammonia level to 121 g / dl and the meld score to 28 . he developed acute hypoxic respiratory failure secondary to multiple causes , including progressive liver failure . this case highlights two potential pitfalls of tips placement when using this technique in the treatment of rectal variceal bleeding . first , tipss may not be always successful in controlling serious bleeding from rectal varices , despite optimal portosystemic pressure reduction . we observed rebleeding after the tips placement despite a 50% reduction in the pressure gradient , with a final pressure gradient of 6 mm hg . some authors have also reported that a tips failed to control bleeding from rectal varices [ 6 , 7 ] . recurrent bleeding from rectal varices after tips placement may be related to the large size of the varices . rectal varices , unlike esophageal varices , are true veins and are likely to have larger diameters . according to laplace 's equation , the tension in the varix wall is proportional to the radius of the vessel for any given transmural pressure . , it is recommended to decrease the portosystemic pressure gradient to < 12 mm hg in esophageal variceal bleeding . however , this targeted pressure gradient may not be adequate for controlling bleeding from rectal varices . some authors advocate embolization of the rectal varices at the time of tips placement , even if normalization of portal hypertension is achieved [ 7 , 10 ] . given the successful control of bleeding following embolization in our case , concomitant variceal embolization at the time of tips placement may be necessary to control massive bleeding , especially when the rectal varices are large . second , tipss can be associated with life - threatening complications that can possibly lead to early mortality . since the first application of a tips in the treatment of recurrent bleeding from anorectal varices in 1993 , a tips alone or a tips combined with variceal embolization has been reported to be useful in controlling such bleeding without significant morbidity or mortality [ 2 , 3 , 4 , 5 , 10 ] . however , tipss are inherently associated with risks of procedure - related complications , hepatic encephalopathy and progressive liver failure . godil and mccracken reported a case of rapid liver function decompensation and encephalopathy following tips placement in a 73-year - old woman with rectal variceal bleeding . although no recurrent bleeding was seen , the patient died 4 weeks after the tips procedure . according to the american association for the study of liver diseases practice guidelines , tips is recommended only in the absence of other options for patients with 30-day predicted mortality ( meld > 1518 or serum bilirubin > 4.0 mg / dl ) . although emergent tips placement can be the last resort to control massive bleeding from rectal varices , even in high - risk patients it must be used cautiously because it can lead to life - threatening complications , as seen in our case . despite its minimally invasive nature , tips placement has been associated with a 30-day mortality rate as high as 36% when it is used to control acute gastroesophageal variceal bleeding . one alternative to tips placement in high - risk patients may be the percutaneous embolization of rectal varices via a transhepatic approach . although reports on the use of this technique for bleeding rectal varices are limited , it could be useful in controlling an initial acute bleeding and in stabilizing a patient without affecting liver function . however , collaterals can redevelop after embolization , and recurrent bleeding requiring repeated intervention has been reported . some authors have reported several cases of obliteration of bleeding large rectal varices with the use of balloon - occluded antegrade transvenous sclerotherapy with or without coil embolization [ 14 , 15 ] . in this technique , a sclerosing agent , such as ethanolamine oleate , was injected into the varices while the superior rectal vein was occluded using a balloon catheter . further research is needed to determine its efficacy . in conclusion , although tipss have been reported to be useful in controlling bleeding from rectal varices , there are potential pitfalls in using this technique to treat rectal variceal bleeding . a tips may not always be successful in controlling massive bleeding from large rectal varices even after normalization of portal hypertension , and concomitant variceal embolization may be necessary . furthermore , tipss can be associated with life - threatening complications that may lead to early mortality .

in patients with portal hypertension , bleeding from rectal varices is rare . however , it can be life - threatening . we report a case of massive bleeding from large rectal varices in a 59-year - old man with alcoholic cirrhosis . emergent transjugular intrahepatic portosystemic shunt ( tips ) placement was performed following failed local endoscopic therapy . despite normalization of the portosystemic pressure gradient , the patient had another episode of massive bleeding on the following day . embolization of the rectal varices via tips successfully stopped the bleeding . after the procedure , rapid decompensation of the cirrhosis led to severe encephalopathy , and death was observed . although tipss have been reported to be useful in controlling bleeding from rectal varices , our case illustrates the potential pitfalls in using this technique in the treatment of rectal variceal bleeding . tipss may not be always successful in controlling massive bleeding from large rectal varices , even after normalization of portal hypertension . tipss can also be associated with life - threatening complications that may lead to early mortality .

diabetes mellitus ( dm ) currently affects approximately 8.3% of the population and more than 79 million people have prediabetes . diabetics are more susceptible to infections due to increased glucose levels and suppressed immune response as well as the neuropathy and decreased blood flow to extremities that lead to slow - healing wounds . for example , approximately 2025% of the 23.6 million diabetics in the usa will develop foot ulceration during the course of their disease . a quarter of these patients will develop infections , often with antibiotic resistant bacteria , that will necessitate amputation of their foot or leg . more than one - half of the lower extremity amputations in the usa occur among people with dm ( approximately 82,000 amputations / year ) and are associated with significant morbidity and mortality . for example , up to 50% of patients die within the first 18 months following amputation [ 3 , 5 ] , and survivors face significant lifestyle impairments and frequent loss of their contralateral extremity within 5 years . amputation in diabetic patients is usually precipitated by the development of a chronic wound , clinically defined as a wound that fails to heal within 30 days . infection of these wounds , often by multidrug resistant organisms ( mdro ) , makes them recalcitrant to healing . much is known about the epidemiology of diabetic chronic wound infections due to countless studies surveying the associated microorganisms . although the specific percentages differ from study to study , the most predominant aerobes are staphylococcus aureus , coagulase - negative staphylococci , streptococcus species , enterococcus species , corynebacterium species , enterobacteriaceae , and pseudomonas aeruginosa . most of these infections are polymicrobial , and about half harbor both aerobes and anaerobes . the most predominant anaerobes are gram - positive cocci , prevotella species , porphyromonas species , and bacteroides fragilis . an increase in the occurrence of mdro chronic wound infections in the dm population has been noted over the last decade and has been primarily attributed to methicillin resistant s. aureus ( mrsa ) , but antibiotic resistant gram - negative organisms , particularly p. aeruginosa , have also been implicated [ 810 ] . mdro are defined as microorganisms that are resistant to two or more classes of antimicrobial agents . for diabetics , the risk factors associated with acquiring an mdro infection have been identified and include previous antibiotic therapy and its duration , frequency of hospitalization , duration of hospital stays , osteomyelitis , and proliferative retinopathy [ 9 , 10 , 12 ] . these risk factors would suggest that mdro infection rates would be higher in the diabetic population versus the nondiabetic population ; however , to our knowledge , there have been no reports directly comparing the rates of mdro infections in diabetic versus nondiabetic wounds . the goal of this study was to determine if infections with mdro occurred more in the diabetic population , and , if so , which bacterial species were most prevalent . the medical records of patients , aged 1889 years , who were seen in the general surgery , vascular , trauma , and wound clinics and admitted to the university medical center ( lubbock , tx ) with a diagnosis of chronic wound infection during the previous 10 years , were analyzed . texas tech university health sciences center institutional review board approval was obtained for collecting the data and reporting on its analyses . the database maintained information on age , sex , presence of obesity , race , hospital length of stay ( los ) , disposition , and patient comorbidities ( smoking , diabetes mellitus ( dm ) , chronic kidney disease ( ckd ) or renal insufficiency , congestive heart failure ( chf ) , coronary artery disease ( cad ) , chronic obstructive pulmonary disease ( copd ) , history of vascular surgery , immunodeficiency , and previous myocardial infarction ( mi ) ) . any microorganism identified by the clinical laboratory during the course of the patients ' wound care at university medical center ( lubbock , tx ) and their antibiotic susceptibilities were recorded . a microbial isolate was considered to be a multidrug resistant organism ( mdro ) if it was resistant to one or more classes of antimicrobial agents as determined by clinical and laboratory standards institute 's antimicrobial susceptibility testing standards . pearson correlation , student 's t - test , and chi - square tests were performed . all variables significant to p < 0.1 were then entered into a binary logistic forward - stepwise regression analysis . a total of 115 chronic wound patients were identified ( 41 dm and 74 non - dm patients ) . table 1 compares the demographic information of the dm and non - dm wound groups . the dm group was significantly older and more obese than the non - dm group ; however , their sex and race were comparable . comorbidities including peripheral vascular disease ( pvd ) , ckd / renal insufficiency , chf , cad , and copd were all found significantly more frequently in the dm group . staphylococcus aureus was the most prevalent mdro , followed by enterococcus and pseudomonas ( figure 1 ) . these three genera were also the most prevalent cause of non - mdro infections , with pseudomonas being number one , followed by enterococcus and s. aureus . out of the total 52 s. aureus isolates , 30 ( 57.7% ) were mrsa and 26 of these were also resistant to at least one other class of antibiotics . there were 44 enterococcus isolates , 18 of which were mdro and 8 of which were vancomycin resistant ( vre ) . out of the 39 pseudomonas isolates obtained , 12 were mdro . just over half of the infections were polymicrobial ( 52.2% ) and aerobes / facultative anaerobes made up the vast majority of the bacterial population ; anaerobes were only isolated from 6 wounds ( all of which were bacteroides ) . while there were more gram - negative genera isolated from wounds , gram - positives ( e.g. , s. aureus and enterococcus ) made up a much higher percentage of the population distribution . among the polymicrobial infections , pseudomonas and s. aureus were most commonly found together , and coinfection was positively correlated with dm ( table 2 , figure 2 ) . our hypothesis for this study was that mdro infections were more prevalent in the chronic wounds of patients with dm . mdro were isolated from the wounds of 63.4% of dm patients and 50% of non - dm patients ( figure 2 ) , which did not represent a significant correlation ( chi - square , p = 0.258 ) . further , dm was not identified as a risk factor for mdro infection with multivariate logistic regression ( table 3 ) . pseudomonas was the most common genera of bacteria isolated from the wounds of dm patients ( figure 2 ) . pseudomonas was isolated from the wounds of 61% of dm patients but only 18.9% of non - dm patients ( figure 2 ) , which represented a significant correlation , and this was true for mdr - pseudomonas as well ( table 2 ) . s. aureus and enterococcus isolates were distributed more equally among the dm and non - dm population and did not correlate with either group . the variables included and the results of the multivariate analyses are shown in tables 3 and 4 . interestingly , smoking was the only independent risk factor identified for acquiring an mdro wound infection ( table 3 ) . dm was an independent risk factor for acquiring an mdr - pseudomonas wound infection ( p = 0.031 ) ( table 4 ) . the rates of chronic wound mdro infections vary widely between institutions . the current study found a 54.8% overall prevalence of mdro infections in the chronic wound patients admitted to our hospital over the last 10 years , which was in the midrange of the rates we have seen reported ( 18.272% , [ 9 , 10 , 13 , 14 ] ) . overall , the makeup of the microbial populations in our study also reflected those which have been frequently reported [ 1517 ] , with the most prevalent mdro being s. aureus ( 22.6% ) . also consistent with prior findings , gram - positives made up the majority of isolates obtained and a little over half of the infections were polymicrobial , with pseudomonas and s. aureus being the most commonly associated . one notable weakness of our study , which is apparent in the data obtained , is the lack of anaerobes isolated . anaerobic isolates were obtained from only 6 wounds , which is clearly not in line with other studies that report isolating anaerobes from approximately half of their wound cultures . while the method of sampling was not determined in our study , the reliance of culturing from surface swabs still plagues many institutions even though numerous studies have demonstrated the superiority of obtaining deep tissue biopsies for culturing [ 19 , 20 ] . additionally , conventional clinical microbiology techniques , which rely on culturing , are biased for microorganisms that grow well in the laboratory ( e.g. , nonfastidious , aerobic microorganisms ) . recent strategies that bypass culturing and identify microorganisms by dna sequencing have revealed that up to 90% of bacteria in wounds are facultative or obligate anaerobes [ 21 , 22 ] , although their roles in pathogenesis and antibiotic resistance are unknown . the goal of this study was to determine if chronic wound patients with dm contracted mdro infections more frequently than chronic wound patients without dm . while this was not the case for mdro in general among our patient population , we made the observation that dm was strongly correlated with pseudomonas infection ( both mdr and non - mdr ) . others have also noted that microbial colonization of diabetic wounds appears to be different than that of nondiabetic wounds , with increased incidence of streptococcus , staphylococcus , and pseudomonas , among others [ 13 , 22 ] . possible reasons for these differences include the altered environment of the diabetic wound ( e.g. , hypoxia , hyperglycemia , etc . ) , longer duration of infection , more frequent hospital exposures , and extended periods of antibiotic use , all of which can influence shifts in the wound microbiota . while we did not collect information concerning prior antibiotic usage , age was also identified as a risk factor in acquiring an mdr - pseudomonas infection ( table 4 ) . another factor that could greatly influence the ability of a wound infection to be resolved is the amount and/or type of biofilm in the wound . biofilms are communities of microbial cells attached to a surface or each other that are surrounded by a polysaccharide matrix . it has been proposed that the presence of large amounts of biofilm in wound beds acts as a mechanical barrier to cell migration , granulation , and reepithelialization and stimulates a chronic state of inflammation , which slows healing [ 2326 ] . it has been shown in vitro that bacteria residing in biofilms can be up to 1000 times more tolerant to antibiotic agents than free - floating planktonic bacteria . unlike conventional antibiotic resistance , which is typically caused by transferable genetic alterations that confer protection against antibiotics , tolerance implies a transient , nonheritable phenotype . first , the sessile or dormant state that many bacterial cells adopt when living in a biofilm makes them less susceptible to antibiotics that act only on proliferating cells . secondly , the polysaccharide matrix surrounding the biofilm may perturb the penetration of antimicrobials , and lastly , bacterially altered microenvironments ( e.g. , osmotic gradients and ph differences ) may antagonize antibiotic efficacy . this tolerance is completely dependent on being in the biofilm environment ; thus once a microbe is removed ( e.g. , by swab culture ) and proliferated in vitro , subsequent generations of planktonic cells will revert back to their susceptible phenotypes . thus , even if a clinical isolate does appear to be an mdro via conventional susceptibility testing , this does not mean that it does not display biofilm - related tolerance in vivo . in our study biofilm formation may provide an explanation as to why smoking was identified as a risk factor for acquiring an mdro infection ( table 3 ) . while smoking causes many alterations to the host immune response that can predispose smokers to infection and/or delayed wound healing [ 28 , 29 ] , we found it puzzling that it was not also identified as a risk factor for pseudomonas infection . one possible explanation for this finding is that the majority of mdro infections in our study were caused by s. aureus , a microorganism notorious for causing biofilm - related infections . recently it was shown that cigarette smoke increased the ability of s. aureus to adhere to host cells and form biofilms in vitro . while this study was conducted using human upper airway epithelial cells , in an attempt to explain high levels of upper respiratory infections in smokers , it is possible that smoking increases the likelihood of s. aureus adhering and forming biofilms in the wounds of smokers . we recently showed that p. aeruginosa biofilm formation was enhanced in the wounds of diabetic mice compared to their nondiabetic littermates , especially when the diabetic mice were on insulin therapy . these significantly elevated amounts of biofilm resulted in increased antibiotic tolerance and delays in healing . while the mechanisms involved are still not completely understood , we showed that insulin stimulated p. aeruginosa cells to adopt a biofilm lifestyle and that insulin treatment modulated the diabetic immune system to favor p. aeruginosa biofilm formation [ 32 , 33 ] . thus , based on these findings , it is reasonable to speculate that p. aeruginosa is more prevalent in diabetic wounds not only because diabetic patients simply come into contact with it more frequently , but also because there is some selective pressure in the environment of the diabetic wound that favors pseudomonas colonization and/or persistence .

diabetes mellitus ( dm ) affects 23.6 million people in the usa and approximately 2025% of diabetic patients will develop foot ulceration during the course of their disease . up to a quarter of these patients will develop infections that will necessitate amputation . although many studies report that the rates of antibiotic resistant infections have increased dramatically in the dm population over the last decade , to our knowledge there have been no reports directly comparing the rates of antibiotic resistant infections in dm versus non - dm wounds . we performed a retrospective study comparing the wound infections of 41 dm patients to those of 74 non - dm patients to test the hypothesis that infections with multidrug resistant organisms ( mdro ) were more prevalent in the dm population . we found that 63.4% of dm and 50% of non - dm patients had mdro infections , which was not statistically different . however , 61% of the dm patients had pseudomonas infections compared to only 18.9% of non - dm patients . furthermore , dm patients had significantly more coinfections with both pseudomonas and staphylococcus aureus . though our initial hypothesis was incorrect , we demonstrated a significant correlation between pseudomonas and pseudomonas / s . aureus coinfections within dm wounds .

a 73-year - old diabetic patient presented with a recent - onset visual decline od . 1a ] with mild non - proliferative diabetic retinopathy with no macular edema ; left fundus was normal . optical coherence tomography ( oct ) revealed vitreomacular traction ; central macular thickness ( cmt ) was 630m [ fig . 1b ] . after obtaining an informed consent from the patient , he underwent vitrectomy , erm removal , and membrane peeling with dual staining : trypan blue dye 0.15% ( retiblue , aurolab , madurai , india ) for erm and brilliant blue g 0.05% ( ocublue plus , aurolab , madurai , india ) for internal limiting membrane . 4 weeks later , bcva had improved to 20/40 ; cmt was 379 m [ fig . , bcva gradually declined to 20/60 with cmt increasing again to 412 m and recurrence of macular cystic changes [ fig . the patient received intravitreal triamcinolone acetonide ( ivta , 4 mg/0.1 ml ) od . within 4 weeks , bcva recovered to 20/40 ( cmt : 323 m ) . over the next 10 weeks , the bcva improved to 20/20 od [ fig . ( a ) fundus od reveals macular epiretinal membrane , ( b ) horizontal oct scan reveals vitreomacular traction ; central macular thickness ( cmt ) is 630. note the central defect in the inner segment - outer segment ( is - os ) junction , ( c , d ) one month postoperatively , macula is free of membrane , oct shows partial recovery of foveal contours ( cmt : 379 ) , ( e , f ) 2.5 months postoperatively , macula developed cystoid thickening ( cmt : 412 ) , ( g - h ) six months postoperatively , macular edema resolved ( cmt : 319 ) , with an intact is - os junction and external limiting membrane persistence of macular edema after vitrectomy for erm removal is well - known ; and is generally attributed to chronic vascular leakage . but recurrence of edema after an initial post - surgical resolution has been rarely reported . we attempted treatment of recurrent macular edema with ivta on the basis that it would favorably affect macular edema due to both vascular and inflammatory etiologies . remarkably , ivta did not merely restore the post - operative visual outcome , but improved it to 20/20 ; a rare event in erm surgery in spite of the excellent visual gains reported . this outcome was obtained in spite of an interrupted inner segment - outer segment ( is - os ) junction in the pre - operative oct [ fig . finally , visual recovery is reported to peak around 12 - 24 months after erm removal with reconstitution of is - os junction ; we obtained both the milestones much earlier , at 6 months postoperatively in this case . konstantinidis et al used ivta routinely after vitrectomy for erm ; they reported excellent visual outcomes , which were obtained in a short time , as in our case . however , proactive use of ivta as reported by these authors may invite other problems like secondary glaucoma and cataract ; and can be recommended as a default part of surgical protocol only after a head - to - head trial against vitrectomy without ivta for erm . i propose a case for using ivta to enhance surgical outcome when residual or recurrent macular edema is observed after erm removal .

a patient underwent successful vitrectomy for macular epiretinal membrane with anatomical and functional improvement . 10 weeks later , there was a recurrence of macular edema with corresponding visual decline . an intravitreal injection of triamcinolone acetonide not only restored the macular anatomy but also improved the visual outcome beyond that achieved after surgery .

iniencephaly is a rare and fatal neural tube defect involving both the brain and the neck ( 1 , 2 ) . this entity was first described in 1836 by saint - hilaire ( 1 ) . in 1897 , lewis mentioned two types of iniencephaly : iniencephaly clausus with spinal defect and no cephalocele , and iniencephaly apertus with spinal defect and cephalocele ( 3 ) . it is a disorder that is defined by three characteristic findings including an occipital bone defect , spina bifida of the cervical vertebra , and increased lordosis with hyperextension of the cervical spine ( 4 , 5 ) . incidence varies from 0.1 - 10/10,000 and more than 90% of the patients are female ( 6 , 7 ) . a 25-year - old pregnant female ( g2p2l1 ) with full - term pregnancy was referred for elective cesarean section due to polyhydramnios . the patient had a 3-year - old normal boy from her previous pregnancy . the baby weighed 3250 g. extreme retroflexion of the head and left club foot were seen . brain and thorax ct scan without contrast with coronal , sagittal and 3-dimensional reformatted images of the vertebra and chest wall were obtained . images revealed absence of the posterior portion of the corpus callosum and prominent cerebellar cistern . cerebellar vermis is not appreciated in the brain ct scan raising the possibility for agenesis . indeed , multiple bony abnormalities are visualized , composed of occipital bone defect around the foramen magnum causing a 2.5 cm widening of the foramen ( figure 3a and 4 ) , hyperextended cervical spines ( figures 3a and 3b ) as well as unfused posterior elements of cervical and thoracic spines ( arrows in figures 4 and 5 ) , hemivertebra at t1 ( figures 3c and 3d ) , hypoplasia of the mandible , hypotelorism , posterior fusion of t10-t11-t12 and c5-c6-c7 ( 3d - images in figure 4 ) , bifid ribs with posterior fusion ( ribs 3 and 4 , and 7 and 8) and anterior fusion ( ribs 5 and 6 ) were seen ( figures 3c and 3d ) . transthoracic echocardiogram was done and ventricular septal defect ( vsd ) ( apical ) , patent ductus arteriosus ( pda ) and patent foramen ovale ( pfo ) were detected . abdominopelvic sonography revealed small - sized kidneys for gestational age on both sides ( right side was 35 17 mm and left side was 33 16 mm ) . it is a rare neural tube defect with three distinctive features of occipital bone defect , cervicothoracic vertebral body abnormality as partial or total vertebral absence or fusion , and abnormal arch fusion . this anomaly causes cervical shortening and hyperextension of the cervicothoracic spine that leads to continuation of mandibular skin with the chest wall ( 1 , 5 , 8) . in 1836 , saint hilarie described iniencephaly for the first time . he assumed that the arrest of the embryo in physiological retroflexion during the 3rd week of gestation or failure of normal forward bending during the 4th week could be the cause of this defect ( 1 ) . in 1897 , the type with encephalocele was defined as iniencephalus apertus and the one without encephalocele as iniencephalus clausus ( 3 ) . according to this classification associated anomalies with iniencephaly are separated to central nervous stystem ( cns ) anomalies and non - cns anomalies . there are many cns anomalies associated with iniencephaly such as microcephaly , polymicrogyria , holoprosencephaly , vermis agenesis , cerebellar cyst , encephalocele , cyclopia and atresia of the ventricular system . the non - cns anomalies reported in iniencephaly are facial dysmorphism , chest deformity , pulmonary hypoplasia , cheilognathopalatoschisis . anomalies of the urinary , cardiovascular , skeletal and gastrointestinal systems seem to be more frequent . these associated anomalies may increase the fatality of iniencephaly and the necessity of a thorough workup in survivors ( 2 ) . in addition , iniencephaly clausus should be differentiated from klippel - fiel syndrome and cervical meningomyelocele or teratoid masses ( 9 ) . cervical vertebrae are abnormal in iniencephaly and almost normal in anencephaly . our case revealed retroflextion of the cervical spine with spinal dysraphysm that was completely covered by skin . about klippel - fiel syndrome and ineiencephaly , both have segmentation cervical spine anomaly ; however , hyperextension is not seen in klippel - fiel syndrome ( 9 ) . iniencephaly clausus a rare fatal congenital neural tube defect with a complex spine , cns , and non cns anomalies . prenatal diagnosis is possible and differential diagnosis could be anencephaly , klippel - fiel syndrome with myelomeningoceles or neck masses . according to these gross skeletal abnormalities , this type of fetal anomaly could be seen very well by prenatal sonography so a more sophisticated sonography during pregnancy could find the anomaly in the first and second trimesters so the patient could be referred for legal abortion .

iniencephaly is a rare kind of neural tube defect that is classified into two types of iniencephaly apertus and iniencephaly clausus . this anomaly could be diagnosed prenatally by obstetric ultrasonography and terminated by therapeutic abortion ; however , it could be undiagnosed until birth similar to our case due to the abnormal position of the fetus or lack of experience of the sonographer . due to abnormality of the neural tube , which causes abnormal head and neck position , all these cases will die shortly after birth . we hereby introduce the photos and imaging findings of a case of an alive neonate with iniencephaly clausus .

dry eye syndrome or keratoconjunctivitis sicca is one of the most common diseases in ophthalmology [ 1 , 2 ] . according to published investigations , its prevalence ranged from 5% to 6% in the general populations , and it reached 34% in the elderly . severe cases can cause serious complications , even loss of visual acuity . in the past three decades , submandibular gland transplantation has been demonstrated as an effective method for treating severe dry eye syndrome [ 412 ] . some published papers declared that the prevalence of epiphora after smg transplantation was about 40% [ 4 , 13 , 14 ] . although several methods , including atropine gel and operation , have been used to treat epiphora , the clinical outcomes remain unsatisfied [ 4 , 1315 ] . botulinum toxin type a ( btxa ) , a neurotoxic protein produced by clostridium botulinum bacteria , has been widely used in clinic to treat the excessive gland secretion including drooling , hyperlacrimation , and hyperhidrosis . in 2002 , keegan and his colleagues reported that btxa was an effective treatment for hyperlacrimation in spite of side effects . after then , yu and his colleagues also confirmed the effect of btxa on epiphora after smg transplantation [ 4 , 18 ] . however , both of them included few samples and no further investigations were reported about its mechanisms . in this study , we constructed a new model of smg transplantation in rabbit and aimed to investigate the effect of btxa on excessive secretion after smg transplantation and its underlying mechanisms . 35 male new zealand white rabbits ( weighing 2.3 0.2 kg ) were used to establish new smg transplantation models . all experimental procedures were approved by the institutional ethics committee of animal research ( peking university health science center ) . btxa used in this study was as gifts by lanzhou institute of biological products , china . the titer of one - unit btxa from this institute is about equal to 3 - 4 units of dysport ( ipsen , slough , uk ) and one unit of botox ( allergan , irvine , ca , usa ) . fitc , antibodies to aquaporin-5 ( aqp5 ) and -actin , were purchased from santa cruz biotechnology ( santa cruz , ca , usa ) . the rabbit models of submandibular gland transplantation in previous researches were intricate and the transferred gland secretion was interrupted by rabbit accessory lacrimal gland [ 2024 ] . to simplify and better simulate the operation , we established a novel model based on the previous models . the key operation steps were showed in figure 1 . for operation , all rabbits were anesthetized with sodium pentobarbital ( 20 mg / kg according to rabbits ' body weight ) . after three months of smg transplantation , we detected whether the transferred smgs were successful . during the three months , one died of disease and one was infectious . besides , three were excluded because the smg transplantation failed . then , all the good transplantation models including 30 rabbits were randomly assigned to five groups ( six per group ) , including one control group and four experimental groups ( 2 weeks group , 4 weeks group , 12 weeks group , and 24 weeks group ) . all transferred glands in the experimental groups were injected with 0.1 ml btxa with the concentration of 100 u / ml . in experimental groups , the salivary secretion outputs were detected and the transferred smgs were removed under anesthesia at 2 , 4 , 12 , and 24 weeks after btxa injection . as for the control group , salivary secretion outputs were tested and the transferred smgs were collected after three months of smg transplantation . saliva flow was measured for five minutes in rest ( one minute for feeding ) , and we statistically calculated the length of wet filter paper with saliva ( 35 5 mm ) . we performed the measurements of salivary secretion between 9:00 am and 12:00 am while rabbits were awake . to observe the morphological and structural changes , ultrathin section was stained with uranyl acetate and lead citrate and ultrastructure were acquired under a transmission electron microscope ( h-7000 electron microscope ; hitachi , tokyo , japan ) . proteins were extracted from the transferred smgs and quantified by bca method as previous description . 40 g proteins extracts were separated on 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride ( pvdf ) membranes . the membranes were blocked with 5% nonfat milk for two hours and then probed with aqp5 antibody at 4c overnight . the membranes were washed with pbst for 10 min ( 3 times ) and then incubated with horseradish peroxidase- ( hrp- ) conjugated secondary antibody ( 1 : 4000 dilution ) . frozen sections of transferred smg were fixed in cold acetone for 15 minutes and were immunostained with anti - aqp5 antibody ( 1 : 100 ) overnight at 4c and incubated with fitc- or tetramethylrhodamine isothiocyanate - labeled secondary antibodies as described previously [ 6 , 26 ] . fluorescence images were captured by confocal microscope ( tcs sp5 ; leica , heidelberg , germany ) . statistical analysis was performed by graphpad prism software ( graphpad prism , la jolla , ca , usa ) . differences among groups were analyzed by one - way analysis of variance ( anova ) and then bonferroni testing . a value of p < 0.05 was considered as statistical significance . to observe the role of btxa in treating excessive secretion outputs of transferred smg , we injected 0.1 ml btxa with concentrations of 100 u / ml into transferred gland in the experiment groups ( 10 u btxa mixed with 0.1 ml 0.9% saline ) . compared with the control group , a significant decrease of secretion output was observed in the btxa - treated group at 2 weeks and 4 weeks , whereas there was no significant difference in 12 and 24 weeks groups ( figure 2(a ) for rest in 5 minutes and figure 2(b ) for feeding in one minute ) . normal acinar and ductal cells were observed in the transferred smg without btxa injection ( control group , figure 3 , con ) . compared with control group , the 2 and 4 weeks groups had more fibrous tissues in the glandular lobules and smaller acinar cells ( figure 3 , 2 w , and figure 3 , 4 w ) . after 12 and 24 weeks of btxa injection , the morphological appearance of gland recovered gradually ( figure 3 , 12 w , and figure 3 , 24 w ) . tem indicated that massive secretory granules could be observed in the acinar cell of control group ( figure 4 , con ) . compared with the control group , the volume of acinar cells was smaller and the number of secretory granules was less at the time of 2 and 4 weeks ( figure 4 , 2 w , and figure 4 , 4 w ) . however , at 12 weeks , the morphological appearance of gland recovered gradually , and , at 24 weeks , it recovered to the normal control gland ( figure 4 , 12 w , and figure 4 , 24 w ) . aqp5 is a water channel protein , which plays a role in the generation and secretion of saliva [ 2729 ] . proper aqp5 expression and subcellular localization are necessary to maintain water homeostasis [ 29 , 30 ] . to explore whether btxa directly affects aqp5 protein , western blot and immunofluorescence were performed to detect the aqp5 expression and subcellular localization in acinar cells . results suggested that aqp5 protein expression was decreased at the time of 2 weeks and 4 weeks but almost returned to the levels of control group at 12 and 24 weeks ( figure 5(a ) ) . immunofluorescent analysis showed that aqp5 was mainly located at the apical and lateral membranes of the acinar cells in transferred smgs of control group ( figure 5(b ) , con ) . in the experimental groups , results suggested that the fluorescence intensity of aqp5 reduced significantly and the aqp5 protein distributions were changed at 2 and 4 weeks group . however , all the changes almost recovered at the time of 12 and 24 weeks after btxa injection ( figure 5(b ) ) . smg transplantation has been considered as one of the most effective treatments for severe xerophthalmia [ 4 , 11 , 31 , 32 ] . however , about 40% of patients suffered from epiphora after smg transplantation [ 13 , 14 , 33 ] , which reduced patients ' life quality and increased their social embarrassments . current therapeutic strategies of epiphora after smg transplantation include surgery , a variety of drugs , and other therapies [ 15 , 31 , 34 ] thus , it is necessary to find a better therapeutic method with safety and efficacy . btxa has been widely used in oral and maxillofacial surgery for almost 20 years , including treating muscular spasm , drooling , frey 's syndrome , and produced encouraging results [ 16 , 35 , 36 ] . our previous animal experiments had also demonstrated that btxa could reduce the secretory output of smg of rabbits and rats [ 19 , 26 ] . thus , it is likely to be a good candidate for the treatment of epiphora after smg transplantation . although keegan had reported that btxa treated epiphora with good results in 2002 , only one case was included and there is no high quality evidence to support its applications . as is well known , drugs ' safety and efficacy should be comprehensively estimated before it could be used in clinical treatment , including btxa therefore , the efficacy and safety of btxa should be well demonstrated in animal models before we could use it in patients . considering that the previous models were intricate and did not well reflect the truth of salivary secretion [ 21 , 22 , 25 , 37 ] , we established a new transplanted smg model in rabbits . in this model , we injected 10 u btxa ( 100 u / ml ) into the transferred gland and found btxa also inhibited the salivary secretion temporarily . at the time of 2 and 4 weeks after btxa injection , however , the glandular output of smg transplantation recovered gradually at the time of 12 weeks and 24 weeks after btxa injection , suggesting that the drug wore off over this time period , which are consistent with the previous studies [ 19 , 26 ] . besides , he and tem results showed atrophic and less granules of acinar cells in transferred smgs , which might help to explain the reduced function of smg . it was reported that btxa injection reduced the size of acinar cells and aqp5 expression in rabbits and rats , and aqp5 localization plays a significant role in salivary fluid secretion [ 19 , 26 , 28 , 3840 ] . the translocation of aqp5 from the cytoplasm to the apical plasma membrane is required to promote secretory capacity [ 29 , 41 , 42 ] . besides , our previous study also found that btxa could directly affect aqp5 expression and distribution in smg cell without innervation , which indicates that btxa could directly inhibit smg cell secretion by affecting aqp5 . in this study , western blot and immunofluorescence results suggested that btxa reduced the aqp5 protein expression and promoted aqp5 expression transposition from the cell membrane to cytoplasm after btxa injection . based on what was mentioned previously , we speculated that btxa might share a similar role in the treatment of epiphora after transplanted smg and btxa could directly inhibit the secretion of the denervated gland . in summary , our experiments have demonstrated that btxa injection could effectively control the epiphora after autologous smg transplantation in rabbits more for than 4 weeks . btxa injection reduces aqp5 expression and promotes redistribution of aqp5 in the transplanted smg , which suggests that btxa inducing aqp5 protein expression reduction and redistribution might be a therapeutic target for controlling glandular secretion .

objectives . to investigate whether botulinum toxin type a ( btxa ) could control excessive secretion after submandibular gland ( smg ) transplantation in rabbits and its possible mechanisms . methods . a new smg transplantation model was established in rabbit . 30 successfully constructed models were randomly assigned to five groups including control group and four experimental groups . secretion outputs were used to analyze the effect of btxa injection on excessive secretion . hematoxylin and eosin ( he ) staining , transmission electron microscopy ( tem ) , western blot , and immunofluorescence were performed to analyze its possible mechanisms . results . after btxa injection , a significant decrease of excessive secretion after smg transplantation was found in 2 and 4 weeks groups , but no significant effect on 12 and 24 weeks groups . he and tem results showed that btxa led to morphological and ultrastructural changes of acinar cells of transplanted smg . western blot results suggested that btxa decreased the aquaporin-5 ( aqp5 ) protein expression after btxa injection for 2 and 4 weeks . immunofluorescence results showed that aqp5 protein was mainly expressed in the cytoplasm after btxa injection for 2 and 4 weeks , which might indicate that btxa promoted aqp5 expression from the cell membrane to cytoplasm . conclusion . btxa could effectively control excessive secretion after smg transplantation in rabbits .

the institute of medicine ( iom ) has defined patient safety as the prevention of harm to patients . patient safety includes risk assessment , identification , management of patient related risk , reporting and analysis of incidents and the capacity to learn from and follow - up incidents and implement solutions to minimize the risk of the reoccurrence of the incident . international studies have revealed that the rate of medical errors was 5 - 80/100,000 consultations in primary health - care ( phc ) settings , with prescription errors of 11% and adverse event rate at 3.7/100,000 clinic visits . medical record based study from general practice in holland revealed a prevalence of 2.2% safety incidents in 1000 patient records . in saudi arabia , patient safety and medical errors have become an important national issue discussed by the media in the past decade . however , only a few studies have been conducted on this subject . of these studies only one discussed the knowledge and attitude of undergraduate medical students , two others discussed patient safety culture in hospital , and one reported the status of medical liability claims in saudi arabia . another study explored the preference and perception of the public on the disclosure of medical errors . a study in a phc setting in riyadh city by khoja et al . , found that there were about 19% errors in prescriptions issued by doctors working at primary health - care centers ( phcc ) . one recent study was conducted at an academic center to assess the attitude of nurses toward patient safety . this scarcity of studies indicates that more studies on patient safety are required and medical errors in the provision of health - care , particularly the knowledge and attitude toward these issues have to be explored . the objective of this study was to assess the attitude of phc physicians in aseer region , saudi arabia toward patient safety . this cross - sectional study was conducted among physicians working at phcc in aseer region , saudi arabia , in august 2011 . a self - administered questionnaire consisting of three parts was used to achieve the objective of this study . the first part of the questionnaire dealt with the socio - demographics , the academic and work profile of participants . this questionnaire was developed and validated by carruthers et al . for use among students and tutors in uk this questionnaire was found to have reliability ranges between 0.64 and 0.82 for the nine factors namely ; 1-patient safety training received , 2-errors reporting confidence , 3-working hours as error cause , 4-error inevitability , 5-professional incompetence as error cause , 6-disclosure responsibility , 7-team functioning , 8-patient involvement in reducing errors , 9- and importance of patient safety in curriculum . items were assessed on a likert scale of seven points ( 7 = strongly agree , 1 = strongly disagree ) . attitude to patient safety was classified as positive , neutral or negative depending on scores given for each item : a score of less than four was negative attitude / disagree , four was neutral and a score of five or more indicated a positive attitude / agree . for questions ( 11 - 17 ) and question , ( 25 ) attitude was considered positive / agree if the score was less than 4 , neutral if the score was four and negative / disagree if it was five or greater . the last part of the questionnaire developed by the investigator consisted of three questions ; 1-receiving training on the phcc doctors who had attended family medicine essentials course in aseer region and agreed to participate in this study were invited to complete the questionnaire under the direct supervision of the investigator , who explained the purpose and the importance of this study . permission from the authors of the apsq - iii was obtained to use the questionnaire through e - mail contact . data of the questionnaire were coded and then entered into personal computer provided with statistical package for the social sciences spss version 15 for statistical analysis . appropriate statistical tests ( chi - square , anova ) were used accordingly and p values were considered significant if > 0.05 . the total number of participants in this study was 228 doctors out of 365 ( 65% ) physicians working at phcc in aseer region at the time of the study , giving a response rate of 65% . the mean age was 39 years ; 77% were males ; saudi doctors represented 18% and 80% had no post mbbs qualifications . the average experience of work at phcc was 8.3 years and the average number of patients seen daily was 44 patients . less than one - third ( 30% ) had attended a course on patient safety and only 52% defined medical error correctly . characteristics of physicians at phcc , aseer region 2011 ( n=228 ) statistical analysis showed that 20% of saudi doctors , 42% of arab doctors and 20% of non - arab doctors had attended a course on patient safety ( = 9 , p = 0.01 ) . those who had worked at a phcc for more than 5 years had attended such courses compared to those who had worked for > 5 years ( = 12 , p = 0.006 ) . the older doctors tended to attend courses related to patient safety more than young doctors ( = 8 , p = 0.02 ) . saudi doctors and those who had worked at a phcc for less than five years defined medical error correctly compared to the non - saudi ( = 20 , p = 0.01 ) and those who had worked at a phcc for more than 5 years ( = 22.5 , p = 0.03 ) . table 2 depicts the mean scores of questions assessing attitudes toward patient safety in nine areas . attitude of phc physicians toward patient safety , aseer region , ksa , 2011 the best score was given for reducing medical errors ( 6.2 points ) , followed by role of training and learning on patient safety ( 6 and 5.9 points ) . however , participants were not satisfied with undergraduate training on patient safety ( 4.8 points ) . confidence in reporting medical errors and reporting the errors of other people scored 4.8 points and the confidence to be open with supervisor about an error had made scored 4.6 points . regarding the relationship between working hours and occurrence of medical errors , it was thought that shorter shifts would reduce medical errors ( 5.4 points ) , not taking break would increase the risk of medical errors ( 5.7 points ) while the number of hours a doctor worked would increase the likelihood of medical error ( 5.4 points ) . concerning the inevitability of errors , it was agreed that even the most experienced and competent doctors make errors ( 5.7 points ) , on the other hand , participants disagreed with the statement that most medical errors resulted from the carelessness of nurses ( 5.9 points ) or careless doctors ( 4.9 points ) . reporting all medical errors was considered necessary even if they caused no harm to patients ( 3.9 points ) while teaching teamwork skills would reduce medical errors ( 6.2 points ) . patients have an important role in preventing medical errors and their involvement was considered important in reducing the risk of medical errors ( 3 and 3.9 points respectively ) . teaching students about patient safety was considered a priority in the training of medical students ( 5.6 points ) . learning about patient safety before graduating would help doctors to become more effective ( 6.2 points ) . table 3 shows association between socio - demographic variables and attitude toward patient safety . statistical analysis revealed that females scored higher points than males in many questions ( numbers 1 , 2 , 14 , 19 , 23 , 24 ) ( p = 0.00 - 0.04 ) . association between some demographic variables and mean score for some items in apsq - iii using analysis of variance ( anova ) showed that non - arab doctors scored higher points than arab and saudi doctors for the first eight questions and question numbers 12 and 18 ( p values between 0.00 and 0.03 ) , those above 45 years , scored the highest points compared to those between 36 and 45 years and less than 36 years old in nine questions with different p values ranging from 0.00 to 0.04 for questions numbers ( 1 , 2 , 3 , 6 , 10 , 12 , 14 , 20 , 21 ) . those doctors who had worked for more than 20 years were found to have a positive attitude compared with those who had worked between 11 - 20 years , 5 - 10 years and less than five years for nine questions ( 2 , 3 , 6 , 9 , 10 , 14 , 19 , 20 , 21 ) with p values ranging between 0.00 and 0.02 . regarding the association between qualification and attitude toward patient safety , it was found that those with high qualifications had a positive attitude ( highest points ) toward patient safety as observed in question numbers ( 7 , 8 , 15 , 17 , 21 , 24 ) with p values between 0.001 and 0.04 . doctors who had training on patient safety was found to have positive atitude ( items number 2 , 6 , 13 , 23 ) [ table 4 ] . impact of training on some aspects of attitude of phcc doctors toward patient safety , aseer region , 2011 most of phcc doctors in aseer region showed a positive attitude toward patient safety . however , 70% had not attended any training course on patient safety , which was reflected in their knowledge , which was 52% and 61% were able to define medical error and knew the main causes of medical errors . such important findings indicate that there is urgent need for such interventions as conducting continuous professional development programs on medical errors and patient safety for phc physicians . in spite of the importance of patient safety in the medical school curriculum , ( 2010 ) , mentioned that more than two - thirds of medical students agreed that the teaching of patient safety in medical schools and the continuous training of health staff was necessary . another study from hong kong ( 2009 ) showed that 90% of medical students strongly agreed that patient safety was an important topic for teaching in medical school . those findings should alert us on the issue of the curricula of medical colleges in ksa and the importance of making reporting medical errors is important step in improving the quality of health - care including patient safety . in other words , about one third of the participants were comfortable with reporting medical errors . these low scores which reflected the negative attitude of some physicians toward reporting adverse events could be due to the lack of a system for reporting medical errors . also , a culture of safety in health settings , as reported by alahmadi is yet to be developed . the confidence of participants in talking about their errors with their supervisor if harm is caused to the patient was given an average score of 5.6 and majority of participants ( 78% ) said they would do so . this rate is in agreement with the findings of a study conducted of gps in denmark ( 2006 ) , which revealed that more than 75% of gps would report adverse event that occurs . in the few phcc with a high number of patients attending and work overload , participants showed that a shorter shift for the doctors and taking breaks would reduce medical errors . the area of errors inevitability scored 3.2 - 5.9 points regarding competency and experience of doctors . these findings are comparable to those reported from uk . as reported by hammami et al . ( 2009 ) the disclosure of medical errors poses a big dilemma in health settings in saudi arabia . in this study , doctor had the responsibility of disclosing errors to patients only if they resulted in harm to the patient , while 40% disagreed and 16% were neutral . on the other hand , most participants ( 79% ) agreed to report all medical errors while 12% disagreed . a study of medical trainees ( 2006 ) found that 80% would disclose adverse events to patients . these diversity of attitude could be explained by the lack of training and experience of phcs in dealing with medical errors . in addition , there is a lack of established culture of reporting adverse events in phc settings in saudi arabia . most participants ( 91% ) agreed that the teaching of teamwork would reduce medical errors . these high scores confirm the vital role played by the teaching of teamwork and leadership in patient safety mentioned by firth - cozens . patients play an essential role in their health and safety by active involvement in decision making and self - management . phcc physicians showed average to high agreement ( 84% ) in this regard ( 4.9 and 5.9 points ) compared to 5.2 points in uk study , but less than what was reported from saudi arabia ( 44.7% ) . the last theme of the study was about the importance of patient safety in the curriculum . a total of 90% of the participants with a high average score of 5.6 out of seven points agreed that teaching students about patient safety is a priority in medical training while 84% with the highest score of all items in the questionnaire agreed that learning about patient safety before graduation from medical schools would produce more effective doctors , these important findings are in agreement with results of two studies conducted among medical students in the qassim region and hong kong , which emphasized the priority of putting patient safety in the undergraduate curriculum of medical colleges . in this study , attitudes toward patient safety were affected to some degree by some demographic and scientific background such as gender , age group , nationality , qualification and work experience at phcc . female doctors had a more positive attitude toward patient safety than male doctors , which was difficult to explain . the doctors with more experience in phcc had a more positive attitude toward patient safety than those with a short experience . it is known that as doctors got older and more experienced , their attitude to their profession changed for the better . it was found that doctors with high qualifications had a positive attitude toward patient safety . such a finding could be either because they had taken some courses or their training had included some sessions on patient safety and medical errors . the impact of training on patient safety and attitude was not always positive as only a few items ( items no 2 , 6 , 13 , 23 ) were positively affected by training . these associations should be interpreted carefully as less than one - third of the participants had had a course on patient safety . this study showed that phc physicians in aseer region had a positive attitude toward patient safety . undergraduate education on patient safety considered a priority to make future doctors effective was inadequate . teamwork approach and patient involvement were given a priority in the prevention of medical errors and the improvement of patient safety . phc physicians in aseer region should have training sessions on patient safety and medical errors . further studies are needed to explore the knowledge and behaviors of phcc physicians on patient safety and medical errors . phc physicians in aseer region should have training sessions on patient safety and medical errors . further studies are needed to explore the knowledge and behaviors of phcc physicians on patient safety and medical errors .

objective : the objective of this study was to assess the attitude of physicians at primary health - care centers ( phcc ) in aseer region toward patient safety.materials and methods : this study was conducted among working primary health - care physicians in aseer region , saudi arabia , in august 2011 . a self - administered questionnaire consisting of three parts was used ; the first part was on the socio - demographic , academic and about the work profile of the participants . the attitude consisting of 26 questions was assessed on a likert scale of 7 points using attitude to patients safety questionnaire - iii items and the last part concerned training on patient safety , definition and factors that contribute to medical errors . data of the questionnaire were entered and analyzed by statistical package for the social sciences ( spss ) version 15.results:the total number of participants was 228 doctors who represent about 65% of the physicians at phcc , one - third of whom had attended a course on patient safety and only 52% of whom defined medical error correctly . the best score was given for the reduction of medical errors ( 6.2 points ) , followed by role of training and learning on patient safety ( 6 and 5.9 points ) , but undergraduate training on patient safety was given the least score . confidence to report medical errors scored 4.6 points as did reporting the errors of other people and 5.6 points for being open with the supervisor about an error made . participants agreed that even the most experienced and competent doctors make errors ( 5.9 points ) , on the other hand , they disagreed that most medical errors resulted from nurses carelessness ( 3.9 points ) or doctors carelessness ( 4 points).conclusion : this study showed that phcc physicians in aseer region had a positive attitude toward patient safety . most of them need training on patient safety . undergraduate education on patient safety which was considered a priority for making future doctors work effective was inadequate .

squamous cell carcinoma ( scc ) is by far the most important and common malignant mucosal neoplasm to affect the head and neck region . occasionally , variants of scc may be encountered , which includes verrucous , exophytic or papillary , spindle cell ( sarcomatoid ) , basaloid and adenosquamous types that make up in aggregate for about 10 - 15% of all sccs . spindle cell carcinoma ( spcc ) also called lane tumor is an uncommon poorly differentiated type of scc comprising up to 3% of scc . spcc has been referred to by a variety of names such as pseudosarcoma , carcinosarcoma and pleomorphic carcinoma , which reflects the divergent interpretations of the sarcomatoid component as reactive or neoplastic and mesenchymal or epithelial . there is a profound male to female predilection ( 11:1 ) and generally occurs in individuals in their seventh decade of life . according to ellis , the frequent sites of occurrence of spcc are the lower lip , tongue and alveolar ridge . this report describes a rare presentation of spcc of the gingiva with a low metastatic potential contrary to the aggressive nature of the tumor . a 46-year - old male patient reported to the department of periodontology , faculty of dental sciences , sri ramachandra university , chennai , india with an intraoral swelling in relation to the lower left first and second premolars for the past 8 months associated with a dull pain . he gave a history of smoking cigarettes ( 2 packets / day ) for the past 30 years and keeping the tobacco quid on the left side of the vestibular area , but had stopped the habit because of burning sensation . on clinical examination , a single sessile erythematous swelling with a fungating whitish mass in the center was seen [ figure 1 ] . on palpation , it was firm in consistency measuring about 1.5 cm ( apicocoronally ) and 2.0 cm ( mesiodistally ) extending from the mesial aspect of tooth 34 to the mesial aspect of tooth 36 . both the premolars exhibited grade 1 mobility with tenderness on vertical percussion and no attachment loss . initial appearance of the lesion with a fungating whitish mass on the surface patient was counseled regarding the cessation of the smoking habit . scaling was performed on the first visit and selective grinding of the opposing cusp in occlusion was carried out . at the recall visit , the surface necrosis had disappeared ( which could have probably been due to withdrawal of tobacco quid usage ) . complete hemogram , intraoral periapical radiograph and orthopantomograph were taken . except for an increase in the eosinophil count , no significant alterations were evident in the radiographs [ figure 2 ] . based on the clinical findings , orthopantomograph revealing no hard tissue abnormalities an incisional biopsy of the growth was performed under local anesthesia . the tissue specimen was immediately transferred into 10% buffered formalin solution , sent for routine histopathological examination and were further subjected to immunohistochemical ( ihc ) analysis . histologically , the tumor showed an ulcerated parakeratotic stratified squamous epithelium [ figure 3 ] with a focus of epithelial pearl formation [ figure 4 ] . the underlying connective tissue stroma revealed richly cellular pleomorphic spindle cells arranged in fascicles resembling a herring bone pattern characteristic of a fibrosarcoma [ figure 5 ] . ihc analysis revealed spindle shaped cells that showed positive reactions for cytokeratin [ figure 6 ] and vimentin [ figure 7 ] but negative for cd34 [ figure 8 ] . positive membrane immunoreactivity was observed in the basal cell layer and connective tissue stroma with a relatively increased lymphatic network complexity as compared with the tumor free zone [ figure 9 ] . photomicrograph of spindle cell carcinoma showing stratified squamous epithelium with surface ulcerations , granulation tissue and mixed inflammatory cells ( h and e , 10 ) photomicrograph showing epithelial pearl formation ( arrow ) ( h and e , 40 ) photomicrograph of spindle cell carcinoma showing richly cellular pleomorphic , hyperchromatic spindle cells arranged in fascicles depicting a herring bone pattern ( arrow ) ( h and e , 10 ) spindle shaped tumor cell component immunostained with anti - human cytokeratin antibody showing positive immunostaining for cytokeratin ( 40 ) spindle shaped tumor cell component immunostained with anti - human vimentin antibody showing positive immunostaining for vimentin ( 40 ) this component shows negative immunostaining of spindle cells for cd34 and positive immunostaining of endothelial cells ( 40 ) positive expression of podoplanin in the spindle cells and increased lymphatic network complexity ( 40 ) a whole body plain and contrast computed tomography ( ct ) view was performed . ct view of mandible with contrast revealed a 17.8 mm 4.7 mm sized soft - tissue density lesion in the buccal aspect of the body of the mandible on the left side with no evidence of bony erosion [ figure 10 ] . few sub centimeter sized lymph nodes were present in the left submandibular [ figure 11 ] and bilateral deep cervical ( level ii ) regions [ figure 12 ] . computed tomography view of mandible with contrast depicting a soft tissue density lesion in the buccal aspect of the body of the mandible on the left side ( arrow ) computed tomography view of the mandible with contrast depicting few sub centimeter sized lymph nodes in the left submandibular region ( arrow ) computed tomography view of the mandible with contrast depicting few sub centimeter sized lymph nodes in the bilateral deep cervical region ( arrows ) patient was referred to an oncologist . following chemotherapy , the patient was subjected to surgical management that involved a segmental resection of the mandible with supraomohyoid neck dissection followed by radiation therapy . spcc is a rare type of scc that most often involves the larynx and gingiva is a rare site for its occurrence . in the present case , the placement of the tobacco quid in that region could have contributed to this unusual site predilection since the activity of the carcinogens is generated through deoxyribonucleic acid adducts . scc most commonly affects men than women , usually in the middle or later decades of life , ( although any age can be affected ) . in accordance clinical presentation of oral spcc can vary from an exophytic polypoid mass with an ulcerated surface to a frankly infiltrative ulcer , occurring mainly in the alveolar ridge . in this case , spcc presented clinically as a polypoid growth with surface necrosis involving an unusual location , i.e. , the mandibular gingiva . although there are various risk factors such as age , genetic , viruses , environment and occupation , which can influence the occurrence of spcc , four predominant factors , which are considered to predispose for the development of spcc are alcohol abuse , poor oral health , previous irradiation to the area of the tumor and the most important risk factor being tobacco in various forms such as cigarette , cigar , pipe and smokeless tobacco . spcc is considered to be basically aggressive in nature because the incidence of metastases was found to be 36% and the 2-year survival rate was 55% in tumors involving the oral cavity . our present case indeed was unique since the tumor was slowly progressive over 8 months duration with no signs of distant metastases contrary to the reported aggressive nature of conventional spcc . in spcc the most sensitive and reliable epithelial marker cytokeratin was used for demonstration of the epithelial phenotype . positive cytokeratin and vimentin expression was seen , but the tumor cells were negative for cd34 ( only the endothelial cells showed a positive reaction ) eliminating the possibility of any vascular malignant tumors . podoplanin , a molecule expressed in malignant cells was used to determine for any lymphatic invasion . to the best our knowledge , this is one of the first cases to have employed a lymphatic marker for spcc of the gingiva . to conclude , spcc can occur on the gingiva and since exposure to these tumors is infrequent for clinicians , it is imperative to reiterate that all patients have an early diagnostic biopsy before the definitive therapy for a better prognosis and thereby reducing morbidity and mortality .

