text
stringlengths 693
9.48k
| summary
stringlengths 229
2.09k
|
---|---|
a cross - sectional study in questionnaire format ( appendix ) was prepared by the authors of this study and given to a convenient sample of adult diabetic patients who were receiving medical treatment . this study was done in a surgical ward in a baghdad teaching hospital during january 2015april 2015 . an additional 10 diabetic patients who are related to the authors of this study were invited to participate in this study to increase the sample size . seventy - nine patients who provided their verbal informed consent were included in this study . statistical software ( spss v. 12 , chicago , il ) was used for data input and analysis . continuous variables were presented as meanstandard deviation ( sd ) , and discrete variables were presented as numbers and frequencies . chi - square test for independence was used to test the significance of association between discrete variables . unpaired t test was used to test the significance of difference in the mean of two independent samples . pearson 's correlation was used to test the correlation between continuous variables . for doing correlations , the results shown in table 1 indicate that diabetic patients who suffered from df were significantly older than those without df . a long history of dm ( more than 10 years ) was associated with the development of df , while the presence of comorbid diseases was not associated with the development of df . demographic data of the patients table 2 shows that the most important factors that made diabetic patients more prone to develop df were using a combination of insulin and oral antidiabetic agents , physical activity , and unavailability of medications in the public sector . factors that affect diabetic patients to develop diabetic foot dm : diabetes mellitus ; df : diabetic foot . table 3 shows that the frequency of df occurrence is well correlated with the absence of a home glucose meter , less frequent blood glucose measurements , and with long duration of dm . correlation between different parameters on diabetic foot frequency table 4 shows that the high cost of home glucose meter strips was the main cause for unavailability of this apparatus . this study showed that the age of diabetic patients who suffer from df were significantly higher than those without df . similarly , it was found that most of the patients who developed df were in their fifth and sixth decades of life , with mean age of 59.3 years ( 12 ) ; furthermore , a long history of dm ( more than 10 years ) was associated with development of df . in contrast to the finding in this study , researchers found that the duration of dm is not related to df risk for patients in the united states ( 10 ) , while another studies showed that diabetic patients who develop df are usually those with long history of dm ( 12 , 13 ) . another important finding in this study is that the patient 's educational level was not significantly different between diabetic patients with df and those without df ; in contrast to the finding of this study , low educational level was a risk factor to develop df in diabetic patients in the uae ( 14 ) . this difference may be because low level of education is very common among iraqi diabetic patients ( 15 ) . in this study , the presence of comorbid diseases was not associated with the development of df ; while in many other studies comorbidities are associated with increasing df incidence ( 1719 ) . one possible explanation for this strange finding is that whenever the demand for glycemic control increased ( as in patients with medical comorbidities ) , the patient compliance with medical advice will be increased ( 19 ) . this in turn could mean better glycemic control and fewer complications from hyperglycemic attacks ( 20 , 21 ) . this study has shown there are many risk factors that make the diabetic patients more prone to develop df , at which patients who are using a combination of insulin and oral antidiabetic agents were at high risk to develop df . the same finding was observed in an indian study where diabetic patients who use a combination of insulin plus oral hypoglycemic agents are at higher risk of developing df ulcers ( 22 ) . the use of combined therapy in diabetic patients is common and may be because dm is one of the diseases that progress and become less responsive to treatment with time ( 23 ) . this hypothesis is consistent with the findings in this study because patients with a long history of dm were at high risk from recurrent df ulcers . moreover , it is well known that the use of many medications decrease patient compliance to therapy ( 24 ) , which further mean losing glycemic control ( 20 ) and increasing df ulcer risk to the patient ( 21 ) . additionally , another finding in this study was the association between physical activity and the risk of developing df , despite the fact that physical activity can improve glycemic control ( 25 ) . this might be explained by the fact that most diabetic patients in this study had low educational levels , and around 50% of them did not inspect their feet regularly . this could result in a higher chance of foot wounds and blisters through physical activity . this study also showed that unavailability of medications in the public sector , the free sector , is one of the major risk factors to develop df ulcerations since nearly one third of participating patients stated that they will stop using their treatment if it is not freely supplied to them , this finding may be rational since many people in iraq are below poverty line ( 26 ) and thus they are unable to purchase their medications from private pharmacies . it is well known that df has a high recurrence rate ( 27 ) . in this study it was found that the frequency of df occurrence was well correlated with less - frequent blood glucose measurements and with the absence of home glucose meters . most patients in this study stated that they did n't own a home glucose meter because even if they can purchase the apparatus they are n't able to afford the costly strips for the regular glucose monitoring . in this regard , the lack of home glucose meters is surely linked with less - frequent glucose monitoring , which was further linked to bad glycemic control ( 28 ) , and eventually to more complications with df . at which better glycemic control is associated with better outcomes for patients with df and may decrease the rate of df recurrence ( 29 ) . there are some limitations in this study like the small sample size and the cross - sectional rather than longitudinal design that affect the reliability of study conclusions and therefore , a longitudinal large - scale study should be performed to confirm the results of this study . it is recommended that the iraqi ministry of health ensure adequate and continuous supply not only of antidiabetic medications but also of glucose meter strips ; furthermore diabetic educational programs should be made freely available to all diabetic patients to ensure a better glycemic control which eventually decrease the risk of diabetic complications . in conclusion , older patients , long history of dm , using multiple antidiabetic medications , and physical activity with less frequent inspection of the feet were some of the major risk factors for developing df among iraqi diabetic patients , while the frequency of glucose monitoring is inversely related to the recurrence of df ulcers . the authors have not received any funding or benefits from industry or elsewhere to conduct this study . | there are a few studies that discuss the medical causes for diabetic foot ( df ) ulcerations in iraq , one of them in wasit province .
