Datasets:

anumafzal94

/

pubmed-2shot-4096

like 0

the anorectum plays an important role in regulation of defecation and in the maintenance of continence.1 the most widely used test for anorectal function is anorectal manometry . a comprehensive assessment of anorectal function consists of measuring at a minimum each of the following parameters : ( 1 ) anal sphincter function , ( 2 ) rectoanal reflex activity , ( 3 ) rectal sensation , ( 4 ) changes in anal and rectal pressures during attempted defecation , ( 5 ) rectal compliance and ( 6 ) performance of a balloon expulsion test.2 anal sphincter function is assessed by measurement of resting sphincter pressure , squeeze sphincter pressure , and the functional length of the anal canal . maximum resting anal canal tone predominantly reflects internal anal sphincter function , while voluntary anal squeeze pressure reflects external anal sphincter ( eas ) function . functional anal canal length is defined as the length of the anal canal over which resting pressure exceeds that of the rectum by greater than 5 mmhg or , alternatively , as the length of the anal canal over which pressures are greater than half of the maximal pressure at rest ( fig . maximal resting anal pressure is defined as the difference between intrarectal pressure and the highest recorded anal sphincter pressure at rest , and is generally recorded 1 - 2 cm from the anal verge . maximum squeeze pressure is defined as the difference between the intrarectal pressure and the highest pressure that is recorded at any level within the anal canal during the squeeze maneuver ( fig . rapid distention of the rectum induces a transient increase in rectal pressure , followed by a transient increase in anal pressure associated with eas contraction ( the rectoanal contractile reflex ) , and in turn , a more prolonged reduction in anal pressure due to relaxation of the internal anal sphincter ( the rectoanal inhibitory reflex , fig . the rectoanal contractile reflex is a compensatory guarding mechanism that allows a positive anorectal pressure gradient to be maintained during transient increases in intra - abdominal pressure ( such as coughing ) , which is essential for preserving continence . in fecal incontinence patients , anal sphincter pressure the lowest volume of air that evokes sensation and a desire to defecate , and the maximum tolerable volume are recorded.4 assessment of rectal sensation is useful in patients with fecal incontinence or rectal hyposensitivity . when an individual is requested to ' bear down , ' as if attempting to defecate , the normal response consists of an increase in rectal pressure that is coordinated with a relaxation of the eas ( fig . inability to perform this coordinated maneuver suggests a diagnosis of dyssynergic or obstructive defecation , a common cause of constipation.5 this response can be quantified using the defecation index = maximum rectal pressure during attempted defecation / minimum anal residual pressure during attempted defecation . a normal defecation index is > 1.5.5 three types of dyssynergic defecation are recognized.6 most patients show paradoxical increase in anal sphincter pressure during attempted defecation with normal adequate pushing force ( type 1 , fig . some patients are unable to generate an adequate pushing force , and exhibit a paradoxical anal contraction ( type 2 ) . in type 3 , the patient can generate an adequate pushing force , but has absent or incomplete ( < 20% ) sphincter relaxation . rectal compliance is calculated by plotting the relationship between balloon volume ( dv ) and steady state intrarectal pressure ( dp ) . the balloon expulsion test is used to assess rectoanal co - ordination during defecatory maneuvers.7 the test evaluates a patient 's ability to expel a filled balloon from the rectum , providing a simple and more physiologic assessment of defecation dynamics . most normal subjects can expel the balloon within 1 minute.5 if the patient is unable to expel the balloon within 3 minutes , dyssynergic defecation should be suspected .

anorectal manometry is the most well established and widely available tool for investigating anorectal function . anal sphincter tone can be quantified by anorectal manometry . the anorectal sensory response , anorectal reflexes , rectal compliance , and defecatory function are also assessed by anorectal manometry . this report will focus on defining parameters for measurement and interpretation of anorectal manometry tests .

cell biology is an inherently multidisciplinary science , requiring approaches from genetics , chemistry , physics , applied mathematics , and engineering . while biochemical and genetic approaches have been successfully integrated into the field , other disciplines require more effort . physical scientists that join the field of cell biology retain the training and language from their physical discipline , which has been specialized for specific purposes . applied mathematicians , condensed matter physicists , and mechanical engineers all have unique perspectives on how to model complex biological phenomena ( fig . this has led to the development of parallel theoretical and experimental approaches for modeling cell biological phenomena that are difficult to directly compare or rigorously test . a challenge for the future is to develop a community of researchers that will integrate these diverse physical approaches to identify strengths , resolve differences , and determine the best approaches for modeling cell behaviors . a flow chart showing examples of how various disciplines from the physical sciences ( bottom ) have optimized a variety of theoretical / modeling tools ( left ) as well as experimental techniques ( right ) that have been applied to cell biological problems . a current challenge is to systematically have them benchmarked against each other and identify their weaknesses and strengths before using them to provide a new framework optimized for mesoscale cell biology . one of the simplest solutions to implement is to develop a consistent and precise language to describe measurements or ideas . in my field , which centers on how mechanical forces are sensed and generated by cells , terms like mechanosensing or even stiffness sensing are used without precision , resulting in confusion of what is known versus just thought to be true . precision of language is essential for standardizing experimental protocols and measurements and in being able to clearly communicate conclusions and ideas . one historical role of physical scientists in biology has been the introduction of new experimental and analytical tools . some of these tools , such as microscopy and scattering techniques , have been developed extensively . however , in other cases , the nature of measurements require small apparatuses that can be difficult to replicate or operate ( magnetic tweezers are a notorious example ) , making it difficult for other laboratories to build upon this knowledge . similar issues arise in analysis and methods . it is extremely important for these methods to be used and validated by different laboratories to confirm results independently and by many individuals so that the language used to describe physical concepts and results can be made more precise . being able to directly compare two different measurement techniques so that the same parameters can be used is essential for resolving discrepancies . even though the goal is to understand cell physiology , model testing will require physical characterization that may not immediately inform a biological process . to use an analogous example : the work in basic materials science of magnetism that needed to be performed before we could construct and build computer hard drives . it is my hope that the cell biology community will remain interested in these advances in characterization of biological materials and systems , as they are crucial to uncovering synergies that are not currently apparent . in the physical sciences , research has evolved so that individuals typically focus on either theory or experimentation . of course , each of these can be further subdivided into analytical theory versus computer modeling , as well as sample preparation versus characterization . it also has led to a vigorous feedback between theoretical prediction , experimental measurement , and new materials development . to be useful , models need to be falsifiable . there is increasing evidence that many of the models used in biology are over - parameterized and , consequently , difficult ( or impossible ) to falsify . that is , when parameters are assigned with molecular - level details , the number of parameters quickly becomes large . in these scenarios , changes in the parameter value have little effect on the model predictions and make it difficult to verify the accuracy of the model ( for more details , see http://www.lassp.cornell.edu/sethna/sloppy/ ) . identifying order parameters that encompass the physical quantities or metrics ( e.g. , elastic modulus , organelle transport ) that make up many of the molecular details is essential for developing models with fewer control parameters . such order parameters will provide crucial insight into understanding regulation of the individual macromolecular machinery . the word mechanism in cell biology typically refers to a molecular mechanism that is explored rigorously by genetic and biochemical testing . understanding the physical mechanism requires both identification of the parameters controlling a system and then elucidation of the regulation of parameter values . moreover , understanding how molecular interactions give rise to a single physical parameter is not straightforward , and may require years of work . it is quite natural to apply models and approaches that we have used to engineer machines , such as the flow of decision making in electrical circuits or mechanic designs . however , cells are working under different sets of constraints , and a future challenge of understanding cellular machines is that completely different design principles may be used . establishing a culture that encourages dynamic feedback between theory , experimentation , and a potentially very exciting possibility is that understanding the physical mechanisms controlling biological machines will enable a completely new set of design principles that provide insight into how living cells are able to respond and adapt to highly variable environments . this will enable understanding of how these states change during disease progression and the capability of engineering biological cells to maintain a healthy phenotype .

a major goal in cell biology is to bridge the gap in our understanding of how molecular mechanisms contribute to cell and organismal physiology . approaches well established in the physical sciences could be instrumental in achieving this goal . a better integration of the physical sciences with cell biology will therefore be an important step in our quest to decipher how cells work together to construct a living organism .

the present discussion focuses on the review by oliveira and coworkers ( presented in this issue ) , and on the use of hypertonic saline resuscitation in sepsis . early fluid resuscitation of patients with systemic inflammatory response syndrome reduces the incidence of mortality due to septic shock and sepsis . these favorable results have led to consideration of other fluid modalities . in their review , oliveira and coworkers consider the use of hypertonic saline solutions in the treatment of patients with severe sepsis . hypertonic saline has been extensively investigated in animal models with regard to its efficacy in treating hemorrhagic hypotension . numerous clinical studies of patients with traumatic injuries have been initiated with favorable , but not definitive , results . limited animal studies have been directed at treatment of septic shock using hypertonic solutions , and clinical studies have been exploratory at best . following administration there was a small effect on oxygenation by increasing cardiac output and oxygen delivery . an abstract reported by oliveira an colleagues described a randomized study of 25 stable patients with sepsis . administration of 250 ml hypertonic saline in dextran significantly improved cardiac index and pulmonary artery occlusion pressure as compared with administration of an equivalent volume of normal saline . although favorable , those studies of responses to hypertonic saline solutions in stable patients with sepsis are only descriptive . furthermore , administration of hypertonic saline solutions during the early stages of septic shock when the patient is not yet hyperdynamic has not been investigated . the major benefit of hypertonic solutions is the rapid expansion of blood volume for a small volume administered . this advantage is sustained by the addition of colloids such as dextran . in their review , oliveira and colleagues suggest that the major benefit of resuscitation with hypertonic solutions in models of septic shock is the restitution of blood volume and accompanying improvements in cardiovascular and hemodynamic function . hypertonic solutions have been demonstrated to modulate the immune system . as pointed out by oliveira and coworkers , hypertonic saline has a pronounced anti - inflammatory effect that could reduce the response to sepsis and attenuate later multiple organ failure . recently , shi and coworkers found resuscitation with hypertonic saline to ameliorate the gut and lung injury seen following use of ringer 's lactate . this lack of injury reduced bacterial translocation , and would presumably reduce the incidence of sepsis . comparisons between various resuscitation solutions on outcome have been controversial . however , the work of rhee and colleagues in comparing various solutions suggests pronounced differences in immune modulation . the question that must be addressed is whether the presently available solutions are harmful in conditions in which immune function is challenged , and are thus inappropriate to use . rhee and coworkers showed that hypertonic solutions , especially when combined with dextran , are superior to ' standard of care ' solutions . this leads to the conclusion that presently used solutions may be harmful because they compromise immune function and that hypertonic solutions are of benefit because they do not . in their review , oliveira and coworkers discuss the use of hypertonic solutions for treatment of septic shock ; however , they do not refer to the possible prophylactic benefit of early use of these solutions . the etiology of sepsis is based on a sustained period of hypoperfusion of vital organs . the use of hypertonic solutions as the initial fluid therapy , irrespective of the cause of hypotension or cardiac insufficiency , may be of benefit in blocking the cascade that leads to septic shock . in a study of trauma patients initially resuscitated with hypertonic saline dextran , no cases of sepsis occurred in the hypertonic saline group as compared with an incidence of 2% in the standard of care group . although interesting , this difference was not significant . the favorable preservation of tissues and immune function that occurs following early resuscitation of the hypotensive patient with hypertonic solutions bodes well for a favorable outcome in the treatment of sepsis . oliveira and colleagues point out the probable advantages of using hypertonic solutions in patients with sepsis . there is a rapid and sustained expansion of plasma volume , leading to improvement in cardiovascular function , rectification of microcirculatory blood flow , and favorable modulation of immune function . all of these factors may contribute to improved outcomes in patients with sepsis and septic shock . beyond the scope of the present commentary is the possibility that early resuscitation with hypertonic solutions could contribute to a reduced incidence of sepsis by modulation of immune responses and reduced tissue injury . these improvements following hypertonic saline resuscitation would have a greater impact on the subsequent course of patients admitted to the intensive care unit . at present , although the experimental data are positive and the rationale for use of hypertonic solutions in the care of patients with sepsis or septic shock is reasonable , definitive clinical studies as to the safety and efficacy in this patient population are still required . cew is a faculty member of the university of california at davis , which holds the us patent for hypertonic saline / hyperoncotic solutions . he holds advisory positions in companies developing these solutions and serves as a consultant to other companies .

the review by oliveira and colleagues on the subject of hypertonic saline resuscitation in sepsis ( included in the present issue ) suggests possible benefits for hypertonic saline . there is a firm experimental basis for the actions of hypertonic saline / hyperoncotic solutions in hemorrhagic hypotension , which include expansion of blood volume , improvement in cardiac index , favorable modulation of the immune system , and improvement in survival . these actions are presumed to be of benefit in the treatment of sepsis or septic shock . however , there are few experimental data regarding the use of these solutions , and clinical studies are descriptive . the major impact of early administration of hypertonic solutions may be attenuation of tissue injury , sepsis , and septic shock . early and aggressive fluid resuscitation with hypertonic solutions to clinical end - points should be investigated in patients with systemic inflammatory response syndrome , sepsis , and septic shock .

we present an unusual case of a 24 year old male who was hospitalized to undergo a dental procedure and subsequently developed a cardiac arrest 2 days following the procedure . the patient presented with a swelling in the buccal cavity for which a biopsy was taken . two days following the procedure , the patient suddenly presented at night with recurrent ventricular tachycardia ( vt ) and fibrillation ( vf ) , which were intractable requiring multiple dc shocks . during this period arterial blood gas analysis revealed severe metabolic acidosis . electrocardiogram ( ecg ) revealed vt / vf [ figure 1 ] . following termination of vt , subsequently detailed history from the wife revealed that the patient had a heated argument with his wife , after which he was not seen in bed for 2 - 3 hours . 2 hours later , patient was found to be unresponsive and cardiac arrhythmias were noted . electrocardiogram showing ventricular tachycardia electrocardiogram showing deep t - inversions in precordial leads following termination of the arrhythmia the circumstances led us to suspect poisoning as one of the cause for his medical condition . patient had access to hand sanitizers which was freely available in the hospital attached to the walls . the constituents of hand sanitizer include isopropyl alcohol ( ipa ) , glycerin and perfume . his gastric lavage sample was analyzed by head space gas chromatography- mass spectroscopy , which revealed the presence of ipa . patient remained hemodynamically stable for the next 9 days although his conscious level did not improve . when it does occur in the young , it is important to consider poisoning or toxic ingestion as one of the causes . centre of disease control endorses the use of alcohol based hand sanitizers to prevent pathogen transmission . in a few case reports , a prisoner and a hospitalized patient had consumed ethanol based sanitizer . they underwent conservative management and recovered . a few cases with intoxication due to ipa based sanitizers have been reported.[35 ] these patients underwent aggressive hemodialysis and had an uneventful recovery . in our patient we could reverse the toxic effects of ipa with hemodialysis but due to intractable arrhythmias patient had sustained hypoxic ischemic encephalopathy and later succumbed to sepsis . healthcare professionals need to be aware of common toxins which are accessible to patients in the hospital setting . we recommend to use a caution in bold letters may cause death if ingested on the label of the container . inhalation and ingestion of ipa at high concentration leads to apnea , cns depression with subsequent coma and death . treatment of ipa poisoning should include decontamination by activated charcoal ; supportive care is required for hypotension and respiratory depression . this case summarizes the need to educate healthcare professionals regarding the toxic effects of commonly available sanitary products in the hospital with a protocol to manage the same when it does occur .

we present an unusual case of 24 year old male who was hospitalized for dental procedure and developed cardiac arrest 2 days after the procedure . the patient presented with swelling of buccal cavity for which a biopsy was taken . two days after the procedure , apparently normal patient suddenly presented at mid night with vt and vf , which were intractable requiring multiple dc shocks . during this period arterial blood gas analysis revealed severe acidosis . the circumstances led us to suspect poisoning as one of the cause for his medical condition . we looked for commonly available toxins . one of the commonly available toxins is hand sanitizer which contains isopropyl alcohol , glycerin and perfume . due to prolonged cardiac arrest and intractable arrhythmia patient had sustained hypoxic brain injury . patient remained hemodynamically stable for next 9 days although his cns status did not improve . patient succumbed to sepsis on 9th day . healthcare professionals should be aware of such possibilities and treat the patients at the earliest and put a check on the easy availability of ipa based hand sanitizers .

sinus node dysfunction with prolonged pauses is a rare finding in children unless they have had prior congenital heart surgery . abrupt termination of a supraventricular tachycardia ( svt ) or pacing can be associated with sinus pauses due to overdrive suppression of the sinus node . however , such pauses are rarely seen in children despite the common prevalence of paroxysmal supraventricular tachycardia ( psvt ) perhaps because of the relative healthy state of the sinus node . we describe a case of long sinus pauses in a teenager with an asymptomatic ectopic atrial tachycardia . treatment with radiofrequency catheter ablation of the underlying tachyarrhythmia led to resolution of the sinus pauses . an asymptomatic 14 year old boy was referred for evaluation of an irregular heart rhythm noted during a routine checkup . a standard 12lead electrocardiogram revealed short runs of an atrial tachycardia ( fig . 1 ) . an ambulatory 24 hour holter monitor done to assess the frequency and behavior of the tachycardia showed frequent sinus pauses ( fig . 2 ) with a longest pause around 5 s. the pauses were mostly ( but not always ) associated with termination of the svt . because of the concerns of the long sinus pauses and because we felt that pharmacologic therapy could lead to worsening of the pauses , he was taken up for catheter ablation . at the ablation procedure , he was found to have an ectopic atrial tachycardia arising within the right atrial appendage . the ectopic focus was mapped with three dimension electro anatomical mapping ( carto , biosense webster ) , and successfully ablated . post ablation , he showed no sinus pauses with atrial burst pacing ( normal corrected snrt ) and holter monitor done one week later showed normal sinus rhythm with no pauses , and no sinus bradycardia ( lowest heart rate was 42 ) . sinus node dysfunction with long sinus pauses is rare in children with an otherwise normal heart . while sinus pauses due to overdrive suppression of the sinus node in the context of atrial fibrillation is described in adults , it has not been reported in children , . adult reports have shown that ablation of the atrial fibrillation can lead to resolution of the sinus pauses , . however , it is unclear whether this also applies to children . we decided to defer pacemaker therapy and instead opted for management of the tachyarrhythmia with catheter ablation . ablation was preferred over medication because of potential concerns that an antiarrhythmic medication could lead to worsening of the bradycardia . decision making was influenced by the fact that the patient was asymptomatic , with a normal cardiac structure and function on echocardiogram . while pacemaker placement would have been a permanent or semi - permanent intervention , ablation was preferred since it is a one - time procedure . sinus pauses can occur in young patients with paroxysmal svt . based on this case , we recommend that initial treatment should be directed towards the svt and not to the bradyarrhythmia .

sinus pauses in the setting of supraventricular tachycardia is rare in children . we describe an asymptomatic teen with irregular heart rate detected during an incidental exam who was found to have short runs of a slow ectopic atrial tachycardia on electrocardiogram and prolonged sinus pauses on routine ambulatory ecg . successful catheter ablation of the ectopic atrial tachycardia led to resolution of the sinus pauses .

a 30-year - old male presented to chonnam national university hospital complaining of pitting edema of both lower extremities . laboratory studies were as follows : blood urea nitrogen , 24.7 mg / dl ; serum creatinine , 1.4 mg / dl ; and c - reactive protein , 3.5 mg / dl . one week later , the follow - up serum creatinine level had increased from 1.4 mg / dl to 3.0 mg / dl . the renal ultrasound showed a resistive index ( ri index ) of 0.53 and hypoechoic fluid collection in the pelvic cavity and around the transplanted kidney . follow - up renal ultrasound showed hydronephrosis of the transplanted kidney ( fig . 1 ) and pelvic cavity fluid collection , which was confirmed by abdominal computed tomography ( fig . the scan showed focal tracer accumulation in the pelvic area , and there was evidence of abnormal leakage from the transplanted kidney and ureter ( fig . to distinguish between lymphocele and urinoma , we conducted sono - guided percutaneous drainage of the fluid collected in the pelvic cavity ( fig . the chemistry of the peritoneal fluid was more equivalent to the serum values than to the urinary values ( table 1 ) . the common etiologies of perirenal fluid collections occurring after kidney transplantation include urinomas , hematomas , abscesses , and lymphoceles.1 examination of the aspirate fluid is an essential method for specifying the kind of perirenal and pelvic cavity fluid collection . analysis of fluid composition is also helpful in identifying urine leakage , because higher creatinine and potassium concentrations and lower sodium concentrations are detected in urine than in lymphocele fluid.2,3 indeed , urine fistulae may be responsible for perirenal collection , particularly early after surgery , through ureteral or bladder leaks . perirenal hematomas occur during the postoperative period or after traumatism and are easily diagnosed by examining the fluid composition . abscesses are also easily identified by aspirate white blood cell composition and bacterial cultures.1 the cause of lymphocele formation is unclear , but it is believed to result from transection of the lymphatic vessels accompanying the external iliac vessels during transplantation surgery and subsequent lymph accumulation in a nonepithelialized cavity in the extra - peritoneal plane adjacent to the transplanted kidney.4 the therapeutic options for lymphoceles occurring after kidney transplantation include simple aspiration under imaging control drainage with or without sclerotherapy and more invasive options of laparoscopic or open surgery to fenestrate the lymphocele into the peritoneal cavity . however , treatment decisions seem to be center - dependent.5 our patient underwent simple aspiration and antibiotic treatments . his serum creatinine level decreased to within the normal range , and the hydronephrosis was resolved . because treatments of lymphocele and urinoma differ , it is important to clarify the cause of the perirenal fluid collection after kidney transplantation . in addition , early detection of transplantation - associated complications is expected to preserve renal function in patients with kidney transplantation . in summary , we have presented a case of perirenal and pelvic cavity fluid collection after kidney transplantation . this case suggests that physicians should remember how to differentiate lymphocele and urinoma in postobstructive nephropathy in patients who have received a kidney transplant .

a 30-year - old male presented with pitting edema . he had received a kidney transplantation 3 months previously . his serum creatinine level was increased , and a renal ultrasound showed hypoechoic fluid collection in the perirenal space and pelvic cavity . we conducted sono - guided percutaneous drainage of the fluid collected in the pelvic cavity . the chemistry of the peritoneal fluid was more equivalent to serum chemistry values than to urinary values . simple aspiration and treatment with antibiotics were performed . we have presented a case of lymphocele after kidney transplantation . this case suggests that physicians should remember how to differentiate the pelvic cavity fluid collection in patients who have received a kidney transplant .

femoral artery pseudoaneurysm following by cardiac catheterization is a serious groin complication requiring careful assessment and prompt intervention . risk of femoral artery pseudoaneurysm is estimated at 0.6 to 17 following diagnostic and interventional procedures . the clinical usage of bedside ultrasonography as part of the physical examination by attending emergency physicians has increased significantly over recent years . bedside emergency department ultrasonography provides the clinician with critical information noninvasively , rapidly determining various anatomical structures . we presented the case of a femoral artery pseudoaneurysm detected by the bedside emergency department ultrasonography secondary to angiographic catheterization . a 51-year - old woman presented to the emergency department ( ed ) with a 2-day history of right groin pain , discoloration and swelling of the inguinal area . six days before presentation , diagnostic angiographic catheterization was performed in her right femoral area . on physical examination , emergency department ultrasonography ( us ) performed at the bedside revealed a pulsating anechoic lesion communicating with the superficial femoral artery by using a 10-mhz linear probe ( fig . 1 ) . doppler examination of the patient showed a 31 26-mm pseudoaneurysm in direct continuity with the right femoral artery ( fig . she was surgically treated and discharged from the hospital fully recovered 10 days later . 2a and b : duplex doppler us image depicts a 31 26-mm pseudoaneurysm ( psa ) with bidirectional flow within the neck pseudoaneurysm of the superficial femoral artery . there is an anechoic lesion communicating with the right superficial femoral artery a and b : duplex doppler us image depicts a 31 26-mm pseudoaneurysm ( psa ) with bidirectional flow within the neck a painful mass in the femoral area should heighten the clinician s index of suspicion for a possible pseudoaneurysm . differential diagnoses of pseudoaneurysm include abscess and hematoma formation , cyst , malignant mesenchymal tumor and lymphadenopathy , which may be the landmark of sexually transmitted infections such as lymphogranuloma venereum , gonorrhea or cancers such as lymphoma . the diagnosis of a femoral pseudoaneurysm may be performed with invasive and noninvasive methods : color doppler us , ct angiography , magnetic resonance angiography and conventional angiography . all of these conditions may be evaluated with bedside ed us . using b - mode imaging , a pseudoaneurysm will usually appear as an anechoic lesion communicating with the femoral artery in the femoral area ; this mode is useful for measuring pseudoaneurysm size and compression of adjacent structures . other advantages of ed us examination are that it is a simple , rapid , inexpensive and useful method for evaluating pseudoaneurysyms . duplex ultrasound is the diagnostic test of choice and demonstrates a high velocity jet through a defect in the arterial wall on color flow imaging . , us examination may be a valuable tool in the ed to perform the differential diagnosis of a superficial femoral pseudoaneurysm .

backgroundfemoral artery pseudoaneurysm following by cardiac catheterization is a serious groin complication requiring careful assessment and prompt intervention.aimsrisk of femoral artery pseudoaneurysm is estimated at 0.6 to 17 following diagnostic and interventional procedures.methodsthe clinical usage of bedside ultrasonography as part of the physical examination by attending emergency physicians has increased significantly over recent years.resultsbedside emergency department ultrasonography provides the clinician with critical information noninvasively , rapidly determining various anatomical structures.conclusionswe presented the case of a femoral artery pseudoaneurysm detected by the bedside emergency department ultrasonography secondary to angiographic catheterization .

in this study , somatic cell cloned embryos were successfully produced on the basis of a previous report . briefly , femoral fibroblasts of an 11-year - old holstein dairy cow from koiwai farm were used as donor cells for somatic cell cloned embryos . two cloned holstein cows , cody 1 and cody 2 , were derived from femoral fibroblasts of the donor holstein cow with the somatic cell cloning technique . birth weights ( bw ) and other after - birth data of the offspring of cody 2 and of cody 2 are shown in the pedigree charts ( fig . birth weights ( bw ) and other after - birth data of the somatic cell cloned holstein cow ( cody 2 ) and the offspring are shown in the pedigree charts . * holstein cow derived from multiple ovulations for cody 2 and embryo transfer . * * holstein cow and calf derived from artificial insemination ( ai ) for cody 2 . ) . co1 was born after multiple ovulation treatments on cody 2 and embryo transfer into recipient cows , whereas co2 was born through artificial insemination ( ai ) of cody 2 . growth performance of the two somatic cell cloned heifers did not differ from that of other cattle born within the same month , with no specific apparent clinical abnormalities . birth weights ( bw ) and other after - birth data of the somatic cell cloned holstein cow ( cody 2 ) and the offspring are shown in the pedigree charts . * holstein cow derived from multiple ovulations for cody 2 and embryo transfer . * * holstein cow and calf derived from artificial insemination ( ai ) for cody 2 . the second generation offspring of the somatic cell clone heifers calved successfully , with co1 producing a male japanese black crossbred calf in the first parturition and then producing a female holstein calf via ai in the second parturition . reproduction and milk production data were collected from the donor cow ( first sixth lactation ) , cody 2 ( first third lactation ) , co1 and co2 ( first second lactation ) . milking cows from koiwai farm ( 563 cows with a mean parity of 2.6 ) were used as the control group . the primipara age of the month and calving intervals ( days ) were collected as reproduction data . the calving intervals ( days ) of the donor holstein cow ( first sixth lactation period ) and the control group were 523 days and 427 days , respectively . the reproduction performance was particularly reduced in the two somatic cell cloned holstein heifers . for milk productivity , data for the lactation curve and transitions of monthly milk compositions during the first lactation ( fig . 1 ) were collected on the basis of the dairy herd performance test every month . the milk yield ( kg ) over 305 days and milk composition rates ( fat , protein and snf ) for each lactation period were measured ( table 1 ) . the mean milk yield and milk composition rates ( fat , protein and snf ) of the donor holstein cow from the first to sixth lactation periods were 11,015 kg and 3.5% , 3.2% and 8.7% , respectively , whereas they were 8,128 kg and 3.7% , 3.3% and 8.9% , respectively , for the control group .

abstract this study examined two female offspring of a somatic cell cloned holstein cow that had reproduction problems and milk production performance issues . the two offspring heifers , which showed healthy appearances and normal reproductive characteristics , calved on two separate occasions . the mean milk yields of the heifers in the first lactation period were 9,037 kg and 7,228 kg . the relative mean milk yields of these cows were 111.2% and 88.9% , respectively , when compared with that of the control group . no particular clinical abnormalities were revealed in milk yields and milk composition rate [ e.g. , fat , protein and solids - not - fat ( snf ) ] , and reproductive characteristics of the offspring of the somatic cell cloned holstein cow suggested that the cloned offspring had normal milk production .

the extent to which hcv infection is associated with sexual exposure has been debated extensively . the 2008 egyptian demographic and health survey estimated that 15% of people aged 1559 years in egypt have anti - hcv antibodies and 10% have chronic hcv infection . however , this high figure is related to past transmission events and is not representative of the hcv transmission occurring in egypt . sexual transmission of hcv may contribute to the total burden of infection in egypt . the objectives of this study were to detect the risk for sexual transmission of hcv infection from chronically infected subjects to their long - term monogamous heterosexual partners ( 50 spouses ) and to identify various sexual practices associated with that risk . spouses were carefully selected to exclude risk factors and participants were hbv ( hbsag , hbcab , and hbsab ) and hiv antibody negative . all participants were tested for liver enzymes , hcv specific antibodies ( ortho clinical diagnostics , new jersey , usa ) , and hcv rna assay with real - time pcr using qiagen extraction kit and brilliant hcv qrt - pcr for stratagene 's mx3000p . five spouses showed evidence of hcv infection , two were positive for hcv antibody alone ( 4% ) and three were positive for hcv antibody and hcv pcr ( 6% ) . no association was found between the hcv infection status and various selected risk factors such as sex , age , duration of marriage , frequency of sexual intercourse , history of sexually transmitted diseases , and other risk factors for hcv . the only association detected was the age category where both positivity of hcv antibody and hcv pcr were associated with the older age category ( > 60 y ) . as regards the direction of transmission , an insignificant difference between male and female spouses of chronic hcv-4 infected patients was detected . in this study the prevalence of hcv in the heterosexual spoused is 10% which may seem to be lower than the general population . however , our patient population was carefully selected so that sexual intercourse would be the major risk factor . one possible explanation is that a higher cell - mediated immune response against hcv in repeatedly exposed sexual partners would partially protect them against infection . the detection of hcv - specific cellular immune responses in seronegative sexual partners of hcv patients has been documented [ 2 , 3 ] . an important limitation is failure to analyze the sequence of nucleotides of the hcv genome . the detection of homology in the nucleotide sequences would have been a strong evidence of a common source of infection but it would not clarify the direction of the infection , nor the responsible risk factors . the major limitation of our study may be the relatively small number of participants . our study results raise the possibility that hcv is sexually transmitted between spouses in egypt . this confirms the need to screen all people in the so - called high risk groups for hcv infection . due to the ongoing high incidence of hcv in egypt , further research is needed to identify the exact routes of transmission and the associated risk factors so that preventive measures can be instituted .

we screened for evidence of hcv infection in healthy heterologous monogamous spouses of chronic hcv patients and studied the relation with various risk factors . a cross - sectional study of fifty healthy monogamous heterosexual spouses of hcv - positive index cases was carried out . all participants were hbv and hiv negative . the association with various risk factors was studied . five spouses ( 10% ) showed evidence of hcv infection . two partners were positive for hcv antibody alone ( 4% ) and 3 for antibody and hcv pcr ( 6% ) . no association was found between hcv infection and various sociodemographic parameters with the exception of older age categories . intraspousal transmission of hcv may be an important source of spread of hcv infection . the reservoir of hcv - infected individuals in egypt is sizable , and sexual transmission of hcv may contribute to the total burden of infection in egypt .

several pathogenetic mechanisms have been proposed in the past , but the entity still remains unclear . first described its histopathological findings in 1999 , where the transepidermal elimination of urate - like crystals was observed . the term necrotizing infundibular crystalline folliculitis was first used in 2001 by kossard et al . . in 2011 , denisjuk et al . proposed to rename the lesion to necrotizing ostial crystalline folliculitis due to the fact that in their study the most important pathognomonic feature of urate - like crystals was their location in the ostia and rarely in the infundibular region of the hair follicles . microscopically , a follicular invagination is observed , filled with cellular debris and keratin lamellae embedded in alcian blue - positive filamentous mucinous material which resembles urate - like crystalline material . here we describe the case of a 71-year - old male patient who presented with multiple hyperkeratotic lesions of the forehead ( fig . biopsy material obtained from the patient was fixed in formalin , embedded in paraffin , cut at 5 m and stained with hematoxylin - eosin , periodic acid - schiff and alcian blue according to standard procedures . on histological examination , a follicular invagination containing some cellular debris and keratin lamellae was observed ( fig . 2a , b ) . in the ostium of this follicular structure , filamentous mucinous material numerous fungal elements consistent with malassezia yeasts were seen ( data not shown ) , but no bacteria were observed . the clinical and histological aspect of our case is quite typical for the so - called necrotizing infundibular crystalline folliculitis , a folliculocentric disease first reported in 2001 on which only few data have been published . in a recently published study of denisjuk et al . , 25 cases diagnosed in the past with necrotizing infundibular crystalline folliculitis ( as solitary lesions or accompanied by skin neoplasms ) or with ostiofolliculitis have been reviewed . both sexes were equally affected ; most of them in the 50th decade and presenting lesions at the same predilection sites as acne , but clinically different from it . it remains unclear whether the presence of malassezia plays a crucial role in the induction of crystalline structures or mucin . another possible mechanism inducing the crystalline material seems to be a chemical or physical injury . in our case , malassezia yeasts were abundant in the biopsy described above , but they were absent in biopsies of clinically identical lesions of the same patient with a much less characteristic histological aspect . no bacteria have been observed in our case , and there were no anamnestic data including a possible chemical or physical injury . in the study of denisjuk et al . , in 86% of all cases , yeasts and gram - positive bacteria corresponding to propionibacterium acnes have been identified . pathogenetically these lesions may represent a perforating disorder , but some cases have shown a primary folliculocentric necrosis rather than a primary perforating process . sebum accumulation as nutrient medium for the microorganisms has been discussed , accompanied by the accumulation of crystalline material due to the destruction of tonofilaments and the degradation of lipids , followed by a rupture of follicular epithelia and accumulation of inflammatory cells . histopathologically , the pathognomonic features are the birefringent urate - like crystals representing as alcian blue - positive filamentous mucinous material . on electron microscopy , this crystalline material is composed of disrupted bundles of tonofilaments embedded in an amorphous matrix . it was proposed that it represents monosodium urate produced in the skin as a result of increased cell proliferation following local physical or chemical injury . a surrounding inflammatory infiltrate was observed in our case , but this feature has not been reported in all of the cases described in the literature . clinical response to topical or systemic antimycotic treatment suggests a role of malassezia yeasts in the pathogenesis of necrotizing infundibular crystalline folliculitis . in conclusion , our case is one more example of this exceptional lesion of as yet unknown etiology . analysis of more cases will shed light on the understanding of the exact pathogenesis of this peculiar skin disease .

necrotizing infundibular crystalline folliculitis is a rare follicular lesion of which the etiology is not well understood . here we describe the case of a 71-year - old male patient presenting with multiple hyperkeratotic lesions localized on the forehead . histopathological analysis of one of the lesions revealed a follicular invagination containing cellular debris and keratin lamellae containing filamentous mucinous material and numerous crystals birefringent in polarized light microscopy .

clinical presentation of gas under the diaphragm and acute abdomen can be due to rupture of viscus , perforated peptic ulcer disease and rarely spontaneous . a 38 year old woman presented in accident and emergency ward with a history of acute abdominal pain . she gave a history of dyspepsia , symptoms of gastritis in the past and was treated with omeperazole . she was seen by surgeons who advised for an erect chest x - ray which showed gas under the diaphragm implying the diagnosis of perforated peptic ulcer disease . erect chest x - ray highlighting the presence of subphrenic gas she was seen b they gynaecology team in view of history and acute abdomen . a detailed history was elicited and patient reported having had sexual intercourse earlier on the same day and denied the pain following it . her vital signs were stable and abdominal examination revealed diffuse vague tenderness , no sign of distension or guarding and vaginal examination was difficult and no abnormalities detected . in view of the clinical symptoms and radiological findings patient was taken for emergency laparatomy . there was no perforation of viscus but there was a defect noted in the vaginal vault . gas under the diaphragm can be due to like perforation in stomach , duodenum due to peptic ulcer disease , in jejunum or illeum by inflammatory bowel disease or cancer can lead to pneumoperitoneum . this can present as an acute symptom.(1 ) 10% of cases diagnosed on pneumoperitoneum are not due to perforation of an air containing viscus but due to sexual activity , peritonitis , gas forming bacteria and some rare causes like iucd . first case of pneumoperitoneum due to post coital perforation after abdominal hysterectomy has been reported in 1980.acute abdomen may or may not be the symptom ( 2,3 ) . vaginal evisceration may or may not be a presenting symptom.(3,4 ) in our patient the acute symptoms and x - ray findings lead for an early laparatomy . this condition could have been managed conservatively if the pain has not been severe . the vault repair can be corrected laparoscopic or vaginally and a major laparatomy could be avoided embarrassment and modesty often prevent patients form talking about sexual activity . clinical examination during acute pain , particularly vaginal examination , is more painful for patients . the condition is rare but gynaecologist and surgeons should be aware of the situation and appropriate team work is essential to deal with the rare situations .

gas under the diaphragm can be due to like perforation in stomach , duodenum due to peptic ulcer disease , in jejunum or illeum by inflammatory bowel disease or cancer can lead to pneumoperitoneum . we present a rare cause of pneumoperitoneum following abdominal hysterectomy .

the in - vivo study on ophthalmic products is done on experimental animals , usually on rabbit 's eye . preparation volume 50 l is instilled topically in the center of the lower cul - de - sac . eyes of the animal are observed for signs of irritation and injury . in vitro methods diclofenac sodium solid lipid nanoparticles ( slns ) , prepared with goat fat and phospholipids evaluated using bio - engineered human cornea , produced from immortalized human corneal endothelial cells ( henc ) , stromal fibroblasts , and epithelial cells . sustained release and high permeation of diclofenac sodium through the bio - engineered cornea were achieved . the bovine corneal opacity and permeability ( bcop ) assay has been accepted as a valid in - vitro alternative method to the draize eye irritation test with the development of an improved laser light - based opacitometer ( llbo ) for the analysis of the complete corneal surface instead of dual beam op - kit opacitometer . confocal laser scanning microscopy study on the transport mechanism through the corneal epithelium of nanostructured lipid carrier was carried out in rabbits in vivo . the corneas were isolated and rinsed in physiological saline to remove the adhesive fluorescence fragment . after 30 minute administration in to eyes , the interaction with corneal epithelia to be investigated by observing the corneal samples using confocal laser scanning microscopy ( clsm ) . the epiocular tissue model is a new in - vitro test method for ocular irritation , produced by mattek corporation tissue production facilities . the epiocular tissue model shows in - vivo like morphological and growth characteristics that are uniform and highly reproducible . the tissue consists of highly organized basal cells , which progressively flatten out as the apical surface of the tissue similar to the normal in - vivo corneal epithelium . this test could be applied as an alternate to rabbit eye test in the toxicological assessment of ophthalmic preparations . the in - vivo study on ophthalmic products is done on experimental animals , usually on rabbit 's eye . preparation volume 50 l is instilled topically in the center of the lower cul - de - sac . eyes of the animal are observed for signs of irritation and injury . in vitro methods diclofenac sodium solid lipid nanoparticles ( slns ) , prepared with goat fat and phospholipids evaluated using bio - engineered human cornea , produced from immortalized human corneal endothelial cells ( henc ) , stromal fibroblasts , and epithelial cells . sustained release and high permeation of diclofenac sodium through the bio - engineered cornea were achieved . the bovine corneal opacity and permeability ( bcop ) assay has been accepted as a valid in - vitro alternative method to the draize eye irritation test with the development of an improved laser light - based opacitometer ( llbo ) for the analysis of the complete corneal surface instead of dual beam op - kit opacitometer . confocal laser scanning microscopy study on the transport mechanism through the corneal epithelium of nanostructured lipid carrier was carried out in rabbits in vivo . the corneas were isolated and rinsed in physiological saline to remove the adhesive fluorescence fragment . after 30 minute administration in to eyes , the interaction with corneal epithelia to be investigated by observing the corneal samples using confocal laser scanning microscopy ( clsm ) . the epiocular tissue model is a new in - vitro test method for ocular irritation , produced by mattek corporation tissue production facilities . the epiocular tissue model shows in - vivo like morphological and growth characteristics that are uniform and highly reproducible . the tissue consists of highly organized basal cells , which progressively flatten out as the apical surface of the tissue similar to the normal in - vivo corneal epithelium . this test could be applied as an alternate to rabbit eye test in the toxicological assessment of ophthalmic preparations . most of the formulation efforts aim at maximizing ocular drug absorption through prolongation of the drug residence time in the eye as well as to slow drug release from the delivery system and minimize pre - corneal drug loss . nanostructured platforms provide the effective ways for delivery of insoluble drugs to the target site . as these platforms for ophthalmic delivery are very recent and the research continues , formulation factors such as loading of drug , release rate , stability , and therapeutic effectiveness for these needs to be optimized .

the topically applied drugs as drops are washed off from the eye in very short period , resulting in low ocular bioavailability of drugs . number of approaches have been attempted to increase the bioavailability and the duration of action of ocular drugs . this review provides an insight into various novel approaches ; hydrophilic nanogels , solid lipid nanoparticles , and nanosponges applied very recently in the delivery of insoluble drugs , prolonging the ocular residence time , minimize pre - corneal drug loss and , therefore , bioavailability and therapeutic efficacy of the drugs . despite various scientific approaches , efficient ocular drug delivery remains a challenge for pharmaceutical scientists .

in things necessary , unity ; in things doubtful , liberty . in the previous issue of critical care , nil - weise and colleagues investigate the effectiveness of the semiupright position ( and elements of the ' ventilator bundle ' ) in preventing ventilator - associated pneumonia ( vap ) . however , while physicians try to reconcile the art with the science of medicine by attempting to apply at the bedside the results of clinical trials , intensive care patients receive , on average , only about one half of the recommended core clinical interventions . this inconsistency in clinical decision - making and care provision is not due exclusively to variation in case mix and facilities but is the result of the intrinsic complexity of critical care , on one hand , and the physician 's heuristics ( that is , intuitive judgments ) on the other . errors of omission , such as failure to perform routine tasks or an intended plan , or the loss of key information at handover are particularly relevant today , when the management of critically ill patients is more complex , the working shift pattern of health - care professionals requires multiple daily handovers , and patients and physicians experience discontinuity in care . the standardization of the process of care , therefore , requires structuring the task environment and compensating for heuristics to facilitate consistent and reliable delivery of best evidence based practice . this is the aim of care bundles , defined by the institute of healthcare improvement as a ' a group of interventions related to a disease process that , when executed together , result in better outcomes than when implemented individually ' . the definition implies that its elements should function as a package and that its effectiveness comes from the excellence of the supporting evidence and its consistent comprehensive execution . although proponents of standardized , protocol - driven care see the conceptual advantages of bundles ( that is , that they simplify decisions , reduce omissions and errors in medical reasoning , promote goal - orientated care , and deal with areas of uncertainty by giving a pragmatic but consistent solution ) , adherence to bundles depends on the interplay between factors that act as barriers or enablers . commonly , lack of knowledge , unavailability of resources , high costs , nursing convenience , fear of adverse events or patient discomfort , and ( most importantly ) disagreement on the strength of the supporting evidence in conjunction with external barriers can affect a physician 's ability to execute recommendations . in this context , nil - weise and colleagues report a systematic review and the recommendations of a european expert panel on the benefits and disadvantages of the semi - upright position in the prevention of vap . the authors found nonsignificant reductions in the incidence of vap ( clinically suspected and microbiologically confirmed ) and in mortality with semi - upright position with no sufficient data to quantify harm ( for example , venous thromboembolism , hemodynamic instability , or patients ' discomfort ) . in this context , the expert panel suggested that the semi - upright position be used as the preferred option but only in the absence of clear contraindications ( for example , spinal injury ) and with necessary restrictions ( for example , nursing tasks , medical interventions , and patients ' wishes ) . expert opinions and adherence to recommendations often seem dissociated from the strength of clinical evidence . for instance , some strategies considered to be ineffective by trials have high rates of adherence , whereas others found to be effective ( for example , continuous subglottic aspiration and digestive decontamination ) have a high rate of nonadherence . in addition , regardless of ( or , occasionally , despite ) the strength of evidence , some clinicians oppose the concept of care bundles in general , arguing that bundles ( a ) are used by industries as a marketing tool , ( b ) deprive clinicians of clinical autonomy , ( c ) are inefficient ( similar benefit could be achieved with fewer elements ) or ineffective as they may divert from the implementation of a more effective set of interventions not included in the bundle , ( d ) increase the risk of over- or under - treatment ( that is , not all patients need all elements of the bundle all of the time ) , ( e ) may be inappropriately adopted as a measure of organizational performance , or ( f ) suffer from positive publication bias and lack of external validity in ' the real world ' or contain elements that are not plausibly related to the bundle 's objectives ( for example , thromboprophylaxis and vap prevention ) . in the paper by nil - weise and colleagues , the expert panel recommended upright head elevation , despite a lack of strong supporting evidence , as did the uk national institute for health and clinical excellence ( nice guidance psg002 ) . this apparent discrepancy between ' evidence - based ' and ' common - sense ' recommendations may reinforce the perception that committees ' advice is ' unscientific ' or attempts to drive consensus rather than reflect it . given these uncertainties , the question for the practicing clinician is , should we use bundles and protocols ? in the presence of clear evidence , the answer seems simple : if the components are scientifically sound , yes ; but when the evidence is conflicting , a common - sense approach is necessary . the best guess involves the consistent use of protocols for routine and common practice , as overall they are unlikely to cause significant harm and are more likely to be beneficial . however , the optimal balance between protocolized versus individualized care will change among institutions , depending on staffing and case mix , and with the availability of new research . in this context , using compliance to each element of a bundle as an indicator of performance may not reflect quality of care unless other considerations of risks and benefit of the proposed interventions are included and the reasons for deviation are reported . in the meantime , we should strive to implement current performance systems to deliver the consistent engineered care that patients and their families expect and deserve .

care bundles aim to improve standard of care and patient outcome by promoting the consistent implementation of a group of effective interventions . however , a variety of barriers prevent their full application in clinical practice . here , we discuss some of the benefits and limitations of care bundles in the delivery of safer and more effective and consistent health care .