of the many neoplasms known , squamous cell carcinoma ( scc ) is the most common to affect the oral cavity . spindle cell carcinoma ( spcc ) is considered a rare high malignant variant of scc occurring predominantly in the upper aerodigestive tract . soft - tissue spindle cell neoplasms are quite uncommon in the oral cavity reportedly accounting for lesser than 1% of all tumors in the oral region . our case shows an unusual presentation of spcc involving the mandibular gingiva in a 46-year - old smoker patient , which presented as a firm , erythematous swelling with surface necrosis . an incisional biopsy was performed for microscopic evaluation to confirm the clinical diagnosis and for treatment planning .

japan is one of the world s fastest aging societies , and the increase in the elderly disabled requiring long - term care is becoming a social problem . according to the long - term care insurance report 2012 issued by the ministry of health , labour and welfare ( mhlw ) , 5,306,000 people , including the bedridden elderly , now have a certification of long - term care need1 , and the figure is expected to continue to increase . according to the mhlw report of basic research on japanese life 2010 , cerebrovascular diseases ( strokes ) are the most common cause for disabilities that require care , accounting for 21.5% . the percentage increases as the care - need level increases . for people with the highest care - need , which is level v , since japan is rapidly aging , people suffering from strokes are expected to increase . taking appropriate measures for the bedridden elderly in addition , strokes often cause aftereffects . under the government policy that reduces medical spending and encourages elderly people to be treated at home , discharging them from institutions as soon as possible , services for homebound elderly hemiparetic stroke patients that consider their quality of life ( qol ) are required for them to live securely and stably at home . this study looked at homebound elderly hemiparetic stroke patients , researched their physical conditions and qol , and analyzed and examined factors that affect the qol to discover how these patients can maintain their qol at home after being discharged from institutions . a questionnaire was administered to 21 homebound elderly hemiparetic stroke patients who were 65 years old or over , used home - visit care services , did not suffer from obvious dementia , and were able to answer the questionnaire ( 12 males and 9 females , average age : 79.3 8.4 years old ) . we visited their homes and researched their physical functions and qol . in term of ethical considerations , details of the study were explained to subjects verbally and in writing , and signed consent forms were received from subjects . the research items were subject age , gender , daily life independence level of the elderly disabled persons ( bedridden degree ) , care - need level , activities of daily living ( adl ) , and qol . this measure consists of 13 mobility items and 5 communication and social cognition items . a full score is 126 points in total , meaning fully - independent , and the lowest possible score is 18 points , meaning total assistance is required . the mos 36-item short - form health survey ( sf-36 , japanese - version 1.2 ) was used for the qol assessment5 . this measure is a comprehensive health - related qol scale , and is commonly used for assessment with subjective outcome measures . the subscales consist of 8 sections : physical functions ( pf ) , role physical ( rp ) , body pain ( bp ) , general health ( gh ) , vitality ( vt ) , social functions ( sf ) , role emotional ( re ) , and mental health ( mh ) . nationwide standard scores for each gender and age are available , and can be easily compared with the scores of the subject group . this is an advantage of this measure . to examine the correlations between the qol and adl and the burden felt by caregivers , , we used stat soft s statistical analysis software , statistica . a significance level of 5% was considered statistically significant . for the adl independence of the homebound elderly hemiparetic stroke patients , the subjects total fim scores ranged from 24 to 123 points ( average : 72.7 34.1 ) , indicating that some required total assistance and some were nearly fully - independent . for the bedridden degree , only 1 subject ( 4.8% ) was nearly independent and able to go out alone . eight subjects ( 38.1% ) were independent at home but required assistance for going out , and 12 subjects ( 57.1% ) required assistance both at home and when going out . regarding their care - need levels , 2 subjects were at the assistance - need level , 5 subjects were at care - need level i , 3 subjects were at care - need level iii , 6 subjects were at care - need level iv , and 5 subjects were at care - need level v. the average qol of the homebound elderly hemiparetic stroke patients was lower in six subscales , excluding rp and re , and was particularly lower for the pf and mh subscales , than the deviation score of 50 of the nationwide standard scores for the same age group ( table 1table 1 . comparison between disabled elderly person s qol and the national standard deviation value ( 50)deviation valuesf-36mean sdphysical function29.311.4role physical55.8 6.2body pain49.8 9.6general health47.913.8vitality45.810.8social function47.114.5role emotional 52.07.8mental health 43.17.8 ) . no correlations were observed between the qol and age and gender . for the correlations between the qol and total fim scores of the homebound elderly hemiparetic stroke patients , the pf and vt subscales for qol were significantly high when adl independence was high . as for the correlations between the qol and fim items , the physical functions and vitality significantly correlated with all mobility items . when adl independence was high , the pf and vt subscales for qol were also high ( r=0.710.84 , p<0.001 ) . the sf subscales were significantly correlated with the independence of transfer ( from bed to chair , wheelchair to toilet seat , etc . ) and movement ( from a room / place to another room / place ) . when patients are more capable in transfer and movement , their spheres of activity become broader and the sf scores also become higher . the bp subscale showed significant negative correlations with transfer ( 0.55 , p<0.05 ) and movement ( r=0.71 , p<0.01 ) , suggesting that patients complain more about body pain when they are more capable in transfer and movement and their spheres of activity are broader ( table 2table 2 . correlation coefficient of disabled elderly person s qol ( sf-36 ) and independence in adl , bedridden degree , and care - need levelsf-36adl and otherspfrpbpghvtsfremhfimmovement itemself - care0.77 * * 0.50 0.47 0.02 0.61 * * 0.25 0.08 0.35 excretion control0.71 * * 0.49 0.42 0.17 0.52 * 0.29 0.05 0.34 transfer0.78 * * 0.42 0.55 * 0.05 0.51 * 0.51 * 0.19 0.08 locomotion0.84 * * 0.50 0.71 * * 0.01 0.55 * 0.52 * 0.29 0.11 cognition itemcommunication0.17 0.16 0.22 0.13 0.21 0.10 0.16 0.10 social cognition0.30 0.19 0.25 0.26 0.30 0.46 0.05 0.05 total0.78 * * 0.46 0.53 * 0.05 0.53 * 0.47 0.01 0.29 bedridden level 0.74 * * 0.45 0.61 * 0.21 0.61 * 0.26 0.13 0.20 care - need level0.50 * 0.20 0.55 * 0.31 0.10 0.37 0.43 0.08 * * p<0.01 , * p<0.05 . pf : physical function , rp : role physical , bp : body pain , gh : general health , vt : vitality , sf : social function , re : role emotional , mh : mental health ) . * pf : physical function , rp : role physical , bp : body pain , gh : general health , vt : vitality , sf : social function , re : role emotional , mh : mental health for the correlations between the qol and bedridden degree , subjects with a higher bedridden degree showed significantly lower pf ( r=0.74 , p<0.01 ) and vt scores ( r=0.61 , p<0.05 ) and complained less about body pain ( r=0.55 , p<0.05 ) . for the correlations between the qol and care - need level , subjects with a higher care - need level showed significantly lower pf scores ( r=0.50 , p<0.05 ) and complained less about body pain ( r=0.55 , p<0.05 ) ( table 2 ) . although the stroke mortality rate is decreasing in japan , more and more people are suffering from strokes . strokes often cause aftereffects , leaving patients with disabilities . since shortening the duration of hospital / institution stays is encouraged today , services for homebound elderly hemiparetic stroke patients that consider their qol are required for them to live securely and stably at home after discharge from hospitals or institutions . this study looked at homebound elderly hemiparetic stroke patients and their qol , and analyzed and examined factors that affect qol . the results indicated that patient age or gender does not directly affect qol . the results , however , showed that their qol was affected by the bedridden degree , care - need level , and adl independence . the results showed that the qol of the homebound elderly hemiparetic stroke patients was lower in six subscales , excluding rp and re , than the deviation score of the same age group . their physical activity and spheres of activity are limited , and they have less social interaction . our results suggested that homebound elderly hemiparetic stroke patients are more anxious about their future health and are depressed . as for the correlations between the adl and qol of ordinary elderly people , sugisawa6 reported that their qol correlates with their adl independence . sasuga8 noted that extended adl ( 8 adl items and 12 iadl items ) are a factor that affects the qol of the homebound disabled . our results also indicated that the adl independence of homebound elderly hemiparetic stroke patients correlates with their qol , such as their physical functions and vitality , verifying the results of the above - mentioned researchers . the qol of homebound elderly hemiparetic stroke patients also significantly correlated with the bedridden degree and care - need level , which indicate mobility and amount of assistance required . when patient bedridden degree and care - need level were higher , the qol was lower . therefore , our results suggested that improving the adl independence and lowering the bedridden degree and care - need level are required to improve the qol of homebound elderly hemiparetic stroke patients . regarding the correlations between the qol and fim items , the pf and vt subscales were significantly correlated with independence in the mobility items . when transfer and movement ability are higher , individuals have broader spheres of activity and higher social functions . therefore , in order to improve the qol , such as physical functions , vitality and social functions , of people requiring long - term care , improving adl independence is , of course , important . it is , however , particularly important to assure their movement ability , as fukuya9 has noted . patients with higher transfer and movement ability also tended to have broader spheres of activity and to complain more about body pain . with the development or worsening of such body pain , this contradicts the improved social functions with broader spheres of activity . when patients have more opportunities to engage in activity , the physical burden imposed on their bodies increases , and they have more risk of suffering from body pain . the risk of developing new body pain must be assessed and addressed appropriately in order to improve qol , particularly the individual s social functions and body pain . the results of this study suggested that , in order to improve the qol of homebound elderly hemiparetic stroke patients , continuous rehabilitation to maintain and improve patient adl ability and assess and relieve the pain that patients feel when they move their bodies is required .

[ purpose ] this study examined the quality of life ( qol ) of homebound elderly hemiparetic stroke patients and factors that affect it . [ subjects ] the subjects of the study were 21 homebound elderly hemiparetic stroke patients who were 65 years old or over and required care for daily living ( 12 males and 9 females , average age : 79.3 8.4 years old ) . their physical and psychological conditions , qol , and other characteristics were researched . [ methods ] the functional independence measure ( fim ) was used for the activities of daily living ( adl ) assessment , and the mos 36-item short - form health survey ( sf-36 , japanese version 1.2 ) was used for the qol assessment . [ results ] no correlations were observed between the qol of homebound elderly hemiparetic stroke patients and their age and gender . however , the results showed that their qol was affected by their independence in adl , bedridden degree , and care - need level . [ conclusion ] these results suggest that in order to improve the qol of homebound elderly hemiparetic stroke patients , ongoing rehabilitation to improve independence in adl and lower the bedridden degree and care - need level is required .

recurrence of c. difficile was defined as confirmed presence of c. difficile toxin via polymerase chain reaction ( pcr ) after complete resolution of diarrhea for a minimum of 2 weeks and a maximum of 6 months and the completion of antibiotic therapy ( 5 , 7 ) . rf is a statistical model used for classification and regression which works by using input variables to create an output of regression trees . the mode class of all of the classes of the individual trees is then chosen as the output and is used to determine the variables of interest . regression trees are binary trees with nodes that correspond to different values in the input variables . the rf algorithm searches for a value that best separates all instances within that node based on the outcome of interest . if the instance chosen is not able to be separated further , then it is called a terminal node . the variables used in this study were selected after an extensive review of literature and only the most common comorbidities found in patients with cdi and re - infection were included . among the numerous existing variables , 25 of the most strongly associated variables have been selected . variables which were not found to be significant have not been included in order to optimize the rf algorithm . explanatory variables used in this study a retrospective chart review was performed on patients diagnosed with cdi based on international classification of disease ( icd-9 ) codes . the selection of the study population , selection criteria , and sampling were all performed subject to the approval of the institutional review board ( irb ) . patients diagnosed with cdi via pcr between february 2009 and june 2013 . patients with recurrence within 2 weeks or after 6 months of initial cdipatients with documented non - compliance to prescribed medical therapy patients with recurrence within 2 weeks or after 6 months of initial cdi patients with documented non - compliance to prescribed medical therapy using these criteria , data of 200 randomized patients diagnosed with cdi were collected . the prevalence of cdr within the randomly selected sample size was 15% ( 30 patients ) . rf statistical analysis and randomization was performed using the spm salford predictive modeler version 6.0 ( salford system , san diego , ca ) . the predictive model was designed by professors leo breiman and adele cutler of the university of california , los angeles . our sample population was randomly separated into two distinct groups , a training group and a validation group . the training group was used essentially to create our learning algorithm , which comprised 2,000 regression trees . each tree comprised binary nodes or branches , which contribute their results to the variables of interest . at each node , a variable is tested ( e.g. , 80 mg ppi ) . at that node , the data entered will either fall into a branch of cdr or no recurrence . through the 2,000 regression trees the cumulative predictions created in the 2,000 trees will create the probability of the patient having a recurrence of an initial cdi . the training and testing groups , although broken into two groups , still allow for all patients in the sample selection to be run through the predictive model . as opposed to amalakuhan 's study , which used a 75% training group to 25% validation group distribution split ( 8 , 9 ) , we used an experimental 70%:30% distributional split . this allowed an additional 10 patients to our validation group , presumptively strengthening the end result and the predictive probability of our model . within both the training and validation groups , the predicted probability of determining the patients who had cdr was almost completely equal . the rf model using the indices as set above was run 500 times , and for each of these 500 runs , the accuracy of the predictive model was assessed by calculating the sensitivity , specificity , area under the curve ( auc ) for receiver operating characteristic , and precision ( fig . recurrence of c. difficile was defined as confirmed presence of c. difficile toxin via polymerase chain reaction ( pcr ) after complete resolution of diarrhea for a minimum of 2 weeks and a maximum of 6 months and the completion of antibiotic therapy ( 5 , 7 ) . rf is a statistical model used for classification and regression which works by using input variables to create an output of regression trees . the mode class of all of the classes of the individual trees is then chosen as the output and is used to determine the variables of interest . regression trees are binary trees with nodes that correspond to different values in the input variables . the rf algorithm searches for a value that best separates all instances within that node based on the outcome of interest . if the instance chosen is not able to be separated further , then it is called a terminal node . the variables used in this study were selected after an extensive review of literature and only the most common comorbidities found in patients with cdi and re - infection were included . among the numerous existing variables , 25 of the most strongly associated variables have been selected . variables which were not found to be significant have not been included in order to optimize the rf algorithm . a retrospective chart review was performed on patients diagnosed with cdi based on international classification of disease ( icd-9 ) codes . the selection of the study population , selection criteria , and sampling were all performed subject to the approval of the institutional review board ( irb ) . patients with recurrence within 2 weeks or after 6 months of initial cdipatients with documented non - compliance to prescribed medical therapy patients with recurrence within 2 weeks or after 6 months of initial cdi patients with documented non - compliance to prescribed medical therapy the prevalence of cdr within the randomly selected sample size was 15% ( 30 patients ) . rf statistical analysis and randomization was performed using the spm salford predictive modeler version 6.0 ( salford system , san diego , ca ) . the predictive model was designed by professors leo breiman and adele cutler of the university of california , los angeles . our sample population was randomly separated into two distinct groups , a training group and a validation group . the training group was used essentially to create our learning algorithm , which comprised 2,000 regression trees . each tree comprised binary nodes or branches , which contribute their results to the variables of interest . at each node , a variable is tested ( e.g. , 80 mg ppi ) . at that node , the data entered will either fall into a branch of cdr or no recurrence . through the 2,000 regression trees the cumulative predictions created in the 2,000 trees will create the probability of the patient having a recurrence of an initial cdi . the training and testing groups , although broken into two groups , still allow for all patients in the sample selection to be run through the predictive model . as opposed to amalakuhan 's study , which used a 75% training group to 25% validation group distribution split ( 8 , 9 ) , we used an experimental 70%:30% distributional split . this allowed an additional 10 patients to our validation group , presumptively strengthening the end result and the predictive probability of our model . within both the training and validation groups , the predicted probability of determining the patients who had cdr was almost completely equal . the rf model using the indices as set above was run 500 times , and for each of these 500 runs , the accuracy of the predictive model was assessed by calculating the sensitivity , specificity , area under the curve ( auc ) for receiver operating characteristic , and precision ( fig . our population consisted of 198 patients from two sister hospitals in a community setting with a documented cdi . of those patients , 30 had cdr , giving us a recurrence rate of approximately 15% . the mean age of the patients in the recurrence group was 70.8 ( sd 17 ) , while the mean age of the population without recurrence was 68.7 ( sd 17.7 ) . the majority of the population was caucasian ( 88.4% ) with the remainder of the population being either african american ( 6.6% ) or other races ( 5.0% ) ( table 2 ) . demographic and risk factor table our final model based on 500 runs of the rf produced the following results : sensitivity , 83.3% ; specificity , 63.1% ; overall correct predicted percentage , 66.1% ; and auc , 82.6% cdi is a growing concern in the health care system , and it represents one of the most difficult challenges faced by clinicians . throughout the 1990s and 2000s , the number of c. difficile - related hospital stays per 100,000 population has been steadily increasing , peaking at 114.6 in 2008 from a low of 33.2 in 1993 ( 10 ) . the major problem associated with c. difficile infection is the high rate of recurrence of 20 to 35% . if a recurrence has occurred , the chances of a second recurrence further increases to 4565% ( 11 , 12 ) . cdr increases mortality and morbidity , length of hospital stay , health care costs , and utilization of other health care resources . it also puts additional burden on the patient 's quality of life and their families . previous studies have also documented that cdr resulted in 265 additional days of vancomycin use and 19.7 days of metronidazole use ( 13 ) . although some studies have looked at the causes , there is little consensus on causes of cdr . previous studies have identified the following associated risk factors : age , horn 's index , proton pump inhibitor use , antibiotic use , alteration of colonic microflora , initial disease severity , and hospital exposure ( 1418 ) . for this study , we created an rf predictive model using multiple well - known risk factors associated with cdi identified in previous studies . after 500 runs of the tree - based algorithm , the rf model performed extremely well in classifying predictors of cdr versus non - recurrent cases . the overall accuracy of our rf model was 66.1% with a sensitivity and specificity of 83.3 and 63.1% , respectively . the area under the receiver operating curve was 82.6% , which is comparable to other strong models . our study expanded on their work by using a larger amount of patients that were followed for a longer period of time of 3 years . in addition , specific important co - variables such as ppi 's chemotherapy , corticosteroids , and antibiotic use were used in our study ( 19 ) . the rf has already been used successfully in other studies in determining predictors in various chronic and acute conditions . ( 6 ) previously demonstrated that the rf was excellent at predicting factors associated with readmissions for copd exacerbation . a well - documented study by adrienne chu demonstrated that the rf machine learning algorithm outperformed six other prediction models in determining the cause of gastrointestinal bleeding ( 20 ) . the models that were outperformed included well - known algorithms such as the support vector machine , boosting , artificial neural network , linear discriminant analysis , and logistic regression . one of the major strengths of our study was that it contained a large number of patients who were followed for several years ( 20092013 ) . we also used a large number of significant variables in this study to create the prediction model . one of the major limitations of our study was that the majority of our sample population was caucasian . the recurrent nature of infection is worrisome since repeated use of antibiotics against the same strain of bacteria may lead to resistance mechanisms . in this study , we used the rf machine learning algorithm to create a strong prediction model with high sensitivity to predict cdr . in the evolving field of medical informatics , the use of such learning algorithm models can be used in risk factor stratification for hospitalized patients . if patients at risk for cdr could be accurately identified , specific management strategies could be developed resulting in better management , decreased morbidity and mortality , better health care resource utilization , and decreased length of hospital stay . we believe that the advantages offered by the rf makes it the ideal tool for this task .

background clostridium difficile infection ( cdi ) is a growing problem in the community and hospital setting . its incidence has been on the rise over the past two decades , and it is quickly becoming a major concern for the health care system . high rate of recurrence is one of the major hurdles in the successful treatment of c. difficile infection . there have been few studies that have looked at patterns of recurrence . the studies currently available have shown a number of risk factors associated with c. difficile recurrence ( cdr ) ; however , there is little consensus on the impact of most of the identified risk factors.methodsour study was a retrospective chart review of 198 patients diagnosed with cdi via polymerase chain reaction ( pcr ) from january 2009 to jun 2013 . in our study , we decided to use a machine learning algorithm called the random forest ( rf ) to analyze all of the factors proposed to be associated with cdr . this model is capable of making predictions based on a large number of variables , and has outperformed numerous other models and statistical methods.resultswe came up with a model that was able to accurately predict the cdr with a sensitivity of 83.3% , specificity of 63.1% , and area under curve of 82.6% . like other similar studies that have used the rf model , we also had very impressive results.conclusionswe hope that in the future , machine learning algorithms , such as the rf , will see a wider application .

it typically occurs within fourteen days of aneurysmal rupture , and it is associated with significant morbidity and mortality [ 1 , 2 ] . while pathophysiology remains incompletely understood , the interplay between inflammation and the innate immune response is strongly implicated . following sah , increased blood - brain barrier ( bbb ) permeability engenders a proinflammatory milieu in the cerebral cisterns and extravascular space . subarachnoid blood initiates leukocyte transmigration via cellular margination , adhesion , rolling , and diapedesis . the process necessitates violation of the tight junctions between endothelial cells of the bbb and typically occurs in response to stimulatory chemoattractants or chemokines . regulation of the extracellular matrix and basal lamina by matrix metalloproteinase ( mmp ) enzymes may play a critical role in vasospasm . mmps have been studied extensively in the pathogenesis of ischemic stroke and the development of aortic and cerebral aneurysms . recently , investigations have examined the role of mmps in the setting of sah . in this paper , we specifically review the function of mmps in cerebral vasospasm . understanding the complex interactions between inflammation and degradation of the extracellular matrix may ultimately allow for better development of diagnostic markers and targeted therapies relevant to the management of delayed cerebral vasospasm . mmps are a family of extracellular and membrane - bound proteases capable of degrading or proteolytically modifying the extracellular matrix ( ecm ) through interactions with collagenases , laminins , and proteoglycans . they utilize zinc - dependent endopeptidases to regulate physiologic processes relevant to development , homeostasis , and tissue modeling . mmps are secreted by macrophages , leukocytes , smooth muscle cells , endothelial cells , astroglia , and microglia in response to growth factors and inflammatory cytokines [ 712 ] . activation through the zymogen in a cysteine switch was first demonstrated by van wart and birkedal - hansen . demonstrated that mmp-3 is capable of activating pro mmp-1 , mmp-7 , mmp-8 , mmp-9 , and mmp-13 , while mmp-2 can activate pro mmp-1 , mmp-9 , and mmp-13 . activated mmps have important roles in neuronal development , function , and differentiation [ 1418 ] . inhibition is mediated by a family of proteins known as tissue inhibitors of metalloproteinases ( timps ) . activated leukocytes are a major source of mmp production following brain injury [ 21 , 22 ] . as mmps degrade the basal lamina , cellular transmigration is facilitated . degradation of the blood - brain barrier allows leakage of inflammatory mediators into the extracellular matrix . the proinflammatory environment , in turn , may promote arterial dysregulation , stimulate leukocyte migration , enhance cytokine / chemokine production , and render the affected vessels susceptible to narrowing . a review of the specific mmps follows ; only those that have been studied in the setting of delayed cerebral vasospasm ( mmp-1 , mmp-2 , mmp-8 , mmp-9 , and mmp-13 ) are included . the effect is durably negated by mmp inhibitors [ 2325 ] . to date , a single investigation has examined the role of mmp-1 in cerebral vasospasm . in an experimental rodent model , satoh et al . utilized immunohistochemical and western blot analysis of basilar arteries to quantify mmp-1 deposition . when compared to controls , this elevation peaked at 30 minutes post - sah and was temporally concordant with vessel narrowing . only one group has examined the role of mmp-2 in the pathogenesis of cerebral vasospasm . other investigators , however , have documented elevated mmp-2 levels in vessel walls of ruptured and unruptured cerebral aneurysms [ 2628 ] and in patients who suffered ischemic stroke . due to a paucity of large studies and conflicting data , the precise role of mmp-2 in the development of cerebral aneurysms and pathogenesis of vasospasm the putative role of mmp-9 in cerebral vasospasm was first explored by mcgirt et al . . they compared levels with individuals admitted for elective aneurysm clipping and patients who suffered from non - sah stroke . further , they assessed mmp-9 levels in sah patients who developed cerebral vasospasm and those who did not . onset of vasospasm was defined as transcranial doppler flowmetry velocities greater than 180 cm / s and/or new focal neurological deficits with angiographically confirmed vasospasm . mean peak serum mmp-9 levels were increased in the sah cohort that developed vasospasm when compared to the group that did not . further , peak mmp-9 levels for the sah cohort that developed vasospasm were significantly elevated when compared to the focal ischemia and control cohorts . mmp levels of greater than 700 ng / ml independently increased the odds of subsequent vasospasm by 25-fold . these findings first advocated mmp-9 as a potential diagnostic biomarker for cerebral vasospasm in the setting of sah and incited significant interest in related research . in a rat sah model , sehba et al . examined the role of mmp-9 on basal lamina integrity in the cerebral microvasculature . collagen iv is a major structural component of the basal lamina , comprising approximately 90% of the total protein [ 32 , 33 ] . the authors noted activation of four key signal transduction molecules ( p38 , erk1/2 , elk-1 , and activating transcription factor-2 ) and resultant transcription of ecm - related ( mmp8 , mmp9 , and mmp13 ) and inflammatory ( il6 , tnfa , il1b , cxcl1 , cxcl2 , ccl20 , and inos ) genes . the findings suggested one signal transduction pathway by which mmps are activated in response to sah and elucidated potential targets for therapy . examined serum mmp-9 concentrations in a relatively small cohort of sah patients and compared values to normal controls . the authors found mmp-9 levels to be increased in the sah group , but they failed to demonstrate correlation with clinical hunt and hess scores . feiler et al . examined the influence of mmp-9 on cerebral edema and functional outcomes following sah in mmp-9 knockout ( mmp-9/)mice . they found no significant differences in acute intracranial pressure ( icp ) , cerebral blood flow , or mean arterial blood pressure between mmp-9/ and wild - type mice . however , day 7 mortality was significantly lower in mmp-9/ mice ( p = 0.03 ; 20% versus 60% ) . the mmp-9 knockout mice also demonstrated less brain edema , lower chronic icp , and improved neurological recovery when compared to the wild - type mice . findings suggest a role for mmp-9 in the genesis of cerebral edema and increased intracranial pressure following sah . early brain injury ( ebi ) is believed to cause significant morbidity and mortality following sah . the study examined ecm protein lamina integrity and anoikis / apoptosis in the hippocampal region . injury increased from 12 to 72 hours , with peak activity evident at 24 hours . similarly , laminin density decreased at 12 hours , reached a nadir at 24 hours , and began to recover at 48 hours . brain water content , a surrogate measure for cerebral edema , increased at time points relevant to neuronal apoptosis . the authors concluded that mmp-9 plays an important role in the pathophysiology of early brain injury following sah via degradation of laminin and resultant anoikis of hippocampal neurons . a single long - term study has associated mmp-9 levels and inflammation with poor clinical outcomes following sah . chou et al . examined mmp-9 and neutrophil levels in blood and csf of fifty - five sah patients . the investigators examined associations between the following parameters : ( 1 ) serum and csf leukocyte and neutrophil and mmp-9 levels , ( 2 ) development of cerebral vasospasm , and ( 3 ) poor clinical outcome ( three - month modified rankin score ) . development of cerebral vasospasm was independently associated with persistent elevation of blood leukocytes and neutrophils on post - sah days 014 but not with csf or serum mmp-9 levels . poor three - month modified rankin scores correlated with elevated blood neutrophil counts on post - sah days 2 - 3 , elevated serum mmp-9 levels on post - sah days 4 - 5 , and elevated csf mmp-9 values on post - sah days 014 . further , blood neutrophil levels correlated with mmp-9 levels on post - sah days 68 and 1014 . together , these findings suggest that neutrophils may represent a major source of mmp-9 production in the early post - sah time period . as mmp-9 levels were associated with poor three - month outcomes , but not delayed cerebral vasospasm , the authors postulate a role for mmp-9 in alternate mechanisms of brain injury ( aside from vasospasm ) following sah . wang et al . recently described the time course of basilar artery mmp-9 expression in an experimental murine model of sah . further , the investigators explored the effect of sb-3ct , a selective mmp-9 inhibitor , on the development of cerebral vasospasm . they discovered that expression of mmp-9 peaked on postbleed day 3 and returned to normal by day 14 which is consistent with the time course of delayed cerebral vasospasm . the authors noted a significant reduction in vasospasm ( measured by cross - sectional area of the basilar artery ) on postbleed day 3 following the administration of sb-3ct . these findings highlight an mmp-9 inhibitor which may hold therapeutic promise in the setting of cerebral vasospasm . recent studies have assessed the utility of mmp inhibitors in translational models of stroke and cerebral ischemia . however , few inhibitory strategies have been investigated in the setting of vasospasm . in a study by dittmar et al . , various classes of mmp inhibitors including monoclonal antibodies , tissue mmp inhibitors , and broad - spectrum mmp inhibitors ( bb-94 , bb-1101 , and kb - r7785 ) proved to be effective in reducing tissue damage in an animal model of cerebral ischemia . in a rodent model , reijerkerk et al . demonstrated that bb-3103 , a broad - spectrum matrix metalloproteinase ( mmp ) inhibitor , decreased endothelial gap formation , occludin loss , and the ability of monocytes to traverse the endothelium . future studies may seek to translate these positive findings from closely related systems into relevant cerebral vasospasm models . mmps are a family of proteases that preserve the structure of blood vessels . under normal conditions , they regulate transfer of molecules , aid in adaptation of the ecm , and maintain the bbb . in state of disease , they can mediate breakdown of the bbb and thus modify the local inflammatory response . together , these factors may incite or propagate delayed cerebral vasospasm . in this capacity , mmps likely contribute to progressive injury following ischemia and aneurysmal rupture . mmps could ultimately provide a potential biomarker for early diagnosis or a target for therapeutic intervention in the setting of delayed cerebral vasospasm following sah .

delayed cerebral vasospasm is a significant cause of morbidity and mortality following aneurysmal subarachnoid hemorrhage ( sah ) . while the cellular mechanisms underlying vasospasm remain unclear , it is believed that inflammation may play a critical role in vasospasm . matrix metalloproteinasees ( mmps ) are a family of extracellular and membrane - bound proteases capable of degrading the blood - rain barrier ( bbb ) . as such , mmp upregulation following sah may result in a proinflammatory extravascular environment capable of inciting delayed cerebral vasospasm . this paper presents an overview of mmps and describes existing data pertinent to delayed cerebral vasospasm .

the families included in the analyses were ascertained from nine different sources : the four t1dgc regional networks of asia - pacific ( n = 228 ) , europe ( n = 585 ) , north america ( n = 370 ) , and the u.k . ( n = 124 ) ; the diabetes uk warren 1 repository ( n = 429 ) ; the human biological data interchange repository ( n = 424 ) ; the joslin diabetes center ( n = 112 ) ; the steno diabetes center ( n = 146 ) ; and sardinia ( n = 78 ) . to be included in the study , a family had to have at least one asp available for sampling ; availability of one or both biological parents was preferred but not required . an individual was designated as affected if he or she had documented type 1 diabetes with onset at < 35 years of age , had used insulin within 6 months of diagnosis , and had no concomitant disease or disorder associated with diabetes . most families , 2,287 ( 91.6% ) , had exactly two affected full siblings , 101 ( 4.0% ) had three , and 7 ( 0.3% ) had four or more . among 2,657 asps in total , both parents were available for 69.6% of the asps , 18.9% had only a single parent available , and 11.6% had neither parent available . a few extended pedigrees also provided 13 affected half - sib pairs and 22 affected - affected avuncular pairs . genotyping was carried out at the center for inherited disease research ( cidr ) using the illumina human linkage-12 genotyping beadchip , which contains 6,090 single nucleotide polymorphisms with an average genome - wide spacing of 0.58 cm . before statistical genetic analyses , genotype data were evaluated for mendelian errors using pedcheck ( 8) . prest ( 9 ) was used to estimate the likelihood of each specified relationship in pedigrees given the genotyping information . based on these analyses , 43 families were removed from further analysis due to the presence of a duplicate family , a duplicate sample within the family , nonresolvable family errors , or missing genotype information . the kong and cox linear nonparametric linkage ( npl ) model ( 11 ) implemented in merlin was used for the npl linkage analysis . marker - marker linkage disequilibrium was modeled in the linkage analysis using the maximum - likelihood clustered marker approach implemented in merlin with a cutoff of r > 0.5 . genotyping was carried out at the center for inherited disease research ( cidr ) using the illumina human linkage-12 genotyping beadchip , which contains 6,090 single nucleotide polymorphisms with an average genome - wide spacing of 0.58 cm . before statistical genetic analyses , genotype data were evaluated for mendelian errors using pedcheck ( 8) . prest ( 9 ) was used to estimate the likelihood of each specified relationship in pedigrees given the genotyping information . based on these analyses , 43 families were removed from further analysis due to the presence of a duplicate family , a duplicate sample within the family , nonresolvable family errors , or missing genotype information . the kong and cox linear nonparametric linkage ( npl ) model ( 11 ) implemented in merlin was used for the npl linkage analysis . marker - marker linkage disequilibrium was modeled in the linkage analysis using the maximum - likelihood clustered marker approach implemented in merlin with a cutoff of r > 0.5 . figure 1 shows the results of the genome - wide analysis for linkage to type 1 diabetes in the entire t1dgc family collection . the average information content across all chromosomes was 0.924 and ranged from 0.904 on chromosome 20 to 0.939 on chromosomes six and x. table 1 lists the regions where evidence for linkage exceeded the threshold for suggestive linkage ( logarithm of odds [ lod ] 2.2 ) in an asp linkage study . the hla region on chromosome 6p21.3 was the only region to display significant evidence of linkage to type 1 diabetes ( lod = 213.2 ) . these included a region on chromosome 2q ( lod = 3.28 ) , where there have been multiple past reports of linkage to type 1 diabetes , and the region surrounding the insulin gene at 11p15.5 ( lod = 3.16 ) that has been previously implicated in type 1 diabetes susceptibility by both linkage and association studies . the remaining two regions were on chromosome 19 ( lod = 2.84 and 2.54 ) and are separated from each other by 48.5 cm ; evidence of linkage to chromosome 19 has been reported before but not to any level of confidence that justified specific attention . other previously reported type 1 diabetes loci , which quite often were given type 1 diabetes designations , were not confirmed in the current study ( table 2 ) . evidence for linkage was evaluated using merlin , and lod scores were calculated using the kong and cox linear npl model ( 10,11 ) . lod scores are plotted on the vertical axis versus chromosomal position on the horizontal axis . lod scores at region 15.5110.5 cm on chromosome 6 are larger than four and not shown . regions with suggestive or significant evidence of linkage to type 1 diabetes * genotyped markers bounding the lod-1 support interval . evidence for linkage in regions previously reported to harbor iddm loci * not corrected for allele sharing at iddm1 . adjustment based upon the expected lod at d6s283 and the recombination fraction with hla yields an adjusted lod of 2.7 . when considering evidence for linkage to type 1 diabetes on chromosome 6 that might possibly be due to loci other than the classic hla genes , it was necessary to take into account the significant allele sharing at hla , where lod scores > 3.6 were detected over an interval of 100 cm surrounding the locus . we searched for evidence of additional type 1 diabetes risk loci by calculating expected lod ( elod ) scores based upon allele sharing at hla along the length of chromosome 6 ( supplementary fig . 1 , available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db08-1551/dc1 ) . the observed lod score exceeded the elod by 3.6 in three regions . one of these regions , from 81.5 to 101.5 cm ( maximum lod elod = 10.8 ) , overlapped with the location of the previously reported iddm15 locus ( 6,12 ) . the t1dgc family collection includes the largest number of asps to be tested for linkage to type 1 diabetes in a genome - wide scan yet provides suggestive or significant evidence for only five loci linked to type 1 diabetes . in light of the numerous previous reports of loci linked to type 1 diabetes , we considered the relationship between the findings here and prior studies ( table 2 ) . the majority of studies , as in our current report , have observed significant evidence of linkage to type 1 diabetes at hla , and there is well - confirmed evidence of disease association in the same region . several additional loci on chromosome 6 ( iddm5 , iddm8 , and iddm15 ) have been proposed based on previous linkage studies ( 1,13,14 ) . the current study provides little support for either iddm5 or iddm8 ( table 2 ) . however , we did obtain a regional maximum lod of 5.43 , at 190.0 cm on chromosome 6q27 , where iddm8 was previously localized ( 13 ) when linkage disequilibrium was not modeled in the analysis . this region is characterized by a relatively strong intermarker linkage disequilibrium , which might explain this and previous reports of linkage in this region . an additional region on chromosome 6q provided evidence for linkage to type 1 diabetes after adjusting for the effect of allele sharing at hla . previous studies have tested for linkage at iddm15 , which is located in this region , by calculating the expected lod score at iddm15 based upon the observed identical - by - descent ( ibd ) sharing at hla and the recombination fraction between hla and d6s283 ( 7,12 ) . the excess of the observed ibd sharing compared with that which was expected was then used as a measure of the independent contribution of iddm15 . applying this approach to the current dataset identified a broad ( 20 cm ) region where the adjusted lod exceeds 3.6 . uncertainties remain as to the precise location of iddm15 because male and female recombination maps differ substantially in this region . nevertheless , this region of increased lods , after adjusting for the contribution of allele sharing at hla , provides support for the existence of an additional linkage to type 1 diabetes in this region . chromosome 2q contains two confirmed type 1 diabetes risk loci near the ifih1 and ctla4 genes identified by association and three proposed loci ( iddm7 , iddm12 , and iddm13 ) for which suggestive evidence of linkage has been observed in some , but not all , studies ( 1517 ) . in the current report , there was no support for multiple distinct loci ; suggestive evidence of linkage was observed in the 2q32.3 region , approximately midway between the previously proposed locations of iddm7 and iddm12 . the ins locus at 11p15.5 is also well established as a risk locus for type 1 diabetes ( 18 ) . two regions on chromosome 19 displayed suggestive evidence of linkage to type 1 diabetes , which , given our sample sizes and marker map , is the most interesting data yet for this chromosome . so far , no associations with genome - wide significance have been reported in these regions . recently , genome - wide association ( gwa ) studies have identified at least 18 genomic regions with significant evidence of association to type 1 diabetes , but the majority of these loci , although common in the population , have relatively modest individual effects on risk ( e.g. , odds ratios [ ors ] of 1.11.3 ) ( 1922 ) . linkage studies are not optimal for detecting such loci where the risk alleles are common and have small individual effect sizes . thus , it is not surprising that none of these newly identified loci from gwa studies fall within regions of even suggestive linkage in the current study . several of our linkage peaks do include loci previously detected by association , but these tend to have large effects on risk such as hla ( or 11.4 ) ( 23 ) or ins ( 2.38 ) ( 18 ) . the large sample size studied here , 2,658 asps from 2,496 families , provided us with unprecedented power to detect linkage to type 1 diabetes across the genome . while we detected one locus with significant evidence of linkage , and five more regions with suggestive evidence , our study provides little support for the majority of previously proposed type 1 diabetes loci . our power to detect evidence of linkage to type 1 diabetes comes at a cost ; the low frequency of families with multiple affected siblings required a world - wide recruitment effort . therefore , we can not exclude the possibility that loci with strong effects in particular populations might be obscured in the current analysis . for example , lod = 3.21 was observed at 66.1 cm on chromosome 17 in the 370 t1dgc families recruited by the north american network , whereas no linkage was detected in the other eight populations ( lod scores ranging from 0.62 to 0.30 ) . in summary , the evidence for independent major gene effects in type 1 diabetes detectable by linkage ( e.g. , rare variants ) , which are shared across populations , appears to be limited to a few genes in the hla complex : ins , ctla4 , iddm15 , and possibly two regions on chromosomes 19 . the combination of these putative rare variant effects with common variants of smaller effect size , more readily detected by association - based approaches , accounts for the majority of risk for type 1 diabetes of which hla class ii alleles are by far the major contributor . identification of candidate genes and variants in these and other regions will help to clarify the biochemical pathways and mechanisms that contribute to risk for this common autoimmune disease . the substantial collection of biospecimens and data assembled by the t1dgc , and available to diabetes researchers ( www.t1dgc.org and www.t1dbase.org ) , should be an important resource for further characterizing those genomic regions identified by either linkage or association approaches as contributing to risk for type 1 diabetes .

objectivetype 1 diabetes arises from the actions of multiple genetic and environmental risk factors . considerable success at identifying common genetic variants that contribute to type 1 diabetes risk has come from genetic association ( primarily case - control ) studies . however , such studies have limited power to detect genes containing multiple rare variants that contribute significantly to disease risk.research design and methodsthe type 1 diabetes genetics consortium ( t1dgc ) has assembled a collection of 2,496 multiplex type 1 diabetic families from nine geographical regions containing 2,658 affected sib - pairs ( asps ) . we describe the results of a genome - wide scan for linkage to type 1 diabetes in the t1dgc family collection.resultssignificant evidence of linkage to type 1 diabetes was confirmed at the hla region on chromosome 6p21.3 ( logarithm of odds [ lod ] = 213.2 ) . there was further evidence of linkage to type 1 diabetes on 6q that could not be accounted for by the major linkage signal at the hla class ii loci on chromosome 6p21 . suggestive evidence of linkage ( lod 2.2 ) was observed near ctla4 on chromosome 2q32.3 ( lod = 3.28 ) and near ins ( lod = 3.16 ) on chromosome 11p15.5 . some evidence for linkage was also detected at two regions on chromosome 19 ( lod = 2.84 and 2.54).conclusionsfive non hla chromosome regions showed some evidence of linkage to type 1 diabetes . a number of previously proposed type 1 diabetes susceptibility loci , based on smaller asp numbers , showed limited or no evidence of linkage to disease . low - frequency susceptibility variants or clusters of loci with common alleles could contribute to the linkage signals observed .

alagille syndrome ( algs ) is an autosomal dominant disorder caused by heterozygous mutation in the jag1 ( jagged 1 ) gene on chromosome 20p12 . its estimated prevalence is about 1 out of 70,000 births , when ascertained by the presence of neonatal jaundice . it has been traditionally defined by a paucity of intrahepatic bile ducts , in association with five main clinical abnormalities : cholestasis , cardiac disease , skeletal abnormalities , ocular abnormalities , and a characteristic facial phenotype . abnormalities were reported in different systemic organs : in the eye , posterior embryotoxon and retinal pigmentary changes were observed ; in the heart , pulmonic valvular stenosis as well as peripheral arterial stenosis ; in the bones , abnormal vertebrae ( butterfly vertebrae ) and decrease in interpediculate distance in the lumbar spine ; in the nervous system , absence of deep tendon reflexes and difficulty learning ; in the faces , characteristic traits such as broad forehead , deep - set eyes , prominent nose , pointed mandible and chin , bulbous tip of the nose , and varying degrees of fingers foreshortening . no gene mutations associated with craniosynostosis was found , therefore , jag1gene was suggested to play a possible role in cranial suture formation . furthermore , severe hypodontia was described in a 3-year - old asian boy with algs . twenty - two percent of the patients with algs had spontaneous or post - procedure bleeding in various organs and were subjected to special risk for bleeding . therefore , it can be speculated that abnormalities in the jag1-gene may impair hemostatic function . nine percent had vascular anomalies or events , and vascular accidents accounted for 34% of mortality . vascular anomalies including basilar and middle cerebral artery aneurysms , internal carotid artery anomalies , aortic aneurysms , and co - arctation of the aorta were documented in algs patients . furthermore , latex - hypersensitivity and severe susceptibility to dental decays or decalcifications on the posterior deciduous teeth were described . this report describes a combined surgical - orthodontic procedure for guided - eruption of a deeply impacted macrodontic maxillary central incisor in young algs patient . although an interdisciplinary approach was needed , surgical procedure may be complicated by the severe risk of increased bleeding and vascular events . a 10-year - old male was presented to our dental office complaining of delayed eruption of a maxillary central incisor [ figure 1 ] . his medical history indicated a diagnosis of algs with no previous systemic treatment or complication . clinical examination revealed characteristics algs traits : broad forehead , deep - set eyes with eye - socket , pointed mandible and prominent chin ; maxillary hypoplasia , maxillo - mandibular retrusion ; and increased vertical facial dimension were also noted . he presented a class i molar relationship on both side , a correct overjet and a deep overbite ( 90% ) . absence of maxillary right central incisor with no adequate space in the maxillary arch was noted . an intra - oral examination revealed the presence of several decalcifications on deciduous teeth with previous conservative treatment on first permanent molars and maxillary first deciduous molar on right side . a 10-year - old male with history of alagille syndrome , presence of macrodontic central incisor vertically retained were shown cephalometric analysis indicated a class i skeletal pattern with retrognathic maxilla and mandible , prominent chin , and slight hyperdivergent tendency . treatment objective was to create space in the maxillary arch and allow the eruption of the impacted central incisor . surgical exposure and orthodontic traction with a fixed appliance was planned . risk of increased bleeding , vascular events , and latex hypersensitivity were the major concern , requiring the use of latex - free materials , controlled hemostatic procedure , and antibiotic prophylaxis as recommended by the cardiologist . bands on deciduous second molars and begg 's brackets on permanent incisors and deciduous canines were placed . after alignment and levelling were completed using 0.014 nickel titanium archwire , a relatively rigid stabilizing wire ( 0.018 round australian wire ) was placed , and a coil spring was used to create adequate space between the central incisor and the right lateral incisor . an access flap was elevated to expose the impacted tooth and a lingual button connected to a ligature wire was bonded to the palatal surface . a closed surgical exposure technique was chosen . an elastic module for applying an apically directed force once crown of the maxillary incisor adequately appeared in the maxillary arch , a begg bracket was bonded to the vestibular surface and alignment and levelling were completed using 0.014 nickel titanium wire , and later replaced by 0.018 round australian wire [ figure 3 ] . closed surgical exposure and vertical traction of the central incisor post - treatment photographs 9 months later . macrodontic incisor caused gingival margin and incisal border incongruence with the adjacent teeth the impacted maxillary right central incisor was brought into proper alignment with the adjacent teeth . once alignment was achieved , greater height and crown width of the macrodontic incisor caused gingival margin and incisal border alterations [ figure 3 ] . conservative treatment and minimal restorative interventions , accessory periodontal treatment , and dental reshaping procedures may be indicated to re - establish the proper size and dimension of the macrodontic incisor . a 10-year - old male was presented to our dental office complaining of delayed eruption of a maxillary central incisor [ figure 1 ] . his medical history indicated a diagnosis of algs with no previous systemic treatment or complication . clinical examination revealed characteristics algs traits : broad forehead , deep - set eyes with eye - socket , pointed mandible and prominent chin ; maxillary hypoplasia , maxillo - mandibular retrusion ; and increased vertical facial dimension were also noted . he presented a class i molar relationship on both side , a correct overjet and a deep overbite ( 90% ) . absence of maxillary right central incisor with no adequate space in the maxillary arch was noted . an intra - oral examination revealed the presence of several decalcifications on deciduous teeth with previous conservative treatment on first permanent molars and maxillary first deciduous molar on right side . a 10-year - old male with history of alagille syndrome , presence of macrodontic central incisor vertically retained were shown cephalometric analysis indicated a class i skeletal pattern with retrognathic maxilla and mandible , prominent chin , and slight hyperdivergent tendency . treatment objective was to create space in the maxillary arch and allow the eruption of the impacted central incisor . surgical exposure and orthodontic traction with a fixed appliance was planned . risk of increased bleeding , vascular events , and latex hypersensitivity were the major concern , requiring the use of latex - free materials , controlled hemostatic procedure , and antibiotic prophylaxis as recommended by the cardiologist . bands on deciduous second molars and begg 's brackets on permanent incisors and deciduous canines were placed . after alignment and levelling were completed using 0.014 nickel titanium archwire , a relatively rigid stabilizing wire ( 0.018 round australian wire ) was placed , and a coil spring was used to create adequate space between the central incisor and the right lateral incisor . an access flap was elevated to expose the impacted tooth and a lingual button connected to a ligature wire was bonded to the palatal surface . a closed surgical exposure technique was chosen . an elastic module for applying an apically directed force once crown of the maxillary incisor adequately appeared in the maxillary arch , a begg bracket was bonded to the vestibular surface and alignment and levelling were completed using 0.014 nickel titanium wire , and later replaced by 0.018 round australian wire [ figure 3 ] . closed surgical exposure and vertical traction of the central incisor post - treatment photographs 9 months later . macrodontic incisor caused gingival margin and incisal border incongruence with the adjacent teeth the impacted maxillary right central incisor was brought into proper alignment with the adjacent teeth . once alignment was achieved , greater height and crown width of the macrodontic incisor caused gingival margin and incisal border alterations [ figure 3 ] . conservative treatment and minimal restorative interventions , accessory periodontal treatment , and dental reshaping procedures may be indicated to re - establish the proper size and dimension of the macrodontic incisor . the major concern in treating this patient was the cardiological and vascular risk following surgical periodontal procedure , such as dental implant insertion , since high impaction position of a retained tooth may often require a traumatic surgery . increased bleeding , vascular events , and latex hypersensitivity were previously reported in algs patients , therefore , the use of latex - free materials and controlled hemostatic procedure were mandatory , even if these patients reported no previous medical history of specific hypersensitivity or hemostatic dysfunction . in agreement with cardiological recommendations , it was decided that antibiotic prophylaxis was not required since surgical procedure was not considered a risk for bacterial endocarditis . in accordance , first , closed - eruption technique may often avoid a second surgical procedure or re - intervention , second , it usually provides the most esthetically pleasing result since it preserves as much as possible gingival margin contour of the central incisor and adequate zone of attached gingival . open surgical exposure has the disadvantage of producing a non - keratinized vestibular gingival margin during vertical traction . using this technique , papillary apical positioned partial - thickness flap during the orthodontic traction may be needed to achieve an esthetic gingival margin contour over the central incisors and provide the teeth with an adequate zone of attached gingival labial to the crown . furthermore , because of the relatively high prevalence of gingival defects in some studies , adjunctive post - orthodontic periodontal surgery might be required in many patients treated with this method . an impacted maxillary central incisor in a child often represents , in addition to a disturbing esthetical problem , the parent 's main concern according which a patient can be referred to the orthodontist to evaluate the possibility of a disturbance eruption . orthodontic treatment has not been usually postponed until the complete eruption of the permanent dentition especially when the problem can be treated in the early mixed dentition stage . however , it is important to properly inform the patient about the possibility of failure before undertaking extensive measures necessary for the management of a severely impacted tooth . factors suggesting clinical success may be considered on the basis of position and orientation of the impacted tooth , amount of root formation , and degree of root dilacerations . and sabri reported that movement of an impacted central incisor could be impossible because of ankylosis and external root resorption . ho and liao reported that unsuccessful predictors for impacted central incisors were older age , highimpacted tooth , and dilacerated incisors . in this case , high impaction in the maxillary bone was the only negative factor increasing the likelihood of unsuccessful treatment result . however , central incisor has been successfully brought into proper position after having provided sufficient space in the maxillary arch , but an unavoidable unesthetic higher gingival margin in respect to the adjacent teeth was present after alignment ; this was due to the different crown size of the macrodontic central incisor . in fact , problems related to macrodontic tooth can include difference in size and shape , space deficiency , interproximal contact points with the adjacent teeth , and incongruence in gingival margin or incisal border . nevertheless , this case can not be considered as a true macrodontia ; when true macrodontia occurs in the incisal region , it can often be confused with conjoined teeth or fusion of teeth , since the union of two or more teeth results in a single large tooth during the odontogenesis . the main difference is that size reduction of macrodontic central incisors by proximal grinding is not possible without jeopardizing tooth vitality . in this case , reshaping procedure or minimal restorative interventions such as indirect composite veneers may be indicated . the esthetic outcome of these procedures can be excellent without unnecessary loss or teeth extraction . knowledge of the use of indirect composite veneers can provide another treatment option for esthetic problems in the management of tooth anomalies , including macrodontia . in conclusion this case report demonstrates that is possible , controlling carefully the procedure , to perform a combined surgical and orthodontic treatment in an algs patient .

this case report describes the surgical - orthodontic guided - eruption of a deeply impacted macrodontic maxillary central incisor in a 10-year - old patient with alagille syndrome ( algs ) . in the first stage , orthodontic treatment with fixed appliance on deciduous teeth allowed to create enough space for the eruption of the maxillary right central incisor . the second stage included closed surgical exposure and vertical traction . after impacted tooth erupted in the proper position , accessory periodontal treatment and dental reshaping procedures may be indicated to camouflage macrodontic incisor with the adjacent teeth . this is the first report that presents a patient with algs undergoing orthodontic and surgical treatment .