the aim of our study was to analyze the medical , therapeutic , and patient risk factors for developing df ulcerations among diabetic patients in baghdad , iraq . |
gave a rare cause of upper gi bleed has prominent associations with autoimmune disorders and liver cirrhosis . we report a case of chronic kidney disease stage 5 with chronic liver disease who presented with blood loss anemia and was found to have vascular ectasia involving both the antrum and duodenum . a middle - aged woman , a known case of hypertension and stage v chronic kidney disease ( ckd ) since 10 years , and on maintenance hemodialysis ( mhd ) for 6 years , presented with complaints of blood in the stools since the past 8 months , and abdominal distention and discomfort since the past 2 months . she was diagnosed with chronic liver disease ( cld ) related to hepatitis c virus ( hcv ) 8 months back . as a result of continuous loss of blood in the stools , the patient had developed severe anemia , for which she had received multiple blood transfusions during the past 8 months . on examination , an abdominal examination revealed free fluid with no organomegaly , whereas the other systems were unremarkable . her laboratory investigations revealed severe iron - deficiency anemia with hemoglobin of 4.3 gm / dl . her hcv genotype was one with the rna copies of 8.5 10 iu / ml . ultrasonography ( usg ) of her abdomen was suggestive of cld with cirrhotic changes , with normal portal vein and bilateral contracted kidneys , without any organomegaly . the hepatic venous pressure gradient was 5 mmhg . during her hospital stay , she was given hemodialysis along with blood transfusion and intravenous ( iv ) iron in view of the severe iron deficiency . as she had melena , she was taken for upper gastrointestinal ( gi ) endoscopy and colonoscopy , where she was found to have multiple linear gastric vascular malformations in the antrum , compatible with gastric antral vascular ectasia ( gave ) , with spurt oozing [ figure 1 ] . argon plasma coagulation ( apc ) was done for gave to which she responded well [ figure 3 ] . subsequently the altered blood in stools decreased , her blood transfusion requirement decreased , and she was discharged on a conservative line of management . although previously reported in the literature , gave or watermelon stomach was first described definitively by jabbari et al . although known to be associated with a number of conditions like cirrhosis , ckd , collagen vascular diseases and pernicious anemia , the exact etiopathogenesis of gave remains unknown . the most common reported association is with autoimmune disorders , whereas cirrhosis accounts for 30% of the condition in these patients . the incidence of gave in ckd is unknown , with few relevant publications in the literature . our case was interesting as incidentally the patient had both ckd and cld , both of which are associated with gave . however , as the history of ckd was of 10 years , whereas hcv - related cld was recently diagnosed , the possibility of ckd - associated gave was more likely . moreover , her usg revealed a normal portal vein , with a normal size cirrhotic liver . absence of portal hypertension ruled out the possibility of portal hypertensive gastropathy , which has an endoscopic appearance similar to that of gave . besides the antrum , the patient also had vascular ectasias affecting the first part of the duodenum . there are reports of duodenal vascular ectasia in association with gave , even in patients with a normal antrum . pharmacological treatments with documented efficacy are tranexamic acid , estrogen progesterone therapy , especially in renal failure , and octreotide injections even as surgical antrectomy provides the most definitive therapy for gave , it is associated with significant morbidity and mortality . various endoscopic treatments have been described to manage gave , including neodymium : yttrium aluminum garnet ( nd : yag ) laser , apc , and a heater probe . of these , apc is the most frequently used endoscopic treatment , as it is easier and safer to use , with limited depth of penetration and a tendency for the ionized electric arc to deflect away from the coagulated tissue to the surrounding mucosa . the number of sessions needed to eradicate gave depends on the pattern , extent , and number of lesions . in our case , the patient was managed effectively with apc in a single session , with a decline in gastric blood loss and requirement of blood transfusion . to conclude , gave is a rare cause of persistent gi blood loss , with a known association with ckd . presenting as transfusion - dependent anemia , it can be effectively eradicated by endoscopic therapies , especially apc , as in our case . | gastric antral vascular ectasia ( gave ) , also called watermelon stomach , is a rare cause of gastrointestinal ( gi ) bleeding . gave is associated with a number of conditions , including portal hypertension , chronic kidney disease ( ckd ) , and collagen vascular diseases , especially scleroderma .