it presents as a painless and slowly growing mass and also as exophthalmoses like in orbital masses . this study aims to identify the clinical course , surgical treatment and histopathologic properties of pleomorphic adenoma diagnosed in a patient who had painless exophthalmia with an intraorbital mass . a 62-year - old male patient referred to our clinic due to painless exophthalmia of his right eye for the last 2 years . on neurological examination of the patient , there was no abnormality except for the up - gaze restriction and severe exophthalmia . cranial magnetic resonance imaging ( mri ) revealed an isointense mass on the superolateral part of right orbita in the coronal intersections and it was contrasted homogenously ( fig . 2a and b ) . the existing score of our patient according to rose and wright was + 8 points histological examination of the surgical specimen covered the epithelial and stromal components that formed the glandular structures . figure 1:(a and b ) computerized tomography revealed a homogenously contrasted intraorbital mass in the right eye . figure 2:(a and b ) cranial mri revealed a homogenously contrasted mass on the superolateral part of the right orbita . figure 3:(a and b ) postoperative computerized tomography revealed the replacement of the eye . figure 4:(a ) four times h - e biphasic tumor composed of epithelial and stromal components . ( b ) ten times h - e fibromyxoid stroma and epithelium that form glandular structures . ( a and b ) computerized tomography revealed a homogenously contrasted intraorbital mass in the right eye . ( a and b ) cranial mri revealed a homogenously contrasted mass on the superolateral part of the right orbita . ( a ) four times h - e biphasic tumor composed of epithelial and stromal components . ( b ) ten times h - e fibromyxoid stroma and epithelium that form glandular structures . although the orbital tumors originate primarily from vascular , muscle , cartilage , neural tissues , lacrimal glands and lymphoid structures , they can also originate from the surrounding structures and ( low possibility of ) metastasis . epithelial tumors account for 30% of the lacrimal gland lesions , while 12% of epithelial tumors are pleomorphic adenoma . the term pleomorphic ( benign mixed tumor ) was first defined and used by willis . malignant transformation can occur in 1020% of pleomorphic adenomas of the lacrimal gland [ 5 , 6 ] . seventy - five percent of pleomorphic adenomas transform into pleomorphic adenocarcinoma , while the rest transform into cystic carcinoma . pleomorphic adenoma must be considered for the patients whose clinical course lasts for 12 months . malignancy must be considered for cases with pain and progredien symptoms . in his study , wright reported that 39 of 40 cases diagnosed with primary malignant lacrimal gland tumors had a painful mass . in addition to pain , neoplasm of the lacrimal gland , which destroys the bones , can be interpreted as malignancy . while pleomorphic adenomas do not destroy the bones , malignant neoplasm does [ 9 , 10 ] . although pleomorphic adenomas constitute 49% of all orbital tumors , their morbidity is very high . displacement of the mass without its capsule and malignant transformations following the incisional biopsies prior to the diagnosis of pleomorphic adenoma increase the morbidity . to this end , rose and wright developed a scoring system to evaluate the lacrimal gland masses [ 6 , 9 ] ( table 1 ) . according to this scoring system , if the value obtained from this table is below + 2 , the value may indicate carcinoma and thus incisional biopsy can be performed . the values + 3 and higher may indicate pleomorphic adenoma and thus , incisional biopsy must not be performed . the success of the treatment depends on the displacement of the mass with its capsule . it can also lead to malignant transformation of pleomorphic adenoma . the existing score of our patient according to rose and wright was + 8 points . table 1:management of lacrimal gland masses according to rose and wrightclinicalscore1 + 1duration of acute symptoms<10 months>10 monthspersistent painpresentabsentsensory losspresentabsentradiological1 + 1well - defined round or oval massabsentpresentmoulding of mass to globe or along the lateral orbital wallpresentabsenttumor calcificationpresentabsentinvasion of bonepresentabsentduration of symptoms in relation to tumor sizeshort symptomslong symptoms management of lacrimal gland masses according to rose and wright pleomorphic adenoma of the lacrimal gland must be considered in the presence of long - term painless exophthalmoses . for the patients suspected to have pleomorphic adenoma , incisional biopsy should not be performed in order to prevent the likelihood of a relapse to occur . the displacement of the mass with its capsule can extend the patients ' lives and improve their quality of life .

we present a case of a 62-year - old male patient with pleomorphic adenoma and painless solid mass in his right eye . computerized tomography demonstrated a mass with a diameter of 2.5 cm located in the right lacrimal gland . the mass was removed completely by combined orbitofrontal craniotomy through a transcranial approach . histopathologic examination revealed pleomorphic adenoma of the lacrimal gland . orbital tumors originate primarily from vascular , muscle , cartilage , neural tissues , lacrimal glands and lymphoid structures . five percent of all intraorbital masses originate from the lacrimal gland . pleomorphic adenoma presents as a painless and slowly growing mass and also as exophthalmoses . pleomorphic adenoma has a high morbidity . morbidity increases due to the total displacement of the tumor without its capsule and incisional biopsy for the purpose of diagnosis . the success of the treatment depends on the removal of the tumor with its capsule .

rickets is still a common health problem and is considered to be a challenge even in developed countries . epidemiological data are not available in many countries , etiology is sometimes difficult to establish and vitamin d supplementation and rickets treatment have been debated for a long time . a child aged 10 months old was admitted in pediatric emergency department with focal seizures with secondary generalization . the child has , delay in motor developmental mile stones and hypotonia and poor gain in height . biochemical and radiologic signs were suggestive for rickets . biochemical profile showing low serum calcium-6.1 mg / dl ( 9.2 - 11 mg / dl ) , low phosphorus-3.9 mg / dl ( 3.4 - 6.2 mg / dl ) , elevated alkaline phosphatase-4116 u / l ( < 269 u / l ) parathyroid hormone was 233.6 pg / ml ( 15 - 65 pg / ml ) 25-oh vitamin d was 40 ng / dl . radiographic images of the wrist showed fraying and cupping of the distal radius and ulna , as well as bone demineralization ; the metaphyses are widened , irregular and cupped . physical examination , biochemical data ( hypocalcemia , mild hypo - phosphatemia , high serum concentration of alkaline phosphatase ) and rachitic changes on x - ray , were compatible with the diagnosis of rickets . the child was started on sodium valproate 20 mg / kg / day , calcium 500 mg / day and vitamin d 6 lakh iu following which there was no improvement in the serum calcium level and there was recurrence of seizures . then endocrinologist opinion sought following which the child was initiated on 0.5 g / day of active vitamin d ( cacidiol ) along with 1000 mg of calcium . there was no seizure recurrence in the last 15 months and serum calcium normalized . in view of response to 1 calciferol 1,25 oh vitamin d and enzyme studies were not done in view of financial constraints and lack of availability . a total of 10 different allelic variants of vddr have been identified , exhibiting little or no clinical differences . prominent clinical manifestations of vddr - i include growth failure , short stature , skeletal abnormalities , genu valgum , rachitic rosary , open fontanels , pathologic fractures , muscle weakness and convulsions . radiologic findings usually include fractures , generalized osteopenia , growth failure and arched or curved legs . the most common laboratory findings include hypocalcemia , hypophosphatemia , elevated parathormone levels and high alkaline phosphatase . moreover , the serum levels of 25(oh ) vitamin d are normal or raised while the levels of 1,25(oh ) vitamin d are low or undetectable . vitamin d is intimately involved in a wide variety of biologic processes , including calcium homeostasis , bone formation and cellular differentiation . in order to exert its effects , vitamin d must be activated by a metabolic pathway that requires the enzymatic activity of 25-hydroxylase and 1--hydroxylase . the gene for vddri has been recently mapped to the long arm of chromosome 12 , region one bands 2 - 4 ( 12q12-q14 ) , representing the location of the 1--hydroxylase gene . hence , it has been suggested that the disease should be referred to as 1--hydroxylase deficiency . stong clinical suspicion is required for the clinical diagnosis of vddr and therapeutic challenge with 1 calciferol will prove the diagnosis .

there are two types of vitamin d dependent rickets ( vddr ) that cause rickets in children . vddr type 1 ( vddr - i ) is caused by an inborn error of vitamin d metabolism , which interferes with renal conversion of calcidiol ( 25ohd ) to calcitriol ( 1,25(oh)2d ) by the enzyme 1--hydroxylase . patients with vddr - i have mutations of chromosome 12 that affect the gene for the enzyme 1--hydroxylase , resulting in decreased levels of 1,25(oh ) vitamin d. clinical features include growth failure , hypotonia , weakness , rachitic rosary , convulsions , tetany , open fontanels and pathologic fractures . we report a case of vddr - i in 14-month - old male child . establishing an early diagnosis of these genetic forms of rickets is challenging , especially in developing countries where nutritional rickets is the most common variety of the disease where genetic diagnosis is not always possible because of financial constraints . a prompt diagnosis is necessary to initiate adequate treatment , resolve biochemical features and prevent complications , such as severe deformities that may require surgical intervention .

there had been no pain or dysphonia but a bothersome sensation related to progressive surface roughness that prompted her to seek care . she was otherwise healthy ; a small congenital melanocytic nevus affecting the right inner thigh had been excised during early childhood . on examination , there was no palpable cervical lymphadenopathy . a well - demarcated , circular plaque ( 1.21.10.3 cm ) with a slight pebbled texture affected the left posterior hard palate . while predominantly erythematous , there was scattered light brown pigmentation ( figure 1 ) . figure 1initial presentation of a non - homogenous brown - pigmented palatal plaque . initial presentation of a non - homogenous brown - pigmented palatal plaque . the underlying stroma contained sheets of nevus cells ( figure 2 ) exhibiting maturation and extending deep into the lamina propria and around minor salivary ducts ( figure 3 ) , nerves and blood vessels . cells diffusely stained with melana ( figure 5 ) and ki-67 suggested a low proliferative index . only the superficial cells stained with hmb-45 ( figure 6 ) . figure 2papillomatous oral squamous epithelium and sheets of nevus cells extending deep within the lamina propria ( h+e , 4 ) . papillomatous oral squamous epithelium and sheets of nevus cells extending deep within the lamina propria ( h+e , 4 ) . figure 4scant melanin pigmentation was seen only in superficial nevus cells ( h+e , 20 ) . scant melanin pigmentation was seen only in superficial nevus cells ( h+e , 20 ) . figure 5diffuse staining of nevus cells with melana . diffuse staining of nevus cells with melana . melanocytic nevi are separated into acquired and congenital subtypes with the latter identified at birth . the palate is not easily visualized , however , which may explain delayed identification . while it is recognized that parental history may not be accurate , there was certainty of identification during early infancy . the larger size was suggestive of a congenital nevus as acquired nevi are usually less than 6 mm in diameter . congenital nevi may have a papular , pebbly or verrucous surface as well as hypopigmented areas . histologically , a congenital pattern was characterized by a diffuse infiltration of nevus cells extending around blood vessels , nerves , salivary ducts as well as between collagen bundles . nevus cells may exist and proliferation in diverse anatomic locations as evidenced by identification of aggregates in the parenchyma of lymph nodes . oral melanocytic nevi are uncommon , and to the best of these authors knowledge , only three well - documented cases of intraoral congenital melanocytic nevi have been reported in the english literature , ( table 1 ) . other mucosal sites are also uncommonly affected with rare reports of conjunctival or genital congenital nevi . characteristics of reported oral congenital melanocytic nevi classification of congenital melanocytic nevi is by size : small ( < 1.5 cm ) , medium ( 1.5 to 19.9 cm ) and large or giant ( > 20 cm ) . the primary concern is malignant transformation and there is general agreement that the risk increases with the size . while a clear risk exists for larger lesions , such an association is controversial with small congenital nevi . identified histologic features of congenital nevi in 8.1% of melanoma specimens . in another study , a melanoma risk of 2.64.9% was estimated for persons with small congenital nevi and it was concluded that small congenital nevi may represent precursors for at least some cases of cutaneous melanoma . there is general agreement that the larger the congenital nevi the more likely the need for excision . for small congenital nevi , management may be either excision or observation but there exists no clear consensus or guidelines . excision seems reasonable as in most cases one would expect minimal surgical morbidity and excision facilitates comprehensive histologic sampling to exclude melanoma , and presumably , may prevent malignant transformation . from the patient 's perspective , as was the case with this patient failing to attend post - surgical assessment , excision may potentially mitigate the necessity for long - term observation . ultimately , decisions require individualization with consideration of the size , anatomic restrictions as well as patient factors such as co - morbidities and ability to attend observation .

oral pigmented lesions are uncommon and congenital melanocytic nevi are especially rare . we report a case of a patient with multiple congenital melanocytic nevi including a palatal lesion . this is reported to add to the scant literature that exists on this subject . prognosis and management are discussed .

during 20052010 ( time span needed to cover the study area ) and during the months more favorable for infection ( october april ) , foxes were either shot at night or trapped . therefore , a grid of 5 km 5 km to 10 km 10 km , depending on the department size , was superimposed over the sampling area , and no more than 1 fox was collected in each square . the geographic district where the sample was taken was then noted , and each fox was randomly allocated geographic coordinates within the commune ( a french administrative division of 10100 km ) . staff were trained by the anses - nancy laboratory ( national reference laboratory for echinococcoses ) ; that laboratory also confirmed any unrecognized specimens . for time- and cost - effectiveness during the analysis , we used the segmental and sedimentation counting technique ( 12 ) . the distribution of e. multilocularis prevalence in foxes was modeled against geographic coordinates by using a generalized additive model with a logistic link function and a thin plate regression spline on 300 knots ( 13 ) . analyses and graphic displays were conducted by using arcgis 9.3 , r 2.14.0 and the r packages maptools 0.810 , mgcv 1.712 , sp . 0.991 , and splancs 2.0129 . eighty - five could not be assigned a commune code and were not kept for further analysis , except to compute e. multilocularis prevalence in departments . the mean number of foxes collected by department was 84.95 ( sd 25.76 ) , which represents a mean of 1.56 foxes per 100 km ( sd 0.57 ) . for 4 departments , ( 36 , 61 , 67 , and 69 ) , full sampling urban areas , such as departments 93 , 95 , and 91 , also were undersampled because of human population density and high urbanization , all factors preventing easy fox sampling . the prevalence varied widely among departments , from 0 ( 95% ci 05% ) to 54% ( 95% ci 42%64% ) ( table 1 ) but was locally higher in some areas ( figure 2 ) . the mean prevalence in the entire studied area was 17% ( n = 3,307 ; 95% ci 16%19% ) . the prevalence in the historically echinococcosis - endemic area was 41% ( n = 789 ; 95% ci 37%44% ) and represented > 55% of all infected foxes and furthermore , in comparing our results with those of earlier similar studies during the same season with the same technique , we detected a significant increase of e. multilocularis prevalence in foxes over time in most of these departments ( table 2 ) . model - predicted prevalence ( a ) and standard error ( b ) of echinococcus multilocularis in foxes , france , 20052010 . 1 = 100% our study confirms the presence of e. multilocularis in areas where it is known to be endemic and indicates its presence in 25 additional departments . however , we can not discard the possibility that e. multilocularis was present but remained undetected during the 1980s1990s . that e. multilocularis could have remained undetected if it were not already at a very low prevalence in general isolated human cases recorded in the early 2000s outside areas to which it is known to be endemic corroborate this possibility ( 3 ) . the same uncertainty applies in other parts of europe ( 14 ) . taken as a whole , these findings indicate that the transmission intensity of e. multilocularis through fox populations in the occidental part of the european focus area is likely to have increased during the late 1990s and led to a much higher average prevalence than previously reported . furthermore , infected foxes close to large - scale conurbations , such as paris and its large suburban surrounding departments ( 93 , 91 , and 77 ) ( figure 1 ) amounting to 11,728,240 inhabitants , may create new conditions for human exposure similar to those already described in other highly urbanized cities , such as in switzerland , germany , and eastern france ( nancy ) , but on a much larger scale . we believe that the public needs to be proactively informed and protected , including through awareness initiatives among urban residents and , in specific areas ( 15 ) , more direct action toward the parasite may be considered . monitoring the possible further extension of the parasite westward and southward and the evolution of prevalence in foxes in the historically and the newly echinococcosis - endemic areas also are essential .

during 20052010 , we investigated echinococcus multilocularis infection within fox populations in a large area in france . the parasite is much more widely distributed than hitherto thought , spreading west , with a much higher prevalence than previously reported . the parasite also is present in the large conurbation of paris .

recently , endoscopic papillotomy ( e.p.t . ) has achieved wide acceptance as an alternative to surgery for the management of choledocholithiasis . however , there are several of problems , one of which relates to the size of the stone . a stone larger than 2.5 cm in diameter has been regarded as a contraindication of endoscopic papillotomy due to complications and frequent failures . a new method in which the stone is partially crushed in place and then extracted has been developed and has been successfully used on large stones . we experienced a patient who had a cholecystectomy and presented with a very large stone ( 6 2 2 cm ) ( fig . although endoscopic papillotomy was contraindicated in this case , it was performed with the usual lithotripter , because the patient refused surgery . a 34 year - old man was admitted to the department of internal medicine complaining of a colicky right - upper abdominal pain accompanied by chills and fever of 2 days duration . he was healthy until 5 months earlier when he experienced the abrupt onset of right - upper abdominal pain accompanied by mildly icteric sclera . under the impression of postcholecystectomy syndrome , endoscopic retrograde cholangiopancreatography was performed which revealed a large stone in the distal common bile duct . endoscopic papillotomy and irrigation of common bile duct were done in the endoscopic room at that time . thereafter he was healthy until 2 days prior to his present admission , when right - upper abdominal pain accompanied by chills , fever and cold sweats recurred . all vital signs were within normal limits except body temperature which was 38c . on physical examination his sclera was icteric , the hepatic edge was not palpable and no other abnormal findings were noted . laboratory data included wbc 11,600 with 76% neutrophils ; alkaline phosphatase , 21.6 ka / u ( normal 2.710 ) ; serum asparate aminotransferase ( got / gpt ) , 351/318 iu./l ; and total bililubin / direct bililubin 3.7/1.5 mg / dl . initially the patient s condition was diagnosed as obstructive jaundice with cholangitis . on the 2nd hospital day , endoscopic retrograde cholangiography was performed revealing a large stone ( 622.0 ) ( fig . 1 ) in the common bile duct which was partially removed by endoscopic papillotomy and lithotripsy with irrigation . 4 days later , right - upper abdominal pain returned and a follow - up e.r.c.p . showed a large stone ( 333 ) impacted in the orifice of the papillotomy site ( fig . after widening the papilla by cauterization and incision a wire was inserted through the papillotomy site into the bile duct , and by repeated crushing and extraction the remaining stones were removed ( fig . 3 ) . the e.r.c.p . performed 2 days after those procedures showed air bubbles in the common bile duct but no definite stone shadows were visualized ( fig . the development of endoscopic retrograde cholangiography as a diagnostic tool for biliary tract and pancreatic disease , has resulted in nonsurgical treatment for diseases of the biliary tract ( 14 , 8) . since endoscopic papillotomy was performed succefully in 1973(9 ) , it has also contributed to the therapeutic procedures for common bile duct stone and papillary stenosis . the main indication for endoscopic papillotomy is the extraction of common bile duct stones from cholecystectomized elderly or high risk patients . however , endoscopy should not be routinely performed in patients with common bile duct stones larger than 2.5 cm in diameter because of complications and frequent failures ( 5 , 6 ) . following papillotomy the majority of common bile duct stones were extracted with the aid of a basket or passed spontaneously ( 6 ) , but more than 10% of the stone were not extracted easily due to their large size or a narrowing of the bile duct above the papilla . although there is a report that some large stones may pass spontaneously ( 10 , 11 ) , most can not be extracted despite a large papillotomy which may result in complications . to overcome these problems , nonsurgical mechanical procedures such as electrohydraulic lithotripsy , dissolution therapy , and lithotripter have been developed with varing sucess(12 ) . while ejectrohydraulic lithotripsy and dissolution therapy have failed to gain wide acceptance because of technical problems and adverse reactions(13 , 14 ) , mechanical lithotripsy has proved to be of value(14 , 15 ) . presently some centers report a high suscess rate(97% ) with few complications using this method(12 ) . it is difficult to conclude that the endoscopic papillotomy is always more effective than surgical procedures for the treatment of common bile duct stones ( including large ones ) , but it has definite advantages in some selected cases .

a previously cholecystectomized man presented on endoscopic retrograde cholangiography with a large stone ( 622 cm ) in the common bile duct.the patient refused surgical removal of the stone , so although endoscopic papillotomy was contrainicated , it was attempted . herein is presented a case report of successful removal of a large stone by endoscopic papillotomy and lithotripsy with no significant complications .

fd may occur in one bone ( monostotic ) or multiple bones ( polyostotic ) and may be associated with other conditions like mccune albright syndrome . clinical presentation may occur at any age , with the majority of lesions being detected by the age of 30 years . common sites of skeletal involvement are the long bones , ribs , craniofacial bones , and the pelvis . a 32-year - old female presented with pathological fracture of the shaft of the right femur . radiological evaluation revealed features of fd ( with fracture of the right femoral shaft ) , with similar lesions in the opposite femur . the right femoral fracture was treated with intramedullary nailing , and intraoperative biopsy confirmed the diagnosis of fd . in order to document the extent of bony involvement in the rest of the skeleton , whole body bone scintigraphy was performed 3 hours after intravenous injection of 99mtc - methylene diphosphonate ( mdp ) . multiple sites of increased skeletal tracer uptake were detected in the skull , left mandible , multiple ribs , pelvis and both lower limbs [ figure 1 ] . single - photon emission computed tomography / computerized tomography ( spect / ct ) of the skull was performed for evaluation of the extent of skull bone involvement and showed involvement of the right sphenoid , ethmoid and frontal bones and left mandible , with evidence of bone expansion [ figure 2 ] . ct component of spect - ct [ figure 3 ] shows bony expansion with ground glass appearance involving right sided ribs . involvement of the sphenoid wing ( commonly described as the pirate sign ) was also better depicted with spect / ct . tc-99 m mdp whole body images show multiple sites of increased tracer uptake , including the skull and facial bones , multiple ribs , pelvis and bones of both lower limbs . the pirate sign indicates involvement of the right sphenoid wing hybrid spect / ct fusion to determine the extent of skull and facial bone involvement shows intense tracer uptake in the sphenoid , ethmoid and frontal bones non - contrast ct scan of the chest shows bony expansion and deformity of the right ribs , where intense osteoblastic activity was detected fd is postulated to occur as a result of a developmental failure in the remodeling of primitive bone to mature lamellar bone and a failure of the bone to realign in response to mechanical stress . failure of maturation leaves a mass of immature isolated trabeculae enmeshed in dysplastic fibrous tissue that constantly turns over but never ( or very , very slowly ) completes the remodeling process . the combination of a lack of stress alignment and insufficient mineralization results in substantial loss of mechanical strength , leading to the development of pain , deformity , and pathologic fractures . the etiology has been linked with a mutation in the gs alpha gene that occurs after fertilization in somatic cells and is located at chromosome 20q13.2 - 13.3 . the monostotic presentation of fd is more frequent than polyostotic presentation , and lesions enlarge in proportion to skeletal growth . polyostotic lesions often continue to enlarge after skeletal maturity , with progressive deformity and an increase in pathologic fractures . patients with polyostotic disease and large , painful lesions in weight - bearing long bones are at the greatest risk for pathologic fracture . local expansion of fd in the maxilla , zygomatic , or ethmoid bones of the face can produce substantial functional and cosmetic deformity . at the initial presentation , radionuclide bone scintigraphy is useful to demonstrate the extent of the disease . actively forming lesions in adolescents have greatly increased isotope uptake that corresponds closely to the radiographic extent of the lesion . polyostotic fd has been demonstrated using f18-fluoride positron emission tomography / computed tomography ( pet / ct ) . the utility of volume rendering has also been demonstrated in evaluation of the bony deformities . the pirate sign has been previously described on planar bone scintigraphy in fd . recent studies have described the advantage of performing bone spect in addition to ct to determine the extent of fd in the skull base and of hybrid spect / ct imaging in fd of the lumbar vertebra . the present case illustrates the utility of hybrid spect / ct in documenting the complete extent of bony involvement of the skull base .

polyostotic fibrous dysplasia is a rare progressive benign disorder of the bone . bone scintigraphy is extremely useful in the initial evaluation for identifying the extent of disease . we report a case presenting with pathological fracture of the shaft of the right femur . after treatment of the fracture , bone scintigraphy revealed involvement of multiple bones including the skull and facial bones . the utility of single - photon emission computed tomography / computerized tomography in the evaluation of the extent of skull base involvement is highlighted .

a recent report in critical care demonstrates the types of steps hospitals are taking to address the growing problem of icu capacity constraints . these steps are often necessary , as icu strain leads to serious , real - world problems . for example , both admission delays from the emergency department to the icu and premature discharges from the icu to the ward are associated with increased mortality . moreover , although the data are mixed , new evidence suggests that when icus are strained , patients in the icu experience a greater risk of death . cancelling high - risk elective surgeries due to a lack of appropriate postoperative care means less revenue at a time when many hospitals are struggling financially . clearly the stakes are high . when faced with icu capacity constraints , however , hospitals have a limited number of options . the first , and perhaps most obvious , option is to simply add more icu beds . hospitals are taking this approach in the united states , where the number of icu beds is increasing over time . however this approach is misguided at best and harmful at worst - hospitals vary in the degree to which they use intensive care without much variation in outcome , suggesting that many icu patients do not really benefit from icu - level care . additionally , increasing the number of icu beds increases the hospitals fixed costs while at the same time creating waste in the system during times when the icu is not full . another option is to create alternative levels of care within the hospital for moderate - risk patients who may not need the icu . these alternatives can take the form of step - down units for patients in recovery or , as demonstrated by kastrup and colleagues , expanded post - anesthesia care units ( pacus ) that can care for intermediate risk , short - stay patients . the benefits of these approaches are that they increase icu capacity more efficiently than simply adding icu beds , since these types of beds are cheaper to maintain . as a case in point , in kastrup and colleagues ' study the hospital case mix index - a measure of hospital efficiency related to the average cost per case - increased from 0.286 to 0.309 , indicating a lower cost per case and , presumably , higher operating margins . at the same time , length of stay in the icu increased - probably due to both removal of short - stay postoperative patients from the denominator and a lack of bed pressure to discharge patients earlier in their treatment course . although at first glance this move appears to have been a good one for the hospital , it is worth noting several caveats that could cause efforts like these to backfire . first , increasing icu capacity by shuttling some postoperative patients through the pacu could just result in more low - risk patients being admitted from the ward . this effect would increase the cost of care for these patients , negating other cost savings . second , this move presupposes that an intensivist and trained icu nurses are available to staff the pacu . in many health systems , in addition to these caveats , kastrup and colleagues ' study has some noteworthy limitations . the case mix index is a crude measure of hospital efficiency , and actual costs , charges and margins are not reported . also , this was a single - center , before - after study that did not control for severity of illness . at least some of these changes are probably due to differences in severity of illness on admission and routine temporal trends , rather than due to the staffing change itself . despite these limitations , kastrup and colleagues ' study provides important lessons about the risks and rewards of expanding icu capacity . providing high - quality critical care in the era of capacity constraints requires creative solutions . adding more icu beds is conceptually easy but is also costly and inefficient . developing new service lines that can care for intermediate - risk patients is more efficient , but is only of value in some circumstances . for example , the high - intensity pacu approach of kastrup and colleagues will not work for icus with low numbers of postoperative patients or for icus that only care for extremely high - risk surgery patients that almost always require icu admission . finally , we must remember that much of icu utilization is overuse - many patients , especially those at very high risk of death , would not want intensive care at their end of life . addressing capacity constraints purely by adding capacity , rather than working to prevent overuse , may be a missed opportunity to better align care with patient preferences . otherwise we risk making changes that are purely about improving the bottom line , rather than about improving care for our patients .

icu capacity strain is associated with increased morbidity and lost hospital revenue , leading many hospitals to increase the number of icu beds . however , this approach can lead to inefficiency and waste . a recent report in critical care highlights a different approach : creating new service lines for low - risk patients . in this case , the authors started a post - anesthesia care unit with an intensivist - led care team , resulting in lower hospital costs with no changes in icu mortality . although this type of change carries some risks , and will not work for every hospital , it is an example of the creative solutions hospitals must sometimes undertake to maintain the supply of critical care in response to a rising demand .

obturator hernias ( ohs ) are rare ; they represent only 0.051.4% of all abdominal wall hernias . the typical patient with an women are affected nine times more frequently than men , because of broader pelvis with a larger triangular obturator canal opening with a greater transverse diameter , and a history of pregnancy . additional contributing factors are multiparity , chronic illness , malnutrition and conditions associated with increased intra - abdominal pressure . a 88-year - old woman presented to the ed with abdominal pain , vomiting , right hip pain and diarrhoea . medical co - morbidities include ischaemic heart disease , hypertension and bilateral osteoarthritis of the hip . her surgical history includes three caesarean sections , open cholecystectomy , umbilical hernia repair and left mastectomy for breast cancer . a computed tomography ( ct ) abdomen revealed small bowel obstruction due to the right oh ( fig . 1 ) and a trial of conservative management was made for patient due to her age , multiple co - morbidities and patient 's wishes . the patient re - presented 1 month later with small bowel obstruction and pain radiating down medial left leg . abdominal x - ray was consistent with small bowel obstruction ( fig . 2 ) and intra - operatively , there was a large right oh containing a small bowel , which was reduced , and a bard polypropylene mesh plug inserted into the defect and fixed with prolene interrupted sutures . the patient made an unremarkable recovery , and she was discharged 3 days after the operation . figure 1:(a and b ) small bowel obstruction secondary to a right oh . ( a ) coronal and ( b ) axial . figure 2:abdominal x - ray showing dilated small bowel loops and severe osteoarthritis changes in both hips . figure 3:(a and b ) small bowel obstruction secondary to a left oh . ( a ) coronal and ( b ) axial . ( a and b ) small bowel obstruction secondary to a right oh . ( a ) coronal and ( b ) axial . abdominal x - ray showing dilated small bowel loops and severe osteoarthritis changes in both hips . ( a and b ) small bowel obstruction secondary to a left oh . ( a ) coronal and ( b ) axial . it occurs when viscera herniates through the obturator canal , through which the obturator vessels and nerve pass to reach the hip . three stages of oh formative have been described : ( 1 ) pre - peritoneal connective tissue and fat enter the obturator canal ; ( 2 ) a dimple is formed in the peritoneum over the internal orifice of the obturator canal and progresses to the invagination of a peritoneal sac and ( 3 ) viscera , typically ileum , enters the sac . in an emaciated patient , the loss of protective pre - peritoneal fat over the obturator canal increases the risk of herniation . according to a case series of 30 patients by mayo clinic , the most common presenting signs and symptoms were bowel obstruction ( 63% ) , abdominal / groin pain ( 57% ) and a palpable lump in medial aspect of thigh ( 10% ) . romberg sign , which is pain along the distribution of the obturator nerve , is present in 37% of patients . high morbidity in oh is directly related to the advanced age of the patients , diagnostic delay , gangrene and bowel perforation , deterioration and disability of the patients , and associated chronic diseases [ 7 , 8 ] . as such , conservative management has little or no place in the management of oh , as is proved in our case where conservative management did eventually fail . the early diagnosis is challenging when the symptoms and signs are non - specific . among the various radiologic diagnostic modalities , ct scan has superior sensitivity and accuracy , as it allows definitive diagnosis of oh before laparotomy , and it can also show incarcerated bowel in the obturator foramen , with contrast scans having the ability to demonstrate any ischaemia or infarction . in a setting where ct is not available , plain abdominal radiographs can show signs of bowel obstruction , and ultrasound examination may reveal a hypoechoiec mass reflecting a dilated oedematous bowel segment . oh repair is usually accomplished by a midline laparotomy and primary repair . however , with the advent of laparoscopy , additional choices of mesh , and the possibility of a pre - operative diagnosis , other options for repair now exist . laparoscopic repair is only suitable for elective repairs , mostly when oh presents as an incidental intraoperative diagnosis during a laparoscopic hernia repair or other pelvic operation . a midline laparatomy was applied in this case because it has the advantages of better exposure and facilitation of bowel resection when necessary . we used a prosthetic plug to reinforce the obturator foramen in one side and a simple primary closure for the other side , and the outcome was satisfying . after reduction of the contents , it is necessary to check the viability of the bowel and perform segmental resection of ischaemic or gangrenous areas . in conclusion , they should always be suspected when a thin elderly woman presents with symptoms of bowel obstruction or non - specific pain over the thigh and hip .

obturator hernia ( oh ) is a rare type of pelvic hernia . it can cause significant morbidity and mortality , especially in the elderly age group . delayed treatment is associated with high rates of strangulation ( 25100% ) . we present an 88-year - old woman who presented with symptoms of bowel obstruction and right hip pain . computed tomography ( ct ) abdomen revealed bilateral ohs and bowel obstruction secondary to the right oh . she was managed conservatively due to her age and co - morbidities and her bowel obstruction subsequently resolved . she was discharged , only to re - present 1 month later with similar complaints . a repeat ct scan revealed bilateral ohs and bowel obstruction due to the left oh . she underwent midline laparatomy and both ohs were reduced . the right oh was fixed with polypropylene mesh plug and the left oh was fixed with primary closure . the patient recovered and no recurrence was noted during follow - up .

a traumatic right diaphragmatic rupture as the result of blunt trauma is a rare condition . the overall incidence of diaphragmatic rupture after blunt trauma is 0.8 - 3.6% ( 1 ) . most injuries are due to vehicular - related incidents ( 79.5% ) and falling from a height ( 15.9% ) ( 2 ) . right - sided tears are significantly less likely than left - sided tears , 27.3% and 68.2% respectively ( 3 ) . the correct diagnosis of diaphragmatic injury is initially missed in 12%-66% ( 1 ) delayed diagnosis and treatment of diaphragm rupture is associated with increased rates of morbidity and mortality . in our case on our outpatient clinic , a 37-year - old man was presented with 31 years before a fall from a wall of 3 meters on his right side . next to this major event the man was involved in a moped -car accident with only his face wounded , 18 years ago . during his life the patient presented to us with primary complaints of progressive , stabbing pain in the upper right abdomen and right lower thorax with simultaneous periods of dyspnoea . the symptoms worsened over a year , eventually leading to shortness of breath during rest . beside this presentation the patient had right upper abdominal pain while eating spicy food . on admission , his vital signs were stable and colour was fair . pulmonary examination revealed diminished breath sounds at the basal right hemithorax and the diaphragm was determined to be higher on the right by percussion . the diagnosis was confirmed by thoracic - abdominal x - rays and computerised tomography ( ct ) imaging , which revealed intra - thoracic displacement of the liver and also the gallbladder ( figure 1 ) . an elective thoracotomy in the sixth intercostal space was performed with repairing the diaphragmatic hernia ( figure 2 ) . the liver with gallbladder was replaced in the abdominal cavity , after adhesiolysis of the lung from pleura and diaphragm , whereupon the diaphragm was closed tensionless by running technique with non - absorbable sutures . two drains were left behind , one near the diaphragm and one in the right upper thorax . right sided diaphragmatic rupture with consequently hepatothorax is a rare condition . blunt traumatic diaphragm rupture a delay could result in increased rates of morbidity and mortality ( 5 ) . in case of hepatothorax , hypovolemic shock can occur , because of possible kinking of the inferior vena cava with obstruction of the blood . in this case there was a lateral impact on the chest , which distorted the chest wall and sheared the diaphragm . there remains doubt about the cause of delayed diagnosis and treatment of this diaphragm injury , since it could occur as the result of either delayed rupture or delayed detection . even if the herniation did not take place initially it would result in herniation eventually , because of the significant discrepancy between the intra - thoracic pressures and higher intra - abdominal pressure . most of the diaphragmatic ruptures occur on the left side , because the right diaphragm is congenitally stronger than the left . moreover the liver partially protects the right side as the impact can be spread over a large area . pain in the upper abdomen and lower thorax , dyspnoea , cyanosis and hypotension are typical symptoms of diaphragmatic injury , but if the rupture is small the patient can remain symptom free for a long time . the true incidence of traumatic diaphragm rupture is unknown because in 12 - 66% ( 1 ) of major trauma victims , the diagnosis is missed . there is no consensus yet , on the gold standard of imaging technologies to diagnose diaphragm rupture . based on the literature , diagnosis of diaphragmatic injury requires a high index of suspicion regardless whether you make an x - ray or ct . the choice of surgical approach includes thoracotomy , laparotomy , or both if it is necessary . the decision to repair the diaphragm either way is dictated by the stability of the patient and the presence of other associated organ injuries .

a traumatic right diaphragmatic rupture is an uncommon condition , as it occurs in 0.8 - 3.6% after blunt trauma . it is challenging to find the diagnosis immediately and is illustrated by the incidence of 12 - 66% initially missed diagnosis ( 1).most blunt traumatic diaphragm ruptures are an indication for early aggressive surgical intervention by way of thoracotomy , laparotomy , or both if it is necessary . delayed diagnosis and treatment of diaphragm rupture is associated with increased rates of morbidity and mortality . therefore , diagnosis of diaphragmatic injury requires a high index of suspicion . we report a case of a 37-year - old man with right diaphragmatic rupture after blunt injury 31 years prior to admission .

ameloblastic fibroma ( af ) is an extremely rare true mixed benign tumor that can occur either in the mandible or maxilla . it is frequently found in the posterior region of the mandible , often associated with an unerupted tooth . it usually occurs in the first two decades of life with a slight female predilection , causing delay in tooth eruption or altering the eruption sequence . small tumors are asymptomatic , while larger ones produce significant swelling of the jaws . on radiographs , smaller lesions are well circumscribed and unilocular with a sclerotic border , while larger ones are multilocular . histopathologically , af consists of odontogenic epithelium in the dental papilla - like background without dental hard tissue formation . similar lesions with hard tissue deposits are categorized as ameloblastic fibro - odontoma or odontoma depending on the degree of calcification . recently , there are few reports of this condition with high recurrence rates and malignant transformation . a 19-year - old female patient came to the department of oral medicine and radiology with a chief complaint of slowly progressive swelling on the right side of her lower posterior jaw . on intraoral examination , the right lower buccal vestibule was obliterated due to the expansion of the buccal cortical plate . the mucosa over the swelling was normal , except for slight blanching due to expansion of the buccal cortical plate . the lesion is seen extending from posterior aspect of first molar to the retromolar area , measuring 3 cm in size . on palpation , the swelling was slightly tender and no abnormality was detected in the adjacent teeth . panoramic radiograph showed a unilocular radiolucent area with well - defined borders , involving the posterior aspect of the right mandible . the lesion was measuring approximately 3.5 cm in size and was extending posteriorly from the distal aspect of the second molar to the retromolar area . microscopically , hematoxylin and eosin sections showed islands and strands of epithelial cells in a loose connective tissue stroma resembling primitive dental papilla [ figure 1 ] . the peripheral epithelial cells lining the islands and strands were low columnar , similar to the cells found in the peripheral layer of the follicle in ameloblastoma . the connective tissue resembled cellular fibroblastic tissue similar to the dental papilla in the developing tooth . hyaline - like tissue is also seen adjacent to the epithelial strands and islands [ figure 2 ] . it was interesting to note that both the epithelial islands and connective tissue stroma revealed high cellularity when compared with the conventional lesions of af . however , severe dysplastic features such as cellular and nuclear pleomorphism and increased number of abnormal mitotic figures were not observed . in this context , immunohistochemistry for ki-67 [ figure 3a ] proliferative marker along with proper positive [ figure 3b ] and negative [ figure 3c ] controls were performed . this had ruled out the diagnosis of a malignant tumor , confirming the diagnosis of af . photograph showing strands and islands of odontogenic epithelial cells in a loose connective tissue stroma resembling primitive dental papilla ( h and e 100 ) photograph showing the peripheral cells resembling ameloblasts with hyaline - like material surrounding the islands ( h and e 400 ) ( a ) photograph showing negative staining for ihc marker ki-67 antigen ( b ) photograph of positive control for ihc marker ki-67 antigen ( c ) photograph of negative control for ihc marker ki-67 antigen the histopathological finding of high cellularity in this lesion is uncommon as conventional afs show mild to moderate cellularity in a loose myxomatous connective tissue background . our case of af with high cellularity is unusual in the context of its histopathology .

ameloblastic fibroma is a rare odontogenic tumor comprising neoplastic epithelial and mesenchymal tissues . this lesion was previously considered to be a benign lesion with very limited recurrence rate and malignant transformation . however , recent reports have suggested that this lesion has the potential for recurrence and malignant transformation . in this brief report , we report a case of af in the context of its high cellularity on histopathological examination .

according to popular studies , the attempted resuscitation of patients in traumatic cardiac arrest in the prehospital care environment should not be pursued due to undo risk to the provider and has been shown to be ineffective . however , after review of current literature , sherren and colleagues developed and published in a recent edition of critical care a detailed treatment algorithm for their helicopter emergency medical service ( hems ) that encourages aggressive resuscitation for patients in traumatic cardiac arrest ( tca ) . what is known in a review of the quoted literature is that in the prehospital care environment , the survival rate of tca patients is 0 to 3.7% , but in newer published studies survivability has risen to 7.5% . what we already know is that prehospital medical cardiac arrest ( mca ) survival is approximately 9.8% , with in - hospital cardiac arrest survival at 24.2% . in mca , chest compressions , defibrillation , medication , and oxygenation are the mainstay treatment tools . where the tca patient differs is that many do not have extensive co - morbidities or coronary artery disease ; their arrest is primarily due to one of or a combination of factors : hypovolemia , obstruction of blood flow and hypoxia . in the patient with thoracic trauma , these causes are addressed by well described techniques of thoracostomies , endotracheal intubation and blood products . this is followed by a clamshell thoracotomy , allowing for a better chance for hemorrhage control and treatment of hemopericardium if found . sherren and colleagues discuss a very well outlined pathophysiology and rationale for tca survivorship in their article . although mca and tca are not the same diseases , their survival statistics are interesting and possibly some inference can be made when mca data are more closely observed . it appears that the differences between mca survival in the prehospital versus a hospital setting , where admitted patients are older with increased morbidities , might be due to the personnel performing the resuscitation . staffing models for emergency medical services ( ems ) , especially for hems , differ between the us system and the european model . in the us , pre - hospital ems systems ( including most hems ) are staffed by allied health professionals and not by physicians . in the european model ( including australia ) hems are staffed by well trained physician / paramedic / nurse teams and this is possibly where the difference occurs for survival for tca patients . in multiple european studies it was noted that there was a decrease in mortality of trauma patients without a decrease in scene time when a physician was part of the flight crew [ 6 - 9 ] . in the us , less than 5% of hems are staffed by physicians , and most of those involved in such teams are in their first few years out of medical school . thus , no us ems systems have fully trained physicians as part of their standard ambulance crew . a reasonable question to consider is whether staffing is the reason why tca statistics differ between the us and european models ? paramedic training teaches needle thoracostomy for suspected tension pneumothorax , which in many jurisdictions do not need online direct physician permission as it is deemed life saving and with limited risk . however , it is well known that in patients with larger chest walls , almost 50% of the time the needle fails to reach the plural space to relieve the obstruction of blood flow caused by the tension pneumothorax . on the contrary , the placement of a tube or finger thoracostomy are very successful and fairly routine in ems systems staffed with experienced physicians with excellent results . it can not be fully applicable to hems not staffed by a well trained physician , as the proficiency of thoracotomy is an advanced skill that takes practice and years of anatomical training to be able to perform well . as the authors stated , more study is needed to see if it is the depth of training or the protocols that are the reason for the increases in survivorship from tca . i do not believe that this algorithm will be promoted in hems systems staffed only by paramedics and nurses , as their level of training does not allow for advanced procedures such as these . therefore , one should expect that prehospital attempts at the resuscitation of the tca in those systems without physicians on board will remain futile . ems : emergency medical services ; hems : helicopter emergency medical service ; mca : medical cardiac arrest ; tca : traumatic cardiac arrest .

traumatic cardiac arrest resuscitation is considered a heroic and futile endeavor . however , newer articles have more promising statistics and divide between prehospital ground and helicopter transport . here we discuss why there might be a difference in the survivability of this subset of trauma patients .

chylopericardium is a rare clinical entity that is characterized by the presence of chyle in the pericardial cavity . its association with lymphangiomas , cystic hygromas , thoracic and cardiac surgery , trauma , radiation and malignancy is well reported [ 2 , 3 ] . however , primary chylopericardium , in which there is absence of known precipitating factors , is rarely encountered in clinical practice . the severity of clinical manifestations of chylopericardium is varied and may range from the complete absence of symptoms to cardiac tamponade , and thus a high index of suspicion is required for the prompt recognition of the underlying diagnosis and management of its sequalae . in this report , we present a case of chylopericardium in a 23-year - old woman , presenting with acute shortness of breath in the background of extensive neck vein and superior vena cava ( svc ) thrombosis , of unknown aetiology . she had been admitted into hospital 2 weeks earlier due to a community acquired pneumonia with parapneumonic collection , which required drainage and intravenous antibiotics . her initial recovery was uneventful and thus the patient was discharged home a few days later . on this admission , a large cardiac shadow was seen on the chest radiogram , and pericardial effusion confirmed on computed tomography ( ct ) of the thorax . the scan also demonstrated diffuse lymphadenopathy as well as extensive and multifocal thrombosis of the internal jugular veins bilaterally , the brachiocephalic vein and of the svc , managed with therapeutic dose of subcutaneous tinzaparin . further diagnostic screening for rheumatological , auto - immune and infectious causes was unremarkable , whilst lymph node biopsies were negative for malignancy . aspiration of the pericardial collection was suggestive of the presence of chyle , a suspicion that was confirmed on biochemical analysis of the aspirate . cytology and cultures of the aspirate were negative for malignant and infectious causes , respectively ( fig . figure 1:pre - operative chest radiograph and axial view of a ct thorax , demonstrating a large pericardial collection . pre - operative chest radiograph and axial view of a ct thorax , demonstrating a large pericardial collection . after pericardiocentesis , the patient had recurrence and was thus taken to theatre , underwent an anterior left mini - thoracotomy , through which a pericardial window was fashioned , 600 ml of chyle were collected and an 18 fr drain was placed in the pleural cavity . her postoperative course was uneventful , drain removed on day 3 , and she was discharged home as the collection and her symptoms had resolved . she remains symptom and collection free at 1 year postoperatively , with no evidence of recurrence on follow - up chest radiographs . the association of chylopericardium with trauma , previous thoracic or cardiac surgery , congenital lymphangiomas , radiation and malignancy is well recognized [ 25 ] . however , primary chylopericardium is a clinical entity that is more rarely encountered and only diagnosed if all known precipitants have been excluded [ 68 ] . its pathophysiology remains controversial , and is thought to be related to either elevated pressure in the thoracic duct , or to abnormal communications between the thoracic duct and the lymphatics of the pericardium [ 3 , 6 ] . clinical manifestations are varied as it is the age spectrum of patients affected , with reports of chylopericardium in neonates through to older adult . the imaging modalities that can be used to ascertain the underlying cause , with varying specificity and sensitivity , include lymphangioscintigraphy , lymphangiography , monitoring of chest radioactivity after oral intake of i - triolein and observation of the distribution of sudan iii dye in the pericardial cavity after ingestion [ 2 , 3 ] . however , the diagnosis still relies on the cytology , chemistry and microbiology of pericardial aspirate , obtained via pericardiocentesis . the management of this condition though controversial has two main therapeutic aims . this can be achieved via pericardiocentesis or surgically with the formation of a pericardial window / partial pericardiectomy , which can be combined with ligation of the thoracic duct and by conventional open methods or via video - assisted thoracoscopic surgery ( vats ) . the second aim is the avoidance of metabolic , nutritional and immunological compromise , resulting from the loss of chyle , via a diet rich in medium chain triglycerides or , if necessary total parenteral nutrition [ 2 , 9 , 10 ] . in this instance as pericardiocentesis is associated with a high incidence of recurrence , we opted for the pericardial window , combined with dietetic input to address the patient 's nutritional requirements . the patient having been informed of her options , opted for the option of conventional surgery in preference to vats , a method that can also be safely used for the same purpose [ 24 ] . the patient remains symptom - free a year postoperatively , and has been put on a surveillance programme with frequent follow - up . in conclusion , chylopericardium is a clinical entity that is not frequently encountered in the daily clinical practice and requires a high index of suspicion . its management needs to address both the prevention of cardiac tamponade and the correction of nutritional and metabolic compromise that can ensue .

chylopericardium is a recognized complication of thoracic trauma , surgery or malignancy . idiopathic or primary presentations , however , are rarely encountered in clinical practice . the severity of its presentation varies from the complete absence of symptoms to cardiac tamponade . we present the case of a 23-year - old woman with chylopericardium and extensive neck vein thrombosis that was managed surgically with a pericardial window .

a 56-year - old man presented with a 12-month history of tingling ulcers on both feet ( figure 1a ) . he was otherwise well . on examination there were ulcers on both feet , 11.5 cm in diameter with a macerated edge . skin - colored to red - brown papules were noted on both knees ( figure 1b ) as well as irregular red circles on both calves . skin biopsies taken from knee papules and red circles on the lower leg showed extravascular eosinophilic deposits in the dermis ( figure 1c ) , which stained positive with pas , igm ( figure 1d ) and kappa stains , but negative with congo red . investigations are summarised here : serum kappa free chains , 85.9 mg / l ( normal 3.319.4 mg / l ) ; serum lambda free chains , 17 mg / l ( normal 7.726.3 mg / l ) ; serum free kappa chains /free - lambda chains ratio , 5.05 ( normal 0.261.65 ) ; serum electrophoresis , elevated ig m gradient ; serum immunofixation , monoclonal ig m / kappa - type immunoglobulin ; urine immunofixation , monoclonal kappa - free chain ; bone marrow microscopy , infiltrate of lymphoplasmocytic cells ( 15% ) ( most cd20 and cd138 positive ) with preferential expression for igm . the cutaneous manifestations of waldenstrm macroglobulinaemia have been classified as either infiltration by neoplastic cells or those related to the paraproteinaemia , such as immunoglobulin deposition , cryoglobulinaemia or blood hyperviscosity . approximately 5% of patients with waldenstrm macroglobulinaemia develop cutaneous manifestations , with neoplastic infiltration being the least common . prognosis does not appear to be influenced by the presence or absence of cutaneous disease . the patient presented with a burning red face which was initially diagnosed as rosacea but with time the more typical purple infiltration developed . macroglobulinaemia the neuropathy is typically sensorimotor , initially with paraesthesias and numbness in the feet and hands . the possible mechanisms in waldenstrm macroglobulinaemia include microangiopathy , direct infiltration of nerves , endoneural deposition of igm protein or amyloidosis , hyperviscosity or immunoglobulin deposit in blood vessels . the tingling ulcers in our patient are probably an example of this and , although biopsies were not taken from the ulcers , may have been due to igm deposition given he also had macroglobulinaemia cutis . there has been only one other case reported , to our knowledge , of ulcers on the sides of the feet . these developed in areas of hyperkeratosis and were associated with dysaesthesia and a burning sensation . however , the biopsy showed a leukocytoclastic vasculitis with a neutrophilic infiltrate . another report described igm dermal deposits that presented as painful hyperkeratotic papules on the soles of the feet that were not ulcerated . storage papules , also known as macroglobulinaemia cutis , are rare but well described and are usually found on the knees or other extensor surfaces . they are usually skin - coloured , red - brown or translucent , and may be umbilicated , crusted or haemorrhagic . after five cycles the lower limb ulceration and neurological symptoms had resolved , although the blood igm level did not change . waldenstrm macroglobulinaemia is a low - grade lymphoplasmacytoid lymphoma that usually presents with nonspecific systemic symptoms , but cutaneous changes may be the initial manifestation and hence may present first to a dermatologist . although our patient presented with tingling ulcers , the diagnosis was reached after skin biopsy from knee papules demonstrated dermal immunoglobulin deposition .