a cutaneous sinus of dental origin is a relatively uncommon occurrence and may be easily misdiagnosed . they do not always arise close to the underlying infection and dental symptoms may be absent ( 1 ) . often patients seek care from general physicians and surgeons with other diagnoses being made such as furuncles , basal cell and squamous cell carcinomas . it has been estimated that half of all patients undergo surgical excisions , multiple biopsies , antibiotic courses and even radiotherapy before definitive diagnosis ( 1,2,3 ) . misdiagnosis worsens the chronicity of the lesion and has pronounced effects on facial aesthetics due to unnecessary treatments resulting in further skin scarring . once the correct diagnosis is made , definitive treatment , through either tooth extraction or root canal therapy to eliminate the source of infection , is simple and effective . a 40-year - old male presented to the oral and maxillofacial surgery department with a 3-year history of a cutaneous sinus affecting the left cheek . he complained of intermittent swelling affecting the left face with a discharge of pus onto the left cheek . he had suffered an alleged assault 3 years prior and was struck with fists and glass bottles to the left face . he suffered no other medical conditions , did not take any medications and had no allergies . he had only recently registered with a dentist . in the 12 months prior to his presentation the patient had been referred to a local plastic surgery department via his general medical practitioner and had received treatment with no resolution of symptoms . the lesion was refractory to oral antibiotics and he had undergone excision biopsy of the cutaneous sinus followed by a z - plasty scar revision . on examination there was scarring to the left mental region with evidence of previous revision surgery and a draining cutaneous sinus ( fig . 1 & 2 ) . showing scarring to the left mental region with evidence of previous revision surgery and a draining cutaneous sinus intra - orally there was a crowned lower left first premolar which was not tender to percussion . image showing scarring to the left mental region with evidence of previous revision surgery and a draining cutaneous sinus plain radiographs revealed a periapical radiolucency of the lower left first premolar . cone beam computed tomography ( cbct ) showed the gp point to be in communication with the periapical area ( fig . ct showing gutta percha point communicating with the periapical area he was diagnosed with an oral cutaneous sinus associated with a non - vital lower left first premolar . a cutaneous dental sinus is a channel that leads from a dental focus of infection to drain onto the face or neck ( 2 ) . they are typically formed by periapical abscesses , which result from inflammatory degeneration of the pulp and periodontal membrane ( 4 ) . the inflammatory and immunological processes then induce bone resorption , resulting in the formation of an intraoral or cutaneous sinus . the point of drainage usually depends on the location of the apex of the affected tooth in relation to the muscular attachments of the bone and will follow the path of least resistance through the fascial planes of the face ( 5 ) . approximately 80% of cutaneous sinuses that occur arise from mandibular teeth and thus appear on the chin or submental region ( 6 ) . rarely , a dental cyst or un - erupted tooth can be the source of the infection lesions may resemble a pyogenic granuloma , actinomycosis , a thyroglossal duct cyst , a branchial cleft cyst , a furuncle , a squamous cell carcinoma and an epidermal cyst ( 1 ) . careful questioning of the patient about past symptoms may help identify a dental cause but symptoms may not be present in all cases . sinus tracts are most commonly found on the chin , submental region or in the submandibular area ( 7 ) . there is periodic drainage and crusting in some cases and the lesion is depressed below the normal skin surface . in particular , the examiner should look for dental caries or restorations and periodontal disease . a gp point can be used to trace the sinus tract to its origin , which is usually a nonvital tooth . biopsy , if performed , will show nonspecific findings such as hyperplasia and chronic inflammation ( 8) . once the correct diagnosis is made , root canal therapy or surgical extraction is the treatment of choice and antibiotics may be used as an adjunct to surgical therapy . . surgical revision of the scar can be undertaken to provide better a cosmetic result . failure of a cutaneous sinus tract to heal after adequate root canal treatment or extraction requires further evaluation and biopsy . as in this case , clinicians should be aware of the fact that any cutaneous lesion of the face and neck can be of dental origin and should seek communication and evaluation from appropriate specialists and general dental practitioners .

we report a case of a cutaneous sinus related to a non - vital lower premolar . the case was misdiagnosed by non - dentally trained medical staff and subsequent treatment proved ineffective . following referral to an oral and maxillofacial clinic the correct cause was established . correct treatment was followed by rapid resolution of signs and symptoms.this case highlights the need for healthcare professionals dealing with such patients to be aware of the dentition as a cause for cutaneous sinuses in the head and neck region . those professionals not dentally qualified should enquire about dental pain and consider referral to the dental practitioner or a specialist department for further evaluation . even those with a dental background can be fooled and a through history and examination is paramount , supplemented by special investigations were appropriate .

the laparoscopic removal of a cervical stump following a supra cervical ( subtotal ) hysterectomy was first described by nezhat et al , and they concluded that the cervical stump could be removed laparoscopically by an experienced surgeon . the advantages of the laparoscopic approach included possible stump adhesiolysis , providing adequate postoperative vault support , and assessment of the pelvic lymph nodes . the 43-year - old , presented with a history of persistent p v discharge and occasional post - coital bleeding . she had undergone subtotal hysterectomy in 1994 , due to postpartum hemorrhage following a normal delivery . a colposcopic biopsy done in january 2009 , reported severe dysplasia of the cervix , with a human papillomavirus ( hpv ) effect and crypt extension . there was a strong family history of cancer of the cervix , as her mother had succumbed to the disease . on general examination she was in fair general condition , well - built and well - nourished , with adequate hydration . the hemoglobin was 13.3 g / dl , blood sugar was 5.3 mmols / l , urea and electrolytes were normal . an initial diagnosis of abnormal pap smear was entertained and the patient opted for a laparoscopic trachelectomy , with the option of a laparotomy , after discussing all her options . there were dense adhesions in the pouch of douglas involving the bowel and the cervical stump . the pelvic lymph nodes were clearly visualized ( after intracervical methylene blue injection ) and did not appear to be enlarged . gentle adhesiolysis was undertaken using sharp dissection , bipolar cautery , and a harmonic scalpel . the vaginal vault was subsequently opened over the ceramic cup of a clermont ferrand elevator . a cystoscopy with retrograde ureteral catheterization , to confirm the integrity of the bladder and ureters , was undertaken . the cervical stump after laparoscopic trachelectomy at one week of follow - up the patient was well . a postoperative intravenous urogram ( ivu ) confirmed that both the ureters and bladder were intact . subtotal hysterectomy was developed as a procedure in the 1990s , and is regarded as a safe option to total abdominal hysterectomy in the management of benign uterine conditions and in obstetrics , due to severe postpartum hemorrhage . okaro et al , in an assessment of the long - term outcomes of laparoscopic supracervical hysterectomy analyzed the case records of 70 consecutive women undergoing the procedure . of these , 24.3% ( 17 cases ) reported symptoms related to the cervical stump , within 14 months of the original surgery . in his series 14 of these patients underwent laparoscopic trachelectomy , one had only laparoscopic adhesiolysis and two underwent a laparotomy with trachelectomy due to dense bowel adhesions on the cervical stump . histologically the stumps showed endometriosis ( 23.5% ) and mild dysplasia in 7.6% of the patients . in this case our patient presented with persistent p v discharge and occasional post - coital bleeding . the subsequent pap smears were abnormal . in a retrospective of 41 patients undergoing laparoscopic subtotal hysterectomy , van der stege et al , noted that 98% of the patients were satisfied with their procedure , with 10% of them having monthly spotting . they concluded that although laparoscopic hysterectomy for benign diseases was a satisfactory procedure , special attention should be paid to careful management of the cervical stump . hilger et al , reviewed the indications of 310 trachelectomies performed at the mayo clinic from 1974 to 2003 . they included stump prolapse ( 4% ) , fibroid mass ( 1% ) , cervical dysplasia ( 6% ) , carcinoma in situ ( 5% ) , irregular bleeding ( 2% ) , and cervicitis ( 53% ) . the complications following vaginal trachelectomies were encountered in 80% of the procedures against 37% in the abdominal procedure . in our report the cervical stump confirmed carcinoma in situ .

a 43-year - old , who underwent a subtotal hysterectomy for postpartum hemorrhage following a normal delivery , 10 years ago , presented with a history of persistent vaginal discharge and post - coital bleeding . a pap smear reported moderate dysplasia , and a subsequent colposcopic biopsy reported severe dysplasia with crypt extension . the patient underwent a laparoscopic trachelectomy , and histology of the stump reported cervical squamous carcinoma in situ , with no microinvasion .

polycythemia is clinically defined as elevated red blood cell mass ( hemoglobin > 18.5 g / dl in men , 16.5 g / dl in women or other evidence of increased red cell volume or hemoglobin or hematocrit greater than 99th percentile of method - specific reference range for age , sex , altitude of residence or hemoglobin greater than 17 g / dl in men , 15 g / dl in women if associated with a documented and sustained increase of at least 2 g / dl from an individual 's baseline value that can not be attributed to correction of iron deficiency , or elevated red cell mass greater than 25% above mean normal predicted value 1 . polycythemia can be further classified as primary polycythemia , secondary polycythemia , or polycythemia due to abnormal hypoxia sensing . primary polycythemias are caused by intrinsic defects in the erythroid precursors that result in hyper responsiveness to normal level of serum erythropoietin ( epo ) . secondary polycythemias are driven by the factors ( predominantly epo but also insulin growth factor 1 and cobalt ) extrinsic to the erythroid progenitor cells . generally , in secondary polycythemia , the increased red cell mass represents a physiologic response to tissue hypoxia or abnormally increased level of serum epo 2 . polycythemias due to abnormal hypoxia sensing include chuvash polycythemia , polycythemias associated with von hippel - lindau mutations other than the chuvash polycythemia mutation , and polycythemia due to proline hydroxylase mutation 3 , 4 . acquired conditions that lead to increased epo production , such as chronic hypoxia and a variety of tumors , are the most common causes of secondary polycythemias . these include hemoglobin variants with high affinity for oxygen , congenitally low erythrocyte 2 , 3 biphosphoglycerate levels , and inherited methemoglobinemias . all these conditions are characterized by a left shift in hb dissociation curve which in turn leads to tissue hypoxia and a physiologically appropriate increase in epo levels . congenital cyanotic heart or lung disorders , which lead to tissue hypoxia and increased epo level are also examples of secondary congenital polycythemias but these are characterized by a normal hb dissociation curve . two subjects ( mother and daughter ) , from a family with multiple subjects with polycythemia , were available for evaluation : subject 1(mother ) : she is a 59 year old caucasian woman who presented with lifelong history of polycythemia . her medical history was remarkable for 1 ) multifocal ductal carcinoma in situ ( dcis ) of the breast in 2002 , treated with simple mastectomy and 2 ) colonic diverticula and internal hemorrhoids since 2005 . family history was remarkable for presence of lifelong history of polycythemia in her mother and two daughters . laboratory parameters revealed high hb ( 16 gm% ) , high hematocrit ( 48% ) , normal mcv , normal platelet and white blood cell counts , normal arterial oxygen saturation , and normal liver function tests . subject 2 ( daughter ) : she is a 30 year old caucasian woman who presented for further evaluation of lifelong history of polycythemia . family history was significant for lifelong history of polycythemia in her mother , maternal grandmother and her younger sister . laboratory parameters were remarkable for elevated hemoglobin ( 17.2 gm% ) and hematocrit ( 51.4% ) but normal mcv , normal platelets and white blood cell counts , normal arterial oxygen saturation , and normal liver function tests . both subjects underwent following laboratory tests : serum epo levels were normal in both subjects ( 15 miu / ml and 19 miu / ml respectively , normal range 4.1 - 19.5 miu / ml ) . venous blood gas parameters were obtained which included partial pressure of oxygen ( venous po2 ) , venous ph and venous oxygen saturation . calculation of affinity of hb for oxygen ( p50 ) was done using the mathematical formula as described 5 . routine hb electrophoreses , high performance liquid chromatography ( hplc ) 6 , 7 , isoelectric focusing ( ief ) in polyacrylamide gel , globin chain analysis 8 and peptide mapping 9 were performed . this was followed by beta globin gene sequencing which was performed by abi3730 96-capillary sequencer at the dna sequencing core facility at the university of utah school of medicine ( primers and conditions available upon request ) . the p50 was found to be low at 18 mm hg ( normal range 22.6 to 29.4 ) suggesting increased affinity of hb for oxygen . ief showed a band anodal to hb a and globin chain analysis by hplc revealed an unidentified beta globin variant in both subjects ( figure 1 ) . peptide mapping showed an extra peak at 26.9 min but showed no decrease in any peaks suggesting a mutation somewhere in the core ( figure 2 ) . beta globin gene sequencing revealed a novel mutation ( gtg->ttg ) of codon 109 of exon 3 of beta globin gene . this mutation leads to a previously reported high affinity hb variant known as hb johnstown ( beta109 val->leu ) 10 - 12 ; however , this nucleotide change is novel and previously unreported ; and it leads to a previously described amino acid substitution that was however , caused by a different nucleotide missense mutation . hb johnstown ( beta109 ( g11 ) val->leu ) is a high oxygen affinity hb variant and there are three reports in the literature . it was first reported by jones and colleagues in oregon , in 1990 , in a healthy asymptomatic subject with mild erythrocytosis and left - shifted hemoglobin - o2 dissociation curve10 . as with many other hb variants , hb johnstown is silent on standard hemoglobin electrophoretic analyses , and was identified and isolated by reverse - phase hplc of individual globin chains . structural analysis revealed the substitution beta 109 ( g11 ) val ->leu 10 . in 2000 , the underlying beta globin mutation [ beta - globin codon 109 ( gtg ->ctg ) ] was first reported by ropero and colleagues , in two unrelated families ( total four subjects ) of basque extraction in spain 11 . in one of these families , hb johnstown mutation was present in double heterozygosity with another beta 0 thalassemia mutation ivs-1-nt1 ( g->a ) . in 2004 , feliu - torres and colleagues reported hb johnstown [ beta - globin codon 109 ( gtg ->ctg ) ] in an eight year old girl , who had been referred for evaluation of erythrocytosis , in double heterozygosity with another beta globin mutation [ ivs - i-1(g->a ) ] . however , these reports described a causative g to c mutation that is different that mutation we describe in our subject with hb johnstown , namely g to t , both encoding the same amino acid ; i.e. leucine and present in subjects not known to be of spanish / basque extraction . the sigmoid shape of hb - oxygen dissociation curve is indicative of cooperative interaction between heme and oxygen . oxygen affinity and hb - oxygen dissociation is affected by blood ph , 2 , 3- biphosphoglycerate ( 2 , 3 bpg ) level in the red cell and temperature , and globin structure 13 . affinity of hb with oxygen is expressed as the p50 , which is the partial pressure of oxygen in blood at which 50% of the hb is saturated with oxygen . the venous p50 can be measured directly using a cooximeter which is no longer easily available in routine and even reference laboratories . lichtman and colleagues have reported a mathematical formula which can be used to calculate p50 reliably 5 . calculating p50 using this formula requires the following venous gas parameters : partial pressure of oxygen ( venous po2 ) , venous ph and venous oxygen saturation , and uses anti - log mathematical function that many clinicians find difficult to use for calculation 5 . the p50 of a healthy person with normal hb is 26 1.3 mm hg . the 99% confidence interval for individual observations has been reported to be 22.6 to 29.4 mm hg . an abnormally low p50 reflects an increased affinity of hemoglobin for oxygen and vice versa . elevations and reductions in 2 , 3- bpg level in the erythrocyte will also lead to corresponding changes in p50 values ; however , in only reported subjects this decrease was limited to a p50 value between 20 and 35 mm hg . there should be high suspicion for the presence of a high affinity hb variant if p50 value is < 20 mm hg 5 . during oxygenation and deoxygenation , there is considerable movement along the interface of alpha 1 and beta 2 chains of the hb tetramer . all these substitutions can affect the cooperative nature of oxygen binding with heme , and in turn , can change the affinity of hb for oxygen . the majority of mutations affecting oxygen affinity result in high affinity hb variants which result in leftward shift of the dissociation curve and relative tissue hypoxia 14 . there are 90 high affinity hb variants , listed on the globin server , known to be associated with high affinity for oxygen ( http://globin.bx.psu.edu/hbvar/menu.html accessed on may 04 , 2007 ) 15 . high affinity hb variants release oxygen in the tissue relatively slowly and create relative tissue hypoxia . this leads to increased production of epo from kidneys which results in increased red blood cell mass and polycythemia . at an elevated level of increased red blood cell mass ( which depends upon the oxygen affinity of a given variant ) adequate oxygenation of the tissue is reestablished and epo production plateaus and at this new steady state serum epo is often at normal level . this leads to stabilization of hb level after achieving a certain elevated level of hematocrit . family history of polycythemia in a subject with polycythemia should raise the suspicion for the presence of a high affinity hb variant 14 . a low p50 value ( obtained from venous gas parameters ) is supportive of high oxygen affinity hb variant or decreased 2 , 3 bpg level . in a polycythemic patient , establishing a correct diagnosis of a high affinity hb variant is important as these patients have normal life expectancy and do not require phlebotomy . the therapies used for polycythemia vera such as phlebotomy and chemotherapy should not be used in patients who have polycythemia due to high affinity hb variants . with this report , we are providing an electronic version ( using microsoft excel program ) of the mathematical formula 5 , with which p50 can be calculated in few seconds , provided venous gas parameters are available , without necessity of more sophisticated calculations using antilog parameters . with increased ease and rapidity of calculation using our excel program ( supplementary material ) , we hope that use of p50 will increase , leading to improved detection of hb variants in subjects with familial polycythemia .

two polycythemic subjects from a family with multiple polycythemic subjects were evaluated . estimation of oxygen affinity of hb from venous blood gas parameters ( p50 ) revealed low p50 suggesting a high affinity hb variant . further work up , which included beta globin gene sequencing , revealed a novel mutation changing a codon to the previously reported high affinity hb - hb johnstown ( beta109 val->leu ) . polycythemic subjects with high affinity hb variant are asymptomatic with normal life expectancy . their differentiation from polycythemia vera ( pv ) is crucial to avoid therapy which is otherwise reserved for pv patients . we provide an electronic version ( in microsoft excel program ) of a previously reported mathematical formula for rapid calculation of p50 from venous blood gases . estimation of p50 is an essential initial step in the evaluation of a subject with personal and family history of polycythemia .

since , their initial introduction in the 1960s , composite resins have undergone improvement in all areas , including aesthetics , wear , and handling . however , high - polymerization shrinkage continues to represent major disadvantages . previous research has shown polymerization shrinkage to lead to bond failure and micro - leakage of resin composite restorations . micro - leakage is a matter of concern because it leads to staining at the margins of restorations , recurrent caries , hypersensitivity , and pulp pathology . the use of a liner to act as a flexible intermediate layer between restoration and substrate has been suggested as a method of relieving the stress associated with polymerization shrinkage . flowable composites have been recommended as liners due to their low viscosity , increased elasticity , and wettability . these composites retained the same small particle size of traditional hybrid composites , but reduced the amount of filler content in order to reduce the viscosity of the resin mixture . because , flowable composites are richer in resin than traditional composites , their elastic modulus is also lower , which gives them greater bond - strength values than those of conventional materials . another system recently , introduced in the field of dentistry , smart dentin replacement ( sdr ) ( dentsply , konstanz , germany ) , includes a photoactive group in a modified urethane dimethacrylate resin . activated resin has demonstrated a relatively slow radical polymerization rate , suggesting that the photo initiator incorporated into the resin affects the polymerization process ; moreover , the incorporation of activated resin results in 60 - 70% less shrinkage stress when compared to conventional methacrylate - based resins . sdr was initially marketed as a flowable composite resin whose reduced polymerization stress allowed it to be applied in bulk in a single layer up to 4 mm thick , followed by a mandatory 2-mm cover layer of conventional composite resin . however , despite ongoing debates regarding , the use of flowable composite resin material to relieve stress , and promote adaptation , its aforementioned usages have yet to be confirmed in any clinical study . in the only study , conducted to date that describes the relevant parameters for sdr , the polymerization stress level of sdr was reported to be considerably lower than that of conventional flowable materials . micro - leakage is a phenomenon in which oral micro - organisms , fluids , and chemical substances are diffused through the interface between tooth structure and restorative material . fluids may progress through the dentin into the pulp , resulting in post - operative sensitivity , recurrent caries , pulpal inflammation , and restoration failure . the rapid development of dental materials , and the time needed for in vivo and in vitro studies has meant that the effects of sdr as an intermediate layer under resin composites on marginal micro - leakage have not received sufficient attention . therefore , this study aimed to investigate the effect of a new - generation flowable composite resin , sdr on micro - leakage in class v composite restorations . the null hypothesis of the study was that micro - leakage would not be affected by types of flowable composite . the teeth were carefully cleaned using a hand scaler and water - pumice slurry in prophylaxis rubber cups . a total of 144 standard class v cavities ( 4 mm width 2 mm height 2 mm depth ) were prepared on the buccal and lingual surfaces , with occlusal margins located in enamel and cervical margins in dentin / cementum . specimens were randomly assigned into 3 groups ( n = 48 ) according to , the adhesive system applied , as follows : group 1 : two - step , self - etch adhesive system ( clearfil se bond , kuraray , osaka , japan ) . group 2 : one - step , self - etch adhesive system ( adper easy one , 3 m espe , seefeld , germany ) . group 3 : total - etch adhesive system ( adhesive 200 t , 3 m espe , mn , usa ) . materials used in this study following the application of the bonding agents , each group was further divided into 3 subgroups ( n = 16 ) according to the liner material used , as follows : group a : no liner ( control group ) . group b : conventional flowable composite resin ( aelite flo lv , bisco , il , usa ) . group c : new - generation flowable composite resin ( sdr , dentsply , konstanz , germany ) . in both groups b and c , 1 mm of composite was applied to the cavity surfaces as a liner prior to the composite restoration . all specimens were restored with the light - activated , hybrid composite resin aelite ls posterior ( bisco , il , usa ) using an incremental technique , with one increment applied obliquely against the occlusal wall , another against the gingival wall , and a final increment applied following the tooth contour . each increment was light - cured for 20 s with a visible light - curing unit ( elipar free light iii , 3 m espe , st . all cavity preparations , restorations , and finishing procedures were performed by the same operator . after 24 h storage in distilled water at 37c , the restored teeth were subjected to thermocycling for 1000 cycles in water baths at 5 and 55c with a dwell time of 30 s. nail polish was applied to the teeth , except on the restorative material and tooth structure 1 mm from the cavosurface margins . all specimens were immersed in 0.5% basic fuchsin solution for 24 h and then were sectioned longitudinally through the center of the restorations with a low - speed diamond saw under water spray . sectioned restorations were examined under a stereomicroscope ( olympus sz61 , olympus optical co , tokyo , japan ) at 25 magnification . dye penetration along the occlusal and cervical margins of the tooth - restoration interface was evaluated by two independent observers and recorded as follows : 0 = no dye penetration , 1 = penetration involving half the occlusal / gingival wall , 2 = penetration involving more than half the occlusal / gingival wall , and 3 = penetration involving the axial wall . statistical analysis was performed using mann - whitney u and kruskal - wallis tests at p < 0.05 . mean micro - leakage scores of all groups are given in tables 2 and 3 . both sdr and conventional flowable composite resin did not affect micro - leakage as an intermediate layer . no statistically significant differences were observed between groups ( p > 0.05 ) [ table 4 ] . micro - leakage is defined as the clinically undetectable passage of bacteria , fluids , molecules , or ions between a restorative material and the cavity wall to , which it is applied . micro - leakage at the tooth - restoration interface is considered a major factor in the longevity of dental restorations . it may lead to staining and a hastening of the breakdown at the restoration margins , as well as hypersensitivity , recurrent caries , and pulpal pathology . improvements in resin composites have increased their usefulness as restorative materials ; however , polymerization shrinkage continues to remain one of the primary deficiencies of composite restorations . polymerization shrinkage causes contraction stress within the restoration that leads to micro - leakage , as well as stress within the surrounding tooth structure . in a study , usha et al . compared two inserting techniques in class v cavities , and they found that the split incremental technique had lower micro - leakage because of less polymerization shrinkage than the oblique technique . the use of a liner as a flexible intermediate layer has been mentioned among numerous methods suggested for relieving the stress caused by polymerization shrinkage . this is based on the lower young 's modulus of elasticity exhibited by flowable composite in comparison to other hybrid materials , which could help dissipate the contraction stress that occurs during polymerization . in addition , to their increased elasticity , the low - viscosity and high wettability of flowable composites have led to their recommendation as suitable liners . although some studies have shown flowable composite used as a liner to exhibit superior contact with the floors , and walls of cavity preparations , in vitro studies have yielded conflicting results regarding the ability of an elastic liner to decrease micro - leakage . found a combination of flowable and hybrid composites to yield the most effective reduction in micro - leakage . simi and suprabha showed that the marginal adaptation of a composite improved when used in conjunction with a flowable composite lining . furthermore , chuang et al . concluded that a 0.5 - 1.0 mm layer of flowable composite liner used under packable composite restorations resulted in a significant reduction in micro - leakage . it is possible that the relatively thin layer of the liner minimized the effects of the polymerization shrinkage in the present study . in contrast , some studies have indicated that the use of flowable material as an intermediate layer does not reduce micro - leakage in posterior composite restorations . majety and pujar reported that the thickness of the flowable composite intermediate layer does not affect micro - leakage . swift et al . showed that the use of a low - viscosity resin as an intermediate layer does not have a consistent effect on micro - leakage of class v composite restorations . similarly , this study found that the use of a flowable composite liner does not affect micro - leakage . sdr , a flowable composite resin with a filler load of 68% weight that has recently been introduced on the market , claims to possess a lower modulus of elasticity , as well as lower levels of polymerization stress in comparison to traditional flowable composite , without compromising on depth of cure . the material is marketed as a resin composite for bulk application in direct composite resin restorations . a recent study , comparing sdr with two traditional flowable methacrylate - based composites found that sdr had the lowest level of shrinkage stress , the longest pre - gel time , and the lowest shrinkage rate . found the polymerization stress of sdr to be lower than that of other flowable composites , whereas no differences were found in flexural modulus and volumetric shrinkage ( 3.5% volume ) of the composites tested . according to , burgess et al . , the chemistry of sdr is designed to slow the polymerization rate , thereby reducing polymerization shrinkage stress without affecting polymerization shrinkage levels . jin et al . found that the new sdr resin system in unfilled , as well as in various differently filled formulations , exhibited less curing stress than conventional resin . although sdr had the lowest shrinkage stress , in the present study , no differences were observed in micro - leakage between teeth restorated in sdr and in the conventional flowable composite resin . the combinations of packable composite with sdr and with conventional flowable composite resin tested in the present in vitro study in order to , demonstrate micro - leakage in class v composite restorations . it can be concluded that the use of new - generation and conventional flowable composite resins as an intermediate layer between restoration and dental substrate does not reduce micro - leakage .

aim : to evaluate the effect of application a new - generation bulk - fill flowable composite resin as an intermediate material between composite resin and dental substrates on micro - leakage in class v composite restorations.materials and methods : a total of 144 class v cavities were prepared in 72 human molars . specimens were then randomly distributed among three groups according to adhesive system applied ( group 1 : clearfil se bond ; group 2 : adper easy one ; group 3 : adhesive 200 t ) , and each group was divided into three subgroups according to liner material used ( group a : no liner - control group ; group b : aelite flo lv , low viscosity microhybrid composite ; group c : smart dentin replacement ) . all cavities were restored using resin composite ( aelite ls , low shrinkage posterior composite ) . specimens were stained with 0.5% basic fuchsin and evaluated dye penetration.results:there was no significant difference in dye penetration was found between the control and the experimental groups.conclusions:micro-leakage is not affected by the application of either conventional or new - generation flowable composite resin as an intermediate material between composite resin and dental substrates .

for the pharmacometrician and the system pharmacologist , computer software is , quite simply , the equivalent of the laboratory for the molecular biologist , or of the research clinic for the practicing clinician . it is the environment where tools are developed , observations and conjectures are made , hypotheses are formulated and tested , multiple scenarios are run , and discoveries are made for the betterment of science or patients . it is only natural that cpt : psp , in its efforts to merge pharmacometrics and systems pharmacology , wishes to be the home to cutting - edge tutorial papers that can bring practitioners of one discipline closer to the other , spreading beyond the initiated to familiarize our audience with an ever - increasing number of tools . such familiarity is expected to facilitate new findings , developments , and discoveries by indicating capabilities and potential applications of pharmacometrics and systems pharmacology software and helping with repeatability of the study , an essential element in any scientific discipline . in the words of umberto eco , thinking back to another powerful medium used to propagate information , if you want to use television to teach somebody , you must first teach them how to use television . the cpt : psp designation for a tutorial , as stated in the journal 's guide to authors , is an educational article providing practical tutorial on tools , methodologies , and approaches in pharmacometrics and systems pharmacology . this is of crucial importance for the continued health of both pharmacometrics and systems pharmacology because the pace of changes in these dynamic fields appears to outpace any concerted efforts to provide timely didactic needs by current higher education systems . an integrated technical education on modeling and simulation tools has been sporadic , carried out individually in centers scattered around the globe . as explained in the inaugural editorial and in a description of our disciplines foundational tutorials , cpt : psp strongly supports ( technical ) tutorials that aid the dissemination and uptake of model - based approaches in pharmacometrics and systems pharmacology , targeting a wide spectrum of audiences from novices to advanced modelers . inevitably , many of these tutorials may focus on one or more software tools , some of which may be commercial products or otherwise proprietary . the cpt : psp editorial team has been debating the content of the tutorials , their scientific scope , and also whether in any way to limit the scope of such tutorials to those where the software is available for free ( whether tout court , for research purposes , or for research purposes to noncommercial organizations only ) , because this fits into the mission of the journal to support the dissemination of the discipline . this editorial is the result of our deliberations and defines our current position on this topic ; we are putting it forth in cpt : psp to be proactive and in the hope that it will stimulate some needed debate . an important ( but often underappreciated ) distinction we need to make early on is between a software tutorial and a user 's manual . we would most often consider user 's manuals not publishable by cpt : psp , as they consist of a sequence of steps and/or reference material that software users can consult as they solve real - world problems or attend a hands - on workshop to learn the mechanics of the software . cpt : psp looks to publish software tutorials that contain a real - world scientific problem ( case study ) and apply the method or the software to solve that problem step - by - step , much like it is done in a real - world scientific inquiry scenario . that way , the usefulness of the document is increased , as the reader now learns twice over : from the scientific basis of the solution to the case study , and the operational aspects of the specific computer software being used . a software tutorial is thus richer than a user 's manual , as it includes both a description of the scientific problems the software is meant to solve and the practicalities of the software tool itself , whereas a user 's manual most often contains only the latter . we collectively believe that cpt : psp should focus on software tutorials , whereas user 's manuals may be published separately ( in a biomedical computing journal , for example ) or become a useful appendix to a tutorial manuscript ( e.g. , available through a web link ) . in general , the tutorials should provide a balanced view of the field and include consideration of other , similar software . the journal requires all software to be freely available under the open source initiative for an article to be considered for publication . the best case in point would probably be that we could not publish a nonmem tutorial if we were to apply such criteria . to us , there seems to be a fundamental difference between the bioinformatics / computational biology discipline ( where software has always been free and open source , since the very early days of the field ) and ours ( where software has very often , almost exclusively , been commercial ) . however , unambiguously adjudicating the scientific merit of publications requires that the study be repeatable by other researchers , and this will still be facilitated when the files and data used for any piece of research are made available to others , as opposed to the software platform itself . an analogy can be drawn when details of an analytical method to assay chemicals or genes are given , but the ability to repeat the study is still impinging on access to a liquid chromatography mass spectrometry machine or gene sequencer , which obviously can not be easily provided as an appendix to the report ! let us elaborate further on these aspects and on what this implies for the authors and readers of software tutorials published in cpt : psp . in many ways , the intent of the more traditional approach of including in research articles the model ( differential ) equations in plain text ensures that mathematical models can be ultimately implemented ( with a bit of work ! ) in any computer code . however , everyone with an interest in this topic is painfully aware that what gets in the way of the process is that the information is usually incomplete and the textual reporting is error prone . publishing or making available computer code or modeling scripts is intended to streamline the process of implementing anew models described in cpt : psp research articles . curated databases are also increasingly available that are accessible to all free of charge , without significant restrictions . it is apparent that databases such as these are of value , and unrestricted access has in general to be evaluated for costs and benefits against other modes of dissemination . we certainly see availability of computer code as a very important avenue to maximize the impact of our published tutorials . a compromise that we are already striving to implement in the cpt : psp research articles would be to upload enough information to enable the reader to reproduce the model results , assuming the software platform is broadly available , perhaps at a cost . this could be as simple as a parameter set ( in native format ) , or as detailed as the actual model code or tutorial script ( e.g. , control files for nonmem ) , workspace file , and so forth , depending on the specifics of the platform used . this would enable the reader access to the software to reproduce the simulations , even if the software is commercial or otherwise proprietary . the only requirement would be that the journal reader needs to be able to run the code in the native software format and reproduce the published simulations ( for verification ) with no modifications . of note , this approach is indirectly borne out in the life sciences : a dna sequence is required to be published in some journals , but this does not require the author to supply a sequencer machine as well . the tools to run a simulation can be separate from the conditions and inputs that need to be specified , i.e. , all the details that permit an independent reader re - run the study . this is in line with the requirements from other journals , and it is our belief that such an approach would satisfy the great majority of readers . financial interests are often complex and hard to define , and software fees vary widely in the amount of profit they bring . some tools may require a fee which includes user support , and others may charge separately for extended service ( through consulting , for example ) . at any rate , we feel that there may be a place in cpt : psp also for commercial software . this is provided the considerations we outlined above about reproducibility of the simulations can be met . we encourage submissions of tutorials where authors are not exclusively employed by the developer , or where not all authors have a financial interest in the software . we recognize the potential limitations of this ; however , we believe the user base who regularly applies these tools would be attracted to manuscript co - authorship with the developers , thus bringing the user community 's specific perspective to the tutorial text . finally , regardless of its potential shortcomings , it seems to us that peer review will continue to be the method of choice for propagation of scientific information on new discoveries and novel approaches to technical problems , and our journal of course wholeheartedly supports this notion . our view is that peer - reviewed software tutorials to be published in cpt : psp should include : a description of one or more scientific motivating problems that will be used to structure the tutorial flow ; instructions as to how to use the software to solve this or similar modeling analysis problems ; scripts or other computer code or pseudocode , as appropriate , to enable a user to reproduce the tutorial sequence ; and an inclusive author list , ideally comprising users without monetary interests in the software , in addition to the software developers . a line attributed to the mathematician paul halmos states that the best way to learn is to do ; the worst way to teach is to talk . after committing some of our thoughts to paper , we now prefer to let our submissions do the talking . accordingly , we hope that the software tutorials we will host on the pages of cpt : psp will contain relevant , useful , reproducible , durable , and practical examples to effectively assist our readers in learning , and in turn sharing and thus growing , our craft .

in addition to methodological tutorials,1 cpt : psp has recently started to publish software tutorials.2,3 our readership and authors may be wondering what kind of format or product is expected , and the review of submissions we have already received prompted several discussions within the psp editorial team . this editorial reflects on these discussions and summarizes their salient points . it aims at providing some details about the current vision of cpt : psp for software tutorial articles . in addition , it brings some clarity on the topic of what role commercial software tutorials can have in cpt : psp and how cpt : psp tutorials differ from publications which describe the software itself , as those which can be found in other computer science journals . finally , the discussion includes reproducibility considerations and the general use of commercial and noncommercial software in cpt : psp publications . we hope our thoughts , and especially a stated requirement to publish user input to the software to aid in reproducibility , will help in guiding our authors and will stimulate healthy debate among our readers about the evolving nature of our science , how it can be facilitated using software and associated databases as a conduit , and what role this journal can play in fostering both the best modeling and simulation practices and the best scientific approaches to computational modeling , to bring the advantages of modeling and simulation to all regular practitioners , and not to just a ( self ) selected few .

a 30-month - old boy initially presented with hip joint pain and fever , which failed to improve despite treatment that was given under the impression of a septic hip at a local hospital . one month later , he was admitted to another hospital due to progressed multifocal bone pain . the imaging work up , including bone scanning and mri for the head , neck and pelvis , suggested multiple metastatic lesions in the skeleton and bone marrow . a 2.5 cm sized left adrenal mass was detected on the contrast - enhanced ct ( fig . 1a ) . on the laboratory studies , the serum neuron - specific enolase ( nse ) and ferritin , and the urine vanillymandelic acid ( vma ) were elevated to 72 ng / ml , 1,245 ng / ml and 42 mg / day , respectively ( normal ranges : 0 - 12 ng / ml , 22 - 322 ng / ml , and < 3 mg / day , respectively ) . therefore , the patient was diagnosed with stage 4 neuroblastoma of a left adrenal origin , according to the international neuroblastoma staging system . subsequent chemotherapy was started , and this was followed by surgical resection of the residual adrenal lesion several months later . the pathologic diagnosis of the primary lesion was ganglioneuroblastoma with the large portion of the tumor being differentiated into ganglioneuroma , which was caused by the previous chemotherapy . after additional high dose chemotherapy followed by autologous peripheral blood stem cell transplantation , he was clinically considered to be in nearly complete clinical remission . the patient did well until recurrent abdominal pain developed at four years of age . at that time , contrast - enhanced ct scan of the abdomen demonstrated multiple small low attenuated nodular lesions in the pancreas ( fig . three weeks later , the laboratory examinations revealed that the amylase and lipase were elevated to 538 u / l and 1,023 u / l , respectively ( normal ranges : 13 - 100 u / l and 13 - 60 u / l , respectively ) . contrast - enhanced abdominal ct showed diffuse swelling of the pancreas with an increase in the size of multiple pancreatic masses throughout the entire pancreas ( fig . the chest ct that was performed for a palpable nodule in the sternal area also showed a destructive soft tissue mass of the sternum . the nse was also elevated to 95 ng / ml ( normal range : 0 - 12 ng / ml ) . after two weeks , progressive dilatation of the intrahepatic duct was noted on the follow up sonography ; this was due to obstruction of the common bile duct by the pancreatic mass ( fig . the patient 's pancreatitis was presumed to be present secondary to pancreatic metastasis . because the patient was in very poor general condition and he showed a rapid clinical decline with severe cholestasis the little boy was managed both conservatively and compassionately ; sadly , he expired one month after the diagnosis of relapse . neuroblastoma accounts for 8 - 10% of all malignancies in childhood and it occurs in the adrenal medulla and along the sympathetic nervous system by tumor arising from neuroblasts ( 1 , 2 ) . the prognosis depends on the age and stage at the time of diagnosis . infants younger than one year or patients with localized tumor have a good prognosis , whereas approximately 70 - 80% of patients older than one year have metastatic disease at diagnosis and they have a poor prognosis with a high recurrence rate in spite of receiving the best current multimodality therapy ( 1 , 2 ) . common sites of metastasis , via lymphatic and hematogenous routes , are the bone , bone marrow , lymph nodes , liver , dura and lung ( 1 , 2 ) . bone metastasis is common in children older than one year , and this often involves the long bones and orbit , which causes bone pain or proptosis . the unusual metastatic sites that were previously reported include the cns , kidney , and the cardiac and skeletal muscles ( 3 - 5 ) . to the best of our knowledge , pancreatic metastasis is generally uncommon from any source , even if it has been reported that the colon , lung , and kidney are the most common sites of primary tumors that metastasize to the pancreas ( 6 ) . especially in children , pancreatic metastasis was reported in patients suffering with leukemia , lymphoma , ewing sarcoma and rhabdomyosarcoma ( 7 , 8) . in the presented case , we were not certain at first that the multiple nodules found in the pancreas represented metastasis of neuroblastoma . however , as the pancreatic nodules increased in size , and this was associated with metastatic lesion in sternum and with the corresponding increased mibg uptake and increased nse value , then the diagnosis of pancreatic metastasis was made . performing tissue diagnosis for the pancreatic lesion was difficult to achieve in this seriously ill little boy and it was simply not justified when the clinical , laboratory and imaging findings were sufficient to make the diagnosis of metastatic relapse . it 's likely that there were residual tumor cells that became disseminated through the blood and lymphatic systems , and this caused early relapse at multiple sites , including the pancreas . as in our case , pancreatic metastasis may be complicated by biliary obstruction and pancreatitis . metastasis - induced acute pancreatitis can occur as an initial manifestation of tumor or it can happen later during the course of disease ( 9 , 10 ) . although the mechanisms to explain this phenomenon still remain controversial , it has been assumed that obstruction of the pancreatic duct by tumor , and the secretion of plasminogen activating enzymes that in turn activates trypsinogen - inducing autodigestion , may cause pancreatitis ( 9 , 10 ) . whatever the mechanism is , metastasis induced pancreatitis may result in a very poor outcome as in our case ; this is especially likely when it occurs together with extensive disease or severe pancreatitis ( 10 ) . in conclusion , we present here a very rare case of neuroblastoma that metastasized to the pancreas in a 4-year - old boy . pancreatic metastasis should be taken into consideration for those patients who are found to have pancreatic nodules concurrent with neuroblastoma .

we present here a very rare case of metastatic relapse in the pancreas of a 4-year - old boy who had been treated for stage 4 neuroblastoma . computed tomography showed multiple metastatic masses in the pancreas with secondary pancreatitis . to the best of our knowledge , this is the first case report of pancreatic metastasis in a child with neuroblastoma .

synovial sarcoma ( ss ) most commonly affects the para - articular regions of the extremities of young adults , . occasionally , however , ss has been identified in less common locations , including the head and neck , heart , lungs and prostate . herein , we describe a case of primary renal ss , an exceedingly rare diagnosis , in a 52-year - old woman . the diagnosis was established by histology and immunostaining . to our knowledge , based on a review of the english literature , this marks the first case report describing the magnetic resonance ( mr ) features of synovial sarcoma of the kidney . a 52-year - old female presenting with a history of right flank pain underwent computed tomography ( ct ) examination which revealed an amorphous partially cystic right lower pole renal mass with heterogeneous enhancement . further workup with magnetic resonance imaging revealed a 6.0 5.9 6.1 cm mass in the lower pole of the right kidney . three - plane localizer , coronal single shot fast spin echo ( ssfse ) t2 , axial in and out of phase , axial fat suppressed t2 weighted , axial 5-min and 10-min delayed , and axial 3d liver acquisition with volume acceleration ( lava ) sequences were acquired . on t1 weighted imaging ( fig . 1a ) , the mass was heterogeneous , with the posterior region having similar intensity to skeletal muscle and the anterior region with higher signal intensity . axial t2 weighted imaging revealed marked heterogeneity with areas of high , intermediate , and low signal , known as the triple sign ( fig . 1b ) . the mass contained multiple areas of high t2 signal emanating from the center of the mass , with surrounding intermediate and low t2 signal intensity regions ( fig . figure 1axial in - phase t1 weighted gradient recalled echo ( gre ) image ( a ) , showing a heterogeneous mass lesion involving the medial portion of the lower pole of the right kidney ( arrow ) , with a posterior isointense area and an anterior area of higher signal intensity , relative to skeletal muscle . axial fat suppressed t2 ( b ) and coronal ssfse t2 images ( e ) show marked heterogeneity and the triple sign ; : areas of low , intermediate and high signal intensity ( arrows ) . axial post - contrast gre image ( c and d ) shows enhancement of the t2 hypo - intense areas ( arrow ) . axial in - phase t1 weighted gradient recalled echo ( gre ) image ( a ) , showing a heterogeneous mass lesion involving the medial portion of the lower pole of the right kidney ( arrow ) , with a posterior isointense area and an anterior area of higher signal intensity , relative to skeletal muscle . axial fat suppressed t2 ( b ) and coronal ssfse t2 images ( e ) show marked heterogeneity and the triple sign ; : areas of low , intermediate and high signal intensity ( arrows ) . axial post - contrast gre image ( c and d ) shows enhancement of the t2 hypo - intense areas ( arrow ) . the patient underwent right nephrectomy with a pathological diagnosis of high - grade , poorly differentiated spindle - cell synovial sarcoma . immunohistochemical staining showed focal positivity for cytokeratin cam 5.2 and negativity for s100 , ck7 , and epithelial membrane antigen ( ema ) . the most common sarcoma of the kidney is leiomyosarcoma , accounting for 4060% of reported cases . the first set of 15 cases reported was in 2000 , by argani , with few other cases reported in the english literature . there have been no reports to date describing the mr imaging findings of primary ss of the kidney . there is a slight male predominance , with a male - to - female ratio of 1.2 . furthermore , there seems to be a predilection for the right kidney , with a right - to - left ratio of 2.2 . the typical presentation of ss of the kidney is non - specific , and resembles that of other primary tumors of the kidney . patients may complain of localized flank or back pain , hematuria , or a palpable abdominal mass . the imaging modality of choice is magnetic resonance imaging ( mri ) , given its high sensitivity for soft tissue abnormalities . although diagnostic for some soft tissue tumors , mr signal intensity characteristics are usually non - specific for ss . most synovial sarcomas tend to be large masses , averaging 8 cm in size . the most common mr finding is an oval , well - defined nodular mass . on t1 weighted imaging , small lesions are typically homogenous , with a signal intensity similar to that of skeletal muscle , while lesions larger than 5 cm often exhibit intermediate intensity signal and are heterogeneous secondary to hemorrhagic and necrotic areas . on t2 weighted imaging , , lesions are hyperintense , usually with intratumoral hemorrhage ( 73% ) and cystic components ( 77% ) ; 3557% exhibit the triple sign , showing areas that are hyper- , iso- , and hypo - intense relative to skeletal muscle , representing hemorrhage / necrosis , septa / cellular elements , and calcified / fibrotic areas ; however , this is also seen in other soft tissue tumors , namely malignant fibrous histiocytoma , . mr imaging after intravenous contrast injection shows heterogeneous enhancement . histologically , ss consists of round spindle cells with minimal cytoplasm and active mitotic figures . these tumors are further divided into two subtypes , monophasic and biphasic , depending on the absence or presence of a well - develop glandular epithelium . although , synovial sarcoma in any location is regarded as slow growing , it should be considered a systemic disease . indeed , 25% have pulmonary metastases at the time of diagnosis . despite wide surgical resection , local recurrence and metastatic disease however , ss , more than other sarcomas , are more often treated with neoadjuvant chemotherapy followed by surgical treatment . these tumors demonstrate moderate chemo sensitivity , with 50% response rates to ifosfamide - based or doxorubicin - based regimens . studies of extremity ss have shown that ifosfamide - based chemotherapy reduces tumor volume by greater than 50% and improves disease - specific survival . in contrast , renal cell carcinoma is generally considered chemoresistant , although newer drug therapies such as sorafenib and sunitinib have led to some optimism , . multiple studies of ss of the extremity have shown a strong association between tumor size , volume , and histological grade to disease recurrence and patient mortality . high grade ss is favored in tumors that exhibit cystic components , hemorrhage , and fluid levels , as well as the triple sign .

abstractprimary renal synovial sarcoma ( ss ) was first described in 2000 by argani , with only a few subsequent cases being reported in the english literature . herein , we describe a case of a 52-year - old woman who presented with right flank pain . magnetic resonance imaging revealed a 6-cm mass in the lower pole of the right kidney . t1 and t2 weighted imaging revealed a heterogeneous mass with triple sign . there was post - contrast enhancement . imaging , histology and immunostaining together made the diagnosis of ss of the kidney .

hyoscine - n - butyl bromide ( hbb ) is a widely used antispasmodic and anticholinergic drug belonging to the belladonna alkaloid class of semisynthetic quaternary ammonium compounds . these compounds exert a spasmolytic action on the smooth muscles of the bile - gastrointestinal tract,1 the genitourinary tract , the salivary glands ( xerostomia),2 and also on the visual apparatus at an ocular level - in particular , the irido - ciliary complex . as a consequence , they provoke collateral effects such as mydriasis and accommodation disturbances.3,4 we report the case of a 23-year - old woman who complained of accommodation disturbances and a diplopia upon oral administration of hbb . the patient ( 23 years old ) attended the department of sense organs , university of rome la sapienza , rome , italy 2 hours after administration of one pill of buscopan ( boehringer ingelheim , ingelheim , germany ) complaining about double vision in the primary position and cloudy vision in the left eye ( le ) more than in the right eye ( re ) , in addition to dry mouth . the patient was quickly sent to our ocular motility center , where she underwent an ophthalmologic examination 2 hours after drug administration . the examination included the following tests : best refraction test for far and near vision test of the anterior segment through slit - lamp biomicroscope fondus oculi test through indirect schepens ophthalmoscopy goldmann applanation tonometry . during each examination , ocular motility was analyzed through a corneal reflex test , cover test , diplopia trial , wirt test , worth test , and hess screen . laboratory examinations , radiological analyses , and neurologic and internistic visits were carried out in order to exclude the most frequent causes of diplopia in adulthood such as virus infection , hypertension , diabetes , toxic factors , and neurological or demyelinating diseases.57 the previous ophthalmologic visits in other medical centers had shown a natural visual acuity of 10/10 in both eyes and an ocular motility without any particular alteration . at our first check ( 2 hours after drug administration ) , the patient presented visual acuity in the re of 10/10 and in the le of 8/10 . in the last one , visual acuity reached 10/10 after the addition of + 1d spherical lens . in both eyes , examination of the anterior segment detected pupil anisocoria ( le > re).8 intraocular pressure and fundus examination were normal . the ocular motility tests detected a slight vertical deviation increasing in the sight downward and decreasing in an anomalous position . the hess screen revealed a slight deficit of the superior oblique muscle of the le , and the bielschowsky test was positive . at the second check , after 2 days , natural visual acuity was 10/10 in both eyes , without the need to correct the hypermetropia of the le detected in the previous check . with regard to ocular motility , the diplopia test with red filter on the re revealed a higher diplopia of the sight downward and to the right with white lower light . specifically , a hypofunction of the superior oblique muscle of the le was evident and a hyperfunction of the inferior rectus muscle of the re ( figure 1 ) . also present was a hyperfunction of the inferior oblique muscle of the le and a hypofunction of the superior rectus muscle of the re . the bielschowsky sign was positive , with consequent anomalous position of the head inclined to the right . the worth test highlighted a diplopia at near distance , which was compensated for by the patient with a modification of the head position . the laboratory analyses ( neurological and radiological ) excluded toxic factors and systemic neurological or demyelinating pathologies of adult diplopia ( either chronic or acute ) . at the third check , after 1 week , visual function was full and all alterations of ocular motility ( slight hypofunction of the superior oblique muscle of the le and slight hyperfunction of the inferior rectus of the re ) were not observed ( figure 2 ) . at the fourth check , carried out after 1 month , the clinical picture was as in the third check . hbb , an antispasmodic and anticholinergic drug belonging to the belladonna alkaloid class of semisynthetic compounds , as a quaternary ammonium derivative , does not involve the central nervous system , as it does not cross the hematoencephalic barrier.8,9 in the reported case , the anticholinergic effect acted at a peripheral level ( through blocking the locoregional ganglia and antimuscarinic activity ) , causing , in addition to oral drying , the ocular disturbances recorded at the first check : mydriasis , accommodation disorders,3 and , as a consequence , diplopia . because hbb , in general , does not act directly on the skeletal muscle tissue , most likely the observed temporary diplopia was not due to a direct action of the drug on the oculomotor muscles . it is possible that it could have been due to the cycloplegic effect on the accommodation of le , which was able to alter the mechanism of sensory - motor fusion and highlight a hypofunction of the superior oblique muscle of the le . the latter was evident either by the positivity of biesholwky sign or by the red filter diplopia trial . such a hypothesis is supported by the fact that even 1 month after the disappearance of symptoms and diplopia , the persistence of the functional alteration of the oculomotor muscles was not confirmed . it could be supposed that the le , in normal conditions , by exerting an accommodation power of + 1d , is able to maintain the function of the oculomotor muscles of both eyes in a balanced condition , allowing them to remain in axis in all sight positions . in the reported case , it is likely that hbb was the causal factor of the diplopia , due to a partial block of the accommodation . as a consequence , because a latent hypermetropia was present in the le , the fusional balance ( sensory and motor ) maintaining the orthophoria was probably broken . furthermore , the consequent diplopia of the patient was peculiar because instead of the most common horizontal deviation there was a transient , vertical deviation associated with a hypofunctionality of the superior oblique muscle of the le and a secondary hyperfunctionality of the inferior rectus muscle of the re .

hyoscine - n - butyl bromide is a widely used antispasmodic belonging to the belladonna alkaloid class of semisynthetic quaternary ammonium compounds . these compounds exert a spasmolytic action on the smooth muscles of the bile - gastrointestinal tract , genitourinary tract , salivary glands ( xerostomia ) , and also on the visual apparatus - in particular , the irido - ciliary complex . as a consequence , they provoke collateral effects such as mydriasis and accommodation disturbances . we report the case of a 23-year - old woman who complained of not only dry mouth but also cloudy vision and a diplopia , both of temporary type , 2 hours after oral administration of hyoscine - n - butyl bromide .