limited reports of gave are present in ckd patients .
argon plasma coagulation ( apc ) is an effective therapy for gave .
we describe the case of a ckd , stage v patient , who presented with recurrent blood loss in stools and transfusion - dependent anemia .
her endoscopy revealed gave , which was managed uneventfully with apc . |
ovarian neoplasms are a heterogenous group of benign and malignant tumors of epithelial , stromal and germ - cell origin . granulosa cell tumors ( gct ) account for 1.5% of all ovarian tumors and about 5 - 8% of all ovarian malignancies . approximately 95% of gct cases occur in adults , and these are prone to develop recurrence which occasionally happens may years after the initial diagnosis . fine needle aspiration cytology ( fnac ) as a pre - operative investigation for ovarian neoplasms has been discouraged to reduce the risk of possible intra - peritoneal seeding . for effective planning of the surgical management , the demand for intra - operative cytological assessment has increased in recent years in patients with suspected ovarian neoplasms.[57 ] in this report , we describe a case of adult tumor gct , where intra - operative cytology , not only helped in obtaining a diagnosis but also helped in planning the surgical protocol . a 30-years - old lady ( p2l2 ) with last childbirth 7 years back presented with amenorrhea and anorexia of 1-year duration . she denied any history of abdomen pain , weight loss , chronic cough or fever . , she was found to have a mobile , non - tender lump in the suprapubic region . a mass of 22 - 24 weeks size pregnancy was felt separately from the uterus in the anterior fornix . serum ca-125 , alpha - fetoprotein , carcino - embryonic antigen and -human chorionic gonadotrophin levels were normal . ultrasonography of the pelvic region revealed a complex left adnexal mass measuring 12.7 9 11.6 cm with central solid and cystic areas with calcification . computerized tomography scan of the abdomen was suggestive of a neoplastic lesion of the left ovary , with a differential diagnosis of teratoma and ovarian carcinoma . on macrosopy , the tumor measured 18 11 8 cm in size , encapsulated with a smooth external surface . on microscopy , the smears were hypercellular with cells arranged in a follicular and trabecular pattern . the cells were also seen dispersed in loose cohesive sheets with focal tight micro - follicular pattern occasionally traversed by delicate vasculature . individual tumor cells were small to moderate sized , round to oval with occasional large cells having high nuclear : cytoplasmic ratio . the nuclei were central , round to oval with fine , evenly distributed chromatin and with occasional prominent nucleoli . wisps of metachromatic stroma in between tumor cells and cellular follicular arrangements reminiscent of call - exner bodies with central metachromatic stroma were present [ figure 1a d ] . ( a ) photomicrograph of cytology smears showing a hypercellular smear with cells in a trabecular pattern ( mgg , 40 ) , ( b and c ) and also in loose cohesive sheets with focal tight micro - follicular pattern . focally cellular follicular arrangement reminiscent of call - exner bodies with central metachromatic stroma ( mgg , 100 ) . ( d ) occasional large tumor cells with fine vacuolated cytoplasm and high nuclear : cytoplasmic ratio . the nuclei were central , round to oval with fine , evenly distributed chromatin with occasional prominent nucleoli ( ) and nuclear grooves ( -- > ) . ( e ) frozen section ( toluidine blue , 100 ) and ( f ) formalin - fixed paraffin embedded section ( h and e , 100 ) a diagnosis of gct was offered , which corroborated with frozen section examination [ figure 1e ] . subsequent formalin - fixed paraffin - embedded ( ffpe ) sections confirmed the above findings and diagnosis of gct [ figure 1f ] . fnac is a simple and reliable method for the diagnosis of a variety of female genital tract tumors . however , till date the gynecologists across the world are hesitant to accept the role of preoperative fnac on pelvic masses , especially in ovarian masses , owing to the potential risk of intra - peritoneal tumor implantation , though the risk is often overestimated and has not been conclusively documented . intra - operative diagnosis of ovarian lesions can be achieved by a number of cytological techniques , including imprint and scrape cytology , and intra - operative fine - needle aspiration cytology . though these methods are less accurate as compared to frozen sections , these are bereft of the fear of dissemination and also has an added advantage of providing a more specific diagnosis in most cases . however , few studies have demonstrated that in experienced hands the diagnostic efficacy of intra - operative cytology are comparable to that of frozen sections with 92% diagnostic accuracy in characterizing cytological pattern and morphology of ovarian tumors . scrape smear cytology is a modification of imprint cytology in which cells are harvested by scraping the cut surface of the specimen . it is an economical , simple and quick method of intra - operative diagnosis , and does not alter the utility of the specimen for subsequent histopathology examination . though the history of scrape cytology dates back to 1927 , its utility during intra - operative consultation has often been neglected in comparison to frozen sections and imprint cytology . scrape cytology could be preferred over touch preparation / imprint cytology , as in most cases , the former technique would