a 56-year - old man presented with tingling ulcers on the feet . on further skin examination , papules on the knees were observed . biopsies revealed extravascular eosinophilic deposits of igm , and waldenstrm macroglobulinaemia was diagnosed . the skin manifestations have resolved with chemotherapy . peripheral neuropathy and storage papules are rare manifestations of waldenstrm s macroglobulinaemia .

phosphate - based cathartic agents can be bought over the counter ( otc ) as remedial for constipation . it is widely prescribed for colon preparation before any form of intra - abdominal surgery or colonoscopy . we report a 49-year - old female who had a history of end - stage renal failure secondary to iga glomerulonephritis . she has been on regular hemodialysis since 2001 . she was found to have right renal cell carcinoma during a routine 5 yearly ultrasound surveillance . she was referred to a urologist who arranged for an elective laparoscopic nephrectomy of her right kidney . the calcium and phosphate levels taken 1 month before the surgery were normal at 2.75 mmol / l and 0.97 mmol / l , respectively , and she had a complaint of severe constipation from tumor - related hypercalcemia . one day before the planned surgery , she volunteered information that she had purchased two sachets of otc generic oral sodium phosphate ( osp ) for her severe constipation . calcium and phosphate levels were 1.08 mmol / l and 5.88 mmol / l , respectively . the strong temporal relationship between the otc consumption and the acute metabolic abnormalities led nephrologists to believe that this was an unusual case of acute hypocalcemia and hyperphosphatemia secondary to osp . the repeat calcium and phosphate levels 4 h after dialysis were 2.34 mmol / l and 1.84 mmol / l . laxatives are solutions of certain ingredients introduced orally or rectally to induce laxation . the different categories of laxatives include hyperosmotic chemicals ( glycerin , sorbitol ) , lubricant ( mineral oil ) , salines ( sodium phosphate / sodium biphosphate ) , and stool softeners ( docusate potassium ) . it is frequently given in favor of standard polyethylene glycol - based lavage solutions because of the smaller required volume , which results in better patient compliance and improved colonic cleansing . in this case , according to the objective causality assessment by the naranjo probability scale , the causal association between osp and the adverse event was probable ( naranjo score = 6 ) . the adverse drug reaction was evaluated for causality assessment using the world health organization - uppsala monitoring center ( who - umc ) criteria . the assigned causality category with the who - umc criteria for this adverse drug reaction was likely . in january 2014 , the united states food and drug administration issued a warning that using more than one dose of otc sodium phosphate product in 24 h can cause rare but serious kidney injury , arrhythmias , or even death . various types of metabolic derangement , i.e. , hyperphosphatemia , hypocalcemia , hypernatremia , hypokalemia , and metabolic acidosis have been associated with osp . hyperphosphatemia is more likely to occur in patients with renal insufficiency , who have decreased excretion of phosphate . the other at - risk groups are those who are elderly , those who had intestinal obstruction , decreased intestinal motility , or on concomitant medications that can reduce renal perfusion ( diuretics , angiotensin converting enzyme inhibitor , or angiotensin receptor blocker ) . patients with history of congestive heart failure should also use osp with cautioned as the resulting hypernatremia could lead to acute fluid overload . even in patients with normal renal function , significant changes in the serum calcium and phosphate levels occurred after osp . in some occasions , this can lead to acute kidney injury . the sole causative factor could be explained by the case of biopsy - proven phosphate - induced nephrocalcinosis reported by desmeules et al . , where the nature and localization of the lesions strongly suggest that phosphate ingestion led to obstructive calcium - phosphate crystalluria , followed by intratubular nephrocalcinosis . phosphate - based cathartic agents should only be used in patients with normal renal function . it may be prudent to evaluate serum calcium and phosphate levels before and after administration of sodium phosphate . otc osp abuse should be suspected when a patient with renal impairment and constipation presents with sudden hypocalcemia and hyperphosphatemia .

oral sodium phosphate ( osp ) , an effective bowel purgative , is available over the counter ( otc ) and requires a substantially lower volume than polyethylene glycol - based preparative agents . rarely , osp consumption has been associated with acute hypocalcemia and hyperphosphatemia . we describe a case of chronic kidney disease patient developing symptomatic hypocalcemia following otc osp .

classic neuroimaging findings described in gm2 gangliosidosis is hyperdense signal in bilateral thalami in non - contrast computed tomography ( ncct ) scan and hypointensity in t2 weighted mri images . hyperdens thalamus in ncct head in a child with neuroregrssion , facial dysmorphism and organomegaly , should lead us to think about gm1 gangliosidosis . a 16-month - old girl presented with history of regression of mile stones for last 6 months . psychomotor development was normal until 12 months of age ; subsequently , she gradually lost ability to sit , neck control , and social smile . she had attained vocabulary of single syllable by 1 year , but subsequently lost it . there was no significant family history . on examination , she had coarse facies , horizontal nystagmus , hepatosplenomegaly , and multiple mongolian spots [ figure 1 ] . on fundus examination , she had bilateral macular cherry red spots [ figure 2 ] . skeletal survey revealed dysostosis multiplex at dorsolumbar junction , as superiorly notched ( inferiorly beaked ) vertebral bodies in the lateral view at the thoracolumbar junction [ figure 3 ] . clinical diagnosis of gm1gangliosidosis was supported with mri brain findings and confirmed with absence of -galactosidase enzyme activity in leukocytes [ figure 4 ] . clinical pictures of a 16-month - oldgirl showing massive hepatosplenomegaly , excessive mongolian spots , and severe failure to thrive photograph of retina in patient with gm1gangliosidosis showing cherry red spot and optic disc edema x - ray of same patient showing dysostosis multiplex at lumbar spine and ncct scan of brain ( axial sections ) at level of thalamus showing bilateral hyperdense thalamus axialt1-weighted image and t2-weighted image at the level of thalamus show diffuse dysmyelination of white matter with bilaterally symmetric thalamic signal change , which appear hyperintense on t1-weighted and hypointense on t2-weighted images gm1gangliosidosis is a rare autosomal recessive lysosomal storage disorder caused by deficiency of lysosomal enzyme -galactosidase , resulting in progressive neural and visceral accumulation of gm1gangliosides , its asialo derivative ga1 , and other minor glycolipids and glycopeptides . three clinical phenotypes can be distinguished and classified by age of onset : infantile , late infantile / juvenile , and adult . the age of onset and rate of progression of the disease depend on the residual activity of enzyme -galactosidase . infantile gm1gangliosidosis , the most common and severe form , is characterized by facial and skeletal abnormalities and neurological deterioration before the age of 6 months . this disorder can be diagnosed by several ways , including lysosomal enzyme assay of low -galactosidase activity in peripheral blood leukocytes or cultured skin fibroblasts , detection of abnormal urinary oligosaccharide excretion , and rectal biopsy . prenatal diagnosis by measurement of enzyme activity in amniotic fluid and cultivated amniotic fluid cells has also been established . the classic neuroimaging findings in patients with infantile gm1gangliosidosis include thalamic hyper density on non contrast computed tomography ( ncct ) scan and hypointense signal of the thalami with persistent high signal intensity of the white matter on t2-weighted images , indicating severely defective myelination[13 ] [ figure 4 ] . significant white matter abnormalities are present only in the infantile form of gm1gangliosidosis , but they are also described in other infantile - onset neuronal storage disorders , such as gm2gangliosidosis and infantile neuronal ceroid lipofuscinosis . a paucity of myelin in gm1gangliosidosis has been demonstrated by several classical neuropathologic and neuroimaging studies of patients and animal models .

gm1gangliosidosis is a rare autosomal recessive lysosomal storage disorder caused by deficiency of enzyme -galactosidase , resulting in progressive neural and visceral accumulation of gm1gangliosides . coarse facial features , bilateral cherry red spots , and dysostosis multiplex are important clue to diagnose this condition . we describe a case of gm1gangliosidosis with dysostosis multiplex and characteristic magnetic resonance imaging findings .

extragonadal occurrence is rare , and it is usually found in the anterior mediastinum , retroperitoneum , and sacrococcygeal region . primary retroperitoneal teratoma is unusual in patients above the age of 30 years ; only 10% have been reported to occur after that age . teratomas confined to the adrenal gland are exceptional ; only 3 cases have been reported in the english - language literature . we report 2 cases of mature teratomas of the adrenal gland that were laparoscopically excised . an 8-year - old boy was seen for lumbar pain after a fall . upon physical examination , excretory urogram revealed a mass in the upper pole of the right kidney ( figure 1 ) . abdominal computed tomography showed an 8-cm heterogenous right adrenal lesion with calcifications ( figure 2 ) . laparoscopic transperitoneal exploration was carried out , and a complete right adrenal resection was performed . no bleeding occurred during surgery , and the patient was discharged home after 48 hours . the tumor was found to be a mature cystic teratoma located in the right adrenal . three years after surgery , the patient remained asymptomatic and was free of tumor recurrence . a 61-year - old obese woman was incidentally diagnosed with a left adrenal mass during spinal surgery . computed tomographic scan revealed an 8-cm solid left adrenal lesion ; no calcifications were noted . the patient underwent percutaneous drainage of the collection and was discharged on postoperative day 10 . pathologic examination of the tissue confirmed a mature cystic teratoma that measured 8 cm in diameter and weighed 54 g. after 12 months , a small access port - site hernia was diagnosed . an 8-year - old boy was seen for lumbar pain after a fall . upon physical examination , excretory urogram revealed a mass in the upper pole of the right kidney ( figure 1 ) . abdominal computed tomography showed an 8-cm heterogenous right adrenal lesion with calcifications ( figure 2 ) . laparoscopic transperitoneal exploration was carried out , and a complete right adrenal resection was performed . no bleeding occurred during surgery , and the patient was discharged home after 48 hours . the tumor was found to be a mature cystic teratoma located in the right adrenal . three years after surgery , the patient remained asymptomatic and was free of tumor recurrence . a 61-year - old obese woman was incidentally diagnosed with a left adrenal mass during spinal surgery . computed tomographic scan revealed an 8-cm solid left adrenal lesion ; no calcifications were noted . the patient underwent percutaneous drainage of the collection and was discharged on postoperative day 10 . pathologic examination of the tissue confirmed a mature cystic teratoma that measured 8 cm in diameter and weighed 54 g. after 12 months , a small access port - site hernia was diagnosed . retroperitoneal teratomas are extremely rare . generally , the exact location is difficult to define . differentiation of a retroperitoneal teratoma in the para - adrenal area from a true adrenal teratoma is tricky . to our knowledge , only 3 cases of para - adrenal teratoma and adrenal teratoma have been described . clinical presentation at diagnosis is usually vague with unspecific lumbar and abdominal pain . on computed tomographic scans magnetic resonance t2 weighed images show teratoma as a highlighted intensity around the tumor components . according to lam et al , of 149 consecutive laparoscopic adrenalectomies performed in the last 10 years at our institution , only 2 ( 1.34% ) were adrenal teratomas . pathologic criteria for benign lesions were met in both cases : absence of malignant or immature elements in the tumor , absence of other similar lesions in other parts of the body , normal serum levels of afp and hcg , and absence of recurrence in the long - term follow - up . we prefer transperitoneal laparoscopic adrenalectomy for adrenal tumors , because it is a minimally invasive , well - tolerated , highly effective technique . laparoscopic transperitoneal adrenalectomy is a feasible and effective technique that enables excellent oncologic results . to our knowledge

background : teratoma is a germ - cell tumor that commonly affects the gonads . its components originate in the ectoderm , endoderm , and mesoderm . extragonadal occurrence is rare . teratomas confined to the adrenal gland are exceptional ; only 3 cases have been reported in the english - language literature . we report 2 cases of mature teratomas of the adrenal gland that were laparoscopically excised.methods:two patients ( ages 8 and 61 years ) were diagnosed with adrenal teratoma at our institution . radiological examination showed a solid 8-cm adrenal lesion in both cases . hormonal assessment was normal . both patients underwent laparoscopic transperitoneal adrenalectomy.results:surgical time was 120 minutes and 50 minutes , respectively . one patient was discharged on postoperative day 2 , and the other remained hospitalized until day 10 . the latter patient required percutaneous drainage of a retroperitoneal collection . both tumors were identified as mature cystic teratomas . no evidence was present of recurring disease in either patient.conclusions:adrenal teratoma is rare . laparoscopic transperitoneal adrenalectomy is a feasible , effective technique that enables excellent oncologic results . to our knowledge , this is the first report of laparoscopic adrenalectomy for pure adrenal teratoma .

alternative medicine refer to a broad set of health care practices that are not part of that country s own tradition or conventional medicine and are not fully integrated into the dominant health - care system . according to who they are used interchangeably with traditional medicine in some countries . homeopathic medicine , herbal medicine and acupuncture are the most common , albeit not the unique , cam forms in european countries . homeopathy is a method of medical practice that aims to improve the level of health of an organism through the administration of medicinal products selected individually according to the principle of similarity ( see text ) . since homeopathy is strictly individualized and takes into account the physical , emotional , mental , constitutional , biographical and environmental state , it is a medicine of the whole person . the term homeopathy comes from the greek ( omoios = similar , pathos = suffering ) . integrative medicine is not simply the combination of conventional medicine with complementary and alternative medicine . the consortium of academic health centers for integrative medicine defines it as the practice of medicine that reaffirms the importance of the relationship between practitioner and patient , focuses on the whole person , is informed by evidence , and makes use of all appropriate therapeutic approaches , healthcare professionals and disciplines to achieve optimal health and healing . alternative medicine refer to a broad set of health care practices that are not part of that country s own tradition or conventional medicine and are not fully integrated into the dominant health - care system . according to who they are used interchangeably with traditional medicine in some countries . homeopathic medicine , herbal medicine and acupuncture are the most common , albeit not the unique , cam forms in european countries . homeopathy is a method of medical practice that aims to improve the level of health of an organism through the administration of medicinal products selected individually according to the principle of similarity ( see text ) . since homeopathy is strictly individualized and takes into account the physical , emotional , mental , constitutional , biographical and environmental state , it is a medicine of the whole person . the term homeopathy comes from the greek ( omoios = similar , pathos = suffering ) . integrative medicine is not simply the combination of conventional medicine with complementary and alternative medicine . the consortium of academic health centers for integrative medicine defines it as the practice of medicine that reaffirms the importance of the relationship between practitioner and patient , focuses on the whole person , is informed by evidence , and makes use of all appropriate therapeutic approaches , healthcare professionals and disciplines to achieve optimal health and healing .

some physicians have incorporated some forms of complementary and alternative medicine ( cam ) or related medicinal products in their clinical practices , suggesting that an unconventional treatment approach might be seen as an integration rather than as an alternative to standard medical practice . among the various cams , homeopathy enjoys growing popularity with the lay population , but it is not acknowledged by academia or included in medical guidelines . the major problem is to establish the effectiveness of this clinical approach using the strict criteria of evidence - based medicine . this issue of the journal of medicine and the person collects contributions from some of the most prestigious centers and research groups working in the field of homeopathy and integrative medicine . these contributions are not specialized information but are of general interest , focusing on this discipline as one of the emerging fields of personalized medical treatment .

to report an effect of the full tendon transposition augmented with posterior intermuscular suture and recession - resection surgery , for the patient with monocular elevation deficiency ( med ) and large exotropia . full tendon transposition augmented with posterior intermuscular suture and recession - resection surgery was performed for a 26-year - old male patient had monocular elevation deficiency ( med ) and large exotropia . preoperative angle of deviation was 56 prism diopters ( pd ) hypotropia and 45 pd right exotropia , compared with 18 pd left hypertropia and 10 pd right esotropia postoperatively . essotropia persisted after 2.5 years , however , and so the right medial rectus was recessed after removal of the previous posterior intermuscular suture . at a three - year follow - up after the second surgery , alignment was straight in the primary position at near and far distances . full tendon transposition augmented with posterior intermuscular suture and recession - resection surgery was effective for a patient with med associated with significant horizontal deviation , and a second operation was easily performed when overcorrection occurred . a 26-year - old male patient had med and large exotropia from birth , and a marked limitation of supraduction in the affected eye . he had no significant medical or ophthalmic history of prior trauma . an examination revealed best corrected visual acuities of 20/40 in his right eye and 20/20 in his left eye . preoperative angle of deviation was 56 prism diopters ( pd ) hypotropia and 45 pd exotropia of the right eye ( fig . the full tendon transposition of horizontal recti muscles to superior rectus muscle parallel to the spiral of tillaux was performed after lateral rectus muscle recession 9.0 mm and medial rectus muscle resection 5.0 mm ( fig . the transposed horizontal recti muscles were augmented with a posterior intermuscular suture as we previously described.4 briefly , the posterior augmentation consisted of a 5 - 0 non - absorbable polyester suture with a t-5 spatulated needle ( dacron ; ethicon ) that was placed through 25% of the belly of each transposed and paralytic rectus muscle at 7 mm posterior from the original muscle insertion . postoperative angle of deviation improved to 18 pd hypertropia of the left eye and 10 pd esotropia of the right eye ( fig . binocular single visual fields improved to 65 from 0. 10 pd esotropia of the right eye persisted after 2.5 years , leading the patient to complain about the cosmetic problem . accordingly , the right medial rectus was recessed 5.0 mm from the spiral of tillaux after removal of the posterior intermuscular suture . at a three - year follow - up , alignment was straight in the primary position at near and far distances . there were no complications such as anterior segment ischemia during the surgery and postoperative follow - up . surgery is indicated in med if there is vertical deviation in the primary gaze , deviation causing suppression and amblyopia , diplopia in the primary gaze , and contracted binocular fields . in patients with med associated with a significant horizontal deviation , multiple extraocular muscle surgery or normal fellow eye surgery are generally necessary.1 - 3 most patients or their parents , however , do not allow surgery in the normal fellow eye , and surgery on the multiple extraocular muscles may cause anterior segment ischemia . full tendon transposition augmented with posterior intermuscular suture and recession - resection surgery can effectively correct patients with med associated with significant horizontal deviation , while reducing the risk of anterior segment ischemia and avoiding an operation on the normal eye . additionally , the intermuscular suture can be easily removed even when a second operation is needed . in this case report , full tendon transposition augmented with posterior intermuscular suture and recession - resection surgery was an effective and safe procedure in a patient with med associated with significant horizontal deviation .

purposeto report an effect of the full tendon transposition augmented with posterior intermuscular suture and recession - resection surgery , for the patient with monocular elevation deficiency ( med ) and large exotropia.methodsinterventional case report . full tendon transposition augmented with posterior intermuscular suture and recession - resection surgery was performed for a 26-year - old male patient had monocular elevation deficiency ( med ) and large exotropia.resultspreoperative angle of deviation was 56 prism diopters ( pd ) hypotropia and 45 pd right exotropia , compared with 18 pd left hypertropia and 10 pd right esotropia postoperatively . essotropia persisted after 2.5 years , however , and so the right medial rectus was recessed after removal of the previous posterior intermuscular suture . at a three - year follow - up after the second surgery , alignment was straight in the primary position at near and far distances.conclusionsfull tendon transposition augmented with posterior intermuscular suture and recession - resection surgery was effective for a patient with med associated with significant horizontal deviation , and a second operation was easily performed when overcorrection occurred .

brown - mclean syndrome ( bms ) is an infrequently diagnosed condition , defined by peripheral corneal edema that spares the center . clinically , bms is most often seen after cataract extraction but has been described after other surgeries as well ( e.g. , corneal transplantation ) [ 2 , 3 ] . nonsurgical insults such as lens subluxation [ 2 , 4 ] , angle closure glaucoma , myotonic dystrophy , and keratoconus have also been described . here , his past ocular history was significant for bilateral congenital cataracts which required bilateral cataract extraction by phacoemulsification with posterior chamber intraocular lens ( pciol ) implantation at 2 months of age . there was no other relevant medical ( topical or systemic medication ) or surgical history . despite this intervention , the patient developed bilateral amblyopia and had severe nystagmus when either eye was occluded . at the time of presentation , his visual acuity was hand motion in both eyes . slit lamp examination of the right eye revealed a clear cornea with a fine pigmented line involving 360 degrees of the peripheral endothelium and a clear pciol . the left eye revealed normal conjunctiva , a clear central cornea with 360 degrees of peripheral stromal corneal edema with microbullae without epithelial defect , or vascularization , and a clear pciol ( fig . these findings were consistent with incipient bms in the right eye and established bms in the left eye . bms , first described in 1969 , is a condition defined by the presence of peripheral corneal edema with sparing of the central cornea . in its initial phase , a pigmented line on the peripheral endothelium may be seen . on progression , our patient 's findings were consistent with early bms in the right and more advanced disease in the left eye . one previous report described a 12-year - old girl with pigmented endothelial precipitates in the inferior peripheral cornea in the setting of congenital cataract removal 11 years earlier . however , the diagnosis of bms was not certain given the lack of corneal edema . bms typically occurs , on average , 17 years after surgery , with a widely published range of 1 month to 34 years [ 3 , 4 , 6 , 7 , 8 ] . a recent randomized , controlled study in 114 patients who underwent cataract extraction for congenital cataracts evaluated outcomes after lens implantation versus no lens implantation . overall , complications were low . with regard to corneal edema , no patients in the aphakia group and 1 patient in the iol group developed central corneal edema that lasted more than 30 days . the pathophysiology , which leads to peripheral corneal edema as opposed to central changes , is still unclear . bms has been thought to be associated with altered dynamics of the iris and aqueous that can occur after surgery and/or trauma . bms may have a genetic influence as it was reported in three members of an extended family , with a strong family history of low vision and ruptured tendons . it has also been reported in two pairs of sisters , one pair of which had marfan syndrome . interestingly , the condition is typically stable without progressive central corneal decompensation , and , therefore , patients usually remain asymptomatic . although specular microscopy may be performed to monitor the condition , it may not predict the clinical course , as the central cornea usually remains transparent , even when the central cell density is low . however , transient central edema associated with increased intraocular pressure , foreign body sensation , infectious keratitis , bullous keratopathy , and corneal endotheliitis in patients with bms has been reported . as our patient was asymptomatic , at this stage , our plan is to observe him . however , prior reports of patients with bms described various treatments to alleviate ocular surface discomfort including topical corticosteroids , hypertonic solutions , and/or therapeutic contact lenses . other reported options include stromal micropuncture of the peripheral cornea and annular amniotic membrane transplantation [ 12 , 13 ] . in summary , our case highlights that bms may develop in children as well as in adults . all children who undergo ocular surgery or experience ocular trauma should be monitored on a regular basis for the development of this and other potential ocular complications .

the purpose of this manuscript is to report the case of a 12-year - old patient who presented for routine ophthalmic examination after congenital cataract surgery performed at 2 months of age . the patient was diagnosed with bilateral brown - mclean syndrome by slit lamp examination . no treatment was required because the patient was asymptomatic and had a clear central cornea . this is the first described case of brown - mclean syndrome in a pediatric patient , representing the importance of clinical examination in the pediatric age group after cataract surgery because of the risk for patients of developing peripheral edema .

connective tissue nevi of the skin are hamartomas , consisting predominantly from one of the components of the extracellular matrix namely collagen , elastic fibres or proteoglycans . we hereby describe a case of eruptive collagenoma in a child which started at an early age of three and half years . we report this case due to its relative paucity of literature in paediatric population coupled with appearance of lesions over an atypical site ( face ) . a 4 year old girl presented to the dermatology department with history of noticing multiple , grouped , asymptomatic raised skin lesions predominantly in bilateral axillae , upper back and face for 6 m. the lesions appeared on normal skin , without any preceding inflammation or trauma . there was no history of epilepsy , developmental anomalies , delay in milestones or any pertinent family history . clinical examination revealed multiple , symmetrically distributed , brownish papules and plaques having a leathery surface ranging in size from 0.2 0.2 cm [ figure 1 ] to 2.5 2.5 cm [ figure 2 ] . few skin coloured , firm , non tender nodules , with surface showing irregular thickening , giving a peau d orange appearance were noted in the axillae [ figure 3 ] . well defined brownish plaques having a leathery surface on flexor aspect of left forearm multiple brownish papules and plaques on the face skin coloured nodules with surface showing irregular thickening giving a peau d orange appearance considering a differential diagnosis of connective tissue nevus , histoid hansen 's and neurofibromatosis the patient was investigated . routine investigations were normal , while histopathology revealed a thickened reticular dermis with haphazardly arranged thickened collagen bundles suggestive of collagen naevus on haematoxylin and eosin stain [ figure 4 ] . masson 's trichrome highlighted an increase in the collagen tissue in the dermis [ figure 5 ] , while verhoeff - van gieson showed a marked paucity of elastic fibres [ figure 6 ] . ( h and e , 100 ) photomicrograph showing dense thick collagen bundles in the dermis . ( masson 's trichrome stain , 100 ) photomicrograph demonstrating an increased collagen with marked reduction in elastic fibres . in an attempt to classify collagenomas , uitto et al . characterized them , based on pattern of distribution ( localized or generalized ) and mode of inheritance ( acquired or inherited ) . while inherited autosomal dominant collagenomas include familial cutaneous collagenomas and shagreen 's patches of tuberous sclerosis , those that are acquired are eruptive collagenomas and isolated collagenomas . eruptive collagenoma , first reported by cramer in 1966 , presents with sudden symmetrical appearance of several firm skin - coloured papules and nodules of various sizes , usually less than 1 cm in diameter , on the trunk and upper extremities , in the first two decades of life . the incidence and pathogenesis is unknown with no established family history or associated systemic findings . histopathologically , the lesions are characterized by an excessive accumulation of randomly arranged dense collagen bundles with either diminished , altered or absent elastic tissue . eruptive collagenoma should be differentiated from other collagenomas namely familial cutaneous collagenoma , which is an autosomal dominated disorder , first described by henderson et al . , in 1968 , characterized by clinical features similar to eruptive collagenoma . however , there is a positive family history , third decade presentation and associated systemic involvement . isolated collagenomas are sporadically acquired collagenomas localized to one body region and not associated with any disease . they can present as paving stone naevi , plantar collagenoma , zosteriform lesions and papulolinear lesions . shagreen patch is a collagenoma variant associated with tuberous sclerosis , characterized by single to few asymmetrically distributed skin - coloured plaques of variable size predominantly in the lumbosacral region . papular elastorrhexis and nevus anelasticus are closely related entities which mimic eruptive collagenomas both clinically and histologically . papular elastorrhexis is characterised by multiple , 2 mm to 5 mm , flat , firm papules over the trunk and extremities while nevus anelasticus present as perifollicular papules . both these conditions are associated with a decrease in elastic fibres . due to paucity of reported literature it is uncertain , whether these entities reflect a part of the same disease process or are separate disease states . this patient was diagnosed as eruptive collagenoma based on first decade presentation of multiple lesions , histopathological findings and the absence of family history and systemic findings . though in most cases the onset of presentation has been beyond the first decade , only two cases have been reported with development of lesions within the first decade . the earliest onset of presentation , in a 2 year old nigerian girl and the other by lee et al . , with onset at 5 years . only 2 case reports by mukhi et al an extensive review of indian literature has yielded a paucity of case reports of eruptive collagenoma . although this entity is relatively uncommon , a good clinical acumen and a degree of suspicion help in the clinical diagnosis of such cases , while histopathology confirms the diagnosis . there is a relative paucity of published case reports in pediatric age group . to the best of our knowledge and after extensive review of literature , we could not find any case reports in indian pediatric population . besides this , involvement of atypical sites like

eruptive collagenomas are non familial connective tissue nevi of unknown etiology presented with an abrupt onset . while most cases are reported in young adults , there is a paucity of literature in children . we report a case of a 4-year - old girl , who presented with multiple asymptomatic , papules , plaques and nodules on the face , trunk and upper extremities with no systemic involvement . histopathologically , the lesion showed thickened homogenized collagen fibres highlighted by masson 's trichrome stain and paucity in elastic fibres by verhoeff - van gieson stain , confirming the diagnosis of eruptive collagenoma .

the abdominal organ herniation trough the right diaphragm is even rarer due to the liver protective function . the case reported concerns about a patient suffering from massive delayed right diaphragmatic hernia with right liver and bowel dislocation . a 41-year - old patient was referred to our emergency department with complaints of wheezing and cough since 1 month . during a previous admission , a diagnosis of right basal pneumonia his medical history was significant for motorcycle accident ~20 years before involving and bladder rupture . a chest x - ray revealed right basal consolidation with inhomogenous opacity at the medium and lower chest area . a computed tomography ( ct ) scan demonstrated massive right diaphragmatic hernia with dislocation of the liver that appeared overturned ~180 , transverse and ascending colon and part of small bowel ( fig . 1 ) . figure 1:thorax and abdominal ct showing the dislocation of right upper abdominal viscera thorax and abdominal ct showing the dislocation of right upper abdominal viscera he was then admitted to the surgery department for a laparoscopic exploration that confirmed the radiological finding of inveterate right diaphragmatic hernia with an 8 cm defect . because of the impossibility to reduce the liver in abdomen , due to the thoracic adhesions , a right anterolateral thoracotomy was then performed . the liver was uneventfully reinstated and colon and small bowel were replaced in anatomical position . postoperative oxygen saturation was normal and a chest x - ray was performed before discharge and revealed complete re - expansion of the lung . the diaphragmatic hernia is the herniation of abdominal organs into the chest through a diaphragmatic defect . these can be congenital or acquired . acquired diaphragmatic hernia occurs , in most of the cases , as a result of blunt or penetrating thoraco - abdominal trauma . left hemidiphragmatic hernia is more common because liver exerts a protective function against the herniation of the viscera . herniation of the abdominal organs may be completely asymptomatic ; due to this reason , ~66% of diaphragmatic rupture are not recognized at the time of trauma . the chest negative pressure causes the gradual migration of abdominal contents leading to the onset of symptoms . we can classify this clinical condition in two types : type i ( early ) and type ii ( delayed ) . clinical presentation includes gastrointestinal symptoms ( abdominal pain , nausea , vomiting and sub - occlusion ) , respiratory ( dyspnea , orthopnea and chest pain ) or cardiocirculatory ( hemodynamic compromission ) [ 14 ] . the initial diagnostic tool is chest or abdominal x - ray but ct scan is the best modality to assess the extent of dislocation , the size of diaphragmatic defect and the belt - like constriction of abdominal contents , referred to as the collar sign . surgery is always necessary for the treatment ; the approach could be laparotomic / thoracotomic or minimal invasive . in our case , minimally invasive approach was used as a diagnostic tool in order to evaluate the diaphragmatic defect and choose the best approach ( thoracotomic or laparotomic ) . in delayed case , diagnosis may be a compulsory thoraco - abdominal approach in order to lyse adhesions between abdominal organs and thoracic structure . diagnosis of diaphragmatic hernia should always be considered in patient with chest or abdominal trauma because the mortality rate can reach 31% in the first 24 hours following the trauma . it should also be considered many years after trauma in case of onset of typical symptoms .

abstractright diaphragmatic hernia is an uncommon injury following abdominal trauma . a case of delayed right post - traumatic diaphragmatic hernia is presented . the patient referred us with wheezing and cough since 1 month . a chest - abdominal computed tomography scan demonstrated a large diaphragmatic defect with liver and intestinal dislocation . the patient underwent surgical intervention with diaphragmatic repair . no complications were observed during admission and follow - up is actually negative for recurrence .

in this issue of critical care , cuthbertson and colleagues report the views of 141 intensive care and infection control specialists from four countries on the potential utility , risks and research opportunities of selective digestive decontamination ( sdd ) . using structured interviews , a delphi process , and a theoretical behavioural domains framework , they determined the extent of consensus and perceived importance of specific issues relating to sdd . respondents demonstrated substantial equipoise on risks and benefits of sdd combined with moderate agreement on concerns that sdd might contribute to antimicrobial resistance . there was uncertainty about the generalisability of sdd research to local context or to all patient groups , and moderately strong support for participating in a national randomised controlled trial of sdd despite a common view that sdd was not a high clinical priority , presumably related to the reported use of other strategies to minimise healthcare - associated infections and ventilator - associated pneumonia ( vap ) . sdd is unique amongst intensive care interventions in having the largest and most consistent evidence base for benefit in terms of minimising secondary infections and reducing mortality . since the initial publications by stoutenbeek and van saene in 1983 and 1984 describing sdd in mechanically ventilated trauma patients , there have been at least 65 randomised controlled trials and 12 meta - analyses involving around 15,000 patients . no other intervention approaches this weight of evidence , and yet expert opinion frequently disregards the technique . sdd was omitted from the first consensus statement of the surviving sepsis campaign ; in the second iteration sdd was considered but no recommendation made , since expert opinion was shown to be bimodal , demonstrated through the development of the grade grid . in the third iteration in 20122013 , sdd has achieved a level 2b recommendation ( suggested use based on ' moderate evidence ) . the main barrier to sdd relates to the perceived risk of antimicrobial resistance ( or emergence of species not covered by the traditional regimen , such as gram - positive bacteria ) if sdd were to be widely adopted , with the spread of these organisms to the wider environment . the historical over - use of antimicrobials ( intravenous and oral in humans , as growth promoters in animals ) has led to calls for better antimicrobial stewardship , and doctors are now conditioned to minimise frequency and duration of prescriptions . the current survey respondents tended to support the statements that sdd increases antimicrobial resistance and that research to date has not adequately addressed this issue . however , recent studies [ 8 - 12 ] do not support either position ; in the two largest trials , rates of resistance were lower in the sdd group . indeed , it is the conventional use of broad - spectrum intravenous antimicrobials that may promote the emergence of resistance by creating sub - lethal concentrations of antimicrobials in the gut , which then becomes a reservoir of pathogenic aerobic organisms in critically ill patients . this suggests the possibility that sdd may not only be unlikely to promote resistance , but also might actually prevent their emergence . the second barrier relates to local perceptions of performance : the sense that sdd is not required because hospital acquired infections are already well - controlled . the majority of respondents agreed with the statement that ' our vap rates are low. this may be the case if icus are regularly auditing their vap rates . however , as we found in the matching michigan project [ 13 - 15 ] , many icus were surprised to find that their performance in minimising blood stream infections from central venous catheters was not as good as they had expected . the third barrier may be the availability of ' competing non - antimicrobial interventions for preventing vap in mechanically ventilated patients , often combined in ' vap bundles. sdd should be compared with these non - antimicrobial approaches to determine whether there is synergy , or whether the newer techniques can substitute for sdd . the final barrier to sdd might be uncertainty about who should receive it , in what form and with which components . originally promoted as a technique for preventing gut overgrowth with potentially pathogenic gram - negative aerobes by preserving the normal colonic anaerobic flora , it gradually came to be seen primarily as a technique for preventing vap from retrograde oropharyngeal spread of enteric organisms . the classical nosocomial gram - negative pathogens of the 1980s were replaced in the 1990s and 2000s by resistant gram - positives for which sdd was not specifically designed ; in recent years multiply - resistant gram - negatives have returned . this means that the sdd regimen must be adapted to local circumstance - for example , including enteral vancomycin or modifying the anti - gram - negative components . evolving concepts of the mechanism(s ) of action of sdd now re - emphasise the gut as the primary reservoir of pathogenic organisms , and establishment of normal enteric flora as the main therapeutic aim . to this extent sdd and interventions directed at increasing splanchnic blood flow share the same conceptual framework of the gut as ' the largest undrained abscess in the body. one question that the survey did not directly ask is ' what evidence and effect size would encourage you to use sdd as a routine intervention in mechanically ventilated patients? the answer to this is likely to include the absence of emergence of resistance over several years ( at both the individual and environmental level ) and improvements in survival to at least 1 year . it is clear that the research will need to compare sdd against non - antimicrobial interventions directed against vap , and will need to take into account local microbial ecology . a multicentre cluster - randomised trial has been proposed ; this might usefully include a factorial design with blinding of the sdd component to explore potential synergies between interventions rather than a straight head - to - head comparison . such a trial might finally allow us to move from practice based on ' gut instinct to evidence - based medicine .

barriers to the use of selective digestive decontamination include concerns about emergence of resistant organisms , over - estimation of current performance in preventing ventilator - associated pneumonia ( vap ) , alternative methods of preventing vap , and misunderstanding of mechanisms of action . a definitive cluster - randomised trial should be undertaken that incorporates practitioner concerns and effect - size preferences .

although in most cases post - lp headaches are not severe and have a benign course , they can also be a manifestation of a potentially life - threatening complication such as subdural hematoma ( sdh ) . we describe a patient in whom a massive sdh developed after lp and cerebrospinal fluid ( csf ) drainage , which were performed during the diagnostic evaluation of freezing of gait . sdh should not be excluded from the differential diagnosis of headache following lp , especially when there is a loss of csf . in most cases headache following lumbar puncture ( lp ) is not severe and has a benign course,1 but it can also be a manifestation of a potentially life - threatening complication such as subdural hematoma ( sdh ) . we present herein a case of massive sdh after lp and cerebrospinal fluid ( csf ) drainage . a 57-year - old man was admitted to our hospital with freezing of gait ( fog ) and bradykinesia . he had suffered three minor ischemic strokes over the past 15 years , from which he had completely recovered . amantadine was administered following the diagnosis of parkinson 's disease , but the patient did not improve . mri revealed multiple ischemic changes in the periventricular white matter and bilateral basal ganglia , as well as diffuse cerebral atrophy with ventriculomegaly ( fig . levodopa was administered following the diagnosis of vascular parkinsonism , but did not improve the condition of the patient . lp and csf drainage were performed to rule out normal - pressure hydrocephalus ( nph ) . the patient 's gait did not improve , and lp and csf drainage were again performed 3 days later . the opening pressure at that time was 7.7 cmh2o , and a further 30 ml of csf was drained . after the second drainage , the patient 's gait improved slightly , and he was pleased with the result . however , because the improvement was not marked , ventriculoperitoneal shunting was not performed and he was discharged . he was taking aspirin ( 100 mg daily ) and ramipril ( 5 mg daily ) . brain computed tomography ( ct ) revealed slight progression of ventriculomegaly and no signs of intracranial hemorrhage ( fig . csf drainage was repeated once more because his gait had improved slightly after csf drainage on the first admission and aggravation of fog due to progression of hydrocephalus could not be completely ruled out . a 22-gauge tuohy needle was used in the lateral decubitus position . the opening pressure during this procedure was 7 cmh2o , and 25 ml of csf was drained . two days after drainage , he began to develop mild posterior neck pain and an occipital headache accompanied by nausea . he received conservative treatment but showed no improvement . on the 3rd day post - lp , although his headache was not aggravated on the 4th day , on the 5th day he was found in the bathroom stuporous and with right hemiplegia . an emergency craniotomy and evacuation of the hematoma were performed , and he recovered to his pre - sdh condition . sdh is a rare but well - known complication of lp performed for spinal anesthesia2 and diagnostic lp performed for suspected meningitis.3 however , a massive sdh after lp and csf drainage , which were performed as part of the diagnostic evaluation of our patient with fog , has not been described previously . the pathophysiological mechanism of post - lp sdh may involve low intracranial pressure ( icp ) as a result of lp and subsequent congestion , dilatation , and tearing of the subdural vein.4 this could explain the occurrence of sdh in patients with ventriculoperitoneal shunts4 and in those with spontaneous csf hypovolemia,5 where the icp is chronically low . considering these findings , it is surprising that most of the reported cases of post - lp sdh were associated with lp performed for spinal anesthesia , in which the loss of csf is negligible , rather than with diagnostic lp for csf analysis , in which the loss of csf is greater and the risk of consequent intracranial hypotension is higher . in lp and csf drainage for the diagnosis of nph , as in our patient , the loss of csf is by substantially greater than for diagnostic lp for csf analysis . it is conceivable that patients undergoing lp and csf drainage are at an increased risk of post - lp sdh . it was initially thought that the headache in our patient was a common post - lp headache because it developed 2 days after lp , which is when post - lp headaches usually occur,1 and because of the absence of focal or lateralized neurologic abnormality , which would have suggested the presence of an intracranial space - occupying lesion . furthermore , the patient 's headache improved with recumbency , although it did not completely disappear . the preexisting gait disturbance and parkinsonism observed in our patient , which are occasionally initial symptoms of sdh , might have hindered the early detection of an sdh . this case shows that sdh should not be excluded from the differential diagnosis of headache following lp , especially when there has been a loss of csf .

backgroundheadache is a common complication of lumbar puncture ( lp ) . although in most cases post - lp headaches are not severe and have a benign course , they can also be a manifestation of a potentially life - threatening complication such as subdural hematoma ( sdh).case reportwe describe a patient in whom a massive sdh developed after lp and cerebrospinal fluid ( csf ) drainage , which were performed during the diagnostic evaluation of freezing of gait.conclusionssdh should not be excluded from the differential diagnosis of headache following lp , especially when there is a loss of csf .

lipoid proteinosis , also known as hyalinosis cutis et mucosae ( omim 247100 ) , was first described by urbach and wiethe in 1929 . since then , over 250 cases of this autosomal recessive disorder have been described . it is characterized by the deposition of an amorphous hyaline substance ( glycoprotein ) in the mucous membrane and skin . hoarseness and thickening of vocal cords are the most characteristic symptoms present from infancy or early childhood.3 , 4 another classic and most easily recognizable sign is the beaded eyelid papules . the other cutaneous changes may include waxy , yellow papules and nodules with generalized skin thickening . the mucosa of the pharynx , tongue , soft palate , tonsils and lips is also infiltrated.6 , 7 other features may include epilepsy and calcification in the temporal lobes or hippocampi . since suturing is difficult because of rigid mucosa in these patients , the use of cryosurgery seems to offer advantages for removing oral nodular lesions . therefore , cryosurgery ( n2o ) was performed to remove and reshape the lip lesions in a case of this rare syndrome . the patient was a 24-year - old female from shahrekord , central iran , who sought medical care at the department of oral medicine , isfahan university of medical sciences in 2003 . the patient was completely edentulous and showed the classic signs of lipoid proteinosis ( figure 1 ) . during oral examination , the patient had six sisters and one brother , and two of her sisters ( 25 and 11 years old ) suffered from the same syndrome . the results of complete blood analysis and routine urinalysis were all within the normal limits . the biopsy of lip lesions was performed with a scalpel under local anesthesia and examined by a pathologist to confirm the diagnosis . suturing after biopsy was difficult because the mucosa was rigid and the sutures cut into it . the patient suffered from some nodules on upper lip . after applying local anesthetic spray on the site , cryosurgery ( n2o , c 502 t , emd co ; tehran , iran ) was performed ( 63c for one minute ) , as this treatment has been used for similar superficial lesions . the surgery was done in two sessions ; half of the lip was involved in each ( figure 2a , b ) . the superficial layers were fallen by day 3 . after the operation , the patient had pain for about a week with a visual analogue scale of up to five . follow up , no new nodules were formed ; however , some fissures were created on her lip ( figure 2c ) . after the treatments , the appearance and the emotional state of this young female had improved . lipoid proteinosis is a rare autosomal recessive disorder accompanied by hoarseness as well as infiltration and thickening of the skin and certain mucous membranes . recently , lipoid proteinosis was mapped to 1q21 and pathogenetic loss - of - function mutations were identified in the extracellular matrix protein 1 ( ecm1 ) gene.2 , 4 some treatments for this disorder have already been reported . a case of lipoid proteinosis was successfully treated with dimethyl sulfoxide , however , in three other cases , it showed no beneficial effect . retinoids have shown encouraging results in cutaneous lesions in previous studies.12 , 13d - penicillamine had a favorable effect in a patient with this syndrome . microlaryngoscopy and dissection of the vocal cords , dermabrasion , chemical skin peeling and blepharoplasty were performed in some cases.5 , 1 lasers are used in many fields of medicine and dentistry . carbon dioxide laser surgery of thickened vocal cords and beaded eyelid papules has proved to be helpful in some studies.2 , 1 nd : yag and er : yag lasers were applied to remove oral lesions in one case of this syndrome . cryosurgery is the use of very low temperatures to destroy tissue . immediately following cryosurgery , tissues are virtually indistinguishable from the normal , but latent damage is produced which progresses to severe destruction of the tissue . it is a safe , effective method of treatment for many benign soft tissue lesions in the oral cavity . as suturing was difficult in this patient and mucosa was rigid , the use of cryosurgery seemed to offer some advantages in removing oral lesions in this case . it seems that surgical methods like cryosurgery and laser1 , 1 have some advantages over conventional surgery for removing oral lesions of lipoid proteinosis syndrome as there is no bleeding and no need to suture , and it is more comfortable for the patient . the described approach is considered an early report of n2o cryosurgery being used in removal and reshaping of lip lesions of this rare syndrome .

lipoid proteinosis is a rare hereditary metabolic disorder transmitted as an autosomal recessive trait . it is characterized by the deposition of an amorphous hyaline - like material ( glycoprotein ) in the mucous membranes , skin and various internal organs . cryosurgery ( n2o ) was applied to remove and reshape the lip lesions in a case of this rare syndrome . the patient was a 24-year - old female . cryosurgery ( 63c n2o for one minute ) was performed to re - shape some areas of the upper lip . the lips were softer and had better esthetics after treatment . the use of cryosurgery offers advantages over surgery in reshaping of the lip lesions in this syndrome , since suturing is not feasible in rigid mucosa of these patients .

trichotillomania ( ttm ) is a type of impulse control disorder , characterized by recurrent pulling of hair , which leads to pleasure and relief of tension . prevalence rates of this condition range between 1% and 13.3% , with initial mean age of onset between 10 years and 13 years and a notable peak at 12 - 13 . the disease leads to hair loss , which may sometimes be severe and lead to significant social and functional impairment . the etiology of the disease is still unknown , although some have suggested a genetic component . this was based on a limited number of reports on familial hair pulling and one twin concordance study . we hereby describe a case of familial ttm in three generations , thereby underlining the familial basis for this disorder . a 13-year - old male presented with 1-year history of focal hair loss in the mid - frontal scalp . he was previously treated with local steroids for presumed alopecia areata , with no improvement . examination revealed a patchy area of hair loss , with several short broken hairs of varying lengths [ figure 1a ] . on dermoscopy examination of the scalp , we found the typical features of ttm , including short hairs with trichoptilosis , broken hair ( different lengths ) and black dots [ figure 1b ] . histological examination showed trichomalacia with irregularly shaped hair follicles and melanin pigment casts [ figure 1c and d ] . upon further questioning , the father admitted repeated pulling of his beard hairs since puberty , with mild - to - moderate severity of symptoms . the 60-year - old paternal grandfather also suffers from severe recurrent hair pulling of his beard since puberty , which sometimes precludes him from leaving home . ( a ) patchy area of hair loss on the scalp , with several short broken hairs of varying lengths ; ( b ) dermoscopy of the scalp lesion demonstrating short hairs with trichoptilosis , broken hair ( different lengths ) and black dots ; ( c - d ) low ( c ) and high ( d ) magnification histopathology of the scalp lesion demonstrating the presence of trichomalacia with irregularly shaped hair follicles ( arrows , c ) and melanin pigment casts ( arrows , d ) it is believed that the etiology of ttm is complex , involving biological , psychological and social factors . this was based on a limited number of reports on familial ttm and one twin concordance study . in this twin study , respective concordance rates for monozygotic and dizygotic twin pairs were 38.1% and 0% for diagnostic and statistical manual of mental disorders iv criteria and 58.3% and 20% for non - cosmetic hair - pulling , leading to a heritability estimate of 76.2% . rare variations in slitrk1 were associated with disorders of the obsessive - compulsive spectrum and among them also ttm . mouse models also suggested a relationship between mutations in hoxb8 and sapap3 and ttm - like behavior in mice . although several cases of familial ttm have been reported , to our knowledge , this is the first report of ttm in a three - generation family . this report strengthens the possibility that ttm is a genetic disease , probably with a complex inheritance pattern . it also underlines the importance of proper family history taking when examining a ttm patient .