vitamins are essential for nutrition and physiological function , and therefore , their intake is necessary for humans and animals , as the body is unable to synthesize these essential nutrients required for growth . vitamins can be classified into water - soluble and fat - soluble vitamins ; the former includes niacin , nicotinamide , vitamin b6 , vitamin b2 , vitamin b1 , folic acid , pantothenic acid , and vitamin c , while the latter includes vitamin a , vitamin d , vitamin e , and vitamin k . vitamins have specific and important functions , and as such , both humans and animals require vitamins to achieve and maintain health and productivity . vitamins function to control various endogenous metabolic activities taking place in the body , such as energy and amino acid metabolism . although only small amounts of vitamins are required , vitamin deficiency ( or indeed , excess ) can lead to diseases such as beriberi and dermatitis [ 2 , 6 , 7 ] . thus , to prevent a vitamin deficiency or excess in animals , as well as to attain maximum performance , the control of feed additives is necessary . indeed , vitamins are essential for maintaining normal metabolic processes in animals , while also retaining their condition and performance . as animals are unable to synthesize vitamins , the small amounts of these nutrients required must be supplied in their feed . various methods have been reported for the characterization of water - soluble vitamins , such as high performance liquid chromatography ( hplc ) coupled with ultraviolet ( uv ) detection [ 10 , 11 ] , liquid chromatography ( lc ) coupled with mass spectrometry ( ms ) , lc coupled with ms / ms , and gas chromatography . the most commonly used methods for the determination of vitamin components are based on hplc separation . lc - ms and lc - ms / ms , which provide information about the molecular mass and structural features of components , are considered more useful than other methods for the separation , identification , and quantification of the characteristic vitamin compounds . however , since these methods are expensive to purchase and maintain , many laboratories prefer hplc - uv detection , which is less costly , relatively convenient to operate , and suitable for the routine analysis of vitamins . ion - paring reagent we used in this study has amine group , so it is suitable for water - soluble vitamins analysis as well as iodine speciation analysis and pesticide residue analysis [ 1618 ] . in this study , six water - soluble vitamins in animal feed ( nicotinic acid ( niacin ) , nicotinamide , folic acid , riboflavin , pyridoxine ( vitamin b6 ) , and thiamine ( vitamin b1 ) ) complete animal feeds have complex matrixes containing fat , protein , carbohydrate , salt , and so on . water - soluble vitamins we targeted have amine functional group which represents polarity . to increase the selectivity of the water - soluble vitamins in complicated matrixes , in addition , simultaneous analytical method for the determination of 6 water - soluble vitamins has been rarely reported . moreover , therefore , this newly developed simultaneous method should be validated in various feed matrixes . a novel analytic method is therefore reported , which is suitable for detecting and quantifying the vitamins present in animal feed , while also aiding in the management of feed standards . a total of 30 animal feed samples were used , and 20 dried samples were pulverized into fine powders ( hmf-100 , hanil electric co. , seoul , korea ) . the pulverizer was set at a maximum speed of 22,000 rpm to give fine powders ranging in size from 400 to 1000 m . hplc grade acetonitrile , methanol , and acetic acid were purchased from merck ( darmstadt , germany ) , and picb-6 ( pic , paired - ion chromatography ; b , separate bases ) was purchased from waters ( st . milford , ma , usa ) . water was purified using a milli - q rios/elix water purification system ( millipore , bedford , ma , usa ) . nicotinic acid ( niacin ) , nicotinamide , pyridoxine ( vitamin b6 ) , riboflavin , thiamine ( vitamin b1 ) , and folic acid standards were purchased from sigma aldrich chemie gmbh ( bellefonte , pa , usa ) . the six vitamins were classified into three groups , groups 1 , 2 , and 3 , and stock solutions were prepared using the preprocessing reagent , water , and 0.01 n naoh to obtain a final vitamin concentration of 100 group 1 consisted of thiamine and pyridoxine , and the stock solutions were prepared by mixing the standard preparation with water ( 100 ml ) . group 2 consisted of riboflavin and folic acid and was prepared by mixing the standard preparation ( 10 mg ) , 0.01 n naoh , and water ( 100 ml ) . group 3 consisted of nicotinic acid and nicotinamide and was prepared by mixing the standard preparation ( 10 mg ) with the preprocessing reagent ( 100 ml ) . working solutions were prepared by diluting the stock solutions , and all solutions were refrigerated . the samples were prepared for extraction by the ion - pairing reagent . each homogenized sample from animal feed ( 1.5 g ) was placed into a centrifuge tube and mixed with the extraction solvent ( 10 ml , 5 mm picb-6 in 0.1% ch3cooh ) . a portion of the liquefied sample ( 10 g ) was added to a 25 ml volumetric flask , and the volume was made up to 25 ml using the extraction solvent ( 5 mm picb-6 in 0.1% ch3cooh ) . we used picb-6 as ion - pairing reagent because most of vitamins we determined showed higher resolution when we used picb-6 than other ion - pairing reagents . the mixtures were then homogenized for 10 min , sonicated for 10 min at room temperature , and centrifuged at 13,000 rpm for 10 min at 4c . the resulting supernatant was filtered through a 0.45 m disposable filter ( whatman ) . finally , the stabilities of the standard preparations were determined over one week in an amber vial at room temperature , with samples being taken for analysis every 24 h. hplc was performed on a shiseido nanospace si-2 system ( shiseido , tokyo , japan ) equipped with a binary solvent delivery pump , an autosampler , and a photodiode array detector ( pda ) and was controlled using the ezchrome elite software ( agilent technologies , palo alto , ca , usa ) . a reversed phase unison uk - c18 ( 100 m 4.6 mm , 3 m particle size ) ( tokyo , japan ) column was used for all separations at a column temperature of 40c . prior to use , the mobile phase was filtered through a 0.45 m membrane filter ( millipore , milford , ma , usa ) and degassed under vacuum . the mobile phase was composed of buffers a ( 5 mm picb-6 in 0.1% ch3cooh ) and b ( 5 mm picb-6 in 65% methanol ) with the following gradient elution : 0 min , 10% b ; 02 min , 10% b ; 222 min , 70% b ; 2227 min , 70% b ; 27 - 28 min , 10% b ; and 2835 min , 10% b. the sample injection volume was 2 l , and the flow rate was set at 0.5 ml / min . method validation was performed according to the guidelines set by the international conference on harmonization ( ich , 2005 ) and the international union of pure and applied chemistry ( iupac , 2002 ) . the method was validated for linearity , sensitivity , selectivity , accuracy , and precision , as outlined in figure 2 and table 1 . the developed rp - hplc / uv method incorporating an ion - pairing reagent was validated to verify that its performance met the requirements for routine vitamin analysis . several performance characteristics were measured , including selectivity , linearity , sensitivity , accuracy , and precision . selectivity was determined by the absence of interference in the chromatographic window , and this was measured using blank chromatograms at the specific quantification wavelength ( i.e. , 270 nm ) . as shown in figure 2 and table 1 , the chromatograms of the water - soluble vitamins indicate successful separation of all six compounds in < 29 min , with good resolution ( 5.5534.85 ) and asymmetry ( 0.941.08 ) , thereby indicating satisfactory selectivity for this hplc system . linearity was assessed by building external calibration curves for each compound using the vitamin - containing working solutions . calibration curves were obtained by plotting the analyte peak area versus its concentration over seven different concentrations . each concentration of the mixed standard solution was injected in triplicate , and then , the regression parameters were calculated . the sensitivity of the developed method was evaluated by determining the lod and loq values . under the described chromatographic conditions , these values were calculated based on the response and slope of each regression equation at signal - to - noise ratios ( s / n ) of 3 : 1 and 10 : 1 , respectively . for the different components , the lod values ranged from 25 to 197 g / kg , while the loq values ranged from 84 to 658 g / kg . the method precision was then determined by measuring the intra- and interday precision . for the intraday precision , six replicates of the mixed standard solutions were analyzed within 1 d , while the solutions were examined in triplicate for three consecutive days for the intraday precision . the precision was expressed as the percentage of the relative standard deviation ( % rsd ) . the overall intraday % rsd values were < 5.6% , while the interday values were < 4.8% ( see table 1 ) . the accuracy was evaluated by adding the mixed standard solutions at two different concentrations ( high : 20.0 mg / kg ; low : 2.0 mg / kg ) to feed from the association of american feed control official ( affco , 201591-swine mineral and vitamin supplement ) . the mixture was extracted using the developed ion - pairing reagent technique and hplc method . excellent recovery rates of 82.398.9% indicated a high level of accuracy for this method , as detailed in table 1 . the stability of all standard solutions was also tested over 7 d , with the majority having decomposed within 3 d. in particular , in the case of folic acid , rapid decomposition was observed after 3 d compared to that of the other water - soluble vitamins ( i.e. , 63.38% cf . these results demonstrated that it is necessary to prepare a fresh standard preparation for each analysis . based on the above validation data , the proposed method was concluded to provide good linearity , sensitivity , selectivity , accuracy , and precision for the simultaneous analysis of water - soluble vitamins . among the 30 different animal feeds that were analyzed in this study , vitamins were detected in all animal feeds purchased from supermarkets ( table 3 ) . identification of the six compounds was by comparison of their retention times and uv spectra with those of the standards and the pure compounds . the qualitative and quantitative compositions of the six compounds in the animal feed varied significantly . more specifically , the nicotinic acid content ranged from 1,868 to 46,289 mg / kg with an average content of 15,969 mg / kg , while the nicotinamide content ranged from 1,339 to 49,920 mg / kg with an average of 16,257 mg / kg . in addition , the content of folic acid varied between 102 and 5,012 mg / kg ( average = 813 mg / kg ) , while that of pyridoxine was between 2,065 and 49,530 mg / kg ( average = 17,758 mg / kg ) . finally , the riboflavin and thiamine contents ranged from 3,015 to 36,820 mg / kg ( average = 13,286 mg / kg ) and from 1,359 to 48,930 mg / kg ( average = 11,786 mg / kg ) , respectively . thus , a simple , qualitative , and quantitative method for the simultaneous detection and quantification of six vitamin compounds from animal feed was successfully developed and validated using rp - hplc / uv detection . the proposed method showed accuracy and precision and was successfully employed for analyzing different types of feeds . analytical results demonstrated that this hplc method provides a good alternative for routine analysis , owing to its simplicity , specificity , and sensitivity . finally , it exhibits the potential to be applied as a reliable quality evaluation method for animal feed .

a novel and simple method for detecting six water - soluble vitamins in animal feed using high performance liquid chromatography equipped with a photodiode array detector ( hplc / pda ) and ion - pairing reagent was developed . the chromatographic peaks of the six water - soluble vitamins were successfully identified by comparing their retention times and uv spectra with reference standards . the mobile phase was composed of buffers a ( 5 mm picb-6 in 0.1% ch3cooh ) and b ( 5 mm picb-6 in 65% methanol ) . all peaks were detected using a wavelength of 270 nm . method validation was performed in terms of linearity , sensitivity , selectivity , accuracy , and precision . the limits of detection ( lods ) for the instrument employed in these experiments ranged from 25 to 197 g / kg , and the limits of quantification ( loqs ) ranged from 84 to 658 g / kg . average recoveries of the six water - soluble vitamins ranged from 82.3% to 98.9% . method replication resulted in intraday and interday peak area variation of < 5.6% . the developed method was specific and reliable and is therefore suitable for the routine analysis of water - soluble vitamins in animal feed .

anti - mllerian hormone ( amh ) , also known as mller inhibiting factor or mller inhibiting substance , is a glycoprotein formed from two identical subunits , each with a molecular weight of 72 kda . the hormone is part of the growth factor family , which includes 35 different peptide structures , including inhibin , activin , growth differentiation factor , and bone morphogenic protein.1 up until a few years ago , amh was known mainly for its role in the differentiation of male sexual characteristics.2,3 amh is not secreted in the female embryo , allowing development of the female sexual organs , starting from the mller ducts which do not regress , although they differ in the uterus , fallopian tube , and upper part of the vagina . expression of the hormone in women is different at various stages of life , and starts to be detected at week 36 of gestation . its concentration reaches a maximum during puberty , begins to decrease in adulthood , and disappears completely following the menopause . amh , produced from the granulosa cells of the primary follicles , reaches maximum expression in the preantral follicles , with lesser secretion by the greater antral follicles . at this point , growth starts to become dependent on follicle - stimulating hormone ( fsh ) . the data suggest that amh is a factor in regulation during the initial recruitment and cyclical recruitment phases leading to selection of the dominant follicle , and that it has a potential autocrine and paracrine role in follicular development in the female ovaries . after a period of optimal fertility at age 1830 years , oocyte quality diminishes in parallel with a progressive loss of follicles . in women with normal ovulation , serum levels of amh slowly increase , reaching a peak during puberty and then progressively diminishing with the passage of time . moreover , recent studies have shown that amh is correlated with the number of small antral follicles . this observation supports the hypothesis that serum levels of amh can reflect the state of the ovarian follicles better ( given its relative stability during the entire cycle ) than the more usual hormonal markers ( fsh , luteinizing hormone [ lh ] , estradiol , and inhibin b ) , and demonstrates how amh can be a favorable candidate as a marker of the ovarian reservoir.46 reproductive behavior has changed dramatically in the last century , and it is important to be able to identify loss of fertility in a woman as early as possible . more and more women are now delaying pregnancy to a more advanced age , when the quality and amount of ovarian follicles begins to decrease . the first sign of aging is increased levels of fsh at the age of 3540 years , when the menstrual periods tend to shorten . therefore , determining ovarian age is important for patients in whom treatment with in vitro fertilization is proposed , keeping in mind that the probability of pregnancy and subsequent birth of a child gradually diminishes from the age of 3738 years onwards . from this point of view , amh has been identified and proposed for evaluation of responses in patients undergoing assisted reproductive technology . it is now a potential candidate for inclusion in the clinical report , in order to be able to construct a strategy which is targeted and personalized to the characteristics of the patient , and able to increase the benefits of treatment from the physiological , psychological , and economic points of view.79 numerous studies have advocated the use of amh in assisted reproductive technology as a noninvasive test in order to estimate the antral follicle count.10,11 amh is now proposed as a hormonal test in the study of feminine infertility and in the diagnosis of pcos . the diagnosis depends on two of the following criteria : clinical and/or biochemical evidence of hyperandrogenism ( with exclusion of other causes of excess androgen ) , oligo or anovulation , and polycystic ovaries ( european society of human reproduction and american society for reproductive medicine , consensus conference , rotterdam , 2003).12,13 such data lead us to conclude that inclusion of serum amh levels in routine tests for patients undergoing assisted reproductive technology is useful , both quantitatively and qualitatively , not only in the study of patient responses to clinical treatment for infertility , but also in clinical assessment.1420 numerous tests and markers are used in order to identify pathologies involving the ovaries . amongst these are exclusion serum markers of other endocrinopathies ( prolactin , thyroid stimulating hormone , 17-hydroxyprogesterone ) , conf irmation of serum markers of ovarian pathology ( fsh , lh , estradiol , inhibin b ) , invasive scan markers ( transvaginal or laparoscopic ultrasound for antral follicle count ) and , over the last few years , amh levels . there are also other confirmation and monitoring serum tests for pcos ( androstenedione , testosterone , free testosterone , dehydroepiandrosterone ) . this diagnosis will not only render possible a targeted and personalized therapy in order to achieve a greater probability of a positive outcome of treatment , but will also avoid potential harmful effects of treatment , that could eventually preclude assisted reproduction altogether . in this study , we evaluated the value of serum analysis of amh as a diagnostic test in patients undergoing assisted fertility , in order to diagnose pcos prior to treatment . the purpose was to identify a cost - effective , noninvasive clinical method for assessing ovarian pathology , which would also reduce psychological stress for the patient . amh can be measured on any day of the cycle , because there are no fluctuations and it has low cyclical interindividual or intraindividual variability . the study was carried out on 236 serum samples taken from women aged 2646 years and scheduled for exogenous gonadotrophin treatment for infertility at the institute for maternal and child health , burlo garofolo , trieste , between september 2010 and june 2011 . all patients signed an informed consent form before entering the study , which was approved by the ethics committee at our institution . the sample centrifugation for 5 , as described in the manufacturer s instructions , was done to remove residual fibrin and cellular matter , prior to storage . the serum was stored at 2c8c for up to 24 hours and was then frozen at 20c . the confidence limits for amh controls were printed on the control vial labels and intra- and inter - test precision was within two standard deviations ( 2 sd ) . measurement of amh levels was carried out on the third day of the ovarian cycle using an enzyme - linked immunosorbent assay ( beckman coulter , immunotech , dsl diagnostic system laboratories , marseille , france ) . this quantitative , specific , and sensitive technique allows measurement of small amounts of molecules present in biological samples . moreover , it is possible to analyze a high number of samples in a short space of time , as a result of being able to use microplates . it is based on a colorimetric system , with the intensity of color being directly proportional to the concentration of the antigen , which is measured by spectrophotometry . the field of measurement comprises concentration of the analyte sensitivity to the concentration of the highest calibrator standard , from 0.14 ng / ml to 21 ng / ml . the precision is given by an intratest and an intertest , with respective variation coefficients of 12.3% and 14.2% , respectively . the instrument used for analysis in the enzyme - linked immunosorbent assay was a semiautomatic spectrophotometer ( pantech , new york , ny ) . the enzyme - linked immunosorbent assay used was a typical sandwich test , the peculiarity of which concerns a second biotinylated monoclonal antibody directed against the antigen and conjugated with the enzyme streptavidin and horseradish peroxidase . streptavidin is a purified tetrameric protein of bacterial origin ( streptomyces avidinii ) . in order to estimate the amh concentration in the study samples , a calibration curve for interpolation was constructed , using standard amh samples with diverse absorbance concentrations ( pasquinelli and porta , 1994 ) , according to instructions supplied in the analysis kit . fsh levels for all the patients was measured , as well as lh ( only in six patients with very elevated amh levels ) using an automated colorimetric method ( modular p , elecsys ) . in this study , we analyzed 236 serum samples from patients aged 2646 years who had been referred to our institution for medically assisted fertility in september 2010 to june 2011 . we identified 57 patients who were starting in vitro fertilization or embryo transfer with amh values within the normal range ( 3.64 1.51 ng / ml ) , 77 with values below normal ( 1.38 0.32 ng / ml ) , and 96 cases with undetectable values of amh . six patients had very high amh levels ( 10.0 2.28 ng / ml ) and , of these , five were found to have pcos on pelvic ultrasound examination ( p < 0.05 ; table 1 ) . the published studies have reported the average values for patients who were part of control groups or had pcos . comparing the values that we obtained with those of other laboratories , it can be seen that the average values of controls are lower than those in patients with pcos , confirming the validity of the test as an indicator of this syndrome ( table 2 ) . moreover , numerous studies have identified an inverse correlation between amh levels , fsh levels , and patient age . therefore , we attempted to confirm these correlations in our group of patients and fsh levels were also measured in serum samples , showing an average value of 8.53 miu / ml ( follicular phase normal range 3.512.5 miu / ml ) ( figures 13 ) . the cost - effective dosage of amh is similar to that of other hormones , such as fsh and lh . many studies published in recent years have demonstrated that the concentration of amh is 34 times higher in patients affected by pcos than in patients without the disease . one is that the follicles are transformed into cysts when they are at the preantral or antral stage , and remain at this stage and continue to secrete the hormone , and the other is that granulosa cells secrete a greater concentration of amh , detectable at the follicular level . in our case histories , the changes in reproductive state and amh levels this inverse correlation has been found in many studies in the literature , and is confirmed by the present study.2125 our data emphasize that amh can be used to identify pcos and is a reliable marker of infertility associated with patient age and other hormonal tests , such as fsh , because it is influenced by the menstrual cycle , or identification by means of invasive tests such as transvaginal or laparoscopic ultrasound for follicular count and residual ovarian capacity . in conclusion , amh is confirmed as a useful test to study folliculogenesis and ovarian potential in various situations of infertility and for identification of pcos , to avoid the possibility of subjecting patients at risk to ineffective assisted reproductive technology , and using in vitro fertilization or in vitro embryo transfer only after careful clinical assessment.2635

backgroundthe anti - mllerian hormone ( amh ) is a dimeric protein secreted by the female ovaries and has two fundamental roles in follicle genesis . it delays the entrance of the primordial follicle into the pool of follicles in growth and diminishes the sensitivity of the ovarian follicle towards follicle - stimulating hormone ( fsh ) . the purpose of this work was to study the amh ( nv 2.06.8 ng / ml ) as a marker during assisted reproductive technology ( art ) , in order to identify cases of infertility due to polycystic ovarian syndrome ( pcos ) . this syndrome affects 10% of women with infertility problems , and a new biological marker could be useful to general practitioners of internal medicine to help generate the suspicion of pcos so that they can refer the patient to the gynecologist for confirmation.methodsthis study enrolled 236 patients aged 2646 years undergoing assisted reproductive technology at the institute for maternal and child health , trieste , italy . on the third day of the ovarian cycle , the patients were given doses of amh , fsh , and luteinizing hormone ( lh , in cases of amh < 2.06.8 ng / ml ) . a control pelvic ultrasound was also carried out.resultswe identified 57 patients who were starting in vitro fertilization or embryo transfer with amh values within the normal range ( 3.64 1.51 ng / ml ) , 77 with values below normal ( 1.38 0.32 ng / ml ) , and 96 cases with undetectable values of amh . six patients had very high amh levels ( 10.0 2.28 ng / ml ) and , of these , five were found to have pcos on pelvic ultrasound examination ( p < 0.05 ) . we also found inverse correlations between amh levels and age ( r = 0.52 ) and between amh and fsh levels ( r = 0.32).conclusionin clinical practice it is common to encounter patients who turn to medicine in search of a cure for female infertility . in our experience , amh two or three times the normal amount ( 10 2.28 ng / ml ) , is a good indication of pcos and infertility .

intravesical instillation of bacillus calmette gurin ( bcg ) remains a first - line treatment for superficial transitional cell carcinoma of the bladder . although its use is relatively safe , severe complications such as granulomatous hepatitis , osteomyelitis , pneumonitis , and sepsis occur in few patients . complications of intravesical instillation of bcg can be local or systemic , with early or late presentation . here , we report an 88-year - old man who developed fever , rigors , and episodes of syncope following fourth intravesical bcg instillation for the treatment of superficial transitional cell carcinoma of the bladder . pancytopenia , disseminated intravascular coagulation , ground glass appearance on computerized tomography of the chest scan in addition to multiple bone marrow granulomas , suggested the diagnosis of disseminated bcg infection . our case study highlights the importance of early recognition and prompt treatment of patients with disseminated bcg infection following intravesical instillation . although isolation of mycobacterium is desirable to make the diagnosis , it is not unusual to have negative smears and cultures and this should not be used to dismiss the possibility of bcg infection . ( bcg ) vaccine , a live attenuated strain of mycobacterium bovis , was first introduced in humans in 1921.1 intravesical bcg instillation was initially described by marales in 19762 ; it is used for the treatment of superficial transitional cell carcinoma of the bladder . however , a rare but severe complication of bcg immunotherapy is the development of disseminated bcg disease that can be manifested by features of miliary pneumonitis , sepsis soft tissue infections , bone marrow involvement , and/or granulomatous hepatitis.3 symptoms can present as early as a few hours or as late as several months following the bcg therapy . its antitumor effect seems to be t - lymphocytes dependent ; however , its precise mode of action is not yet fully understood.3 although transurethral resection of bladder tumor ( turbt ) can completely eradicate a tumor , recurrence rates range from 48% to 70% , and progression occurs between 7% and 40% of the time.4 these relatively high rates suggest the need to consider adjuvant intravesical therapy , like bcg , in many patients . an 88-year - old male patient was diagnosed with superficial transitional cell carcinoma of the bladder ( t1 ) . he underwent multiple sessions of turbt followed by weekly intravesical bcg therapy in june 2013 . immediately following his fourth bcg session , he developed fever , rigors , respiratory distress , episodes of syncope and confusion , raised inflammatory markers , and disseminated intravascular coagulation ( dic ) shortly after bcg instillation . three days later , he developed fever of 39.5 c associated with chills and rigors and received empiric intravenous antibiotics . his course was complicated by gross hematuria . his hemoglobin level ( hb ) dropped from 13.8 to 7.6 g / dl . blood and cerebrospinal fluid ( csf ) culture reports were negative ; csf protein level was 0.35 g / l , white blood cell ( wbc ) count was 1 cell/l , and glucose was 7.1 laboratory examination revealed pancytopenia with wbcs 1.8 10 cell / l , hb 10.3 g / dl , and platelets 39 10/l . there was evidence of dic with elevated prothrombin time 18.7 , partial thromboplastin time 47 , low fibrinogen 1.1 g / l ( normal range 2.04.0 g / l ) , a positive d - dimer test , and serum albumin 28 levels of bilirubin , alanine aminotransferase , and alkaline phosphatase ( 64 mol / l , 320 iu / l , and 244 iu / l , respectively ) were elevated . ct scan of the chest and abdomen was reported to show bilateral basal ground glass opacities and air space disease associated with bilateral mild pleural effusion . a ground glass nodule was seen in the ( r ) upper lobe ( fig . bone marrow aspirates and trephine biopsy showed multiple small granulomas ( figs . 2 and 3 ) . liver biopsy , on the other hand , could not be done because of the dic . sputum , bone marrow , csf , and urine smear test results and cultures for mycobacteria were negative . he received isoniazid 300 mg , rifampicin 600 mg , and ethambutol 1.2 g , together with prednisolone 60 mg once daily . one month following anti - tuberculosis ( tb ) treatment , he developed skin rash and eosinophilia . his latest blood tests showed hb 12.9 g / dl , wbc 9 10 cell / l , platelets 364 10/l , alanine aminotransferase 13 intravesical bcg instillation has been shown to delay the time to the first recurrence after turbt and to reduce the risk of progression to muscle invasive disease . also , intravesical bcg treatments have been shown to eradicate residual tumors in some patients with papillary carcinoma and carcinoma in situ and to improve overall survival.3 also , rare but severe complications can occur , which can be local or systemic , with early or late presentation . we here report a patient with disseminated bcg infection following intravesical instillation for superficial bladder carcinoma . he presented with fever , rigors , respiratory distress , raised inflammatory markers , and dic shortly after the instillation ; features compatible with disseminated bcg infection.5 this acute presentation is probably due to high levels of cytokines released directly into the bloodstream as a part of the hypersensitivity response rather than mycobacterium dissemination.6 there is still controversy relating to whether the clinical presentation of bcg systemic disease is caused by actual dissemination of m. bovis in the involved tissues or is secondary to hypersensitivity reaction.7 the isolation of viable mycobacteria from involved tissues suggests an ongoing active infection . the presence of granulomas in the absence of isolated mycobacteria in other cases , however , favors a hypersensitivity response . moreover , response to corticosteroids in addition to antitubercular drugs further supports a hypersensitivity etiology . this patient presentation fits into early presentation of the disease that typically occurs within three months of bcg instillation . in a series of 41 patients with bcg infections , patients with early disease developed an illness characterized by fever , generalized symptoms , and evidence of systemic infection with involvement of the liver and lungs in nearly all cases.8 although systemic sepsis and even death have been reported in cases with early bcg infection , intravesical treatment with bcg appears to be relatively safe . in a study of 1200 patients who received bcg immunotherapy , only 2.9% incidence of high fever ( > 39 c ) , 1.0% major hematuria , 0.9% granulomatous prostatitis , 0.7% granulomatous pneumonitis / hepatitis , 0.5% arthritis or arthralgia , 0.4% epididymo - orchitis , 0.4% life - threatening bcg sepsis , 0.3% urethral obstruction , and 0.1% cytopenias were reported.9 previous reports have speculated as to the mechanism of bcg dissemination . one accepted risk factor is recent urological trauma.10 our patient had an episode of severe hematuria , possibly secondary to trauma and warfarin therapy . like many reported cases in the literature , the search for acid - fast bacilli performed on bone marrow , sputum , urine , and csf returned negative . some authorities use the negative culture results to support their hypothesis that the granulomas in bcg disease result from a hypersensitivity reaction and not an infection.11 there have been no randomized trials to assess the optimal therapy for bcg infection . currently , due to the lack of randomized trials on the side effects of intravesical bcg , minimal recommendations are available , and severe complications are usually described in case reports only.12 the suggested first - line treatment is the combination of isoniazid , rifampicin , and ethambutol . m. bovis is intrinsically resistant to pyrazinamide , and low - level isoniazid resistance has been described in some strains.13 bcg - related dermatitis have been previously reported ; however , the development of the rash in the setting of improved inflammatory biomarkers and the skin biopsy changes are more consistent of a drug rash.14 pancytopenia , abnormal liver function tests , dic , and raised c - reactive protein have all reverted to normal . interestingly , the ca-125 declined from 88 to 16 u / ml ( normal range 035 u / ml ) . there are few reports on increased ca-125 in m. bovis infection . on the other hand , many studies have documented the utility of ca-125 in patients with m. tuberculosis infection . serum ca-125 levels in patients with tb peritonitis are as high as seen in ovarian cancer associated with peritoneal infiltration . these high levels fall after adequate treatment and are considered as a useful marker in the diagnosis and follow - up of patients with tb peritonitis.15 although our case is not the first case report on such a severe complication as similar cases were previously reported in the literature,6,7,16 it adds to previous reports and reinforces the recommendation that all patients should be made full aware of the potential systemic and delayed complications of bcg immunotherapy . our study highlights the importance of early recognition and prompt treatment of patients with disseminated bcg infection following intravesical instillation . although isolation of mycobacterium is desirable to make the diagnosis , it is not unusual to have negative smears and cultures , and this should not be used to dismiss the possibility of bcg infection .

backgroundintravesical instillation of bacillus calmette gurin ( bcg ) remains a first - line treatment for superficial transitional cell carcinoma of the bladder . although its use is relatively safe , severe complications such as granulomatous hepatitis , osteomyelitis , pneumonitis , and sepsis occur in few patients . complications of intravesical instillation of bcg can be local or systemic , with early or late presentation.case presentationhere , we report an 88-year - old man who developed fever , rigors , and episodes of syncope following fourth intravesical bcg instillation for the treatment of superficial transitional cell carcinoma of the bladder . pancytopenia , disseminated intravascular coagulation , ground glass appearance on computerized tomography of the chest scan in addition to multiple bone marrow granulomas , suggested the diagnosis of disseminated bcg infection . all these features recovered on antituberculosis treatment.conclusionour case study highlights the importance of early recognition and prompt treatment of patients with disseminated bcg infection following intravesical instillation . although isolation of mycobacterium is desirable to make the diagnosis , it is not unusual to have negative smears and cultures and this should not be used to dismiss the possibility of bcg infection .

biological effects of electromagnetic millimeter waves were observed in many experiments on various biological objects , starting from the bacteria to the whole human body as well as model systems in general . it was repeatedly noted that the nature of the microwaves on biological objects is different from the conventional thermal effect of electromagnetic waves of the other bands , and the physical nature of this phenomenon is still unclear . in order to implement adequate physical model an actual definition of non - thermal effect requires precise temperature measurement of irradiated objects . it is considered that the use of low power ( with output power up to 20 mw ) millimeter waves generators does not result into significant heating of the irradiated matter . calculations provide an increase of temperature to 1c for different patterns of exposure , which should not cause essential biological effects . however , direct measurement of the temperature change in the area of irradiation is a challenging technical problem . high - sensitivity temperature sensors ( thermocouples , thermistors , etc . ) , making perturbations in the investigated samples , affect the local temperature and heat transfer characteristics in a given place . although less accurate , optical methods based on visible or ultraviolet absorption , infrared , raman , and fluorescence spectroscopy are more convenient for registration of temperature changes in small volumes . in contrast , fluorescence - based thermometry which has satisfactory metrological parameters ( sensitivity , performance , spatial resolution ) at the same time is simple and reliable . the water in the millimeter wave range is characterized by a considerable absorption of electromagnetic waves . in particular , at a frequency of 50 ghz , corresponding to wavelengths in vacuum of 6 mm , the absorption coefficient is equal to 5.1 mm . accordingly , the spatial temperature distribution in the irradiated samples containing water is very inhomogeneous . electromagnetic millimeter waves heat the substances containing water in a thin surface layer with high temperature gradient , the numerical value of which can be estimated only by indirect methods . therefore , existing methods for irradiation of biological objects are imperfect and metrological control tools are not reliable . to determine temperature changes in water caused by the millimeter wave absorption we used an optical noncontact method , which is based on the existence of the fluorescence intensity dependence of temperature of organic dyes . the local temperature rise in the capillary was measured , placed inside a rectangular waveguide , in which millimeter waves propagate . we have chosen two dyes with opposite temperature effects : rhodamine 6 g ( r6 g ) and rhodamine c ( rc ) . calibration of the fluorescence intensity of organic dyes aqueous solutions on temperature was carried out by means of diffraction spectrometer . semiconductor laser emission with 406 nm wavelength and 60 mw output power was used as an excitation source . the concentration of dyes ( ~0.4 g / liter ) was chosen from the condition of maximum temperature sensitivity and temperature coefficients of approximate equality . the glass cuvette ( 3 mm pass length ) with the dye solution was placed inside a large glass rectangular cell with water , which served as a water bath . water temperature was maintained to within 0.2. the fluorescence spectra were measured at temperatures from 20c to 40c , over each 5c ( figure 1 ) . the intensity of fluorescence was normalized by the initial value , which corresponded to the temperature of 20c ( figure 2 ) . it was established that , in most cases , the temperature rise is making destructive contribution to the fluorescence yield . with the growth of temperature , the frequency and energy of molecules collisions in solution , as well as the amplitude of internal molecular vibrations , increase , leading to an increase in nonradiative relaxation of the excited levels , and thus fluorescence quenching . along with the temperature quenching of the dye solution in particular , some organic molecules in aqueous solution tend to form associated complexes : dimers , trimers , and so forth , where fluorescence quantum yield is much lower than that in the individual molecules . at sufficiently high concentrations , the fluorescence spectrum is formed as a superposition of the spectra of individual molecules and their associates . some associates divided into separate molecules with increasing temperature that is accompanied by a relative increase in fluorescence intensity . figure 2 shows that the fluorescence temperature dependence of the rc solution corresponds to the one option , while r6 g to another , and in the range 20 40c their intensities approximated by a linear function : ( t)/i ( 20c ) = a + bt , where b is a temperature sensitivity coefficient . for given concentrations of solutions millimeter wave radiation from high frequency signal generator through polarizing attenuator was applied to the measuring module ( figure 4 ) . the measuring module consists of the segment of rectangular waveguide with a cross section 7.2 3.4 mm , inside which , through the middle , was inserted a glass capillary with an inner diameter of 0.5 mm . for capillary with water in a rectangular waveguide area of maximum absorption of the electromagnetic millimeter wave corresponds to antinodes of electrical components and is concentrated in the central part of x ~ 1 mm . fluorescence signal from the central section was removed through a round hole made in the middle of the narrow waveguide wall opposite the capillary . the light stream focused by lens and passed through an orange filter to a photodetector . some radiation that was applied to the measurement module through waveguide directional coupler ( figure 4 ) fell on power meter and has been registered as a signal proportional to the input power ( pin ) , where = 0.1 is coefficient coupler . similarly , the radiation that passes through the module was recorded as a signal proportional to the output power ( pout ) . the difference p = pin pout was equal to the power , absorbed in the sample . previously in the range of 4050 ghz frequency dependence of the capillary absorption of water was measured . at a frequency of 47.5 ghz a pronounced resonance maximum was observed , typical for rectangular waveguide with dielectric cylinder of small diameter . power was absorbed into the capillary with a solution governed by polarization attenuator with attenuation coefficients 0 , 1 , 2 , 3 , 4 db , which corresponded to an absolute value of 20 mw , 15.8 mw , 12.5 mw , 10 mw , and 7.9 mw , respectively . duration of registration signal t 40 s was chosen from the condition significantly exceeded time of establishing thermal equilibrium : t . constant of relaxation was assessed by the expression ~ ( x)/d , where d is the coefficient of thermal conductivity of water was of the order of a few seconds for a given irradiation scheme . figure 5 shows the dynamics of r6 g and pc fluorescence dyes for switched on and off microwave radiation with different capacities . the absorption of microwaves leads to fluorescence increasing for r6 g solution and fluorescence quenching for rc . the gradual decrease in fluorescence intensity is caused by photodestruction of organic dye molecules . by switching off temporarily laser emission , the initial level of fluorescence i20|/i of the absorbed power in the capillary is obtained from the experimental data ( figure 6 ) . in the first approximation it can be approximated by linear functions : ( 1)y=0.150.023x for r6 g ; y=0.140.024x for rc . thus taking into account the calibration dependence ( figure 2 ) , it corresponds to a local temperature increase in the capillary absorbed at maximum power 20 mw : t1 = ( 7.7 0.4)c for r6 g and t2 = ( 7.4 0.4)c for rc . it could be seen that even a low - power microwave source , under certain conditions , causes significant heating of the sample , which can lead to significant biological effects . it should be noted that the special conditions of the experiment ( placing the sample inside the waveguide , radiation at the resonant frequency ) determine the maximum possible temperature response . although in the vast majority of biophysical experiments irradiation conditions of millimeter wave are not so tough , however are carried out in the near zone of the horn or waveguide . in the vicinity of the irradiated object the appearance of the local area temperature increase of a few degrees can cause thermal biological effects at low levels of total radiation power . it is assumed [ 7 , 8 ] that millimeter wave irradiation of dyes solutions has possible additional nonthermal effect of millimeter waves on the spectral properties of solutions which is due to the change in the structure of water . during irradiation , restructuring of water under millimeter wave field causes structural changes in the molecular associates and promotes their decay . in our study , we obtained the same value of the effective temperature for solutions with different scenarios of temperature behavior . this indicates the absence of nonthermal effect of millimeter waves on water , at least in the conditions of sample irradiation inside the resonator at the resonant frequency . the equality of slope coefficients approximating lines indicates the fact that probable nonthermal effect of millimeter waves on water under the given conditions can be neglected . optical noncontact method , which is based on the existence of the fluorescence intensity temperature dependence of the organic dyes , was used to determine changes in water temperature in the millimeter wave absorption . using two dyes with opposite effects , temperature heating using even low - power sources of millimeter waves , the local increase in temperature of the sample can be several degrees . at the same time , the results indicate the absence of nonthermal effect of millimeter waves on the water . the application of noncontact temperature sensing based on the temperature sensitivity of florescent dyes is a simple and novel method to detect temperature change in small biological objects .

temperature sensitivity of the fluorescence intensity of the organic dyes solutions was used for noncontact measurement of the electromagnetic millimeter wave absorption in water . by using two different dyes with opposite temperature effects , local temperature increase in the capillary that is placed inside a rectangular waveguide in which millimeter waves propagate was defined . the application of this noncontact temperature sensing is a simple and novel method to detect temperature change in small biological objects .

during a first step ( november 2009february 2010 ) , seroprevalence rates for a(h1n1)pdm09 virus were assessed in 120 breeding pigs ( > 4 years old ) from 57 farms . blood was obtained from randomly selected pigs at the only slaughterhouse on the island , where pigs are held for <3 hours . we screened the samples for antibodies to influenza a viruses by using the i d screen antibody influenza a kit ( id.vet , montpellier , france ) , and titers were determined by using hemagglutination - inhibition ( hi ) assays ( 5 ) against all classical swine influenza viruses and a(h1n1)pdm09 virus ( table 1 ) . ninety - eight ( 81.7% ; 95% ci 74.7%88.5% ) of the 120 serum samples were positive for a(h1n1)pdm09 virus ( hi titers > 20 ) ; the range of positive titers was 40640 , and 54.2% of the samples expressed high hi titers ( 160640 ) . of the 98 serum samples , 5 reacted at low titer and with only 1 european a ( h1n1 ) swine virus ( titer < 20 ) , i.e. , > 4 dilutions lower than for a(h1n1)pdm09 virus , indicating cross reactivity ( 6 ) . thus , pigs from 47 ( 82.4% ) of 57 tested farms had been infected by a(h1n1)pdm09 virus ; the seroprevalence rate was 81%100% for pigs on 79.0% of the farms . farms with affected pigs were located throughout the island ( figure ) . * hi , hemagglutination inhibition . hi tests were performed according to standard procedure ( 5).titers are expressed as the reciprocal of the highest dilution of serum that inhibits 4 hemagglutination units of virus . a(h1n1)pdm09 lineage . location of farms tested for antibodies against influenza a(h1n1)pdm09 virus in serologic surveys , runion island , 20092011 . blue dots , seronegative farms ; red dots , seropositive farms . in a second step ( june 2010 , when a(h1n1)pdm09 infection was no longer detected among humans ) , we tested whether the virus was still circulating among pigs born that year . to obtain nasal swab and blood samples for testing , we randomly selected 390 fattening pigs ( 2527 weeks old ) at the slaughterhouse ; the pigs originated from 45 farms . at the time of sampling , the veterinary surveillance system did not report any clinical signs suggesting virus circulation among herds . however , 3.5% of the serum samples ( 9% of tested farms ) contained antibodies to a(h1n1)pdm09 virus ( hi titers 20160 ) . nasal swab specimens from 6.7% ( 26/390 ) of pigs were positive for a(h1n1)pdm09 virus as determined by using a specific real - time reverse transcription pcr ( rrt - pcr ) ; the pigs originated from 13 ( 28.8% ) farms ( 7 ) . two strains , a / sw / la reunion/0164/10 and a / sw / lareunion/110348/10 , were isolated onto mdck cell cultures ( 5 ) . during july december 2010 , 11 farms reported influenza - like clinical signs in pigs , and proof of a(h1n1)pdm09 virus infection was established on 3 farms ( farms a fattening pigs on farm a were seronegative for a(h1n1)pdm09 virus . in july , when acute respiratory disease was reported among pigs , 12 of 39 fattening pigs ( 1821 weeks old ) sampled on farm a were still seronegative for a(h1n1)pdm09 virus ; however , rrt - pcr results were positive for a(h1n1)pdm09 virus . four weeks later , when pigs had recovered from influenza , only 7.7% ( 3/39 ) of sampled pigs on farm a had rrt - pcr results positive for a(h1n1)pdm09 virus , and all 39 were seropositive for the virus . high rates of rrt - pcr positivity were also noted for pigs on farms b ( 17/30 pigs ) and c ( 6/15 pigs ) . two a(h1n1)pdm09 strains ( a / sw / lareunion/0167/10 and a / sw / la reunion/110194/10 ) were isolated from pigs on farms a and b , respectively . four influenza virus strains were isolated from pigs , and all induced a cytopathic effect and displayed hemagglutinating activity on chicken erythrocytes ; all 4 were confirmed as a(h1n1)pdm09 virus by specific rrt - pcrs . in addition cross - hi assays ( 5 ) revealed that these strains exhibit antigenic relationships with swine influenza a(h1n1 ) viruses from classical and avian - like lineages , although they reacted most strongly with a(h1n1)pdm09 virus ( table 1 ) . genome sequencing of these strains showed high ( > 98% ) nucleotide sequence homology to the corresponding genes of a / california/04/09 and 2009 human strains from runion island , suggesting human - to - swine transmission ( h. pascalis , unpub . data ) . in a third step ( march , july august , and october 2011 ) , 3 other sampling campaigns were conducted at the slaughterhouse , including 831 fattening pigs from 104 farms . nasal swab samples for 7 ( 8.4% ) pigs from 3 ( 2.9% ) farms still had rrt - pcr positive results . however , serologic analyses revealed that pigs on 40% of the farms ( distributed throughout the island ) were seropositive for a(h1n1)pdm09 virus , indicating continuing circulation of the virus in swine herds ( table 2 ) . seroprevalence rates are % farms positive at the herd level among all farms ( n ) and % pigs positive at the animal level among all animals ( n ) . consistent with findings elsewhere ( 8) , our results show that a(h1n1)pdm09 virus has substantially affected swine herds in runion island . results of our long - term ( 2 years ) investigation show that a(h1n1)pdm09 virus has circulated in pigs beyond the 5-week epidemic among humans during the austral winter 2009 ( 3 ) and has become a novel enzootic pathogen in runion island . several facts may account for the heavy human - to - swine transmission of a(h1n1)pdm09 virus . first , the reassortant pandemic virus contains genomic segments originating from swine influenza viruses established in pigs ( 1 ) . second , pigs are highly susceptible to experimental inoculations with a(h1n1)pdm09 virus and support high intraspecies transmissibility ( 9 ) . third , the pressure of infection caused by a(h1n1)pdm09 virus among humans in runion island was high but most infections were mild or asymptomatic ( 3 ) ; therefore , people pursued their professional activities , acting as silent spreaders of the virus . last , pigs on runion island had no history of previous passages of swine influenza viruses ; thus , the lack of specific immunity to influenza a viruses would have contributed to the high sensitivity of the pigs to infection , as described ( 10,11 ) . despite serologic proof of large numbers of infected pigs during late 2009early 2010 in runion island , influenza - like signs were not exhibited and reported until july 2010 ; this finding was similar to that in new caledonia ( 8) . in july 2010 , several herds showed symptomatic changes in infection that could indicate either a change in virulence of the circulating strain or the intervention of co - infecting pathogens or some other environmental factor(s ) . mycoplasma hyopneumoniae and pasteurella multocida were co - detected on farms with pigs with signs of infection ( data not shown ) . co - infection with swine influenza virus and these bacteria is known to contribute to severe respiratory disorders among pigs ; thus , these bacteria may have enhanced pathogenicity of a(h1n1)pdm09 virus on affected farms ( 12 ) . because specific immunity to a(h1n1)pdm09 virus will decline over time when the virus is no longer circulating among humans , persistence of the virus in an animal reservoir raises concerns about the risk for genetic evolution of the virus and retransmission back to humans of variants with potentially increased virulence . as an example , during the 2011 austral winter , only influenza a(h3n2 ) and b viruses were recorded ( 13 ) . novel reassortant viruses containing genomic segments from a(h1n1)pdm09 and enzootic swine influenza viruses have been isolated in pigs ( 14 ) . such a reassortant was responsible for several cases of influenza among humans in 2011 ( 15 ) ; these cases were mild , but other , more virulent pathogenic viruses could emerge . hence continuous surveillance of a(h1n1)pdm09 infection in pigs

during 2009 , pandemic influenza a(h1n1)pdm09 virus affected humans on runion island . since then , the virus has sustained circulation among local swine herds , raising concerns about the potential for genetic evolution of the virus and possible retransmission back to humans of variants with increased virulence . continuous surveillance of a(h1n1)pdm09 infection in pigs is recommended .

mammalian embryos , like those of most animals , are initially sexually undifferentiated and can develop into either male or female individuals following one of two alternative processes . the paternal transmission of a y chromosome triggers testicular differentiation , whereas the presence of a paternal x chromosome pushes gonads towards ovarian differentiation . characterization of the pathways that promote testicular or ovarian differentiation is essential for a better understanding of sex determination pathologies , including gonadal dysgenesis , gonadal agenesis and sex reversal . in humans , xy sex reversal is relatively frequent ( occurring in about 1 in 3,000 newborns ) and is genetically heterogeneous , with loss of function of the sry male - sex - determining gene accounting for only 15% of the cases . by contrast , xx sex reversal is rare ( about 1 in 20,000 newborns ) and is usually caused by the translocation of sry onto another chromosome . the underlying cause of sex reversal still can not be identified in approximately 75% of patients , indicating that a significant number of genes ( or regulatory regions of known genes ) involved in sex determination are yet to be revealed . . in bmc developmental biology , are shedding new light on the genes involved in female sex determination . the mammalian gonads are derived from the intermediate mesoderm and arise as paired thickenings of the coelomic epithelium on the ventromedial surface of the mesonephros . in mice , the genital ridges are visible at embryonic day 10 ( e10 ) and are composed of somatic cells and primordial germ cells ( pgcs ) . at this stage somatic progenitors have the capacity to give rise either to follicular and thecal cells in the ovary or sertoli and leydig cells in the testis , whereas pgcs can differentiate either as oogonia or spermatogonia . sex determination is initiated in the supporting somatic cell lineage by the sex - specific expression of key factors and the subsequent upregulation of downstream male or female pathways responsible for promoting one fate and suppressing the other ( figure 1 ) . a genetic model for sex determination , controlled by a balance of antagonistic pathways . in xy gonads , sry triggers upregulation of sox9 , leading to sertoli cell commitment and testicular differentiation . sertoli cell differentiation is a result of the establishment of a positive feedback loop between sox9 and secretion of fgf9 ( and also pgd2 ; not shown ) , which act in a paracrine manner to recruit additional sertoli cells . in xx gonads , two independent signaling pathways involving the rspo1/wnt4/-catenin pathway and foxl2 male sex determination begins with the commitment of sertoli cells , via the cell - autonomous action of sry and the non - autonomous mechanisms involving autocrine / paracrine signaling of fibroblast growth factor 9 ( fgf9 ) and the hormone prostaglandin d2 ( pgd2 ) ( figure 1 ) . in xy gonads , sry is transiently activated ( from e10.5 to e12.5 in mice ) in the supporting cell lineage . the onset of sry expression initiates the male differentiation pathway by upregulating sox9 , which in turn upregulates fgf9 expression and increases pgd2 synthesis . fgf9 and pgd2 both help maintain sox9 expression , forming a positive feedback loop , and thereby helping to direct the differentiation of the supporting lineage into sertoli cells . in addition , sertoli cells are also recruited through a non - autonomous mechanism : sry - expressing sertoli cells secrete pgd2 , which acts in a paracrine manner to upregulate sox9 expression in supporting cell precursors . sox9 and fgf9 downregulate female signals , such as the secreted factor wnt4 , to block ovarian differentiation . large - scale transcriptional analyses have revealed that , as in xy gonads , a robust female - specific genetic program is initiated in xx gonads as early as e11.5 ( for a review see ) . however , no morphological differentiation is apparent until e13.5 , when germ cells enter meiosis following induction by retinoic acid . in contrast to xy gonads , germ cells are crucial for the formation and maintenance of the ovarian structure in xx gonads . in their absence , follicles do not assemble and ovarian dysgenesis ensues . an additional modification that occurs in the nascent ovary is the formation of loose cordlike structures , referred to as the ovigerous cords . within these cords , some oocytes undergo apoptosis , and those that remain become surrounded by a monolayer of flattened pre - granulosa cells to form individual primordial follicles . over the past few years , significant progress has been made towards the identification of the molecular basis of female sex determination . recent findings suggest that at least two independent factors or signaling pathways act in a complementary manner to promote the ovarian fate and repress male signaling and testicular development : the r - spondin1/wnt4/-catenin pathway and the foxl2 transcription factor ( figure 1 ) . r - spondin1 ( rspo1 ) has recently emerged as a key female - determining factor , probably acting at the top of the ovarian development pathway . this secreted factor is a potent modulator of wnt signaling and activates the canonical -catenin pathway . transcripts encoding rspo1 are upregulated in somatic cells of xx gonads from e11.5 onwards . in humans , loss of function of the rspo1 gene leads to xx female - to - male sex reversal , and duplications of the rspo1 and wnt4 loci lead to xy male - to - female sex reversal . recent studies in mice suggest that rspo1 is required for wnt4 expression in xx gonads and that it exerts its functions via stabilization of -catenin to promote ovarian fate and block testis development . targeted deletion of rspo1 in mice impairs ovarian differentiation and triggers the development of ovotestes ( gonads composed of both ovarian and testicular tissues ) in xx gonads . more precisely , it prevents the upregulation of wnt4 , resulting in testis - like vascularization and the appearance of androgen - producing cells , two characteristics also seen in wnt4 mutant ovaries . wnt4 is expressed at low levels in mouse bipotential gonads and becomes ovary - specific by e11.5 . both in humans and in mice , mutations in the wnt4 gene lead to late - onset partial sex reversal with appearance of testis - type vasculature , adrenal - like cells and wolffian duct derivatives . overall , rspo1 , wnt4 and -catenin are components of a single pathway that promotes ovarian development and suppresses the formation of testis cords . however , rspo1 is not likely to be the sole female - determining gene because its ablation results in the formation of ovotestes . in addition to the rspo1/wnt4/-catenin signaling pathway , the foxl2 transcription factor has also been proposed as a candidate female - sex - determining gene . foxl2 is a member of the large family of forkhead / winged - helix transcription factors and has been shown to be essential for granulosa cell differentiation and ovarian maintenance in mice . its expression , which is independent of rspo1 , begins at e12.5 in pre - granulosa cells . foxl2 has been implicated in xx sex reversal in goats , but its ablation in mice results in only partial secondary sex reversal , and in humans partial loss of function has been associated with premature ovarian failure . transcriptome analyses by garcia - ortiz et al . indicate that the ovarian genetic program in foxl2 mutant mice is already deregulated by e13.5 , long before the first observations of histological alterations and partial sex reversal . the differing effects of foxl2 loss of function in goats , mice and humans have raised doubts about the role of foxl2 as an ovarian - determining factor . however , recent findings suggest that foxl2 and the rspo1/wnt4/-catenin signaling pathway may act independently , but in a complementary manner , to promote ovarian development and suppress the male pathway . the combined loss of wnt4 and foxl2 leads to extensive gonadal xx sex reversal , with testis - like tubules that express high levels of sox9 and anti - mllerian hormone and contain well differentiated spermatogonia . the presence of testis cords and spermatogonia as early as birth indicates that sex reversal in double mutant ovaries is more dramatic and precocious than in either single knockout . nevertheless , the loss of both wnt4 and foxl2 does not lead to complete sex reversal but results in xx ovotestes . this suggests that additional factors or signaling pathways could also promote ovarian development and suppress the male pathway . one hypothesis proposes the existence of functional redundancy with other wnt ligands , such as wnt5a , wnt6 and wnt9a , that are also expressed in the developing ovary . alternatively , given that the ablation of rspo1 has more dramatic effects on -catenin activation than wnt4 ablation , it is possible that the concomitant ablation of rspo1 and foxl2 could lead to a complete sex reversal . our knowledge of the factors and molecular pathways controlling ovarian and testicular development is steadily expanding . however , the genetic causes leading to sex determination pathologies in humans are mostly unknown . additional genes or regulatory regions involved in the sex determination process therefore remain to be identified . recently , large - scale genomic analyses revealed that more than 90% of the eukaryotic genome is transcribed , yielding tens of thousands of non - coding rnas of various length . although the function of some non - coding rnas is understood , the biological significance of the vast majority remains unknown . therefore , it will be particularly interesting to investigate whether these transcripts have a role in testis- and ovary - determining pathways . we thank dagmar wilhelm and marilena papaioannou for critical comments on the manuscript . due to journal policy , we have only sparingly referenced the literature and apologize to those whose work we were unable to specifically mention .

in mammals , the sex of the embryo is determined by the fate of the gonad . recent papers , including one in bmc developmental biology , shed light on the molecular regulation of ovarian development and suggest that the r - spondin1/wnt4/-catenin pathway and the foxl2 transcription factor act in a complementary manner to promote ovarian fate and to repress testicular development .