yield much more material than the latter . further , its role as a potential tool in intra - operative consultation is more pertinent in institutions unequipped with frozen section facility . in these scenarios , in experienced hands , it not only offers a viable alternative , but also helps to reduce the overall cost and processing time , without compromising quality . nuclear features , seen in gct , along with nuclear grooves may also be seen in proliferating brenner tumor and sex cord tumor with annular tubules ( sctat ) . immunostaining with beta - inhibin , cd99 , vimentin and cytokeratin is confirmatory of gct . other corroborative molecular genetic markers include somatic foxl2 402c > g mutation , and conditional disruption in the pten mutation in the kras ( g12d ) , expressing granulosa cells . rapid intra - operative diagnosis of the nature of ovarian tumors in a young woman avoids unnecessary removal of contralateral ovary and helps preserve fertility . it can allow individualization of treatment like complete surgery in a case of malignancy and particularly the post - operative irradiation of anaplastic carcinoma . it can also be used for staging , for post - operative follow - up , and for recurrences . material obtained by this technique can be utilized for flow cytometry and cytogenetic studies . in spite of the various applications , its use has not been widely recognized in diagnosis of ovarian tumors and there are only a few reports on diagnosis of ovarian tumors , including gcts , by imprint cytology . the case reiterates the accuracy of scrape cytology in intra - operative ovarian tumor diagnosis by correlating it with histopathology which is considered as the gold standard . cytological evaluation provides a better morphological detail , and in experienced setup compares well with frozen section and subsequent formalin - fixed paraffin - embedded sections . ability of the scrape cytology smears to render immediate diagnosis highlights its role and potential usage in intra - operative consultation in institutions unequipped with frozen section facility . | adult granulosa cell tumor is often a hormonally active stromal cell neoplasm of the ovary with malignant potential .
intra - operative pathological assessment is a valuable tool in guiding optimal surgical treatment in patients . of the various intra - operative cytological diagnostic modalities ,
scrape smear cytology is an effective , economical , simple , fast and reliable method with results comparable with frozen section diagnosis .
we describe a case of adult granulosa cell tumor in a 30-years - old lady diagnosed on intra - operative scrape cytology , and further reconfirmed on frozen section and histopathology . |
the epidermal growth factor receptor ( egfr ) is over expressed in various solid malignancies including non small cell lung cancer ( nsclc ) . however , they are associated with a dermatologic side effects , which can occasionally be responsible for discontinuation of the egfr inhibitors . hence , we report a case of metastatic adenocarcinoma of lung who developed skin ulceration with gefitinib and responded to interruption of the drug and early intervention . the present case report is about a 50-year - old female patient who had been diagnosed as having lung adenocarcinoma with multiple bone metastases was initiated on gefitinib therapy at an oral dose of 250 mg / d . after 2 weeks of initiating therapy , the patient presented with ulcer over the palm [ figure 1 ] . the ulcers improved with stopping gefitinib for 2 weeks and also with the addition of topical steroids and antibiotics . non - small - cell lung cancer ( nsclc ) with sensitive mutations of the egfr is highly responsive to gefitinib . gefitinib is a small molecule tyrosine kinase inhibitor ( tki ) of egfr . since 2004 , it was clear that a substantial proportion of nsclc obtaining objective response when treated with gefitinib harboring activating mutations in the egfr gene . the occurrence of skin disorders ( dry skin and acneiform rash ) is explained by the fact that egfr is also expressed in the basal layer of the skin ; inhibition of the receptor will disturb normal biology and result in skin rash . skin rash is notorious as an adverse event of egfr - tki and is noted in up to two - thirds of patients receiving any of these agents although severe in only 5 - 10% who can develop pyogenic granuloma like lesions . very rarely the cutaneous inflammation is so pronounced that skin necrosis with black eschar formation and ulceration is seen . the cutaneous side - effects are treated with topical steroids and antibiotics with interruption of treatment for 2 - 4 weeks as in our case . | we report a case of gefitinib - induced skin ulceration in a 50-year - old female with metastatic adenocarcinoma of lung who developed this adverse effect 2 weeks following initiation of gefitinib at a dose of 250 mg / day . the ulcer improved with stopping gefitinib for 2 weeks and also addition of topical steroids and antibiotics . we are reporting this case to create awareness among treating oncologists of this adverse effect and also prompt interruption of therapy and topical steroids / antibiotics is useful to treat this adverse event . |