trichotillomania ( ttm ) is a type of impulse control disorder , characterized by recurrent pulling of hair . the etiology of ttm is complex , but a genetic contribution to this condition was advocated based on a limited number of reports on familial ttm . we report a 13-year - old male with history of focal hair loss in the scalp . examination showed a patchy area of hair loss , with several short broken hairs of varying lengths . dermoscopy and pathology examinations were consistent with ttm . upon further questioning , his father admitted repeated pulling of his beard . the paternal grandfather also suffers from severe hair pulling of his beard since puberty . to our knowledge , this is the first report of ttm in a 3 generation family . this report strengthens the possibility that ttm is a genetic disease , probably with a complex inheritance pattern . it also highlights the importance of appropriate family history taking when examining a ttm patient .

we studied 20 serum samples from survivors of confirmed hantavirus infection , 11 from chilean patients and 9 from patients in the southwestern united states . samples were collected from 8 months to 11 years after the patient was hospitalized with hcps . the neutralizing titer was measured for each sample against snv and andes virus by a focus - reduction neutralization assay in vero e6 cells , as described previously ( 7 ) . in brief , serial 2-fold dilutions of heat - inactivated patient plasma samples were made , from 1:100 to 1:1,600 , and were mixed with equal volume of 50100 focus - forming units per milliliter snv ( isolate sn77734 , titer 2 10/ml ) or andes virus ( chilean strain of human origin , isolate chi-7913 ) and incubated at 37 for 1 hour ( 15 ) . the mixture was then used to infect a confluent monolayer of vero e6 cells ( atcc crl 1586 ) in duplicate wells of a 48-well dish , with a 1.2% methylcellulose overlay in the medium to confine the virus to the foci . after incubation for 1 week , viral foci were detected with polyclonal rabbit anti - n antibody followed by peroxidase - conjugated goat anti - rabbit immunoglobulin g. foci were enumerated under an inverted light microscope . nab titers were defined as the reciprocal of the highest serum dilution that resulted in an 80% reduction in the number of foci compared to virus controls in duplicate assays . the endpoint plasma nab titers against andes virus and snv from chilean and north american survivors of hantavirus infection are shown in the table . all chilean patients had detectable plasma nab against andes virus , with titers > 1:400 in all but 1 patient . in contrast , 9 of the 11 samples failed to show nab titers > 1:100 against snv , while the other 2 neutralized snv only at low titers . similarly , all north american patients had plasma nab against snv at titers > 400 , and only 1 showed some neutralization against andes virus , at low titer . no relationship was seen between the endpoint nab titers against the homotypic virus and time elapsed from acute disease in either chilean or north american patients , nor did a particularly high homotypic titer predict that neutralizing activity would be present against the heterologous virus . in survivors of hantavirus disease who reside in chile or the united states , we found high titers of plasma nab against the type of hantavirus that is prevalent in the patient 's own region , while substantial titers against the heterologous agent of hcps were absent . in this small group of participants , nab titers did not show any readily detectable decline with time elapsed after infection ; titers as high as 1:1,600 could be detected 11 years after illness . these results suggest that plasma from patients who survive hantavirus infection is a potential source of nab and could be used as a therapeutic alternative for patients with acute disease or as a prophylactic intervention for persons who may have been exposed to the virus . the absence of in vitro cross - neutralization makes the alternative of clinically effective cross - protection less likely and discourages the use of convalescent - phase sera to treat patients whose geographic origin is different from that of the plasma donor . our results suggest that a monovalent vaccine would not elicit protection against different types of hantavirus , even when the viruses are phylogenetically as similar as snv and andes virus . the positive results of cross - protection studies in hamster models should be interpreted cautiously , since experimental infection in those studies would tend to favor unusually brisk immune responses that go well beyond eliciting nab and likely include potent cell - mediated or innate immune responses that can not be mimicked with passive immunization ( 12 ) . similarly , some component of the cross- protective efficacy observed with genetic immunizations with hantavirus envelope genes may ultimately be related to t - cell immunity ( 13 ) . from this perspective , either multivalent or region - specific vaccines may have to be developed to protect persons at high risk from this new , relatively infrequent , but still highly lethal disease .

we evaluated titers of homotypic and heterotypic neutralizing antibodies ( nabs ) to andes and sin nombre hantaviruses in plasma samples from 20 patients from chile and the united states . all but 1 patient had high titers of nab . none of the plasma samples showed high titers against the heterologous virus .

however , compared with open cholecystectomy , the incidence of bile duct injury appears to be increased , resulting in significant morbidity . bile duct injury during lc ranges from mild to severe with serious and disastrous consequences . it may lead to fistula formation or life - threatening biliary peritonitis in case of a significant leak . in case of small leaks , it could be entrenched by the adjacent organs and fibrin usually forming a localized collection or biloma . bilomas are often due to a leak from an inadequately secured cystic duct stump , an accessory bile duct or a duct of luschka in the gallbladder fossa of the liver . biloma have been reported to have occurred at unusual locations such as in the abdominal wall or even intrahepatic sub - capsular space . we report a case of biloma presenting at an unusual location in the lesser sac . a 28-year - old previously healthy female presented to the outpatient department 10 days following lc . the patient complained of moderate pain in epigastrium and right hypochondrium starting 2 days after the operation . she had no fever and no jaundice and her medical history did not suggest any major comorbid condition . the physical examination revealed the patient to be average built , conscious , and oriented ; she was afebrile with pulse rate of 76 beats / min and blood pressure of 100/70 mm hg . her abdominal examination revealed healed port site scars , a soft abdomen with no signs of peritonitis . there was a vague mass palpable in the epigastrium and left hypochondrium , tender on deep palpation . laboratory data revealed a haemoglobin of 10.9 g / dl , white blood cells of 10,700/mm(83% neutrophils ) , a blood urea of 40 liver enzymes showed a total bilirubin of 1 mg / l with a direct component of 0.4 mg / l ; serum glutamate - oxaloacetate transaminase , serum glutamic - pyruvic transaminase , alkaline phosphatase were 70 iu / l , 60 iu / l and 46 iu / l respectively . serum amylase level were 48 u / l , ultrasonography of the abdomen revealed a large unilocular fluid - filled collection in the left hypochondrium . a diagnosis of postoperative lc subhepatic collection was made and patient posted for diagnostic laparoscopy . diagnostic laparoscopy revealed a prominent bulge of stomach [ figure 1 ] with stretching of the gastrocolic omentum due to a collection in the lesser sac ; the gall bladder fossa and surrounding organs were unremarkable [ figure 2 ] . bulge appeared to be a psuedocyst ; however , there were no other intra - abdominal signs of pancreatitis . in view of no positive history suggestive of pancreatitis the gastro colic ligament was divided and a clear bilious fluid [ figure 3 ] was seen in the lesser sac . a litre of this fluid was drained from the lesser sac and an abdominal drain left in place . the patient had an uneventful postoperative period with no further bilious drainage in the drain . bilomas resulting as a complication of cholecystectomy are often due to a leak from an inadequately secured cystic duct stump , an accessory bile duct or a duct of luschka in the gallbladder fossa of the liver . bilomas usually present with abdominal pain , nausea , anorexia , jaundice , fever and abdominal tenderness , but presentation may vary from minimal symptoms to full blown biliary peritonitis . our patient presented with unusual features for a biloma , which included an unlikely site of bile collection following an uneventful lc . patient was managed with diagnostic laparoscopy and drainage . on follow - up , patient was subjected to a magnetic resonance cholangiopancreatography , which showed normal biliary anatomy . bilomas must be considered in the differential diagnoses of postoperative patient presenting with unusual clinical presentation after an uneventful lc .

bilomas resulting as a complication of cholecystectomy are often due to a leak from an inadequately secured cystic duct stump , an accessory bile duct or a duct of luschka in the gallbladder fossa of the liver . occasionally , bilomas may have an unusual presentation . we describe here a rare case of biloma in the lesser sac after an uneventful laparoscopic cholecystectomy .

a 72-year - old woman presented for further examination of a right breast lump . according to the patient , the lump had been present for at least 10 years . she complained of discomfort of recent onset in the right breast . on physical examination , a soft , mobile , 10 cm mass , which occupied nearly the entire right breast , was palpated . on mammography , a large circumscribed mass surrounded by a water - density capsule the mass was a mixture of isodense and fat densities and had dystrophic calcifications in a branching pattern . 1a , b ) . on ultrasonography ( us ) , the mass was very heterogeneous and completely encompassed in a thin echogenic pseuduocapsule of compressed breast tissue , which was compatible with hamartoma . however , a careful us examination revealed an irregular hypoechoic mass of 1.4 cm with a non - parallel orientation within the hamartoma ( fig . 1c ) . a retrospective review of the mammograms revealed focal asymmetry , which correlated with the suspicious mass on us ( fig . 1a , b ) . the lesion was early enhanced and a washout on enhanced mri scans ( fig . surgical excision for entire mass was done and the diagnosis from the frozen specimen of the suspicious area was idc . , there was no evidence of local recurrence of the idc or any distant metastasis . mammary hamartomas , a term applied to breast tumors in 1971 by arrigoni et al . ( 13 ) , have also been referred to as lipofibroadenomas , adenolipofibromas , and fibroadenolipomas ( 1 ) . hamartomas may present as tender or non - tender palpable lumps , but are often discovered incidentally during a screening mammography ( 1 , 14 ) . the typical mammographic feature of hamartomas is a circumscribed fibrofatty mass ( 15 ) . on us , most mammary hamartomas have circumscribed margins , an oval shape , and heterogeneous internal echogenicity ( 16 , 17 ) . the clinical , radiologic , and histologic findings of the previously described 14 cases of malignant hamartomas and the current case are summarized in table 1 . the mean patient age was 56.3 years ( range , 25 - 78 years ) . the size of the hamartomas range from 1.5 - 12.0 cm in diameter and the size of the associated carcinomas range from 0.3 - 3.5 cm in diameter . of the described 15 cases , mammography was obtained in 12 cases , of which 10 showed the typical appearance of hamartomas with suspicious features , such as clusters of microcalcifications , pleomorphic micocalcifications , and spiculated masses . the remaining two cases had the typical appearance of a hamartoma with no suspicious features , thus co - existing malignancies were unexpected findings at the time of tumorectomy . us findings were available in only six cases , of which four had suspicious masses with irregular margins , hypoechogenicity , or a non parallel orientation within the hamartomas ; and two cases were diagnosed pre - operatively as carcinomas by us - guided fine needle aspiration or core needle biopsies and underwent one - step curative surgery ( 6 , 7 ) . as stated above , the majority of cases had suspicious findings within the hamartoma on mammography or us . radiologists therefore need to pay careful attention in order to detect subtle suspicious findings , even though mammography or us may show typical hamartomas . among the 15 cases described here , 12 had carcinomas that were confined to the hamartomas and the remaining three cases had carcinomas that involved both the hamartomas and adjacent normal breast tissue . if carcinomas involve both the hamartoma and normal breast tissue , it is difficult to determine whether the carcinoma arises within the hamartoma or an isolated carcinoma which initiates growth nearby later extends into the hamartoma . however , in the majority of cases described here , including the current case , the carcinomas were located within the hamartomas , ( 2 - 5 , 7 , 8 , 10 - 12 ) thus we believe that the malignancies arose within the hamartomas . in conclusion , breast hamartomas have generally been classified as rare , benign tumors , and carcinomas occur only rarely . radiologists should recognize that malignancy may co - exist or develop in hamartomas and be alert to the presence of suspicious features within a hamartoma .

mammary hamartomas are typically a benign condition and rarely develop into malignant lesions . only 14 cases of carcinomas associated with a hamartoma have been documented in the literature . in this case report , we describe a case of invasive ductal carcinoma within a hamartoma in a 72-year - old woman . mammography , ultrasonography , and magnetic resonance imaging showed the features of a typical hamartoma with a suspicious mass arising in it . this case illustrates the importance of identification of unusual findings in a typical mammary hamartoma on radiologic examinations .

coronary artery embolism is an established cause of acute coronary syndrome , but paradoxical coronary artery embolism causing myocardial infarction is rare and requires a high degree of clinical suspicion for diagnosis . recognition of this condition is important as these patients are at risk of future fatal embolic phenomena . percutaneous device closure of interatrial communication either in the form of patent foramen ovale ( pfo ) or atrial septal defect ( asd ) should be considered to prevent future embolism . a 64-year - old male with multiple myeloma was admitted for autologous stem cell transplantation . two weeks previous he was diagnosed with a peripherally inserted central catheter ( picc)-related right basilic and axillary vein thrombosis [ figure 1a , arrows ] complicated by pulmonary embolism that was treated with low molecular weight heparin . ( b ) right coronary angiogram showing flush occlusion of posterior descending artery and posterolateral branch of right coronary artery . ( c ) transesophageal echocardiography ( tee ) with agitated saline showing bubbles crossing the patent foramen ovale ( pfo ) . ( e ) tee showing a thrombus in superior vena cava during an attempt at picc removal , the patient coughed and developed sudden severe left - sided chest pain . an electrocardiogram showed st segment elevation in inferior ( ii , iii , and avf ) leads . cardiac biomarkers were elevated ( troponin - t 2.230 ng / ml ( normal < 0.01 ng / ml ) and creatine kinase myocardial band fraction 65.1 ng / ml ( normal < 6.7 ng / ml ) ) . coronary angiography revealed flush occlusion of the posterior descending artery and posterolateral branch of the right coronary artery [ figure 1b , arrows ] . severe thrombocytopenia ( platelet count 37 109/l ) secondary to newly diagnosed heparin - induced thrombocytopenia precluded use of antiplatelet agents and hence , coronary intervention . transesophageal echocardiography with agitated saline showed a small pfo ( figure 1c , arrow ) with bidirectional shunt seen on color doppler imaging [ figure 1d , asterix ] . in addition , a large thrombus was seen in the superior vena cava [ figure 1e , arrow ] . a diagnosis of st elevation myocardial infarction secondary to paradoxical embolism to the right coronary artery was entertained . in addition to long - term treatment with fondaparinux for venous thrombosis , percutaneous pfo closure was recommended to prevent recurrent embolism . paradoxical coronary embolism is rare and accounts for 1015% . of all paradoxical emboli , and 25% of acute coronary events in patients our patient had a documented picc associated thrombus , and an episode of cough preceding the onset of chest pain caused transient elevation in right atrial pressure with right to left shunting and paradoxical embolism though a pfo . the valsalva maneuver is routinely used to demonstrate shunting across the pfo during echocardiographic examination in individuals in whom spontaneous shunting is not seen . paradoxical embolism was first reported by cohnheim in 1877 and is known to cause cerebral , peripheral arterial , and in rare instances coronary artery occlusion . paradoxical coronary artery embolism should be suspected in patients who otherwise are at low risk for atherosclerotic coronary artery disease . in a given clinical scenario , demonstration of venoarterial communication ( most often at the atrial level ) together with identification of a venous source of embolus and lack of thrombi in the left heart fulfill the criteria for presumptive diagnosis of this condition . a definite diagnosis requires demonstration of thrombus across the venoarterial communication either by echocardiography or contrast computed tomographic angiography of the chest . many times paradoxical coronary artery embolism can only be made at the time of autopsy . when suspected clinically , a search for an underlying condition predisposing to venous thrombosis should be undertaken . the management of acute coronary syndrome caused by paradoxical coronary artery embolism is similar to that occurring in the setting of atherosclerotic coronary artery disease . manual aspiration thrombectomy with or without angioplasty and stenting followed by aggressive medical management including antiplatelet agents , is the standard of practice . the management of patients with contraindication to antiplatelet therapy may be challenging as in this case . aspiration and manual thrombectomy should be the main therapeutic intervention in such a situation unless the embolus is distal in a small coronary artery . optimum therapeutic strategy in preventing recurrent embolic events in patients with pfo is not established . a recent meta - analysis of three randomized clinical trials addressing the role of transcutaneous closure of pfo showed a benefit in preventing recurrent cerebrovascular ischemic events in patients with cryptogenic stroke when compared with medical therapy . another study demonstrated lower recurrent neurological event rates with amplatzer compared with cardioseal - starflex and helex devices . although percutaneous device closure has not been studied in paradoxical coronary embolism , it should be considered to prevent fatal recurrent events . in summary , in addition to acute management of acute coronary syndrome , pfo closure to prevent recurrent thromboembolism should be considered .

paradoxical coronary artery embolism is a rare , but often an underdiagnosed cause of acute myocardial infarction . it should be considered in patient who presents with chest pain and otherwise having a low risk profile for atherosclerosis coronary artery disease . we describe a case of paradoxical coronary artery embolism causing st segment elevation myocardial infarction in a patient with upper extremity venous thrombosis . echocardiography demonstrated a patent foramen ovale ( pfo ) with bidirectional shunt . in addition to treatment of acute coronary event closure of the pfo should be considered to prevent a recurrence .

limbic signs dominate the clinical picture in the former whereas a paralysis of lower motor neuron type dominates the latter . the diagnosis of rabies is not difficult if it presents with classical symptoms of excitations or phobias . however , it poses a diagnostic challenge when presented as acute flaccid paralysis ( afp ) . we report a case of paralytic rabies following intradermal anti - rabies vaccine , following cat scratch . a 15-year - old girl was brought with the complaints of fever of 5 days , headache and vomiting of 4 days , weakness of bilateral lower limbs , followed by upper limbs , change in voice and nasal regurgitation of feeds since 2 days . gag reflex was absent with pooling of secretions and absence of movements of soft palate and uvula . power in bilateral upper and lower limbs was 1/5 ( medical research council grade ) . she was immunized with a complete course of intradermal cell culture anti - rabies vaccine first dose started on day 2 of cat scratch . updated thai red cross schedule ( 2 - 2 - 2 - 2 - 2 ) was used for intra dermal vaccination . cat scratch was not cleaned . provisional diagnosis of paralytic rabies was made on the basis of paralysis with history of cat scratch . although rare with the modern cell culture vaccines , the possibility of vaccine - induced gbs was also considered . laboratory investigations revealed normal complete blood counts , serum electrolytes , liver and kidney function tests . cerebrospinal fluid ( csf ) analysis showed 412 cells with 10% neutrophils and 90% lymphocytes with sugar of 62 mg / dl . rabies virus rna was detected in csf and skin biopsy samples by reverse transcription polymerase chain reaction . neutralizing antibodies to rabies virus were detected in both serum and csf by the rapid fluorescent focus inhibition test . conservative management was started , but rapid progression with respiratory paralysis occurred over the next 2 days . there was no improvement and the patient succumbed on the 10 day of onset of the disease . about 55,000 human deaths occur due to rabies annually worldwide ; about 36% of these deaths occur in india . the disease infects domestic and wild animals , and is spread to people through close contact with infected saliva via bites or scratches . there are two forms of human rabies : ( 1 ) the well - known encephalitic ( furious ) and ( 2 ) the paralytic ( dumb ) rabies . the encephalitic form starts with fever , malaise , pharyngitis , and paraesthesia at the site of the bite , followed by the classical neurological symptoms of hydrophobia , aerophobia , agitation , hypersalivation , and seizures . this is followed by paralysis and coma ; death is usually due to respiratory failure . the second clinical form of rabies , paralytic ( dumb ) or guillain - barre - like , is characterized by progressive paralysis without an initial furious phase . even though , the paralytic rabies is unfamiliar to health care providers , 20 - 30% of rabies victims present in this manner . paralytic rabies is more common after rabid vampire bat bites and in persons who have received post - exposure vaccination . studies conducted in the united states by the center for disease control and prevention have documented that a regimen of one dose of rig and five doses of the human diploid cell culture vaccine ( hdcv ) over a period of 28 days was safe and induced an excellent antibody response in all recipients . clinical trials with rabies vaccine adsorbed and purified chick embryo cell vaccine have also demonstrated immunogenicity equivalent to that of hdcv . many individuals did not receive immunoglobulin where indicated , and some of them received the vaccine in the gluteal region instead of in the deltoid . although our patient had grade iii cat scratch for which rig is strongly recommended , she only received the vaccine in the deltoid region without rig . neurological reactions following newer vaccine administration have been extremely rare . after millions of vaccinations worldwide , three guillain - barre type paralytic reactions have been described , and all cases recovered completely . rare findings in our case are paralytic rabies following cat scratch and development rabies after administration of intradermal rabies vaccine . the limitation of our report was that we were not able to do magnetic resonance imaging of brain and nerve conduction studies . paralytic rabies should be considered if any child presenting with afp with brain stem symptoms and signs , even if they had already received anti - rabies vaccination and also following cat scratch . most rapidly immunogenic vaccine regimen should be used in patients at high risk , especially if rig has not been given .

only few reports of failure of intradermal postexposure prophylaxis for rabies following cat scratch exist in the published literature . we are reporting such a case in a 15-year - old girl . the child had category iii cat scratch on her face . she presented with progressive paralysis , finally developing quadriplegia and respiratory paralysis . typical hydrophobia and aerophobia were absent . she received intra - dermal anti - rabies cell culture vaccine . she did not receive anti - rabies immunoglobulin . the girl succumbed on the 10th day of weakness . diagnosis of rabies was confirmed by isolation of rabies virus rna in cerebrospinal fluid and skin biopsy sample by reverse transcription polymerase chain reaction .

a 72-year - old female patient with corneal edema due to fuchs corneal dystrophy , after 2 years , uneventful phacoemulsification surgery with intraocular lens implantation was scheduled for dsaek . the following eye had visual acuity of 20/25 ( correction + 1,0 dsph ) and underwent descemet 's stripping endothelial keratoplasty ( dsek ) combined with phacoemulsification surgery 3 years earlier . spectral - domain optical coherence tomography ( sd oct ) examination revealed corneal edema with descemet membrane folds on posterior corneal surface and fluid spaces under the corneal epithelium . the donor cornea was dissected with a moria microkeratome ( 350 m keratome plate ) . after fashioning the clear corneal incision , the surgery was discontinued and the optical coherence tomography ( oct ) exam with commercially available sd oct device ( ivue ; optovue , fremont ; usa ) was performed . acquiring of the image was gained by pressing the foot pedal after focusing the anterior eye segment structures within the oct scan [ fig . 1 ] . after making sure that all of descemet membrane was removed , the air was injected into the anterior chamber with following eye surface sweeping in order to remove fluid from the graft interface . the graft seemed to be attached when analyzing in the surgical microscope . after performing sd oct , multiple fluid micro - spaces were revealed in the area of the graft interface [ fig . 2 ] . due to that , we performed corneal stab incisions in the four main clock hours . after incisions , sd oct revealed a proper graft adhesion to the posterior corneal surface [ fig . 3 ] . at the end of the surgery , the whole procedure lasted for 35 min , which increased the time of the surgery by approximately 15 min . there is a border on posterior corneal surface with and without descemet membrane spectral - domain optical coherence tomography scan performed after donor disc implantation . there is an inaccurate adhesion of a graft with accompanying fluid spaces noticeable spectral - domain optical coherence tomography scan performed after corneal stab incisions with a surface sweeping . assessment of the intraoperative donor disc attachment could be performed routinely with the use of a slit - lamp attached to the surgical microscope or alternatively by observing the donor lenticule border using very high microscope magnification . however , none of those methods gives such a certainty of proper graft attachment as performing intraoperative oct . intraoperative oct analysis by revealing the residual interface space has a potential to reduce the post - operative disc dislocation rate . optical coherence tomography is a high speed , high resolution , non - contact optical imaging technique developed for noninvasive cross - sectional imaging in biologic systems . after dsek surgery , oct was used to monitor cornea and graft morphometric dynamics and its influence on refractive changes after the surgery . the first paper describing the use of handhold oct ( bioptigen sd oct ) during the dsaek to assess the donor - host interface was published in 2010 . this is the first report presenting the intraoperative commercially available oct device . in our opinion , there are two main problems regarding the intraoperative use of oct : the surgery during the sd oct exam is interrupted and there is a necessity of the use additional surgical drapes to prevent the possible touching of the operating field . this inconvenience could be removed by using c - arm allowing the oct exam in the controlled manner . the ideal way would be to use integrated oct and surgical microscope , similar to those used in the vitreoretinal surgery . to conclude : oct assisted dsek allows the assessment of the accuracy of the descemet stripping and donor disc attachment .

optical coherence tomography has already been proven to be useful for pre- and post - surgical anterior eye segment assessment , especially in lamellar keratoplasty procedures . there is no evidence for intraoperative usefulness of optical coherence tomography ( oct ) . we present a case report of the intraoperative donor disc attachment assessment with spectral - domain optical coherence tomography in case of descemet stripping automated endothelial keratoplasty ( dsaek ) surgery combined with corneal incisions . the effectiveness of the performed corneal stab incisions was visualized directly by oct scan analysis . oct assisted dsaek allows the assessment of the accuracy of the descemet stripping and donor disc attachment .

teratomas are tumors that typically , but not always contain all three germ cell layers ectoderm , mesoderm , and endoderm . teratomas are classified as mature , immature , and malignant based on the degree of differentiation . these lesions can occur throughout the spinal canal , but there is a thoracic and lumbar predominance among reported cases with the conus medullaris region being the most frequent . a 12-year - old boy was referred to our hospital with a 2 months history of back pain and 1-week history of bilateral leg weakness , urinary incontinence , and constipation . on physical examination ; he had no gross motor deficit but bilateral numbness in his legs . lumbosacral spine magnetic resonance imaging revealed a well - delineated , intramedullary , 2 cm 4 cm mass at the l1 - 2 levels of the lumbar spine . the mass was hyperintense in all sequences , and it was containing a hypointense lesion in the central zone . magnetic resonance imaging of lumbar spine ; ( a ) sagittal t2-weighted and ( b ) axial t2-weighted images showing a well - delineated , intramedullary , 2 cm 4 cm mass at the l1 - 2 levels of the lumbar spine the patient underwent an emergent surgery . the operation was performed under a surgical microscope with the assistance of intraoperative neurogenic monitoring evoked potentials . a midline incision was performed at the conus medullaris level , and a creamy , yellow - white , mucoid substance was discharged . subsequent to the evacuation of the tumor 's content , calcified solid component , and capsule was resected . however , gross total resection could not be performed because of the tenacious adhesions of the tumor to the adjacent parenchyma . after removal of the tumor , dura mater and l1 and l2 vertebrae were reconstructed . the patient had an uneventful postoperative course and his severe back pain and bilateral leg weakness improved after the surgery . now , as 1 month after surgery , the patient has no reported recurrent symptoms . ( a ) photomicrograph ( h and e , 40 ) showing connective tissue containing mucinous epithelium ( b ) photomicrograph ( h and e , 20 ) showing adipose tissue containing mature muscle cells ( c ) photomicrograph ( ihc , 40 ) showing smooth muscle cells reacted positively with actin associated anomalies such as metameric cutaneous lesions , sinus tracts , neural tube defects or split cord malformations may be present . the current classification states that a teratoma is a tumor that composed of derivatives from all 3 primitive germ layers . histologically , these lesions are divided into three categories ; mature , immature , and malignant . it is important to study the specimen completely because benign and malignant elements can be present simultaneously . magnetic resonance imaging is the most valuable diagnostic technique but , even so it can not determine with certainty the differential diagnosis between teratoma and other intramedullary lesions . the primary treatment for teratomas is surgery , and total surgical resection of the tumors should be the aim of these operations . however , as in our case gross total resection may not be possible in every operation . in a literature review made by poeze et al . , it was found that intramedullary tumors could be completely removed only in 61.8% of the reported cases . application of intraoperative electrophysiologic monitoring is important in these operations , and it is important to resect tumor as extensive as possible according to intraoperative electrophysiologic monitoring findings . removal of the tumor should be stopped when the neurological function is at risk due to the tenacious adhesions of the tumor to the adjacent parenchyma . radiotherapy is an adjuvant treatment modality that should be indicated when the tumors contain malignant components . however , adjuvant radiotherapy is not recommended for benign teratomas , and there is not any role of adjuvant chemotheraphy in the treatment of spinal teratomas .

teratoma is a tumor that derivatives from all three primitive germ layers and spinal intramedullary teratomas are very rare lesions . the primary treatment modality for these tumors is surgical resection , and total resection should be the aim . however , subtotal resection is a valid alternative to prevent traumatizing adjacent functional neural tissue . in this report , we presented a case of a 12-year - old male patient with spinal teratoma of the conus medullaris . we describe the presentation , evaluation , and treatment of this rare disease .

when microvascular option is not available or contraindicated the pedicle options are usually pectoralis major myocutaneous ( pmmc ) flap for lining and deltopectoral ( dp ) flap for cover . if this procedure can be done in a single stage it becomes advantageous both for the patient in terms of reducing the morbidity , total cost , hospital stay and to the surgeon with no microvascular expertise . the idea is to transpose a medially based platysma myocutaneous neck flap , to cover the cheek defect after it has been lined by pmmc flap . the resultant neck defect after elevation of neck flap is covered by transposing a dp flap to the neck . we are describing the procedure in a 43-year - old female patient with squamous cell carcinoma of right side buccal mucosa with skin involvement and ulcerating neck node [ figure 1 ] . a medially based platysma myocutaneous flap was planned so as to cover the skin defect of cheek comfortably . the onco surgeon then proceeded with the neck dissection , which was already bare after elevation of the platysma myocutaneous flap followed by excision of the tumour . the residual neck skin over which the dp flap is going to sit was marked and elevated as a laterally based platysma myocutaneous flap and transposed to the dp area . preoperative photograph showing ulcerated carcinoma cheek with ulcerating neck node intraoperative photograph showing planning of the flaps - medially based platysmal myocutaneous flap ( a ) , laterally based platysmal myocutaneous flap ( b ) , deltopectoral flap ( c ) and pectoralis major myocutaneous flap ( d ) showing planning of flaps ( a ) medially based platysmal myocutaneous flap ( b ) laterally based platysmal myocutaneous flap ( c ) deltopectoral flap and pectoralis major ( d ) myocutaneous flap intraoperative photograph showing the inset of the flaps into their respective positions with skin - grafted chest wall ( flap d is used for lining and hence not seen in the picture ) eighth day postoperative photograph of the same patient , showing well settled medially based platysmal myocutaneous flap ( a ) , laterally based platysmal myocutaneous flap ( b ) and deltopectoral flap ( c ) the patients with conventional dp flap usually do not leave the hospital till flap detachment and final inset . hence the hospital stay is significantly reduced with this procedure . during the second stage , some surgeons prefer to excise the bridge segment , which leaves a large skin grafted area on chest which is not aesthetic . skin graft requirement is less ( approximately 20% ) than a conventional dp since part of the pectoral area is covered by the laterally based cervical flap . by the same logic overall cost associated with a double procedure and longer stay is also avoided . for the onco surgeon , the neck dissection is easier with an elevated platysma myocutaneous flap leaving a bare neck . since the length of the dp flap to reach the neck is shorter than a cheek defect , it is more reliable . there is no doubting the fact that free tissue transfer is superior to this technique . but this flap comes in the armamentarium when the logistics do not favour a free flap . this is aesthetically superior to a double paddle pmmc and more so in a female patient where the flap is very bulky . forehead flap is also an option where lining and cover can be provided but it is aesthetically not appealing for obvious donor site deformity . providing cover with a cervicothoracic flap is another option but it is cumbersome to raise such a huge flap as a single unit . our technique splits this single cervicothoracic unit into three units which allows a better positioning of regional tissue units . the plastic surgeon has to precisely plan and raise the neck flap prior to the onco procedure so as allow the onco surgeon access to the neck . in patients with normal neck skin , a part of it is sacrificed near its base to avoid dog ear , which was not the case with this patient since she had an ulcerating neck node . this technique offers an alternative to single - staged microvascular procedure and is superior to double - paddle pmmc or conventional dp with pmmc for classical lining and skin defects .

even though free tissue transfers are a routine in many centres , pedicle flaps still have a huge roll to play in our country . there are many centres in the country where pedicle flaps are in use because of logistic problems . deltopectoral and pectoralis muscle flaps are usually preferred for composite cheek defects . when both these flaps are used in combination it is a two - staged procedure . we describe a single - stage procedure to reconstruct a composite cheek defect with pectoralis major myocutaneous flap for lining and single - stage deltopectoral flap for cover . in the available literature search , single - stage dp and pmmc have not been described for management of composite cheek defect .

about 50% of patients with a diagnosis of non - small cell lung carcinoma exhibit metastatic disease at the time of diagnosis . the preferential sites of extrapulmonary spread are the lymph nodes , liver , brain , adrenal glands , and bones . a 51-year - old smoker was diagnosed with a poorly differentiated non - small cell lung carcinoma of the right lower lobe in stage ct2a he received front - line therapy with cisplatin - pemetrexed . a ct scan after 4 cycles revealed a partial response in the lung and a complete response in the brain . after 2 cycles , locoregional progression was observed , with the extrapulmonary disease still controlled . after 2 cycles , the patient complained of abdominal pain and reported melena , yet without signs of intestinal obstruction . biological data revealed severe aregenerative anaemia ( haemoglobin concentration at 6.9 g / dl , reticulocyte count at 120,000/mm ) and iron deficiency signs consisting of low serum ferritin , iron , and transferrin saturation . the stool examination for occult blood was strongly positive , while gastric fiberscopy and colonoscopy results were normal . abdominal ct with contrast medium enhancement showed an intussusception of the small bowel ( fig 1 ) . we then decided to explore the small bowel by means of capsule endoscopy , which revealed several secondary lesions , including one stenosing the first jejunal loop and another one ulcerated and bleeding ( fig 2 ; online suppl . videos 1 and 2 ; for all online suppl . a double - balloon enteroscopy was performed thereafter for lesion biopsy , confirming the metastatic localisation of a poorly differentiated lung carcinoma . on account of the patient 's poor performance status , surgical treatment was not considered , with only symptomatic treatment performed using several blood transfusions and iron supplementation . at last , the patient died 20 months following the cancer diagnosis and 5 months after discovering the intestinal metastasis . improvement in metastatic lung cancer management has led to extending survival , and we are thus faced with an increasing number of uncommon metastatic sites . gastrointestinal metastases are considered to be rare , usually occurring in advanced disease stages , and associated with poor prognosis . due to their mostly asymptomatic presentation , were observed in 12% of patients , with the small bowel as the most common site of metastatic involvement . gastric and duodenal metastases likely cause abdominal pain , haematemesis , as well as chronic bleeding resulting in anaemia . small bowel involvement often leads to acute abdomen , and may be associated with various clinical complications such as perforation , obstruction , or haemorrhage . clinical cases of gastrointestinal metastases from lung cancer have been reported , with diagnosis systematically delayed . as illustrated in our case report , although conventional imaging revealed jejunal intussusception , the correct diagnosis of metastatic intestinal involvement was only brought upon by capsule endoscopy . this non - invasive procedure thus represents a valuable method contributing to a rapid and detailed diagnosis while reducing underdiagnosis . this strategy allows for obtaining a therapeutic effect in patients with solitary gastrointestinal metastases , and a favourable palliative effect on survival in those with preoperatively diagnosed metastases . we reported a case of small bowel metastases from primary lung cancer revealed by abdominal pain and severe recurrent anaemia . capsule endoscopy allowed for an aetiologic diagnosis to be obtained , and should thus be considered in lung cancer patients complaining of abdominal symptoms , which may indeed be related to gastrointestinal metastases . written informed consent was obtained from the patient for publication of this case report and any accompanying images .

gastrointestinal metastases from lung cancer are rare and usually asymptomatic . we report a case of small bowel metastases from primary lung cancer revealed by abdominal pain and severe recurrent anaemia . the diagnosis was obtained with capsule endoscopy . this non - invasive procedure thus represents a valuable method contributing to a rapid and detailed diagnosis while reducing underdiagnosis , and it should thus be considered for lung cancer patients complaining of abdominal symptoms , which may indeed be related to gastrointestinal metastases .

benign primary intramural tumors of the esophagus are rare and account for approximately 2% of all esophageal tumors . most of them are esophageal leiomyomas ; less frequent are schwannomas or malignant masses such as gastrointestinal stromal tumors ( gist ) . endoscopic ultrasound biopsy or frozen section biopsy during the operation does not differentiate the tumors . we report a case of benign esophageal schwannoma causing progressive dysphagia in a 37-year - old woman . a 37-year - old woman presented due to symptoms of chest pain during swallowing of solid food for 3 months . the physical examination was noncontributory . computed tomography of the chest showed a soft tissue mass in the lumen of the upper esophagus ( fig . endoscopic ultrasound identified the mass at 19 cm from the incisors , but the biopsy was nondiagnostic . computed tomography scan showing concentric soft tissue lesion surrounding the esophagus bronchoscopy and pulmonary function test of the patient were normal . the right chest was opened through a right anterolateral thoracotomy at the fifth intercostal space . the intramural tumor 3.5 3 3 cm was enucleated without erosion of the mucosa ( fig . the esophageal wall allowed primary closure of the muscular layers , and the native esophagus was preserved . enucleated esophageal schwannoma ( 3.5 3 3 cm ) histopathological examination of the tumor revealed spindle - shaped cells in a fasciculated and disarrayed architecture and nuclei in a palisading pattern ( fig . immunohistochemically the tumor was positive for s100p and gfap , and negative for cd34 , cd117 , sma , desmin and h - caldesmon ( fig . spindle - shaped cells in a fasciculated and disarrayed architecture and nuclei in a palisading pattern . a ) 40 , b ) 200 immunohistochemical studies revealed s100 protein positivity postoperative recovery was uneventful , and there has been no evidence of recurrence to date . esophageal schwannoma is uncommon and difficult to diagnose in preoperative investigations due to its similarity to other intramural esophageal tumors ( leiomyoma , gist , oesophageal cysts or cancer ) . these tumors more frequently develop in women and are often located in the upper and mid esophagus . malignant schwannoma has also been reported [ 1 , 2 ] . symptoms of this tumor include dysphagia , dyspnea [ 1 , 3 ] , chest pain , and hematemesis , and appear when the tumor increases in size . imaging studies ( positron emission tomography , computed tomography , and magnetic resonance imaging ) are useful for the confirmation of esophageal tumor [ 1 , 4 , 5 ] . endoscopic ultrasonography - guided fine needle aspiration biopsy is not always useful for diagnosis , as in our cases . the value of frozen section is limited , and it can lead to diagnostic pitfalls . final diagnosis is possible upon positive immunohistochemical studies for s-100 protein and negative staining for smooth muscle markers such as sma , cd34 , and cd117 . surgical excision of the tumor is the method of choice , because chemotherapy and radiotherapy are ineffective . the option of enucleation is recommended when : the tumor is well encapsulated , a clear margin is achievable , and there is sufficient redundant mucosa to close the defect . in our case enucleation with video - assisted thoracoscopic surgery ( vats ) is possible for small tumors ( 2 cm ) . for large tumors ( 8 cm ) with broad adjacent to the muscular layer and an extensive mucosal defect , esophagectomy with gastric pull - up is recommended [ 3 , 7 ] .

schwannomas of the esophagus are rare peripheral nerve tumors . a 37-year - old woman with dysphagia was found to have an intramural tumor of the upper esophagus . the lesion was revealed on computed tomography . endoscopic ultrasound biopsy was nondiagnostic . through right thoracotomy , the mass was enucleated from the wall of the esophagus . benign schwannoma was diagnosed only after immunological staining examination .

our case is a 37-year - old male who hails from sivagangai district , tamil nadu . the patient had minimal bleeding of 20 ml / day within the past 2 days which was not associated with pain , postural change , trauma or nose picking . he had a history of headache , that was dull aching in type and confined to the frontal region . the patient gives a classical history of residing in an endemic region with cattle rearing as his occupation and also gives a history of routine bathing in the ponds along the animals . on examination , a small single fleshy bluish pink pedunculated polypoidal mass its surface was smooth , and it was not probed due to anticipation of bleeding . all routine investigations were done , and contrast computed tomography paranasal sinuses was done which showed a single nonenhancing mass seen to be attached to the inferior turbinate with no signs of bony erosion and any other abnormalities . the patient was later planned for elective surgery , and an endoscopic excision was done and the base was cauterized to prevent recurrence . the specimen was sent for histopathological examination where it showed that the polyp was lined by stratified squamous epithelium and it was infiltrated by numerous lymphocytes and plasma cells . later follow - up of the case was done at 6 months and after 1-year where no signs of recurrence seen . rhinosporidiosis is seen to be endemic is seen in about 70 countries but its incidence is very high in india and sri lanka , in india certain places tamil nadu like , madurai , sivagangai , ramanathapuram , chenglepet ( singaperumalkoil ) districts are highly endemic for the disease . the organism causing the disease is described in textbooks as the fungi rhinosporidium seebri but latest research conclude that the actual organism belongs to clusters with novel group of fish parasites referred to as the dermocystidium , rossete agensts , icthyophorus and psorospermium clade . the presentation of the disease classical as the person belongs to an endemic area , bathes in ponds and is also a cattle raiser all of which have documental evidence of being associated with rhinosporidiosis . it is described that the polyp usually presents at multiple sites and is attached to the septum and lateral wall . the presentation in our case is solitary , and the site is also very unique as it is attached to the inferior turbinate . this also promotes us to the fact that we might have diagnosed the patient in the very early course of the disease and if not he would have progressed to the advanced stages and presented with the more textbook features . the treatment which we have offered is simple endoscopic excision and cauterization of the base which is approved by standard textbooks another add - on therapy , which could have been added is dapsone to prevent recurrence . the histopathological findings also are very standard when compared with some findings like pseudoepithelomatous squamous cell metaplasia [ figure 1 ] . at present , the latest methods of treatment include the use of ktp-532 potassium titanyl phosphate laser for treatment and has been showing promising results . the classical findings like the fungal spores were also visualized which were similar to the images in figure 1 .

rhinosporidiosis is a unique disease , which is seen to be endemic in certain places in india such as tamil nadu and sri lanka . the disease is caused by rhinosporidium seebri and it is transmitted by bathing in ponds contaminated by cattle feces containing spores of the organism . the disease usually presents as multiple granulomatous bleeding polyps . the case described here is a unique presentation where it occurs only in a single site and that too in an uncommon location where the suspicion of rhinosporidiosis is a last possibility .

left ventricular noncompaction has been classified as a primary cardiomyopathy with a genetic origin.1 morphologically , this condition is characterized by a thickened , two - layered myocardium with numerous and prominent trabeculations and deep , intertrabecular recesses.13 left ventricular noncompaction may be an isolated finding or it may be associated with a variety of other congenital heart defects.1 left ventricular noncompaction is associated with numerous sarcomere mutations and this fact created the view that there is a spectrum spanning hypertrophic cardiomyopathy ( especially apical hcm ) , dilated cardiomyopathy and left ventricular noncompaction.4 current diagnostic criteria for left ventricular noncompaction require the visualization of two distinct myocardial layers.5 the work of stllberger departs from this stipulation and he coined the term left ventricular hypertrabeculation.5 this entity , which can be viewed as a less severe form of noncompaction , is characterized by the presence of more than three trabeculations located apically to the papillary muscles.5 we present a case report of a three month old male infant who presented with sudden infant death syndrome . the macroscopical characteristics of this case was reported before.6 this three month old non - caucasian died suddenly and unexpectedly at his day care centre . he did not have any known medical problems and no surgical procedures were ever performed . no known allergies were present and no known family history of sudden , unexpected death were present . unfortunately the family members were lost to follow up , before electrocardiographic and echocardiographic screening could be performed to assess their risk for sudden unexpected death . postmortem examination of the heart revealed numerous apical trabeculations of the left ventricle ( see fig . no abnormalities were detected in any other organs during the postmortem examination and no thrombi were detected in the arterial system or the left ventricle . figure 1 clearly demonstrates more than three trabeculations in the left ventricle in a location apical to the papillary muscles . according to stllberger7,8 this case which presented as a sudden infant death syndrome histological assessment of sections underlying the left ventricular trabeculae revealed prominent areas of subendocardial fibrosis ( see figs . 2 , 3 and 4 ) . figure 5 is a histological section of the apex of the left ventricle of a three month old male infant who also presented as a sudden infant death syndrome , but without left ventricular hypertrabeculation to serve as a control . endocardial fibrosis with prominent elastin deposition have been described in cases of left ventricular noncompaction.5,9,10 currently , it is thought that ischaemia may play a major role in the pathogenesis of left ventricular noncompaction : mri and thallium-201 scintigraphy has shown subendocardial and transmural perfusion defects which corresponds to areas of noncompacted myocardium.5,1114 reduced coronary flow reserve , indicating microvascular dysfunction has also been shown to be present in isolated ventricular noncompaction by pet.12 currently , a chicken and egg dilemma exists regarding the pathogenesis of isolated ventricular noncompaction : either an impairment in the development of the myocardial microcirculation impairs the normal compaction process of the myocardium or vice versa . in this case report current literature notes the presence of fibrosis in cases of ventricular noncompaction , this is the first case describing fibrosis in ventricular hypertrabeculation the less severe form of noncompaction . secondly , the presence of such striking subendocardial fibrosis implies that the involved areas in the left ventricle must experience ischaemia already in utero . lastly , we propose that these fibrotic areas may act as the foci of ventricular arrhythmia as the underlying cause of death . l du - toit - prinsloo , wfp van heerden and g saayman did the post - mortem analysis and histological assessment .

left ventricular noncompaction has been classified as a primary cardiomyopathy with a genetic origin . this condition is morphologically characterized by a thickened , two - layered myocardium with numerous prominent trabeculations and deep , intertrabecular recesses . recently , it has become clear that these pathological characteristics extend across a continuum with left ventricular hypertrabeculation at one end of the spectrum.the histological findings include areas of interstitial fibrosis.we present a case of left ventricular hypertrabeculation which presented as sudden infant death syndrome . histologically areas of subendocardial fibrosis was prominent and we propose that this entity may be a hidden cause of arrhythmic death in some infants presenting as sudden infant death syndrome . , with areas of subendocardial fibrosis as possible arrhythmogenic foci .

a 37-year - old woman presented to us complaining of sudden right flank pain and lower abdominal pain that had lasted for 1 week , as well as nausea and vomiting . two years previously she had undergone a laparoscopic right partial nephrectomy at another hospital owing to a small right renal mass that was diagnosed as renal cell carcinoma ( t1an0m0 ) . postoperatively , she had gradually acquired lower urinary tract symptoms , such as urge incontinence , urgency , frequency , and nocturia . three months earlier , she had been checked with abdominopelvic computed tomography ( ct ) for regular follow - up of the renal cell carcinoma and heard that there were no definite abnormal findings in the ct scan . in the physical examination , the results of a urine test showed 5 to 10 red blood cells per high power field , and plain x - ray of the kidney , ureter , and bladder revealed metallic surgical clips on the right upper abdomen and a possible right renal stone , but no abnormal density on the ureteral courses ( fig . 1 ) . the abdominopelvic ct scan revealed a 0.5 cm1.0 cm opacity on the right proximal ureter with borderline hydronephrosis and a tiny right renal stone ( fig . 2 ) . ureteroscopy with the patient under general anesthesia showed a white rectangular parallelepiped foreign body at the proximal right ureter ( fig . the foreign body was removed by use of a ureteroscopic stone basket device and was identified as a medium - sized surgical clip ( fig . 3b ) . there was no extravasation of the renal pelvis during contrast media instillation via the channel of the ureteroscope . a ureteral stent was placed for 1 week , and the patient had no more flank pain . currently , partial nephrectomy is considered a standard treatment for small renal tumors with the benefit of preserving renal function ; improving overall survival , especially for patients younger than 65 years of age ; and decreasing the overall mortality rate . for t1b tumors , more clinical data are required to establish the oncological and functional benefits of partial nephrectomy ( pn ) . lpn has come to represent comparable perioperative and oncological outcomes in the recent era and has gained popularity , although it remains a challenging and highly advanced laparoscopic procedure . the most demanding step during lpn is the repairing of the collecting system and renal defect because this repair requires advanced laparoscopic skills and is performed under time pressure to minimize the warm ischemia time . there is a report of the migration of absorbable lapra - ty suture clips in the collecting system after lpn , and massoud also reported the migration of a metal surgical clip into the ureter after opn , all of which were passed spontaneously . furthermore , intravesical migration and stone formation of a surgical clip after laparoscopic radical prostatectomy has been reported , but there have been no reports of ureter migration of a surgical clip after partial nephrectomy . reviewed the different sealants and laparoscopic instruments that are available for achieving hemostasis of the renal parenchyma in lpn and determined that there is no gold standard single agent or combination that can be applied to all cases . the decision as to which technology to use and how to manage the hilum should be made on a case by case basis . hem - o - lok or metal clips that are used to repair the collecting system and the renal defect in lpn can migrate postoperatively and cause secondary complications , such as urinary stones . ureteral stones following lpn can be managed conservatively with hydration and narcotics , but if symptoms do not improve , surgeons may consider more aggressive ureteroscopic management .