we reviewed medline , embase , pubmed , and the cochrane databases to identify all patients who had rimary cerebellopontine angle melanocytoma ( pcpam ) . we searched the following terms : melanocytoma , pigmented tumors , and melanoma combined with posterior cranial fossa or cpa . we included only those tumors that fulfilled the diagnostic criteria for primary melanocytoma and those located in the cpa . the clinical presentation , radiological features , histological findings , treatment , and the outcome of the treatment of these patients were collated and analyzed to document pcpam 's behavior and outcome . we also reviewed our neuro - oncology and neuropathology databases to look for any pcpam in our institution . the collated data were analyzed using simple statistics to determine frequencies , means , medians , and rates . a 40-year - old man presented with occipital headaches associated with nausea . on examination he displayed truncal ataxia , the new clinical signs were sensory neural deafness on the right and ataxia . his magnetic resonance imaging ( mri ) brain scan demonstrated a solitary lesion arising in the right para - pontine space and cpa . it appeared to be extra - axial with mass effect and normal internal auditory meatus appearance . on t2w the lesion was mixed appearance : isointense , hyperintense , and areas of hypointensity ( fig . ( a ) axial t2 image showing a right cerebellopontine angle ( cpa ) isointense mass and areas of hypo and hyper intensity . ( b ) coronal t1 image showing a right cpa mass displacing the brainstem . the craniotomy was performed via retro - sigmoid approach with the intent of total removal . the seventh cranial nerve was monitored during surgery but the eighth was not monitored because he was profoundly deaf on the right . at operation a purplish - pink friable tumor involving the right cpa , extending down to the foramen magnum inferiorly was found . however , the tumor was found to be invading the brainstem and the surrounding structures , encasing the right vertebral artery . he proceeded to 4-week course of radiotherapy and was seen in the clinic with satisfactory postoperative progress . histologically tumor cells appeared relatively uniform , and were arranged in solid lobules with no evidence of necrosis . the nuclei were rounded and exhibited a mild degree of pleomorphism , with rounded nucleoli ( fig . granular brown pigment was present in occasional tumor cells and in macrophages around the tumor lobules that gave a positive reaction for melanin on a singh stain . these findings indicated that this was a melanocytic lesion , rather than a melanotic schwannoma . mitotic activity was not a prominent feature ( < 1% ) and the cell proliferation index on a ki-67 immunostain was low ( < 5% ) ( fig . 2c ) . the relative lack of mitotic activity , necrosis , and pleomorphism , along with a low cellular proliferation index , favored a diagnosis of melanocytoma rather than malignant melanoma . after 3.5 years of initial presentation , tumor progression was detected on mri surveillance and further surgery was undertaken . histological analysis of the second specimen demonstrated similar appearances to the initial specimen ( few mitotic figures ( < 1% ) and a ki-67 proliferation index of < 5% ) , with no evidence of malignant transformation . ( a ) hematoxylin and eosin stain demonstrating solid lobules of uniform cells with scanty pigment ( mostly in macrophages ) and rounded nuclei . ( b ) immunocytochemistry for melan - a showing strong cytoplasmic positivity , confirming the melanocytic nature and helping to exclude meningioma and schwannoma . ( c ) immunocytochemistry for ki-67 revealing a low proliferation index ( ~ 5% ) which would be unusual in a primary or metastatic malignant melanoma . the craniotomy was performed via retro - sigmoid approach with the intent of total removal . the seventh cranial nerve was monitored during surgery but the eighth was not monitored because he was profoundly deaf on the right . at operation a purplish - pink friable tumor involving the right cpa , extending down to the foramen magnum inferiorly was found . however , the tumor was found to be invading the brainstem and the surrounding structures , encasing the right vertebral artery . he proceeded to 4-week course of radiotherapy and was seen in the clinic with satisfactory postoperative progress . histologically tumor cells appeared relatively uniform , and were arranged in solid lobules with no evidence of necrosis . the nuclei were rounded and exhibited a mild degree of pleomorphism , with rounded nucleoli ( fig . granular brown pigment was present in occasional tumor cells and in macrophages around the tumor lobules that gave a positive reaction for melanin on a singh stain . these findings indicated that this was a melanocytic lesion , rather than a melanotic schwannoma . mitotic activity was not a prominent feature ( < 1% ) and the cell proliferation index on a ki-67 immunostain was low ( < 5% ) ( fig . 2c ) . the relative lack of mitotic activity , necrosis , and pleomorphism , along with a low cellular proliferation index , favored a diagnosis of melanocytoma rather than malignant melanoma . after 3.5 years of initial presentation , tumor progression was detected on mri surveillance and further surgery was undertaken . histological analysis of the second specimen demonstrated similar appearances to the initial specimen ( few mitotic figures ( < 1% ) and a ki-67 proliferation index of < 5% ) , with no evidence of malignant transformation . ( a ) hematoxylin and eosin stain demonstrating solid lobules of uniform cells with scanty pigment ( mostly in macrophages ) and rounded nuclei . ( b ) immunocytochemistry for melan - a showing strong cytoplasmic positivity , confirming the melanocytic nature and helping to exclude meningioma and schwannoma . ( c ) immunocytochemistry for ki-67 revealing a low proliferation index ( ~ 5% ) which would be unusual in a primary or metastatic malignant melanoma . there were enough data on each case to include in our analysis ( table 1 ) . the mean age at presentation was 44.4 years ( range : 9 to 71 years ) , men were affected more commonly than women 7:5 . between the ages of 30 to 60 years the most common presenting symptom was headache ( 58% ) , dysphagia , ataxia , and vomiting was noted in 29% , diplopia and sensory deafness in 25% , facial numbness , papilledema and leg weakness in 21% , neck pain in 8% , and syncope in 4% . the median duration of symptoms was 5 months ( range : few weeks to 14 years ) . twelve patients had total surgical resection ( 11 in one stage and 1 in two stages ) with median follow - up of 4 years with no deaths . late recurrence was reported in two cases : one after 8 years and the other after 10.8 years . only 1 of 12 totally resected pcpam had adjuvant radiotherapy . nine patients had subtotal removal . five patients had subtotal removal with 1 month to 3.5 years follow - up with 1 early death ( 20% ) , two progressed within months ( 40%),and one died within a year ( 20% ) . a total of 80% of subtotal resections either progressed or died within 12 months of diagnosis . three had subtotal resection followed by radiotherapy ; one died after 6 months due to hemorrhage , one had no recurrence at 2 years and the third recurred at 3 years and died at 3.5 years . one patient only had biopsy and died within 3 days of surgery , and one patient had diagnosis made at autopsy . primary cpa melanocytomas are very rare tumors and it is unlikely one center or one team will have sufficient numbers to establish their behavior , prognosis , or best treatment . our review revealed peak incidence between 30 and 60 years of age and preponderance in males , but they can present at any age . the duration of symptoms varied widely , from 3 months to 14 years . pcpam presented with symptoms and signs of an expanding mass in the posterior cranial fossa , and may lead to obstructive hydrocephalus or cerebellar dysfunction.6,7 these symptoms and signs are similar to other lesions in the same anatomical location , acoustic neuroma , meningioma , metastasis , and epidermoid cysts . although preoperative diagnosis was not made in all cases , a high index of suspicion is the key to clinch the diagnosis preoperatively . mri characteristically demonstrated hyperintensity on t1-weighted images and hypo- or isointensity on t2-weighted images.6,8,9,10 these tumors enhanced homogenously with gadolinium . the lack of characteristic hyperintensity on t2-weighted imaging may possibly be due to their cellular or fibrous nature , resulting in diminished water content , paramagnetic effects of melanin , susceptibility artifacts or possibly hemorrhage . pcpams are strongly immunoreactive to s-100 protein , hmb-45 and vimentin and , are nonreactive to epithelial membrane antigen and glial fibrillary acid proteins.9,11,12,13 em of melanocytomas demonstrate small smooth nuclei , indstinct nucleoli , abundant cytoplasm , and elaborate cytoplasmic processes . there is no external lamina around cytoplasmic membranes , no micropinocytotic vesicles and absent junctional complexes , and interdigitation of apposing cells . our patient did not have em examination because our pathologist was quite happy with the diagnosis without em , however , if there was a doubt em would be helpful . pcpam must be distinguished from other histologically similar lesions of the central nervous system , such as melanotic schwannomas and meningiomas,9,11,14 metastatic or primary malignant melanoma , meningeal melanocytic naevi , pigmented neurofibromas , and pigmented primitive neuroectodermal tumors . although pcpam and primary malignant melanomas of the leptomeninges originate from leptomeningeal melanocytes , they are different in appearance and behavior.14,15,16,17,18,19 pcpams have a much better prognosis than their malignant counterparts . although most authors consider pcpams to be benign tumors , however melanocytomas in other locations such as the spinal cord tended to recur after resection and can be locally aggressive.9,12,20,21,22,23,24 as such some consider pcpams to be borderline tumors with guarded prognosis.9,12,21 surgical resection had resulted in prolonged remission for up to 35 years,25 which justifies an aggressive surgical management.8,12,25,26 however , early recurrence was reported in 8% and late recurrence in 16% with fatal consequences . postoperative radiation therapy had been used in four patients ; in one patient after complete resection who was alive and well 7 years after diagnosis , and in three patients after subtotal removal , one died from hemorrhage within 6 months , one recurred after 3 years and the third was alive and well 2 years after treatment.26,27 hamasaki et al and kurita et al treated patients with meningeal melanocytoma after partial surgical resection by radiosurgery with good early results.28,29 there was only one report in which chemotherapy was used in the management of spinal melanocytoma with time to tumor progression of 15 months.30 none of the reported cases metastasized implying that pcpam are locally invasive tumors in which patients succumb to local recurrence and invasion rather than distant metastases . they should be considered in the differential diagnosis of tumors of the posterior cranial fossa . the role of radiotherapy , radiosurgery , and chemotherapy is undetermined even when surgical resection was incomplete . further documentation of these rare tumors and worldwide tumor registry is essential to study their behavior and find the best treatment paradigm .

introduction primary cerebellopontine angle melanocytomas ( pcpams ) are very rare . their natural history and prognosis are not fully understood . we reviewed the literature and add a new case to analyze pcpam 's presentation , radiological features , and outcome of treatment.methods we performed a literature review using medline , embase , pubmed , and cochrane databases . we searched for melanocytoma , melanoma , and pigmented tumors in the posterior cranial fossa and cpa to identify pcpam . we have also searched our institution 's neuro - oncology database.results we identified 23 pcpam from the literature and one case of our own . the mean age at presentation was 44.4 years with slight male preponderance . pcpam presented with cerebellopontine angle ( cpa ) syndrome with or without hydrocephalus . preoperative diagnosis was difficult ; they appeared hyperintense on t1 and isointense on t2 magnetic resonance imaging ( mri ) and enhanced with gadolinium . however , the final diagnosis was only made by immunohistochemical examination . total surgical resection of pcpam was associated with prolonged survival while subtotal excision was associated with frequent recurrence.conclusion pcpam are very rare and should be considered in the differential diagnosis of all cpa lesions that appear hyperintense on t1 and isointense on t2 mri images . patients with pcpam should undergo total surgical resection to avoid fatal recurrences .

illness associated with infection with mers - cov is characterized primarily by mild - to - severe respiratory complaints , most requiring hospital admission for pneumonitis or acute respiratory distress syndrome . as of june 11 , 2015 , ecdc has reported 1,288 laboratory - confirmed cases , including 498 deaths ( 1 ) . overall , a large proportion of mers cases is suspected to be a result of zoonotic transmission ( 1 ) with growing evidence for dromedary camels ( camelus dromedarius ) as a reservoir . mers - cov - specific antibodies have been detected in camels across the middle east and the african continent , suggesting a geographically widespread distribution ( 2 ) . analysis of an outbreak associated with a barn in qatar found dromedaries and humans to be infected with nearly identical strains of mers - cov ( 3 ) and further support for camels as reservoir came from a study in saudi arabia ( ksa ) that found widespread circulation of different genetic variants of mers - cov in camels , with geographic clustering of human and camel mers - cov sequences ( 4 ) . however , few other studies provided evidence for zoonotic transmission of mers - cov from camels ( 5 ) . we investigated the rate of mers - cov circulation in dromedaries at the slaughterhouse in qatar , previously linked to two mers cases in qatar . a random group of 105 camels that presented for slaughter in february ( n=53 ) and march ( n=52 ) 2014 were sampled for mers - cov analysis ( table 1 ) . animals either had come directly from within qatar or ksa , or had been sold through the central animal market ( cm ) . swabs and lymph nodes were tested for mers - cov rna by internally controlled rt - pcr targeting upe and n genes , as described ( 3 , 6 ) . ( 7 ) was obtained from the first group of 53 samples and among others sequences generated from this group have been used to define a general mers - cov typing fragment ( 8) . in total , 59% of the camels showed evidence for virus shedding in at least one type of swab at the time of slaughter ( table 1 ) . the percentage positive samples was the highest for nasal samples , followed by oral swabs , fecal swabs , and bronchial swabs . all but one animals with virus shedding from any sample had a positive nasal swab . for saliva ( oral ) , the percentage of positive samples was the highest for animals between 7 and 12 months of age . approximation of the viral loads in the samples using the ct values obtained with the upe target showed no significant differences between types of samples and age groups ( fig . 1 ) it should be noted that viral loads with ct>20 were observed only in the nasal swabs and the nasal swab sample with the highest viral load was found to contain infectious virus ( 7 ) . mers - cov rna shedding by dromedary camels at the central slaughterhouse , qatar , depicted by sample type ( a ) and age group for nasal swabs ( b ) . viral loads in samples are approximated using ct values obtained with the up - e target and are expressed as ct ( 40-ctsample ) . mers - cov detection in pre- and postmortem samples from camels presented for slaughter in doha , qatar ( n=105 ) percentage positive for mers - cov rna as detected by two rt - pcr targets , followed by ( absolute number of samples positive/ total number tested ) . to obtain further insight in the diversity of the viruses that circulated in dromedary camels at the slaughterhouse , mers - cov strains were sequenced according to a recently developed technique that enables the identification of divergent mers - cov types [ sequences and technique in ( 8) ] . in total , five different sequence types were identified with three different types found at both sampling moments ( table 2 ) . camels either came from the large al - shahaniya international racing complex ( ash ) or from different sources elsewhere in qatar ( indicated by the initial arrow for animals 68 and 1012 in ( table 2 ) . subsequently , they were either brought to a showing area ( al mazad , am ) , to the barns at the cm for a holding period , or immediately sent to the slaughterhouse ( sh ) . therefore , the sampling for animals 15 and 913 reflects mers - cov sequence diversity as a result of import from other regions in qatar , whereas virus circulation at the cm more likely explains the virus diversity for animals 68 . summary of background information from slaughter camels for which sequences could be obtained from nasal swabs ash = al - shahaniya , am = al mazad , sh = slaughterhouse , cm = central market . antibodies to mers - cov s1 were found in 100 out of 103 animals tested by micro - array technology ( 9 ) . for 53 animals , antibody levels were also determined by virus neutralization assay as described earlier ( 9 ) . almost all animals had detectable neutralizing antibodies with no obvious age pattern and no significant difference in proportion of animals with low antibody levels ( < 20 ) ( fig . there was no correlation between antibody levels and the viral load as reflected by ct values ( fig . reciprocal mers - cov - neutralizing antibodies titers by age group ( a ) and correlated with ct ( 40-ctsample ) ( b ) for 53 camels at central slaughterhouse , qatar . a random group of 105 camels that presented for slaughter in february ( n=53 ) and march ( n=52 ) 2014 were sampled for mers - cov analysis ( table 1 ) . animals either had come directly from within qatar or ksa , or had been sold through the central animal market ( cm ) . swabs and lymph nodes were tested for mers - cov rna by internally controlled rt - pcr targeting upe and n genes , as described ( 3 , 6 ) . ( 7 ) was obtained from the first group of 53 samples and among others sequences generated from this group have been used to define a general mers - cov typing fragment ( 8) . in total , 59% of the camels showed evidence for virus shedding in at least one type of swab at the time of slaughter ( table 1 ) . the percentage positive samples was the highest for nasal samples , followed by oral swabs , fecal swabs , and bronchial swabs . all but one animals with virus shedding from any sample had a positive nasal swab . for saliva ( oral ) , the percentage of positive samples was the highest for animals between 7 and 12 months of age . approximation of the viral loads in the samples using the ct values obtained with the upe target showed no significant differences between types of samples and age groups ( fig . 1 ) it should be noted that viral loads with ct>20 were observed only in the nasal swabs and the nasal swab sample with the highest viral load was found to contain infectious virus ( 7 ) . mers - cov rna shedding by dromedary camels at the central slaughterhouse , qatar , depicted by sample type ( a ) and age group for nasal swabs ( b ) . viral loads in samples are approximated using ct values obtained with the up - e target and are expressed as ct ( 40-ctsample ) . mers - cov detection in pre- and postmortem samples from camels presented for slaughter in doha , qatar ( n=105 ) percentage positive for mers - cov rna as detected by two rt - pcr targets , followed by ( absolute number of samples positive/ total number tested ) . to obtain further insight in the diversity of the viruses that circulated in dromedary camels at the slaughterhouse , mers - cov strains were sequenced according to a recently developed technique that enables the identification of divergent mers - cov types [ sequences and technique in ( 8) ] . in total , five different sequence types were identified with three different types found at both sampling moments ( table 2 ) . camels either came from the large al - shahaniya international racing complex ( ash ) or from different sources elsewhere in qatar ( indicated by the initial arrow for animals 68 and 1012 in ( table 2 ) . subsequently , they were either brought to a showing area ( al mazad , am ) , to the barns at the cm for a holding period , or immediately sent to the slaughterhouse ( sh ) . therefore , the sampling for animals 15 and 913 reflects mers - cov sequence diversity as a result of import from other regions in qatar , whereas virus circulation at the cm more likely explains the virus diversity for animals 68 . summary of background information from slaughter camels for which sequences could be obtained from nasal swabs ash = al - shahaniya , am = al mazad , sh = slaughterhouse , cm = central market . antibodies to mers - cov s1 were found in 100 out of 103 animals tested by micro - array technology ( 9 ) . for 53 animals , antibody levels were also determined by virus neutralization assay as described earlier ( 9 ) . almost all animals had detectable neutralizing antibodies with no obvious age pattern and no significant difference in proportion of animals with low antibody levels ( < 20 ) ( fig . there was no correlation between antibody levels and the viral load as reflected by ct values ( fig . reciprocal mers - cov - neutralizing antibodies titers by age group ( a ) and correlated with ct ( 40-ctsample ) ( b ) for 53 camels at central slaughterhouse , qatar . a high proportion of dromedary camels shed mers - cov rna when presented for slaughter on two occasions at the central abattoir in qatar . co - circulation of multiple mers - cov variants demonstrates multiple virus introductions through flow of new animals traded into this group of animals , reflecting the virus diversity in wider qatar , including animals imported from australia , the middle east region and east africa . this suggests that cm is a driver of mers - cov circulation and a high - risk site for human exposure . indeed two cases in qatar were linked to visits to this area , and serology data on the only five workers that exclusively work in camel slaughter in qatar illustrated this potential burden as four of the five slaughterers had igg antibodies specific for mers - cov ( 10 ) a study at four slaughterhouses in egypt showed an overall rna prevalence in nasal swabs of 3.6% among 110 camels ( 11 ) , which is significantly lower than in our study . a comparison of the organization of the meat markets between egypt and qatar could provide insight in the observed differences . the camels that are put together for a holding period of weeks prior to slaughter in doha have a wide variety of origins with varying initial immune status , which might provide a platform for extensive virus circulation . these include nave camels from australia ( 12 ) and camels from areas in the horn of africa and the gulf region with known differences in immune status ( 2 , 13 , 14 ) . we observed a positivity rate in rectal swabs of 15 out of 103 animals that were analyzed ( of which 61 were positive in nasal swabs ) . other studies observed none to very low numbers of camels shedding mers - cov rna in feces ( 3 , 15 ) . however , the total numbers of animals in these studies were too low to make a significant comparison with the data presented here . in the current views on mers - cov epidemiology , young camels ( 1year ) with primary infections are thought to play a bigger role in mers - cov transmission than older animals for which less frequent shedding is observed ( 4 , 15 ) and who demonstrate higher rates of seroconversion ( reviewed in ( ref . 2 ) . however , we observed no significant differences in mers - cov rna shedding between different age groups . moreover , the lack of correlation between viral rna loads and levels of neutralizing antibodies in the animals suggests limited protection and potential for reinfection despite previous exposure , similar to the situation in humans with the four common human covs and as observed in a camel herd in ksa ( 15 ) . a problem is that the time since onset of infection could not be determined as the animals did not show overt symptoms . therefore , it remains to be determined how the kinetics of infection are . in theory , the observed shedding of virus in the presence of neutralizing antibodies could represent sampling toward the end of an infection cycle . alternatively , the data may reflect limited mucosal immunity as has been shown for other animal coronaviruses ( 16 ) . the possibility of camel vaccination has been suggested as a possible approach to controlling mers - cov transmission to humans . however , this may prove to be a challenging task in light of the above observations . given the high numbers of animals shedding these viruses in dynamic environments like the doha market and abattoir , potential human health risks need to be considered and the implementation of management alternatives ( e.g. separation of nave animals from previously exposed animals and personal protective equipment for employees ) might reduce the burden of mers - cov exposure to humans . the authors have not received any funding or benefits from industry or elsewhere to conduct this study .

two of the earliest middle east respiratory syndrome ( mers ) cases were men who had visited the doha central animal market and adjoining slaughterhouse in qatar . we show that a high proportion of camels presenting for slaughter in qatar show evidence for nasal mers - cov shedding ( 62/105 ) . sequence analysis showed the circulation of at least five different virus strains at these premises , suggesting that this location is a driver of mers - cov circulation and a high - risk area for human exposure . no correlation between rna loads and levels of neutralizing antibodies was observed , suggesting limited immune protection and potential for reinfection despite previous exposure .

preterm birth ( ptb ) is the leading cause of infant morbidity and mortality in the world . the world health organization ( who ) defines preterm birth as any birth before 37 completed weeks of gestation or fewer than 259 days since the first day of woman 's last menstrual period ( lmp ) . in developing countries , the main causes of preterm births include infectious diseases and poor availability and accessibility of health care resources . in high - income countries , the increase in the number of preterm births is linked to conception among older women and increased number of multiple pregnancies as a result of usage of fertility drugs . in some developed countries , medically unnecessary inductions and caesarean section deliveries before full term also increase preterm birth rates . in rich and poor countries , many preterm births remain unexplained [ 1 , 2 ] . approximately three - fourths of perinatal deaths occur in foetuses that are delivered at < 37 weeks , and about 40% of these deaths occur in those delivered at < 32 weeks . in addition to its contribution to mortality , preterm birth has lifelong effects on neurodevelopmental functioning such as increased risk of cerebral palsy , impaired learning , and visual disorders and an increased risk of chronic disease in adulthood . the economic cost of preterm birth is high in terms of neonatal intensive care and ongoing health care and educational needs . the social cost is also high , with many families experiencing the sudden loss of a preterm baby or a stressful hospital stay , sometimes for months . defining risk factors for prediction of preterm birth is a reasonable goal for several reasons . first , identification of at - risk women allows initiation of risk - specific treatment . second , the risk factors might define a population useful for studying specific interventions . finally , identification of risk factors might provide important insights into mechanisms leading to preterm birth . yet , data regarding preterm births and risk factors are not routinely collected in hospitals . therefore , to obtain insight into the risk factors for ptb , a secondary care hospital was chosen in southern india for the study . data of births in dr . tma pai hospital , udupi , during the period from january 2010 to may 2013 were used for this study . approval for the study was taken from the institutional ethics committee . the births at dr . all live births during the period from january 2010 to may 2013 were included into this study . potential cases were all women who were recorded in the labour log book as giving birth at a gestational age between 28 and 37 weeks . the hospital numbers of these women were taken from the log book and the patient records were collected from the hospital medical records . data from these records were used to fill the questionnaire . for every case record , two control records were obtained . controls were all women who had a live birth after 37 weeks of gestational age . two controls two years older or younger than the case were selected by simple random selection . out of which 17 babies were still born , 47 records were not found , and 20 cases had inadequate data and hence were excluded from the study so the final analysis was done for 154 cases . the gestational age was assessed by using date of last menstrual period and confirmed by ultrasound in the records . the criteria used for defining the different clinical conditions are shown in table 1 . the questionnaire used for data entry was divided into six sections : background information of the mother , medical history , current pregnancy details , baby details , details of previous conceptions , medical disorders complicating current pregnancy , and investigations . in the background information of the mother section , information was obtained about the age , occupation , height , and the body weight at the beginning of the pregnancy . in the medical history section , information was obtained about family and medical history of the pregnant woman . risk factors found in the women were categorized into twelve categories : fetal distress ; failed induction ; hypertensive disorders of pregnancy ; malpresentation and multiple pregnancy ; previous uterine scar ; antepartum haemorrhage ( aph ) ; prom ; medical disorders : anemia , hyperthyroidism , hypothyroidism , rh negative with ict positive , and rh negative ; oligo / polyhydramnios ; gestational diabetes mellitus ( gdm ) ; cephalopelvic disproportion ; and others : manual removal of placenta , baby hydrocephalus with absent posterior vault , bladder injury , and fetal polycystic kidneys . univariate logistic regression analysis was used to examine the association between preterm birth and risk factors . the univariate association of risk factors with preterm birth was approximated by determining the odds ratio . odds ratio was calculated for the risk factors associated with preterm and term deliveries . univariate and multivariate logistic regression analysis were used to examine association between risk factors and preterm and term birth . among the 4,137 antenatal admissions during the study period , 238 were admitted with preterm labour . the mean birth weight of the 167 ( 33.1% ) preterm babies was 2452.7 grams and the mean birth weight of 338 ( 66.9% ) term babies was 2977.8 grams . table 3 shows that the most common mode of delivery was spontaneous vaginal delivery , respectively , 41.4% and 51.2% for cases and controls . emergency lower segment caesarean section ( lscs ) occurred more in the preterm group than in the control group . the mothers in both the case and control group were healthy , with very few preexisting medical conditions as shown in table 4 . the most common antenatal complication was pregnancy induced hypertension ( or = 4.5 , 95% ci 1.3415.25 ) . hypertensive disorders of pregnancy were found to be the most common cause of preterm labour ( 21.4% ) . height less than 1.50 m as the common risk factor was seen in 26 ( 16.8% ) women . . fetal distress occurred among 23 ( 14.9% ) women and oligo- or polyhydramnios in 19 ( 12.3% ) women . in the control group the most common complication was fetal distress , found in 53 ( 15.9% ) women , followed by failed induction 45 ( 13.5% ) , gdm 27 ( 8.1% ) , and previous uterine scar 27 ( 8.1% ) . significant associations were found between hypertensive disorders of pregnancy , height < 1.50 m , prom , oligo-/polyhydramnios , threatened abortion , twin gestation , and preterm birth . the present study has shown that preterm delivery was significantly associated with hypertensive disorders of gestation , height < 1.50 m , prom , oligo-/polyhydramnios , threatened abortion , and twin gestation . hypertensive disorders of pregnancy were present in 21.4% , which were the commonest obstetrical risk factor . the finding was contradictory to the study done by shresta et al . in which hypertensive disorders of pregnancy were seen in 13.3% . analysis of nonobstetrical risk factors revealed height < 1.50 m as a significant risk factor for preterm birth . short women are more likely to have a small pelvis , which can lead to obstructed labour . placenta previa and placental abruption are often associated with vaginal bleeding and often lead to preterm birth ( ptb ) . in this study , prom was seen in 27 ( 17.5% ) and 21 controls ( 6.3% ) . multiple gestations , accounting for only 2 - 3% of infants , carry a substantial risk of preterm delivery and result in 1520% of all preterm births . about 40% of twins will have spontaneous labour or prom before 37-week gestation , with others having an indicated preterm delivery because of preeclampsia or other maternal or fetal disorders . the widespread availability of assisted reproduction has resulted in a large increase in the incidence of multiple gestations and this increase , in turn , has led to an increase in the preterm birth rate . the mechanism for preterm labour in multiple gestations and particularly higher order multiple gestations may be related to uterine distension , increased intrauterine volume , or related complications such as cervical incompetence . in particular , higher circulating levels of relaxin associated with superovulation may cause cervical insufficiency , with subsequent ptb . reduction of multifetal gestations , particularly high order multifetal gestations , may improve neonatal outcome . according to krupa et al . vaginal bleeding caused by placental abruption or placenta previa is associated with a very high risk of preterm delivery , but bleeding in the first and second trimesters that is not associated with either placental abruption or placenta previa is also associated with subsequent preterm birth . the present study did not find any significant association between aph and preterm birth . oligo- or polyhydramnios are associated with preterm labour , although the association was not statistically significant in the present study . maternal demographic characteristics associated with preterm birth include low socioeconomic and educational status , low and high maternal ages , and single marital status [ 9 , 10 ] . observational studies of the type of work and physical activity related to preterm birth have produced conflicting results . the level of physical activity is not consistently related to the rate of preterm birth [ 1114 ] . the limitation of the current study was inability to assess these nonobstetrical risk factors like socioeconomic status , maternal malnutrition , cigarette smoking , and direct abdominal trauma as these data were not found in the records , but all the women were married as marriage is the usual norm of the society . based on data from 184 countries , the global average preterm birth rate in 2010 was 11.1% . preterm birth rates varied widely between countries . at a national level , the estimated preterm birth rate ranged from about 5% to 18% . the highest rates of preterm birth were in south - eastern asia and sub - saharan africa ( 13.5% and 12.3% of all livebirths , resp . ) . india has the highest preterm birth rate ; incidence of around 13.0% has been reported in other studies , in contrast to the current study ( preterm rate of 5.8% ) . the authors speculate that this could probably be because of the fact that the pregnant women in this region are healthy . they are young , do not smoke or drink alcohol , and have very few or nil preexisting illnesses . the commonest obstetrical risk factor for preterm birth was hypertensive disorders of pregnancy and nonobstetrical risk factor was height < 1.50 m. significant risk factors for preterm birth found in this study were gestational hypertension , height < 1.50 m , preterm rupture of membranes , threatened abortion , and twin gestation .

introduction . preterm birth is the leading cause of newborn deaths and the second leading cause of death in children under five years old . three - quarters of them could be saved with current , cost - effective interventions . the aim of this study was to identify the risk factors of preterm birth in a secondary care hospital in southern india . methods . in the case - control study , records of 153 antenatal women with preterm birth were included as cases . age matched controls were women who had a live birth after 37 weeks of gestational age . gestational age at delivery and associated risk factors were analyzed . results . the preterm birth rate was 5.8% . common risk factors associated with preterm birth were hypertensive disorders of pregnancy ( 21.4% ) , height < 1.50 m ( 16.8% ) , premature rupture of membranes ( 17.5% ) , and fetal distress ( 14.9% ) . mean birth weight for preterm babies was 2452 grams while the birth weight for term babies was 2978 grams . conclusion . the commonest obstetrical risk factor for preterm birth was hypertensive disorders of pregnancy and nonobstetrical risk factor was height < 1.50 m. the percentage of preterm birth was low , comparable to developing countries .

an 11-year - old female was referred to our care for the treatment of a pathologic fracture of the lumbar spine . one month prior , she had fallen during exercise , causing persistent back pain . when symptoms failed to abate , computed tomography ( ct ) of the spine was performed , revealing a fracture at the l-2 level that was most likely pathologic . mary 's hospital as a pediatric hematology patient . a chest x - ray ( fig . 1 ) revealed a left lower lobe infiltrate with pleural effusion , and the chest ct revealed bilateral pleural effusions with multiple , diffuse nodules of both lungs . biopsies of the bone marrow and the sole of the right foot confirmed stage iv rhabdomyosarcoma . after 5 months of chemotherapy , a complete metabolic response was evident by pet - ct ; and after 11 months of treatment , the lung lesions and pleural effusions had essentially resolved . however , two nodules persisted in the left lung - one in the upper lobe and the other in the superior segment of the lower lobe ( fig . 2b ) . for diagnostic and curative purposes , wedge resection of these two nodules was performed via mini - thoracotomy . the patient 's recovery was uneventful , and she was discharged on postoperative day 6 . grossly , the resected nodules were firm and ovoid , measuring 3 mm in diameter . in histologic sections , tumor proliferation was lepidic , marked by cuboidal to columnar cells with scanty cytoplasm following alveolar contours . the patient was tumor - free after 6 months , but a new mass developed on her left wrist 10 months postoperatively . solitary pulmonary nodules are largely due to inflammation , but the neoplasms that do occur are generally malignant , with the incidence of metastatic disease outnumbering that of primary lung cancer . most primary cancers of the lung are bronchogenic in origin , typically arising during the sixth or the seventh decade of life . in the second decade , the reported incidence is only 0.9% , and prior to the age of 40 years , this figure changes little ( 1.2% ) . although its etiology and risk factors are not fully appreciated , smoking and environmental exposures are unlikely contributors . instead , an association between congenital pulmonary airway malformation ( cpam ) , type i and bac has been reported , and bac has been encountered as a second malignancy among survivors of other pediatric malignancies , including ewing 's sarcoma , hodgkin 's lymphoma , hepatoblastoma , and testicular teratocarcinoma . in this instance , there were no signs of cpam in the preoperative chest x - ray or chest ct , and the lung lesions were not cystic . shiraishi et al . similarly reported three young patients ( 14 , 17 , and 23 years of age ) with osteosarcoma and concurrent malignancy ( adenocarcinoma ) or premalignancy ( atypical adenomatous hyperplasia ) of the lung . all lung pathology was proven before the chemotherapy for osteosarcoma , but the significance of this association remains to be seen . our patient presented with bilateral pleural effusions and boggy lungs , precluding the identification of bac . without a definitive timeline , bac could not legitimately be linked to chemotherapy . kowalczyk et al . reported that the probability of the second malignancy was greater in pediatric acute lymphoblastic leukemia patients than in the normal group . further studies including genetic predisposition need to be followed . pediatric patients with bac are usually asymptomatic , which hampers discovery and diagnosis . therefore , our patient was under ct surveillance for disseminated sarcoma . ultimately , it is important to recognize that solitary lung nodules in young patients with sarcomas can be primary malignancies , particularly bac . as in adults , the prognosis for bac in juveniles is better than that for other lung malignancies , provided that the surgical resection is adequate . multiple lung lesions reappeared at this time , consistent with metastases . at present , the patient is still living and will continue to be follwed .

primary tumors of the lung are uncommon in pediatric patients , particularly bronchioloalveolar carcinoma ( bac ) . an 11-year - old female suffering from back pain for 1 month was referred to seoul st . mary 's hospital for treatment of a pathologic fracture of the lumbar spine . comprehensive evaluation disclosed numerous pulmonary metastases of rhabdomyosarcoma ( stage iv ) . during chemotherapy , most of the lung lesions regressed , with the exception of two nodules . wedge resections , intended for diagnosis and cure , yielded a histologic diagnosis of bac .

given the risk of paralysis associated with cervical transforaminal injection , is it time to reconsider transforaminal injections of the lumbar spine ? arguments for discontinuing lumbar injections have been discussed in the anesthesia literature , raising concern about the risks of epidural steroid injections ( esis ) . in a 47-year - old man , paraplegia of the lower extremities developed , specifically conus medullaris syndrome , after he underwent an esi for recurrent pain . the patient felt his legs going dead ; paraplegia of the lower extremities was noted . an initial magnetic resonance imaging study performed after the patient was transferred to the emergency department was unremarkable . however , a later neurosurgical evaluation showed conus medullaris syndrome , and a second magnetic resonance imaging study showed the conus infarct . we conducted a search of the pubmed database of articles from 2002 to 2011 containing the following keywords : complications , lumbar epidural steroid injection(s ) , cauda equina syndrome , conus medullaris infarction , spinal cord infarction , spinal cord injury , paralysis , paresis , plegia , paresthesia , and anesthesia . summarizing this case and 5 similar cases , we weigh the potential benefits and risks of esi . although one can safely assume that this severe , devastating complication is rare , we speculate that its true incidence remains unknown , possibly because of medicolegal implications . we believe that the rarity of this complication should not preclude the continued use of transforaminal esi ; rather , it should be emphasized for discussion with patients during the consent process . a 47-year - old man who had undergone an l4/l5 laminectomy and discectomy 5 years earlier presented with recurrent pain in the left buttock and posterior leg . after receiving an esi by a local anesthesiology group within the cincinnati , ohio , area , the patient was transferred from the outpatient pain clinic to our institution . information regarding his medical history and prior treatment , as well as details of the procedure , was limited to that provided by the patient himself or the accompanying procedure report . the patient reported that he had previously received esis on the left side of his lower back ; this was the second injection in a series of 3 . correct needle placement in the left l5-s1 neural foramen was verified with epidurography immediately after the injection , the patient felt his legs going dead ; paraplegia of the lower extremities was noted . because of the concern for intrathecal injection with resultant motor blockade , the patient was monitored for 4 hours . when no clinical improvement was observed , he was transferred to a nearby community hospital emergency department for neurologic examination . although the initial magnetic resonance imaging ( mri ) study performed in the emergency department was unremarkable ( fig . however , a second mri study to evaluate the possibility of vascular complications obtained 48 hours after the injection showed a conus infarct ( fig . 2 ) . five hours after esi in a 47-year - old man , magnetic resonance imaging scans performed at the emergency department were unremarkable , showing a normal appearing conus . ( a ) ( b ) t1-weighted sagittal image ( repetition time , 416.7 ; echo time , 15.0 ) . magnetic resonance images ( about 48 hours after the procedure ) showing extensive signal abnormalities within the lower thoracic spinal cord and conus compatible with the clinical diagnosis of conus infarct . ( a ) t1-weighted sagittal image ( repetition time , 675.0 ; echo time , 9.6 ) . ( b ) t2-weighted sagittal image ( repetition time , 3640.0 ; echo time , 102.0 ) . ( c ) short tau inversion recovery ( stir ) sagittal image ( repetition time , 4000.0 ; echo time , 58.0 ) . at 1-month follow - up , the patient could walk without assistance with a slow and calculated gait , had symmetric lower - extremity strength , and had dorsiflexion strength of 4 of 5 bilaterally . his urinary urge sensation had returned , and occasional episodes of fecal incontinence occurred in relation to bladder overdistention . our search of the pubmed database ( 20022011 ) included the keywords complications , lumbar epidural steroid injection(s ) , cauda equina syndrome , conus medullaris infarction , spinal cord infarction , spinal cord injury , paralysis , paresis , plegia , paresthesia , and anesthesia . esi is regarded as an effective and conservative means of treating low - back pain resulting from nerve root inflammation . recent case reports of post - procedural conus medullaris syndrome after spinal vascular compromise raise the question regarding safety . our case represents a sixth patient in whom conus medullaris syndrome developed after sustaining an acute spinal cord infarct during esi . in 5 other case reports ( table 1 ) , this complication affected patients ( aged 4271 years ) who had previous lumbar surgery and then underwent a transforaminal steroid injection . of note , findings of spinal cord injury were not detectable on the initial mri study within the first 24 hours in 1 case . injections are typically evaluated first by aspiration and injection of contrast . a nonvascular penetrating injection of contrast media verifies safe needle placement . however , in a series of 761 lumbosacral transforaminal injections performed , furman et al . reported that the sensitivity of positive flash or actual aspiration was only 44.7% , because only 38 of 85 patients had shown either flash or actual aspiration before injection . specifically , they showed that there was an 11.2% rate of vascular injection in their series . in evaluating correct placement of 316 caudal - approach esis , implicated aspiration as an errorprone method for verifying needle placement , reporting a 9.2% incidence of vascular violation despite negative findings on aspiration . blood is supplied to the caudal - most portion of the spinal cord by the anterior spinal artery , 2 posterior spinal arteries , segmental radiculomedullary arterial branches , and most importantly , the artery of adamkiewicz . the location of the artery of adamkiewicz , which is the primary blood supply to the conus medullaris , is fairly unpredictable . it travels with the nerve through the foramen at or near the level of its origin from the thoracolumbar segmental arteries . . showed that the artery of adamkiewicz originated from the left t9 - 12 posterior intercostal arteries in 75% of cases and from the l1 - 2 lumbar arteries in 10% of cases . in 31 cadavers biglioli et al . located this artery between t12 and l3 in 26 cases ( 83.9% ) . in a 2002 review of more than 4000 spinal angiograms , lo et al . examined the variability of the artery of adamkiewicz , noting that it originated at l2 in 1% of cases and l4 in 0.075% of cases . of the proposed mechanisms by which spinal cord medullary infarction may occur , one explanation may be the combined effect of an undetected direct arterial injection into a low - lying artery of adamkiewicz and the resultant embolic incident from the injectate . houten and errico proposed that the collaterals surrounding the cord at the level of this artery were proximal to the injection site and thus allowed direct passage of the injected material into the conus . however , as discussed by lo et al . considering this observation , we believe that it is unlikely that our patient had this low - lying artery that could have then been injected with an epidural steroid at this precise location . another plausible explanation is that an inadvertent sacral radicular artery injection carried injection material distally to the spinal cord . reported that material injected into the abdominal aorta below the level of the artery of adamkiewicz would appear in the conus through collateralization . the most likely cause is injection of steroid particulate through either the artery of adamkiewicz or collateral radiculomedullary arterial branches . prior lumbar surgery may lead to compromise of normal vascular supply to the spinal cord , thus making it more susceptible to vascular injury . subsequent thrombus formation would result in an embolic infarct in the spinal cord supplied by the affected artery . florey noted that such vasoconstriction was a local effect lasting 5 seconds to 10 minutes at the site of injury only . found that fine needle ( 30-gauge ) arterial puncture in rhesus monkeys induced intense vasospasm , typically lasting anywhere from 4 hours to 4 days . many studies have examined mechanically induced vasospasm of the cerebral vasculature and may be indirectly suggestive that a similar phenomenon can occur in the spinal cord and conus medullaris . of the multiple recommendations made to avoid such devastating complications as paralysis , first and foremost is the strict adherence to the standard and widely accepted techniques of transforaminal esis . these guidelines include the use of multiplanar fluoroscopy or computed tomography guidance together with contrast material to prevent complications . if recovery of neurologic function fails to occur in a patient within a 2- to 3-hour time period after esi , an initial mri study may be obtained to exclude an epidural hematoma . repeat mri after 24 hours should be performed as well . in our patient , as well as 1 other reported case , a delayed effect was observed with mri signal changes occurring after 24 hours . given the risk of paralysis associated with cervical transforaminal injection , is it time to reconsider transforaminal injections of the lumbar spine ? although the risk of permanent neurologic deficit is negligible , arguments for discontinuing lumbar injections have been presented in the anesthesia literature . however , when one considers the potential benefit of this noninvasive treatment modality , abandoning such injections may be premature . however , we speculate that more than 6 cases of conus medullaris syndrome after esi have occurred , and medicolegal considerations may explain why they may go unreported . at the very least , patients should be clearly informed regarding the potential risks of esi , including paralysis . although one can safely assume that this severe , devastating complication is rare , its true incidence remains unknown . in our opinion , the rarity of this complication should , at this time , not preclude the continued use of transforaminal esi for relief of pain in select patients but should be included in the consent process .

backgroundgiven the risk of paralysis associated with cervical transforaminal injection , is it time to reconsider transforaminal injections of the lumbar spine ? arguments for discontinuing lumbar injections have been discussed in the anesthesia literature , raising concern about the risks of epidural steroid injections ( esis).methodsin a 47-year - old man , paraplegia of the lower extremities developed , specifically conus medullaris syndrome , after he underwent an esi for recurrent pain . correct needle placement was verified with epidurography . immediately after the injection , the patient felt his legs going dead ; paraplegia of the lower extremities was noted.resultsan initial magnetic resonance imaging study performed after the patient was transferred to the emergency department was unremarkable . however , a later neurosurgical evaluation showed conus medullaris syndrome , and a second magnetic resonance imaging study showed the conus infarct . we conducted a search of the pubmed database of articles from 2002 to 2011 containing the following keywords : complications , lumbar epidural steroid injection(s ) , cauda equina syndrome , conus medullaris infarction , spinal cord infarction , spinal cord injury , paralysis , paresis , plegia , paresthesia , and anesthesia.conclusionssummarizing this case and 5 similar cases , we weigh the potential benefits and risks of esi . although one can safely assume that this severe , devastating complication is rare , we speculate that its true incidence remains unknown , possibly because of medicolegal implications . we believe that the rarity of this complication should not preclude the continued use of transforaminal esi ; rather , it should be emphasized for discussion with patients during the consent process .

epithelial ovarian cancer ( eoc ) has the highest death rate among gynecologic malignancies throughout the world , primarily because most patients are diagnosed with advanced stage disease . the standard treatment consists of cytoreductive surgery followed by induction chemotherapy with a taxane / platinum combination . despite an initial excellent response to chemotherapy , the disease subsequently recurs in most patients and their long - term prognosis is dismal . for patients with optimally debulked stage iii ovarian cancer , the median progression - free survival ( pfs ) is 21 months , with a median overall survival ( os ) of 57 months ( 1 ) . even patients who attain a complete clinical response ( ccr ) after primary therapy , as defined by the absence of symptoms , normal examination , serum ca 125 concentration below 35 u / ml and imaging analyses showing no evidence of disease , have a median pfs from completion of therapy of about 21 months ( 2 , 3 ) . most patients who attain ccr to primary treatment receive no additional chemotherapy , although the majority will require multiple salvage regimens due to tumor recurrence . attempts to improve the clinical outcome of eoc patients included the identification of new first - line regimens which are able to induce higher ccr rates and effective treatments to consolidate or maintain the response achieved by first - line chemotherapy ( 4 ) . consolidation therapy uses one or more of the multiple chemotherapeutic agents known to be active in recurrent disease ( 5 , 6 ) . one of these agents , hexamethylmelamine ( hmm ) , which has been used to treat recurrent ovarian cancer for many years , is well tolerated ( 7 - 11 ) and is associated with prolonged pfs and os in the phase ii setting ( 12 ) . little is known , however , about outcomes of consolidation therapy in advanced eoc patients ; and there have been no comparison studies of hmm consolidation therapy in these patients . patients ( n=102 ) with histologically confirmed advanced ( stage iii or iv ) eoc and documented ccr following front - line platinum - based therapy who had been treated at asan medical center between january 1997 and november 2006 were enrolled . all patients had who performance status of 2 or less ( karnofsky index > 60 ) and adequate bone marrow ( white blood cell count [ wbc ] > 3.010/l and platelet count > 10010/l ) , kidney ( serum creatinine < 120 m / l ) , and liver ( liver enzymes 2upper normal limit ) function . patients ( n=49 ) treated with oral hmm ( altretamine ) consolidation therapy were retrospectively assessed and compared to the untreated patients ( n=53 ) . each patient in the former group received 260 mg / m / day hmm for 14 consecutive days of each 28-day cycle , with a maximum of 12 cycles . treatment was stopped early due to disease progression , unacceptable toxicity , or withdrawal of patient compliance . the patient was followed for recurrence of measurable disease as defined by the study protocol . patients were also followed by physical examination , pelvic examination , complete blood counts , blood chemistries and ca-125 concentration every 3 months for the first 2 yr and every 6 months thereafter until disease progression , death , or loss to follow - up . among clinical and pathological characteristics of patients , optimal debulking was defined as residual tumor < 1 cm , suboptimal debulking as residual tumor 1 cm . serum ca-125 concentration was measured 6 weeks after initiation of the front - line chemotherapy . pfs was estimated from the date of study registration to the date of clinically proven recurrence . data analysis was performed using spss ( version 12.0 ) . the chi - square test , student 's t - test were used to compare clinical and pathologic characteristics of patient groups . pfs analyses were performed using the kaplan - meier method and log - rank test . we estimated the parameters in the cox proportional hazard model using pfs as a dependent variable , ca-125 concentration and debulking status as independent variables , and recurrence as a censoring variable . of the 102 patients with documented ccr from advanced eoc following front - line platinum - based therapy , 49 received hmm consolidation treatment and 53 received no consolidation treatment . the two groups were similar in age , debulking status , histological type , stage , ca-125 concentration 6 weeks after initiation of first - line therapy , and recurrence rate ( table 1 ) . of the 49 hmm - treated patients who received at least one cycle of oral altretamine , 14 patients did 3 cycles , 4 patients did 4 to 5 cycles of hmm . among the patients who received 6 - 12 cycles ( n=31 ) , 12 patients did 12 cycles of hmm . although the median pfs of the hmm - treated group ( 38 months ; 95% confidence interval [ ci ] 16 - 60 months ) was longer than that of the untreated group ( 21 months ; 95% ci 16 - 26 months ) , the difference was not significant ( p=0.235 ) ( fig . 1 ) . of patients with optimal debulked disease ( residual tumor < 1 cm ) , those who received consolidation treatment had a median pfs of 41 months ( 95% ci 25 - 57 months ) , whereas those who received no treatment had a median pfs of 25 months ( 95% ci 19 - 31 months ) , but there was no significant difference ( p=0.333 ) ( fig . 2 ) . of patients with suboptimal debulked disease ( residual tumor 1 cm ) , median pfs of those who did and did not receive hmm were 16 months ( 95% ci 10 - 22 months ) and 16 months ( 95% ci 12 - 20 months ) , respectively ( p=0.204 ) ( fig . 3 ) . using cox 's proportional hazards model , we found that serum ca-125 concentration 6 weeks after initiation of first - line therapy , which means just before the 3rd cycle of adjuvant chemotherapy ( p<0.0001 ) , stage ( p=0.005 ) , and debulking status ( p=0.038 ) were significant prognostic factors for pfs ( table 2 ) . cytoreductive surgery followed by induction chemotherapy with a taxane / platinum combination is currently accepted as the standard regimen for advanced eoc . despite excellent responses to first - line chemotherapy , most patients with advanced ovarian cancers who achieve ccr relapse after a median time of 18 - 24 months ( 13 - 15 ) . among attempts made to improve the clinical outcome of eoc patients several trials have assessed maintenance therapy with single - agent hmm , epirubicin , topotecan , or paclitaxel in patients responsive to first - line platinum - based chemotherapy ( 2 , 16 - 18 ) . hmm ( altretamine ) is a synthetic , cytotoxic , antineoplastic , s - triazine derivative that can be taken orally . its exact mechanism of action is unknown , although chemically it resembles alkylating agents ( 19 , 20 ) . vergote et al . reported a 14% response rate of hmm as a single agent in 50 patients with pltinum - resistant disease . and oral altretamine 260 mg / m / day was given for 14 days every 4 weeks for six cycles to patients with figo stage iii eoc who obtained a clinical response following platinum - based therapy ( 12 ) . to date , however , there have been no trials comparing hmm with no treatment in patients with advanced eoc . the dosage of hmm used in this study was 260 mg / m / day for 14 days every 4 weeks , for a maximum 12 cycles ; and median follow - up was 3.2 yr . 37 of 49 ( 75.6% ) patients with hmm did not receive maximum 12 cycles . hmm therapy for patients received less than 6 cycles ( n=18 ) were caused by a progression of disease , and severe gastrointestinal toxicity . for patients receiving 6 or more cycles of hmm ( n=31 ) the reasons of discontinuation were patient 's desire of discontinuation of consolidation therapy due to poor compliance with gastrointestinal discomfort and a loss of follow - up . our study failed to show the statistical significance in the median pfs of the hmm - treated group ( fig . serum ca-125 is a marker frequently used in evaluating the clinical situation in ovarian cancer patients , and the rate of decline in serum ca-125 during primary chemotherapy has been an important prognostic factor in several multivariate analyses ( 21 ) . moreover , postoperative serum ca-125 concentration is an independent prognostic factor in patients with invasive ovarian cancer ( 22 ) . reduction in serum ca-125 over the first two cycles of platinum - based chemotherapy is an independent predictor of survival in patients with suboptimal stage iii or iv ovarian cancer ; patients without significant declines had a particularly poor prognosis ( 23 ) . in agreement with these findings , our study results showed that ca-125 concentration 6 weeks after initiation of first - line chemotherapy was prognostic for pfs . we also found that debulking status was a prognostic of pfs in patients with advanced eoc . our finding is in agreement with that large residual disease after initial surgery is the strongest prognostic variable for tumor recurrence ( 14 , 24 , 25 ) . of our 102 patients , 80 had optimal cytoreductive surgery ( residual < 1 cm ) , whereas 22 had suboptimal surgery ( residual 1 cm ) . although all 102 patients achieved ccr following first - line chemotherapy , those with optimal surgery had a better prognosis than those with suboptimal surgery . the ultimate aim of consolidation therapy is to improve clinical outcome , including prolonged survival rate and better quality of life in patients with eoc . few studies have investigated consolidaton therapy in patients with advanced eoc . although our study were retrospective analysis and failed to show the prolonging pfs in patients with advanced eoc by consolidation therapy with hmm , we consider that our study can contribute data to investigate the effectiveness of consolidation therapy in epithelial ovarian cancer .

the aim of this study was to assess the efficacy of consolidation therapy with hexamethylmelamine ( hmm ) in patients with advanced epithelial ovarian cancer ( eoc ) . patients treated at our hospital between january 1997 and november 2006 and in documented clinical complete response from advanced ovarian cancer following front - line platinum - based therapy were retrospectively analyzed . the patients treated with hmm were compared to the patients of matched counterpart without consolidation therapy . of 102 patients enrolled , 49 were treated with hmm and 53 received no consolidation treatment . for patients with hmm and observed patients , the mean age were 54.6 and 55.6 yr ; the distribution of stage was similar ( p=0.977 ) ; the optimal surgery was performed in 36 ( 73.5% ) and 44 ( 83% ) ( p=0.336 ) ; the recurrence rate were 27 ( 55.1% ) and 33 ( 62.3% ) ( p=0.463 ) ; and the median progression - free survival were 38 months and 21 months for patients with hmm and observed patients ( p=0.235 ) . no treatment - related adverse events were reported during the follow - up period . although this study failed to show the significant survival benefit of consolidation therapy with hmm in patients with advanced eoc , we consider that our study can contribute data to investigate the effectiveness of consolidation therapy in epithelial ovarian cancer .

role of the p53 protein in regulation of cell cycle , cell growth and maintenance of genomic stability has been largely described . numerous alterations in p53 lead to neoplasmatic transformation . a rare familial li - fraumeni syndrome was associated with germline mutations in this gene . in families with li - fraumeni syndrome most commonly observed neoplasms are : soft tissue sarcomas , osteosarcomas , brain tumors , breast cancer , leukemias , and adrenocortical tumors , but not ovarian cancer however , over 200 epidemiologic studies evaluated ovarian cancer risk associated with snp variants in tp53 . among them the tp53 215 g > c ( rs1042522 , p.pro72arg ) is one of the most commonly disputed . the results differ between populations with little or no evidence for the risk of cancer for opposite pro or arg alleles [ 28 ] . similar thus inconclusive results are observed in ovarian cancer [ 911 ] and thereby reproduce previous findings . these equivocal data may suggest that the tp53 rs1042522 does not influence carcinogensis directly , but might be linked to another pathogenic alteration responsible for higher risk of ovarian cancer . one of the candidate gene is the wrap53 ( also denoted as wdr79 and tcab1 ) located on chromosome 17p13 which partly overlaps the tp53 and interacts with the 5utr of p53 . wrap53 is required for control and induction of p53 upon dna damage to maintain normal levels of p53 in the cell preventing its deprivation which may then lead to a cancer the identification of wrap53 as a regulator of p53 shows that dysfunction of wrap53 itself may be a separate cause leading to a cancer [ 13 , 14]recent reports suggested that common variations in wrap53 may independently increase risk of estrogen receptor negative breast cancers and correlates with poor prognosis of head and neck cancer . aim of this study was the analysis of association between snps located in wrap53tp53 region : rs1042522 , rs2287497 , rs2287498 and ovarian cancer risk in the polish population . the studied group consisted of 626 ovarian cancer patients from the registry of international hereditary cancer centre in szczecin , poland , who were diagnosed in years 20032009 in cooperating oncology centers in szczecin and pozna . the control population consisted of 1045 healthy women who visited their family doctors in the area of szczecin . mean age and age structure did not differ significantly between cases and controls ( age range 2679 vs 2779 , mean age 55.5 vs 56 respectively ) . the study protocol was approved by the institutional review board of the pomeranian medical university , the approval was obtained from all cooperating institutions , and signed informed consent for genetic testing was obtained from all participants . 10 ml of peripheral blood samples for dna extraction were acquired from cases and controls . all samples were genotyped with use of simple probes on roche lightcycler 480 in 384 well plates in 10 l pcr reaction using 1:10 dilution of lightcycler 480 genotyping master , 0.5 m of excess primer , 0.05 m of limiting primer , 0.6 m of probe and ~20 ng of dna according to roche applied sciences genotyping master mix instructions . all statistical calculations were performed using the common homozygous of each snp as the reference value . each of the snps was evaluated individually per genotype by calculating odds ratio ( or ) , 95 % confidence interval ( 95 % ci ) , p values using a chi test . genotype distributions of all three examined snps in control population were in accordance with hardy weinberg equilibrium : rs1042522 ( maf = 0.28 , hwe = 0.19 ) ; rs2287497 ( maf = 0.12 , hwe = 0.65 ) , rs2287498 ( maf = 0.10 , hwe = 0.57 ) . the distribution of the genotypes among ovarian cancer samples revealed an association of studied snps with ovarian cancer risk . rs1042522 cc homozygotes were more frequent in cases when compared to controls ( or = 1.46 ) ( table 1 ) . similar association was observed for wrap53 rs2287497 and rs2287498 where tt homozygotes and aa homozygotes , were more frequent among cases than controls ( or = 1.95 , 2.65 , respectively ) ( table 1 ) . all the results were statistically significant.table 1distribution of genotypes among ovarian cancerssitecasescontrolsorpci 95 % n(%)n(%)rs10425225cc599.4726.91.460.031.002.11cg26542.343641.71.080.250.881.33gg30248.253751.41.001.00rs2287497tt203.2171.61.950.031.013.76tg11818.922021.10.890.190.721.18cc48878.080877.31.001.00rs2287498aa193.0121.22.650.011.275.50ga9915.818417.60.900.240.691.18gg50881.284981.21.001.00 distribution of genotypes among ovarian cancers a combined analysis of examined three snps showed an even stronger association with ovarian cancer risk for cases with three rare homozygotes cc + tt + aa versus wild type homozygotes gg + cc + gg ( or = 4.76 p = 0.0006 ci 95 % 1.84-12.32 ) . however , detailed studies around this region will be needed to clarify the observed association of that specific homozygosity in other populations . the ambiguous associations found for rs1042522 with little or no evidence for the risk of ovarian cancer were previously described in different populations , similarly neither tp53 germline mutations nor li - fraumeni syndrome was proven to be associated with an increased risk of ovarian cancer . hence the hypothesis that an evaluation of snps located in close proximity to tp53 may reveal that rs1042522 is just a marker of other pathogenic alleles . wrap53 is one of the candidate flanking genes to tp53 located on antisense strand to tp53 . an analysis of the literature revealed studies involving genotyping of 23 snps in the tp53 region including some variants outside the tp53 coding sequence , among them snps located in fact within wrap53 . previously published multicenter pooled data suggested an association between rs2287497 and rs2287498 with serous invasive ovarian cancers , but the results were inconsistent between analyzed populations [ 10 , 11 ] . rs2287498 is a synonymous amino acid change in exon 2 ( f150f ) of wrap53 gene , expected to affect function at a splice site , rs2287497 is an intronic change , however supportive of an association . the study of schildkraut included a small number of polish ovarian cancer patients , however narrowed to serous ovarian cancer cases only , because of the a priori belief that tp53 variants might be more closely related to serous cancers . schildkraut findings showed a trend consistent with our results , but due to relatively smaller groups ( 118 ovarian cancers vs. 618 controls ) the scores were not statistically significant leaving the case open . our results provide the evidence for an association between snps both in tp53 and wrap53 and a risk of invasive ovarian cancer in poland . our results might be a suggestive evidence that specific homozygosity of several snps in tp53wrap53 region is significantly overrepresented in ovarian cancer patients . the observations suggest a stronger association of both rs2287497 and rs2287498 ( wrap53 variants ) than of rs1042522 ( tp53 variant ) and lead to a conclusion that snps in wrap53 is more strongly associated with an ovarian cancer risk than rs1042522 in tp53 . it is possible that other variants of wrap53 , not selected for the evaluation , are also related to the disease .