zoonotic parasites are widespread in the world , especially in asian countries , including vietnam . thelazia callipaeda railliet and henry , 1910 ( nematoda : thelaziidae ) is a nematode parasite in the genus thelazia . this nematode is zoonotic and parasitic in the eyes as implied by its name " oriental eyeworm " or " eyeworm " . it was reported for the first time from a dog in pakistan in 1910 , and later shown to be widespread in china , france , germany , india , indonesia , italy , japan , korea , the netherlands , russia , switzerland , taiwan , myanmar , and thailand . the final hosts include dogs and cats , but occasionally rabbits , monkeys , raccoons , dogs , foxes , wolves , and humans can also serve as the final host . it is relatively well recognized that drosophilid flies but not musca domestica are the vector hosts for t. callipaeda [ 4 - 6 ] . also in japan , 3 species of the genus amiota ( drosophilidae ) , namely , amiota okadai , a. magna , and a. nagatai , have been identified . the adult worm is parasitic in the conjunctival sac of a final host , and gives larvae continually by ovoviviparity . when a fly licks the tear in the eye of a final host , including humans , the larvae enter the conjunctival sac , and become adults in 1 month after 2 molts . symptoms of t. callipaeda infection include conjunctivitis , excessive watering , visual impairment , and ulcers or scarring of the cornea . in some cases , the only symptom is the presence of worms obscuring the host 's vision as a floater . with regard to the nematode infection in the human eyes in vietnam , dirofilaria repens was recently reported from the human conjunctiva . however , t. callipaeda infection has never been reported in vietnam . in this study , we report for the first time a case of human t. callipaeda infection in vietnam which was verified by both morphology and molecular analysis using the mitochondrial cytochrome c oxidase 1 ( cox1 ) gene . the patient was a 26-year old male residing in the cao phong village , hop tien commune , dong hy district , thai nguyen province of mountainous north vietnam . in july 2008 , he felt a bulge - sticking pain in his left eye and extracted 5 small nematode worms by himself but he did not keep them . then , half a day later , he visited the thai nguyen provincial hospital and a medical doctor collected 2 more worms . the morphology of the worms was not so good , but they were thin , long , and cylindrical with milkish - white color . one was a male , 10 mm in length and 0.4 mm in width , with a curled tail end , and the other was a female , 15 mm in length and 0.5 mm in width , with a slender tail end . the female worm had a scalariform buccal cavity , a long muscular esophagus and a conical tail , and the vulva opening at the anterior portion of the esophago - intestinal junction . comparison with the figure described as t. callipaeda in miyazaki showed that these worms were t. callipaeda ( nematoda : thelaziidae ) . to support the morphological diagnosis , pcr analysis was performed on the cox1 gene with the primer of thelf - thelr for the vietnamese thelazia . total 627 nucleotide and 209 amino acid sequences of the cox1 gene were compared with those of the previously known strains or isolates reported in genbank ( table 1 ) . there were 7 nucleotide differences in the vietnamese t. callipaeda , but no changes in the amino acids at the changed places . the vietnamese isolate had high homologies ( 98 - 99% ) with 8 t. callipaeda isolates from china in genbank ( no . aj544882 ) . however , the homology of our isolate with thelazia gulosa ( no . aj544881 ) from italy was low , 86% ( table 1 ) . a phylogenetic analysis between the vietnamese t. callipaeda and standard strains or isolates in the world showed that t. callipaeda from vietnam and t. callipaeda from china and italy is an identical group ( fig . the first human case of thelaziasis was reported in china in 1917 , and later from india , thailand , korea , russia , and japan . in japan in korea , 39 human cases were reported until 2011 , and a total of 146 adult worms were collected from the patients . however , in vietnam , this is the first time when t. callipaeda infection is reported from a human patient . the worms were parasitic in the conjunctival sac of an eye of a 26-year - old man . he felt a bulge - sticking pain in his left eye and no other symptoms . a total of 7 worms were extracted , but 5 worms collected by the patient himself were lost and only 2 were available . although the worm morphology was not so good , they were identified as 1 male ( with a curled tail end ) and 1 female ( with a straight , slender tail end ) , and could be identified as t. callipaeda . the flies of the family drosophilidae , intermediate hosts for t. callipaeda , are very common in vietnam . this zoonotic disease can be transmitted from animals to humans . in order to support the morphological diagnosis , the nucleotide and amino acid sequences of the cox1 gene of our vietnamese worms were compared with those of 9 isolates of t. callipaeda reported in genbank ( 8 from china and 1 from italy ) . the results showed that there were 7 places of nucleotide differences in our isolate but no changes in the amino acid sequence at the changed places . thus , the amino acid homology between the vietnamese isolate and 8 other isolates in the world was 100% , and only 1 isolate , number 4 ( genbank no . am042552 ) , revealed 99% homology with our isolate ( difference in 1 amino acid , i.e. , phenylalanine ) . | a 26-year - old man residing in a village of thai nguyen province , north vietnam , visited the thai nguyen provincial hospital in july 2008 . he felt a bulge - sticking pain in his left eye and extracted 5 small nematode worms by himself half a day before visiting the hospital .