we report a case of ureteral migration of a surgical clip after partial nephrectomy in which the clip was misdiagnosed as a ureteral stone . a 37-year - old woman had undergone laparoscopic partial nephrectomy of right renal cell carcinoma at another hospital 2 years previously . postoperatively , she had gradually acquired lower urinary tract symptoms . then , she complained of sudden right flank pain for a week . a plain x - ray and enhanced abdominopelvic computed tomography scan were performed . a 0.5 cm1.0 cm right upper ureteral opacity with borderline hydronephrosis was seen but could not be found on the x - ray . ureteroscopy revealed a medium - sized hem - o - lok clip on the right upper ureter that was removed with a stone basket . we concluded that a hem - o - lok clip used for collecting system sealing had migrated to the ureter and had been misdiagnosed as a ureteral stone on a computed tomography scan .

diffuse normolipemic plane xanthoma ( dnpx ) was first described by altman and winkelmann in 1962 . the features of this entity are : ( 1 ) xanthelasma palpebrarum ; ( 2 ) diffuse xanthoma planum of the head , neck , trunk , and extremities , and ( 3 ) plasma lipid values that are within normal limits . several associations have been reported between dnpx and lymphoproliferative and myeloproliferative disorders , particularly multiple myeloma and benign monoclonal gammopathy ( often iga ) [ 2 , 3 ] . all therapeutic options for the treatment of plane xanthoma include mechanical removal by excision , chemabrasion , dermabrasion , or abrasive laser therapy [ 4 , 5 , 6 ] . we report on a patient with dnpx who received oral probucol and showed significant clearing of the lesions . a 70-year - old woman presented with well - defined macular yellowish patches on her eyelids , both cheeks , and the nose lasting over a few years ( fig . 1 ) . she had no history of topical steroid use or extensive sun exposure on her face . a skin biopsy specimen revealed the accumulation of foam cells and touton giant cells in the superficial dermis ( fig . complete blood count , and liver and renal function tests were within normal limits , but she had elevated levels of iga [ 460.7 mg / dl ( normal values : 100400 mg / dl ) ] and amylase [ 270 iu / l ( normal values : 40120 plasma lipid levels including total cholesterol , hdl and ldl cholesterols , triglycerides , and apolipoproteins were normal . she was diagnosed with idiopathic macroamylasemia and treatment was considered unnecessary . based on the clinical and histopathological findings , a diagnosis of dnpx was made and oral administration of probucol ( 500 mg / day ) was initiated . the lesions began to recede after 2 weeks and had almost resolved within 8 months ( fig . dnpx , first described in 1962 , is characterized by diffuse , yellow to orange , slightly elevated plaques with sharply delineated borders that may affect any part of the body . type i contains patients with xanthomas found in association with an altered lipoprotein content or structure . type iii consists of patients with neither lipoprotein abnormalities nor underlying systemic disease , but in whom local tissue alterations seem to play a role in xanthoma formation . lesions can be removed by excision , chemabrasion , dermabrasion , or abrasive laser therapy [ 4 , 5 , 6 ] . lorenz et al . used an er : yag laser for full - face dnpx lesions under general anesthesia and reported that the lesions were almost completely removed after 2 sessions . although these excisional or abrasive therapies may be useful for limited lesions including palpebral xanthelasmas , they may be too invasive for widespread lesions . probucol is an antioxidant that may inhibit atherogenesis by limiting the oxidative modification of ldl cholesterol [ 8 , 9 ] and , thus , foam cell formation and/or endothelial cell injury . . showed that xanthelasma lesions decreased in size in their 7 cases , and 3 lesions disappeared during probucol therapy in patients with hypercholesterolemia . furthermore , 17 out of 25 xanthelasma patients ( 68% ) with normolipemia exhibited regression after taking probucol . therefore , we used probucol to treat our patient with dnpx . the results obtained were remarkable , and we suggest that probucol be included as a primary therapy for dnpx .

we report on a 70-year - old woman with diffuse normolipemic plane xanthoma ( dnpx ) who developed macular yellowish patches on the eyelids , both cheeks , and the nose . histology revealed the accumulation of cd68-positive foam cells and touton giant cells in the superficial dermis . plasma lipid levels were within normal limits . the patient had no underlying hematological diseases . her extensive lesions precluded surgical excision . the patient was given oral probucol instead , which resulted in a significant reduction of the lesions after 2 weeks . the lesions almost disappeared within 8 months . plane xanthoma is primarily treated with excisional or abrasive therapies ; however , probucol can be a safe and effective alternative therapy for dnpx .

the most important reason for this is the apparent development of a nondepolarizing , relaxant - induced neuropathy , which leads to difficulty in weaning patients from artificial ventilation , among other problems . some frequently used drugs , such as corticosteriods and aminoglycoside antibiotics , contribute to this neuropathy . therefore , nowadays relaxants are only administered in the icu for specific indications , such as when decreased muscle tone is required , for treating patients who fight the ventilator and in order to allow permissive hypercapnia . relaxants are still needed frequently in surgical anaesthesia to facilitate quick procedures such as endotracheal intubation . its ultra - short duration of action renders rapid return of spontaneous breathing possible if intubation fails . the situation in the icu is different , however . during anaesthesia , intubation and artificial ventilation are only indicated to facilitate surgery by ensuring an open airway . in the icu these are absolute indications , and rapid return of spontaneous ventilation is not necessary , given that intubation is mainly indicated to start artificial ventilation . its mechanism of action ( depolarization of muscle cell membrane ) results in the release of intracellular potassium by upregulating acetylcholine receptors , especially outside the motor endplate , and changing their characteristics . potassium release is already massively increased in a number of circumstances and diseases that are frequently present in icu patients , including long - term immobilization , extensive muscle trauma , many neuromuscular diseases , denervation of muscles , burns , sepsis , encephalitis and acute renal failure . potassium release can be further augmented by acid - base balance disturbances and by corticosteroids . when such an arrest occurs it is difficult to resuscitate the patient . in patients with myopathy or those receiving long - term treatment with corticosteroids it is likely that cardiac arrest in such cases has an even higher mortality rate than cardiac arrest in succinylcholine - induced hyperkalaemia alone . in intensive care patients there is large variability in the activity of plasma cholinesterase , an enzyme that metabolizes succinylcholine . for example , many drugs decrease plasma cholinesterase activity , including ecothiopate , bambuterol , corticosteroids , cytotoxics , anticonceptives and oestrogens . heart - lung machines that are used during cardiac surgery induce a decrease in plasma cholinesterase activity , which lasts for approximately 10 days . repeated plasma exchange decreases plasma cholinesterase activity . in pregnancy ( i.e. in patients with hellp syndrome [ haemolysis , elevated liver enzymes , low platelets ] , eclampsia , etc . ) , plasma cholinesterase activity is markedly decreased , resulting in a prolonged succinylcholine effect . the same holds for patients with sepsis , malignancy , burn trauma and liver disease . in such patients there is a wide variability in the neuromuscular blocking effect , onset and duration of paralysis caused by succinylcholine . muscle hypertonia , myalgia , hypersalivation , elevated intraocular and intracranial pressures , and induction of malignant hyperthermia are also side effects of succinylcholine . occasionally , harmful cardiovascular effects also occur following succinylcholine administration , caused by stimulation of nicotinic receptors in the autonomic ganglia ( sympathetic and parasympathetic ) and of cardiac muscarinic receptors . furthermore , succinylcholine increases plasma noradrenaline ( norepinephrine ) concentrations , resulting in cardiovascular effects . finally , the histamine - releasing properties of muscle relaxants are well known , and succinylcholine has the strongest histamine - releasing effect of all such agents . given the profile described above , it is unlikely that many authorities would approve succinylcholine for registration if it were presented today as a new drug . nondepolarizing muscle relaxants do not have the deleterious effects connected with depolarization . in order to be useful for facilitating endotracheal intubation in the icu , they must have an acceptable speed of onset , have a relatively short to intermediate duration of action , be noncumulative , and preferably should not have cardiovascular side effects or induce histamine release . candidates to replace succinylcholine for intubation include vecuronium , rocuronium , atracurium , cisatracurium and mivacurium . the onset of action of atracurium , cisatracurium and vecuronium is rather long , and atracurium and cisatracurium can release histamine . rocuronium has an onset of action similar to that of succinylcholine , and provides similar intubation conditions 1 min after administration . the duration of action of mivacurium is shorter , but it has a slower onset , the intubation conditions are comparable only after 45 min , and it has stronger histamine - releasing properties than does rocuronium . because mivacurium is metabolized by plasma cholinesterase , the interindividual variability in effect is as wide as with succinylcholine . many studies have shown that rocuronium is a highly acceptable replacement for succinylcholine in the icu ; therefore , in my opinion , succinylcholine is obsolete . suitability of relaxants for use in the icu the number of ' + 's or ' - 's indicates the degree to which the drug is favourable or unfavourable with respect to the parameter under question .

muscle relaxants in intensive care unit ( icu ) patients are predominantly administered to facilitate intubation . the adverse effect profile of succinylcholine is such that its use in the icu must be considered obsolete . suitable alternatives are the intermediately long - acting nondepolarizing relaxants , of which rocuronium is probably preferable .

a 76-year - old male ex - smoker presented with a recent history of hematuria and transient right - flank pain . on physical examination , no mass was palpable in the abdomen , and no costovertebral angle tenderness was found . hemogram and blood chemistry results were normal , except for azotemia ( serum creatinine , 2.2 ng / ml ) . magnetic resonance urography confirmed an irregular ureter mass 2 cm from the ureterovesical junction of approximately 5 cm ( fig . cystoscopy showed no abnormalities in the urinary bladder , and the findings of urine cytologic examination were negative . grossly , several small and large simple cysts were observed in the renal cortex , of which the largest measured 32 cm . the distal end area was dilated , and an irregular polypoid mass measuring 51.51.2 cm was identified 2 cm from the bladder cuff ( fig . 2 ) . microscopically , a population of mononuclear cells with numerous interspersed multinucleated giant cells were observed . the mononuclear cells contained round- to oval - shaped nuclei with vesicular chromatin , inconspicuous nucleoli , moderate nuclear clearing , and mild nuclear pleomorphism . ogcs had multiple round - to - oval , bland - appearing nuclei ranging from 4 to 34 in number . the tumor invaded focally into the periureteric adipose tissue and was categorized as american joint committee on cancer stage pt3nxmx . immunohistologic examination showed that the multinucleated giant cells were positive for cd68 , cd45 , epithelial membrane antigen ( ema ) , vimentin , and cytokeratin ( cytoplasmic but not nuclear staining ) and negative for desmin and cd31 ( fig . the 5-month postsurgical follow - up , the patient was doing well , had no evidence of disease recurrence , and had a serum creatinine level of 2.5 ng / ml . extraskeletal ogc carcinoma of the urinary tract is extremely rare and has most frequently been reported in the breast and pancreas . fewer than 30 case reports of ogc tumors of the urinary tract have been published in the english literature [ 2 - 6 ] . the most common tumor locations in the urinary tract are the kidney , renal pelvis , and bladder . only one case of ogc carcinoma of the bladder with right ureter invasion has been reported . to the best of our knowledge , this is the first case report of an ogc carcinoma of the distal ureter without a bladder tumor . much controversy exists regarding the nature and origin of epithelial , histiocytic , and mesenchymal ogcs . one study indicated that these types of ogcs may result from the fusion of mononuclear histiocytes / macrophages , which are attracted to the tumor by growth or chemotactic factors released by neoplastic epithelial cells . immunohistochemical analysis in this previous study showed that the ogcs were positive for vimentin , ema , and the cell surface proteins cd68 and cd45 and were negative for cytokeratin . as is well known , hematuria and flank pain are the most common and frequent initial symptoms . the appearance of ogc carcinoma under cystoureteroscopy is similar to that of other urothelial tumors . because of the rarity of ogc tumors in the urinary tract , previous reports indicate that the median survival rate associated with ogc tumors is less than 2 years . aggressive management is recommended because of the poor prognosis of this condition ; however , no adjuvant treatment has yet been established . adjuvant radiation therapy may be beneficial , because giant cell tumors of the bone are radiosensitive . although adjuvant chemotherapy , such as mitoxantrone / etoposide / cyclosporine , has been reported to be beneficial in patients with transitional cell carcinoma of the urinary tract , a large population - based study is needed to confirm the benefits of such therapy in the treatment of invasive ogc tumors of the urinary tract . previous reports indicate that extensive surgical excision appears to be the recommended treatment for primary or recurrent lesions until the treatment benefits of adjuvant chemotherapy or radiotherapy are established .

extraskeletal osteoclast - like giant cell ( ogc ) tumors are uncommon and have mainly been found in the breast and pancreas . ogc neoplasms of the urinary tract are extremely rare . most cases found in the renal pelvis and bladder are associated with either an in situ urothelial malignancy or a conventional high - grade urothelial carcinoma . these malignancies tend to be associated with a poor prognosis and disease course . to our knowledge , no cases of ogc tumors of the distal ureter only have been published . here , we present the case of a 76-year - old man who underwent hand - assisted laparoscopic nephroureterectomy because of painless gross hematuria with right flank pain . pathologic examination showed ogc carcinoma of the right distal ureter . no local tumor recurrence or distant metastasis was found at the 5-month follow - up .

laparoscopic surgery of the prepared upper and lower gastrointestinal ( gi ) tract has been well reported . successful closure of ruptured duodenal ulcers associated with peritoneal soiling has demonstrated that laparoscopic techniques can be applied to repair of the perforated viscus . more controversial is the therapeutic role of laparoscopic surgical techniques in perforations of the lower gi tract . , a 24-year - old male , presented with an injury sustained when he fell upon a pneumatic jack - hammer . upon his arrival in the emergency room , his only complaint was that of perianal pain . he was found to have a single complex laceration involving the perianal skin , subcutaneous tissue and completely lacerating the internal sphincter and the lower 4 cm of the rectum . the patient remained in the emergency room for two hours prior to being taken to the operating room holding area . there , he was found to have developed a complaint of generalized abdominal pain and findings of tachycardia and peritoneal signs . a proctoscopic examination revealed a transmural laceration of the anterior aspect of the rectum at 6 cm . no further studies were performed as it was felt that a patient with evolving peritoneal signs , penetrating trauma and free air needed to be explored . under general anesthesia , a transanal , single layer repair of the rectum was performed entirely via transanal approach , with continuous sutures of polyglycolic acid . the external sphincter and cutaneous margins of the complex laceration were then approximated with interrupted polyglycolic acid sutures . following this , laparoscopic entry to the abdomen was obtained at the umbilicus by the open hasson technique . a small volume of bloody serous fluid was noted in the pelvis and was aspirated and submitted for culture . using atraumatic bowel graspers ( snowden - pencer ) , the small bowel was run from the ligament of trietz to the ileo - cecal valve and no injury was detected . the bladder appeared intact upon inspection and , on gentle elevation of the bladder flap , the repaired rectal tear was visualized . a jackson - pratt drain was placed and positioned along the sigmoid gutter into the pelvis . the patient was placed on empiric therapy with imipenam and was observed in the icu . he was further evaluated by the urology service with a voiding cystourethrogram which was normal . cultures of the peritoneal cavity revealed gram negative rods which proved to be e. coli . his white blood count , 17,000 upon admission , decreased progressively and he was transferred from the icu . the patient passed flatus on postoperative day ( pod ) 3 and was allowed clear liquids . the drain was producing only small amounts of serous fluid following his first stools and was removed on pod 5 . his recovery at home was uneventful other than the development of a keyhole deformity of the anus which was repaired , uneventfully , six weeks later . there was no loss of sexual function or change in voiding or bowel habits , and he has since returned to work without disability . less well described , and more controversial , is its use in the treatment of acute lower gi pathology , including perforation . the approach to the issue of right vs. left - sided colonic perforation and the creation of a temporary stoma vs. primary resection or repair has evolved to the point where recent papers describe primary resection or repair without colostomy as the method of choice in selected left colon injuries . our patient presented with penetrating trauma to an unprepped left colon and bacterial peritonitis . while the perforation proved to be amenable to transanal closure , laparoscopy offered the opportunity to inspect the pelvic and abdominal organs , irrigate the abdomen , place a drain and test the integrity of the suture line . our experience in laparoscopic colon surgery would have allowed sutured or stapled closure , or resection , with or without colostomy , should the injury have been more proximal or associated with more extensive tissue damage or gross soilage . this result would certainly agree with the suggestion by others that the laparoscopic approach be considered first in dealing with an expected single perforation from iatrogenic injury during colonoscopy and may suggest that a subset of perforated diverticulitis patients may exist in whom the standard two - stage hartmann procedure , and its resultant disability , may prove unnecessary .

elective laparoscopic colonic surgery is increasingly recognized as feasible and perhaps preferential . a case of laparoscopically assisted surgery for trauma to the rectum with bacterial peritonitis is presented . it presents an example of the application of this modality to the treatment of iatrogenic colon perforations and perhaps selected diverticulitis .

the presence of an idic(ph ) chromosome(s ) represents a mechanism for genomic bcrabl1 amplification and may contribute to resistance against targeted therapies based on imatinib or dasatinib . a 52yearold , previously healthy man presented to his local ed with worsening right groin pain of 2months duration , which began after a traumatic fall with direct trauma to that site . at that time , he was discharged home from the ed with a diagnosis of rectus sheath hematoma . his pain continued to progress , and he returned to the ed where repeat ct demonstrated worsening hematoma size and a cbc showed significant leukocytosis . the patient was transferred to our hospital with a concern for leukemia . at our institution , the admission white blood cell count ( wbc ) was 116.4 10/l with a differential consisting of 70% neutrophils , 3% metamyelocytes , 6% myelocytes , 2% promyelocytes , 7% lymphocytes , 5% eosinophils , 4% basophils , and 3% blasts ( fig . the platelet count was 506 10/l and the hemoglobin level was 10.5 g / dl . ( a ) the peripheral blood smear shows a leukocytosis with neutrophils at various stages of maturation , a basophilia ( < 20% ) , and 3% blasts ; ( b ) the marrow is hypercellular with diffuse granulocytic proliferation and numerous dwarf megakaryocytes ; ( c ) bcrabl1 fish showed a variant fusion pattern ( 3 fusions ; 1 orange ; 1 green ) ; ( d ) chromosome analysis revealed an abnormal male karyotype with an isodicentric philadelphia chromosome ; ( e ) metaphase fish studies show the presence of two bcr / abl1 fusion signals on the idic(ph ) chromosome . peripheral blood flow cytometry showed an increased granulocyte population with leftshifted maturation and myeloblasts accounting for about 2.5% of the total events . a bone marrow biopsy showed findings consistent with cml including marked marrow hypercellularity with leftshifted granulocytic preponderance , numerous dwarf megakaryocytes , and 3% blasts ( fig . 1b ) . fluorescence hybridization ( fish ) analysis on the bone marrow with bcrabl1 dualcolor , dualfusion probes revealed three distinct bcr / abl1 fusion patterns . the typical bcr / abl1 fusion pattern was observed in 31% of interphase nuclei analyzed . a variant bcr / abl1 fusion pattern ( 3 fusions ; 1 orange ; 1 green ) 1c ) and 2.5% of nuclei showed 4 fusions ; 1 orange ; and 1 green pattern . karyotyping studies revealed the presence of an isodicentric philadelphia chromosome , 46,xy , der(9)t(9;22)(q34;q11.2),22,+ider(22)(q10)t(9;22)(q34;q11.2 ) , in all 20 analyzed metaphases ( fig . additional metaphase fish studies with bcr / abl1 probes showed the localization of two fusion signals on the isodicentric philadelphia chromosome and another fusion signal on the derivative chromosome 9 ( fig . bcrabl1 fusion transcripts were at the level of 100% on the international scale ( is ) . two weeks later , the wbc trended down to 40 10/l and ldh level was 299 the 3month followup visit showed complete hematological response , with the bone marrow showing morphologic remission and a normal karyotype ( 46,xy ) by unstimulated bone marrow culture . however , pcr studies for the mutant transcript showed that there was lack of a major molecular response ( mmr , defined as < 0.1% on the is ) with bcrabl1 transcripts at 6.12% on the is . the patient is clinically well and continues to be followed closely in the clinic at this time . chronic myeloid leukemia ( cml ) is linked to the philadelphia chromosome t(9;22)(q34;q11.2 ) , which results in the formation of a chimeric bcrabl1 gene fusion . by binding to the kinase domain of abl1 , imatinib mesylate inhibits the function of the fusion gene and is a highly effective therapy . . mechanisms of resistance against imatinib treatment may include mutations within the abl1 kinase domain , genomic bcrabl1 amplification and clonal evolution 1 . very few cases of cml with the presence of idic(ph ) chromosome(s ) have been reported in the literature . the idic(ph ) chromosome has generally been observed in accelerated phase or in blast phase of cml 2 , 3 . in other cases , idic(ph ) chromosome(s ) were observed as a secondary chromosomal abnormality in patients resistant to imatinib mesylate or dasatinib 1 , 4 , 5 , 6 . in our patient , the idic(ph ) chromosome was observed at diagnosis with 3% blasts , suggesting the presence of idic(ph ) in chronic phase . additional studies will help in clarifying the prognostic significance of the presence of idic(ph ) chromosome during the chronic phase of cml . to date , only one other study reported the occurrence of idic(ph ) chromosome during chronic phase cml , and this case was associated with lack of hematological and cytogenetic response despite administering higher doses of imatinib 7 .

key clinical messagean isodicentric philadelphia chromosome is an uncommon finding previously described as a secondary chromosomal abnormality in accelerated or blastphase of chronic myeloid leukemia ( cml ) with resistance to imatinib mesylate or dasatinib . here , we present a case with idic(ph ) chromosome identified at initial diagnosis in a patient with chronicphase cml .

median arcuate ligament syndrome ( mals ) or celiac artery compression syndrome is a rare disorder caused by compression of celiac artery by the median arcuate ligament . clinical symptoms include postprandial abdominal pain , nausea , vomiting , epigastric bruit and weight loss . most of the patients with this syndrome are investigated with several diagnostic procedures and managed as functional gastrointestinal disorder ( fgid ) before a certain diagnosis is established . doppler ultrasonography reveals the stenosis / compression of celiac artery with increased flow velocity and computed tomography ( ct ) angiography confirms the compression of celiac trunk and therefore the diagnosis of mals . we report a case of a teenage female patient treated with laparoscopic release of the median arcuate ligament at our institution . a 17-year - old girl with chronic postprandial abdominal pain and weight loss was referred to our clinic . the other causes of chronic abdominal pain were investigated by several studies including gastrointestinal endoscopies and imaging ; however , no definitive cause could be identified . peak systolic velocity ( psv ) in the celiac trunk was measured as 250 cm / s , and dropped to 170 cm / s with deep inspiration ( psv = 80 cm / s ) . diagnosis was confirmed by three - dimensional ( 3d ) ct angiography confirming the narrowing of celiac artery at the beginning of the celiac trunk arising from abdominal aorta [ figure 1 ] . the narrowing of celiac artery at the beginning of the celiac trunk was demonstrated on computed tomography angiography the procedure was carried out via four 5 mm trocars . after opening the lesser omentum , crural fibers of diaphragm was dissected to expose median arcuate ligament . , arcuate ligament was dissected above celiac artery and released with a sealing device ( ligasure ; covidien ) [ figure 2 ] . after the releasing of the ligament , celiac trunk was free , and pulsation can be seen clearly at the distal branches of celiac artery . there were no intraoperative complications and the patient was discharged on the second postoperative day . in the postoperative period , patient was admitted to our clinic with recurrent symptoms of mild abdominal pain . psv in the celiac trunk was measured as 202 cm / s , and dropped to 162 cm / s with deep inspiration ( psv = 40cm / s ) . also , 3d ct angiography was performed to demonstrate the improvement in narrowing of celiac artery . although the pain was described to be of lower intensity when compared with presurgical state , it continued to be disturbing and required frequent use of analgesics . therefore , the patient was referred to the pain management service in the department of anesthesiology for paraspinal ganglion blockage . the patient is free of symptoms in the 9-month follow - up , gained weight and resumed normal daily activity . since the first description of mals in 1961 , there are several debates in the diagnosis and treatment of this rare clinical entity . postprandial abdominal pain , vomiting , and weight loss are the typical clinical symptoms for this syndrome . however , these patients are frequently diagnosed and treated as fgid before the correct diagnosis is confirmed . it is speculated that compression on celiac artery may result in impairment of intestinal perfusion , especially following enteral intake , and results in intestinal angina . other investigators , on the other hand , implicate that the course is a neurological pathology of the celiac ganglion , and consider this disease a primary neurological disorder . several management strategies are instituted for the treatment of mals including interventional angioplasty or stenting and surgical procedures such as releasing of the median arcuate ligament compressing the celiac artery or bypass surgeries . the releasing of the ligament may be done by open , laparoscopic or robotic surgery . minimally invasive techniques have gained popularity in the surgical management of this condition limiting open surgery to more complicated celiac by - pass procedures which do not appear in the pediatric surgical literature . minimally invasive techniques are very efficient in approaching to this surgical site and may be performed safely by an experienced surgeon . there are reports in the literature that complete resolution of symptoms may not be achieved in some patients as in our case . some patients may require prolonged use of analgesics while some others may necessitate para - spinal celiac ganglion blockage as an additional measure to completely alleviate the symptoms . mals should be considered in the differential diagnosis of patients with chronic abdominal pain , especially in those that are triggered postprandially . the diagnosis of fgid virtually requires to be scrutinized if the symptoms are persistent , and should be compelling for the physician / surgeon to search for this perhaps more frequent but rarely recognized entity . doppler ultrasonography revealing increased psv on celiac artery and ct angiography demonstrating compression on the truncus are diagnostic . laparoscopic release of the median arcuate ligament is safe and effective technique in the management of this disorder .

median arcuate ligament syndrome is a rare disorder characterized by chronic postprandial abdominal pain and weight loss caused by compression on celiac artery . a 17-year - old girl with chronic severe abdominal pain and weight loss was referred to our clinic . other causes of chronic abdominal pain were investigated and excluded . the compression on celiac artery was detected on doppler ultrasound and diagnosis was confirmed by computed tomography angiography . the patient underwent laparoscopic release of median arcuate ligament . there were no intraoperative complications ; however , partial pain response was observed postoperatively that necessitated para - spinal ganglion blockage . the patient is symptom - free in 1-year follow - up period .

this 34-year - old man had progressive visual loss in the left eye of 2 months . automated visual fields were symmetrically normal . after seeking a second opinion 14 days later , best - corrected visual acuity ( bcva ) of the left eye was 20/100 ( 6/30 ) with diffuse disc elevation and peripapillary nerve fiber hemorrhage ( fig . optical coherence tomography ( oct ) demonstrated optic nerve head swelling and thickening ( fig . visual acuity was normal in the right eye with negative findings by 90-diopter slit - lamp exam , visual acuity , oct , and fluorescein angiography . detailed medical history was positive for a cough productive of clear sputum of recent duration , nonsmoking status , no exposure to cats , no ingestion of raw meat , and no extramarital relations . physical exam and infectious workup were essentially negative ( hiv , vdrl , borrelia burgdorferi , brucella , angiotensin - converting enzyme ) including chest radiograph and chest ct . ten days after the initial consult , bcva deteriorated further to 20/200 ( 6/60 ) in the left eye with increased disc swelling . he was started on treatment for presumed optic disc tuberculoma consisting of 2 months of rifampin , isoniazid , pyrazinamide , and ethambutol ( respective doses : 150 , 75 , 400 , and 275 mg ) followed by 4 months of rifampin and isoniazid . one week after initiation of quadruple antituberculous therapy , vision improved to 20/30 ( 6/9 ) with decreased disc swelling . bcva in the left eye was 20/20 ( 6/6 ) 2 weeks after initiation of therapy with a marked decrease in both disc elevation ( fig . 4 months after initiation of therapy , visual fields were unchanged . at the last follow - up optic nerve tuberculomas are rarely reported [ 1 , 2 , 3 , 4 , 5 , 6 ] , and their natural history , prognosis , and duration of required treatment remain unclear . davis et al . gathered a large series of optic disc tuberculosis in order to delineate the progress of the disease and propose the most authoritative therapeutic regimen . in this analysis of 62 eyes from 49 patients with tuberculous optic neuropathy , papillitis was present in 51.6% , neuroretinitis in 14.5% , and optic nerve tubercle in 11.3% , with uveitis absent in 11.3% and extraocular tuberculosis absent in 63.3% of patients . in our case , an index of suspicion is required to diagnose ocular tuberculosis when all other systemic investigations are negative , especially in this part of the world where tuberculosis is endemic . isolated optic disc tuberculosis [ 1 , 2 , 3 , 4 , 5 , 6 ] , similar to isolated choroidal or ciliary body tuberculosis , can be the presenting form of tuberculosis in immunocompetent subjects without extraocular clinical signs or symptoms . positive ppd skin test and rapid response to antimycobacterial therapy confirm the clinical diagnosis of presumed ocular tuberculosis .

we present a healthy male subject who developed progressive visual loss in the left eye initially diagnosed as optic neuritis . upon suspicion of infectious etiology , testing was positive for tuberculosis . there were no signs or symptoms of active systemic tuberculosis infection . the patient responded swiftly to antimycobacterial therapy with return of vision and resolution of disc swelling . positive purified protein derivative skin test , negative chest radiograph , negative systemic workup , negative workup for other causes of unilateral optic neuritis and quick response to mycobacterial therapy reaffirm the entity of isolated optic disc tuberculosis similar to isolated choroidal tuberculosis without systemic manifestation .

apart from use in operative cases and cardiac laboratories , transesophageal echocardiography ( tee ) in now being increasingly used in critical care units . the complications with its use are primarily related to gastrointestinal , cardiovascular , and respiratory systems along with some miscellaneous problems related to probe insertion , drugs , and inexperience of the operator . our case report does not describe a complication due to tee per se , but a unique clinical situation , which has not been reported previously . a 55-year - old male , with chronic liver disease , long - standing diabetes mellitus , and obesity ( body mass index of 30 ) , was admitted to the intensive care unit ( icu ) with altered sensorium , upper gastrointestinal bleed , and hemodynamic instability . his hemoglobin was stabilized to 12 g% after transfusion of packed red blood cells . despite control of bleed , he developed a temperature of 39c ( axillary temperature ) with circulatory shock and increasing lactate levels . his 24 h culture ( blood , urine , and mini bronchoalveolar lavage ) reports sent on icu admission were sterile . his bedside echocardiogram showed a very poor window with a provisionally normal report . in view of long - standing diabetes mellitus , obesity , and poor transthoracic images , a bedside tee was planned to rule out a cardiac cause of poor hemodynamics . after appropriate consent , the transesophageal probe ( mylab 30gold esaote , te 022 ) was inserted orally into the esophagus . it was examined physically for any defects before insertion . within seconds of the probe insertion , the examination was withheld and a cold saline lavage was given through the nasogastric tube to reduce the local temperature . the lavage reduced the local temperature down to 38c after which examination was resumed . after obtaining images for 5 min , there was a rise in temperature and the above procedure was repeated twice before we could satisfactorily complete the examination . esophageal heating and potential injury can occur from piezoelectric crystal vibration within the transesophageal probe tip or by direct tissue heating from absorbed ultrasound energy . esophageal thermal injury has been reported in patients with severe atherosclerotic cardiovascular disease in whom the esophageal circulation was presumed to be compromised . therefore , tee probes have a thermocouple to monitor transducer tip temperature and an automatic shutdown mechanism when a critical preset temperature ( 42 - 46c ) has been reached . tee has been described in literature in patients with fever , most commonly in suspected bacterial endocarditis . the manufacturer guide does mention that the thermal limit can be reached in patients with fever . however to our knowledge , this is the first case report describing shutdown of the probe due to increased body temperature of the patient . in our patient , the probe stopped functioning immediately on entering the esophagus in the presence of high temperature and resumed functioning after a cold saline lavage . the stomach lies in close proximity to the liver and inferior vena cava , gastric lavage is a reasonable method to rapidly cool hyperthermic patients . a core temperature reduction of approximately 0.15c / min can be achieved using this method . we could complete our examination because of intermittent cold saline lavages which were given through the nasogastric tube . it would have been ideal if we had anticipated such a problem before probe insertion . active measures would have reduced the body temperature , and we could have completed our examination within a shorter period of time . we would recommend that tee in a critically ill patient with fever should consider such a possibility and appropriate preventive measures should be taken . future attempts should be made for refinement of probe technology so that the machine is able to differentiate in temperature rise within the probe versus the surroundings .

the use of transesophageal echocardiography ( tee ) has been increasing over the past few years . it is considered a semi - invasive monitor and a safe diagnostic device . though complications are rare , they must be known to operators who frequently perform tee . tee probes are known to cause tissue heating and damage on prolonged use . in this case report , we describe shutdown of the transesophageal probe in our patient with high - grade fever .

the finding of a renal mass on imaging is suggestive of metastatic non - small cell lung cancer in the presence of a lung tumor but can also have another origin . we describe the case of a patient diagnosed with stage iv lung cancer based on a renal metastasis . a second opinion including review of histopathological data and additional imaging followed by lung surgery and cryoablation of the kidney lesion revealed two tumors of different origins , non - small cell lung cancer and a renal cell carcinoma . the presence of a renal mass diagnosed on a ct scan in a patient with lung cancer is not always synonymous with metastatic disease . confirmation of diagnosis by tissue sampling is mandatory , especially if a synchronous primary tumor is possible . the presence of metastatic non - small cell lung cancer ( nsclc ) can be suspected by imaging . however , tissue sampling is required to confirm the diagnosis , especially if a synchronous primary tumor is possible . in this case report , we present a case with stage iv lung cancer based on a renal metastasis . a 48-year - old female received palliative radiotherapy ( 30 gy ) directed to vertebrae th9-th12 and 4 cycles of chemotherapy [ gemcitabin 1,200 mg / m ( on days 1 and 8) , carboplatin 80 mg / m ] for an 18-fdg - pet avid , thyroid transcription factor-1 ( ttf-1 ) positive adenocarcinoma of the right lower lobe invading the thoracic vertebrae 10 , and an additional 18-fdg - pet negative lesion in the right kidney , cytology - confirmed adenocarcinoma , considered as a distant metastasis ( ct4nxm1 ) . therapy resulted in a slight reduction of both lesions . due to the determined stage ( iv ) the patient 's data were reviewed and additional 18-fdg - pet and ct scans were performed . except for the presence of the lesion in the kidney , no signs of metastases were found . therefore , the initial diagnosis was reconsidered as two primary tumors : an adenocarcinoma of the lung , stage iiib ( ct4n0m0 ) and an adenocarcinoma of the right kidney ( ct1a ) . two cycles of neo - adjuvant chemotherapy ( cisplatinum 80 mg / m , pemetrexed 500 mg / m on days 1 and 21 ) were administered prior to lung surgery . surprisingly , no tumor was found in the right lower lobe perioperatively . a hemicorporectomy of th10 and a resection of the processus transversus of th10 and th11 were performed , followed by spine stabilization . with regard to the lesion of the right kidney , an expectative approach was agreed because of stable disease ( no growth ) , its localization ( in the mid pole of the kidney ) and small size ( 2.3 cm ) . eleven months later , cryoablation was ultimately performed because the patient insisted on removal of the tumor , which revealed a papillary renal cell carcinoma . this case report emphasizes the importance of differentiating a primary from metastatic disease when a renal mass is diagnosed on a ct scan in a patient with lung cancer . although metastases to the kidneys are very uncommon , differentiation between these two entities is crucial for further management and prognosis ( palliative approach vs. curative intent ) [ 1 , 2 ] . on ct scan , a solitary metastasis to the kidney is more likely to be found in patients with higher tumor stage of the nonrenal malignancy or when other viscera are also affected . usually , the metastasis is an asymptomatic , small , endophytic , and solid mass . the finding of a corresponding hotspot on fdg - pet scan is suggestive of a metastasis , even if it appears to be benign on ct . however , if the primary tumor is not fgd - avid , this might not be the case . the possibility of a primary renal neoplasm should also be considered , but with caution , since the low sensitivity of detection of fdg - pet scans . histology obtained by percutaneous biopsy confirms or strengthens the diagnosis in case of small masses and doubts about performing a nephrectomy . ttf-1 is a typical marker for adenocarcinoma in the lung , while negative in primary renal neoplasms , as illustrated in fig . patients with localized lung cancers may obtain long - term survival with surgery . in case of a primary renal neoplasm ,

backgroundthe finding of a renal mass on imaging is suggestive of metastatic non - small cell lung cancer in the presence of a lung tumor but can also have another origin.case reportwe describe the case of a patient diagnosed with stage iv lung cancer based on a renal metastasis . a second opinion including review of histopathological data and additional imaging followed by lung surgery and cryoablation of the kidney lesion revealed two tumors of different origins , non - small cell lung cancer and a renal cell carcinoma.discussionthe presence of a renal mass diagnosed on a ct scan in a patient with lung cancer is not always synonymous with metastatic disease . confirmation of diagnosis by tissue sampling is mandatory , especially if a synchronous primary tumor is possible .

gangliocytic paragangliomas ( gps ) are rare and peculiar benign tumors , encountered mostly in the periampullary area of the duodenum and much less frequently in the jejunum or third part of the duodenum . some studies have reported that approximately 90% of gps are found in the second part of the duodenum , from where the tumor can invade the ampulla of vater ( aov ) . gps of the duodenum may present as incidental endoscopic and radiologic findings or as gastrointestinal bleeding due to ulceration of the overlying mucosa . gastrointestinal bleeding is the most common clinical presentation , followed by abdominal pain and anemia . we present the case of a 41-year - old female with gp of the duodenum , along with the clinical data , histology , and immunohistochemical staining results that correlated well with previously reported characteristics of duodenal gps . a 41-year - old female was admitted due to a history of abdominal pain . on admission , contrast - enhanced computed tomography ( ct ) revealed a well - defined , enhancing , 2-cm , oval - shaped mass in the second portion of the duodenum , adjacent to the aov . magnetic resonance cholangiopancreatography showed a well - defined , 2-cm , oval - shaped subtle t2 hyperintense lesion in the second portion of the duodenum , adjacent to the aov , as well as a normal common bile duct . upper gastrointestinal endoscopy revealed a 2-cm subepithelial tumor in the ampullary portion of the duodenum ( fig . histopathology revealed spindle cells , ganglion - like cells , and epithelioid cells in the submucosal layer of the duodenum ( fig . this case showed characteristic histologic features of a tumor composed of three cell types ( epithelioid , spindle , and ganglion ) , which classified the tumor as a gp . 4 ) . histology showed a well - demarcated lesion in the submucosal layer of the duodenum ( fig . a follow - up upper gastrointestinal endoscopy performed 2 months later revealed scar formation in the resection site with convergence of the surrounding folds . various theories of the pathogenesis of duodenal gps have been proposed , but the histogenesis of these tumors is uncertain . a gp is known as a " 10% tumor , " based on the frequency of the inherited forms of the disease . approximately 30% of gps show 10 types of susceptibility gene ( " 10-gene tumor " ) . advances in the genetic studies of paragangliomas will have important consequences for the monitoring of patients , from genetic counseling to personalized clinical management . typical histologic patterns of gp include an admixture of ganglion - like cells , carcinoid tumor - like areas , and spindle cell proliferation . immunohistochemical staining of this tumor showed a strong positive reaction for the s-100 protein in the spindle cells , while the epithelioid and ganglion - like cells expressed synaptophysin ( fig . several authors have reported that the epithelioid and ganglion cells are positive for neuroendocrine peptides , such as somatostatin , pancreatic peptide , and serotonin . the incidence of gps is slightly higher in males than in females ( 1.8:1 ) , and the mean age of appearance is 54 years ( range , 17 to 83 ) . gps are considered benign even though they occasionally involve the regional lymph nodes and display distant metastasis or tumor recurrence , features suggestive of malignancy . the characteristic ulceration and bleeding of the overlying mucosa lead to the usual clinical manifestations of melena and sometimes massive hematemesis and unexplained anemia . approximately 50% of patients seek medical attention for gastrointestinal bleeding , but this case did not have a history of gastrointestinal bleeding episodes . duodenal gps are larger than 1.5 cm in at least one dimension and tend to be ulcerated and to bleed . obstructive jaundice is less common in ampullary gp , but obstructive jaundice due to paragangliomas has been reported . the majority of reported duodenal gp cases have been benign in nature , and simple excision of the tumor is deemed sufficient . the emr procedure is safe and easy to perform , because the tumor protrudes into the duodenum . when endoscopic resection is not possible , surgical resection is indicated , and when regional lymph nodes are positive for metastasis , pancreaticoduodenectomy followed by local radiotheraphy is recommended . because the possibilities of recurrence and metastasis can not be excluded completely , decisions on the treatment method to use must be made after careful preoperative staging of the disease prior to local treatment . furthermore , continuous follow up at the outpatient department for early detection of recurrence is necessary .

gangliocytic paragangliomas ( gps ) are rare tumors of the duodenum , presenting as single sessile or pedunculated polypoid masses . clinical manifestations of duodenal gps can vary from an incidental finding at endoscopy to frequent upper gastrointestinal bleeding caused by mucosal ulceration and abdominal pain . gps are considered benign , but the disease can recur and spread to regional lymph nodes . a 41-year - old female presented with abdominal pain . upper gastrointestinal endoscopy revealed a subepithelial tumor of the ampulla of vater in the second portion of the duodenum . the tumor was resected using the endoscopic mucosal resection technique . the tumor was diagnosed as benign gp of the duodenum using histological and immunohistochemical staining procedures .

langerhans cell histiocytosis ( lch ) is a rare , clinically polymorphous group of disorders , presenting with heterogeneous clinical manifestations and an unpredictable outcome . lch is characterized by proliferation of abnormal and clonal langerhans cells , in one or more organs like skin , bone , lymph nodes , lungs , liver , spleen , and bone marrow . occurrence of lch in adults is rare and is commonly seen in infants and early childhood . the disorder is difficult to diagnose in adults and once diagnosed , the multisystem lch has a poor prognosis . a 26-year - old man , presented with a one - week history of polymorphous eruptions over face , trunk , and extremities , associated with painful sores in the mouth as well as fever . the lesions started around the mouth with greasy scaling , which gradually progressed to involve scalp , neck , trunk , and extremities , including genitals . on general physical examination , jaundice , and inguinal lymphadenopathy were present . on cutaneous examination , multiple skin colored to yellowish papules and pustules were present over the scalp , retro - auricular area , face , neck , trunk , extremities , and genitalia , which were associated with facial edema [ figures 1 and 2 ] . oral mucosa showed multiple vesicles , pustules , and hemorrhagic crusting of lips [ figure 3 ] . scaling with crusting present over face , mimicking seborrheic dermatitis yellow - brown papules with pustules present over chest ulcers present over lips laboratory data showed : hb-16.1 gm / dl ; total leukocyte count ( tlc)-33,600/cu.mm ; neutrophil 54% , lymphocyte 25% , eosinophil 21% ; total bilirubin-5.9 mg / dl ; direct bilirubin-3.5 mg / dl ; serum glutamic oxaloacetic transaminase ( sgot)-179 u / l ; serum glutamic pyruvic transaminase ( sgpt)-269 u / l ; alkaline phosphatase ( alp)-167 u / l ; renal function test- within normal limits . biopsy from the skin , liver , and bone marrow showed dense infiltrate of histiocytes with longitudinal nuclear groove and numerous eosinophils and lymphocytes [ figures 4 and 5 ] . diffuse histiocytic infiltrate , h and e staining , 10 histiocytic infiltrate , h and e staining , 100 with the history , clinical findings , and investigation , the diagnosis of multisystem lch was made . he was given vinblastine and etoposide weekly for 6 weeks with daily prednisolone , followed by maintenance therapy of 12 cycles with same drugs at intervals of 3 weeks and daily 6-mercaptopurine . lichtenstein , in 1953 , coined the term histiocytosis - x to describe a group of disorders ( hand - schuller - christian disease , letterer - siwe disease , and eosinophilic granuloma ) characterized by infiltration of involved tissue with large number of abnormal histiocytes . subsequently , these histiocytes were found to be similar to langerhans cell normally present in the skin , and therefore termed as lch . lch is a clonal neoplastic disorder,[13 ] and its pathogenesis is unknown . whether the infiltrating cells are truly neoplastic or reactive in nature is still a matter of debate . the disease affects young children aged 1 - 4 years , but can occur at any age . the incidence is approximately 2 - 5 per million per year in infants and children and is even rarer in adults . the writing group of histiocytic society ( 1987 ) has recently defined the criteria for diagnosis of langerhans cell histiocytosis . the group proposed three levels of certainty in the diagnosis of lch based on clinical features , histopathology , and immunohistochemistry . the scalp is erythematous with greasy scales , appearing much like seborrheic dermatitis . on the trunk , the lesions are discrete , yellow - brown scaly papules , often showing areas of purpura . ulceration in the flexures , groins , and the perianal area is the common presentation in adults . diabetes insipidus is the most common endocrinal abnormality associated with lch caused by the infiltration of pituitary gland by langerhans cells . histologically , there is a dense dermal infiltrate of langerhans cell , recognized by abundant , amphophilic cytoplasm and round or kidney bean - shaped nucleus . by contrast , 20% of the patients with multisystem involvement have a progressive disease course despite treatment . the prognosis is directly related to the age of onset , numbers of organ involved , and the extent of organ dysfunction . the prognosis of the disease depends on systemic rather than cutaneous involvement . etoposide as a single drug is better than other drugs tested , eg , vinka alkaloid , methotrexate , 6-mp . our patient responded well to the combination therapy of vinblastine , etoposide , and oral corticosteroids .

langerhans cell histiocytosis ( lch ) , is a rare disorder , clinically presents with heterogeneous manifestations , and has an unpredictable outcome . commonly seen in infancy or early childhood , the disorder is characterized by proliferation of abnormal and clonal langerhans cell in skin , bone , lymph nodes , lungs , liver , spleen , and bone marrow . occurrence of lch in adults is rare . here , we report the case of an adult with acute onset of polymorphic eruptions all over the body , which on biopsy showed features of multisystem lch , and was confirmed by immunohistochemistry . although multisystem lch has a poor prognosis , our patient responded well to chemotherapy .

a , 46-year - old indian male presented to our hospital with complaints of inward deviation of his left eye for the last 9 months , which he developed after sustaining a head injury . the deviation was associated with horizontal diplopia , which was more in the left lateral gaze . the patient was a known hypertensive and was on medication for the past 7 years . examination showed best - corrected visual acuity ( bcva ) of 20/20 in both eyes . the alternate cover test showed left esotropia of 25 pd in primary gaze [ fig . 1 ] . preoperative photograph shows left esotropia patient underwent left medial rectus recession of 5 mm from the insertion and a split - tendon transposition of the left superior and inferior rectus muscles to the lateral rectus insertion ( hummelsheim procedure ) through limbal conjunctival peritomy . on the first postoperative day , there was moderate corneal edema with anterior chamber reaction of flare 2 + and cells 2 + on slit lamp biomicroscopy . the pupil was still mid dilated and was nonreacting to light [ fig . 2 ] . one week postoperative photograph shows mild conjunctival congestion , no corneal edema and a mid - dilated pupil patient was followed up regularly . on anterior segment examination , the cornea was clear , the anterior chamber was quiet , the pupil was mid - dilated and nonreacting to light [ fig . 3a ] . visual axis was parallel and abduction of the left eye was in near normal [ fig . ( a ) one year postoperative photograph shows quite eye with mid dilated pupil , ( b ) 1-year postoperative photograph shows normal abduction range our patient developed asi following one muscle recession , and two muscle split muscle transposition , which is equivalent to two muscle surgery as the second halves of these vertical recti muscles still continue to contribute one ciliary vessel each . however , our patient was a known hypertensive , which could have been a risk factor for the development of asi . al enezi and al wayel reported asi in a 35 years old myopic patient following a similar procedure . they proposed that high myopia could also be a risk factor for asi with vertical muscle surgery . a two - staged procedure with an interval of 46 months could have prevented asi in our patient with hypertension as a risk factor as this would have allowed time for remodeling of the collateral circulation . however , limbal incisions are said to predispose to more severe ischemia compared to fornix incisions as these compromise the anterior episcleral arterial circle . microscopic surgery on recti muscle for carefully dissecting anterior ciliary vessels before disinsersion can also be considered for high - risk patients as this helps to keep the anterior ciliary vessels intact and prevent asi . anterior segment ischemia should be kept in mind during vertical muscle transposition in high risk patients during strabismus surgery .