among many alterations within the tp53 gene the rs1042522 ( c72 g , p.pro72arg ) has been associated with numerous cancers , however the results differ between populations for opposite pro or arg alleles . similar thus inconclusive results are observed in ovarian cancer , which may suggest that the rs1042522 does not influence ovarian carcinogensis directly , but might be linked to another pathogenic alteration . wrap53 which overlaps the tp53 is required to maintain normal levels of p53 upon dna damage , but also when altered may independently increase the risk of cancer . to evaluate the association between three snps located in wrap53tp53 region : rs1042522 , rs2287497 , rs2287498 and ovarian cancer risk in polish population we genotyped 626 cases and 1,045 healthy controls . our results provide the evidence for an association between studied snps and a risk of invasive ovarian cancer in poland . we found that cc homozygotes in rs1042522 were more frequent in cancers when compared to controls ( or = 1.46 , p = 0.03 ) . similarly in wrap53 both tt homozygotes in rs2287497 ( or = 1.95 , p = 0.03 ) and aa homozygotes in rs2287498 ( or = 2.65 , p = 0,01 ) were more frequent among cases than healthy individuals . there is also a suggestive evidence that specific homozygosity of studied snps in tp53wrap53 region is significantly overrepresented in ovarian cancer patients . in conclusion snps in wrap53 ( rs2287497 and rs2287498 ) have stronger association with an ovarian cancer risk than rs1042522 in tp53 .

although lumbar disc extrusions are frequently observed in neurosurgical practice , posterior epidural migration of an extruded prolapsed intervertebral disc fragment is rare4,6 ) . the migration of disc fragments is generally contained in the anterior epidural space , which is well defined and delineated by the posterior longitudinal ligament and by the lateral membranes attached to it9 ) . this paper reports a unique case of the posterior epidural migration of sequestered lumbar disc herniation mimicking an epidural facet cyst , and discusses the imaging and clinical features of this rare condition . a 32-year - old man with a 2-week history of back pain and severe radiating pain in the left leg was transferred to our institute from a private hospital . he was treated conservatively with anti - inflammatory medication , muscle relaxants , and bed rest in a private hospital ; however , the symptoms did not improve . at the time of the visit , clinical examination findings included a straight leg raise test that revealed hypothesia below the l3 nerve root dermatome with unrestricted motion . magnetic resonance imaging ( mri ) showed a left - sided epidural mass at the l2 - 3 level . the t2-weighted sagittal and axial mr images revealed a left - sided cystic extradural lesion compressing the dural sac ( fig . 1 a and b ) . the lesion showed heterogeneous high signal intensity compared with the degenerated disc on the t2-weighted images . the patient 's symptoms were progressive and unresponsive to conservative treatment , and he had restricted movement . therefore , the patient underwent surgery under a presumptive diagnosis of an intraspinal facet cyst . the lesion was homogeneous , dark brown in color , firm in consistency , and slightly adherent to the duramater . the pathological examination revealed a cartilaginous mass with partial inflammatory and necrotic material identical to what was expected of a degenerated intervertebral disc ( fig . six months after surgery , the patient showed no symptom recurrence or neurological aggravation , except for mild numbness . disc sequestration can be defined as a herniated disc with perforation of the outermost annulus fibrosus and posterior longitudinal ligament with migration of the disc fragment to the epidural space3 ) . rarely , sequestrated disc fragments can migrate to the posterior epidural space of the dural sac , and the majority of extruded discs tend to migrate laterally due to the anatomic properties of the anterior epidural space , which is limited dorsally by the posterior longitudinal ligament and ventrally by the vertebral body . most symptomatic lumbar disc herniations are observed in the posterolateral position with resulting nerve root irritation . the posterior migration of the disc might present clinically with isolated acute or chronic back pain or significant neurological symptoms such as cauda equina compression1,5 ) . on computed tomography images , an extradural migrated fragment is usually observed as a posterior mass compressing the dural sac . sequestrated fragments normally show low signal intensity on t1-weighted images , and 80% of fragments exhibit iso - or slightly high signal intensity on the t2-weighted images relative to the degenerated disc of origin . in the present case , the high signal intensity on the t2-weighted images in this patient could be explained by the higher water content in the herniated material than on an intact disc or a reparative process that led to transient water gain7 ) . differential diagnosis often includes hematoma , epidural abscess , tumor , synovial cyst , or ganglion cyst because the extruded disc fragment rarely migrates to the posterior epidural space . facet joint cysts can mimic the symptoms of an extruded disc ; thus , they can be difficult to diagnose . this is especially the case when there has been hemorrhage into the cyst . on mr images , synovial cysts appear as well - circumscribed extradural cystic lesions that are isointense or hypointense on t1-weighted images , and hyperintense on t2-weighted images . however , signal intensity is highly variable depending on the characteristics of the cyst . an epidural abscess usually presents as a hypointense mass on t1-weighted images and a hyperintense mass on t2-weighted imaging with rim enhancement . conversely , the lack of an associated change in the disc and the adjacent endplates , and the lack of clinical findings of infection suggest another diagnosis . a hematoma is normally isointense or hyperintense on the t1-weighted images , with no enhancement and an associated trauma history2,8 ) . in our case , a preliminary diagnosis of a facet cyst such as a synovial cyst or a ganglion cyst was made because of the high signal intensity on the t2-weighted images compared with the degenerated disc and its location adjacent to the facet joint . we did not include migrated disc in the differential diagnosis due to its unusual location on mri and unrestricted straight leg raise test during examination . consequently , treatment consisted of removing the extruded fragment through a hemi- or complete laminectomy . surgical treatment should be considered to prevent severe neurological deficits in cases of unsuccessful conservative treatment . we report an atypical posterior epidural migration of an extruded lumbar disc mimicking a facet cyst . although atypical , posterior epidural migration of an extruded lumbar disc should be included in the differential diagnosis of a posterior extradural mass in the lumbar spine .

dorsal extradural migration of extruded disc material is clinically uncommon . we report a rare case of posterior epidural migration of an extruded lumbar disc mimicking a facet cyst . a 32-year - old man was admitted to our institute with a 2-week history of severe low back pain and radiating pain in the left leg . the magnetic resonance ( mr ) images revealed a dorsally located , left - sided extradural cystic mass at the l2 - 3 level . the initial diagnosis was an epidural facet cyst because of the high signal intensity on mr images and its location adjacent to the facet joint . intraoperatively , an encapsulated mass of soft tissue adherent to the dural sac was observed and excised . the pathological diagnosis was degenerated disc material . after surgery , the patient experienced complete relief from leg pain .

severe accidental hypothermia is a condition associated with significant morbidity and mortality . in the years 20092012 the polish national statistics department reported 1836 deaths due to excessive exposure to natural cold . the severe accidental hypothermia center ( clhg centrum leczenia hipotermii glebokiej ) was set up in krakow in 2013 ( darocha , 2015 ) . it is a unit functioning within the structure of the cardiac surgery clinic , established in order to improve the effectiveness of the treatment of patients in the advanced stages of severe hypothermia . the coordination of rescue operations ( over an area of 32,950 square km ) was entrusted to a group of doctors ( 4 coordinators ) , who support the decision - making and organization of the operational process from the time of obtaining the information about the incident until reaching clhg . on december 29 , 2014 at 19:15 , the rescuer on duty at the mountain rescue service ( gopr ) received information about a group of tourists who had lost their way in the top regions of babia gora mount , at the height of about 1620 meters above sea level . air temperature was between 6 and 8c ( windchill factor below 0c ) , the wind was w - wnw with gusts up to over a few dozen km per hour , and the falling snow significantly reduced visibility . the mountain rescue service search party on duty ( two people ) left immediately to conduct the search . later they were joined by others , so that 19 mountain rescue service members eventually took part in the operation . at 19:30 , in accordance with the protocol , the member of the mountain rescue notified the severe accidental hypothermia center ( clhg ) about the search operation . at 20:55 two men were conscious and in stage i of hypothermia , while the third one , sitting in the snow , was confused , agitated , and aggressive towards the rescuers who suspected the ii / iii stage of hypothermia according to the swiss staging system . information about this situation was passed on by phone to the clhg coordinator by the gopr rescuers . the victims were covered with metalized foil , put in thermal sleeping bags and in akia emergency rescue sleds . external warming by means of heating pads was started , and continuous heart rate monitoring using an aed was implemented . at 22:08 the mountain rescue service ( gopr ) rescuers started the difficult transport of the victims downhill , in the direction of the meeting place agreed upon with the teams of emergency medical services who were to take further care of the victims . on the basis of the information received by phone , the clhg coordinator started the procedure that is in place for patients in severe hypothermia , with the option of extracorporeal warming . he notified the team on duty at the cardiac surgery clinic of the john paul ii hospital in krakow , and an operating theater , as well as ecmo equipment were booked . due to poor atmospheric conditions ( bad weather ) , it was not possible to use an emergency helicopter . the clhg coordinator and the dispatch center in krakow arranged ambulance transport with a doctor for the patient suspected to have ii / iii stage hypothermia . transport was to take place from the scene of the incident directly to the john paul ii hospital . the decision was made to supply the ambulance with extra equipment ( i.e. , a device for mechanical chest compression and a low - temperature thermometer , both of which were taken from another emergency service ambulance working in the vicinity ) . ht , the coordinator for extracorporeal treatment of severe hypothermia patients took the medical history of the victim from his family . information about the lack of allergies and chronic illnesses and the medication taken was obtained . at 23:05 the rescuers reached the place where the emergency medical rescue team were waiting . after being carried into the warmed ambulance and having the monitoring devices connected , at 23:11 the patient suspected of hypothermia ( ht ) the patient was intubated , intravenous access was obtained and the transfusion of warm infusion fluids was implemented . the clhg coordinator advised the team managing the transport not to undertake advanced cardiovascular life support ( acls ) procedures there and told them to start transporting the patient to hospital as quickly as possible . at 23:26 the team set off with the jpii hospital as their destination . thanks to the continuous cooperation with the medical rescue team , the coordinator was able to evaluate the course of the acls procedures undertaken during transport . at 23:35 there was a brief period of agonal cardiac rhythm with pea ( pulseless electrical activity ) ( fig . the team covered 98 km by land . throughout the journey , the clgh coordinator had current information about the location of the emergency medical rescue team and the expected time of arrival at the destination hospital . the patient had asystole and anisocoria ( the left pupil was larger than the right one ) . with the emergency rescue team , and in urgent mode , he was taken to the already prepared operating theater , where he arrived at 1:15 . after cannulation of the femoral artery and femoral vein , arteriovenous extracorporeal membrane oxygenation ( ecmo ) was started at 1:35 . 200 j defibrillation was attempted , achieving the return of spontaneous circulation , but due to the persisting symptoms of cardiogenic shock , ecmo was continued until the morning hours of 1:01:2015 ( duration of ecmo therapy32 hours ) . the duration of circulatory arrest , from the time of diagnosis to administering extracorporeal circulation was 150 minutes . arterial blood gas values , blood glucose , hemoglobin and blood chemistry levels the patient regained consciousness and was extubated on january 2 , 2015 , and left the icu on january 7 , 2015 in a good neurological status ( glasgow coma scale 15 , cerebral performance category 1 ) , without anisocoria . at the time of leaving the hospital , the echocardiogram showed that the patient had a normal left ventricular ejection fraction ( ef-65% ) . prognosis in circulatory arrest in the course of accidental hypothermia is surprisingly good , despite even long periods of hypoperfusion ( dunne , 2014 ) . such treatment results are possible mainly owing to the cold protection of the brain , maintaining continuous organ perfusion obtained by means of manual or mechanical chest compression , and using extracorporeal warming ( brown et al . , 2012 ; dunne et al . , 2014 ; meyer et al , 2014 ; paal and brown , 2014 ; zafren et al . , 2014 ) . the guidelines proposed by gordon et al . ( 2015 ) suggest to start immediate continuous cardiopulmonary resuscitation ( cpr ) , to minimize interruptions and apply mechanical chest compressions as soon as possible , in circulatory arrest due to primary severe hypothermia . delayed or intermittent cpr may be considered only when continuous cpr is impossible , particularly during difficult evacuations . in the described case , the decision was made to supply the ambulance with extra equipment ( i.e. , a device for mechanical chest compression and a low - temperature thermometer , both of which were taken from another emergency service ambulance working in the vicinity ) . mechanical compression does not have a survival advantage over manual compression , but manual compression can not be done safely or effectively in a moving ambulance . the fourth element , which can significantly impact the prognosis is the appropriate organization of the rescue operation . good coordination , planning , foresight , and acting in accordance with the agreed procedures in the rescue scheme , makes it possible to shorten the time of reaching the destination hospital and effective treatment ( gordon et al . , 2014 ) . the case described here is an example of optimal management on the part of the coordinator and provides proof that the system that had been elaborated works in an effective way . notifying the coordinator of a search operation is one of the more important elements of the procedures in the rescue scheme under discussion . according to the algorithm that is in place , mountain rescue services ( 6 units of mountain rescue services covering the area of 17 680 km ) are obliged to give notification of rescue operations , especially ones conducted in conditions when there is a risk of the occurrence of hypothermia . thanks to this , it is possible to start preparations early . what is equally significant is the regular exchange of information between the coordinator and the units conducting the search and rescue medical operations . in the case described here , the coordinator had complete information about the victim transmitted to him by mountain rescuers , and was given all the parameters of the acls procedures undertaken during the ambulance transport . the immediate provision of the device for mechanical chest compression , which was taken aboard the ambulance transporting the patients as extra equipment , proved how excellent the planning and foresight of the operation was . on the basis of the information gathered , we have created a regularly updated map of the equipment at the disposal of hospitals and medical emergency services , so that coordinators can use them as required . cooperation with the dispatch center in krakow , which has agreed to the procedures in the rescue scheme elaborated by the clhg , is a very important aspect of such operations . in the case described here , on the basis of the information obtained , the coordinator made the decision that there was a high likelihood of circulatory arrest occurring , and therefore made arrangements for the device to be waiting for the patient at the place where he was taken over from the mountain rescuers . general knowledge about the procedures and treatment in managing such cases can therefore be incomplete and out of date . we confirmed that in our recent survey among 42 ers in poland providing emergency healthcare for the population of 5,305,000 ( kosinski et al . , 2015 ) . we believe that in the case being described , this element ( role of coordinator ) could also have influenced the outcome . it is , however , worth noticing that thanks to continuous information campaigns and regular training , the procedures in the rescue scheme that were developed are more and more universally recognized and used . knowledge of the principles of proceeding in hypothermia must be generally known , especially in the mountain rescue community . the recommendations and guidelines elaborated by icar and erc are therefore invaluable because they provide the basis for developing local protocols ( soar et al . , 2010 ; durrer et al . , the case described here confirms that it is possible to achieve full recovery of neurological functions in patients with circulatory arrest in the course of severe hypothermia , even after resuscitation procedures taking a few hours . at the same time , we have proven the effectiveness of the system that had been elaborated , thanks to which patients are referred to specialized hypothermia centers by means of a precisely pre - arranged route and set procedures . for obvious reasons , it is not possible to develop an ideal system , one in which all the possibilities can be foreseen . in another mountain rescue operation supervised by a clhg coordinator , some delays were unavoidable , and resuscitation procedures before introducing ecmo support in the destination hospital took 5 hours and 45 minutes ( own , unpublished data ) . however , similarly to the case fully described in that article , a full recovery of neurological functions was achieved . the element that could have been improved in this case was the delayed measurement of core temperature . neither the mountain rescuers , nor the emergency medical rescue team had appropriate equipment to perform this . core temperature ( tc ) measurement is the only diagnostic tool to assess the severity of hypothermia accurately . early tc measurement can significantly influence the course of rescue and medical proceedings and is by all means recommended ( strapazzon et al . , , the optimal thermometer should be minimally invasive , easy to handle , and independent of environmental conditions . epitympanic temperatures were comparable to invasive tc measurements in cases of deep hypothermia , however there is no clear evidence for the reliability of epitympanic tc at low ambient temperatures . every new case of hypothermia provides a topic for discussion to us and an incentive to introduce modifications raising the effectiveness of the system that had been introduced . its basic elements will always be the knowledge of the team comprising the rescue units , the cooperation of the units taking part in the operation , and good coordination of activities . good coordination , planning , predicting possible problems , and acting in accordance with the agreed procedures in the scheme , make it possible to shorten the time of reaching the destination hospital and implement effective treatment . the severe accidental hypothermia center was set up in krakow in 2013 in order to improve the effectiveness of the treatment of patients in the advanced stages of severe hypothermia .

abstractdarocha , tomasz , sylweriusz kosinski , maciej moskwa , anna jarosz , dorota sobczyk , robert galazkowski , marcin slowik , and rafal drwila . the role of hypothermia coordinator : a case of hypothermic cardiac arrest treated with ecmo . high alt biol med 16:352 - 355 , 2015.we present a description of emergency medical rescue procedures in a patient suffering from severe hypothermia who was found in the babia gora mountain range ( poland ) . after diagnosing the symptoms of ii / iii stage hypothermia according to the swiss staging system , the mountain rescue service notified the coordinator from the severe accidental hypothermia center ( clhg ) coordinator in krakow and then kept in constant touch with him . in accordance with the protocol for managing such situations , the coordinator started the procedure for patients in severe hypothermia with the option of extracorporeal warming and secured access to a device for continuous mechanical chest compression . after reaching the hospital , extracorporeal warming with ecmo support in the arteriovenuous configuration was started . the total duration of circulatory arrest was 150 minutes . the rescue procedures were supervised by the coordinator , who was on 24-hour duty and was reached by means of an alarm phone . the task of the coordinator is to consult the management of hypothermia cases , use his knowledge and experience to help in the diagnosis and treatment . and if the need arises refer the patient for ecmo at clhg . good coordination , planning , predicting possible problems , and acting in accordance with the agreed procedures in the scheme , make it possible to shorten the time of reaching the destination hospital and implement effective treatment .

this could be partly because of the racial predilection as a large percentage of the population has curly hair and also may be due to local cultural customs which unlike the west do not encourage daily shaving of facial hair . twenty - four consecutive male patients presenting to a university health center over a 1 year period from january 2014 to january 2015 with a clinical diagnosis of pseudofolliculitis involving beard area and not on any active treatment for the same were included in the study . patient with other associated skin conditions which according to the investigators might affect clinical feature and/or management including , but not limited to , acne vulgaris , seborrheic dermatitis , rosacea , and other forms of folliculitis were excluded from the study . patient history with regards to shaving habits , patient hair type , morphological patterns of the skin lesions , and dermoscopic findings were recorded . dermoscopic images were shown to the patients and the condition and the principles of treatment were explained to them using the dermoscopic images . most of the patients had a usual shaving frequency of 2 or less per week . all the patients who were using razors mentioned that they tended to stretch the skin while shaving . the most common dermoscopic findings included - handle bar sign showing curved hair attached to the skin on both ends [ figure 1 ] , white areas ( possibly indicating fibrosis ) and scaling [ figure 2 ] , underlying linear bluish pigmentation ( indicating the buried hair shaft ) [ figure 3 ] , and linear vessels with occasional areas of hemorrhage [ figure 4 ] . aerobic culture of specimens taken from the skin lesions showed positivity for staphylococcus epidermidis in eight of the case . sign showing curved hair attached to the skin on both ends white areas ( possibly indicating fibrosis ) and scaling underlying linear bluish pigmentation ( indicating the buried hair shaft ) linear vessels with occasional areas of hemorrhage there are very few studies which have tried to elucidate the dermoscopic correlates of pseudofolliculitis barbae . the first case report was from chuh and zawar , who used dermoscopy to demonstrate the ingrown hairs and also suggested that showing the dermoscopy image to the patients can help them understand the condition better and thus help in achieving better compliance and treatment results . described a unique dermoscopic feature of pseudofolliculitis barbae in the form of a solitary gray - blue , thick curved line and adjacent red lines set upon a structure - less pattern . this pattern does not correspond to known dermoscopic entities such as basal cell carcinoma and seborrheic keratosis . according to the authors , the solitary gray - blue , thick curved line corresponds to the edge of the tightly coiled cluster of ingrown hairs in the dermis and the red lines could represent aberrant vessels secondary to the inflammatory reaction . the gray and blue colors could be explained by the tyndall effect due the melanin in the pigmented hair shaft in the dermis . puhan and sahu recently reported a case of pseudofolliculitis over the back of a patient . pseudofolliculitis corporis for this condition which in this case was most probably induced by the effect of friction due to a pillow which the patient used to put behind is back while driving . our study showed that the most common pattern seen in all cases was the curved hair attached at both ends what we would like to label as the handle bar . white areas with scaling , underlying linear bluish pigmentation ( indicating the buried hair shaft ) similar to that described by ladizinski et al . , and linear vessels with occasional areas of hemorrhage were the other common dermoscopic patterns seen in our cases . other studies have highlighted the predisposition of african race and curly hair to develop pseudofolliculitis . another study showed that the ala12thr polymorphism of keratin k6hf of hair follicle may be partially responsible for the phenotypic expression . the racial and genetic factors might be important for explaining the high incidence of pseudofolliculitis in the population of our study . while we did not do a formal evaluation as done by chuh and zawar to see if showing the dermoscopy images helped patient compliance , as done by us we feel that in general the patients had a clearer understand of the problem and the principles of treatment after they were shown the dermoscopy images . dermoscopy shows characteristic features and can be a useful adjunct for diagnosis in pseudofolliculitis . stretching the skin while using razors and growing the facial hair to a point where it has the length to curve might be important risk factors in the development of pseudofolliculitis .

background : pseudofolliculitis of the beard area is a very common dermatological problem in our geographical region . this could be partly because of the racial predilection as a large percentage of the population has curly hair and also may be due to local cultural customs , unlike the west do not encourage daily shaving of facial hair.objectives:we aimed to mainly study the dermoscopic features of cases presenting with pseudofolliculitis . secondary objectives included evaluating clinical patterns and possible etiological factors.methods:twenty-four consecutive male patients presenting to a university health center with a clinical diagnosis of pseudofolliculitis involving beard area were included in the study . patient history with regards to shaving habits , patient hair type , morphological patterns of the skin lesions , and dermoscopic findings were recorded.results:majority of the patients had curly hair . most of the patients had a usual shaving frequency of 2 or less per week . all the patients who were using razors mentioned that they tended to stretch the skin while shaving . the most common dermoscopic findings included - handle bar sign showing curved hair attached to the skin on both ends , white areas indicate fibrosis and scaling , underlying linear bluish pigmentation ( indicating the buried hair shaft ) , and linear vessels with occasional areas of hemorrhage.conclusion:dermoscopy can be a useful adjunct for diagnosis and patient counseling in pseudofolliculitis . stretching the skin while using razors and growing the facial hair to a point where it has the length to curve might be important risk factors in the development of pseudofolliculitis.limitations:the lack of histopathological correlation is the main limitation in our study .

idiopathic adulthood ductopenia ( iad ) was first proposed as a condition characterized by chronic cholestasis by ludwig et al . in 1988 . currently , the diagnosis of iad is considered with adult or adolescent onset , biochemical evidence of cholestatic liver disease , evidence of ductopenia by liver biopsy with normal cholangiography , and an unknown etiology . a diagnosis of iad requires exclusion of other conditions with chronic cholestasis that are associated with ductopenia [ 1 - 3 ] . to date , less than 100 cases have been reported in the medical literature , with only 1 prior case in korea . we report a case of idiopathic adulthood ductopenia with a brief review of the medical literature . a 19-year - old man who had abnormal liver function tests ( lfts ) was referred to the outpatient clinic . four years and 1 month earlier , abnormal lfts were detected repeatedly , but the patient remained asymptomatic . he had no history of neonatal or infantile liver disease , previous drug treatments , jaundice , itching , or abdominal pain . laboratory tests revealed the following findings : hemoglobin 14.5 g / dl , white blood count 7090/mm , platelets 376,000/mm , alanine aminotransferase ( alt ) 147 iu / l , aspartate aminotransferase ( ast ) 123 iu / l , alkaline phosphatase ( alp ) 1345 iu / l , -glutamyl transpeptidase ( ggt ) 576 iu / l , total bilirubin 0.9 mg / dl and albumin 4.0 g / dl . serum iron , transferrin saturation , ferritin , alpha 1-antitrypsin , and ceruloplasmin were normal . serological tests for anti - smooth muscle , anti - neutrophil - cytoplasm , anti - nuclear , anti - mitochondrial , anti - liver - kidney microsome antibodies , hepatitis b surface antigen , and hepatitis c virus serology were negative . an endoscopic retrograde cholangiopancreatography ( ercp ) demonstrated completely normal extrahepatic bile ducts and minimal irregularities of the intrahepatic bile ducts in the left lobe ( fig . mild chronic inflammatory infiltrates consisting primarily of lymphocytes and liver parenchymal spotty necrosis were also found ( fig . treatment was started with ursodeoxycholic acid at doses of 300 mg twice daily and changed to 200 mg twice daily with vitamins . iu / l ; alt , 64 iu / l ; ggt , 112 iu / l ; alp , 208 iu / l ; and total bilirubin 0.9 mg / dl ( fig . primary biliary cirrhosis ( pbc ) and primary sclerosing cholangitis ( psc ) are the most common causes of chronic progressive cholestasis in adults . however , a small number of patients who present with chronic cholestasis , lack anti - mitochondrial antibodies for pbc and have cholangiographic abnormalities consistent with psc . these groups of patients often are thought to have ama - negative pbc , small - duct psc , or idiopathic adulthood ductopenia . ludwig reported the causes of small duct biliary diseases in 2,082 cases diagnosed between 1988 and 1994 at the mayo clinic . while pbc and psc accounted for more than 90% of the cases with small duct biliary diseases , iad was present in only 1% of cases . in korea , only one case in 2004 , a 28-year - old woman who presented with pruritus and jaundice , has been reported . several possible causes have been suggested , including late onset nonsyndromic paucity of the intrahepatic bile ducts , small - duct psc without large duct involvement and without evidence of inflammatory bowel disease , nonsuppurative viral cholangitis , hepatitis c virus , and autoimmune cholangitis or cholangitis in autoimmune hepatitis , in the absence of typical autoantibodies . typically , iad is more common in males ( m : f , 1.8:1 ) , and it is usually diagnosed in young or middle - aged adults ( 15 - 77 years , median age : 34 years , 30 years for male , 36 years for female ) late onset nonsyndromic paucity of intrahepatic bile ducts usually is diagnosed in the teenage years and nonsuppurative viral cholangitis in adults more than 40 years of age . this case appears to belong to the late - onset nonsyndromic paucity of intrahepatic bile ducts , as abnormal lfts have been identified in teenagers . ductopenia is defined as the loss of interlobular and septal bile ducts of more than 50% among 20 or more portal tracts . approximately one - third of patients present with episodic jaundice and pruritus , which gradually worsens . in other patients , cholestasis progresses incessantly , although the rate of deterioration varies . iad related to autoimmune hepatitis or viral hepatitis requires specific treatments . in advanced cases , liver transplantation is the treatment of choice . in cases that are not severe , ursodeoxycholic acid ( udca ) can be used for treatment . a beneficial effect with the treatment of udca has been suggested , but its impact on the progression of the disease is unknown . the clinical outcome may be dependent on the cause of the disease and on the degree of ductopenia . most patients with a late - onset nonsyndromic paucity of the intrahepatic bile ducts and small - duct primary sclerosing cholangitis may have progressive disease , but this may be self - limited in patients with virus - related cholangitis and autoimmune cholangitis . typically , iad eventually progresses to end - stage liver disease . however , some patients with mild to moderate loss of intrahepatic bile ducts , less than 50% based on a liver biopsy , have a benign course . mild iad , also termed mild idiopathic biliary ductopenia , does not meet the current diagnostic criteria for iad as no cases have had ductopenia involving 50% of the portal tracts . our patient had only abnormal lfts without any symptoms , but had a ductopenia of more than 50% . iad is a progressive disease and our patient may have been diagnosed at an early stage . in conclusion , little is known about iad . iad is not a specific single entity but a syndrome associated with variable etiologies and variable clinical outcomes .

idiopathic adulthood ductopenia ( iad ) is a chronic cholestatic liver disease of unknown etiology characterized by adult onset , an absence of autoantibodies , inflammatory bowel disease , and a loss of interlobular bile ducts . in the present report , a case fulfilling the iad criteria is described . a 19-year - old man was admitted to the hospital for persistent elevation of transaminases and alkaline phosphatase without clinical symptoms . viral hepatitis markers and autoantibodies were absent . the patient had a normal extrahepatic biliary tree and had no evidence of inflammatory bowel disease . a liver biopsy specimen showed absence of interlobular bile ducts from 58% of the portal tracts . he was diagnosed with iad and was treated with ursodeoxycholic acid .

improvement in the standard of living and changes in diet have led to an increase in the prevalence of hypertension , arteriosclerosis , and diabetes mellitus . moreover , cerebrovascular diseases are the second - highest cause of death , followed by cancer , in korea1 . among the cerebrovascular diseases , the prognosis of stroke after the age of 65 years is usually poor , and more than 80% of patients experience neurological damage2 . the rate of disability that affects activities of daily living after a stroke , compared to other chronic diseases , is very high . long - term rehabilitation is necessary because of the loss of function in the upper and lower extremities , speech impairment , and cognitive disorders that accompany a stroke3 , 4 . with regard to the recovery of neurological motor functions after a stroke , patients show 80% and 95% recovery of the upper and lower extremity function within 3 months , respectively5 . despite intensive , long - term treatment , most stroke patients fail to show complete recovery of the function of their upper limbs6 , 7 . among the upper extremity functions , various treatments , including drugs and exercise , are available to enhance motor functions after a stroke . other methods include neurological physical therapy focusing on neurodevelopment therapy and proprioceptive neuromuscular facilitation , occupational therapy , ischemic nerve block , functional electrical stimulation , constraint - induced movement therapy9 , 10 , and robot - assisted therapy for upper limb rehabilitation11 . these treatment methods may speed up the recovery of patients upper limb functions but require long - term efforts , and continuous treatment may be difficult for various reasons . recent research suggests that transcranial direct current stimulation ( tdcs ) of the brain can improve physical functions in stroke patients12,13,14,15 . therefore , we investigated the effects of tdcs on the recovery of upper limb functions in stroke patients . the study included 24 patients with stroke diagnosed by a specialist at c hospital located in d metropolitan city who were receiving rehabilitation treatment for functional recovery . in all the participants , hemiplegic patients were composed of at least 6 months after the onset . participants with a history of stroke , with a personal or family history of epileptic seizure , who underwent implantation of an artificial cardiac pacemaker , or who showed severe upper extremity contracture and deformity were excluded , because participation of such patients was difficult . patients with hemiplegia who were diagnosed with a stroke were randomly assigned to either an experimental or a control group . data were collected from patients who agreed to participate after they fully understood the research procedures . all procedures were approved by the institutional review board committee of c national university hospital in the korea . fugl - meyer assessment ( fma ) was performed before the experiment for all the patients to determine the function of their upper limbs16 . the experimental group received tdcs and physical therapy , whereas the control group received only physical therapy . after 4 weeks , the fma was performed again , and the intervention was performed 5 times per week for 4 weeks . kolmogorov - smirnov single - sample test was performed to examine the general characteristics of the participants and the normality of each item . the data were analyzed with spss 18.0 spss inc , chicago , il , usa ) for windows , and the significance was set at p < 0.05 . with regard to shoulder function , the mean standard deviation ( sd ) fma scores were 22.44 5.64 before and 21.00 6.08 after the treatment in the control group , and they were 22.64 6.02 before and 26.82 4.92 after the treatment in the experimental group ; the changes were statistically significant ( p < 0.01 ) . the mean sd fma scores for the elbow joint were 5.00 3.74 before and 5.11 3.72 after the treatment in the control group , whereas they were 7.09 2.34 before and 8.45 1.92 after the treatment in the experimental group ; the changes were statistically significant ( p < 0.05 ) . in the control group , the mean sd fma scores for hand function were 8.44 5.22 before and 8.89 5.16 after the treatment . in the experimental group , the mean sd fma scores were 10.45 2.62 before and 12.45 2.16 after the treatment . the changes in both the groups were statistically significant ( p < 0.05)(table 1table 1.changes score of fma items in a stroke patients of before and after transcranial direct current stimulationgroupprepost(%)shoulderexperiment ( n=12)22.646.0226.824.92control ( n=12)22.445.6421.006.08elbowexperiment ( n=12)7.092.348.451.92control ( n=12)5.003.745.113.72handexperiment ( n=12)10.452.6212.452.16control ( n=12)8.445.228.895.16values are mean sd , * p<0.05 , * * p<0.01 . in this study , we applied tdcs , which activates the motor areas in the cerebral cortex , in combination with physical therapy for patients with a stroke and who experienced hemiplegia for 6 months . the changes in the fma scores for the shoulder joint , elbow joint , and hand functions were greater in the group that received tdcs than in the group that received only physical therapy . the fma is considered the best tool for the assessment of a patient s motor functions . park and choi17 reported that fma was more effective than other methods for the assessment of the recovery of upper extremity motor functions . in addition , a correlation between the effects of tdcs on upper extremity functions and fma scores was verified , and fma was found to be a valid method for the evaluation of upper limb functions . hummel et al.18 and harvey et al.19 applied tdcs for chronic stroke patients and observed that the extent of improvement in the motor function performance , including fma scores , was greater in the tdcs group than in the non - tdcs group . hummel et al.18 reported that tdcs applied for chronic stroke patients reduced the reaction time of the paretic hand and improved the pinch force . in the present study , the shoulder joint , elbow joint , and hand function scores in the experimental group increased significantly , and these findings support the findings of hummel et al18 . therefore , the results can not be generalized to all female patients with stroke . studies in a larger number of participants would generate results that are more meaningful . the validity of the study would also be improved by clarifying the criteria for the selection of participants . therefore , additional research needs to focus on elucidation of the association between changes in the motor areas in the cerebral cortex and improvement in muscle performance of the upper limbs .

[ purpose ] the purpose of this study was to examine the effects of transcranial direct current stimulation ( tdcs ) applied to the cerebral cortex motor area on the upper extremity functions of hemiplegic patients . [ subjects and methods ] twenty four patients with hemiplegia resulting from a stroke were divided into two groups : a tdcs group that received tdcs and physical therapy and a control group that received only physical therapy . a functional evaluation of the two groups was performed , and an electrophysiological evaluation was conducted before and after the experiment . statistical analyses were performed to verify differences before and after the experiment . all statistical significance levels were set at 0.05 . [ results ] the results showed that functional evaluation scores for the elbow joint and hand increased after the treatment in both the experimental group and the control group , and the increases were statistically significantly different . [ conclusion ] tdcs was effective in improving the upper extremity motor function of stroke patients . additional research is warranted on the usefulness of tdcs in the rehabilitation of stroke patients in the clinical field .

the family of mps one binder proteins ( mobs ) is highly conserved in eukaryotes . mobs represent signal transducers in essential intracellular signaling pathways through their regulatory interactions with serine / threonine protein kinases of the ndr / lats family [ 13 ] . in budding and fission yeast , mob1p and mob2p are crucial for mitotic exit and cell morphogenesis as regulators of the yeast ndr / lats kinases dbf2p , cbk1p , sid2p and orb6p , respectively [ 46 ] . in drosophila , three different mob proteins are expressed by independent genes , with dmob1 ( aka mats ) functioning as a core component of the hippo tumor suppressor pathway as regulator of the fly lats kinase warts [ 79 ] . drosophila mob2 ( dmob2 ) contributes to neuromuscular junction and photoreceptor morphology and the biological function(s ) of dmob3 is currently unknown , although all three dmobs can genetically interact with the fly ndr kinase tricornered . mammalian genomes contain at least six different mob genes termed mob1a , mob1b , mob2 , mob3a , mob3b and mob3c . mob1a / b likewise to dmob1 functions as a regulator of lats kinases in mammalian hippo signaling , although current evidence proposes that the interaction of mob1 with ndr kinases is likely to also play a role in hippo signaling . in contrast to mob1 , mob2 interacts specifically with ndr , but not with lats kinases in mammalian cells [ 1315 ] . mob3a / b / c neither form a complex with ndr nor lats kinases , but instead associate with the pro - apoptotic kinase mst1 ( aka stk4 ) . taken together , throughout the eukaryotic kingdom mobs can play diverse roles as regulators of members of the ndr / lats kinase family and apparently also other protein kinases in specific settings . in this article we will focus on discussing recent discoveries regarding roles of endogenous mob2 in cell cycle progression and the dna damage response ( ddr ) in the context ndr kinase signaling . up to recently , mammalian ndr kinases were the only reported binding partners of mob2 . more precisely , biochemical experiments showed that mob2 competes with mob1 for ndr binding , with the mob1/ndr complex corresponding to increased ndr kinase activity and the mob2/ndr complex being associated with diminished ndr activity . in other words , mob2 binding to ndr can block the activation of ndr kinases . however , the biological significance of mob2/ndr complex formation is currently unknown . actually , no clearly defined physiologically relevant functions of endogenous mob2 were known until recently . intriguingly , a genome wide screen for novel putative ddr factors identified mob2 ( also termed hcca2 and hmob3 ) as one of many potential candidates . considering that the ddr is essential to maintain genome stability and functions as a barrier for ageing and tumorigenesis , we investigated whether mob2 is indeed a ddr protein . intriguingly , we initially found that mob2 knockdown , but not mob2 overexpression , caused a cell proliferation defect associated with a g1/s cell cycle arrest in untransformed human cells . by profiling an array of cell cycle markers we discovered that mob2-depleted cells displayed a significant activation of the p53 and p21/cip1 cell cycle regulators , which was functionally relevant , since co - knockdown of p53 or p21 together with mob2 did not result in the activation of the g1/s cell cycle checkpoint , consequently restoring cell proliferation once we had established that mob2 knockdown causes the activation of a p53/p21-dependent g1/s cell cycle checkpoint , we wondered how this activation occurred . considering that endogenous mob2 is potentially linked to the ddr and that activation of the p53/p21 pathway can occur upon activation of ddr signaling [ 2022 ] , we studied the levels of ddr signaling and endogenous dna damage in mob2-depleted cells . these investigations revealed that mob2 knockdown causes the accumulation of dna damage , and consequently activation of the ddr kinases atm and chk2 , in the absence of exogenously induced dna damage . next , we aimed to consolidate these findings by studying the response of mob2 knockdown cells to exogenously induced dna damage . this showed that endogenous mob2 is needed to promote cell survival and g1/s cell cycle arrest upon exposure to dna damaging agents such as ionizing radiation ( ir ) or the topoisomerase ii poison doxorubicin . moreover , we discovered that mob2 is required to support ir - induced ddr signaling through the ddr kinase atm . collectively , these observations uncovered endogenous mob2 as a novel ddr factor that plays a role in ddr signaling , cell survival and cell cycle checkpoints upon exposure to dna damage . however , we still had not understood how mob2 may function as ddr protein on a molecular level . in this regard , using a yeast two - hybrid screen we had identified rad50 as a novel binding partner of mob2 , which potentially was important , since rad50 is a central component of the essential mre11-rad50-nbs1 ( mrn ) dna damage sensor complex , which in turn is crucial for the sequestering / activation of the ddr kinase atm at dna lesions [ 2325 ] . therefore , we examined this potential interaction in more detail , revealing that mob2/rad50 complex formation can be detected using exogenous and endogenous proteins . moreover , we found that mob2 supports the recruitment of mrn and activated atm to dna damaged chromatin , suggesting that mob2-depleted cells display a defective ddr due to impaired functionality of the mrn . although we could map the binding sites of mob2 on rad50 to two functionally relevant domains of rad50 , we did not succeed in identifying mob2 variants carrying single point mutations that block mob2/rad50 complex formation [ gomez v and hergovich a , unpublished observation ] , which would have enabled us to investigate the functional significance of the mob2/rad50 interaction in more detail . therefore , our study could not conclusively establish that the interaction of mob2 with rad50 is functionally essential for the roles of mob2 in ddr signaling , cell survival and cell cycle checkpoints upon exposure to dna damage . in this regard , it is noteworthy that in the genome wide screen performed by elledge et al . the knockdown of mrn components did not result in ddr defects ( as judged by sensitivity to mitomycin c and a defective g2/m dna damage checkpoint ) as observed in mob2-depleted transformed human cells . thus , the link of mob2 to the mrn does not appear to be relevant in all ddr settings , suggesting that additional mechanisms should be considered . in general , we have only begun to appreciate the cell biological functions of endogenous mob2 in processes that are relevant to human health and disease . in particular regarding the link of mob2 with the ddr , quite a few key questions are yet to be understood . for example , we have yet to comprehend which types of dna damage repair mechanism(s ) is dependent on normal mob2 levels . maybe the expression / localization status of mob2 has the potential to be clinically exploited for the prediction and/or prognosis of responses to dna damaging agents ( i.e. radiotherapy , dna damaging chemotherapeutics , targeted ddr inhibition , and others ) . furthermore , we have yet to obtain a clear mechanistic understanding of how mob2 can function as a ddr protein and how mob2 is regulated in a context - dependent manner . nevertheless , our previous biochemical characterization of mob2 in complex with the ndr1/2 kinases may be of help to lead some of the way . however , based on our own experiments we already speculated that mob2 apparently functions as cell cycle / ddr regulator independently of ndr1/2 kinase signaling . more specifically , we observed that knockdown of ndr1 ( aka stk38 ) or ndr2 ( stk38l ) in untransformed human cells did not trigger a p53/p21-dependent g1/s cell cycle arrest as observed in mob2-depleted cells . overexpression of hyperactive ndr1-pif also did not cause an obvious cell cycle / proliferation defect . however , we believe that further investigations are still required to completely rule out that ndr1/2 signaling is not linked to cell cycle / ddr processes through mob2 , since different reports have recently linked the ndr1/2 kinases to cell cycle and ddr signaling . in addition , compensatory mechanisms may occur upon selective ndr1 or ndr2 manipulations . in mammals , the ndr1/2 protein kinases have been linked to cell biological processes such as cell cycle progression , the ddr , apoptosis , stress signaling and autophagy , with important roles in embryogenesis , immunology and neurobiology . as mentioned above , in particular the connections of ndr1/2 with the cell cycle and ddr are intriguing with respect to mob2 ( figure 1 ) . on the one hand , ndr1/2 are linked to the regulation of g1/s cell cycle progression by controlling protein levels of c - myc and p21/cip1 [ 2932 ] . the role of ndr1/2 in the g1/s cell cycle progression is further supported by cyclin d1 and can have a role in opposing a tgf-mediated cell cycle arrest . thus , various tissue culture cell experiments support the notion that ndr1/2 can play diverse roles in the regulation of cell cycle progression . on the other hand , ndr1 possibly has a function in nucleotide excision repair , a specific type of dna damage repair . in addition , ndr1 potentially is involved in the dna damage induced g2/m cell cycle checkpoint by phosphorylating the cdc25a phosphatase , although this phosphorylation of cdc25a is also mediated by the ddr kinase chk1 , hence warranting future investigations into this possible link of ndr1 and the dna damage induced g2/m cell cycle checkpoint . taken together , current evidence suggests that the ndr1/2 kinase pathway is linked to the regulation of certain aspects of cell cycle progression and signal transduction in response to dna damage ( figure 1 ) . nevertheless , in spite of the involvement of ndr1/2 in the cell cycle and ddr in a similar fashion as observed for mob2 , it is currently unknown whether the mob2 and ndr1/2 pathways are functionally connected , as suggested by our recent biochemical evidence . in this regard , mob2 may act upstream of ndr1/2 by functioning as inhibitor of mob1-mediated ndr1/2 signaling . however , simply based on our current lack of evidence , we should not exclude the possibility that ndr1/2 may play a role upstream of mob2 , in which case it would be very informative to understand the involvement of the ndr1/2 kinase activity , in addition to the regulation of mob2 by ndr1/2 ( or vice versa ) through direct protein - protein interactions . in this regard , experimenters should also keep in mind that single ndr1 or ndr2 knockdown compared to co - depletion of ndr1 and ndr2 may result in different phenotypes due to possible compensatory mechanisms . more specifically , we found that single ndr1 or ndr2 knockout mice are viable and fertile due to compensatory tissue specific up regulation of ndr2 or ndr1 , respectively . in contrast these findings collectively suggest that ndr1 and ndr2 can compensate for each other in a context- and tissue - specific fashion . in case mob2 functions negatively upstream of ndr1/2 in ddr signaling , one would expect that mob2 knockdown or hyperactivation of ndr1/2 result in similar phenotypes , which does not seem to be the case . if ndr1/2 were to act upstream of mob2 in ddr signaling , one would predict that positive regulators of ndr1/2 , such as mob1 , may also contribute to the ddr . interestingly , this seems to be the case , since mob1a or mob1b knockdown appears to be sufficient to cause spontaneous dna double - strand break formation in human cells , proposing that the regulation of ndr1/2 by mob1 might also play a role in the ddr . however , whether ndr1/2 can function upstream of mob2 in cell cycle and/or ddr signaling is yet to be established experimentally . the possible involvement of mob1 in ndr1/2-mob2 signaling is also of purely speculative nature at the moment , in particular when considering that mob1 can associate with different kinases of the hippo core cassette such as lats1/2 and mst1/2 . in this context , we also would like to emphasis the fact that currently the molecular ( structural ) regulation of ndr1/2 kinases by mob1 vs. mob2 is incompletely understood . possibly , mob2 is part of positive and/or negative feedback loops that serve to amplify and/or dampen cell cycle and/or ddr signaling , respectively . certainly , these speculative points illustrate the need for more intensified experimental efforts to understand mob2 as a novel ddr protein on the structural , molecular , cellular and organismal level in the context of human biology in health and disease .

this article is the authors opinion of the roles of the signal transducer mps one binder 2 ( mob2 ) in the control of cell cycle progression and the dna damage response ( ddr ) . we recently found that endogenous mob2 is required to prevent the accumulation of endogenous dna damage in order to prevent the undesired , and possibly detrimental , activation of cell cycle checkpoints . in this regard , it is noteworthy that mob2 has been linked biochemically to the regulation of the ndr1/2 ( aka stk38/stk38l ) protein kinases , which themselves have functions at different steps of the cell cycle . therefore , we are speculating in this article about the possible connections of mob2 with ndr1/2 kinases in cell cycle and ddr signaling .

entamoeba histolytica is an enteric anaerobic protozoan parasite with about 50 million infections and over 100,000 deaths worldwide annually ( 14 ) . developing countries have the highest prevalence of amoebiasis because of human faeces have not been properly separated from food and water supplies . however , socio - economic factors , including poor education , poverty , overcrowding , and un - sanitary conditions are also involved in fecal - oral transmission ( 5 ) . the travellers to endemic areas with low standards of hygiene and sanitation are at risk ( 6 ) . the swimming pools are a potential source , although it has not been proved ( 7 ) . the cysts of e. histolytica are very resistant and can survive for several months in water with temperature of 0 c , 3 days at 30 c , 30 minutes at 45 c , 5 minutes at 50 c , and are extremely resistant to chlorination ( 8) . the genus entamoeba contains six species ( e. histolytica , e. dispar , e. moshkovskii , e. poleki , e. coli , and e. hartmanni ) in the human intestinal lumen ( 913 ) . e. moshkovskii is a free - living amoeba found in anoxic sediments ( 10 ) and e. dispar is considered as a commensal of the human gut . although e. histolytica is proved a pathogen , we still can not definitely determine that other two species do not cause diseases ( 11 , 12 ) . e. histolytica , e. dispar , and e. moshkovskii are morphologically similar , but have differences in genetic and biochemistry characteristics ( 913 ) . since these three species can not be differentiated by microscopy that is the most frequently used diagnostic method predominantly in tropical countries where resources are limited and can only be differentiated by the use of molecular methods such as the polymerase chain reaction based methodologies ( 1 , 9 , 14 ) . there are few studies on surface water contamination with entamoeba and the most studies have been done on fecal samples in epidemiological surveillance . in turkey two out of six water samples ( 32% ) collected from the ankara river were positive for e. histolytca by pcr ( 15 ) . based on a study in thailand , gram staining on water samples in mazandaran showed the contamination rate of e. histolytica and e. coli were 2.3% . and 0.7% , respectively ( 17 ) and mahmoudi et al . , detected acanthamoeba species in 14 out of 27 samples by pcr method in surface water of rasht , guilan , iran ( 18 ) . considering the high level of ground water in the northern parts of iran , the lack of adequate sanitation in rural areas , integration of surface water with domestic and industrial wastewater , especially in the rainy season , and also the fact that contaminated water is one of the transmission ways for e. histolytica , this study was conducted with the aim of determining surface water contamination with cysts of e. histolytica using pcr method in rasht city in this cross - sectional study , 49 water samples were randomly taken from 18 rivers and 6 wetlands from different regions near rasht city in autumn of 2012 . rasht city , in the southern of the caspian sea and capital of guilan province , is one of the wettest regions in iran , which can also be very humid . it is seven meters below sea level and 15 km inland from the anzali lagoon . the samples were collected from 30 cm depth in one - liter bulk and transferred to the laboratory in sterile containers . after centrifugation and filtration using 0.22 m nitrate cellulose membrane filters , the samples were examined and analysed using microscope in direct method . genomic dna of e. histolytica ( hm-1 : imss ) was kindly provided by dr . haghighi , department of parasitology , shahid beheshti university of medical sciences , tehran , iran . freeze - thaw method was used for lysing cysts wall before dna extraction . in the first phase , cysts were subjected to five freeze - and - thaw cycles to facilitate the breakage of cyst wall , followed by 2025 minutes of sonication ( 30-second pulse followed by 30-second rest ) electrical shock ( seven shocks every 15 s ) was given to cysts by sonificator system ( hielscher , germany ) . then , dna was extracted using a dna isolation kit ( dnp kit , cina gene , iran ) and phenol- chloroform extraction method . pcr primers were designed based on small - subunit rrna ( ribosomal rna ) of e. histolytica using invitrogen site . primers sequences were as follows : forward primer 5cccgagaatagaaaactctt3 and reverse primer 5tcaagtatagtgcaccatct 3. pcr amplifications were performed in a final volume of 25 l containing one - time pcr buffer 2.5 l , 1.5 mm mgcl2 0.8 l , 200 m of each dntp , 2 u taq dna polymerase ( takapoo zist , iran ) , 1 l of each primer ( 10 mm , takapoo zist ) and dna template 2.5 l(100200 ng ) . reactions were carried out in a thermocycler ( eppendorf , germany ) pcr system and set as follows : 35 cycles contain denaturation at 94 c , annealing at 43.5 c , extension at 72c , every stage for 30 s and finally the pcr products were analyzed on 1.8% agarose gel after electrophoresis . the sequencing was used on pcr product ( by pishgam co. , iran ) for controlling of the specificity of the result for e. histolytica . in microscopic examination , four samples of the 49 samples were positive for cysts of entamoeba ( histolytica / dispar / muschkovskii ) . these three species can not be differentiated by microscopy and can only be differentiated by the use of molecular methods . by using pcr method , one sample was positive for e. histolytica . just as we expected , in one sample in addition to positive control that was genomic dna of e. histolytica ( hm-1 : imss ) , had a band with 220 bp weight ( fig . 1 ) . pcr amplification of samples dna with the entamoeba histolytica specific primers lane m : molecular marker ( 100 bp ) ladders , c+ : positive control ( e. histolytica dna ) , c : negative control ( h2o ) , lane 1 : amplified product ( 220 bp ) indicating positive sample , lanes 24 : positive samples in microscopic examination that were not amplified by pcr . in molecular analysis and sequencing ( by pishgam co. , iran ) as shown in table 1 . , the gene sequence had 94% , 94% and 93% homology with 18s ribosomal rna(rrna ) , 5.8s rrna ( in plasmid ) and small - subunit 1 gene e. histolytica , respectively . the differentiation between the amoeba species is not possible using light microscopic methods and who has put emphasis on the need to develop improved techniques for the species - specific diagnosis of e. histolytica infection ( 3 ) . many epidemiological surveys on the prevalence of intestinal amoeba based on microscopic methods were performed in iran and almost all of them show a high prevalence of infection in different parts of iran . it is essential to note that the majority of them have not used molecular methods ( 1923 ) . the recently recognized distinction among the e. histolytica , e. dispar , and e. moshkovskii has led to some confusion in epidemiological studies of amoebiasis ( 24 ) . a study in stool samples by direct and formalin - ether concentration methods in iran proved the prevalence of infection with e. histolytica/ e. dispar was 0.78% , 3.9% and 4.6% for the central , northern and southern part of iran , respectively ( 21 ) . a molecular method for differential diagnosis of e. histolytica and e. dispar ( pcr - rflp method ) showed that in different regions of iran , 92.1% of the isolates were e. dispar and 7.9% were e. histolytica or mixed infections . in the northern areas , 5.9% and 94.1% of isolates were e. histolytica and e. dispar , respectively ( 20 ) . many studies using molecular methods confirm that e. histolytica is a rare species in iran and e. dispar is the predominant species ( 12 , 20 , 21 , 2430 ) . the only molecular study on amoeba in iran suggesting that e. histolytica as more prevalent than e. dispar , was conducted by pcr , where 10 of 11 positive samples in microscopic examination were e. histolytica and only one of them was e. dispar ( 31 ) water is a possible source for transmission of entamoeba to human host . cysts can survive for prolonged periods in the environment , because of the protection by their cell wall ( 32 , 33 ) . indicated that two out of six water samples ( 32% ) collected from the ankara river in turkey were positive for e. histolytca by pcr ( 15 ) . phuc et al . , suggested in northern of vietnam where livestock and domestic sewage are used in agriculture , infection with e. histolytica depends on hygiene - related behaviors and socio - economic factors ( 34 ) . in mazandaran ( iran ) by direct method and gram staining , 197(19.9% ) out of 989 samples were contaminated with parasites . from 197 parasitic contaminated samples , 53 cases ( 26.9% ) overall , 100 cases ( 50.8% ) were nonpathogenic and the contamination rate of e. coli was 0.7% ( 17 ) . furthermore , mahmoudi et al . , detected acanthamoeba species in 14 out of 27 samples by pcr method in surface water of rasht , guilan , iran ( 18 ) . in this study , by microscopic examination , four samples of surface water of rasht were positive for entamoeba , but we had not any suggestion about the species . by pcr method in these four samples , one sample was positive for e. histolytica . we had a positive control for e. histolytica , but had not any positive controls for e. dispar and e. moshkovskii , therefore could not identify the species of other three samples . for confirmation the result of pcr , we used sequencing on the pcr production . in sequencing , the gene sequence had 94% , 94% and 93% homology with 18s rrna , 5.8s rrna ( in plasmid ) and small - subunit 1 gene e. histolytica , respectively that is a confirmation for pcr examination . contamination by e. histolytica was proved in the surface water of rasht city and this is the first report of detection of e. histolytica in surface water in iran by molecular method . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors . the authors would like to express their special thanks to b. rezavand , school of medicine , baqiyatallah university , tehran , iran , dr . n. ranji , islamic azad university , rasht branch , rasht , iran and t. taheri , tehran kharazmi university , tehran , iran for support , helpful comments and editing on this manuscript .