two more worms were extracted from his left eye by a medical doctor , and they were morphologically observed and genetically analyzed on the mitochondrial cytochrome c oxidase 1 gene .
the worms were 1 male and 1 female , and genetically identical with those of thelazia callipaeda . by the present study ,
the presence of human t. callipaeda infection is first reported in vietnam . |
carcinoma of the prostate is a common condition , with over 21 000 cases and over 10 000 deaths every year in the united kingdom alone . we describe two patients with known carcinoma of the prostate who presented with visual disturbance and papilloedema on examination . the first patient was a 76-year - old gentleman who presented to the urology service complaining of a poor stream . he re - presented to the urology service 30 months later with a serum psa of 378 g / l with macroscopic haematuria . a trans - rectal biopsy of the prostate was performed and poorly differentiated adenocarcinoma of the prostate was diagnosed . an mri scan was performed , which showed bony metastases in the occipital bone and oedema in the cerebellum ( figs 1 and 2 ) . the slightly hyper - intense signal in the superior sagittal sinus indicates that the thrombosis is between 5 and 15 days old and is due to the presence of methaemoglobin . the patient responded well to 20 gy ( in five fractions ) of radiotherapy , delivered to the occipital region . figure 1
t2w sagittal image of patient 1 , showing metastases in the occipital bone and oedema of the cerebellum.figure 2
t2w axial image of patient 1 , showing mixed signal in the sagittal sinus compatible with thrombosis . after treatment of the metastases with radiotherapy , follow - up imaging showed a return of a normal signal void .
t2w sagittal image of patient 1 , showing metastases in the occipital bone and oedema of the cerebellum .
t2w axial image of patient 1 , showing mixed signal in the sagittal sinus compatible with thrombosis . after treatment of the metastases with radiotherapy , follow - up imaging showed a return of a normal signal void . the second patient was a 62-year - old gentleman who was admitted to hospital with a history of recent onset of headaches , nausea , nocturia and macroscopic haematuria . positive findings on examination included bilateral papilloedema and a markedly ataxic gait with cerebellar ataxia . isotope bone scanning showed bony metastases in the thoracolumbar spine , the pelvis and the base of the skull . computed tomography ( ct ) of the brain did not demonstrate cerebral metastases but mri scanning did reveal bony metastases in the occiput ( fig . venous infarcts in the occipital lobes adjacent to the superior sagittal sinus were also demonstrated ( fig . figure 3
t2w axial image of patient 2 , showing metastases in the occipital bone and iso - intense signal in the occluded sagittal sinus . note the fluid around both optic nerves.figure 4
mrv ( 2d tof ) of patient 2 showing thrombus in the superior sagittal sinus.figure 5
coronal t1w image of patient 2 demonstrating high signal adjacent to the superior sagittal sinus compatible with haemorrhage . t2w axial image of patient 2 , showing metastases in the occipital bone and iso - intense signal in the occluded sagittal sinus . mrv ( 2d tof ) of patient 2 showing thrombus in the superior sagittal sinus . coronal t1w image of patient 2 demonstrating high signal adjacent to the superior sagittal sinus compatible with haemorrhage . the patient was commenced on cyproterone acetate and received 30 gy to the skull in 10 fractions over 14 days . papilloedema has been described in prostate carcinoma due to transverse sinus thrombosis , but this was a result of dural metastases at the torcula and not in the bone of the skull vault . bony metastases in the optic canal have also been described , causing painless visual loss . mri is effective at showing both bony metastases in carcinoma of the prostate and is the imaging modality of choice for cerebral venous sinus thrombosis . intravenous contrast - enhanced ct scanning may show filling defects in the superior sagittal sinus , but mri is more sensitive in the detection of superior sagittal thrombosis and venous oedema and of bone metastases . we would suggest that in a patient with visual disturbance , who is known to be suffering from a malignancy that may spread to bone , mri is the imaging modality of choice and the venous sinuses should be examined with mrv at the time of imaging . | carcinoma of the prostate is a common condition and often spreads to bone .