a , 46-year - old indian male , known hypertensive presented with left esotropia of 25 prism diopters ( pd ) after head injury in a roadside accident 9 months back . the deviation was constant in nature and was associated with complaints of diplopia in left lateral gaze . traumatic sixth nerve palsy was diagnosed . the patient underwent left medial rectus recession of 5 mm and a split - tendon transposition of the left superior and inferior recti to the lateral rectus insertion ( hummelsheim procedure ) . on the first postoperative day , the patient developed corneal edema and anterior chamber reaction of flare 2 + and cells 2 + . the pupil was semi - dilated and was sluggishly reacting to light . anterior segment ischemia was diagnosed , which was managed with topical and systemic steroids .

mucoepidermoid carcinomas of the thymus are extremely rare malignant mediastinal neoplasms and account for 2% of thymic carcinomas ( 1 , 2 ) . until now , radiologic reports of mucoepidermoid carcinoma of the thymus have been rare , but the described gross findings are multilocular cystic structures with focal areas of induration within the walls of the cyst or well - circumscribed homogeneous tumor masses ( 3 ) . we report a case of mucoepidermoid carcinoma of the thymus with radiologic and histologic findings . a 53-yr - old male was admitted to our hospital complaining of right chest pain . erect posteroanterior and lateral radiographs of the chest showed a well marginated anterior mediastinal mass in the entire right lung zone , compressing the lower trachea , right bronchus , and heart toward the left side ( fig . ct scan of the chest demonstrated a 201610 cm - sized , cystic mass with focal heterogeneously enhanced solid portion anteromedially in the anterior mediastinum . direct invasion of the anterior chest wall and pericardium by the mass was suggested , because pericardial fat plane was obliterated and the margin between the mass and the adjacent right anterior chest wall and pericardium was indistinct ( fig . minimal amount of right pleural effusion and pericardial effusion were associated . at surgery , after aspiration of fluid within the cystic mass , pericardial invasion was noted . histologically , squamoid tumor cells formed cords or solid sheets within the fibrous stroma admixed with mucin - secreting epithelium lining gland - like spaces ( fig . the thymic carcinomas are a heterogeneous group of aggressive epithelial malignancies that have a strong propensity for early local invasion and wide spread metastases . squamous cell carcinoma and lymphoepithelioma - like carcinoma are the most common cell types and usually occur in middle - aged men with a mean age of 46 yr ( 4 - 6 ) . radiologically , thymic carcinomas commonly manifest as large , poorly defined , infiltrative anterior mediastinal masses and associated with areas of necrosis , hemorrhage , calcification , or cyst formation ( 2 , 6 , 7 ) . mucoepidermoid carcinoma was first recognized as a distinct pathologic entity in salivary glands by stewart et al . in 1945 . since then , this tumor has been identified in several other organs , including lung , esophagus , anus , cervix , and skin . although extremely rare , mucoepidermoid carcinomas of the thymus have also been described ( 3 ) . so far , only thirteen cases have been reported in the english literature ( 3 , 8 , 9 ) . the patients ranged in age from 17 to 66 yr , with a mean age of 35 yr on reported cases ( 3 ) . clinically , most patients were asymptomatic or had symptoms of chest discomfort , retrosternal pain and dyspnea . but two distinct gross findings , as described by moran et al . , are multilocular cystic structures varying in size with focal areas of induration within the walls of the cyst and well - circumscribed , homogeneous tumor masses ( 3 ) . our case presented as a 20 cm - sized , cystic mass with focal heterogeneously enhanced solid portion anteromedially in the anterior mediastinum . the invasion of anterior chest wall and pericardium was suspected due to indistinct margin between the mass and adjacent right anterior chest wall and pericardium , and surgically proved . histologically , the lesions showed a spectrum of features that ranged from those of well - differentiated , to moderately well - differentiated , to poorly differentiated mucoepidermoid carcinoma , with sheets and solid islands of squamoid cells admixed with mucin - secreting epithelium lining gland - like spaces ( 3 ) . the histogenesis of these tumors is still unclear ; however , the demonstration of transitions between the tumor cells and the epithelium lining the cysts as well as residual non - neoplastic thymic remnants within the walls of the cysts in four of six cases supports the theory that these tumors arise from thymic epithelium ( 3 ) . differential diagnoses of masses of the anterior mediastinum associated with extensive cystic changes include thymic cysts , thymomas , teratomas , seminomas , hodgkin 's disease , and metastasis ( 10 - 14 ) . and also mucoepidermoid carcinoma of the thymus should be included in the differential diagnosis , although the carcinoma is an exceedingly rare anterior mediastinal malignant tumor ( 3 ) . it is very difficult to differentiate from each other by only radiologic findings ( 10 - 14 ) . however , mucoepidermoid carcinoma of the thymus should be considered when a large cystic mass with focal induration within the anterior mediastinum on ct scan is noted .

mucoepidermoid carcinoma of the thymus is an extremely rare malignant mediastinal neoplasm , and to our knowledge , only 13 cases have been reported . we report a case of mucoepidermoid carcinoma of the thymus that was seen in a 53-yr - old man with right chest pain . chest ct scan showed a huge , cystic mass having a focal solid portion with direct invasion of the adjacent anterior chest wall and pericardium in the anterior mediastinum . mucoepidermoid carcinoma of the thymus should be included in the differential diagnosis for masses of the anterior mediastinum associated with extensive cystic changes , although the carcinoma is exceedingly rare .

the incidence of acute appendicitis within an external hernia accounts for 0.13 - 1% of all acute appendicitis . amyand hernia is well known to surgeons ; it was named after claudius amyand who performed appendectomy for perforated appendicitis in the inguinal hernia sac in 1735 . in the case of femoral hernia , it is called de garengeot hernia , after a french surgeon who first described it in the literature in 1731 . de garengeot hernia is reported to account for 0.5 - 3.3% of all femoral hernias . because of the rarity and the lack of typical symptoms associating with acute appendicitis , achieving preoperative diagnosis is very difficult . a 90-year - old female was referred to our institution with a 3-day history of right inguinal swelling and inguinal pain which the patient recognized few hours prior to admission . the egg - sized mass , located slightly lower than the inguinal ligament , was red from inflammation and severe pain was induced by direct compression . physical findings revealed inguinal tenderness , but there were no complaints of abdominal pain in the right lower quadrant , nausea , or vomiting . laboratory findings showed a slight elevation of crp ( 0.49 mg / dl ) , the rest of the data was in the normal range . abdominal x - ray showed no gas - fluid levels and no signs of small intestinal dilatation . pelvic ct revealed a small round mass right beside the femoral artery and vein with the density of air and fluid ( fig . a small amount of ascites was present in the pelvic space . under the diagnosis of incarceration of the right femoral hernia involving the small intestine , the inguinal duct was opened by the frontal approach and the inguinal ligament was amputated , loosening the femoral ring . the hernia sac was revealed and the content of the sac was a congested and inflamed appendix ( fig . there was no evidence of perforation and abscess , so the hernioplasty was completed with synthetic mesh . most of the patients are rushed to the surgical room with the inconclusive diagnosis of an incarcerated hernia . laboratory and radiological findings are usually nonspecific . retrospectively , the intestine in our case was blind - ended and had intramural air and wall thickening , all positive findings of an appendix ( fig . ct findings of de garengeot and amyand hernia demonstrate intramural air density in an incarcerated hernia sac indicating intestinal involvement , but lack obstruction or dilatation of the small bowel . although few cases have reached the right diagnosis before surgery , ct scan is the best modality to distinguish de garengeot and amyand hernia from other incarcerated hernias as ct scan can easily reconstruct air - weighted conditions from raw data . either the appendicitis started first and then the inflamed appendix moved into the hernia sac , or the existence of the appendix in the hernia sac is the initial incident and strangulation of the appendix occurred . in this case , the discoloration of the serosa at the base of the appendix suggests strangulation by the femoral ring . most authors conclude that appendectomy via the hernia sac is adequate , but in some cases where the perforated appendix is involved , the transabdominal approach may be more sufficient if abdominal abscess might also be present . the laparoscopic approach for de garengeot hernia as well as other incarcerated hernias is still controversial . laparoscopy might be a good technique to determine the condition of the hernia , but due to the difficulty in preoperative diagnosis , the laparoscopic procedure is unlikely to be the first choice for surgical approach . conclude that the limitation of the laparoscopic procedure is expansion of the inflammation of the appendix . as for the repair of the hernia , some authors suggest that delayed repair or suturing repair should be recommended rather than synthetic mesh in anticipation of infection . however , in recent studies , the consensus is that if there are no signs of abscess formation or perforation , repair by prosthetic mesh is possible without infection or recurrence . nguyen and komenaka pointed out that the factors contributing to the increased incidence of infection is the delay in diagnosis . in this case , the operation was performed immediately and no abscess formation was found in the hernia sac . when intramural air is present in an incarcerated hernia sac without sings of bowel obstruction , we should consider amyand or de garengeot hernia as one of the possible diagnoses .

appendicitis and incarcerated hernia are frequently encountered reasons of emergency surgery for acute abdomen . the treatment in early stages of each condition is generally simple , but when these conditions are combined , the symptoms become slightly complicated , obscuring specific symptoms . especially the lack of symptoms for appendicitis leads to delayed diagnosis , resulting in high morbidity . amyand hernia , which contains appendix in its inguinal hernia sac , is perhaps more familiar to the general surgeons than de garengeot hernia , which is an incarcerated femoral hernia with an appendix in its sac . we report the case of a 90-year - old female with incarcerated femoral hernia who underwent emergency hernioplasty only to reveal an inflamed appendix in its sac . the patient underwent both appendectomy and hernia repair simultaneously with synthetic mesh and was discharged on postoperative day 7 without any complications . we will also discuss the physical and radiological findings of de garengeot hernia .

the incidence of synchronous lesion in patients with colorectal carcinoma is up to 5% [ 1 , 2 ] . we describe a rare case of synchronous neuroendocrine tumor ( net ) and adenocarcinoma present at two different locations but in the same segment of the colon . an 83-year - old male presented with two episodes of bleeding per rectum during hospitalization for coronary artery stenting . his colonoscopic examination revealed two ulceroproliferative tumors , one in the sigmoid colon and another in the descending colon , approximately 20 and 40 cm , respectively , from the anal verge . a contrast - enhanced ct scan of the abdomen confirmed the presence of these two tumors . a clinical diagnosis of synchronous carcinoma colon was made and the patient was subjected to left hemicolectomy . at laparotomy , both the tumors were found confined to the colonic wall without any evidence of lymph node enlargement or dissemination . the sct was larger in size involving 2/3 colonic circumference , whereas the dct was smaller and involved nearly half of the colonic circumference ( fig . 1 ) the proximal tumor in the descending colon turned out to be neuroendocrine cancer and the distal one in the sigmoid colon was adenocarcinoma . the proximal tumor in the descending colon turned out to be neuroendocrine cancer and the distal one in the sigmoid colon was adenocarcinoma . 2a d ) revealed a cellular neoplasm composed of round to polygonal tumor cells with pleomorphic nuclei , fine granular chromatin and prominent nucleoli arranged in diffuse sheets , insular pattern and variable organoid pattern . dct , the smaller of the two , was diffusely positive for synaptophysin and neuron - specific enolase ( nse ) . however , cd56 and chromogranin - a were negative in the same tumor cells . on the other hand , sct that had typical morphology of adenocarcinoma was completely negative for cd56 , synaptophysin , chromogranin a and nse . therefore , based on histomorphology and immunohistochemistry , the sct was diagnosed as well - differentiated adenocarcinoma and the dct was diagnosed as neuroendocrine carcinoma grade 3 . both the tumors had invaded the subserosa without any lymph nodal involvement . figure 2:microscopic appearance of the neuroendococrine carcinoma . ( a ) ( h&e 20 ) showing round to polygonal tumor cells with pleomorphic nuclei , fine granular chromatin and prominent nucleoli arranged in diffuse sheets , insular pattern and variable organoid pattern . immunohistochemistry showed that the tumor was ( b ) diffusely positive for synaptophysin and ( c ) nse . ( a ) ( h&e 20 ) showing round to polygonal tumor cells with pleomorphic nuclei , fine granular chromatin and prominent nucleoli arranged in diffuse sheets , insular pattern and variable organoid pattern . immunohistochemistry showed that the tumor was ( b ) diffusely positive for synaptophysin and ( c ) nse . . approximately 27% of the gastrointestinal ( gi ) tract , nets are located in the descending colon and rectum . second primary malignancy ( spm ) , synchronous or metachronous , in the gi tract , lung or prostate has been reported in 1355% of patients with an net [ 5 , 6 ] . conversely , on immunohistochemical staining , neuroendocrine cells can be detected in up to 41% of colorectal adenocarcinoma . few authors suggest common link between the pathogenesis of the colorectal net and adenocarcinoma [ 8 , 9 ] . kato et al . reported a ck20 positive ( a common marker found in colorectal adenocarcinoma ) large cell net that occurred synchronously to a colorectal adenocarcinoma , suggesting the theory that different types of gi neoplasm might originate from a common stem cell clone which might share a similar genetic mutation(s ) during early oncogenesis . if the net is completely resected , the 5-year survival rate has been reported to be 61% . however , metastatic and non - resectable disease is treated with radiation therapy in combination with systematic chemotherapy . adenocarcinoma and net occurring separately in the same segment of colon , as in the present case , are distinctly rare and have not been reported earlier . reported here , the preoperative diagnosis , based on colonoscopic appearance , was also adenocarcinoma . the differentiation that came as postoperative histological surprise is important since the net has a worse prognosis in comparison with adenocarcinoma . in conclusion , we report an net of the colon that coexisted with an adenocarcinoma , suggesting a possible common link between the pathogenesis of these two distinct entities . in addition , as the incidence of synchronous net and other primary malignancy is increasing , we recommend further screening for other primary malignancy in patients diagnosed with net for the prevention of late - stage diagnosis of synchronous malignancies .

neuroendocrine tumors ( nets ) originating from the gastrointestinal tract are considered to be relatively rare tumors with a poor prognosis . we describe a case of an 83-year - old male who presented with complains of bleeding per rectum . colonoscopy revealed two ulceroproliferative tumors , one in the sigmoid colon and another in the descending colon . the patient underwent left hemicolectomy . based on the immunohistochemistry , the sigmoid colon tumor was diagnosed as well - differentiated adenocarcinoma , whereas the descending colon tumor was diagnosed as net . net coexisted with adenocarcinoma occurring separately in the same segment of colon , as in the present case , is distinctly rare and has not been reported earlier . the coexistence of the nets with other primary malignancies has been increasingly recognized . therefore , we recommend that the patients with the diagnosis of nets should undergo further screening for the associated primary malignancies to prevent late - stage diagnosis of synchronous malignancies .

methadone is the first widely used drug to overcome the opioid withdrawal effects ( 1 , 2 ) . it acts by occupying the receptor affected by exogenous opioids leading to subsequent receptor activation . this activation leads to closing of voltage - sensitive calcium channel ( vscc ) and stimulation of potassium efflux causing hyperpolarization and inhibition of adenylyl cyclase activity ( 3 , 4 ) . successful approaches to pharmacotherapy in opioid addiction continue to rely largely on substitution of short - acting agonists such as heroin and oral administration of long acting high - efficacy agonists ( methadone ) or partial agonists ( buprenorphine ) ( 5 , 6 ) . notably , all opioids that produce analgesia also can cause tolerance , addiction and withdrawal , and all of the available opioids are misused ( 7 ) . it was shown that patients on long - term methadone maintenance treatment had longer qtc interval values than expected . withdrawal symptoms among methadone maintenance therapy ( mmt ) patients had been reported to become worse and last longer than those of heroin or morphine due to extremely longer methadone half life ( 8) . low patient s retention rates in the mmt programme was also reported , making them prone to re - injecting behaviour ( 9 - 11 ) . we believe that calcium channel blocking effect may play a crucial role in opioid dependent and withdrawal syndromes as shown by l - type voltage - dependent calcium antagonist role such as verapamil and felodipine in controlling the withdrawal syndromes effectively ( 12 - 15 ) . both central and peripheral mechanisms play an important role in attenuating opioid withdrawal syndrome via calcium channel blocking agents ( 16 ) . the effects produced by calcium channel blockers are proven to be independent from opioid receptor sites as there is no agents that can replace naloxone from its binding sites ( 17 ) . one study has reported that blockade of l - type voltage - dependent calcium channels by calcium channel blockers is responsible for the attenuation of morphine withdrawal ( 18 ) . other than that , t - type voltage dependent calcium channels have also been shown to play a critical role in the development of morphine dependence and withdrawal ( 19 ) . previous study reported medicinal plants , nigella sativa , a scientific name for islamic prophetic medicine , habbatus sauda to have l - type calcium channel blocking effect ( 20 ) . moreover , further study had also introduced its seeds as a novel treatment for opioid dependence and proven effective in long term treatment of opioid dependence ( 21 ) . this plant has green to blue flowers with small black seeds and grows natively in temperate and cold climate areas . the seed of n. sativa possesses a source of the main active ingredients such as thymoquinone , monotropens - like p - cymene and -pinene , nigellidine , nigellimine , and saponin ( 22 - 26 ) . considering its low toxicity ( 27 - 29 ) , we hypothesized that the main active compound of n. sativa , thymoquinone ( tq ) , has a role in treating opioid withdrawal syndrome . tq also exhibits calcium channel blocker properties via gut spasmolytic , tracheal , and airway relaxant , vasodilator and relaxant activities on the cardiac muscles ( 30 ) . thus , further study is needed in order to explore the biochemical effects and mechanism of action of n. sativa at cellular level . as a conclusion , we would like to suggest probably with the supplementation of n. sativa to methadone , it will indirectly be a starting point to answer the question of opioid dependency and withdrawal for better retention of patients in mmt .

methadone is widely being used for opioid substitution therapy . however , the administration of methadone to opioid dependent individual is frequently accompanied by withdrawal syndrome and chemical dependency develops . other than that , it is also difficult to retain patients in the treatment programme making their retention rates are decreasing over time . this article is written to higlights the potential use of prophetic medicines , nigella sativa , as a supplement for opioid dependent receiving methadone . it focuses on the potential role of n. sativa and its major active compound , thymoquinone ( tq ) as a calcium channel blocking agent to reduce withdrawal syndrome and opioid dependency .

health - care professionals are accustomed to seeing frail older persons , but rarely do they recognize the role of sarcopenia in the pathogenesis of frailty . even more rarely do they institute an aggressive treatment regimen to improve the older person s quality of life . for this reason , six societies , including the scwd , published a consensus statement that defined frailty as a medical syndrome with multiple causes and contributors that is characterized by diminished strength , endurance and reduced physiologic function that increases an individual s vulnerability for developing increased dependency and/or death . for this reason , they agreed that all persons older than 70 years and all individuals with significant weight loss ( 5 % ) due to chronic disease , should be screened for frailty . an objective definition for a physical frailty phenotype was created and validated in 2001 by fried et al . . their definition included weight loss , exhaustion , weakness ( grip strength ) , walking speed , and low physical activity . they found that it was present in approximately 7 % of persons in the cardiovascular health study . based on this schema , a simple five - point questionnaire was developed by the international association of nutrition and aging ( table 1 ) . this consists of adding together all the deficits a person has and then mathematically designating a frailty score . while this is highly predictive of poor outcomes , it is more of a comorbid score than a physical frailty index . it has also been recognized that persons with psychosocial frailty as well as physical frailty tend to have even worse outcomes [ 510].table 1the simple frail scale fatigue resistance ( can you climb a flight of stairs ? ) aerobic ( can you walk a block ? ) illness ( > 5 ) loss of weight ( 5 % in 6 months)three or more positive answers , frail ; one or two positive answers , prefrail the simple frail scale three or more positive answers , frail ; one or two positive answers , prefrail the frail ( fatigue , resistance , aerobic , illness , and loss of weight ) scale has been validated by six separate studies and appears to perform as well as the other more complex scales [ 1116 ] . of the five components of the frail scale , both resistance ( climb a flight of stairs ) and aerobic ( walk one block ) are clearly components of sarcopenia as now defined by multiple groups [ 1721 ] . in addition , while there are many causes of fatigue ( e.g. , anemia , endocrine disorders , sleep apnea , polypharmacy , depression , and vitamin b12 deficiency ) , it is now well recognized that a major cause of fatigue in conditions such as heart failure is poor muscle function [ 22 , 23 ] . while weight loss is not universal in sarcopenia , loss of muscle can lead to weight loss in persons who do not develop obese sarcopenia , and it is a hallmark of cachexia [ 25 , 26 ] . the frailty consensus statement recommended that the treatments for frailty should be exercise ( resistance and aerobic ) , protein - calorie supplementation , vitamin d , and reduction of polypharmacy . the evidence that exercise ( particularly resistance exercise ) when maintained can have marked effects on frailty and sarcopenia is now very strong [ 2833 ] . the major problem is that this form of exercise therapy needs to be provided in a long term , i.e. , for at least a year , where it performs better than conventional physical therapy . it is the time that health - care agencies fund coaches to do twice weekly home visits to do resistance exercise for a year or longer . there is increasing evidence for exercise to be coupled with high quality protein to provide optimal muscle performance [ 3539 ] . persons with low vitamin d have been demonstrated to have decreased strength and increased falls [ 40 , 41 ] . replacement of vitamin d in these persons appears to improve strength and decrease hip fractures . calorie replacement decreases mortality and possibly improves function in persons with malnutrition . for an optimal effect in addition to these basic treatments , there is an increasing interest in developing drugs to treat sarcopenia . testosterone has been demonstrated to increase muscle mass and strength in older persons with and without frailty [ 4651 ] . its possible side effects have led to enthusiasm to produce selective androgen receptor molecules , and one of these , enobosarm , has shown some promise . a variety of other drugs are in earlier stages of development for treating sarcopenia and cachexia . frailty can be screened for by general practitioners as demonstrated by the gerontopole frailty screening tool [ 54 , 55 ] . a simple screening tool , the frail , takes less than 15 s to do and does not require a physician to administer it . treatments for frailty clearly exist . for these reasons we suggest that it is time to couple sarcopenia and frailty and increase its community awareness . if physicians begin to recognize sarcopenia and physical frailty and utilize the simple management strategies available , they will begin to have revealed to them the wonders of watching frail , and sarcopenic persons become more functional and happier in a way similar to how each few steps in a hidden garden reveals yet another wonder .

the physical frailty phenotype consists of fatigue , weight loss , and loss of muscle power . sarcopenia has been shown to be a major cause of frailty . six societies including scwd published a consensus suggesting that all persons older than 70 years of age should be screened for frailty when seeing health professionals . simple screening tests such as the frail ( fatigue , resistance , aerobic , illness , and loss of weight ) scale can be used . it is felt that frailty can be treated by exercise ( resistance and aerobic ) , high quality protein , vitamin d , and treatment of the common causes of fatigue . it is expected that this approach will decrease disability in older persons .

a 50-year - old lady was referred for retinal evaluation to rule out aids - related retinal or ocular disorders . optic nerves appeared normal . a visual field examination using 30 - 2 program on oculus center field perimeter was performed to rule out lesions along the visual pathway , as clinical examination could not explain the visual loss or the symptoms . it showed good reliability in both eyes and a left homonymous hemianopia [ figs . 1 and 2 ] . magnetic resonance imaging ( mri ) of brain was done to determine the cause of homonymous hemianopia , such as infarct / bleed or space - occupying lesion . mri scan showed irregular white matter hyperintensity in the right occipital lobe and a hyperintense lesion in the left frontoparietal region in the subcortical and periventricular white matter [ fig . 3 ] . it also showed irregular white matter hyperintensity and a large area of increased t2-weighted and decreased t1-weighted signal in the left frontal lobe posteriorly involving the subcortical white matter and extending into the centrum semiovale and corona radiata , without enhancement or mass effect . mri showing lesions in right parieto - occipital lobe and elsewhere she was referred to a neurologist for evaluation . a cerebrospinal fluid ( csf ) tap was advised for polymerase chain reaction ( pcr ) evaluation for jc virus . pml is a progressive fatal demyelinating disorder associated with oligodendroglial infection by the human papovavirus jc . occasional cases are described in pregnancy , and some cases may have no identifiable evidence of immunosuppression . the causative agent , the jc virus , invades oligodendroglial cells , causing multiple foci of demyelination . after the primary infection , jc virus remains latent in kidneys and lymphoid organs . up to 64% of healthy adults have shedding of jc virus in urine in the absence of any clinical symptoms , suggesting that asymptomatic active jc virus infection is common in immunocompetent persons . the presenting symptoms in a case of pml are focal deficits like mental deterioration , speech disturbance , ataxia , paralysis , hemiparesis , facial weakness , memory failure , and also ophthalmic symptoms like nystagmus , homonymous hemianopia and diplopia with cranial nerve palsy in one eye and cortical blindness in the other eye . previously reported cases are different from the one we are presenting here , as our patient had come with nonspecific visual complaints and no other neurological symptoms . however , pml should also be suspected in the differential diagnosis of apparently healthy patients with focal deficits , like our patient who had no other symptoms except some visual disturbances in both eyes which she could not categorize . the purpose of presenting this case was to highlight the fact that we , as ophthalmologists , may be the first to see patients with pml and we should have a high degree of suspicion in an appropriate clinical setting . this would help us to carry out necessary tests such as visual field examination and , if necessary , an mri scan to arrive at a diagnosis of pml which is a potentially life - threatening disease but may be helped by highly active anti - retroviral therapy ( haart ) . pml should be kept in mind along with other ocular manifestations , such as cmv retinitis , which are commoner . diagnosis of pml may be difficult . because a large percentage of the population is seropositive for jc virus , csf identification of jc virus by pcr is useful and studies suggest a sensitivity of 95% and specificity of 9099% . the mri findings are characteristic in pml , with a high t2 signal and a low t1 signal which does not enhance with gadolinium and has no mass effect . pml is uniformly fatal , and the survival rate is only a few months following the diagnosis . there are recent reports of improved survival following aggressive haart in hiv , and specific jc antiviral treatment with interferon or cidofovir favor early diagnosis . hence , we should consider pml in all patients who present with progressive neurological deficits ( such as visual field defects ) which are usually , but not always multifocal . if jc virus is absent in the csf , brain biopsy should be considered .

we present a case of a human immunodeficiency virus ( hiv ) positive patient who was referred for retinal evaluation to rule out ophthalmic manifestations of acquired immunodeficiency syndrome ( aids ) . she complained of some disturbance in vision in both eyes . fundus examination showed no abnormality . perimetry , done to rule out optic nerve pathology , showed a left homonymous hemianopia . magnetic resonance imaging ( mri ) scan showed features of progressive multifocal leukoencephalopathy ( pml ) . she had no other neurological symptoms or signs .

skin and soft tissue infections caused by non - tuberculous mycobacteria ( ntm ) , which used to be considered unusual , have become more frequent in recent times . atypical mycobacteria are environmental saprophytes , which may occasionally enter human skin through injuries and cause localized infection . papules , nodules , plaques , ulcers and panniculitis - like lesions are common manifestations . disseminated infection occurs in immunocompromised patients . this kind of cutaneous infection is not frequently seen in humans and its diagnosis can be missed unless there is a strong clinical suspicion coupled with microbiological confirmation . a 52-year old healthy upper middle class , italian male and his 21-year old daughter presented in may 2008 with a history of swelling on of the father 's face and neck , and on the daughter 's buttocks and legs . the swellings had started approximately three months previously , had gradually increased in size , associated with moderate pain . both subjects reported that they were swimmers and that they used to travel to egypt in the summer . on physical examination , the daughter had purple indurated subcutaneous nodules and plaques were observed on her right buttock . the father had subcutaneous granulomas on the lateral left side of his neck that had also ulcerated ( figure 1 ) . both patients reported intermittent discharge from the lesions and associated local non - tender lymphadenitis . diagnostic aspiration from the swelling had been performed approximately 20 days previously after which the swelling had subsided . the cytological findings of the aspirate were inconclusive and the swelling recurred within the following few days which led to the patients returning for a repeat evaluation . laboratory evaluation , including wbc count , chain protein reaction ( cpr ) and antistrept olysin o titre ( as(l)o titre ( asot ) , showed no increase in values . liver , renal function tests and a chest x - ray were within normal limits . needle aspiration from the swelling was repeated and subjected to cytological and microbiological evaluations which showed cream colonies that turned yellow when exposed to light . a repeated skin biopsy specimen of the abscess wall showed an acute - on - chronic infection with edematous granulation tissue and some foreign - body giant cells . molecular diagnosis can identify species of mycobacteria polymerase chain reaction - restriction fragment of the hsp65 gene . after two months of treatment , the lesions healed completely . at 1-year follow up , there was no recurrence of the disease . ( b ) a painful abscess with associated erythema and edema of the right buttock . ( a ) ( b ) a painful abscess with associated erythema and edema of the right buttock . two well - known species , m. tuberculosis and m. leprae , have been known for centuries to cause immense human suffering . the pathogenic potential of most other mycobacteria , present in the environment as saprophytes , has been recognized since the beginning of the 20 century . it is a waterborne mycobacterium that commonly infects fish and amphibians all over the world . categories at risk are home - aquarium enthusiasts , swimmers , aquarium staff , marine - life handlers , anglers , and oyster workers . in most cases , they present as a granulomatous infection localized in the skin , typically following minor trauma and other surgical procedures . the usual presentation is trauma to the skin in non - chlorinated water or salt water , and after about two weeks of inoculation it will develop into a localized papulonodular lesion which eventually ulcerates . the clinical syndrome is variable , the pathology is non - specific and culture is needed for definite diagnosis . infections sometimes heal spontaneously , but drug treatment is usually necessary for several months in order to cure the infection . knowledge of the relative frequency of post - travel related skin disorders , including their geographical and demographic risk factors , will allow for effective pre - travel counseling , as well as improve post - travel diagnosis and therapeutic intervention . in our patients , suspicion was aroused because they were swimmers who used to travel to egypt during the summer and had reported contact with aquatic animals , although they could not recall how many months after the trip the lesions appeared . clinicians seeing patients post - travel should be alert to travel - related skin diseases . to prevent and manage skin - related morbidity during travel , international travelers should avoid direct contact with sand , soil , and aquatic animals . sometimes lesions are aspecific and appear many months later so it is important to keep record of any traveling and seek immediate medical care . with the increased numbers of immunocompromised patients , it is likely that we will see a rising trend in these infections . a high index of suspicion is the key to diagnosis and appropriate samples should be sent for mycobacterial culture before the use of antibiotics .

environmental mycobacteria are the causative factors of an increasing number of infections worldwide . cutaneous infections as a result of such mycobacteria are often misdiagnosed , and their treatment is difficult since they can show in vivo and in vitro multidrug resistance . absence of pathognomonic clinical signs and variable histological findings often delay diagnosis . we report a case of localized recurrent soft tissue swelling by mycobacterium marinum in 2 members of the same family . the cases are being reported for their uncommon clinical presentation and the associated etiological agent . patients recovered completely following therapy with rifampicin 600 mg plus isoniazide 300 mg daily for 45 days .

a 34-year - old female with end - stage renal disease treated by peritoneal dialysis ( pd ) complained of dry cough that had started 1 month previously . the patient 's medications consisted of a calcium channel blocker , angiotensin receptor blocker , erythropoietin , ferrous sulfate , and sevelamer . a chest x - ray showed a pleural effusion on the right side ( fig . a thoracic drainage was placed into the pleural effusion and 1 l of clear liquid was emptied . samples were sent to the chemistry laboratory , to microbiology , and to pathology for further studies . the following results were obtained : glucose , 278 mg / dl ( plasma glucose , 115 mg / dl ) ; total protein < 1.0 g / dl ( total protein in plasma , 7.9 g / dl ) ; lactate dehydrogenase , 49 u / l ( ldh in plasma , 459 u / l ) ; ada , 2.7 iu / l ( 4.3 - 20.3 ) . the effusion contained no malignant cells and the culture grew out no microorganisms . we performed chest computed tomography 1 hour after injecting radiocontrast medium intraperitoneally mixed with 4.25% pd solution . the scan showed focal penetration of intra - abdominal contrast medium via the right hemidiaphragm in the right posterior and lower hemithorax , suggesting a small peritoneopleural fistula ( fig . 2 ) . pleural effusions and hydrothorax are rare complications in pd patients and result from the migration of dialysis fluid under pressure from the peritoneal cavity into the pleural space.1,2 increased intra - abdominal pressure arises either transiently with coughing or straining or permanently from a large volume of pd solution . the mechanism by which peritoneal dialysate transverses the diaphragm is thought to be due to a pleuroperitoneal communication . a sudden increase in intra - abdominal pressure opens a communication between the abdomen and the thorax , allowing pd fluid to leak into the thorax.3 hydrothorax frequently presents as respiratory distress , particularly dyspnea or shortness of breath . a high glucose level in the pleural effusion is an important clue because no other form of hydrothorax has elevated glucose levels.4 pd solution in the thoracic cavity presents a unique situation that occurs only in patients receiving pd . as described in the literature , in most cases , the peritoneopleural fistula is diagnosed by use of scintigraphy . however , scintigraphy is not able to localize a defect in the diaphragm . in the present case , mri has also been attempted to show transdiaphragmatic leakage in a peritoneoflural fistula.5 different therapeutic approaches have been reported . temporary discontinuation of pd , tetracycline instillation into the pleural space , and surgical patch grafting of the diaphragmatic leak have all been described . a novel method may be video - assisted talc pleurodesis.6 this patient received hemodialysis via a permanent catheter after quitting pd .

a 34-year - old female presented with end - stage renal disease ( esrd ) treated by peritoneal dialysis ( capd ) complained of a dry cough . chest x - ray and chest computed tomography ( ct ) scan revealed massive right hydrothorax . because the glucose concentration of pleural fluid was markedly high compared with that of serum , we performed isotope and contrast peritoneography . we used ct for localizing it . mri was also trying to show transdiaphragmatic leakage in peritoneoflural fistula . temporary discontinuation of capd , tetracycline instillation into the pleural space and surgical patch grafting of the diaphragmatic leak have all been described . a novel method may be video - assisted talc pleurodesis .

extranodal involvement is seen in approximately 25% cases of nonhodgkin 's lymphoma ( nhl ) . primary adrenal lymphoma ( pal ) is rare with fewer than 200 cases reported in english literature . the majority of the patients with pal present with bilateral adrenal masses and diffuse large b - cell ( dlbcl ) type is the most common type on histology . unilateral presentation and t - cell / natural killer ( t / nk ) cell histological type is rarer . due to the rarity of the disease , there is a paucity of literature on the role of fluorine-18 fluorodeoxyglucose positron emission tomography / computed tomography ( f-18 fdg pet / ct ) scan in pal . we report f-18 fdg pet / ct scan findings in a case of unilateral t / nk cell pal performed for staging and interim treatment response assessment . a 41-year - old gentleman with no co - morbidities presented with the progressive left hypochondriac pain of 1-month duration . ct guided biopsy with immunohistochemistry revealed tumor cells positive for leukocyte common antigen , cd3 , and weakly positive for cd56 ; while negative for cd20 , cd4 , and cd8 suggestive of high - grade nhl of t / nk cell immunophenotype [ figure 1 ] . staging f-18 fdg pet - ct scan revealed increased metabolic activity in the left adrenal mass . no focus of hypermetabolism was noted elsewhere in the body suggestive of stage i aex ( left adrenal ) [ figure 2 ] . ( methotrexate , dexamethasone , leucovorin , ifosfamide , etoposide , and l - asparaginase ) chemotherapy regimen . interim fdg pet - ct for response assessment post four cycles of chemotherapy revealed complete metabolic and morphological regression of the primary left adrenal mass . biopsy of the left adrenal mass : ( a and b ) photomicrographs showing features of nonhodgkin 's lymphoma with diffuse architecture composed of intermediate to large atypical lymphoid cells ( h and e , 4 and 40 respectively ) . ( h ) cd-8 ( 40 ) increased fluorodeoxyglucose uptake was noted in the left suprarenal gland on maximum intensity projected : ( a ) . ( c ) images of the staging positron emission tomography / computed tomography scan in case of biopsy proven adrenal lymphoma . positron emission tomography / computed tomography scan done post four cycles of smile chemotherapy regimen revealed complete metabolic and morphological response ( d - f ) pal is defined as the presence of adrenal lymphoma without any evidence of nodal involvement or leukemia . although secondary adrenal involvement in nhl is seen in approximately 25% of cases , pal is rare comprising < 1% of nhl and 3% of extranodal nhl with < 200 cases reported in english literature . most of the patients present with nonspecific symptoms such as abdominal pain , fever , and weight loss . in 60% cases , advanced age at diagnosis , large tumor size , increased ldh level , bilateral adrenal involvement ( regarded as stage iv disease ) , and adrenal insufficiency at the time of presentation are poor prognostic factors . since adrenal gland is devoid of lymphoid or hematopoietic tissue , pal is believed to originate from differentiation of primitive totipotent mesenchymal cells . , none of these theories has been conclusively proven due to the rarity of the disease . there are only 5 - 6 cases of t / nk - cell type pal reported in the literature so far , most of them with bilateral adrenal involvement . conventionally , ct scan is used as a first imaging modality for characterization of adrenal lesions . t2-weighted magnetic resonance imaging with chemical shift sequences is also often used to differentiate benign from malignant adrenal masses . f-18 fdg pet / ct scan has an established role in staging , restaging , interim response assessment , and prognostication of lymphomas . various studies have shown higher accuracy of f-18 fdg pet / ct scan in differentiating malignant and benign adrenal masses . yun et al . have shown that fdg pet has a 100% sensitivity , 94% specificity , and 96% accuracy for characterization of adrenal lesions . however due to the rarity of the disease , there is a paucity of literature on the role of fdg pet / ct scan in pal . in our case , baseline fdg pet / ct showed intense uptake in the left adrenal mass with no other nodal or extranodal disease detected elsewhere in the body . hence , in correlation with the biopsy findings , whole body fdg pet / ct played a paramount role in differentiating primary versus secondary involvement of adrenal gland . a study by khong et al . assessing the role of mid - treatment fdg pet / ct for early response assessment of smile therapy in nk / t - cell lymphoma demonstrated that deauville score on mid and end treatment fdg pet / ct is the only significant independent predictor of both overall survival and progression free survival . to the best of our knowledge , this is the first case reported in the literature where a complete metabolic and morphological response was seen on interim fdg pet / ct in a case of unilateral pal of t / nk - cell type treated with smile regimen . therefore , our case further reinforces the valuable role of fdg pet / ct for diagnosis , staging , and treatment response evaluation in pal .

primary adrenal lymphoma ( pal ) is a rare malignancy often involving bilateral adrenal glands . diffuse large b - cell is the most common histological type . unilateral presentation and t - cell / natural killer ( t / nk ) cell histological type is rarer . we report fluorine-18 fluorodeoxyglucose positron emission tomography / computed tomography scan findings in a case of unilateral t / nk cell pal performed for staging and interim treatment response assessment .

a 53-years - old iraqi immigrant with longstanding ulcer history complained of severe epigastric pain . minimal biliary dilatation was identified , with normal gallbladder , intrahepatic ductal air [ figure 1a ] , adhesion between the ventral pancreatic head and posterior proximal duodenum [ figure 1b ] , thin fluid - like track suggesting choledocho - duodenal fistula ( cdf ) [ figure 1c ] . unenhanced images detect peripheral intrahepatic pneumobilia ( arrowhead in a ) , overdistended stomach , and focal adhesion between posterior wall of the proximal duodenum and ventral aspect of the pancreatic head ( thick arrow in b ) . after intravenous contrast administration , detailed oblique - reformatted image ( c ) shows thin fluid - like communication consistent with choledocho - duodenal fistula ( arrow ) . three days later , during acute pancreatitis repeat ct ( d ) detects appearance of peripancreatic effusion , confirms fluid - containing fistulous track between the posterior duodenal bulb and the distal common bile duct ( thin arrow ) endoscopy revealed chronic peptic duodenal bulb deformation without active ulcers and fistulous orifices . after unsuccessful endoscopic retrograde cholangiopancreatography ( ercp ) , clinical conditions worsened with acute pancreatitis . repeat ct detected peripancreatic fluid , increasing pneumobilia , persistent cdf [ figure 1d ] . spontaneous pneumobilia suggests bilioenteric communication , most usually cholelithiasis - related gallbladder perforation into normal duodenum . conversely , the uncommon ( 3.5 - 10% of cases ) cdf results from bulb ulcer penetrating the choledochus.[15 ] reflecting distribution of peptic disease , cdf manifests with pain , malaise or hematemesis in middle - aged men ; jaundice or cholangitis are exceptional . historically , duodenal deformity and biliary opacification during gastrointestinal barium studies identified cdf . conversely , gallbladder mural thickening and intraluminal air shift the diagnosis toward cholecysto - duodenal fistulization . often impossible because of duodenal narrowing

spontaneous pneumobilia without previous surgery or interventional procedures indicates an abnormal biliary - enteric communication , most usually a cholelithiasis - related gallbladder perforation . conversely , choledocho - duodenal fistulisation ( cdf ) from duodenal bulb ulcer is currently exceptional , reflecting the low prevalence of peptic disease . combination of clinical data ( occurrence in middle - aged males , ulcer history , absent jaundice and cholangitis ) and ct findings including pneumobilia , normal gallbladder , adhesion with fistulous track between posterior duodenum and pancreatic head ) allow diagnosis of cdf , and differentiation from usual gallstone - related biliary fistulas requiring surgery . conversely , ulcer - related cdf are effectively treated medically , whereas surgery is reserved for poorly controlled symptoms or major complications .

carney syndrome ( cs ) is an autosomal dominant multiple neoplasia syndrome that includes cardiac , endocrine , cutaneous , and neural tumors . although the age at presentation may vary , cs is usually diagnosed in young patients , predominantly in female gender . cardiac myxomas seen in the course of cs are most often encountered in the left atrium . extra - cardiac manifestations include pigmented skin lesions , cutaneous myxomas , adrenal cortical disease , myxoid mammary fibroadenoma , and testes tumors in male patients . pituitary adenoma , melanotic schwannomas , and thyroid disease may be encountered in lower percentages . in this case report , we describe a middle - aged female patient who underwent surgery with the diagnosis of a large left atrial myxoma associated with cs . a 46-year - old female patient was admitted to our clinic with palpitation , cough , and exertional dyspnea . physical examination revealed pigmented lesions , especially scattered in the neck , chest , and extremities . the thyroid gland was mildly enlarged on palpation , but thyroid ultrasonography did not reveal any nodular or diffuse enlargement . she had been followed up with fibroadenomas located at the upper quadrant of the right breast . echocardiography revealed a left atrial mass , 6 4 cm in size , originating from the interatrial septum that was protruding into the left ventricle through the mitral valve during diastole ( figure 1 ) . peak pulmonary artery pressure was measured to be 65 mmhg , which was accompanied by mild to moderate tricuspid regurgitation . biochemical and hormonal parameters as well as thyroid hormone levels were within normal limits , except for mildly elevated hepatic enzymes ( serum glutamic oxaloacetic transaminase [ sgot ] = 55 iu / l , serum cortisol = 10 g / dl , insulin like growth factor [ igf]-1 = 202 ng / dl , growth hormone [ gh ] = 5 ng / dl , and oral glucose tolerance test with 100 gr glucose : fasting blood glucose level = 110 mg / dl ; 1 hour blood glucose level = 170 mg / dl ; 2 hour blood glucose level = 153 mg / dl and 3 hour blood glucose level = 143 mg / dl ) . left atrial myxoma ( white arrow ) seen on echocardiographic evaluation four chamber view genetic analysis of the patient ( especially the prkar1a gene ) could not be accomplished because of the lacking laboratory facilities in a newly established medical center . the aorta was cross - clamped and the heart was arrested with cold blood cardioplegia . left atriotomy was performed.a large encapsulated soft and lobulated left atrial myxoma , 6 4 cm in size , was attached to the interatrial septum with a broad base . the tumor was excised from the interatrial septum with its pedicle ( figure 2 ) . postoperative echocardiography revealed mild tricuspid regurgitation with a peak pulmonary artery pressure of 30 mmhg . the postoperative course was uneventful and the patient was discharged at the 5th postoperative day without any complication . we described a middle - aged patient with left atrial myxoma associated with concomitant clinical manifestations , which are components of cs : pigmented skin lesions and fibroadenomas of the breast . the overall lifespan of patients with cs is decreased , and cardiac causes of death are the most common among other etiologies . our patient s age was higher , which may reflect the late onset of the disease as well as late admission to a medical center . since more than half of the cases are familial , application of rigorous screening protocols are suggested for the first - degree relatives of the affected patients . our patient s first - degree relatives were screened for the cardiac and other manifestations of cs . the recurrence rate of the myxomas encountered in the course of cs is higher than that of the sporadic cases and this is an important issue since it may require multiple surgical interventions . postoperative short and long - term follow - up controls are crucial in these patients . cs is a complex genetic multiple endocrine neoplasia syndrome with various components relating to different organ systems . different clinical properties are well known and diagnostic criteria are defined concerning the large variety of these manifestations . cardiac myxomas are a corner stone of this disease since cardiac manifestations and related complications account for the majority of the mortality seen in the course of cs .

abstractcarney syndrome ( cs ) is an autosomal dominant multiple neoplasia syndrome that includes cardiac , endocrine , cutaneous , and neural tumors . cardiac myxomas can be seen in the course of cs . a 46-year - old female patient was admitted to our clinic with palpitation , cough , and exertional dyspnea . physical examination revealed pigmented lesions , especially scattered in the neck , chest , and extremities . echocardiography revealed a left atrial mass , 6 4 cm in size , originating from the interatrial septum that was protruding into the left ventricle through the mitral valve during diastole . the tumor was excised from the interatrial septum with its pedicle . the patient was discharged at the fifth postoperative day without any complication . cardiac myxomas are a cornerstone of this disease since cardiac manifestations and related complications account for the majority of mortality seen in the course of cs .

hutchinson gilford progeria syndrome ( hgps ; mim 176670 ) was first described in 1886 by jonathan hutchinson and by hastings gilford in 1897 . since then , just over 100 cases of hgps have been reported and currently , there are approximately 40 known cases worldwide . significant morbidity and mortality result from accelerated atherosclerosis of the carotid and coronary arteries leading to premature death during the second decade of life . a three - year - old boy presented with progressive loss of scalp hair , eyebrows , and eyelashes since six months of age along with stunted growth as a major complaint . the child 's antenatal history was normal but was born to third - degree consanguineously married parents . on examination , he had a senile look with prominent eyes , sparse hair with patches of alopecia and visible veins over the scalp , beaked nose , and receded chin [ figure 1 ] . his voice was high pitched and growth was stunted as parameters were less than the third percentile . teeth and genitals were normal and intelligence quotient ( iq ) was corresponding to the age . hands were short and clawed with thickening and hardening of the skin over the knuckles with racquet nails . there was mottled pigmentation and sclerodermatous changes over the trunk and lower limbs [ figure 2 ] . lower limbs also had prominence of knees and slight valgus deformity [ figures 3 and 4 ] . typical facies of progeria : senile look with prominent eyes , sparse hair , beaked nose , and receded chin mottled pigmentation and sclerodermatous changes over the trunk skin tightening and prominence of knees mid flexion and slight valgus deformity of lower limbs leading to a horse - riding stance the serum lipid profile showed a decrease in high - density lipoproteins ( hdl ) . x - ray of the chest showed a pyriform thorax , overcrowding of proximal ribs , and short clavicle with pointed lateral ends [ figure 5 ] . x - ray of the skull showed diastasis of the sutures and prognathism [ figure 6 ] . x - rays of hands and feet showed acro - osteolysis of phalanges and tarsals [ figure 7 ] . x - ray of the chest showing a pyriform thorax , overcrowding of proximal ribs , and short clavicle with pointed lateral ends x - ray of the skull showing diastasis of the sutures and prognathism . most cases of hgps occur due to de novo autosomal dominant mutation in the lmna gene , located on band 1q21.1 - 1q21.3 this leads to abnormal transcription of the nuclear lamina structural protein called prelamin a. normal farnesylation of prelamin a allows it to attach to the nuclear membrane . failure to remove this farnesyl group , due to the mutation , permanently affixes the protein to the nuclear membrane [ table 1 ] . this affects nuclear morphology and integrity , deoxyribonucleic acid ( dna ) repair , regulation of gene expression , and telomere stability . ultimately , there is genomic instability , decreased cell proliferation , and premature cell senescence and death . difference in prelamin a formation in normal and mutated lmna gene the infant is generally healthy at birth but there may be sclerodermatous skin changes involving the trunk and extremities in some cases . hair growth decreases over the scalp and other parts of the body with areas of alopecia followed by cardiovascular involvement . lipodystrophy involving the face leads to typical facies with senile look , glyphic nose , and involvement of the lower limbs with valgus deformity and mid flexion leads to a horse riding stance . there is diffuse osteopenia , acro - osteolysis of the phalanges and distal clavicles , but bone age is normal . hgps is considered a segmental progeroid syndrome in the sense that it does not recapitulate all the characteristic phenomena of aging like increased tumor formation and cataract development . hypertension develops , but unlike arteriosclerosis in the general population , in progeria , the only lipid abnormality is decreased hdl levels . this syndrome should be distinguished from scleroderma , cockayne syndrome , rothmund thomson syndrome , werner syndrome , acrogeria , and anhidrotic ectodermal dysplasia . in our case , cockayne syndrome was ruled out because of lack of photosensitivity , facial erythema , and ocular defects , and normal iq . thomson syndrome was ruled out by the absence of erythema , poikiloderma , and cataract . acrogeria also manifests at birth but involves only extremities with no tendency to atheroma or decreased life expectancy . there was an absence of conical teeth , hypotrichosis , and partial or complete anhidrosis , which ruled out hypohidrotic ectodermal dysplasia . typical clinical features of the child were sufficient to make the diagnosis . decreased hdl levels and typical x - ray findings confirmed the diagnosis .