background : this study was conducted with the aim of determining surface water contamination with cysts of entamoeba histolytica using pcr in rasht city , northern iran.methods : in this cross - sectional study , 49 water samples including 18 rivers and 6 wetlands were collected from different regions near the city of rasht in autumn of 2012 . after filtration using 0.22 m nitrate cellulose membrane filters , the samples were examined using microscope and pcr method.results : in microscopic examination , four samples of the 49 samples were positive for cysts of e. ( histolytica / dispar / muschkovskii ) . by using pcr method and molecular analysis , one sample was positive for e. histolytica.conclusion:in the molecular analysis , contamination by e. histolytica was proved in the waters of rasht city . further investigations including more samples and necessary preparations must be applied to prevent contamination .

perineal hernias following abdomino - perineal excision of rectum ( aper ) , requiring repair , have been reported to occur in < 1% [ 1 , 2 ] of people . patients may exhibit some perineal bulging following an increase in intra - abdominal pressure , but are rarely symptomatic and , therefore , do not require operative intervention . the literature to date has reported that perineal hernias occur primarily following aper ; however , there is very little data with regard to incidence and the management of perineal hernias . a 79-year - old gentleman who initially underwent a laparoscopic assisted extralevator abdomino - perineal excision ( elape ) of the rectum for extensive circumferential low rectal cancer after neo - adjuvant long course chemoradiotherapy developed a symptomatic perineal hernia . initial closure of the perineal wound was performed using a double layer of interrupted mattress sutures with a 2/0 absorbable braided suture . the patient 's only co - morbidity was intermittent asthma , for which he was prescribed a salbutamol inhaler . given the nature of the disease , it was felt that he would benefit from adjuvant chemotherapy . subsequent radiological surveillance did not show any evidence of recurrence and cea levels remained low . however , magnetic resonance imaging ( mri ) carried out at 19 months demonstrated that the small bowel had herniated through the levator sling and the patient had started to experience severe discomfort in the perineal region . repair of the defect was carried out in conjunction with the plastic surgery team , using a pedicled gracilis flap . again , despite an uneventful recovery , 5 months later the patient experienced lower abdominal pain and nausea and noted a distinct swelling of his left upper thigh . a repeat mri confirmed a further recurrence of the perineal hernia in the form of uncompromised bowel , which extended beneath the gracilis flap , which then continued into the adductor compartment of the left thigh ( fig . figure 1:(a and b ) coronal and transverse magnetic resonance imaging scans demonstrating perineal hernia extending into the left thigh . ( demonstrated by white arrows . ) ( a and b ) coronal and transverse magnetic resonance imaging scans demonstrating perineal hernia extending into the left thigh . given the recurrent nature of the hernia , a rectus flap repair was performed and after 15 months he remains hernia free . although the majority of patients after aper will demonstrate an element of perineal herniation , they do not exhibit any symptoms and , therefore , do not require operative repair . commonly reported symptoms secondary to perineal hernias include perineal discomfort , a dragging sensation , skin breakdown , urinary dysfunction , bowel obstruction and evisceration of pelvic contents [ 14 ] . given the paucity of available literature , it is difficult to identify definitive predisposing factors ; however , reported factors include smoking , chemoradiotherapy , sacrectomy / coccygectomy , excessive length of small bowel , lack of peritoneal closure and excision of the levators [ 1 , 2 , 4 ] . with conventional aper , involvement of circumferential resection margins ( crm ) has been identified to occur most commonly at the floor of the pelvis . the aim of elape is to reduce this crm positivity , along with rates of intra - operative perforation . tissue morphometry of elape specimens showed that this reduction in crm positivity occurs as a result of removing more tissue from around the tumour than standard aper , and thus improving rates of local recurrence and overall survival . despite these superior oncological outcomes , elape has also been associated with an increase in perineal wound complications , which may be attributed to the increased size of the perineal defect . there has been an increase in the uptake of laparoscopic aper in recent years , which may be attributed to an increase in the incidence of perineal hernias ; however , actual figures have not been reported . a possible reason is that a laparoscopic technique may result in fewer adhesions and thus less restriction of small bowel herniation . our patient had undergone both neo - adjuvant and adjuvant therapy , along with a laparoscopic elape . 's systematic review on the outcome of primary perineal reconstruction following elape demonstrated lower rates of perineal complications compared with primary closure . there has been debate surrounding reconstructive technique , but no significant differences in perineal complication rates have been demonstrated between biological mesh and myocutanous flap reconstruction . primary reconstruction using biological mesh may be preferable due to shorter operating times , absence of donor site morbidity and the option of operating independent of a plastic surgeon . however , the tendency for biological mesh to thin with time , leading to possible recurrence and the risk of infection , may make some opt for myocutanous flap reconstruction . cost benefits have been suggested when using a biological mesh over a rectus abdominis flap due to their association with a reduced length of post - operative stay . due to the variety of flap reconstructions reported and due to relatively low numbers in each study , preference is still yet to be determined . the use of a transabdominal technique allows of better visualisation of the defect and allows identification of tumour recurrence , while a transperineal approach minimises the potential risks associated with entering the peritoneal cavity . laparoscopic repair has been shown to have results comparable with those of open repair , but is dependent on patient selection ( body habitus , comorbidities , intraperitoneal adhesions ) . perineal hernia repair can be a challenging procedure , with a recurrence rate of up to 30% ; foster et al . demonstrated that primary reconstruction at the time of elape may be preferable to potentially prevent perineal hernias . presently , it is thought that a high - quality prospective trial is needed to help answer the many questions that arise between surgeons when discussing the management options for perineal hernias . repair after elape poses a significant challenge ; hence , further research is needed to determine the best method of managing and preventing this difficult complication . however , we advocate that management of the perineal defect at the time of initial surgery should be discussed and carried out with the input of the plastic surgeons .

symptomatic perineal hernias following abdomino - perineal excision of rectum have been reported to occur uncommonly . we present the case of a 79-year - old gentleman who developed a perineal hernia after laparoscopic - assisted extralevator abdomino - perineal excision ( elape ) of the rectum . despite initial myocutaneous flap repair , there was further symptomatic recurrence . magnetic resonance imaging demonstrated non - compromised bowel extending beneath the gracilis flap with extension into the adductor compartment of the left thigh . given the recurrent nature , a rectus flap repair was performed and after 15 months , he remains hernia free . there is currently no consensus as to the optimal operative technique in the prevention and management of these hernias ; however , primary reconstruction at the time of elape may be preferable . symptomatic perineal hernias can be severely debilitating and require operative repair . we suggest that surgical options should be discussed and carried out with the input of a plastic surgeon .

malignant transformation of a mature cystic teratoma is an uncommon complication occurring in approximately 1 - 3% of all mature cystic teratomas . although any of the constituent tissues of a teratoma has the potential to undergo malignant transformation , squamous cell carcinoma ( scc ) is the most commonly associated cancer . other tumors arising in a mature cystic teratoma include adenocarcinoma , thyroid carcinoma , malignant melanoma , transitional cell carcinoma , sarcoma , carcinoid tumor , and neuroectodermal tumor . malignant change is rarely recognized preoperatively , and no specific symptoms exist that would lead one to suspect malignant transformation developing from a mature cystic teratoma . because of its rarity , few reports exist of preoperative diagnosis of this tumor by magnetic resonance imaging ( mri ) , in particular fat - suppressed mri . we report mri findings from a very rare case with a malignant transformation comprising of an adenocarcinoma in a mature cystic teratoma , classified as clinical stage ia , and we briefly review the literature on early diagnosis . a 79-year - old multiparous woman ( gravida 2 , para 2 ) was referred to our hospital from a local hospital with a pelvic mass detected by ultrasonography . in the initial pelvic examination , an approximately fist - sized , hard , solid mass transvaginal ultrasonography revealed a 56 cm sized solid mass with cystic portions on the left ovary . the tumor marker levels was as follows ; carcinoembryonic antigen ( cea ) , 134.7 ng / ml ( reference range < 5.0 ng / ml ) ; ca-125 , 4.6 iu / ml ( reference range < 25 iu / ml ) ; ca 19 - 9 , 4.8 iu / ml ( reference range < 37.0 iu / ml ) . pelvic mri showed a 66 cm sized multiseptated solid - cystic mass with internal calcification and fatty component in the left ovary ( fig . the tumor had an obvious solid component that was relatively large and tended to be more solid . exploratory operation was planned with the provisional diagnosis of a malignant transformation of a mature cystic teratoma , based on the age of patient , high level of serum cea , and mri findings of a large solid component . in the laparotomy , a smooth - surfaced spherical , semisolid cystic tumor measuring 566 cm was found to originate from the left ovary . the left ovarian tumor contained mixed yellow sebaceous materials with hair tufts , and a solid , but necrotic , portion measuring 343 cm was found within the tumor . the frozen biopsy in the operation room , which is a routine procedure for ovarian teratomas in our hospital , disclosed an adenocarcinoma combined with benign cystic teratoma . a simple total hysterectomy , bilateral salpingo - oophorectomy , omentectomy , and pelvic lymphadenectomy were performed . the pathologic diagnosis was mucinous adenocarcinoma arising from a mature cystic teratoma of the left ovary . the cystic portion of the ovary consisted of well differentiated mucinous adenocarcinoma , which was initially associated with dermoid tissue mature cystic teratoma ( fig . 1c ) . the uterus and right ovary were normal , and metastases to the omentum and lymph nodes were not observed . from these findings , one month after the operation , cea level returned to normal levels ( 2.6 ng / ml ) . the most common sign of mature cystic teratoma with malignant transformation may be a pelvic mass without any specific symptoms . however , some clinical features of this event have been reported . first , this tumor is age related ; although the ages of patients with this tumor ranged from 21 to 87 years in the literature , this tumor occurs most frequently in postmenopausal women [ 3 - 5 ] . second , tumor size is an important factor contributing to a differential diagnosis between a malignant and mature cystic teratoma [ 3 - 5 ] . in report by kikkawa et al . , a scc developing from a mature cystic teratoma was significantly larger than a mature cystic teratoma , the mean size of 37 squamous cell carcinomas developing from mature cystic teratomas was 152.3 mm , and the cutoff size between benign and malignant tumors was 99 mm . on the other hand , the size of adenocarcinoma tumors varied from the smallest tumor size of 4 mm in diameter to 36 mm . these results reveal that tumor size is ineffective in contributing to the preoperative diagnosis of adenocarcinomas arising from mature cystic teratomas . measurement of serum tumor markers and imaging are two important tools in the differential diagnosis between benign and malignant ovarian tumors . our patient had a raised preoperative serum cea level , but not ca-125 and scc , similar to the findings in the previously reported case . ca 19 - 9 is known to be a good marker for mature cystic teratomas , and scc and cea have been reported as more useful than ca 19 - 9 or ca-125 in the diagnosis of malignant transformation of mature cystic teratoma . cea may be the most useful and scc was second in determining a differential diagnosis between a mature cystic teratoma and a scc developing from a mature cystic teratoma . the mature cystic teratoma is a tumor that can be easily diagnosed by imaging modalities such as plain radiography , ct and mri . most mature cystic teratomas show radiolucent shadows on plain radiography and significantly low density in ct because fat is usually contained within the tumor . with mri , mature cystic teratomas are seen with high signal intensities in both t1-weighed and t2-weighted images , and the presence of fat fluid levels or chemical shift artifacts are also useful findings in the diagnosis of a mature cystic teratoma ( fig . however , few reports exist regarding diagnosis of malignant transformations developing from a mature cystic teratoma with these imaging modalities . they observed solid portions in five of six tumors in mri , and solid portions in two tumors were enhanced by gadolinium to varying degrees . the presence of solid , friable , or variegated portions within the mature cystic teratoma is an important feature in the diagnosis of malignant transformation , and this tumor generally spreads by direct invasion and peritoneal implantation rather than by metastasis to the regional lymph nodes . in the present case ( fig . 1c ) , the diagnosis of mature cystic teratoma was easily made through unique mri findings with fat suppression techniques arising from the fat present within the tumor . the usefulness of mri with fat suppression techniques has also been reported in the diagnosis of mature cystic teratomas . to our knowledge , no other reports of mri with fat suppression techniques exist in the diagnosis of malignant transformation developing from a mature cystic teratoma . the gross appearance of mature cystic teratoma with malignant transformation has been reported to resemble that of cystic teratomas but tends to be more solid . we present an unusual case of mucinous adenocarcinoma arising from a mature cystic teratoma with high level of cea as the only clinical evidence . fat suppressed mri may be helpful in the diagnosis of mature cystic teratomas and its ' malignant transformation tend to have a relatively larger solid component . considering that malignant transformation is usually observed in postmenopausal women , the mere presence of a relatively large solid protuberance in such a patient should raise suspicions that malignant transformation may have occurred . serum tumor marker cea level and fat - suppressed mri may be helpful in evaluating whether mature cystic teratomas , even smaller than tumor size < 5 cm , have undergone malignant transformation .

the most common form of malignant transformation developing from a mature cystic teratoma is squamous cell carcinoma , representing 80% of malignant transformations , while adenocarcinoma accounts for approximately 5% . because of this rarity , few reports exist of preoperative diagnosis of this tumor by magnetic resonance imaging , in particular with fat suppression techniques . here , we report magnetic resonance imaging findings and clinical features of a 79-year - old woman with mucinous adenocarcinoma arising from a mature cystic teratoma ( measuring 56 cm ) , classified as surgical stage ia . because of the poor prognosis of malignant transformation , when mature cystic teratomas are detected ( even smaller than 5 cm tumor size ) in postmenopausal women , serum tumor marker carcinoembryonic antigen levels and fat - suppressed magnetic resonance imaging may be potential indicators of malignant transformation .

the term hemophagocytosis describes the pathologic finding of activated macrophages , engulfing erythrocytes , leukocytes , platelets , and their precursor cells . hlh is an unusual syndrome characterized by fever , splenomegaly , jaundice , and the pathologic finding of hemophagocytosis ( phagocytosis by macrophages of erythrocytes , leukocytes , platelets , and their precursors ) in bone marrow and other tissues . we report an adult patient who presented with systemic inflammatory response syndrome and features consistent with severe sepsis and septic shock , who subsequently received a diagnosis of secondary hlh . we reviewed the relationship between hlh and septic shock from the perspective of an intensivist . a 50 years female presented to intensive care unit ( icu ) with fever , rash , and loss of appetite . she was admitted in an outside hospital with 24 h of epigastric abdominal pain radiating to her flanks . there was no history of night sweats , weight loss , new medications , or toxin exposure . on admission , she presented with a temperature of 38.5c , a heart rate of 120/min , and an erythematous scaling rash covering over 50% of her body surface area , with increased scaling over her scalp . her abdomen was soft and nontender , with splenomegaly palpable 3 cm below the costal margin . there was no peripheral lymphadenopathy , and the rest of her physical exam was unremarkable . her initial blood work consisted of an elevated ferritin and lactic acid dehydrogenase ( ldh ) level , pancytopenia , acute kidney injury , hepatitis , and hypofibrinogenemia . broad - spectrum empirical antibiotics were administered for the presumed diagnosis of sepsis , but without apparent benefit . over a period of 24 days , she developed pressor - dependent hypotension , acute respiratory distress syndrome ( ards ) , acute kidney injury , bicytopenia ( anemia and thrombocytopenia ) , deranged liver functions ( transaminitis ) , and coagulopathy ; and increased inflammatory markers c - reactive protein and patent cooperation treaty . the clinical course in this patient met the criteria for severe sepsis and septic shock except in that it was unclear whether associated infections were causative . persistent fever , severe pancytopenia , hyperferritinemia , hypertriglyceridemia , increased ldh , and splenomegaly eventually prompted bone marrow aspiration ( bma ) leading to the diagnosis of hlh . no family history of hlh was found , and a primary familial form was considered unlikely . according to the computed tomography ( ct ) scan and bone marrow biopsy results , no hematological malignancy was thought to be responsible for a secondary form . despite an extensive multi - site sampling and serological studies , laboratory tests for viral infection including epstein - barr virus , cytomegalovirus , herpes simplex virus , viral hepatitis b and c , hiv were unremarkable . prolonged fever , splenomegaly , bicytopenia , hypofibrinogenemia , hyperferritinemia , and hypertriglyceridemia confirmed the diagnosis of hfs . the delay in diagnosis due to its rare incidence leads the patient to secondary sepsis in spite of aggressive and symptomatic treatment . hlh is a rare disease characterized by uncontrolled proliferation of mature histiocytes , hemophagocytosis , and up - regulation of inflammatory cytokines . the more typical findings are fever , peripheral cytopenia affecting two lineages at least , hepatosplenomegaly , hypertriglyceridemia and/or hypofibrinogenemia , and hemophagocytosis . recently , the histiocyte society updated its guidelines and proposed to add three diagnostic criteria : hyperferritinemia decreased or absent natural killer ( nk ) cell activity , and high soluble interleukin-2 receptor serum levels . they were present in our patient , who developed high persistent fever , severe pancytopenia , splenomegaly on abdominal ct scan , and very high plasma levels of ferritin , triglycerides , and ldh . the hlh-2004 diagnostic criteria considered the gold standard are largely based on studies of children with familial hlh . many of the criteria have poor operating characteristics when considered in the differential diagnosis of septic shock in adults . fever , anemia , thrombocytopenia , hypofibrinogenemia , and hypertriglyceridemia are common features of both syndromes . several studies show that hyperferritinemia consistent with hlh ( > 500 g / l ) occurs in the majority of adults with septic shock . the sensitivity of diagnostic criteria such as hypertriglyceridemia , hypofibrinogenemia , and splenomegaly may be no better than about 50% . the sensitivity of nk cell activity and soluble cd-25 levels approaches 100% , but these tests are not widely available . a strict requirement to fulfill five hlh-2004 diagnostic criteria in the adult patient in an icu could delay potentially lifesaving therapy . other available hlh-2004 criteria should be used in conjunction , with consideration of the limitations in their operating characteristics and logistics in the icu . in our opinion , hlh treatment should be considered in patients with the clinical syndrome of unremitting severe sepsis and/or septic shock with bicytopenia or pancytopenia , elevated ferritin levels , prompting for a bma , which will show histiocytic hemophagocytosis . therapy should be started in all cases with high suspicion after diagnostic tests have been initiated , but regardless of whether the results of all examinations have been obtained . among patients who are acutely ill or deteriorating , we suggest hlh - specific therapy based on the hlh-94 protocol or enrollment in a clinical trial rather than treatment based on the hlh-2004 protocol . hlh-94-based therapy includes etoposide and dexamethasone given at tapering doses over 8 weeks , with intrathecal methotrexate and hydrocortisone for those with central nervous system involvement . additional supportive measures include transfusion of blood products as indicated , induction of amenorrhea , and use of prophylactic antibiotics . the response to initial therapy is a major factor in determining the need for additional therapy including hematopoietic cell transplant . a short course of intravenous ( iv ) methylprednisolone ( 12 mg / kg / d ) is often sufficient in treating hs associated with secondary infections . this treatment is given in concert with adequate anti infectious agents , and it must be administered for the shortest time necessary for correction of the most life - threatening symptoms associated with hs because of the added immunosuppression in the context of severe infection . new antiviral drugs such as cidofovir or ribavirin and rituximab ( anti - cd20 antibody ) may be useful . consideration should be given to the use of iv immunoglobulin in infection - associated hs , to minimize the risk of immunosuppression . importantly , however , the initiation of hlh - specific therapy for severely ill patients should not be delayed while awaiting resolution of a system infection . clinicians are encouraged to enter patients in clinical trials such as the hybrid immunotherapy for hlh trial in the united states ( hit - hlh ; nct01104025 ) or the euro - hit - hlh trial in europe ( eudract201100205214 ) . further study of hlh , may provide important insights into the optimal treatment of sepsis , perhaps leading to the identification of a subset of patients with sepsis in which tissue damage secondary to a hyper inflammatory state might be ameliorated by immunosuppressive therapy .

hemophagocytic lymphohistiocytosis is a clinic pathologic entity characterized by increased proliferation and activation of benign macrophages with hemophagocytosis throughout the reticuloendothelial system . it is a potentially lethal disorder due to an uncontrolled immune response to a triggering agent . hps may be primary , or secondary to malignancy , infections , auto - immune diseases , and pharmacotherapy . hps is a rare , but life - threatening complication . herein , we described a female patient with hps with secondary sepsis . our objective was to raise the importance of early diagnosis of hfs by presenting a representative case .

accidents with a pneumatic nail gun , which has been used in the construction industry , have increased.2 ) however , reports on management of a patient with a nail gun injury to the cranium are rare . the authors report on a case of a patient treated with simple retraction after small skin and prophylactic antibiotic administration . a 56-year - old man had five nail gun - shots due to attempted suicide and was transferred to the emergency room . on his physical examination , his mental status was drowsy and there was no neurological deficit except for nails on his cranium . in his past history , there was no psychological background , however , he used to drink often and became depressed . on plain skull radiography , five nails were found ( figure 1a ) . among the five nails , two penetrated glabella . two nails were located in the right parietal bone and another was located in the left parietal bone . due to the head of the nail , the direction was confined to the outer table of the skull . in addition , a subarachnoid hemorrhage was observed on brain computed tomography ( ct)(figure 1b ) . all procedures were performed in the operating room under general anesthesia in order to treat the emergent condition as rapidly as possible . the nail head was located beneath the scalp and tightly attached to the skull , it was not visible from the outside . a small incision to advance a forceps and a rongeur was necessary , and , all nails were removed successfully ( figure 1c ) . during the period of conservative management antibiotics including vancomycin , ceftriaxone , and metronidazole were administered for two weeks and carbamazepine was administered for a week . conventional angiography was performed , and there was no vascular invasion or newly formed fistula ( figure 1d ) . head injury by pneumatic nail gun injury is rare , and there have been some case reports on management , treatment . according to lee and park,4 ) the speed of the launched nail and presence of the nail head are important determinants of the extent of nail gun related head injuries . if major artery or sinuses are not involved , extraction from the nail head could be the main treatment . ct is typically the first - line radiologic examination in the emergency room for head - injured patients . in general , ct shows excellent details in bone and average value in soft tissue . failure to recognize cerebral damage following penetrating brain injuries , especially when there is retained foreign body , can lead to serious life - threatening complications.1 ) in addition , because involvement of the large vessels is critical to determining the operative strategy , vascular integrity should be evaluated with ct angiography or ct enhanced image in the initial evaluation in the emergency room . in this case , nails were removed by a small scalp incision due to the fact that major artery or sinuses were not involved . if this is not the case , management would be direct ligation or vascular bypass surgery . despite many controversies regarding use of prophylactic antibiotics , the authors believe that broad spectrum antibiotics are appropriate for patients with penetrating brain injury since it is also recommended that antibiotics should be started as soon as possible.3 ) post - traumatic epilepsy is a major cause of disability and inadequate social integration . although there is no prospective study to indicate the efficacy of prophylactic anti - epileptic medication following a traumatic brain injury , it has been recommended that patients be covered for about the first week after injury with a medication such as phenytoin or carbamazepine.5 ) in the patient with head injury by pneumatic nail gun , the first evaluation should focus on the shape of the nail head and vascular integrity from simple x - ray and ct . if the nail head is confined to the depth of skull penetration , cautious extraction of the nail head can be performed without postoperative complication and early start of prophylactic antibiotics can be the next treatment .

a 56-year - old man had five nail gun - shots on his skull due to attempted suicide and was transferred to the emergency room . because the nail head played a role as a brake , the launched nail made a hole in the skull but did not entirely pass through it . if major artery or sinuses are not involved , cautious retrieval after a small scalp incision can be performed and prophylactic antibiotics be administered for treatment .

mother s breast milk is known to contain a variety of biologically active compounds , these include immunological growth factors , cytokines , hormones , oligosaccharides , antimicrobial peptides , enzymes , and immunoglobulins ( 1 ) . growth factors are such as epidermal growth factor ( egf ) , insulin - like growth factor - i ( igf - i ) , transforming growth factor ( tgf ) , and hepatocyte growth factor ( hgf ) ( 2 ) . the hormone igf-1 is a mediator of human growth hormone ( hgh ) and serves to stimulate bodily growth , regulates growth hormone independent anabolic reactions in many types of cells and tissues . igf-1 is an atypical peptide in that it is composed nearly 99% of bound proteins ( 3 ) . igf-1 uses specified cell receptors located on the cell membrane surface to accomplish many mitogenic cell functions that include the induction of cell growth , cell division , and differentiation ( 4 ) . igf-1 tends to initiate an anabolic effect , which increased the utilization of glucose and amino acids while inhibiting protein catabolysis ( 5 ) . since mothers with diabetes tend to suffer from perioidic hyperglycemia , this exposes their fetuses to high glucose levels causing fetal hyperglycemia that stimulates fetal growth and glycogen disposition encouraging macrosomia ( 6 ) . the goal of this research study seeks to determine the igf-1 levels in breast milk of mothers with diabetes and the blood serum of their newborn babies and to establish if their exists any relationship between these measures and the anthropometric measurements of diabetic mother s babies . mother s breast milk is known to contain a variety of biologically active compounds , these include immunological growth factors , cytokines , hormones , oligosaccharides , antimicrobial peptides , enzymes , and immunoglobulins ( 1 ) . growth factors are such as epidermal growth factor ( egf ) , insulin - like growth factor - i ( igf - i ) , transforming growth factor ( tgf ) , and hepatocyte growth factor ( hgf ) ( 2 ) . the hormone igf-1 is a mediator of human growth hormone ( hgh ) and serves to stimulate bodily growth , regulates growth hormone independent anabolic reactions in many types of cells and tissues . igf-1 is an atypical peptide in that it is composed nearly 99% of bound proteins ( 3 ) . igf-1 uses specified cell receptors located on the cell membrane surface to accomplish many mitogenic cell functions that include the induction of cell growth , cell division , and differentiation ( 4 ) . igf-1 tends to initiate an anabolic effect , which increased the utilization of glucose and amino acids while inhibiting protein catabolysis ( 5 ) . since mothers with diabetes tend to suffer from perioidic hyperglycemia , this exposes their fetuses to high glucose levels causing fetal hyperglycemia that stimulates fetal growth and glycogen disposition encouraging macrosomia ( 6 ) . the goal of this research study seeks to determine the igf-1 levels in breast milk of mothers with diabetes and the blood serum of their newborn babies and to establish if their exists any relationship between these measures and the anthropometric measurements of diabetic mother s babies . this prospective case - control study was conducted on 45 neonates and their mothers who were selected from among the neonates present at the nicu and outpatient clinic of neonatology at al minia university pediatric hospital during the period from may 2012 to may 2013 . the neonates and their mothers were divided into two groups : group i ( cases ) included 30 diabetic mothers and their infants , with a gestational age from 3740 weeks , group ii ( control ) included 15 non - diabetic healthy mothers and their infants with a gestational age from 3740 weeks . newborns having congenital anomalies , chromosomal disorders , perinatal asphyxia , sepsis , and whose mothers had disease complications during pregnancy all the newborns included in the study were subjected to a comprehensive medical history as well as taking complete medical examination including anthropometric measurement ( body weight , length , rohrer s neonatal ponderal index ( npi ) , skin fold thickness at triceps and subscapular areas , abdominal circumference , and head circumference ) were performed on the same day , using standardized equipment . three consecutive measurements were taken and when the differences between the readings were acceptable , then the mean was recorded . neonatal blood sample : under complete aseptic technique , 3 cc of venous blood withdrawn into plain tubes for clotting , centrifugation , and serum fractionation . these sera are collected in sterile tubes , then stored at 20 c until used , breast milk samples ( 10 ml ) were collected by a trained nurse from both breasts by manual expression before feeding and then frozen at 20 c within 24 hours or until used . the assay of the igf-1 : this was accomplished by using the enzyme - linked immuno - sorbent assay ( igf-1 600 elisa ) technique ( raybiotech inc . ) by awareness technology inc . chicago , illinois , usa ) using descriptive statistics , t - test , chi - square test , and the pearson product - moment correlation coefficient . the study group consisted of 30 infants and their diabetic mothers and the control group consisted of 15 healthy infants and their mothers . in this study , the infants of diabetic mothers ( idm s ) showed a highly significant increase in the mean of weight , neonatal ponderal index , abdominal circumference , head circumference , triceps skin fold thickness , and sub - scapular skin fold thickness ( p < alao , regarding the mode of delivery of the idms born by cesarean section ( cs ) significantly increased over the control group ( p < 0.001 ) ( table 1 ) . in addition , idms showed highly significant increases in the level of igf-1 in the blood serum as well as their mother s breast milk when compared to the control group ( p < 0.001 ) ( table 2 ) . there was a highly significant positive correlation between serum igf-1 and all anthropometric measures ( weight , head circumference , abdominal circumference , triceps skin fold thickness , sub - scapular skin fold thickness , npi ( p < 0.001 ) , and length ( p < 0.01 ) ( table 3 ) . also , there was a highly significant positive correlation between the milk igf-1 and all of the anthropometric measures ( weight , head circumference , abdominal circumference , triceps skin fold thickness , sub - scapular skin fold thickness , and npi ( p < 0.001 ) with the exception of length ( table 3 ) . insulin - like growth factor-1 ( igf-1 ) is a pleiotropic factor with a wide spectrum of actions in the central and peripheral nervous system ( 7 , 8) . it belongs to a superfamily of structurally related proteins that include insulin , igf-1 , and igf-2 . the biological functions of igf-1 are mediated by specific membrane receptors designated as igf-1 receptors . there are six igf - binding proteins ( igfbps ) , which modulate the bioavailability and receptor targeting of the igfs ( 9 ) . ( 10 ) demonstrated that igf-1 was present in mature and premature human milk samples , its levels were several - fold higher in colostrum than in mature milk and it tends to decrease over the first few days of lactation , they believed that igf-1 could be either synthesized by the mammary gland or transferred from the maternal circulation . additionally , sevigny et al . , ( 11 ) identified igf - binding proteins ( igfbps ) in the human milk of term and preterm infants and found that infants fed with artificial formula during the first months of life showed higher igf-1 levels than breast feeding ones . in the present study , diabetic mothers showed higher rates of performing cs when compared to the control group ( p < 0.0001 ) and this is in agreement with oussama et al . , ( 12 ) their findings suggested that high birth body mass or fetal macrosomia could be considered to be a typical complication of gdm and may be linked to negative maternal and newborn health factors that could include a tendency for maternal postpartum hemorrhaging , perineal tearing , and a greater chance for the need for cs . in the current study , idms showed a significantly higher mean weight , higher npi , greater abdominal circumference ( ac ) , greater triceps skin fold thickness ( tsft ) , greater sub - scapular skin fold thickness ( ssft ) , and head circumference ( hc ) when compared to the control group ( p < 0.001 ) , but there was no significant difference between the case and control groups with regards to neonatal length ( p > 0.05 ) ; this is in agreement with lauszus et al . they studied diabetic pregnancy and noted increases in all of the anthropometric measures in idm as compared to infants of non - diabetic mothers . in our study , idms showed a significantly higher mean serum igf-1 when compared to the control group ( p < 0.001 ) . this may be related to the pronounced metabolic disturbances characterized by hyperinsulinemia in these neonates , which was resulting from maternal hyperglycaemia , with this remaining in a negative correlation with igfbp-1 , intensifies igf-1 secretion , which results in higher concentrations of igf - i in infant serum . additionally , this high level of serum igf-1 may be due to the increased level of placental growth hormone ( gh ) found in serum of idms . ( 14 ) who found that mean levels of igf-1 were significantly higher in the cord blood of the offspring of mothers with gestational diabetes . studies done to investigate igf-1 in the breast milk of diabetic mothers were very scarce . in this study , we found that there was a highly significant increase in the mean maternal milk igf-1 when compared to the control group ( p < 0.001 ) . the breast milk of diabetic mothers has been shown to have a different composition from that of non - diabetic mothers , it may contain elevated levels of glucose and insulin as well as decreased polyunsaturated fatty acids and it is possible that this high level of insulin may elevate the level of igf-1 . also , maternal serum seems to be the primary source of milk igf-1 , so this leads to a high level of igf-1 in the breast milk of diabetic mothers . ( 15 ) who found that the igf-1 concentration in serum of the pregnant diabetic women was significantly higher in comparison with healthy pregnant women . it can be suspected that the observed increased concentrations of igf-1 in dm is a type of compensatory reaction to the increased insulin resistance and hyperinsulinemia , which increases the igf-1 secretion , resulting in a higher concentration of igf-1 in blood serum or manifesting a high level of igf-1 in maternal serum that may be due to a higher level of placental gh found in the serum of pregnant diabetic women , which is the main driver of igf-1 production . the present study found that serum igf-1 levels in idms was positively related to neonatal weight , length , npi , hc , ac , tsft and ssft ( p < 0.05 ) . it has been reported that igf-1 is an important modulator of growth hormone activity in linear growth . also , igf-1 plays a central role in the regulation of prenatal and postnatal growth and also exerts a growth modulating effect by decreasing apoptosis and increasing cell proliferation and angiogenesis so it may be said that igf-1 is positively related to macrosomia and increasing anthropometric measures in idm . this is in agreement with previous research studies ( 5 , 1619 ) that found that igf-1 in cord blood of idm was positively correlated to weight , length , hc , tsft , and ssft . all these findings were corroborated by the data , pointing to the fact that igf-1 plays an active role in the regulation of fetal growth . also , lindsay et al . ( 14 ) emphasized that igf-1 and igfbp-1 showed significant positive and negative correlations , respectively , with birth weight in all of the offspring of diabetic mothers . this study found that maternal milk igf-1 level in diabetic mothers was positively related to neonatal weight , npi , hc , ac , tsft , and ssft ( p < 0.001 ) , but had no significant relationship to neonatal length . igf-1 increased in the milk of diabetic mothers and the serum of their infants there is an association between intrauterine fetal growth and igf-1 in idms , as reflected by anthropometric measurements . there is evidence that the increased action of igf-1 is likely in the offspring of diabetic mothers and represents part of the mechanism of fetal overgrowth . further studies on larger scale are recommended to specify the exact effects of igf-1 on idms and further studies are recommended to clarify the exact level and role of igf-1 in the milk of diabetic mothers .

introductionsince research investigating igf-1 levels in breast milk are few , the goal of this study was to analyze the igf-1 levels in the breast milk of diabetic mothers as well as in the serum of their newborn babies and to identify what relationship exists between blood serum and igf-1 milk levels through patient measurement of mothers and their babies.methodsthis case control study was undertaken under the auspices of the clinic of neonatology at al minia university pediatric hospital over may 2012 through may 2013 . with a total of 30 diabetic mothers and their babies forming the experimental group and the control group consisting of 15 non - diabetic mothers and their babies . a detailed medical history , anthropometric assessments , as well as the measurement of the baby s serum igf-1 and their mother s breast milk igf-1 levels were taken from all participants using elsia . the resulting data were analyzed via statistical package for the social sciences ( spss ) version 16 and measurements of descriptive statistics , t - test , chi - square test , as well as the pearson correlation coefficient.resultsthe infants born to diabetic mothers ( idms ) demonstrated significantly greater anthropometric measurement . both the serum levels and the milk igf-1 levels as well as all of the physical measurements taken were found to have a positive correlation between the level of igf-1 in mother s milk and all of the anthropometric measurements studied with the exception of delivered baby s length.conclusionhigher levels of igf-1 are present in the milk of diabetic mothers and the blood serum of their babies and this characteristic could be used as a prenatal biomarker for macrosomia .

service learning enhances student learning and engagement in undergraduate biology courses ( 1 , 2 ) , but obtaining student buy - in can be frustrating . to alleviate this issue , i had students design their own service - learning projects in my senior - level undergraduate neurobiology course . by carefully guiding students through project design early in the semester , i was able to ensure students produced successful projects that increased their understanding of course material and benefited the community organizations . there is no lab , but the service - learning component gives students one additional hour of credit . based on mercer university s service - learning guidelines , students are required to spend at least 30 hours planning and carrying out the project . course enrollment is typically 16 to 24 students , and i have taught it twice as a service - learning class . on the first day of class , i defined service learning , provided ideas for possible projects , and asked students to brainstorm ideas . over the first two weeks , students shared ideas every day in class , and i encouraged them to talk to one another about their ideas outside of class . students divided themselves into groups of two to five ( depending on the needs of the project ) , based on interest and schedule . in week three , i met with each group to discuss the feasibility of the project . i encouraged them to make contact with their community partner immediately , and i facilitated these initial contacts when necessary . many students already had connections with their agencies , typically through volunteering or a service - learning project from another course . by four weeks into the semester , i asked each group to submit a project proposal . the proposals included a detailed description of the project , project goals and schedule , supplies needed , and a schedule of due dates for reflections ( see appendix 1 for project and proposal guidelines ) . students came up with a diversity of projects , most of which involved teaching neuroscience to a group in the community . most projects lasted five to six weeks ( usually weeks 712 of the semester ) , with one session per week of one to two hours . many chose to teach children , and projects included workshops for homeschoolers at the local museum of arts & sciences , at an after - school program for high school students , in several elementary and middle school classes , and at a rescue mission for homeless families . each group planned activities that demonstrated fundamental concepts in neuroscience that were appropriate for the age group they were teaching . their activities have included basic electrophysiological demonstrations of action potentials using spikerboxes from backyard brains ( https://backyardbrains.com/ ) , dissections of sheep brains , making models of brains and neurons , manipulation of the senses and discussions of the transduction of sensory stimuli , and watching and explaining videos of common neurological disorders . one group wanted to work with adults , and they chose to plan and lead two saturday morning workshops on neurodegenerative diseases at an assisted - living community . they presented the science underlying the most common neurodegenerative diseases , discussed new research on disease treatments , and led activities on nutrition and exercise . by the time groups began their projects ( approximately week 7 ) , students had a firm grasp of neuron function , synaptic transmission , and neuroanatomy , and we had begun discussing sensory and motor systems . as a result , they were ready to teach any of these topics . if a group proposed other topics , i met with them during their planning to ensure that they presented accurate information students wrote reflections after each visit . because the length and frequency of visits varied , i let each group decide on their due dates , as long as each reflection was turned in prior to the next visit . in their reflections , students wrote what they did , what they learned from their preparation and visit , and what they planned to do differently next time . as i read reflections , on the first day of class , i defined service learning , provided ideas for possible projects , and asked students to brainstorm ideas . over the first two weeks , students shared ideas every day in class , and i encouraged them to talk to one another about their ideas outside of class . students divided themselves into groups of two to five ( depending on the needs of the project ) , based on interest and schedule . in week three , i met with each group to discuss the feasibility of the project . i encouraged them to make contact with their community partner immediately , and i facilitated these initial contacts when necessary . many students already had connections with their agencies , typically through volunteering or a service - learning project from another course . by four weeks into the semester , i asked each group to submit a project proposal . the proposals included a detailed description of the project , project goals and schedule , supplies needed , and a schedule of due dates for reflections ( see appendix 1 for project and proposal guidelines ) . students came up with a diversity of projects , most of which involved teaching neuroscience to a group in the community . most projects lasted five to six weeks ( usually weeks 712 of the semester ) , with one session per week of one to two hours . many chose to teach children , and projects included workshops for homeschoolers at the local museum of arts & sciences , at an after - school program for high school students , in several elementary and middle school classes , and at a rescue mission for homeless families . each group planned activities that demonstrated fundamental concepts in neuroscience that were appropriate for the age group they were teaching . their activities have included basic electrophysiological demonstrations of action potentials using spikerboxes from backyard brains ( https://backyardbrains.com/ ) , dissections of sheep brains , making models of brains and neurons , manipulation of the senses and discussions of the transduction of sensory stimuli , and watching and explaining videos of common neurological disorders . one group wanted to work with adults , and they chose to plan and lead two saturday morning workshops on neurodegenerative diseases at an assisted - living community . they presented the science underlying the most common neurodegenerative diseases , discussed new research on disease treatments , and led activities on nutrition and exercise . by the time groups began their projects ( approximately week 7 ) , students had a firm grasp of neuron function , synaptic transmission , and neuroanatomy , and we had begun discussing sensory and motor systems . as a result , they were ready to teach any of these topics . if a group proposed other topics , i met with them during their planning to ensure that they presented accurate information , i let each group decide on their due dates , as long as each reflection was turned in prior to the next visit . in their reflections , students wrote what they did , what they learned from their preparation and visit , and what they planned to do differently next time . as i read reflections , i made sure each group member was participating and gave groups help when necessary . overall , students were very engaged in their projects , and i received very positive feedback from community partners . i tried to see each group in action once , and i was impressed by their enthusiasm when leading activities . students felt a greater sense of accountability for learning the material because they had to teach it to their audience and because they did not want to embarrass themselves in front of their group . coordinating and discussing service - learning projects took class time ( on average , 1530 minutes per week ) , which left less time for traditional lectures and in - class activities . however , i compared student performance on exams and papers between semesters in which i did and did not use service learning via unpaired t - tests . there were no significant differences in any of the measures , indicating that students learned course concepts just as well when service learning substituted for other activities . my students consistently made positive comments on service - learning evaluations ( also see fig . 1 ) : overall , i think the service - learning part of this class was way more beneficial to me than being in a lab each week . teaching someone else about the subject as i was learning helped me reinforce the information and retain it better overall . i feel like this is one of the most direct ways we can utilize the things that we learn in college instead of complaining how we ll never use any of the things we learned in college . the things that i learn today could spark the curiosity and minds of people who might grow up to find a cure for alzheimer s or parkinson s . 1 = strongly disagree , 2 = disagree , 3 = neutral , 4 = agree , 5 = strongly agree . because students selected and designed their own projects , they were very proud of themselves and took ownership of the projects . once students saw how much work it took to design the project and coordinate the logistics with the organization , they felt more accountability for preparing and being on time for each visit . one in particular had so much fun , despite her initial trepidation , that she planned and carried out an 11-week anatomy & physiology workshop at the museum . the disadvantages of giving students so much flexibility in their projects is that it requires a lot of coordination at the beginning of the semester to make sure that every student is finding a group and that groups are making plans . although these provided some initial frustrations , i never had a problem arise once the group wrote a strong proposal . the benefits of having students choose their projects and become fully engaged in them outweighed these minor annoyances .

one of the challenges in teaching a service - learning course is obtaining student buy - in from all students in the course . to circumvent this problem , i have let students in my undergraduate neurobiology course design their own service - learning projects at the beginning of the semester . although this can be chaotic because it requires last - minute planning , i have made it successful through facilitating student communication in the classroom , requiring thorough project proposals , meeting with students regularly , and monitoring group progress through written reflection papers . most of my students have strong opinions about the types of projects that they want to carry out , and many students have used connections that they have already made with local organizations . almost all projects that students have designed to this point involve teaching basic concepts of neurobiology to children of various ages while simultaneously sparking their interest in science . through taking ownership of the project and designing it such that it works well with their strengths , interests , and weekly schedule , students have become more engaged in service learning and view it as a valuable experience . despite some class time being shifted away from more traditional assignments , students have performed equally well in the course , and they are more eager to talk with others about course concepts . furthermore , the feedback that i have received from community partners has been excellent , and some students have maintained their work with the organizations .

myxomas are rare histologically benign tumors of mesenchymal origin , usually found in the heart . the left ventricle of the heart is the most frequent location , with the thigh and shoulder comprising other frequent soft tissue sites3 ) . these tumors are locally aggressive and can be recurrent if en bloc resection is not possible . primary intracranial myxoma with huge calcification arising from skull base is extremely rare and not well - described in the literature . small cases of intracranial myxoma have been recorded ( table 1)67811 ) . in this article , the histological and radiological findings as well as treatment options for a giant primary ossifying intracranial myxoma mimicking a chondrosarcoma will be briefly discussed , together with a review of the relevant literature . a-50-year - old man presented with spontaneous abrupt onset of headache and vomiting , as well as difficulty in standing because of dizziness . this was preceded by a month - long history of progressive hyposmia and feeling generally unwell . neurological examination revealed only right abducens nerve palsy without signs of other cranial nerve palsies or pyramidal signs . he had been referred to our hospital with a prediagnosis of huge intracranial bony neoplasm , such as osteochondrosarcoma . computed tomography ( ct ) studies revealed a well - defined low density mass lesion with huge dense calcification in both frontal lobe and right ethmoid sinus ( fig . magnetic resonance imaging ( mri ) scans revealed a giant neoplasm , 8.06.75.4 cm in size , a well - defined multi - lobulated cystic mass lesion with large popcorn - shaped dense calcifications on the frontal lobe and right ethmoid sinus . after gadolinium contrast enhancement , multifocal enhancing foci could be seen in the cystic mass ( fig . the patient underwent extensive resection of the mass via a right subfrontal and transcortical approach with both - sided frontotemporoparietal craniotomy . the mass was extradural but firmly attached to the dural surface at the frontal base with significant displacement of the falx . part of the right frontal dura was defected and appeared to contain tumor spreading from the frontal base . jelly - like neoplasms that appeared to be cystic radiologically were dissected and enucleated en bloc . the defective dura was repaired with galeal tissue to prevent cerebrospinal fluid ( csf ) rhinorrhea . the gross tumor was totally removed along with the adjacent dura except for the bony component inside right ethmoid sinus ( fig . 3 ) . grossly , the surgical pathology specimens consisted of glistening yellowish soft - to - solid tissue with a large amount of bone ( fig . microscopically , they had a myxoid appearance with focal yellowish spots and a fibrous membrane . immunohistochemically the tumor cells were positive for vimentin and negative for gfap , s-100 , ema , cd34 , and cytokeratin ( fig . 5 ) . the postoperative course was uneventful except for transient frontal lobe syndrome due to a frontal lobe hematoma of the left hemisphere . after three - month the patient returned to work and will be followed - up every 3 - 6 months by mri . they occur equally in males and females and at any age6 ) and in diverse organs including heart , skin , bone , and subcutaneous tissues . myxomas involving the bone of the base of the skull may originate from the primitive mesenchyme in the mastoid , sphenoid or ethmoid cells of embryos and newborns , and rare cases have been reported in the anterior cranial fossa69 ) . myxomas typically manifest as painless , very slow growing masses in soft tissues or bones , and they may go undetected for several years1 ) . if they involve the skull base , as in our case , they frequently develop the signs and symptoms of cranial nerve palsies by the time of diagnosis12 ) . myxomas and chondrogenic tumors usually arise from cartilaginous synchondroses at the skull base . unlike myxomas , chondrosarcomas are expansile , lobulated , soft tissue masses with endosteal bone resorption . in our case , the tumor was thought to be a chondrosarcoma radiologically . intraosseous meningiomas and intradiploic epidermoid cysts are rare but do occur , and should be kept in mind in differential diagnosis7 ) . radiological examination is a decisive tool in the diagnosis of myxoma . myxomas may be hypodense to isodense in ct scans , and show variable enhancement patterns11 ) , and bone window imaging reveals the degree of bony destruction and the expansile pattern of the mass . more extensive bony growth than bony destruction was observed in our case , but this is a rare finding in mxyoma . mri yields an intermediate or low signal intensity on t1-weighted images and a high signal intensity on t2-weighted images , and heterogeneous enhancement is a frequent finding212 ) . radiologically , chondrosarcoma , chordoma , metastatic tumors of the skull , meningioma and epidermoid cysts of the dura and skull base are frequently encountered in differential diagnoses6811 ) . histologically , myxomas consist of characteristic hypocellular areas of satellite and spindle cells with a mucoid intercellular substance . the spindle and stellate cells are fibroblasts and myofibroblasts , and absence of nuclear pleomorphism is typical . therefore , immunohistochemical staining can play a key role in differentiated diagnosis . characteristically , myxomas stain positively for vimentin and negatively for s-100 protein , neuron - specific enolase , neurofilaments , glial fibrillary acid protein , keratin15810 ) . the treatment of choice for primary intracranial myxomas is radical surgical removal because they are generally insensitive to radiation therapy148 ) . however , a huge primary myxoma of the skull base is still a very challenging tumor , and very difficult to remove totally from the cranial base bone . after gross total removal of such tumors , reconstruction of the cranial base is also a problem . when the bones of the skull base are infiltrated deeply or widely , en bloc total resection is generally impossible . even if it were feasible , the morbidity and mortality rate would be too high . in our case we opted for subtotal resection of the bony part of the tumor that had infiltrated the ethmoid sinus and it was removed by piecemeal resection , even though that approach was not very satisfying . however , zhang et al.13 ) reported one instance in which shrinkage of a myxoma of the skull base was seen at a seven month follow - up after gamma - knife stereoradiotherapy . total removal of a myxoma originating from a bone of the skull base may be impossible , and radiotherapy may be a salvage treatment , though definitive evidence is not available . recurrence is common , with 25% of tumors recurring if they can not be removed radically . recurrence has been noted as early as 3 months after surgical resection and as late as 10 years after surgical resection8 ) . we describe here a rare case of giant primary intracranial ossifying myxoma of the ethmoid sinus , review its histopathology , and emphasize that gross total resection , when possible , is the only definitive treatment .

myxomas are rare benign tumors that originate from mesenchymal tissue . they usually develop in the atrium of the heart , the skin , subcutaneous tissue , or bone . involvement of the skull base with an intracranial extension is very rare and not well - described in the literature . we report a rare case of primary intracranial ossifying myxoma arising from the anterior skull base and mimicking a huge chondrosarcoma , and we review the relevant literature .