we describe the imaging findings in two patients with known carcinoma of the prostate who presented with visual disturbance ( both had papilloedema on examination ) .
mri showed occipital bone metastases and superior sagittal sinus thrombosis .
we suggest that mri is the imaging modality of choice in patients suffering from prostate cancer who have visual disturbance and that mrv sequences should be included to detect venous sinus thrombosis . |
a 31-year - old man presented with insidious onset horizontal
diplopia for one year . his best corrected visual acuity was 20/60 in the right
eye with -32.0 diopter ( d ) and 20/60 in the left eye with -31.0
d. orthoptic evaluation revealed 25 prismd esotropia in the
right eye . abduction on both sides was limited [ fig . 1 ] . forced
duction test was negative . he underwent bilateral clear
lens extraction with pmma iol ( model s3500 , optic size 5.0
mm , overall length 12.0 mm , posterior vault 0.3 mm , modified
c loop haptics , aurolab , madurai , india ) implantation . postoperative targeted refraction was -2.0 d. after simple lens
aspiration , iol was implanted through a 5.0 mm superior
sutureless scleral tunnel incision ( + 4 d in right eye and + 5.5 d
in the left ) . postoperatively iol in the left eye was noted to be
inadvertently placed in the sulcus where it was stable , well-
centered and without any tilt for 12 months until the patient
sustained an injury to his left eye with a cricket ball . in the interim period he underwent bilateral partial superior
jensens procedure17 with medial rectus recession achieving
orthoptropia and resolution of diplopia . , he came with the
complaint of mild pain in the left eye following an injury with a
cricket ball three days prior to the presentation . on examination his best corrected visual acuity was the same as it was four
months back . the iol in the right eye was well - centered and
in - the - bag [ fig . 2 ] while there was a total anterior dislocation of
iol in the left eye [ fig . 3 ] . his best corrected visual acuity was
20/60 with -2.5 d -1.0d x90 in both eyes . this was associated
with mild traumatic uveitis ( cells 1 + and flare 1 + ) . the capsular bag was intact and there was
a fibrotic fusion of the anterior and posterior capsule along the
capsulorrhexis margins in the left eye [ fig . 4 ] . since the fibrotic
adhesions between the anterior and posterior capsule could
not be released , the iol was dialed back into the ciliary sulcus
under topical anesthesia and the pupil was constricted with
pilocarpine . this is a rare case where a single - piece pmma iol , implanted
in the sulcus dislocated completely into the anterior chamber
without a wound dehiscence or an iris trauma . sudden positive
pressure in the vitreous cavity following blunt trauma behind
the iris in an enlarged globe of this high myope could have
pushed the sulcus placed pciol into the anterior chamber
through a large pupil . alternatively a lens - iris diaphragm
retropulsion ( lidrs ) type phenomenon might have occurred ,
with extreme dilation of the pupil when the cricket ball hit ,
followed by rebound of the pciol into the anterior chamber . the overall length of the iol and the optic size
were smaller than desired for the sulcus fixation . a small size
of the capsulorrhexis opening with the posterior capture of the
iol optic or a suture fixation of the iol or use of miotics could
prevent this complication . nevertheless , the most important
message is to take meticulous care to place an iol in - the - bag
in every case . | a 31-year - old man with high axial myopia and strabismus fixus
convergens underwent bilateral refractive lens exchange followed
by a squint surgery ( bilateral superior partial jensens procedure
and medial rectus recession ) .
after one year he presented with
traumatic anterior dislocation of the sulcus fixated posterior
chamber polymethyl methacrylate lens .
the lens was dialed
back into the ciliary sulcus without any complications .
this case
highlights the importance of implanting an intraocular lens ( iol )
in - the - bag .