hutchinson gilford progeria syndrome is a rare genetic disorder characterized by premature aging involving the skin , bones , heart , and blood vessels . we report a three - year - old boy with clinical manifestations characteristic of this syndrome . he had a characteristic plucked - bird appearance , prominent eyes and scalp veins , senile look , loss of scalp hair , eyebrows , and eyelashes , stunted growth , and mottled pigmentation with sclerodermatous changes over the trunk and lower limbs . radiological changes and decreased high - density lipoprotein ( hdl ) levels were also characteristic of the syndrome . this interesting case is reported for its rarity .

most commonly , contractures arise where adequate burn care and delivery have not occurred and scar management has not been instigated in a vigorous manner . repair by regeneration can no longer occur when the depth of injury extends beneath the reticular dermis , and healing by secondary intention.1 the resultant wound contraction can lead to contractures over flexor surfaces and its surroundings . for example , limitation of opening jaws may cause difficulties in accessing the dentitions and tissues of the oral cavity , and in using full size of removable denture for the patients . telescopic implant - supported removable partial prosthesis with milled abutments has been used for the patient with burn contracture to provide enough retention and stability for the prosthesis . a 60-year old woman was referred from the plastic surgery department to the department of prosthodontics at yonsei university health system . she had a chief complaint of restoring her oral function and esthetics after series of plastic skin graft procedure done . during the extra oral examination it was noted that the elasticity of muscle and skin tissue around oral angular area was lost due to scars from burns and tissue grafting , which resulted in limited maximum mouth opening of 20 mm . therefore , proper prosthodontic treatment was impossible on the right quadrants of the mouth ( fig . the intraoral examination showed that all of maxillary teeth were missing except tooth number # 25 and splinted gold crowns on # 34 and # 35 , whereas fixed partial denture on # 33 to # 43 were present on the mandible . in order to restore the patient 's masticatory function , prosthodontic treatment plan of using 4 implants on the left quadrants each of two implants were placed on upper and lower posterior left jaws , however no implant on anterior ridge were possible due to severe atrophy of the maxilla . anterior cantilever type removable partial denture was planned to meet patient 's esthetic demand , which consists of a telescopic crown abutment on # 25 and two implant supported abutments on area of # 26 and # 27 in the maxillary area ( fig . 2 ) . on the mandible , implant - supported fixed partial denture on area of # 36 and # 37 was planned . the implants ( strauman basel , switzerland ) ( 4.810 mm ) were placed on predetermined area accompanied with sinus lift ridge augmentation procedure and proper follow up was performed during the 6 month healing period of time . customized abutments were fabricated on implants and designed in the predetermined angle paralleling to the prepared tooth of # 25 ( fig . 3 ) . removable partial denture was inserted to verify phonetics , esthetics and function . key and keyway rigid attachment was used for retention and ledge type rest was used for support ( fig . no complications have occurred in 5 years since the insertion of the prostheses ( fig . removable type of prosthesis was selected as treatment option after considering the factors of oral hygiene maintenance and lip support of patient to improve esthetics . because there was only one natural tooth in the maxilla , we , therefore , had to improve the unfavorable removable partial denture using implants.2 due to the lack of anterior ridge , the implant option on anterior ridge was deemed unavailable , and natural tooth was splinted with implant to support anterior cantilevered prosthesis . combining implants with natural teeth is controversial because of the variations in movement during function.3 a lot of complications regarding implant and tooth - supported prosthesis may arise ; including fracture of the prosthetic components , intrusion of the natural tooth , marginal bone loss , and loss of osseointegration,4 but survival rates of implant and tooth - supported fixed prostheses are comparable to implant - supported fixed prostheses.5 there was no prosthetic complication in implant - and tooth - supported fixed prosthesis in this case . in this case , forces in the cantilevered area were transmitted to the abutments , causing tilting and rotational movements,6 but cantilevered prostheses are preferable when reduced stress is inherent.6,7 the prosthesis in this patient is expected to have a good prognosis since it is designed with hypoocclusion in anterior areas .

the scars and contracture around the oral - facial region may cause difficulty in prosthodontic treatment to restore esthetics and function for the patients , who suffered severe burns . this article presents a technique that uses a fixed partial denture prepared with a conventional milling technique and an attachment to support anterior cantilever removable partial denture , thereby providing a more esthetically acceptable and functional result .

functional hallucinations are an unusual form of perceptual disorder , in which hallucinations are triggered by a stimulus in the same modality , and co - occur with it . for example , a patient may report hearing voices criticizing him every time he hears the sound of a rotating fan , and which stop when the fan is not running . their exact significance is unknown , but they have been reported in schizophrenia and other functional psychotic disorders . the treatment of positive symptoms of schizophrenia , including hallucinations , generally involves the use of antipsychotics . the following is the report of a patient diagnosed with schizophrenia , with persistent functional hallucinosis , who responded to the addition of sodium valproate . a single man , aged 30 , employed in a factory , presented to our outpatient department , in 2007 , with two years continuous illness , characterized by persistent auditory hallucinations , secondary delusions of reference , social withdrawal , and impaired occupational functioning . he also reported obsessive doubts about routine activities , such as closing doors or taps , and a compulsion to check whether he had done these properly , despite knowing that this was unnecessary . he was diagnosed to have paranoid schizophrenia and obsessive - compulsive disorder , and was treated with risperidone ( titrated up to 8 mg / day ) and fluoxetine ( titrated up to 80 mg / day ) . on the above - mentioned medications , he improved significantly , and was able to return to his job . his job involved frequent contact with machinery and motors . whenever he heard these machines running he found these distressing , and this led him to frequently avoid his work or leave it incomplete . he did not hear these voices at any other time , and did not report any recurrence of his other symptoms . his body weight was 62 kg . due to financial difficulties ( the patient was receiving the above medications free of cost from the hospital ) and his overall good response to risperidone therefore , he was given a trial of adjunctive sodium valproate , which was freely available in the hospital and had some evidence of efficacy in reducing positive symptoms , as an adjunct to antipsychotics . after obtaining the patient 's consent , sodium valproate was initiated at a dose of 600 mg / day , and gradually increased by 200 mg every week based on his response and adverse effects . at 1000 mg / day of sodium valproate , the patient reported a significant reduction in his hallucinations , and he felt that he could carry out most of his work . hence , valproate was further increased at the same rate , up to 1800 mg / day . at this dose , the patient reported feeling near - normal , and was in line for a promotion at his workplace . however , he developed significant postural tremors , which interfered with his ability to work , and valproate was reduced to 1700 mg / day . at this dose , he reported that the voices had decreased by 75% , and he scored between 2 and 3 ( mild symptoms ) on item p3 ( hallucinations ) of the positive and negative symptom scale for schizophrenia . he has remained on valproate 1700 mg / day , along with risperidone 8 mg / day and fluoxetine 80 mg / day , for the past three months , and has remained stable . his functional hallucinations still occur from time to time at work , but he is less bothered by them and does not experience any impairment . the management of patients with schizophrenia , who have a single persistent symptom , is a challenging situation . evidence - based treatments , such as changes in medication or cognitive - behavioral therapy , may not always be feasible . in this patient , time and economic constraints made it unlikely that the patient would comply with either . hence , an alternative that would be safe , affordable , and with some evidence of effectiveness was required . on account of the rarity of functional hallucinations however , a single case report suggests that carbamazepine may be helpful . in psychiatry , a cochrane review suggests that it may be useful in reducing aggression and tardive dyskinesia , but has little effect on other symptoms . however , one trial has suggested that adjunctive divalproex reduces positive symptoms , and a case series found the addition of valproic acid useful in difficult - to - treat schizophrenia patients . the effect of adjunctive valproate in schizophrenia is probably not due to the elevation of risperidone levels . valproate acts primarily through gamma - amino butyric acid ( gaba)-ergic mechanisms , which may modulate the actions of dopamine . alternately , it may act through an epigenetic mechanism involving the demethylation of relevant sections of the gaba - related genes . finally , given the paroxysmal , event - triggered nature of the patient 's hallucinations , it is possible that valproate 's ability to block sodium channels in a use - dependent fashion , may have contributed to symptom amelioration , as carbamazepine did in the earlier case . although it can not be recommended in all patients , this case suggests that valproate may be beneficial in selected cases , particularly as an add - on to antipsychotics .

functional hallucinations are a rare phenomenon , wherein hallucinations are triggered by a stimulus in the same modality , and co - occur with it . although hallucinations in schizophrenia are normally treated using antipsychotics , not all patients respond to them . the following is the report of a patient with paranoid schizophrenia who experienced persistent functional hallucinations , triggered by the sound of machines in his factory , in the absence of other psychotic symptoms . these occurred despite adequate doses of risperidone , which had controlled his other symptoms . the addition of sodium valproate , titrated up to 1700 mg / day based on response and tolerability , resulted in a marked improvement in this phenomenon and enabled him to return to work . the implications and possible mechanisms of the patient 's response are discussed .

skin and soft tissue infections caused by non - tuberculous mycobacteria have been increasingly described as a complication associated with many procedures , including liposuction , illicit soft tissue augmentation , acupuncture , and contamination from medical instruments during surgery [ 1 , 2 , 3 , 4 , 5 ] . mycobacterium abscessus is a rapid - growing atypical mycobacterium that has been reported to cause a variety of cutaneous infections . herein , we report a case of cutaneous m. abscessus infection associated with mesotherapy injection . a previously healthy 44-year - old woman presented with a 3-week history of tender erythematous nodules on her face . the lesions had developed 2 weeks after mesotherapy injection for facial rejuvenation , using an unknown substance administered by an uncertified aesthetician . physical examination revealed multiple , discrete , tender erythematous nodules and plaques with minimal serosanguinous discharge on both cheeks ( fig . 1 ) and on the forehead ( fig . a skin biopsy specimen obtained from a nodule on the right cheek revealed dense inflammation predominantly consisting of neutrophils , histiocytes and multinucleated giant cells in the superficial and deep dermis ( fig . 3 ) . gram staining , fungal and acid - fast bacilli stains were negative . tissue culture was positive for m. abscessus , sensitive to clarithromycin , ciprofloxacin , doxycycline , cefoxitin , and amikacin . the patient was treated with a combination of clarithromycin 500 mg twice daily , doxycycline 100 mg twice daily , and ciprofloxacin 500 mg twice daily according to the bacterial sensitivity testing . the patient completed 6 months of treatment , which resulted in complete resolution of the lesions with minimal atrophic hyperpigmented scars . mesotherapy was first introduced in france in 1952 , consisting of an injection of highly diluted drugs and different substances into the dermis and subcutaneous tissue . this technique was originally developed to treat localized pain , vascular and lymphatic disorders , but its use in aesthetic medicine has increased in recent years . m. abscessus belongs to the group of rapidly growing non - tuberculous mycobacteria which is characterized by a rapid growth rate ( within 7 days ) on the culture . the organism is ubiquitously present in soil , decaying vegetation , and water ( e.g. , natural water , sewage water , drinking water tanks , and tap water ) . m. abscessus causes a wide range of clinical diseases including skin and soft - tissue infection , keratitis , osteomyelitis , pulmonary infection , and disseminated infection . in skin and soft - tissue infection , it usually follows penetrating trauma and typically occurs in immunocompetent individuals . there are several reports of outbreaks of m. abscessus infections caused by non - sterile techniques or contaminated materials , following surgery , liposuction , foreign body implantation , mesotherapy , acupuncture , and soft tissue augmentation [ 1 , 2 , 3 , 4 , 5 ] . the clinical presentations of cutaneous m. abscessus infection ranges from asymptomatic to tender erythematous violaceous nodules and plaques , cellulitis , abscesses , ulcer , and draining sinus with serosanguinous discharge . approximately 1020% of localized cutaneous m. abscessus infections in immunocompetent patients resolve spontaneously without treatment in an average of 8 months . currently , there is no standard guideline for the treatment of cutaneous m. abscessus infection . multiple modalities including surgery , draining of abscesses , removal of necrotic tissue , foreign body removal , and an extended course of antibiotics are recommended . however , the in vivo efficacy against the mycobacteria is not completely reflected by in vitro sensitivity alone , but also depends on the function of local and general host defenses against the infection . m. abscessus is usually susceptible to clarithromycin , amikacin , linezolid , tigecycline and variably susceptible to cefoxitin and imipenem ( table 1 ) . monotherapy is not recommended in treating m. abscessus infection because of the potential for emergence of antibiotic resistance , as has been reported with other mycobacteria , such as mycobacterium chelonae . in conclusion , we report a case of cutaneous m. abscessus infection associated with mesotherapy . this case emphasizes the importance of adequate sterile measures in all medical procedures and stresses the need to suspect the possibility of an atypical mycobacterium infection in patients who develop late - onset skin and soft tissue infection after cutaneous injury , injections , and surgical interventions , particularly if they do not respond to conventional antibiotic treatment .

non - tuberculous mycobacterial skin infections have an increasing incidence . in immunocompetent patients , they usually follow local trauma . we present a case of cutaneous mycobacterium abscessus infection following mesotherapy . the lesions were successfully treated with a combination of clarithromycin , ciprofloxacin , and doxycycline . atypical mycobacterial infection should be suspected in patients who develop late - onset skin and soft tissue infection after cutaneous injury , injection , and surgical intervention , particularly if they do not respond to conventional antibiotic treatment .

these patients can have associated urethrovaginal or vesicovaginal fistula , requiring early or delayed surgical repair . spontaneous closure of the fistula associated with obstetric or gynecological injury has been described in the literature . to the best of our knowledge , a 45-year - old female sustained pelvic fracture with urethral injury due to a road traffic accident . initial resuscitation , orthopedic management with internal fixation of the pubic bone , and suprapubic urinary diversion were done elsewhere . she consulted us after 3 months of the initial injury with history of continuous leakage of the urine per vaginum . on pelvic examination , urine was seen emanating from the vagina and a scar was felt in the proximal vagina . she came after 15 days with acute urinary retention and cessation of the urinary leak per vaginum . on filling the bladder with methylene blue through the suprapubic catheter , no leak was demonstrable through the vagina . antegrade cystoscopy revealed normal bladder wall along with complete obstruction and scarring at the level of bladder neck . a mitrofanoff procedure was performed using the tapered ileal segment as intraoperatively , the appendix was found to be very short . she was discharged in satisfactory condition and is doing well till the last follow - up . female urethral injury during pelvic fracture is rare because of the short length of the relatively mobile urethra which lies behind and is protected by the pubic bone . orkin et al . , have reported 6% incidence of urethral injury in a review of 2,000 cases of pelvic fracture . children outnumber the adults in such injuries perhaps because of greater compressibility of the less ossified bones . there can be a urethral contusion , longitudinal urethral laceration or urethral transaction in such cases . in cases of female urethral disruption related to pelvic fracture , immediate repair of the pelvic fracture with the urethral and vaginal injuries is advocated since suprapubic drainage with the spontaneous evolution of these lesions usually leads to complete obliteration of the urethra , urethrovaginal fistula , and various degrees of vaginal stenosis as was seen in our patient . primary endoscopic realignment of the separated urethral ends over a catheter , avoiding tissue dissection or sutures in the traumatized area is an alternative approach recommended by others . however , with realignment , the likelihood of development of a urethral or bladder neck stricture has been reported to be quite high , needing delayed surgical reconstruction . the reconstructive surgery is also more extensive , often requiring a bladder neck construction through transpubic approach . our patient presented late with a completely obliterated urethra with an initial urethrovaginal fistula which later spontaneously got obliterated . the extent of the injury precluded reconstructive surgery and required a catheterizable channel in the bladder . in the cases of fistulas formed due to obstetric or gynecological injuries , spontaneous healing is described in the literature , especially in those cases where the fistula is small and early , with prolonged bladder drainage is provided . our case does bring out a fact that is less emphasized in the medical teaching that while persistence of fistula is often attributed to the distal obstruction , closure of fistula does not necessarily mean restoration of normal anatomy but could be a development of proximal obstruction . to the best of our knowledge , we are describing the first case of spontaneous closure of the urethrovaginal fistula associated with pelvic fracture . the possible explanation for the spontaneous closure in this case is probably because of progressive scarring leading to entrapment of the fistula and encasement of the bladder neck in the dense scar . this can also be a marker of extensive urethral injury and the likelihood of complete urethral obliteration as opposed to a short segment stricture . in female urethral injury due to pelvic fracture , early primary repair should be attempted to avoid subsequent devastating complications like urethrovaginal fistula or urethral obliteration . delayed repair in expert hands however , complete obliteration of the urethra extending up to the bladder neck often precludes reconstructive surgery and may require a catheterizable channel in the bladder . spontaneous closure of the urethrovaginal fistula can occur if there is extensive and dense scarring around the fistulous area .

female urethral injury following pelvic fracture is a rare entity . due to the absence of large series , management guidelines are still not standardized . patients can have associated urethrovaginal or vesicovaginal fistula , management of which poses a major challenge to the reconstructive urologist . spontaneous closure of fistula produced by gynecological or obstetrical injuries have been described in the literature . spontaneous closure of fistula caused due to pelvic fracture has not been described in the literature .

verruca vulgaris is caused by a human papillomavirus ( hpv ) infection of the epidermis . verruca in the external auditory canal ( eac ) has rarely been reported . a previous case report introduced surgical excision for verruca treatment because there was no available nonsurgical treatment for verruca in the eac . we present a case of verruca in both eacs that was successfully treated with intralesional bleomycin injection . a 32-year - old male patient presented with ear fullness and palpable lumps in both eacs . the lumps were identified 18 months prior to the examination and the patient indicated that the lumps appeared to be getting larger . otoscopic examination revealed multiple pinkish , papillomatous masses that filled both of his eacs ( fig . however , we performed intralesional bleomycin injection , which is a simple and effective method for treatment of verruca vulgaris on the hands , feet or face . bleomycin was diluted with 1% lidocaine to make a 1-u / ml bleomycin solution . a 1-ml syringe with a 30-gauge needle the bleomycin solution was injected twice ; 0.5 ml at the first injection and 0.2 ml at the second injection one month later . one month after first injection , the verruca decreased to approximately one - third of the initial size ( fig . two months after the second injections , the verruca was not observed and there was no scarring or necrosis ( fig . eight months after the second injection , the patient confirmed that there was no recurrence . verruca vulgaris is caused by an hpv infection , and there are over 100 human papilloma dna viruses that belong to the dna papovaviridae family . histopathological examination is used for a definitive diagnosis , and revealed characteristic features of hyperkeratosis , papillomatosis , parakeratosis , acanthosis , and koilocytosis . it is associated with low - risk hpv infections ( types 6 and 11 ) that often result in a benign clinical course with no recurrence or malignant transformation . eac infections are thought to be associated with a history of repeated manipulation using the finger tips or ear picking tools . in addition , it has been suggested that the hair follicles may serve as possible reservoirs . eac verruca causes mechanical obstruction which can lead to pressure necrosis of the adjacent bone or conductive hearing impairments , although tympanic membrane involvement is seldom reported . there are currently several methods to treat verruca , which include topical treatments , cryotherapy , immunotherapy , photodynamic therapy , laser therapy , curettage and cautery , radiation therapy , surgical excision and intralesional bleomycin injections . a case report introduced surgical excision of verruca in the eac as the preferred treatment because of difficulty to apply nonsurgical treatment such cryotherapy , photodynamic therapy or laser therapy . however , the most common complication associated with surgical excision is the possibility of scarring and subsequent eac stenosis . intralesional bleomycin injections have been used to treat verruca on the hands , forearm , feet and face . bleomycin was originally isolated from the fungus , streptomyces verticillus , and is frequently used as an antitumor agent . bleomycin blocks the cell cycle at g2 , cleaves single - stranded and double - stranded dna and degrades cellular rnas ; it also forms a complex with metal ions , which reduce oxygen to free radicals . other possible underlying mechanisms are endothelial damage , which induce tumor necrosis factor , hemorrhage of subepidermis and intraepidermis , and the appearance of apoptotic cells . the cytotoxic effect and uptake of bleomycin is increased by mixing drug with local anesthetics because local anesthetics disrupt the cell membrane structure . after bleomycin intralesional injection , verruca on the hands and feet has exhibited hemorrhagic black eschars which suggest adequate bleomycin infiltration . eschar formation is thought to be caused by absolutely decreased blood flow , necrosis , and subsequent detachment of the lesion . however , verruca on the face indicated that the verruca gradually shrank after injection , and disappeared without eschar formation . we thought that the blood supply is decreased after injection but not completely interrupted because of rich and large dermal capillaries of the face . incomplete blockage of blood flow may not cause hemorrhagic necrosis , eschar formation and consequential verruca detachment . induction of endothelial and keratinocyte apoptosis by direct or indirect damage may be result in verruca shrinkage without necrosis or eschar . its clinical course was similar to one of verruca on the face . in conclusion , we present a case of large and multiple verruca in both eacs that was successfully treated with twice intralesional bleomycin injections at one - month interval . an intralesional bleomycin injection is simple , easy to apply without any difficulty and limitation , and had a high degree of patient satisfaction for treatment of verruca in the eac . we propose that it may be an effective , first - line treatment of verruca in the eac .

verruca vulgaris is caused by human papillomavirus ( hpv ) infections . verruca in the external auditory canal ( eac ) has rarely been reported . a previous case report introduced surgical excision as a treatment for verruca in the eac . we present a case of verruca vulgaris in both eacs that was successfully treated with an intralesional bleomycin injection . a 32-year - old male patient presented with ear fullness and palpable lumps in both eacs . both of his canals were filled with multiple pinkish , papillomatous masses . verruca vulgaris was confirmed by skin biopsy . an otolaryngologist referred this patient and recommended surgical excision . however , we performed intralesional bleomycin injections for treatment . twice intralesional bleomycin injections at one - month intervals had excellent results without recurrence , ulceration or scar formation . this result indicates that bleomycin injections may prove to be an effective first - line treatment of verruca in the eac .

atrichia congenita without ectodermal defects ( isolated form ) is a rare autosomal recessive condition characterized by the shedding of scalp hairs between one and six months of age , after which no growth occurs . eyebrow , eyelash and body hair may also be sparse or absent ; patients may have a few pubic and axillary hairs . isolated congenital alopecia has been reported to occur in both sporadic and familial forms . in the isolated familial form , inheritance is usually autosomal recessive , although dominant or irregular dominant inheritance has occurred in some families . the gene locus for familial cases is on chromosome 8p21 - 22 ( alunc - alopecia universalis congenitalis ) , and mutation of the human hairless ( hr ) gene on chromosome 8p21 - 22 produces the clinical picture of atrichia congenita . human hr gene is a homologue of the murine hairless gene and encodes a zinc - finger transcription factor protein that is expressed in the brain and the skin . a one - and - a - half - month - old male baby was brought by his maternal grandmother with complaints of frontoparietal scalp hair recession , sparse eyelashes and eyebrows [ figure 1 ] . the grandmother as well as two of her siblings ( one female and one male ) all had absent scalp , facial , axillary , and pubic hair since infancy . examination revealed complete absence of scalp , facial , axillary , and pubic hair with no papular skin lesions . three siblings ( two females and one male ) with absence of scalp , facial , pubic and axillary hair , along with the maternal grandson ( one - and - a - half - months ) having frontoparietal recession , sparse eyelashes and eyebrows there was no history of delayed milestones in the baby , hypohidrosis , bone pain , hearing loss , or seizures . the condition may be confused with congenital alopecia universalis , vitamin d dependant rickets , and ectodermal dysplasia . in our patients , congenital alopecia universalis was ruled out on the basis of lack of any history of sudden , patchy loss of normally appearing hair progressing to the loss of scalp , body , eyelash , andv eyebrow hair . vitamin d dependent rickets was ruled out on the basis of lack of any history of joint pain , normal serum vitamin d3 and calcium levels , and a normal wrist joint radiograph . ectodermal dysplasia was excluded as there was no history of delayed milestones or loss of sweating . teeth , nails , mucosa ( ectodermal components ) , palms , and soles were normal . the presence of a family history , history of consanguinity , and sparse eyebrows and eyelashes at the time of birth pointed to the diagnosis of atrichia congenita . our patients met two out of five major criteria supplemented by four minor criteria for the diagnosis of atrichia congenita ( isolated form ) . diagnostic criteria for atrichia congenita with papular lesions the case is being reported for its rarity .

atrichia congenita is a rare genodermatoses is characterized by a mutation of the human hairless ( hr ) gene on chromosome 8p22 . there is loss of scalp hair between one to six months of age , after which no growth occurs . eyebrow , eyelash , and body hair may also be sparse or absent ; patients may have a few pubic and axillary hairs . the condition may present in isolation or along with other defects .

since 1980 , when the first implantable cardiac defibrillator ( icd ) was implanted , the use of cardiovascular implantable electronic devices ( cied ) including permanent pacemaker and icd has become more popular . with growing indications , infectious endocarditis is a rare complication following implantation of these devices . in suspected cases , transthoracic echocardiography ( tte ) but , the incidence of constrictive pericarditis due to icd lead infection in dual active fixation method is rare . a 62-year - old man with history of diabetes and opium addiction for 20 years was admitted in 2007 at sina hospital , isfahan , iran , for evaluation of arrhythmia . however , left ventricular ( lv ) function was severely reduced with ejection fraction of 20% the patient was placed on anti - arrhythmia drugs ( amiodarone , 400 mg , orally , three times in day ) and discharged . one year later , the patient was admitted with repeated vt with severe lv dysfunction arrhythmia which did not respond to medical therapy . tte was unremarkable , tee showed large vegetations on the icd lead in ra and also vegetations on the anterior leaflet of tricuspid valve . the result of the blood culture was positive for staphylococcus aureus which was methicillin sensitive . septal motion abnormality ( septal bounce ) the decision was made to remove the device surgically throw median sternotomy in february 2011 . the cultures of excised vegetations were positive for staphylococcus aureus , e.g. , video 1 , figure 2 . leaflet of tricuspid valve , infected implantable cardiac defibrillator leads one month after the surgery , the patient returned to hospital with chest pain , malaise , and no fever . pericardial effusion with air - fluid level in a patient with previous implantable cardiac defibrillator ( non - contrast chest ct . mediastinal window ) one month later , the patient returned with severe lower extremity edema . echocardiography showed echo findings were as follows : moderate pulmonary arterial hypertension ( pap = 45 - 50 mmhg ) , moderate circumferential pericardial effusion with high - density material ( 18 mm ) at pericardium [ figures 4 - 8 ] . mitral valve inflow deceleration time constrictive pericarditis mitral valve velocity propagation significant respiratory variation in tricuspid inflow significant respiratory variation in mitral inflow sever diastolic dysfunction in mitral valve ( doppler ) surgical removal of vegetation of ant . generator and lead removal during ten months follow - up after pericardiotomy , dyspnea and edema improved significantly with no evidence of life - threatening arrhythmias . constrictive pericarditis following icd implantation is rare . with less frequent use of patch electrodes , koich keno et al . reported a case of delayed pericarditis 23 days after icd implantation with active fixation atrial lead method , but no endocarditis . they believed that constant contact of the atrial screw with pericardium was the cause of pericarditis . they believe that mechanical injury was the main reason for pericarditis . in all cases of reported icd infection with large vegetations , icd - related endocarditis is an uncommon but a serious complication , the incidence ranging from 0.5 to2% with high mortality rate close to 35% . the most common bacteria causing icd infection is staphylococcus aureus as it was in our case .

the usage of implantable cardiac defibrillator ( icd ) since 1980s is becoming more popular these days . the rate of both , endocarditis and constrictive pericarditis are low but it still needs attention . we are reporting a rare case of icd endocarditis as a result of toe infection in a diabetic patient . this was followed by infectious pericarditis after device removal by open heart surgery and then delayed constrictive pericarditis .

subfoveal choroidal neovascularization ( cnv ) is a leading cause of visual loss in the geriatric population . peripapillary cnv membranes ( ppcnvm ) have been associated with multiple etiologies [ 2 , 3 ] . while ppcnvm , associated with optic nerve head drusen ( onhd ) , is a well - described entity in the pediatric population , it is not reported in the adult population ( pubmed search november 29 , 2014 ) . herein , we report a case of ppcnvm associated with onhd impacting the macula , which required treatment with an anti - vascular endothelial growth factor ( anti - vegf ) agent . a 75-year - old male presented with a chief complaint of blurry vision in the right eye ( od ) of 3 months duration . the patient 's past medical and ocular history were significant only for herpes zoster ophthalmicus on the left side years prior . on examination , his treatment was initiated with 3 ranibizumab injections , administered every 5 weeks , without any impact on the amount of subfoveal fluid . subsequent treatment with a single aflibercept injection resulted in complete resolution of subfoveal fluid ( fig . the patient 's visual acuity has been stable for 15 months with no recurrence of subfoveal fluid . the association of onhd with macular threatening ppcnvm and its favorable response to anti - vegf agents is already known in the pediatric population [ 2 , 3 , 4 ] . the natural course of ppcnvm is variable and unpredictable ; however , macular threatening ppcnvm requires treatment . while the role of anti - vegf therapy as a treatment for this specific subset of choroidal neovascular membranes was not studied as part of the major neovascular age - related macular degeneration ( amd ) studies , its use for the treatment of other forms of cnv is well established . bevacizumab , ranibizumab and aflibercept are 3 anti - vegf agents used for the treatment of neovascular amd . ranibizumab and bevacizumab are monoclonal antibodies that selectively bind to vegfa [ 7 , 8 ] . aflibercept , however , is a fusion protein composed of the binding domains of vegf receptor 1 , vegf receptor 2 , and the fc portion of igg that selectively binds to vegfa , vegfb , and platelet growth factor ( pigf ) . aflibercept has been shown to have a greater affinity for vegf and a longer half - life than both ranibizumab and bevacizumab . the comparison of age - related macular degeneration treatment trials ( catt ) demonstrated equivalence in efficacy between ranibizumab and bevacizumab in the treatment of wet amd , as did the inhibition of vegf in the age - related choroidal neovascularization ( ivan ) trial . the vegf trap - eye : investigation of efficacy and safety in wet amd ( view 1 and view 2 ) trials similarly demonstrated an equivalence between ranibizumab and aflibercept in treating wet amd . inadequate response to 1 anti - vegf agent is not uncommon when treating cnv , and , on occasion , changing to an alternate anti - vegf agent has demonstrated efficacy . currently , there are no studies that have investigated the response of aflibercept in treatment - resistant peripapillary cnv , likely due to the rarity of this presentation . previous studies have concluded that aflibercept may provide an efficacious therapeutic response in cases of cnv due to amd that initially failed to respond to bevacizumab and ranibizumab . further studies are required to investigate whether aflibercept is an equally efficacious therapeutic alternative to treatment resistant peripapillary cnv . based upon our experience , an individualized treatment plan for adult patients with ppcnvm , associated with onhd ,

optic nerve head drusen can be associated with peripapillary choroidal neovascularization , in both the pediatric and adult population . these membranes can involve the macula , causing significant visual loss . herein , we present a case that required treatment with an anti - vegf agent . the patient failed to respond to the initial agent , but subsequently responded to a change of agent . adult patients with macular degeneration involving peripapillary choroidal neovascularization associated with optic nerve head drusen may require individualized treatment plans .

a 77-year - old woman with known spina bifida occulta presented to the emergency department with a 6-week history of severe low back pain and progressive paraparesis . she was able to walk only two to three steps and only with two helpers . she was previously asymptomatic and was aware of a hairy patch in the lower back since birth . her medical comorbidities included diabetes mellitus ( type ii ) , hypertension , increased body mass index , and mitral regurgitation . neurological examination of the lower limbs revealed proximal lower limb weakness of mrc ( medical research council ) grade 3 in l2 , l3 myotomes and grade 4 in l4 , l5 , and s1 myotomes . reflexes were brisk with upgoing plantars and three beats of clonus in the right foot . subsequent investigation with magnetic resonance imaging of the whole spine showed a low - lying tethered cord and a large disc prolapse at l2/3 causing cord compression with associated syringomyelia ( figs . 1 , 2 , and 3 ) . axial view l2l3 level . sagittal view t1-weighted image . sagittal view t2-weighted image . the initial operative plan was to perform an anterior decompression , which may have entailed a corpectomy with bone graft and fusion . however , her extensive medical comorbidities increased the risk of perioperative morbidity . consideration was given for posterior approach with the possibility of increased risk of wound infection due to the large lumbar pit and hairy patch , overlying the planned surgical wound . as posterior approach presented a significantly lower risk to the patient overall , a posterior decompression with a standard midline incision and laminectomy was performed at l2/3 under general anesthesia . following posterior decompression , the patient recovered full motor power in her lower limbs , and she could eventually walk unaided . in the early postoperative period , she had a deep wound infection , which was successfully treated with debridement , negative pressure therapy ( vacuum - assisted closure pump ) , and antibiotics . follow - up in outpatient clinic 6 months after surgery , she was walking unaided and the wound had healed satisfactorily . tcs was described in last 3 decades and was previously associated only with the pediatric population.4 now , however , there is good evidence that it can occur even in adults and is much more common than previously thought.1 adults with tcs are considered to belong to two groups : those who were healthy in childhood but symptoms developed in adulthood or those who had static neurological deficits or skeletal deformities that were diagnosed in childhood but remained well until the onset of new and progressive neurological deficits in adulthood.3 5 other classifications included grouping them on basis of extent of spinal dysraphism6 or surgical outcome following detethering of the cord.7 it has been shown that adults commonly present with varying neurological symptoms usually following a precipitating factor such as coughing , bending , or strenuous physical activity . it is thought that the mechanical longitudinal traction as a result of tethered cord causes these symptoms . many clinical series have found that these patients can present with a gradual , insidious onset of back pain , nondermatomal leg pain , burning pain in the buttocks and perineal region , and bowel and/or bladder dysfunction.1 2 4 7 they can mimic symptoms of lumbar disc disease or spinal stenosis . there are some reports of symptoms being aggravated due to disc disease.8 the recommended treatment is to detether the cord and excise any lesion.1 2 3 though the role of surgery is controversial , it has been shown that surgical detethering in the presence of neurological deterioration has been of some benefit . motor weakness and pain seem to resolve though the return of sensory deficit , and return of bladder function varies.4 some surgeons have even questioned the role of detethering in the absence of symptoms and whether it would alter the natural history of tcs.9 our hypothesis is that the neurological deficit in this patient was likely secondary to the prolapsed disc . owing to the natural lordosis of lumbar spine , posterior decompressive surgery may have allowed the spinal cord and neural elements to fall back and therefore relieved anterior cord compression . upper motor neuron signs and myelopathy are not usually seen with lumbar disc prolapse when the cord is in the normal position . however , in the presence of low - lying cord , this could result in signs of cord compression with resulting myelopathy or upper motor neuron signs . this is the first case we know of that describes the management of lumbar cord compression with progressive neurological deficit .

low - lying cord is an uncommon entity , and cord compression due lumbar disc disease is rarely encountered . we discuss our experience with a case of lumbar cord compression secondary to a large disc protrusion , which caused myelopathy in a low - lying / tethered cord . a 77-year - old woman with known spina bifida occulta presented with 6-week history of severe low back pain and progressive paraparesis . magnetic resonance imaging showed a low - lying tethered cord and a large disc prolapse at l2/3 causing cord compression with associated syringomyelia . medical comorbidities precluded her from anterior decompression , and therefore a posterior decompression was performed . she recovered full motor power in her lower limbs and could eventually walk unaided . she had a deep wound infection , which was successfully treated with debridement , negative pressure therapy ( vacuum - assisted closure pump ) , and antibiotics . six months after surgery , her oswestry disability index improved from 55% preoperatively to 20% . posterior spinal cord decompression for this condition has been successful in our case , and we believe that the lumbar lordosis may have helped indirectly decompress the spinal cord by posterior decompression alone .

in the current issue of critical care , paulus and colleagues investigate whether the need for additional analgesia to prevent pain from endotracheal suctioning can be predicted by measuring the pupillary dilatation reflex ( pdr ) response to tetanic stimulation in deeply sedated patients . this study touches on two important issues : objective pain assessments and pre - emptive analgesia . pain in the critically unwell can lead to significant physiological and psychological consequences , and may affect patient outcome . assessing pain in the critically ill is challenging . when patients are unable to self - report , assessment is based on behavioural and physical signs . unfortunately physiological variables are not predictive of the presence or absence of pain , and recommended behavioural tools ( critical care pain observation tool and behavioural pain scale ) only identify patients who are experiencing pain . this pain is common and poorly managed , explained in part by the inability of behavioural tools to predict those patients who require additional analgesia for painful procedures . apart from chest drain removal , only low - grade evidence supports the use of pre - emptive analgesia for procedural pain and over - administering opioids to patients is not without potential consequence . management at present is limited to either administering analgesia blindly before every procedure or taking a reactionary approach to treat pain after it has occurred . the predictive utility of pdr to guide pre - emptive analgesia for painful procedures might be a possible solution to an important clinical question . loewenfeld summarised this work and her own investigations in the late 1950s , and copious literature now exists exploring this phenomenon in adults and children under general anaesthesia , in awake volunteers , in organ donors and in the postoperative period as a means of assessing analgesic requirements . larson and sessler summarised in their editorial other influencing factors that clinicians need to consider when using pdr in pain assessment , including the effect of drugs and technical difficulties such as patient movement . however , there are a number of questions that remain unanswered concerning the use of pdr in sedated patients , which should be considered . paulus and colleagues are the first group to investigate pdr in response to tetanic stimuli in deeply sedated patients . pdr is a supraspinal parasympathetic reflex in patients under general anaesthesia but is sympathetically mediated in awake patients . does the mechanism differ dependent on the depth of sedation and how does this affect pdr ? recently the pdr response to light has been shown to reduce with increased levels of sedation , and this needs to be explored in response to tetanic stimuli as well . furthermore , pupil size oscillates naturally ( pupillary hippus ) in the awake state . this is due to the spontaneous fluctuation between the tone and activity of the sympathetic and parasympathetic nervous systems . whether different depths of sedation make a similar contribution to pupil size and affect pdr remains elusive . finally , the influence of different sedative pharmacological agents on the pdr response requires further investigation . the use of pdr to predict additional analgesic requirements for endotracheal suctioning , in deeply sedated patients , shows promise . the use of a non - invasive , innoculus stimulus in conjunction with pdr potentially provides an objective measure to guide pre - emptive analgesia . however , to make pdr a truly useful clinical tool , further research needs to address some of the questions raised above . cb is funded by the higher educational funding council for england and chelsea and westminster hospital nhs foundation trust .

the pupillary dilatation reflex may present an objective method of predicting whether sedated patients require additional analgesia for painful procedures . behavioural pain assessment tools identify pain only once it has occurred and are unable to guide pre - emptive management . the pupillary dilatation reflex response to a tetanic stimulus has been utilised to assess analgesic requirements in patients under anaesthesia and for those with postoperative pain . this tool appears promising to assess pain in the critically ill ; however , a number of questions remain unanswered regarding the influence of sedation on this response . these questions require further exploration before the pupillary dilatation reflex can be widely adopted into clinical practice .

in order to gain insight into the perspective of a dialysis patient s carer , it is important to listen to and talk to carers . this is not as easy as it seems , since carers often feel that they can not talk freely about the burden of caring since they believe that they have nothing to complain about when compared to the suffering and loss experienced by the renal patient for whom they care . however , as health care professionals , it is important that we give carers the time , space and permission to talk about how caring impacts on their lives and the sacrifices and joys it can bring . so , the emphasis in this description is on carer awareness , highlighting for you the importance and value in supporting carers in their role . carer is not a label many people feel comfortable with , and they see themselves as primarily a husband , wife , mother , father , daughter or friend rather than a carers uk website offers the following definition:carers provide unpaid care and support to ill , frail or disabled friends or family members carers provide unpaid care and support to ill , frail or disabled friends or family members more than three in five people will become a carer at some stage in their life and every year 2 million people become carers . there are > 6 million carers in the uk and a study at leeds university estimated that they save the national health service and social care > 87 billion . the legislation covering carers is detailed and the rights of carers are enshrined in : carers recognition and services act 1995 , carers and disabled children act 2000 and the carers ( equal opportunities ) act 2004 . the work and families act 2006 and the equal opportunities act 2010 also make provisions for carers . the carers recognition act ( 1995 ) formally recognized the role of carers and entitled carers to ask for an assessment of their own needs . the carers and disabled children act ( 2000 ) extended this right to be a freestanding right and enabled local authorities to provide services for and make direct payments to carers . the duty of a local authority to inform carers of their rights is detailed in the carers ( equal opportunities ) act 2004 and includes the requirement to include carer s employment , education , training and leisure during an assessment . the work and families act 2006 grants the right for carers to request flexible working and the equalities act 2010 ensures that carers are not discriminated against in the workplace and are permitted time off to fulfil their caring responsibilities . in summary , carers have significant rights enshrined in law and a carer s assessment from a local authority can be helpful for a carer . this assessment considers how caring impacts on the carer physically , emotionally , financially and examines ways to support and sustain the carer . the benefits system is complex and details of the benefits available for carers are beyond the scope of this paper . however , it is important to emphasize that carers benefits are linked to those of the person they care for , who has to have been awarded attendance allowance if > 65 years of age or disability living allowance if < 65 years of age . renal patients performing haemodialysis at home qualify for medium rate care disability living allowance or low rate attendance allowance . patients performing peritoneal dialysis at home may also qualify but only if they require some assistance with the treatment . carers allowance is payable to carers > 16 years of age , who care for > 35 h , and do not earn > 100 per week or are in education for > 21 h per week . it is payable at the weekly rate of 53.90 and can not be paid with another benefit such as retirement pension but can help increase eligibility for means tested benefits . this leaflet was the outcome of work undertaken in york by the renal social worker and carers as part of a department of health action learning set looking at the year before dialysis. we produced a six - page leaflet covering topics such as carers ' rights , diet , medication , exercise , benefits , employment and who s who in the renal team , with telephone numbers . my final message is for renal teams to think carers and to ensure that they are put in touch with the local renal social worker . a renal social worker can help your team work with the financial and psychosocial aspects of living with kidney disease for both patients and their families and in particular highlight the important and often ignored issues for carers .

carers provide unpaid care and support to ill , frail or disabled friends or family members . it is important for health professionals to give carers of home dialysis patients time , space and permission to talk about how caring impacts upon their lives and to look at how best to support them .

upper respiratory tract infections ( urtis ) are illnesses caused by an acute infection of the upper respiratory tract ( ie , the nose , sinuses , pharynx , or larynx ) . acute urtis include the common cold , acute sinusitis , acute pharyngitis , acute laryngotracheobronchitis ( croup ) , acute epiglottitis ( supraglottitis ) , acute rhino sinusitis and acute otitis media . acute urtis are a major cause of morbidity , especially in children and the elderly . common symptoms include cough , fever , headache , sore throat , runny nose , and sneezing . usually , the symptoms subside after a few days . to reduce fever and ease pain and headaches , paracetamol ( acetaminophen ) , ibuprofen , or aspirin how ever , misuse of antibiotics in acute urtis caused by viruses is common and may contribute to overuse of antibiotics and risk for development of antibiotic - resistant bacteria . probiotics are live microorganisms that might lead to health benefits when administered in adequate amounts . they are commonly consumed in fermented foods , such as yogurt and soy yogurt , or as dietary supplements . the underlying mechanisms of how probiotics may improve health are unclear , but improved local immunity ( by maintaining gut wall integrity ) and systemic immunity ( by enhancing nonspecific and specific arms of the immune system ) are possible explanations . this review was carried out to assess the effectiveness and safety of probiotics ( any specified strain or dose ) compared with placebo in the prevention of acute urti in people at risk of acute urti . not all research provides the same quality of evidence . the higher the quality , the more certain we are about what the research says about an effect . the words will ( high - quality evidence ) , probably ( moderate - quality evidence ) , and may ( low - quality evidence ) describe how certain we are about the effect ( table ) . summary of findings : probiotics compared to placebo for preventing acute upper respiratory tract infections patient or population : children and adults of all ages settings : day - care centers , hospital , or unclear intervention : probiotics the corresponding risk ( and its 95% confidence interval ) is based on the assumed risk in the comparison group ( ie , the median control group risk across studies ) and the relative effect of the intervention ( and its 95% ci ) . abbreviations : ci , confidence interval ; or , odds ratio ; rr , risk ratio ; urti , upper respiratory tract infection . grade working group grades of evidence high quality : further research is very unlikely to change our confidence in the estimate of effect . moderate quality : further research is likely to have an important impact on our confidence in the estimate of effect and may change the estimate . low quality : further research is very likely to have an important impact on our confidence in the estimate of effect and is likely to change the estimate . very low quality : we are very uncertain about the estimate . the included studies had heterogeneous populations ( ie , infants , children , marathon runners , and healthy volunteers ) . all participants in all 3 studies were children , which limits the generalizability of findings to adults . high statistical heterogeneity ( ie , i - square = 92% ) and high clinical heterogeneity ( ie , 1 of the 2 studies includes only marathon runners , and the other study includes the general population ) . the study with marathon runners is in favor of placebo ( although nonsignificant results ) ( md 1.60 ; 95% ci 0.34 to 3.54 ) and the study with the general population is in favor of probiotics ( md 1.90 ; 95% ci 2.04 to 1.76 ) . very wide confidence interval . unclear risk of bias in the smaller of the 2 studies ; however , the larger of the 2 studies had a low risk of bias the 10 studies that the cochrane authors reviewed showed that for people at risk of acute urti , compared with a placebo , probiotics may reduce the number of participants who experienced urti episodes ( at least 1 event ) , have an uncertain effect on the mean duration of an episode of urti because the quality of evidence is very low , may reduce the number of participants who used antibiotics , and may make little or no difference to adverse events . none of the studies measured the effect of probiotics on older people . in general , side effects are poorly documented and it is difficult to provide precise information . in these studies , the main side effects were gastrointestinal symptoms such as vomiting , flatulence , and increased irritability . however , pooled analysis showed no statistical difference between the probiotics group and the placebo group ( low - quality evidence ) . the cochrane collaboration is an independent global network of volunteers dedicated to summarizing research about healthcare . this information is taken from this cochrane review : hao q , lu z , dong br , huang cq , wu t. probiotics for preventing acute upper respiratory tract infections .

as part of its efforts to disseminate the results of cochrane reviews to a wider audience , the cochrane complementary and alternative medicine ( cam ) field develops summary of findings ( sof ) tables and then uses those tables as a basis for its plain - language summaries . each sof table presents the most important outcomes for the review as well as the effect of the intervention and the quality of the evidence for each outcome . the process of developing the sof table involves deciding which outcomes to present for which time points and evaluating the strength and quality of the evidence for the outcomes.in this article , we present a cochrane review about the effects of the use of probiotics for preventing acute upper respiratory tract infections . we contacted the authors of the cochrane review to request clarification on points that we did not understand and to have them review the sof table .

a first experiment which was fundamental , described in 1973 , discusses the immune response to various antigens of an asterid : asterina gibbosa . it indicated ( leclerc , 1973 ) , more exactly , the specific immunocytochemical response to hrp ( horse - radish peroxydase ) of the sea star . the general idea that emerged from the experiments made in our laboratories was that echinodermata ( leclerc and brillouet , 1981 , delmotte et al . , 1986 , leclerc , 2012 ) , as exemplified by sea stars ( asterina gibbosa and asterias rubens ) , possessed an immune system able to mount cellular and humoral - specific responses after stimulation with a foreign antigen . in 2011 sea star antibody was shown to correlate to ig kappa genes ( leclerc et al . , 2011 ) and in 2013 a true candidate ig kappa gene was found ( leclerc et al . , 2013 ) . we report the sequence and deduced amino - acid composition of the sea star ig kappa gene . we used the experimental protocol concerning the smart kit pcr cdna synthesis ( clontech ) on the candidate gene cdna sequence ( leclerc et al . , 5cagtcattaaaaggacatgataatttcggaccgggtctttaatattacaatgactgctgctatgcgtggc aacatggcgtctctatggatgttcttctttgtcgtggggataactttacaacggagtttggcgatttaca cgtttcgcgagcaaccgtcggacactagcgcgttgcaggggagcacagtggtgcttcactgctccgttga gcagtacataaacaccacggccatcgtttggtggagccgtgactcggtcatcagccacaacaaagacctg aaactgtccagtctaaacaccgaccagctccaaaggtactcgatttcaggcgacgcatctcggggggaat tcaaccttagaatagtgaactttaccgccacagacgccgccagttaccgctgtcagatgtttgcg3 we purified the polya fraction , according a specific kit and generated the c dna with an oligodt . a non - specific amplification was performed and followed by a specific one with an oligo 956 forward ( 53 ) 5-cagattcagaaacacatgtatttcc-3 and then an oligo 957 reverse ( 53 ) 5-tttagcatggcatgtaaagacacc-3 , always requested for this experiment ( clontech ) . the pcr products showed , in agarose gel , many bands for the negative control , and one band ( 400 bp ) for the specific pcr . the results show that the revealed gene , after sequencing , shows only little gene described in the previous paper ( leclerc et al . , 2013 ) it is enough to decipher this gene to realize it ; here is the sequence as shown in fig . 1 . based on sander 's review ( sander and schneider , 1991 ) , we propose that this gene relates to immunoglobulins as it contains 2 typical cysteines of the domains of ig , without being able to assert , at the moment , if it is about a heavy or light chain of immunoglobulins . a single indication ( delmotte et al . , 1986 ) favors the light chain due to the observed molecular weight ( 30,000 da : delmotte et al . another antigen such as hapten ( leclerc and brillouet , 1981 ) could produce another type of antibody currently , we do n't know , at the moment , if there are several types of antibody in the sea star a. rubens . what we are sure , on the other hand ( because there is a gene ( the sea star ig kappa ) ) , the function of which is the one of the defenses of the sea star against the immunopathogenicity attacks ; the hrp , in the present case . in terms of amino - acid , our gene could present 118 amino - acids as shown in fig . this is slightly smaller than the true ig kappa region v - iv s107b which is reported to be 129 amino - acids found in mammals . in conclusion , this antibody gene of sea star calls back the mouse ig kappa region v - iv s107b precursor gene but is different from it by the number of amino - acids ( 118 instead of 129 aa ) . our data contributes to knowledge the molecular and genetic bases of non - self recognition by invertebrates which will allow further comprehension of the evolution of mhc antigens and immunoglobulins .

the sea star asterias rubens reacts specifically to the antigen : hrp ( horse - radish peroxydase ) and produces an antibody anti - hrp . we previously identified a candidate ig kappa gene corresponding to this manuscript . we show now the gene referred to as : sea star ig kappa gene in its specificity .

lymphocyte apoptosis has been increasingly recognized as an important step in the pathogenesis of sepsis , by inducing a state of ' immune paralysis ' that renders the host vulnerable to invading pathogens . sepsis is an important clinical problem , affecting more than 700,000 people each year in the united states alone , of whom 20% to 30% die . this paradigm led to the development of agents aimed at blocking key mediators of inflammation , such as bacterial lipopolysaccharide , interleukin-1 , and/or tumor necrosis factor- among others . however , when many of these agents were tested in large phase iii randomized controlled trials they failed to demonstrate a beneficial effect [ 4 - 6 ] . thus , therapeutic strategies aimed at suppressing inflammation in sepsis have been disappointing . over the past decade , studies in experimental models and in patients suggested that the immune response of sepsis follows a biphasic pattern , with an initial ' hyperinflammatatory ' phase characterized by high levels of pro - inflammatory cytokines , and a second phase characterized by decreased responsiveness of immune cells to inflammatory stimuli the ' immunoparalysis ' phase . the immunoparalysis phase is an extremely vulnerable period when patients are at particular risk from invading bacteria . the mechanism for this immune paralysis appears to involve apoptosis of immune cells , in particular lymphocytes . in a seminal study , wang et al . found that the intra - peritoneal injection of gram - negative bacteria to mice was followed by apoptosis of cd4+cd8 + lymphocytes in the thymus . hotchkiss et al . used a murine model of cecal ligation and puncture to show that lymphocyte apoptosis also involves lymphocytes from the spleen and most other vital organ systems , and later demonstrated that extensive lymphocyte apoptosis is also present in humans with sepsis . studies using loss - of - function approaches suggested that the mechanisms of lymphocyte apoptosis in sepsis involve both the receptor - mediated and the mitochondrial pathways of apoptosis , with the later playing the predominant role ( reviewed in ) . now extend these laboratory observations to the bedside , by demonstrating accelerated apoptosis in circulating lymphocytes ( cd4 , cd8 and cd19 ) from patients with severe sepsis , but not in non - septic , critically ill patients . this study is important because it confirms a pattern of activation of bcl-2 family members predicted by animal studies , and sets the basis for further studies aimed at modulating lymphocyte apoptosis in sepsis . one particularly interesting finding in weber and colleagues ' study is that the pro - apoptotic molecule bim was markedly upregulated in the lymphocytes of patients with severe sepsis . this is important because , of the different components of the apoptosis cascade that have been tested in animal models ( fadd , bid , bcl2 , caspases ) , only deletion of bim is associated with complete protection from apoptosis . however , it is important to note that blockade of lymphocyte apoptosis is not always protective in sepsis . for example , septic mice lacking myd88 have decreased lymphocyte apoptosis but a significant increase in mortality . myd88 is an important proximal component of the main pathogen recognition pathways , suggesting that inhibition of lymphocyte apoptosis is protective only when the ability of the host to identify and respond to pathogens is preserved . patients were enrolled 4 hours after presentation , which may have been too early in the hospital course to catch the period of maximal apoptosis . also , information on the effects of severe sepsis on the receptor - mediated pathway of apoptosis , particularly fadd and caspase 8 , would have been interesting . in summary , the study by weber and colleagues reaffirms and advances our knowledge of specific pathways involved in lymphocyte apoptosis in patients suffering from severe sepsis , raising hopes for potential therapeutic targets that improve mortality in this patient population .

sepsis is an important clinical problem with a mortality rate of 20% to 30% . lymphocyte apoptosis has been recognized as an important step in the pathogenesis of experimental sepsis , by inducing a state of ' immune paralysis ' that renders the host vulnerable to invading pathogens . the importance of lymphocyte apoptosis in human disease is now confirmed by weber and colleagues , who demonstrate extensive apoptosis in circulating lymphocytes from patients with severe sepsis . weber and colleagues ' data set the basis for further studies aimed at modulating lymphocyte apoptosis in sepsis .