patients with growth hormone ( gh ) deficiency who have a history of abnormal birth injury such as breech delivery occasionally show an atrophic anterior lobe of the pituitary gland , the formation of an ectopic posterior lobe at the median eminence , and a thin or absent pituitary stalk on brain magnetic resonance imaging ( mri ) ( 1 ) . gh insufficiency develops first , followed by insufficiencies of gonadotropins and thyroid stimulating hormone ( tsh ) during childhood , and finally adrenocorticotropic hormone ( acth ) insufficiency in later adulthood ( 2,3 ) . successful pregnancy in hypopituitarism is rare , given its association with an increased risk of pregnancy complications , such as abortion , anemia , pregnancy - induced hypertension , placental abruption , premature birth , and postpartum hemorrhage , as reviewed by du et al . gh replacement therapy ( ghrt ) is not officially licensed for use during pregnancy because of the lack of sufficient safety data . pregnant patients receiving ghrt are often concerned about whether or not they should stop ghrt , and most physicians have reported making a decision on whether or not to continue ghrt in agreement with the patient 's wish ( 6 ) . we herein describe the successful pregnancies and deliveries in a patient with evolving hypopituitarism due to pituitary stalk transection syndrome who partially continued gh , thyroid hormone , and glucocorticoid replacement therapy during pregnancy . a 31-year - old japanese woman visited our hospital because of adrenal insufficiency after her first delivery . she was born by breech delivery at 31 weeks ' gestation , weighing 1,040 g. at the age of 7 years , she presented with growth retardation and was diagnosed with gh deficiency using an insulin - induced hypoglycemia and arginine test . she did not visit our hospital for 5 years from age 15 until age 20 but returned to the department of obstetrics and gynecology because of primary amenorrhea . she succeeded in becoming pregnant after several inductions of ovulation and delivered a healthy male baby weighing 2,795 g , as described by fukuta et al . she received ghrt again 10 months after the first delivery from her primary care doctor ( table 1 ) . clinical course of hormonal data in a patient with evolving hypopituitarism at and after the first delivery . she was referred to the department of endocrinology and metabolism at our hospital by her primary care doctor because her laboratory tests showed adrenocortical insufficiency at 31 years of age . her free t4 was low despite levothyroxine replacement , and her adrenocortical function was diagnosed as mildly insufficient for the first time on the basis of her endocrinological data ( table 2 ) . a low dose of hydrocortisone ( 5 mg daily ) was added to levothyroxine ( 50 g daily ) and somatropin ( 0.45 mg daily ) . her ghrt was reduced to two - thirds of the pregestational dose ( 0.3 mg daily ) at 8 weeks ' gestation and discontinued at 26 weeks ' gestation . thyroxine was increased to 75 g daily after 8 weeks ' gestation and 100 g daily after 26 weeks ' gestation , so that the serum free t4 levels remained 0.7 - 1.1 ng / dl during pregnancy . we carefully followed her with monthly measurements of the serum levels of gh , insulin - like growth factor ( igf)-1 , acth , cortisol , and thyroid hormone during her second pregnancy , as shown in figure . her gh levels rose gradually after the second trimester , but the igf-1 levels were maintained until delivery . she had remained normotensive , and neither proteinuria nor glycosuria was observed during her second pregnancy . under spontaneous labor , she delivered a male baby weighing 3,320 g at a gestation of 40 weeks and 1 day . her serum gh and igf-1 levels fell rapidly three days after delivery , and so the ghrt was restarted . the latest follow - up showed that her two children aged 5 and 2 were both mentally and physically healthy . changes in the serum levels of igf-1 , gh , and cortisol , and in the plasma levels of acth during the second pregnancy and after delivery . an intact gh - igf1 axis is not always essential for normal fertility , but it has been claimed that gh deficiency leads to difficulties in conception and subfertility ( 8) . the role of gh supplementation in the prevention of fertilization problems or early gestational complications in gh - deficient women ( 8 - 10 ) should to be clarified . the efficacy and safety of ghrt during pregnancy is also a matter of debate ( 9 - 12 ) . during normal pregnancy , the pulsatile release of pituitary gh is progressively suppressed and replaced by a continuous secretion of placental gh . gh does not cross the placenta , and its effects on the fetus are probably indirect and mediated by maternal igf-1 production and actions on the substrate supply to the fetus ( 13 ) . therefore , it is justifiable to continue ghrt in women with definite gh deficiency at least until sufficient production of placental gh is achieved ( 14 ) . in the present case the proteinuria was observed at the late stage of third trimester in the first pregnancy but not in the second pregnancy , suggesting that proteinuria may not be an adverse effect of ghrt . very recently , vila et al . ( 6 ) reported the pregnancy outcomes in a large group of patients ( 173 women in 15 countries ) with gh deficiency and hypopituitarism . three different ghrt regimens were adapted : 1 ) ghrt stopped before or as soon as the pregnancy was confirmed , 2 ) ghrt partially continued and stopped at the end of the second trimester , and 3 ) ghrt continued throughout the pregnancy . the different regimens did not seem to influence the percentages of live births ( 80.5% in women who continued ghrt and 80.4% in women who stopped ghrt completely ) . they concluded that pregnancy outcomes and pregnancy complications , such as gestational diabetes , pre - eclampsia and pregnancy - associated hypertension , were not related to the ghrt patterns , method of conception , or number of additional pituitary hormone deficiencies ( 6 ) . we reported the successful pregnancies and deliveries in a patient with evolving hypopituitarism due to pituitary stalk transection syndrome who partially continued gh , thyroid hormone , and glucocorticoid replacement therapy during pregnancy . we hope this report encourages patients with hypopituitarism who wish to have a successful pregnancy and delivery , although the optimal management of hypopituitarism during pregnancy and delivery has not been determined yet . the clinical course of the present case was presented at the 87th annual meeting of the japan endocrine society in april , 2014 .

we herein report a 31-year - old japanese woman with evolving hypopituitarism due to pituitary stalk transection syndrome . she had a history of short stature treated with growth hormone ( gh ) in childhood and had hypothyroidism and primary amenorrhea at 20 years old . levothyroxine replacement and recombinant follicle stimulating hormone - human chorionic gonadotropin ( fsh - hcg ) therapy for ovulation induction were started . gh replacement therapy ( ghrt ) was resumed when she was 26 years old . she developed mild adrenocortical insufficiency at 31 years old . she succeeded in becoming pregnant and delivered twice . ghrt was partially continued during pregnancy and stopped at the end of the second trimester without any complications .

this malignancy is a public health burden in most industrialized countries and a most common cause of cancer - related deaths in the world ( 2 ) . the incidence and mortality rate of this cancer is increasing in iran and it is predicted that iranian population may be experiencing an acceleration of its burden in future ( 3 - 5 ) . a surgical resection is the only curative modality for localized colon cancer . it is the primary treatment modality for crc , and outcome is most closely related to the extent of disease at presentation . the location of the primary tumor may also have prognostic significance . for each stage , cancers arising at or below the peritoneal reflection ( rectosigmoid and rectum ) have a worse five - year survival rate than those arising more proximally ( 6 ) . furthermore , within the rectum , distal cancers have a worse prognosis than more proximal lesions . over the last 50 years , a gradual shift toward right - sided or proximal colon cancers has been observed ( 5 ) . the survival rates of crc vary throughout the world due to quality of care , including surgical techniques , which is a predictor of outcomes for local recurrence and cure rates ( 7 , 8) . crc that has metastasized , or spread , to the regional lymph nodes carries a worse prognosis and a higher risk for recurrence . studies showed that 15 to 30 percent of patients diagnosed with node - negative colorectal cancer experience disease recurrence within 2 - 5 years ( 9 , 10 ) . this high recurrence rate and a higher incidence of colorectal cancer in subjects at high risk of being crc , highlights a healthcare opportunity for surveillance or interventions to reduce the morbidity associated with crc ( 11 ) . the aim of this study was to evaluate the incidence of colorectal cancer recurrence and survival rate within 5 years , after being affected by this cancer , with considering the effects of other clinical and demographic factors . this was a historical cohort study in which all patients whose primary colorectal cancer were resected only by the one expert staff of colorectal surgeon or under his supervision and registered in the taleghani hospital , tehran , since 21st mar , 2004 to 20th mar , 2013 entered to the study . the necessary data such as demographic , age , gender , family history of crc , site and size of tumor , stage of tumor , operation details , histological results , treatment method , etc . had been extracted from medical records . all patients were followed for prognosis , mortality status and recurrence after the surgery ( by repeated periodic visits , colonoscopy and telephone contact ) . survival time was calculated from the date of surgery registration until death or the end of the study . due to protocol of crc management , for patients with stages ii - iii and some symptomatic stage iv , a colectomy ( surgical removal of the tumor and regional lymph nodes and nearby tissues ) were done and then chemotherapy based on 5-fluorouracil was offered to patients younger than 75 years with stage iii or iv colon cancer or complicated stage ii . postoperative chemoradiation was offered only to those with stage ii or stage iii of rectosigmoid cancer when the local clearance was in doubt and preoperative chemoradiation was given to those with fixed t4 lesions . chi - square test and kaplan meier analysis have been done to find the prognosis factors , associated to survival and recurrence . p values of less than 0.05 were considered statistically significant . all analysis carried out , using spss software , version 17 . a total of 107 patients ( 51.2% men ) who underwent resection for colorectal cancer during the study period , entered to this study . 23.4% of patients had positive family history of crc , and 53.8% were sporadic crc . the mean age was 53.50 12.68 years ( range 24 - 76 years ) , and the survival rate was 73.8% with mean survival time of 142.17 21.60 month . the recurrence rate after surgery was 5.7% and all of them were alive till the end of study . region of recurrences were : five patients ( 83.3% ) near to site of anastomosis or previous tumor and one patient exactly at site of anastomosis . the demographic and clinicopathological factors associated with survival time after surgery were presented in tables 1 and 2 . according to log - rank test , regional lymph nodes , distance metastasis and adjuvant therapy were the prognosis factors of survival in crc patients after surgery , respectively . patients with n1 regional ln , m0 level of metastasis and adjuvant therapy had higher survival . also , there was no significant association between type of surgery and risk of death in patients under study ( table 3 ) . the demographic and clinicopathological factors associated with risk of recurrence are presented in tables 4 and 5 . according to the results , this study revealed that , in patients who underwent resection for colorectal cancer , the survival rate is high and the recurrence rate was just 5.7% . the evaluation of post - surgical survival of colorectal cancer is necessary due to comparing results together and then reevaluates cause of differences ( kind of surgery , experience of surgeons , doing chemotherapy or chemo radiotherapy and its regimens , quality of post - surgical care and surveillance ) . there was no correlation between bmi and crc survival in this study , which is different from many similar previous researches ( 12 , 13 ) . no age and gender relationship were observed with survival of crc patients in this study , however some iranian studies indicated that colorectal cancer occurs at a younger age ( 14 ) . this statistics is better than other sites in iran and other countries ( 15 , 16 ) , and similar to some asian studies ( 17 ) , which could be due to improvement of exactness and expertise of surgeon or better adjuvant therapy or difference stages in the patients who were operated . however , the effectiveness of these treatments in the lower stages needs to be evaluated . the number of examined lymph nodes and distance metastasis statistically predicted the survival , which is similar to study that indicated the risk of death was higher in patients with distant metastasis ( 18 ) . tumor size , grade of tumor and some other clinical factors were not associated to survival , which is in contrast to western studies ( 19 ) . the incidence of crc is lower in iran compared to western countries ; however , its burden has been increasing in recent years ( 20 , 21 ) . in addition , five year survival rate of crc has been reported to be lower than the world ( 22 , 23 ) . it seems that among the prognostic factors explored so far , the most important are those that relate to early diagnosis of cancer . so , primary detection is feasible since efficient screening modalities are available ( 24 ) . due to limited data about survival and recurrence of colorectal cancer after surgery and its risk factors in different areas of iran , our study would be helpful to improving surveillance ( pre and post - surgical ) , survival and recurrence of crc and at least better managements and control of its risk factors . the evaluation of incidence and duration of colorectal cancer recurrence ( where site , stage at time of presentation and site of recurrence ) could conduct us to the better planning of post - surgical follow up , reevaluation of kind of surgery , adjuvant and neoadjuvant chemotherapy and chemoradiotherapy , in order to increase the survival of patients . the limitation of this study is low sample size of patients who underwent resection for colorectal cancer . it needs to conduct multicenter study in order to merge the patient s dataset and increase reliability of results for future researches in iran .

background : colorectal cancer ( crc ) is a common malignancyworldwide and its outcome is most closely related to the extent of disease at presentation . early diagnosis of an asymptomatic recurrence increases the likelihood of a complete surgical resection.objectives:the aim of this study was to evaluate the incidence of colorectal cancer recurrence and survival rate within 5 years , after surgery.patients and methods : during the 9-year period since 21st mar , 2004 to 20th mar , 2013 , patients whose primary colorectal cancer were resected in taleghani hospital , tehran , iran were selected in a historical cohort . the necessary data such as demographic , age , gender , family history of crc , site and size of tumor , stage of tumor , operation details , histological results , treatment method , histopathologic , etc . were collected . then the recurrence and survival of colorectal cancer within 5 years after operation and their risk factors were evaluated . p value less than 0.05 were considered significant . all analysis was done using spss software.results:a total of 107 patients underwent resection for colorectal cancer during the study period , with mean age of 53.50 12.68 years ( range 24 - 76 years ) , survival rate of 73.8% ( rectum 70.0% and colon 75.9% ) , and mean survival time of 142.17 21.60 month . the recurrence rate of crc patients , during five years after surgery was 5.7% . regional lymph nodes , distance metastasis and adjuvant therapy were significant prognosis factors of survival after surgery.conclusions:the rate of recurrence in iranian patients was low , which could be due to improvement of exactness and expertise of surgeons or better adjuvant therapy . the significant association between survival and adjuvant therapy clarifies this finding . early diagnosis and primary detection could increase the rate of survival .

it is not unusual to find medially retracted or foreshortened handle of malleus ( manubrium ) during tympanoplasty . apart from posing difficulties in placement of graft during underlay technique , it can affect orientation during surgery as the manubrium is one of the important landmarks in middle ear . sectioning of the tensor tympani tendon near the neck of malleus would lateralize the manubrium to a significant extent and add to mobility of malleus as well . have studied adult crania without clinical otitis and concluded that foreshortened malleus is an anatomic variant , not a sign of pathology . the current study aims at evaluating results of type i tympanoplasty for central perforations where manubrium was found foreshortened preoperatively or during surgery and the tensor tympani tendon ( tt ) was cut during surgery and comparing these results with those cases where manubrium was foreshortened and tt was kept intact . a total of 84 cases were included in the study with inclusion criteria being a dry central perforation where the manubrium of malleus was found to be medially rotated and touching the medial wall of the middle ear . cases with perforation size more than 4 mm ( measured by placing graph paper on the perforation ) are included . cases where all the three ossicles were intact and mobile and where a type i tympanoplasty was performed were included . cases with ossicular erosion or with cholesteatoma or with a marginal perforation were excluded . all subjects with mucosal chronic otitis media were clinically evaluated thoroughly including tuning fork tests and otoendoscopy done when ear is dry for more than 2 weeks . a pure tone audiogram was done for all the subjects . in some of them , a medially rotated malleus could be found during otoendoscopy ( figure 1 ) whereas , in many others , it was found during surgery . odd numbered patients were included in group a where tt was cut during surgery ( figure 2 ) . vascular strip incision was used for canal wall skin and after middle ear contents were observed and after necessary disease removal , malleus was carefully made free of all attachments from remnant of tympanic membrane ( tm ) . if the subject met the inclusion criteria , decision of sectioning of tt was taken if the patient is in group a and tt was kept intact in patients of group b. temporalis fascia was used as the graft material and kept lateral to the handle of malleus and medial to the annulus [ 2 , 3 ] . it was made sure during surgery that the annulus at the anterior canal wall is reposited back in the original position in the sulcus . plenty of gelfoam was kept in middle ear , around ossicles especially medial to manubrium and also in the external ear canal in all cases . cases were followed up regularly for the next 6 months minimum and audiometry results were recorded at 6 months postoperatively . the same amplaid a177 dual channel audiometer with standard calibration was used in all the cases to avoid errors . parameters compared include graft uptake , medialisation suggested by graft touching the medial wall of middle ear , lateralisation suggested by blunting of anterior angle , air bone gap ( abg ) at 6 months , and occurrence of squamous pearls . 42 patients were included in group a where manubrium was found medialised and tt was cut near the neck of malleus and 42 patients belonged to group b where tt was not cut . all patients were between 20 and 40 years of age and there were 29 males and 13 females in group a and 27 males and 15 females in group b. there were 40 patients in group a where graft was successfully taken up and 2 cases where there was residual perforation at 8 weeks and they required revision surgery . in group b , graft uptake was complete in 39 patients and in one patient there was a tiny residual anterior perforation that healed with conservative management and two patients required revision surgery . so graft uptake rate is 95.24% for group a and 92.86% for group b. medialisation was not seen in any patients in group a whereas 2 cases in group b developed graft medialisation where the neotympanic membrane was touching the promontory at 6 months postoperatively as evident on otoendoscopy . blunting of anterior angle was not seen in any of the patients in both groups . hearing thresholds at 500 hz , 1000 hz , and 2000 hz were considered for hearing evaluation . the average preop abg in group a was 35.60 db whereas in group b it was 36.76 db ( p = 0.264 ) . average postop abg in group a was 14.92 db and in group b was 19.88 db with statistically significant difference between the two groups ( p < 0.000001 ) ( supplementary material , available online at http://dx.doi.org/10.1155/2015/531296 ) . three cases in group a and 14 cases in group b had postoperative abg more than 20 db . none of the patients in both groups had bone conduction threshold more than 15 db suggestive of sensorineural hearing loss . average hearing gain in group a is 20.68 db whereas in group b it is 16.88 db . this shows clearly that hearing improvement in group a is significantly better than in group b. statistical analysis was performed with application of student 's t - test for the abg values . handle of malleus is longer than the long process of incus and this provides additional impedance matching function of middle ear and adds to improved conduction of sound through middle ear . when the handle is retracted severely , this should affect conduction of sound as well . have used autologous interposition of incus to overcome severely retracted handle of malleus and stated that patients presenting with com ( chronic otitis media ) , a ( central ) perforation , a medially rotated malleus , and intact ossicular chain are a treatment challenge . lateralizing the malleus handle may require disconnection of the ossicular chain and an autologous incus interposition to bring back the reconstructed tympanic membrane in its original position and improve the hearing . have concluded that the section of the tensor tympani muscle tendon in canal wall - down tympanoplasty with ossiculoplasty had no statistically significant influence on sound transmission and can be a safe maneuver in middle ear surgery . it is well known , and we can see it in our cases ; after cutting the tensor tympani tendon , the anterior tympanic membrane remnant becomes pleated , so we need to completely separate it from the manubrium . the manubrium will support the graft from medial side , so the chances of medialisation should also be reduced . by cutting the tensor this will also help the ossicles to move more freely and it should improve hearing as adequate volume of middle ear is an important consideration for successful conduction of sound . the current study aims to evaluate effect of sectioning the tensor tympani tendon in type i tympanoplasty surgery without mastoidectomy where the canal wall was preserved and the results are compared . table 2 shows comparison of graft uptake rates of different authors . graft uptake rates are adequate if tensor tympani is cut or preserved , whereas hearing improvements are better in patients where tensor tendon was cut and the difference is statistically significant . sectioning of tensor tympani tendon is safe and effective procedure during tympanoplasty if manubrium is severely retracted and it brings good improvement in hearing also .

the current study aims at observing effects of sacrificing the tensor tympani tendon when manubrium of malleus is foreshortened or retracted on graft uptake , hearing improvement , and occurrence of complications if any during type i tympanoplasty surgery for central perforations . 42 patients were included in group a where the tensor tendon was sectioned and 42 patients were included in group b where the tensor tympani tendon was retained and kept intact . graft uptake rates are very good in both groups but hearing improvement was found significantly better in group a than group b. no unusual or undesired complications were seen in any of the cases . sectioning of tensor tympani tendon is safe and effective procedure in cases where manubrium is foreshortened .

the delayed setting , there is often significant scarring , and traditionally these injuries have been repaired through a standard open surgical approach . however , the expansion of laparoscopic and robotic pelvic surgery suggests a role for minimally invasive approaches to the delayed repair of ureteral injuries . we present , to our knowledge , the first case of delayed robotic - assisted ureteral deligation and ureterolysis following iatrogenic ureteral injury occurring during a robotic abdominal hysterectomy . a 57-year - old female underwent a seemingly uncomplicated robotic - assisted total hysterectomy and bilateral oophorectomy for symptomatic fibroids . on postoperative day number 8 , she presented for her postoperative follow - up appointment with a complaint of persistent low back discomfort and right flank pain . the same day , a ct scan with iv contrast was obtained that demonstrated severe right - sided hydroureteronephrosis consistent with a high - grade obstruction ( figure 1 ) . she was admitted , and the following day ( postoperative day 9 ) , she was taken back to the operating room for further evaluation and management . a retrograde uretero - pyelogram demonstrated an abrupt cutoff of the right distal ureter consistent with suture ligation ( figure 2 ) . a ureteral stent was successfully placed , but the ureter remained severely medially deviated , and it was elected to definitively relieve the obstruction . the patient was explored , and the ureteral obstruction repaired via a less - invasive approach using robotic assistance . ct with iv contrast showing severe right - sided hydroureteronephrosis consistent with a high - grade obstruction . retrograde uretero - pyelogram demonstrating an abrupt cutoff of the right distal ureter consistent with suture ligation . a 4-port format was used with a 12-mm supraumbilical camera port , two 8-mm robotic ports each placed lateral to the medial umbilical ligaments and 19 cm from the pubic symphysis , and a 12-mm right lower quadrant assistant port . a penrose drain was placed encircling the ureter , and the ureter was dissected sharply towards the bladder . during this dissection , it became apparent that the right ureter had been incorporated into the running suture used to close the vaginal cuff . the suture was cut and the vaginal closure taken down in its entirety . after releasing the suture , the ureter appeared healthy but encased in inflammatory tissue that was excised . the vaginal cuff was re - closed with a running 30 vicryl secured with lapraty clips ( ethicon , cincinnati , oh ) . her ureteral stent was removed 3 weeks later . a follow - up lasix renal scan 3-months postoperatively demonstrated normal renal function bilaterally without evidence of obstruction . a 4-port format was used with a 12-mm supraumbilical camera port , two 8-mm robotic ports each placed lateral to the medial umbilical ligaments and 19 cm from the pubic symphysis , and a 12-mm right lower quadrant assistant port . a penrose drain was placed encircling the ureter , and the ureter was dissected sharply towards the bladder . during this dissection , it became apparent that the right ureter had been incorporated into the running suture used to close the vaginal cuff . the suture was cut and the vaginal closure taken down in its entirety . after releasing the suture , the ureter appeared healthy but encased in inflammatory tissue that was excised . the vaginal cuff was re - closed with a running 30 vicryl secured with lapraty clips ( ethicon , cincinnati , oh ) . her ureteral stent was removed 3 weeks later . a follow - up lasix renal scan 3-months postoperatively demonstrated normal renal function bilaterally without evidence of obstruction . in females , the ureter courses medially at the base of the broad ligament , traversing just below the uterine vessels and then enters the bladder posterolaterally approximately 2.3 cm from the lateral edge of the cervix . half of all ureteral injuries involve suture ligation , and the majority of ureteral injuries are not identified intraoperatively . the typical management of iatrogenic obstruction of the ureter that is recognized postoperatively involves initial stenting followed by delayed open ureterolysis , repair , ureteral reimplantation , or both . the role of robotic hysterectomy has been expanding rapidly , and iatrogenic ureteral ligation during robotic and laparoscopic gynecologic surgery has been reported . because these complications are rarely found intraoperatively , there is usually great reluctance on the part of the surgeon or patient , or both , to manage these complications robotically . despite this , there is a potential role for robotic surgery in the delayed management of iatrogenic ureteral obstruction . as the role of robotic - assisted surgery continues to expand , complications from minimally invasive urologic and gynecologic surgery can now be managed robotically as well . recent reports have shown that with robotic - assisted techniques , it is feasible to perform upper and lower urinary tract reconstruction with such procedures as ureteral reimplantation and ureteroureterostomy . it is logical that these same techniques can be used for the management of ureteral complications . our experience supports a role for robotic repair of iatrogenic ureteral obstruction due to suture ligation . this role can potentially be expanded to include the repair of other iatrogenic ureteral injuries . this can potentially preserve the advantages to the patient of the initial minimally invasive surgery .

background and objectives : ureteral injuries , while rare , do occur during gynecologic procedures . the expansion of laparoscopic and robotic pelvic surgical procedures increases the risk of ureteral injury from these procedures and suggests a role for minimally invasive approaches to the delayed repair of ureteral injuries . we present , to our knowledge , the first case of delayed robotic - assisted ureteral deligation and ureterolysis following iatrogenic ureteral injury occurring during a robotic abdominal hysterectomy.methods:we present a case report and review of the literature.results:a 57-year - old female underwent a seemingly uncomplicated robotic - assisted laparoscopic total abdominal hysterectomy and bilateral oophorectomy for symptomatic fibroids . on postoperative day 8 , she presented with persistent right flank pain . imaging studies revealed high - grade ureteral obstruction consistent with suture ligation of the right ureter . she underwent successful robotic - assisted ureteral deligation and ureterolysis . her postoperative course was unremarkable , and she was discharged home on postoperative day 1 from the deligation.conclusion:robotic-assisted management of complications from urologic or gynecologic surgery is technically feasible . this can potentially preserve the advantages to the patient that are being seen from the initial less - invasive surgery .

the middle aortic syndrome ( mas ) is an uncommon lesion characterized by severe aortic narrowing in the descending thoracic aorta , abdominal aorta , or both . takayasu 's arteritis is a chronic , autoimmune , and potentially progressive inflammatory disease of large vessels with a preference for the aorta and its major branches . there was no history of rash , abdominal pain , visual blurring , altered sensorium , convulsion urinary , or bowel complaints . birth history , developmental history , and past history were normal . on examination , she was afebrile with a heart rate of 106/min , respiratory rate of 24/min , and blood pressure of 180/110 mmhg ( > 95 percentile for age and sex ) . erythocyte sedimentation rate was 110 mm at the end of 1h ; serum electrolytes , renal and liver function tests , serum calcium , and serum phosphorous were normal . ultrasonographic examination of the abdomen revealed multiple necrotic mesenteric and retro - peritoneal lymph nodes with the largest being 1.7 1.1 cm . her blood pressure was gradually brought under control with oral nifedepine ( 0.5 mg / kg , 6 hourly ) , hydrallazine ( 6 mg / kg / day ) , and propranolol ( 0.5 mg / kg / dose , 6 hourly ) . in view of persistent hypertension , a computed tomography aortogram was done , which showed narrowing of the ostia of celiac , superior mesenteric artery , and bilateral renal arteries , with post - stenotic dilatation and intima - media thickening of the abdominal aorta [ figures 1 and 2 ] . as per eular ( european league against rheumatism)/pres ( paediatric rheumatology european society ) consensus criteria , the diagnosis of takayasu 's arteritis was confirmed as the child had angiographic abnormalities and hypertension . she was started on immunosuppressant therapy , i.e. oral prednisolone ( 2 mg / kg/ day ) and methotrexate ( 2.5 mg / kg / day twice weekly ) . in view of the strongly positive mantoux test , elevated esr , and abdominal lymphadenopathy , a diagnosis of abdominal tuberculosis was made and the child was started on anti - tuberculosis treatment . percutaneous transluminal balloon angioplasty was planned . however , due to financial constraints , she could not undergo surgery immediately and was discharged . on computed tomography angiography of the abdomen showing bilateral renal arteries severely narrowed at their ostia with post - stenotic dilatation . also the abdominal aorta shows increased intima and media thickness computed tomography angiography of the abdomen showing superior mesenteric artery narrowed at its origin with normal distal course . also seen is coeliac artery narrowed just beyond its origin with post - stenotic dilatation although the etiology of mas is not well known , congenital , inflammation , developmental disorder , and infection are thought to be some of the causes . the disease is an important cause of hypertension in children and young adults and is associated with a high morbidity and mortality . it typically presents as severe hypertension in young patients who have weak or absent femoral pulses and an abdominal or lower back bruit . renal artery stenosis is found in 80% of patients , and 25% have involvement of the superior mesenteric artery , inferior mesenteric artery , or celiac axis . mas has been described in takayasu arteritis , fibromuscular dysplasia , a number of genetic diseases , such as neurofibromatosis , mucopolysaccharidosis , williams syndrome , turner syndrome , alagille syndrome , and congenital rubella syndrome . in addition , irradiation of abdominal or retroperitoneal neoplasm early in life , particularly in the case of wilms tumor , has resulted in a similar angiographic appearance . the diagnosis of this rare syndrome is made by computed tomography , magnetic resonance imaging , or angiography . balloon angioplasty or autotransplantation for renal artery stenosis and stent implantation or bypass graft for stenosed aortic segments are the suggested therapeutic options in the treatment of middle aortic syndrome . staged vascular repair

the middle aortic syndrome ( mas ) is a rare condition characterized by diffuse narrowing of the descending thoracic aorta , abdominal aorta , or both . it can be congenital or acquired due to several conditions . we report an 8-year - old girl who developed middle aortic syndrome due to takayasu arteritis .

smoking tobacco not only predisposes to the development of disease , it increases disease severity and treatment failure rates . for these reasons , smoking cessation particularly benefits those patients who have smoking - related cancers such as head and neck or lung cancer and those who are diagnosed with curable disease . cigarette smoking and alcohol consumption are well - established risk factors for developing squamous cell carcinoma of the head and neck . furthermore , a number of studies have revealed an association between tobacco carcinogens and the molecular progression of squamous cell carcinoma of the head and neck . in countries with a high prevalence of smoking , furthermore , the increased incidence of lung cancer from smoking is proportional to the length and intensity of smoking history . smoking cessation before diagnosis reduces the risk of developing a primary tumour of all major histological types of lung carcinoma . prolonged tobacco smoking in cancer patients has many adverse effects during the oncology treatment plan as well . studies with head and neck and lung cancer patients demonstrate that tobacco smoking reduces survival time and increases the risk of a recurrence or a second primary tumor [ 4 , 5 ] . smoking also reduces the efficacy of radiotherapy in head and neck cancer patients , as smokers have a lower rate of complete response and poorer 2-year survival rate than nonsmokers and those who quit prior to treatment . tobacco smoking also exacerbates and prolongs radiotherapy induced complications such as mucositis , dry mouth , loss of taste , voice , impaired pulmonary function , wound healing , as well as tissue and bone necrosis [ 4 , 7 ] . despite these adverse health effects , 23% to 35% of head and neck cancer patients [ 5 , 810 ] and 13% to 20% of lung cancer patients who smoked prior to diagnosis continue to do so after diagnosis . comorbid conditions such as depression , disease - related anxiety , and alcohol abuse often make cessation challenging . the diagnosis of cancer allows an opportunity for patients to review and change their lifestyle habits [ 11 , 12 ] . the earliest descriptions of smoking cessation interventions in the health care setting are described in a summary report by schwartz . interventions may be hospital - based , community - based , or based on individual counseling . current smoking cessation interventions can be either pharmacological , nonpharmacological or a combination of both . examples of effective approaches include identifying tobacco use in patients , motivating them to quit and supporting them to quit through brochures and pamphlets , counseling , pharmacotherapy as well as regular followup . despite the substantial benefits of tobacco cessation in cancer patients , there is still a relative paucity of data on how to best achieve cessation in this population . the aim of our study was to systematically review the literature to summarize tobacco cessation interventions for cancer patients and the associated smoking cessation rates as a consequence of these interventions . this systematic review was performed in accordance with a predetermined protocol consisting of eligibility criteria , a search strategy , outcomes , and statistical analysis . our primary aim was to perform a pooled analysis of smoking cessation rates if appropriate . the literature was searched using ovid medline ( 1950 through november 2010 ) , embase ( 1980 to november 2010 ) , and the cochrane library ( cochrane database of systematic reviews ( 2010 issue 12 ) . relevant articles and abstracts were selected and reviewed , and the reference lists from these sources and recent review articles or meta - analyses were searched for additional publications . the literature search of the electronic databases combined disease specific keywords ( cancer , neoplasm , and malignancy ) with outcome specific keywords ( tobacco cessation , smoking cessation , nicotine cessation , quit rates , patient education , and patient intervention ) for the following study designs and publication types : retrospective studies , prospective cohort studies , randomized controlled trials ( rcts ) , systematic reviews , and meta - analyses . the literature search was not limited for study design or publication date to ensure all relevant published articles were captured . articles were included in the systematic review of the evidence if they were fully published reports or abstracts of randomized controlled trials ( rcts ) evaluating a tobacco smoking cessation intervention versus standard usual care in the adult smoking cancer population ( > 18 years of age ) . to be included , articles were excluded if they were published in a language other than english , did not discuss a tobacco cessation intervention , discussed nontobacco products without separation of data , or were in the pediatric population . relevant data was extracted from fully published reports by two independent review authors using prescribed tables . primary authors of included studies were contacted if further elaboration on data was needed [ 1 , 13 ] . where studies were duplicated , the larger data set was used for the analysis [ 13 , 18 ] . statistical calculations were performed using the statsdirect software ( chesire , uk ) . given that we analyzed prospectively gathered data from randomized trials , we calculated a pooled relative risk . the relative risk was a ratio of the risk of tobacco cessation in the intervention group versus the risk of tobacco cessation in the control group . the relative risks were calculated where data was available by intention - to - treat analysis . pooled relative risks were calculated using the rothman - boice type of mantel - haenszel method assuming fixed effects . the random - effects model of pooled relative risks was calculated using the dersimonian - laird method . the decision to use either a random effects model or a fixed effects model was based on calculation of heterogeneity of the data using an i calculation . where heterogeneity of the data was large , a random effects model was used . confidence intervals of the pooled relative risk were calculated using the greenland - robin variance formula . eight studies [ 1 , 4 , 11 , 13 , 17 , 2022 ] were narrowed down through the search ( figure 1 ) . all the studies identified were rcts in the adult smoking population which described a tobacco smoking cessation intervention and smoking cessation rates . all published studies ( table 1 ) were rcts , which were either single center [ 11 , 13 , 17 , 21 , 22 ] or multicenter [ 1 , 4 , 20 ] . the included studies did not show significant differences in baseline characteristics of mean age and gender distribution except in studies that included only head and neck patients [ 11 , 13 ] ( table 1 ) . interventions were nonpharmacological ( cognitive behavioral therapy , self - help material , education modules , motivational interviewing ) , or pharmacological ( nicotine replacement therapy or bupropion ) ( table 2 ) . all studies evaluated tobacco smoking . all the studies used self - reported rates of tobacco cessation . in addition , some studies used biochemical verification as well for smoking cessation . two of the studies used breath testing of carbon monoxide ( co ) [ 11 , 21 ] , two studies used urine cotinine levels [ 1 , 11 ] and two studies used saliva cotinine levels [ 13 , 17 ] where possible to confirm self - reported rates ( table 2 ) . cessation rates depending on randomization varied for each study at different followup times ( table 3 ) . the studies were evaluated in two groups , one group with a shorter followup time , mean of 5 weeks [ 13 , 17 , 22 ] and the other group had a longer followup time of at least 6 months [ 1 , 4 , 11 , 20 ] . in the second group , pooled rates were calculated from the 6 month abstinence rates in all studies except in one study which did not report a 6 month rate but only a 12 month rate . schnoll et al'.s study was excluded from the longer followup group and analysis due to a purely pharmacological intervention compared to the other studies in the other group which were combination interventions . for the purpose of pooling data , when we examined the shorter followup group , the pooled relative risk was calculated to be 1.16 ( 95% ci = 0.80 to 1.76 ) in the short followup group ( figure 2 ) . the longer followup group had a pooled relative risk of 1.19 ( 95% ci = 0.78 to 1.78 ) ( figure 3 ) . the pooled relative risk of the three most recent studies shows a result that is much more positive , with the relative risk achieving statistical significance . this pooled rate was calculated to be 1.42 ( 95% ci , 1.05 to 1.94 ) . when necessary , authors were contacted to provide additional data to ensure an accurate data set . the identified papers were methodologically sound with prospectively gathered data , randomized study populations , and suitable control groups . only one study looked at a purely pharmacological approach to tobacco cessation while three studies had only a nonpharmacological approach [ 1 , 13 , 17 ] . four studies [ 4 , 11 , 20 , 22 ] had a combination approach of nicotine replacement therapy , counseling and/or cognitive behavioral study . duffy et al . looked at the combination of cognitive behavioral therapy in addition to bupropion and nicotine replacement therapy . comparison of the confidence intervals of the calculated relative risks of the studies does not demonstrate a significant difference in tobacco smoking cessation rates between any of the different types of intervention . similar to other systematic reviews , our analysis comprised of a relatively high heterogeneity of treatments and patient groups . the studies were divided into two groups short followup time ( mean 5 weeks ) and longer followup time ( 6 months ) . while comparing the pooled relative risks of the two groups , it does not demonstrate a significant difference in the cessation rates despite the fact that a longer followup time would tend to represent better cessation rates . however , considering the shorter followup times , it is difficult to state whether at 6 months , this group would continue to have the same cessation rates . when we examined the longer followup group , four studies were included [ 1 , 4 , 11 , 20 ] . this study examined a group of 186 head and neck cancer patients and utilized a nonpharmacological counseling - based approach . if this original study is excluded from the analysis , this long - term followup group does appear to yield a statistically significant effect due to a multi - modal cessation intervention . notably , these other three studies [ 4 , 11 , 20 ] were performed in the most recent decade and examined 705 patients with diverse oncologic diagnoses . furthermore , these three studies all included a pharmacological approach in addition to nonpharmacological intervention . these differences may account for the reason that the pooling most recent studies reaches a statistically significant effect for smoking cessation intervention . in addition , the setting in which the cessation methods were offered are also different . some studies counseled patients on smoking cessation during a postoperative hospital admission , while other interventions were provided in the clinics . comparing the cessation rates of the individual studies does not demonstrate a significant difference in the cessation patterns based on setting . it is unlikely the self - reported rates would bias our review towards a negative result . when all studies are analyzed in the short and long - term , there was no statistical to a tobacco smoking cessation intervention in addition to usual care . however , when examining the effect of a multifaceted approach ( pharmacological and nonpharmacological ) to smoking cessation , the analysis suggested a more positive result . our review does not demonstrate a significant difference in tobacco smoking cessation rates through these interventions . the data does , however , suggest that the combination of both pharmacological and nonpharmacological approaches may be more successful at achieving tobacco cessation . collaboration within the health - care team is paramount in implementing a smoking cessation intervention . the significant benefits of tobacco cessation demand the oncology team continue to explore and investigate novel and known methods to help patients become tobacco - free .

background . tobacco smoking cessation interventions in the oncology population are an important part of comprehensive treatment plan . objectives . to evaluate through a systematic review smoking cessation interventions and cessation rates in cancer patients . search strategy . the literature was searched using medline , embase , and the cochrane library ( inception to november 2010 ) by three independent review authors . selection criteria . studies were included if tobacco smoking cessation interventions were evaluated and patients were randomized to usual care or an intervention . the primary outcome measure was cessation rates . data collection and analysis . two authors extracted data independently for each paper , with disagreements resolved by consensus . main results . the systematic review found eight rcts investigating smoking cessation interventions in the oncology patient population . pooled relative risks were calculated from two groups of rcts of smoking cessation interventions based on followup duration . in both groups , the pooled relative risk did not suggest a statistically significant improvement in tobacco cessation compared to usual care . conclusions . our review demonstrates that recent interventions in the last decade which are a combination of non - pharmacological and pharmacological approaches yield a statistically significant improvement in smoking cessation rates compared to usual care .

gastrointestinal stromal tumors ( gists ) , which arise primarily in the gut wall , are most commonly mesenchymal neoplasms closely related to the interstitial cells of cajal . gists typically carry gain - of - function mutations in genes encoding the kit receptor tyrosine kinase ( cd117 ) or platelet - derived growth factor receptor a , both of which are involved in cell survival , development and proliferation . although gists can arise at any location in the gastrointestinal tract , they are found most often in the stomach ( 60 - 70% ) , followed by the small intestine ( 20 - 30% ) , colon and rectum ( 5% ) , and esophagus ( < 5% ) . in most cases in the stomach , gists show the appearance of a submucosal tumor , with a broad base and smooth surface within normal gastric mucosa , and sometimes have central delle or depression . in larger cases , central ulceration or necrosis presenting with gastrointestinal bleeding the gist of the stomach described in this report was a rare case , with narrow stalk - like based , uneven protruding mass presenting with severe acute anemia despite small size . a 56-year - old woman was admitted to fujita health university with epigastric pain and nausea during the previous one month . laboratory evaluation on admission showed severe anemia ( red blood cell count 138 10/l , hemoglobin level 4.3 g / dl , hematocrit 13.7% ) ( table 1 ) . esophagogastroduodenoscopy revealed a narrow stalk - like based , hemorrhagic and uneven protruding lesion in the lesser curvature of the gastric upper corpus ( fig . 1 ) . endoscopic ultrasonography showed a low echoic mass , measuring 2.0 cm in diameter , within the fourth layer , suggesting that the tumor originated from the intrinsic muscle layer , and showed growth to the mucosal side ( fig . the labeling index ( li ) for mib-1 , determined by counting positively stained nuclei among 1,000 tumor cells , was 1% . although the histological findings suggested that the tumor was probably a benign gist , laparoscopy - assisted local resection was performed after 2 weeks because the patient had continuous severe anemia and epigastric pain . the resected tumor was 1.8 1.5 1.0 cm in size within the locally resected surgical speciemen . the tumor was elastic but hard in consistently , and its surface was uneven and irregular ( fig . the tumor cells originated from the intrinsic muscle layer and showed growth to the mucosal side , cropping out to the surface in most areas of the protruding lesion . histological assessment revealed that the tumor was composed of elongated spindle - like cells , containing rounded or oval , relatively uniform nuclei without apparent atypia ( fig . the li for mib-1 , determined by counting positively stained nuclei among 1,000 tumor cells , was about 1% ( fig . immunohistochemical staining of the tumor by the avidin - biotin peroxidase complex method showed that most of the tumor cells demonstrated immunoreactivity for kit ( fig . the tumor described in this report showed immunoreactivity for kit and cd34 , but not for asma , s100 and desmin , implying that the tumor was pathologically a gist with a lack of differentiation toward smooth muscle , and neural elements . most gists in the stomach generally show the appearance of submucosal tumors , with a broad base and smooth surface within normal gastric mucosa , and sometimes have small central delle or depression . in larger cases , central ulceration or necrosis presenting with gastrointestinal bleeding however , the gist of the stomach described in this report showed narrow stalk - like based , uneven protruding mass presenting with severe acute anemia despite the small size of less than 2 cm , and local resection was needed due to continuous severe anemia and epigastric pain . although the association between the patient 's gastric symptoms and this small submucosal tumor is not fully understood , the considerable amount of blood in the stomach due to continuous bleeding may have led to the gastric symptoms such as epigastric pain and nausea . histological assessment showed that the tumor cells showed growth to the mucosal side , cropping out to the surface in most areas of the protruding lesion , and only a small part of the tumor was within nontumoral gastric mucosa , despite the tumor cells originating from the intrinsic muscle layer . thus the case of our report may be a rare case for its morphological appearance as well as clinical course . metastasis and/or recurrence after surgery may be observed for several gists , despite an initial diagnosis of a benign tumor . therefore , it is recommended to apply risk classification based on tumor size and mitoic count under a hpf . the mib-1(ki-67 ) li or the presence or absence of tumor necrosis is also reported to reflect proliferation activities and malignant outcome . the gist described in our report was less than 2 cm in diameter without necrosis , and had low mitotic activity ( 0/50 hpf ) and li for mib-1 ( about 1% ) . in this context , our gist may have a very low malignant potential and thus metastasis and/or recurrence may not be observed in the future . actually , the patient in this report has been disease - free 18 months after surgery .

we report the case of a 56-year - old woman who had a gastrointestinal stromal tumor ( gist ) of the stomach . she was admitted to our hospital for epigastric pain , nausea , and severe acute anemia ( hemoglobin level 4.3 g / dl ) . esophagogastroduodenoscopy revealed a narrow stalk - like based , hemorrhagic and uneven protruding lesion in the lesser curvature of the gastric upper corpus . although the tumor was less than 2 cm in diameter and was probably a benign gist according to histology , laparoscopy - assisted local resection was needed because the patient had continuous severe anemia and epigastric pain . histological assessment showed that the elongated spindle - like tumor cells originated from the intrinsic muscle layer , and was shown with growth to the mucosal side , cropping out to the surface in most areas of the protruding lesion . only a small part of the tumor was within nontumoral gastric mucosa . most of the tumor cells demonstrated immunoreactivity for kit and cd34 in the cytoplasm but not for sma , s100 , and desmin . mitotic activity ( 0/50 high power field ) and the labeling index for mib-1 ( about 1% ) were low . the gist of the stomach described in this report was a rare case with a narrow stalk - like based , uneven protruding mass presenting with severe acute anemia despite small size .

according to who , one method to indicate fertility of a man is giving a semen sample of male and surveying it under the microscope . some important parameters are sperm concentration , motility , size , shape and so on . under the microscope lens , from a few to hundreds of sperms might be seen each time . not only counting and tracking hundreds of sperms by eye is time consuming , but also visual problems and fatigue can affect negatively on result . approximately from two decades ago casa ( computer assisted semen analysis ) systems are designed to help doctors in measurement of many important determinant parameters in male fertility . for instance , sqa - v system also known as the sperm quality analyzer is used to be a high performance analyzer . the isas also known as proiser is one of the most complete and easiest to use systems in the market . however , respect to commercial interests , no company or group has proposed its method openly . in this paper , we proposed an algorithm to provide information of sperm concentration parameter . this algorithm counts number of sperms of semen sample in the video frames or images which are captured by a microscopic video camera . in the fertility laboratory microscopes provides the facility to attach a camera on it . the camera is connected to a computer and there are some software that show what is seen under the microscope and able to capture a video of it . in this work e.g. according to fig 4 , firstly , tails are not transparent enough to be helpful . secondly , zoom is not small enough not to show many undesired cells . but if algorithm is strong enough to work on 20x zoom frames , it will be useful in wide range of aspects of casa systems . we firstly filter the noise of the image then apply some morphological operations on the relevant image to prepare it for next step . we apply an ellipse detection algorithm which is faster and more effective than hough transform to segment sperms . sum of the segmented sperms is what we want to find out as the sperm concentration . firstly the image which is a frame of captured video by the camera is read , read image is in rgb format but colored image is not useful but redundant in this application , so it is converted to the grayscale . actually the noise which causes this pattern is called periodic noise . in this kind of noise , one or some high amplitude frequencies cause an undesired ordered pattern in image . using band reject filters is the best way to remove this rather constant frequency noise . part of captured frame . stripped white lines are caused by noise in this work , we just want to remove this noise by computer programming and there is no intend to make a real filter . image frame after filtering next step is detecting sperms . however first of all , captured frame from semen contains sperms and some other cells such as bacteria , leukocyte , epithelial cells , etc . second of all , image is captured with 20x optical zoom , so tails of sperms are not observable perfectly and it ca nt help . so , the algorithm should detect the head of sperms and be able to distinguish them from other cells . in image , it is rather impossible to distinguish sperms from other cells by considering just one of these specifications , because you may find other cells with the same size . in some cases , other cells may be same in form , since all sperms do not have exactly the same shape . although some sperm 's heads are so intense , there are some cases which they are as intense as other cells . however using combination of these characteristics we managed to introduce an accurate sperm detection algorithm . . the threshold should be exactly a little bit less than lowest intensity of available spermatozoa 's heads and is determined according to the model of the camera . each camera has its own least intensity and its threshold is fixed and determined by trial and error . so , the camera should be known for the software or its information should be given to the software . by converting the image to binary format , many cells which are not sperm and some sperms which are poorly visible in the focus level disappear . this method deletes the shapes which structuring element ca nt be completely part of it . accordingly , by choosing a structuring element smaller than spermatozoa 's heads , we are able to delete smaller cells without changing sperm 's shapes . if the shape is not chosen correctly , it may affects on shape of remained heads . 4 is the image after closing binary image after closing after deleting some other cells by converting the image to binary format and closing , we use shape characteristics to detect sperms and in uncertain situations , intensity or other characteristics participates . although heads of spermatozoa appear in variety forms , all of them are approximately ellipse , thus , it is rational to use an ellipse detection algorithm to detect sperms . as mentioned above , sperms do not have same form and are not completely ellipse , so the ellipse detection algorithm should be fault tolerant . in an ellipse detection method this method takes the advantage of major axis of an ellipse to find ellipse parameters quickly and effectively . this method does not require the evaluation of the targets or curvatures of the edge contours which are generally very sensitive to noisy working conditions . it has no complicated mathematical computation and requires low memory space , so that is not time consuming . . however , the method needed to be changed to be convenient to our problem . first , it just could detect shapes which were absolutely ellipse , but in our case no object is completely ellipse . second , the method in accepts the first detected ellipse but in this work all possible choices for each object are surveyed and the best one by considering a tradeoff between determinant parameters will be chosen . the algorithm firstly finds the edges of each object , then labels them , and then sees if each object is a sperm head . procedure of accepting each object as a sperm contains three steps : step one : compute area of each object step 2 : select tow pixels of object as major axis of an ellipse . step 3 : find an appropriate minor axis to have an ellipse looks like the object . if this minor axis found save it and go to step two to find a better corresponding ellipse else just go back to step two and choose another pair . algorithm firstly computes the area of each object . if the area has correct size , algorithm will to step two . in step two , algorithm checks if the line between two pixels could be a candidate for major axis of an ellipse like ( x1 , y1 ) and ( x2 , y2 ) in fig . 8 . if the answer is no , another pair is chosen . if the answer is yes algorithm goes to step three . in step three , for all other edge pixels of object , the algorithm checks how long the minor axis should be to have this pixel on the ellipse , according to two selected points in previous step . to make this we first compute the parameters of the ellipse . according to , for each pair of pixels ( x1 , y1 ) and ( x2 , y2 ) , we assumed they are two vertices on the major axis of an ellipse . by choosing the third edge pixel as ( x , y ) in fig . 8 we can calculate four parameters for the assumed ellipse as following : x0=(x1+x2)/2 ( 1 ) y0=(y1+y2)/2 ( 2 ) a=[(x1-x2)+(y1+y2)]/2 ( 3 ) =atan[(y2-y1)/(x2-x1 ) ] ( 4 ) where ( x0 , y0 ) is the center of the assumed ellipse , a is the half - length of the major axis and is the orientation of the ellipse . fig . 6 shows ellipse geometry . f1 and f2 are foci of the ellipse and ( x , y ) is the third point used to calculate the fifth parameter . the distance between ( x , y ) and ( x0 , y0 ) should be less than the distance between ( x1 , y1 ) and ( x0 , y0 ) or between ( x2 , y2 ) and ( x0 , y0 ) . so the half - length of the minor axis can be estimated by the following equation : b= ( adsin ) / ( a- d cos ) ( 5 ) cos = ( a+d f)/(2ad ) ( 6 ) and d in the distance between ( x , y ) and ( x0 , y0 ) . after finding the minor axis for three selected points , without changing the major axis we chose another edge pixel as the third point and find its appropriate minor axis . after doing this for all other pixels , we know that , which pixels has approximately same minor axis size . in other words for each minor axis length how many object 's pixels are on the ellipse . appropriate minor axis should be in proportion to major axis and ellipse which is created according to this minor length should have enough intersections to the object . pointers show the head of major axis of an ellipse is intersected in several places by object . if line between pointed pixels is major axis , by choosing an appropriate minor axis , we are able to make an ellipse which is intersected in several places by object , for instance , the red ellipse in fig . 7 , but most of them are in one side , suppose that object is ellipse and is detected , but if algorithm just consider number of intersections , wrong axis will be chosen . our algorithm assumes that ellipse has two sides which are separated by major axis . to make correct decision it ca nt be an appropriate minor axis if intersections in one side are much more than threshold , in another side are less . at last , in this step , between possible choices for minor axis , the one which its ellipse has more intersections to the object in both sides , is chosen . then algorithm goes back to step two , chooses another pair , and goes on . if the new ellipse has better proportion with area of the object , the previous ellipse parameters will be replaced by the new ones . after choosing all pairs in step two and applying the loop , if no ellipse is detected , the object will be rejected else object could be a sperm . if length of the major axis of detected ellipse is in proportion to area and intensity , the object will be accepted as a sperm . sometimes two sperms are adhered . ( a ) adhered sperms in real ( left ) and edged ( right ) frames . then , just pixels of the detected sperm is deleted and after connecting two endpoints of remained part , we apply our algorithm once again to find out if it detects the second part as a sperm . one important issue in adhered sperms is , the best axis of ellipse for the first detected sperm is not necessarily appropriate for the second sperm . although the chosen major axis makes an ellipse which has lots of intersections to the object , it is not a right choice , because the chosen ellipse may disturb the second one . actually , each object is recognized as one sperm which is not correct . to gain the best result , although , for the first detected sperm of the object the number of intersections of determined ellipse is less than the ellipse of the corresponding object in fig . 8b , the added number of intersections of both ellipses of each object is more . it worked more accurate than manual method and was not more time consuming of that . fig . variety of cells and sperms are available in it so it is a sample to evaluate the algorithm . horizontal axis shows the number of sperms of the frame according to the gold measure . results according to the algorithm are shown with the blue dots and for the operator are shown in red.tow lines shows the results with linear lines . we firstly chose 50 images of different semen samples which were counted by an operator normally . although the operator is able to count without fault , he usually counts fast and not exactly , because he can get the needed information without spending much time . . then these 50 video frames were examined by our algorithm and at last these frames were counted attentively and its results were considered as gold standard . results are shown in table 1 . to scan our algorithm results we divided the sperms into two categories , single and adhered . single sperms are not merged to any kind of cell but in adhered cases , two sperms or one sperm and a cell are overlapped or connected . in cases of single sperm detection the algorithm works better than adhered cases . actually about operator results , the accuracy of counting singles and adheres is not severable , since the operator just says a number by taking a look at the frame and we have no idea which sperms are counted . according to fig . 9 , in frames which have less than 40 sperms the operator counts more exactly because the frames are not crowded and operator is able to count without spending much time and counting some sperms more than twice . but in crowded cases which usually more than 40 sperms are in the frame , the algorithm works more accurate . one reason is , in crowded frames sperms are not well distributed and sometimes the operator confuse whether he have counted relevant sperm or not and he might count it twice or does not count it at all . the second reason is , exact counting takes time and needs patience which usually the operator does nt have them . finally by comparing the average of the fault according to table 1 , the mean standard deviation of fault for manual operator analysis is 6.21%4.34 and for algorithm is 5.5%3.83 which are close to each other . false positive cases are the cells which are considered as sperm by mistake and false negatives are the ones which are sperm but not detected . the result of false positive and false negative detection in single sperm cases shows that the algorithm is strongly powerful not to consider other kinds of cells as sperm but in adhered cases it is not that accurate . it sometimes considers some big sells as adhered cells which contain one or two sperms . however , accuracy of the algorithm is over 94 percents and could be useful in laboratory in some simple cases in order to reduce computation time and human cost . at last it should be mentioned in laboratories which casas are not used , the operator counts sperms under the microscope , so the number and place of sperms change regularly and the results are much more conjectural . in this paper we proposed an algorithm to detect sperms in a video frame which is given by camera from semen sample . we tried to find sperm heads in semen according to characteristics such as their ellipse shape , intensity and area . another possible work which is base on this , is tracking of sperms . in tracking , firstly sperms should be detected and then tracked . another area which this method could be useful is working on morphology of sperm . computing the deviation of pixels of each sperm from detected ellipse could be helpful to indicate the morphological category of spermatozoa .

casa ( computer assisted semen analysis ) systems are designed to assist andrologist labour . most available casa systems are not accurate or so expensive . therefore labours use manual methods to provide parameters . although some companies have achieved appropriate accuracy , they have not released their methods . so proposing methods in this area might be useful for groups who intend to design new casa system . one of the parameters which these systems compute is sperm count . in this paper we introduce our algorithm which can count sperms with an acceptable accuracy . sperm count or concentration is one determinant parameter in male fertility . our program preprocesses the video frame or image of semen sample under the microscope recorded by camera , then use morphology and effective ellipse detection method techniques to segment sperms and then count appropriate sperms .