3 full factorial design was used for the optimization . the levels for the selected independent variables y = b0 + b1x1 + b2x2 + b12x1x2 + b11x12 + b22 x22 on the basis of the preliminary trials a 3 full factorial design was employed to study the effect of independent variables i.e. drug - to - polymer - to - polymer ( x1 ) and the stirring speed ( x2 ) on dependent variables like particle size , drug entrapment efficiency , the time required for 50% drug release ( t50 ) and drug released up to 5 hr ( y5 ) and 12 hr ( y12 ) . the expected in vitro release pattern selected for the colonic delivery was not more than 10% of the drug release up to the end of small intestine ( 5 hr ) and more than 85% of drug release up to 12 hrs . in factorial design batches microspheres thus obtained were recovered from the medium and dried subsequently and stored properly for the further studies . the concentration of cross linking agent and stirring speed were varied in batches c1 to c9 . potential variables such as concentration of chitosan solution , polymers to drug ratio ( 2:1 ) and amount of dispersion medium ( 500 ml ) were kept constant . in vitro drug release studies in simulated gastro intestinal fluids showed a burst release pattern in the initial hour necessitating microencapsulation with eudragit s100 by solvent evaporation technique . the effect of different coat / core ratio on particle size , drug entrapment efficiency and in vitro drug release were studied . the microspheres of all the batches of the factorial design were spherical and free flowing . the average particle size of different chitosan microsphere formulations was found to be in the range of 9.93 m- 18.48 m and showed good correlation co - efficient ( 0.9932 ) . results indicate that the effect of x1 ( stirring speed ) is more significant than x2 ( amount of cross linking agent ) . when higher level of glutaraldehyde was used cross linking favoured and hence slower drug release was observed compared to the other batches . the entrapment efficiency of different formulations was found to be between 66.65 to 92.07% and showed good correlation co - efficient ( 0.9293 ) . the effect of stirring speed on entrapment efficiency showed that optimum speed should be 1000 rpm . in vitro dissolution of all the batches indicates that the burst release pattern in the initial hour . within 5 hr 70 to 90% of drug cumulative in vitro drug release of carvedilol from formulations c1 to c9 thus , only biodegradable polymers were not satisfactory for colonic delivery . the burst release may be due to solubility of chitosan in the acidic ph . in order to prevent the drug release in stomach and small intestine these chitosan microspheres were encapsulated with eudragit s100 , which shows solubility at a ph 7 . since formulation c4 showed high drug loading and drug release pattern , it is selected for microencapsulation process . chitosan microspheres ( c4 ) were microencapsulated with eudragit s100 to achieve colonic delivery of carvedilol . the effect of core - coat ratio on eudragit s100 microencapsulated chitosan microspheres was studied and found that the particle size was increased from 137.87 to 154.33 m with increasing the core - coat ratio from 1:8 to 1:12 . the entrapment efficiency of microencapsulated formulations varied between 90 - 95% with increasing core - coat ratio . the in vitro drug release studies of various eudragit coated chitosan microspheres were performed in simulated gastro intestinal fluids . results showed that 8 - 12% of drug was released within initial 4 hrs and increased thereafter when the formulations were exposed to ph which is above solubility of eudragit s100 . the best formulation then subjected to in vitro drug release in presence of rat ceacal contents . a result of release studies indicates that eudragit s100 coating offers a high degree of protection from premature drug release in the stomach and small intestine . eudragit coated chitosan microspheres deliver most of the drug load in the colon , an environment rich in bacterial enzyme that degrade the chitosan and allow drug release to occur at the desired site after proper transit time . thus , the designed formulation is potential systems as multiparticulate for the chronotherapy of hypertension .

the purpose of this research was to design , and evaluate multiparticulate systems for chronotherapeutic delivery of beta blocker containing biodegradable polymers coated with ph sensitive polymers in hypertension . chitosan was used as a carrier for drug delivery and eudragit s100 was used as an enteric coating polymer . 32 full factorial design was employed to optimize the proper formulation for chronotherapeutic drug delivery .

in this issue of critical care , thiel and colleagues present a new method for tracking the changes in cardiac output in response to passive leg raising ( plr ) , one of the tests recently proposed to predict volume responsiveness in critically ill patients . recent review articles have emphasised the relevance of using dynamic indices such as pulse pressure variation and stroke volume variation for that purpose [ 3 - 5 ] . nevertheless , the respiratory variation of stroke volume can not be used in cases of spontaneous breathing or low tidal volume ventilation . in such problematic cases , plr , by acting as an endogenous volume challenge , represents a helpful tool for predicting fluid responsiveness . compared with the classical fluid challenge , it has the advantage of being rapidly and totally reversible . the potential risks of fluid infusion are thus expected to be minimised , which is important to consider in critically ill patients in whom multiple challenges are often necessary . confirming previous reports , thiel and colleagues have shown that plr is a reliable test for predicting volume responsiveness in mechanically ventilated patients , even in those with spontaneous breathing activity . for tracking the changes in cardiac output during the postural manoeuvre , they used a transcutaneous continuous - wave doppler ultrasound device able to measure blood flow across the aortic or the pulmonary valve . this totally non - invasive method is assumed to be less user - dependent than the classical doppler echocardiography . unlike the oesophageal doppler technique , this device can be applied in non - intubated patients . as predicting volume responsiveness using such a simple method is very attractive , further confirmation studies are necessary . another interesting finding of the study by thiel and colleagues was the high rate ( 54% ) of patients who did not respond to fluid administration , confirming recent reports . this issue must be discussed in line with the recent evolution of ideas and policies in terms of fluid administration in critically ill patients . the concept of increasing cardiac output to correct an occult oxygen debt in critically ill patients was developed during the ' 90s . although it did not lead to improved outcome of intensive care unit ( icu ) patients enrolled in randomised studies , this concept promoted the idea that critically ill patients are often under - resuscitated , even in the absence of hypotension or of any sign of blood volume deficit . the study by rivers and colleagues emphasised the importance of increasing cardiac output by using aggressive fluid administration in the early phase of severe sepsis . this concept has been well adopted by pre - hospital , emergency care and critical care physicians as witnessed by the fact that more than 50% of icu patients are volume - unresponsive in recent studies . however , volume unresponsiveness is an abnormal state since it indicates that the patient 's heart operates on the flat part of the frank - starling curve , as does a failing heart . in this condition , further fluid administration should dramatically increase cardiac filling pressures with inherent high risks of pulmonary oedema development , in particular in cases of altered pulmonary vascular permeability . in this regard , there is now increasing evidence that fluid overload negatively impacts the outcome of critically ill patients . we can schematically distinguish between two opposite situations that are frequently encountered in the icu . the first one is represented by the management of patients in the early phase of sepsis . the surviving sepsis campaign recommends that fluid be administered until the central venous pressure ( cvp ) reaches 8 to 12 mm hg ( or more in mechanically ventilated patients ) provided that the central venous oxygen saturation is less than 70% . as the cvp can not identify volume - unresponsive patients , such an attitude could result in fluid overload of most of those patients . a test capable of reliably detecting volume unresponsiveness at any moment of fluid resuscitation would help to better assess the benefit / risk ratio of continuing such a strategy . the second situation is represented by the management of patients with lung injury after the early stage has passed . however , an uncontrolled fluid restriction attitude ( diuretics or ultrafiltration ) could result in marked volume depletion and subsequent organ hypoperfusion . a test capable of reliably detecting when the degree of volume responsiveness at any moment of fluid restriction is too high would help to assess the benefit / risk ratio of continuing such a strategy . fortunately , the tests developed to detect volume responsiveness can also serve to detect volume unresponsiveness . among different tests , plr is probably one of the most valuable since it can be used in icu patients with spontaneous breathing activity . cvp : central venous pressure ; icu : intensive care unit ; plr : passive leg raising . j - lt and xm are members of the medical advisory board of pulsion medical systems ag ( munich , germany ) .

policies of fluid administration / restriction in critically ill patients have evolved over recent years . abundant fluid resuscitation is encouraged during the early stage of severe sepsis . but a conservative fluid strategy is recommended in later stages , in particular when lungs are injured . both strategies are risky if uncontrolled . tests detecting volume unresponsiveness at any moment of fluid resuscitation or detecting volume unresponsiveness at any moment of fluid restriction would help to better assess the benefit / risk ratio of continuing such strategies . measuring the short - term hemodynamic changes during passive leg raising can be reliably used for that purpose in both situations , even when patients are breathing spontaneously .

bubble hair is an acquired hair shaft deformity characterized by bubble - like areas in the hair shaft seen with light microscopy and corresponding cavitary defects with scanning electron microscopy . it occurs due to thermal injury caused to the hair by hair dryers , heating tongs or hot curls . hair appears dry , wiry , with patchy loss of hair due to excessive fragility . it may be associated with other acquired hair shaft defects such as trichorrhexis nodosa and trichoptilosis . a 22-year - old female patient reported to us with complaints of dry hair with excessive fragility of two - week duration . there was history of using hot iron on wet hair to straighten the hair twice over the past one month . clinical examination of scalp hair showed dry brittle hair which was broken unevenly [ figures 1 and 2 ] . eyebrows and body hair was normal . hair was not easily pluckable but was brittle . uneven broken , dry - looking hair uneven broken , dry - looking hair light microscopic examination of the hair showed spaces within the hair shaft [ figure 3 ] . few hairs showed node - like formation with fraying ( trichorrhexis nodosa ) and there was distal splitting of hair ( trichoptilosis ) [ figures 4 and 5 ] . these changes were noted in other hair samples and not the one which showed bubbles . as the name suggests , bubble hair is full of bubbles much like a sponge . the use of hair curling tongs operating at 125c and applied to the hair for one minute can also induce bubbles in hair fiber . this vaporization of the water may force the spaces in the hair to expand , eventually turning the hair into a sponge - like structure . these damaged hairs are weak and brittle as the bubbles destroy the integrity of the fiber . chemical treatment may also precipitate the onset of bubble hair and any already weak hair , whatever the cause , may be more susceptible to bubble development . electron microscopic studies of previously reported cases revealed a loss of cortical cells and medulla at these sites . , dermatoscopy can be used to highlight hair that warranted closer examination under light microscopy . clinically , hair appears to be kinked , break off , and over time , the condition may develop into a localized alopecia . come out in clumps , and the overall texture of the hair changing from soft and naturally curly to straight and stiff has been reported . it can be prevented and treated by avoidance of using excessive heat and chemicals on the hair and by cutting off the old damaged hair . our case presented with a classical history of use of hot irons to straighten hair followed by hair changes . along with bubble hair , other shaft abnormalities like trichoptilosis and trichorrhexis nodosa were also noted . there are a few reports of bubble hair in literature.[247 ] though it is a common condition , it is rarely diagnosed and reported . light microscopic examination is sufficient to make a diagnosis and counseling the patient will prevent repeated injury to hair shaft .

bubble hair is an acquired hair shaft abnormality characterized by multiple airfilled spaces within the hair shaft . it is a result of thermal injury . we report a classic case of 22-year - old female who complained of dry brittle hair of two - week duration . patient had used hot iron on wet hair twice to straighten hair . hair microscopy was diagnostic and showed multiple air - filled spaces within the hair shaft .

es cell lines including the g9a knockout were cultured based on the standard protocol of the es core laboratory at johns hopkins university ( see full methods for details ) . we differentiated es cells for 1824 days by removing leukemia inhibitory factor ( lif , chemicon ) from the medium and culturing in plates without feeder cells . chromatin was isolated without sonication or formalin cross linking , by digested with micrococcal nuclease ( mnase , ge healthcare , piscataway , nj ) , and then chromatin immunoprecipitation was performed with an antibody specific to h3k9me2 ( abcam , cambridge , ma ) . chip and input dna were amplified , labeled by cy5 and cy3 respectively , and hybridized to nimblegen tilling arrays as described4 . we first conducted within - array normalization to correct the probe sequence effects and position bias . locks are defined as the genomic regions where smoothed values are above 97.5th quantile of log ratios in reference regions ( see full methods for details ) . the pdf files containing all the pictures of locks can be obtained through our website : http://rafalab.jhsph.edu / k9locks/. es cell lines including the g9a knockout were cultured based on the standard protocol of the es core laboratory at johns hopkins university ( see full methods for details ) . we differentiated es cells for 1824 days by removing leukemia inhibitory factor ( lif , chemicon ) from the medium and culturing in plates without feeder cells . chromatin was isolated without sonication or formalin cross linking , by digested with micrococcal nuclease ( mnase , ge healthcare , piscataway , nj ) , and then chromatin immunoprecipitation was performed with an antibody specific to h3k9me2 ( abcam , cambridge , ma ) . chip and input dna were amplified , labeled by cy5 and cy3 respectively , and hybridized to nimblegen tilling arrays as described4 . we first conducted within - array normalization to correct the probe sequence effects and position bias . locks are defined as the genomic regions where smoothed values are above 97.5th quantile of log ratios in reference regions ( see full methods for details ) . the pdf files containing all the pictures of locks can be obtained through our website : http://rafalab.jhsph.edu / k9locks/.

higher eukaryotes must adapt a totipotent genome to specialized cell types with a stable but limited repertoire of functions . one potential mechanism for lineage restriction is changes in chromatin , and differentiation - related chromatin changes have been observed for individual genes12 . we have taken a genome - wide view of histone h3 lysine-9 dimethylation ( h3k9me2 ) . we find that differentiated tissues exhibit surprisingly large k9-modified regions ( up to 4.9 mb ) , that are highly conserved between human and mouse , and differentiation - specific , covering only ~4% of the genome in undifferentiated mouse embryonic stem ( es ) cells , compared to 31% in differentiated es cells , ~46% in liver and ~10% in brain . they require histone methyltransferase g9a , and are inversely related to expression of genes within them , and we term them large organized chromatin k9-modifications ( locks ) . locks are substantially lost in cancer cell lines , and they may provide a cell type - heritable mechanism for phenotypic plasticity in development and disease .

although a richly vascularized organ with important circulatory communications , the penis is seldom the site of metastases . since eberth first reported it in 1870 there have been approximately 300 cases in the english language literature . the primary tumour sites are principally the genitourinary organs , mainly the bladder and prostate gland . only in 15.7% metastatic disease isolated to the penis and amenable to potentially curative treatment is very uncommon [ 13 ] . this is the first case of isolated penile metastasis following abdominoperineal resection ( aper ) with perineal vertical rectus abdominis myocutaneous ( vram ) flap reconstruction . a 58-year - old gentleman presented with diarrhoea . digital rectal examination revealed a low anterior rectal tumour , 3 cm from the anal verge . due to his frequency he underwent laparoscopic defunctioning colostomy prior to neoadjuvant long course chemoradiation in the aristotle trial . restaging showed a modest response to treatment with the crm still predicted positive ( figs 1 and 2 ) . at 9 weeks post radiotherapy he underwent an open difficult aper t2 waited axial image through lower pelvis through the large polypoid rectal tumour with t3 extension involving the crm . t2 axial image through pelvis demonstrating limited response to chemoradiotherapy with tumoral margins still predicted positive . mri pelvis . t2 waited axial image through lower pelvis through the large polypoid rectal tumour with t3 extension involving the crm . t2 axial image through pelvis demonstrating limited response to chemoradiotherapy with tumoral margins still predicted positive . at 18 months post - surgery he presented with an otherwise asymptomatic mass on the lateral aspect of his penile shaft . restaging with ct and mri confirmed an isolated 2.7 cm 6.2 cm lesion in the midshaft involving the corpora cavernosum with extension into the corpus spongiosum . histopathology confirmed metastatic rectal adenocarcinoma with clear resection margins though extensive lympho - vascular and perineural involvement . currently , the patient is clinically doing well , with a reasonable quality of life with his urethrostomy and under close clinical follow up . figure 3:mri pelvis large field t2 sagittal image through penile shaft showing the lesion involving the corpora cavernosum with extension in the spongiosum . mri pelvis large field t2 sagittal image through penile shaft showing the lesion involving the corpora cavernosum with extension in the spongiosum . it is still a controversial subject the reason why the penis , despite its vascularization is a rare site for metastasis . it has been postulated that the route of metastasis include retrograde venous or lymphatic spread , local direct extension , arterial embolism or instrumental spread [ 1 , 2 , 4 ] . currently the most accepted theory is the mechanism that involves retrograde venous spread from pudendal to the dorsal venous system of the penis [ 2 , 4 ] . the most common type of presentation is malignant priapism followed by urinary retention , penile nodules , ulceration , perineal pain , oedema , infiltrative enlargement , dysuria and haematuria , with the corpora cavernosa being the most common site of metastasis and the glans and corpus spongiosum infrequently involved . our case respected the above mentioned cavernosal involvement but also had mild extension into the corpus spongiosum , more to the fact that this isolated metastatic penile neoplasm is extremely rare . management of penile metastasis is mainly palliative as this is a sign of poor prognosis and tends to be part of widely disseminated disease . treatment plan is influenced by the size of the primary , extent of the metastatic spread , performance status of patient and also prognostic characteristics of the primary tumour [ 2 , 5 ] . treatment modalities include the combination of radiotherapy with chemotherapy , local excision and penectomy [ 2 , 4 ] . in isolated disease , as described in this case , penectomy may offer the possibility of cure although such cases are very rare . in conclusion , this is a case report of penile metastasis following rectal adenocarcinoma , being the first one described in a patient that had aper with vram flap reconstruction . this report highlights the rarity of the penis as site of metastasis and marker of disseminated disease , however this is not the case in our report and albeit rare , cure can be achieved in isolated cases .

penile metastases are rare in colorectal cancer . we report the first case of such a recurrence in a patient who had undergone an extralevator abdominoperineal resection with vertical rectus abdominis myocutaneous flap perineal reconstruction . the patient was treated with curative intent by total penectomy .

mutations and substitutions are fundamental changes in nucleotide sequence over evolutionary time ( 1 ) . among the well - established methods for studying the evolution of protein - coding genes , the ratio of non - synonymous substitution rate ( ka , amino acid replacing ) to synonymous substitution rate ( ks , silent ) is the most powerful measure of selective pressure on a protein ( 28 ) . since non - synonymous and synonymous substitution sites are interspersed within a gene segment , this approach literally compares the amino acid replacement rate against the silent substitution rate . traditionally , if ka / ks < 1 , the gene is inferred to be under negative ( purifying ) selection ; if ka / ks = 1 , the gene is probably neutrally evolving ; if ka / ks > 1 , the gene is probably under positive ( adaptive ) selection , since mutations in the gene have higher probabilities of being fixed in the population than expected from the predictions of neutrality . however , this approach , in effect , averages substitution rates over all amino acid sites in the sequence . because most amino acids are expected to be under purifying selection , with positive selection most likely affecting only a few sites , this approach often loses the power to detect positive selection . to increase its sensitivity , a sliding window analysis along the primary sequence was introduced ( 9,10 ) . recent studies further indicate that when a three - dimensional ( 3d ) protein structure is available , one can detect positive selection much more sensitively by using windows in 3d space instead ( 1113 ) . for example , hughes and nei ( 14 ) detected positive selection at the antigen recognition sites ( ars ) in major histocompatibility complex ( mhc ) alleles but not the whole gene . we developed a bioinformatic web server ( swakk ) whose primary purpose is to detect regions under positive selection using a sliding window ka / ks analysis ( figure 1 ) . with the input of two protein - coding dna sequences , one reference protein 3d structure and other user - defined parameters , the web server will automatically align the sequences , calculate ka / ks in each 3d window , and display the results on the 3d structure . the server also can perform the analysis on the primary sequence , either for comparison or when a structure is unavailable . in addition , if two inferred ancestral gene sequences are used as an input , the server can examine natural selection in an ancestral branch of a phylogenetic tree ( 15 ) . we note that two important features distinguish our swakk server from other available web servers ( 1618 ) that can identify functionally important sites in proteins . the first difference is that these other web servers focus on each single amino acid site or codon in the multiple sequence alignment , which essentially averages the overall time interval . instead , our server considers a group of codons within a small window for each pairwise comparison . second , unlike other web servers where protein 3d structures are only used to display the results , our swakk server takes full advantage of the information intrinsically stored in a 3d structure to define neighboring codon groups . without requiring an explicit evolutionary model or expensive computation , swakk thus provides a useful tool to complement the existing arsenal of methods for detecting positive selection . swakk accepts input as a pair of coding dna sequences and a reference protein structure ( pdb file ) . the dna sequences are translated into amino acids and aligned with the amino acid sequence parsed from the pdb file using clustalw ( 19 ) . swakk constructs 3d windows by placing each amino acid at the center and including all amino acids within a pre - specified distance ( in ngstrms ) from the center . all the corresponding codons within a window are extracted to form a sub - alignment , and the ka / ks score ( also the standard error ) is calculated using the paml package ( 20 ) . finally , according to the ka / ks scores and a user - defined cut - off , the sites ( regions ) can be classified as positive , negative or neutral , and these are displayed in different colors on the 3d structure using the chime plug - in component . if a reference structure is not available , the server can also perform the analysis on the primary sequence . in this situation , the window size is defined as the distance in 1d sequence rather than in 3d space , and the results are displayed in the graph drawn by the gnuplot software . with more and more protein structures available , we expect this web server to become a valuable bioinformatic tool for detecting functionally important sites . the server facilitates the identification of regions of a protein sequence or structure that may be under positive selection and is easily accessible to the broad biological community . the upper part is a snapshot of the 3d analyzer web page . on the bottom are sample output files : left , 3d provided by the 3d analyzer ( when the structure is available ) , with amino acids colored based on inferred level of selection . right , 2d graph ( [ ka ks ] versus window location ) provided by the 1d analyzer . the example shown is the mhc glycoprotein gene ( 14,21 ) and , consistent with the previous studies , most of the sites identified under positive selection are clustered in the ars domain .

we present a bioinformatic web server ( swakk ) for detecting amino acid sites or regions of a protein under positive selection . it estimates the ratio of non - synonymous to synonymous substitution rates ( ka / ks ) between a pair of protein - coding dna sequences , by sliding a 3d window , or sphere , across one reference structure . the program displays the results on the 3d protein structure . in addition , for comparison or when a reference structure is unavailable , the server can also perform a sliding window analysis on the primary sequence . the swakk web server is available at .

malakoplakia is an uncommon but distinctive type of chronic granulomatous inflammation that is characterized histologically by the presence of sheets of histiocytes with granular cytoplasm ( von hansemann cells ) admixed with intracellular and extracellular basophilic laminated inclusions ( michaelis - gutmann bodies ) . the present case , however , is the first case of epididymal malacoplakia without concurrent involvement of the testis . although the exact etiology of malakoplakia remains poorly understood , it is commonly associated with microbial infections and states of diminished immune response . here we report an unusual case of malakoplakia that involved the epididymis in a 61-year - old man with a scrotal mass . a 61-year - old man presented with a painful mass of his left epididymis for several months . ultrasonography of the left epididymis revealed a mass lesion of mixed echotexture in the epididymal tail ( fig . histopathology showed an epididymal mass comprising sheets of histiocytes with granular eosinophilic cytoplasm ( fig . many of the histiocytes contained small round to oval targetoid structures that were morphologically consistent with michaelis - gutmann bodies . the patient 's postoperative recovery was uneventful and the surgical outcome has been satisfactory for 8 months . malakoplakia , derived from the greek adjective malakos ( soft ) and plaka ( plaque ) , was first described in 1902 by michaelis and gutmann and was clearly explained by mcclue in his review . epididymal malakoplakia was first described in 1968 by green , and there have been five reports of this condition in korea . malakoplakia , which typically involves the urinary tract , is an uncommon form of chronic inflammation caused by chronic infections and characterized by accumulation of macrophages . it has also been found in various sites such as the gastrointestinal tract , pancreas , liver , lymph nodes , skin , respiratory tract , adrenal gland , vagina , and brain . malacoplakia is characterized histologically by the presence of michaelis - gutmann bodies contained within von hansemann macrophages . special stains such as periodic acid schiff and von kossa for calcium can be particularly helpful in highlighting the michaelis - gutmann bodies when these are obscured within dense lymphohistiocytic infiltrate . the etiology of malakoplakia has not been fully elucidated . coliform bacteria , particularly e. coli , have been isolated from the involved sites of genitourinary malakoplakia in more than two - thirds of patients . another potential contributing factor to the development of malakoplakia is an impaired immune response . in a review by long and althausen , approximately 40% of malakoplakia cases that did not involve the urinary tract were associated with immunosuppression . the ability of phagocytes to completely digest bacteria is impaired in malakoplakia , which is thought to be related to low levels of intracellular cyclic guanosine monophosphate ( cgmp ) and diminished release of b - glucuronidase . this would explain the successful treatment of a case with the cholinergic agonist bethanechol chloride , which acts by increasing the levels of cgmp . the treatment options for malakoplakia include two main approaches : the administration of antibiotics and surgical excision , depending on the site and extent of involvement . antibiotics that can penetrate the cell membrane and concentrate in macrophages are associated with a high cure rate . treatment with trimethoprim - sulfamethoxazole may be helpful because of the ability of trimethoprim to enhance the killing of viable undigested microorganisms inside malakoplakic macrophages . also , because ciprofloxacin penetrates well into macrophages , this drug has been found to be particularly useful in patients with advanced malakoplakia . in addition to these agents , bethanechol is believed to enhance phagocytic bactericidal activity by increasing cgmp levels . if conservative treatment fails to control and diminish the malakoplakia , which is the most likely situation according to most investigators , surgical resection is needed . close follow - up of these patients is needed because multiple locations can be affected . in our case , considering the involvement of the epididymis in our patient , who had no fever and negative results on urinalysis and urine culture , excision of the epididymal mass was the best option without antibiotic therapy , and this treatment led to a satisfactory outcome .

malacoplakia is a chronic inflammatory disease . the disease mainly affects the urinary bladder , although involvement of extravesical sites is increasingly being documented . most frequently involved is the urinary tract , particularly the urinary bladder , although the testis , epididymis , lungs , bone , colon , prostate , female genital organs , and retroperitoneum can also be involved . here we report the case of a 61-year - old man with a scrotal mass with histology that was specific for malacoplakia of the epididymis . the histologic workup demonstrated extensive involvement of the epididymis by diffuse infiltrates of large histiocytes with eosinophilic granular cytoplasm and numerous michaelis - gutmann bodies , which were diagnostic of malakoplakia . this is the first case of epididymal malacoplakia in our country and the first case of epididymal malacoplakia without concurrent involvement of the testis . there have been few reports of this condition worldwide .

the current standard red blood cell ( rbc ) storage time of up to 42 days is not based upon a demonstrable therapeutic benefit , but instead on the observed return of 70% of the viable transfused rbcs at 24 hours after storage for 42 days or less . the structural , biochemical and immunological changes that rbcs undergo during storage are well described , but what remains controversial is the evidence that this storage lesion translates into adverse clinical outcomes for patients receiving older blood . in a previous issue of critical care , ranucci and colleagues report an adverse outcome in infants receiving older blood during cardiopulmonary bypass ( cpb ) . the effects of storage on rbcs include changes in potassium ( increased levels ) , 2,3-diphosphoglycate ( decreased levels ) , lactate ( increased levels ) , ph ( decreased values ) , glucose ( decreased levels ) , adenosine triphosphate ( decreased levels ) , methaemoglobin ( increased levels ) , red cell structure ( from biconcave disc , to echinocytes and then to spherocytes ) , and therefore red cell deformability . storage effects also include changes to the microenvironment with reduced levels of s - nitrosohaemoglobin and nitric oxide . prolonged storage prior to transfusion also results in an immunomodulatory effect , first described by opelz and colleagues who demonstrated reduced transplant rejection after stored red cell administration . this effect theoretically increases infection risk , by accumulation of proinflammatory lipids and neutrophil priming , resulting in severely reduced neutrophil function . the evidence that prolonged storage of rbcs contributes to demonstrable adverse outcomes remains controversial , however , and is hampered by many small retrospective studies with potential selection bias ; most evidence is also confounded by relatively recent changes in practice such as leucodepletion of rbcs . moreover , there is still no consensus on what constitutes old blood , with studies using variable definitions of 5 , 12 , 14 or 21 days . none of the prospective studies to date have shown a correlation between the age of rbcs and adverse outcome . two new studies in progress should provide further data - the age of blood evaluation study ( canadian clinical care trials group ) in trauma / intensive care patients and the red cell storage age study ( us national heart , lung , and blood institute 's transfusion medicine / hemostasis clinical trials network ) in cardiac surgery patients . marik and sibbald reported in 1993 that older rbcs were associated with a reduced intragastric phi value ( a surrogate for gut ischaemia ) and postulated that impaired deformability of rbcs impeded microvasculature flow . a similar study published in 2004 , however , failed to confirm these findings . offner and colleagues suggested that trauma patients receiving blood stored for > 2 weeks had higher rates of infection and multiorgan failure ; but these patients also received a greater volume of transfusion , were older and had more severe injuries . more recently , zallen and colleagues reported in a cohort of 63 trauma patients that those who received older blood had a higher risk of developing multiorgan failure ; yet again , however , these patients were older and received marginally more rbcs . van der watering and colleagues retrospectively reviewed 2,732 patients undergoing cpb ; univariate analysis , but not multivariate analysis , suggested a correlation between storage time and survival . in 2008 koch and colleagues evaluated an even larger patient group of cardiac surgical cases who received rbcs either 14 days old or > 15 days old . their results indicated excess inhospital mortality associated with older blood , but these patients were also more likely to have received more rbcs . these retrospective studies are now added to by that of ranucci and colleagues in a previous issue of critical care , who evaluated outcome in 239 infants receiving blood as either a cpb pump prime or an intra / postoperative top - up transfusion according to whether this blood was 4 days old or older . of 192 infants receiving cpb prime blood , the authors concluded that older blood recipients were more likely to have pulmonary complications . after adjusting for other possible confounders , the rbc storage time remained an independent predictor of major morbidity , although the same association was not found for patients receiving rbcs after cpb . red cell transfusion in the critically ill continues to raise many questions - including whether the storage duration of red cells affects measurable outcomes ; whether leucodepletion results in fewer storage associated complications ; the effect of red cell irradiation on relevant outcomes ; and , finally , the appropriate target haemoglobin level in the preoperative , bleeding and stable critically ill patient . clearly , more robust evidence from prospective trials is required to support the therapeutic use of blood transfusion in the critically ill , or uncertainty will remain . dw is a co - investigator in the relieve study ; a feasibility randomized trial comparing restrictive and liberal blood transfusion strategies in intensive care patients .

since the inception of blood banking , refinements in laboratory processes have allowed for progressively longer storage times of red blood cells . whilst advantageous for the logistics of stock management , the clinical impact of the duration of red blood cell storage prior to transfusion remains uncertain , and a topic of growing interest .

the wt1 gene , located on chromosome 11p13 , plays a crucial role in kidney and genital system development . recent studies have demonstrated that mutations in wt1 , leading to frasier syndrome and denys - drash syndrome ( dds ) , can also cause isolated steroid - resistant nephrotic syndrome ( isrns ) . incomplete dds is characterized as a nephrotic syndrome associated with wilms ' tumor or male pseudohermaphroditism . a previous study has reported one pair of monozygotic twins presenting discordant phenotypes with identical wt1 mutations being of paternal origin . here , we report on discordant phenotypes in monozygotic twins with identical de novo wt1 mutations . female monozygotic twins having very similar appearances and only one placenta were observed . both twins had normal female phenotypes and karyotype 46 , xx . twin a ( figure 1 ( iii4 ) ) was admitted to the department of pediatrics , fuzhou dongfang hospital , p. r. china for evaluation of edema at the age of two . she failed to respond to 6 weeks of prednisone therapy ( 2 mg / kg/24 h ) . at the age of 3.49 years , she also presented with a right abdominal mass . kidney ultrasound revealed a 9.85 cm by 8.32 cm wilms ' tumor in the right kidney , confirmed by computed tomography scan ( figure 2 ) . she was diagnosed with incomplete dds and died at the age of 3.50 years due to renal failure . . abdominal computed tomography scan of twin a at the age of 3.49 years , showing wilms ' tumor in right kidney ( arrows ) . twin b ( figure 1 ( iii5 ) ) was examined at the age of two . she had not displayed wilms ' tumor by kidney ultrasound by the age of 5.14 years , though her serum creatinine had increased to 66 mol / l . she is now 5.85 years old and has not yet displayed wilms ' tumor , verified by both kidney ultrasound and computed tomography scan . a heterozygous variant in exon 9 of wt1 , 1180c > t , leading to an arginine to tryptophan substitution ( r394w ) , was identified in both twins , whereas it was not found in 50 controls or the twins ' parents or older sister . three wt1 polymorphisms , 126c > t , 903a > g and ivs732c > a , were also found in the twins . in this study , we identified an identical de novo heterozygous wt1 mutation , r394w , in monozygotic twins presenting with incomplete dds and isrns , which was not observed in the parents . previous studies have reported wt1 mutation r394w can cause dds or isrns ; therefore , we considered this mutation to be responsible for the phenotypes observed in the twins . the twins , having very similar appearances , had only one placenta and three wt1 polymorphisms , 126c > t , 903a > g and ivs732c > a , suggesting that they were monozygotic twins . twin a presented with isrns at the age of two and developed unilateral wilms ' tumor at the age of 3.49 . twin b presented with isrns at the age of 4.02 and did not present with any renal tumors at the last follow - up when she was 5.85 . the possible reason for our observations is that discordant phenotypes in our twins with identical wt1 mutation r394w could be associated with the two - hit mutational model of wilms ' tumorigenesis . although the onset age of wilms ' tumor in dds patients with wt1 mutation r394w was from 0.3 to 2.7 years [ 5 , 7 , 8 ] , we will still continue a clinical follow - up and make a prompt report if wilms ' tumor will appear in twin b. consistent in part with our study , monozygotic twins with the same wt1 mutation presenting incomplete dds and isrns were reported by fencl et al . ; however , in that case , the wt1 mutation was r366p and inherited from the twins ' father . also , four studies have previously noted monozygotic twins with identical wt1 mutations presenting the same phenotypes [ 1 , 3 , 9 , 10 ] . in conclusion , the female monozygotic twins showed discordant phenotypes , had an identical de novo wt1 mutation r394w and presented incomplete dds and isrns .

mutations in the wt1 gene , leading to denys - drash syndrome and frasier syndrome , can also cause isolated steroid - resistant nephrotic syndrome ( isrns ) . previous studies have reported six pairs of monozygotic twins with wt1 mutations , including one presenting with discordant phenotypes with identical wt1 mutations being of paternal origin and five pairs of monozygotic twins presenting the same phenotype with identical wt1 mutations . in this study , we report on female monozygotic twins showing discordant phenotypes with an identical de novo wt1 mutation , r394w , and presenting incomplete denys - drash syndrome and isrns .

dislocations of the distal interphalangeal ( dip ) joint are usually associated with fractures of its base . dorsal irreducible dislocation of this joint is an especially rare injury , with less than twenty cases reported in english literature since 1940 . the injury is the distal counterpart of the complex metacarpophalangeal ( mcp ) dislocation , with many parallels . however , this is liable to be missed and mismanaged unless a high index of suspicion is maintained , especially in a multiply injured patient . we present a case report with a brief review of the literature and pointers towards managing this problem . a 46-year - old right - handed farmer sustained a motor vehicle accident , resulting in bilateral distal radius fractures and a closed dorsal dislocation of the dip joint of the left middle finger . x - rays showed an increased joint space , along with a dorsoulnar dislocation [ figure 1a and b ] . this suggested soft - tissue interposition , possibly the volar plate of the dip joint . closed pinning of the ipsilateral distal radius fracture was performed under a brachial plexus block , before proceeding to reduction of the finger joint . closed reduction was attempted by exaggerating the hyperextension and ulnar deviation deformity , followed by gentle pressure over the dorsally palpable base of the distal phalanx . ( a and b ) x - ray views showing dorsoulnar distal interphalangeal joint dislocation with increased joint space open reduction was planned after a couple of trials of closed reduction failed . under an arm tourniquet control , a volar zig - zag incision was made centred on the flexion crease of the dip joint . on exposure of the joint , the ulnar condyle of the head of the middle phalanx was found prominent volarly with the flexor digitorum profundus tendon entrapped behind it , with rupture of the a5 pulley . the volar plate was pulled out and reduction completed by manoeuvring the flexor tendon around the middle phalanx head [ figure 3 ] . as the volar plate was avulsed proximally , it was then repaired to the periosteum over the middle phalanx with nonabsorbable sutures ( 5 - 0 prolene ) . a follow - up x - ray at 2 months showed maintenance of reduction [ figure 5 ] . note volar plate interposition ( white arrow ) and displaced profundus tendon ( black arrow ) intraoperative picture post - reduction with centralised profundus tendonvolar concentric reduction of the joint on lateral view with image intensifier ( a and b ) follow - up x - ray showing concentric reduction the first report of an irreducible dip dislocation was by selig and schein in 1940 , who ascribed the irreducibility to buttonholing of the middle phalanx head through the volar plate . over the years , various reports have identified more causes , which are : profundus tendon entrapment behind middle phalanx head , volar plate interposition and buttonholing of the middle phalanx head through a rent in the volar plate or flexor tendon . in the thumb , these injuries have a high incidence of being missed initially as well as late presentation . moreover , excessive traction may actually convert a simple dislocation into a complex one , by pulling the avulsed volar plate into the joint space . once increased joint space is noted on x - rays , closed reduction is to be attempted only by pressure on the distal phalanx base . repeated attempts are unlikely to be successful . in a report and review of literature , abouzahr and poblete found only 12 such cases reported till 1997 having included both open and closed dislocations . they concluded that volar plate interposition was the culprit in closed injuries while the buttonholed profundus tendon caused irreducibility in open injuries . we also feel that , in our case , the displacement of the tendon was the primary impediment to reduction rather than the volar plate interposition . however , this interposition has to be identified and corrected before any attempt at joint reduction is made . similar to the controversy over the mcp dislocation , controversy exists in the approach for open reduction . the dorsal transverse approach , with midlateral extensions , the approach allows easy handling of the interposed tissues but is fraught with wound healing issues . the volar approach , on the other hand , heals well , but with some involved dissection needed to safely extricate the trapped tissues . it also allows repair of the volar plate or tendon , which ensures stability . on the basis of our experience with mcp and proximal interphalangeal joint dislocations k - wire fixation is not necessary if the joint is stable after open reduction . if reduction is unstable , it is worthwhile searching for the soft - tissue components involved and repairing the injured structures . these could be the volar plate , flexor tendon , capsule and/or collateral ligaments . for proper delineation of the injury and subsequent repair , we instructed the patient to use the finger within limits of pain while avoiding strong gripping activities for 3 weeks . however , it is better to safeguard the reduction with a splint if any doubt on the stability of the reduction or patient 's compliance exists . diagnosis requires a high index of suspicion , and x - rays should definitely be obtained . if an increase in joint space is noted , open reduction will usually be necessary .

distal interphalangeal joint dislocations are only rarely complex and irreducible . we present a case and illustrate our approach to management of this problem . open reduction is necessary , and preferred approach is volar . it is imperative to identify the injured soft tissue and repair them as is feasible .

demonstration of coronary artery pathology in autopsies is vital for the elucidation of sudden death cases related to these lesions and for the development of new treatment approaches . congenital coronary artery anomalies are frequently observed in athletes , representing the second most common cause for athletic field deaths ( in about 20% of cases ) . the incidence of sudden cardiac death was reported to be 57% among 49 cases of anomalous left coronary artery . autopsy was conducted on a thirty - year male who died in a road traffic accident and brought dead to the hospital . heart dissection showed the absence of right coronary artery and the presence of left main trunk with unusual dominant course of the left circumflex coronary artery which was supplying whole of the right heart . however , the left anterior descending artery was normal [ figure 1 ] . cut section of the left circumflex coronary showed focal elevated areas [ figure 2 ] which microscopically showed [ figure 3 ] the features of pathological intimal thickening . the family members informed that he did not had any medical / cardiac signs and symptoms , and was absolutely normal before death . gross photograph of dissected heart showing only the left coronary artery with anterior descending and left circumflex branches gross photograph of dissected left circumflex coronary artery showing focal elevated areas in tunica intima microphotograph of the left coronary artery showing intimal thickening . coronary artery anomalies that entail a risk of sudden death are often associated with complex cardiac malformations but may occasionally be solitary . single coronary artery anomaly is most relevant clinically and associated with sudden cardiac death in young athletes and military personnel . a single coronary artery is an unusual congenital anomaly where only one coronary artery arises from the aortic trunk by a single coronary ostium and supply the entire heart . if a single common ostium is present , the pattern is considered to represent single coronary artery . the separate origin ( absent left main ) of the left anterior descending artery / left circumflex artery ( 30.4% ) and the anomalous origin of the left circumflex artery ( 27.7% ) are the two most common coronary anomalies . the anomaly observed in this case was the absent right coronary artery and an unusual dominant course of the left circumflex artery running along the posterior surface of the heart and supplying whole of the right heart , which is an extremely rare occurrence . to the best of our knowledge such an anomaly has only been reported twice in the english literature . the clinical outcome in patients with an anomalous coronary artery is heterogeneous with manifestations such as angina , syncope , myocardial infarction and sudden cardiac death . these are most common causes for sudden and unexpected death in young individuals , particularly during sporting activities and the greatest incidence of sudden death occurs during heavy physical exertion . the cause of sudden death varies from 25% for anomalous right coronary artery to 57% for anomalous left coronary artery . ischemia is the consequence of anatomical malformations , including the acute angle takeoff of the anomalous vessel , with a narrowed slit - like orifice that collapses in a valve like manner , thereby limiting the blood flow . younger patients ( 30 years old ) are reported to die suddenly or during exercise than older patients , despite their low frequency of significant atherosclerotic coronary artery disease . it was proposed that ischemia may be caused by sporadic spasm of the anomalous coronary artery induced by endothelial injury . hence one should be aware of the incidence of single coronary artery in particular , the rarest single dominant left coronary artery especially in athletes and military personnel , who can be screened and proper measures can be taken . in conclusion , we present a case with the absent right coronary artery and the presence of left main trunk with an unusual dominant course of the left circumflex coronary artery which was supplying whole of the right heart with normal left anterior descending artery . to the best of our knowledge such an anomaly has only been described twice in the english literature . performing autopsies for a better understanding of the coronary artery anomalies associated with sudden death

coronary artery anomalous course is rare , reported incidence is approximately 0.31.3% of patients undergoing coronary angiography and approximately 1% of routine autopsy examinations . a single coronary artery is an unusual congenital anomaly where only one coronary artery arises from the aortic trunk from a single coronary ostium , supplying the entire heart . we describe here a rare case with an unusual dominant left circumflex artery and absent right coronary artery .