if the iol needs to be implanted in the sulcus , a larger
diameter of the iol with larger optic size and overall length is
desirable , especially in highly myopic eyes . |
permission was obtained from the patient included in this report . in june 2014 , a 25-year - old woman presented to the outpatient clinic with a 6-month history of progressive left hip pain . physical examination revealed mild pain with motion in the hip joint and slightly limited range of motion . radiographs showed a large osteolytic lesion with well - defined margins in the proximal metaphysis of the femur , partially surrounded by sclerotic cortical bone ( fig . 1 ) . magnetic resonance imaging ( mri ) showed a well - demarcated intra - osseous lesion measuring 584242 mm . t1-weighted images demonstrated a lesion with heterogeneously distributed low- and high - signal intensities , while t2-weighted images revealed similar findings , partially surrounded by areas of low signal intensity , concordant with reactive bone sclerosis . fat - suppressed images showed an area of low signal intensity at the center of the lesion . a radionuclide bone scan demonstrated a lesion with peripherally increased uptake of tc-99 m methyl diphosphonate ( mdp ) in the metaphysis of the femur in the area of radiographic abnormality ( fig . these findings reflected benign bone tumor , such as intraosseous lipoma or liposclerosing myxofibrous tumor , rather than fibrous dysplasia , giant cell tumor , aneurysmal bone cyst , or simple bone cyst . because the lesion was suspected to be a benign bone tumor with progressive pain leading to impending fracture , surgery was performed in august 2014 . curettage of the lesion and bone grafting were performed with a femoral head allograft , which was stored in our bone bank . prophylactic internal fixation using the zimmer natural nail system ( zimmer , warsaw , in , usa ) was performed to prevent pathologic fracture ( fig . macroscopically , the pathologic specimen had abundant tan - brown soft tissue and multiple bone fragments . these histiocytes showed abundant foamy cytoplasm , and were positive for cd68 but negative for cd1a and s100 ( fig . after surgery , we evaluated the lipidemic status of the patient including her family history . she had no relevant history of elevated laboratory results , but her mother did have a history of hyperlipidemia . laboratory tests revealed the following results : fasting blood glucose , 95 g / dl ; hba1c , 5.4% ; total cholesterol , 157 mg / dl ; triglycerides , 63 mg / dl ; high - density lipoprotein cholesterol , 44 mg / dl ; and low - density lipoprotein cholesterol , 101 mg / dl . immunoelectrophoretic fractionation of lipoprotein revealed normal values for alpha , pre - beta , beta , and chylomicrons . implant removal and bone grafting with allograft bone chip for new bone formation were performed to remove foreign body sensation . there was no sign of local recurrence and the patient could successfully perform normal activities at the last follow - up ( fig . pix is an extremely rare , benign bone tumor that usually occurs in the appendicular skeleton , such as the calcaneus , rather than the axial skeleton . the lesion in this patient showed a sharply defined lytic lesion with a narrow zone of transition , and partially or completely sclerotic margins . these characteristics also are seen in intraosseous lipoma , liposclerosing myxofibrous tumor , simple bone cyst , aneurysmal bone cyst , non - ossifying fibroma , chondroblastoma , giant cell tumor , and fibrous dysplasia . the location of the lesion made it difficult to include pix in the differential diagnosis preoperatively . pix can exhibit an aggressive appearance , with an expansile border or cortical disruption , and may mimic malignancy , such as multiple myeloma or metastatic bone tumor3 ) . mri is typically characterized by a circumscribed area of heterogeneous signal intensity on t1- and t2-weighted images , and associated loss of signal when fat is suppressed , which is hypothesized to result from the cholesterol - laden histiocytes seen on histopathology5 ) . the typical histopathologic appearance of pix is a lesion consisting of numerous foamy cells and non - foamy mononuclear or multinucleated giant cells , and , occasionally , touton - type giant cells6 ) . abundant cholesterol clefts with giant cells at the focal area and cholesterol clefts between bone spicules also can be seen in the lesion7 ) . in our case , we could see numerous foamy cells and multinucleated giant cells , but touton - type giant cells and cholesterol clefts between bone spicules were not observed . giant cell tumor and intra - osseous lipoma might be considered in the differential diagnosis . giant cell tumors usually show a lytic lesion in the epiphysis , rather than in the metaphysis , and sometimes grow to the articular surface . the key histopathologic appearance is multinucleated giant cells with up to 100 nuclei that have prominent nucleoli8 ) . intraosseous lipomas are usually located in the long bones and have radiologic findings similar to pix . however , a well - defined lesion with sclerotic borders and mineralization of the central lesion are often pathognomonic . computed tomography and mri also can be diagnostic because they show high composition of fat content in the lesion9 ) . however , we suggest that this lesion is highly associated with familial factors because her mother had a history of hyperlipidemia . further study is needed to investigate the specific genes associated with xanthoma in patients with a family history of hyperlipidemia . when pix is accompanied by progressive pain or aggressive appearance , the optimal treatment typically consists of curettage of the lesion and bone grafting10 ) . the necessity of prophylactic internal fixation depends on the location and extent of the lesion . because the pelvis , proximal femur , and tibia are particularly prone to pathologic fracture , internal fixation may be indicated . in this patient , although the lesion did not exhibit an aggressive appearance , it showed extensive osteolysis with thin cortical bone accompanied by progressive pain in the left proximal femur . thus , internal fixation was performed to prevent pathologic fracture . in conclusion , we report a rare case of pix of the proximal femur in a patient without hyperlipidemia . this diagnosis can be difficult to make preoperatively using clinical examination , laboratory findings , and imaging studies . the variable clinical and radiologic characteristics of pix reinforce the necessity of bone biopsy to confirm diagnosis . | we report the case of a 25-year - old woman presenting with left hip pain . a lesion was found in the proximal femoral metaphysis . benign bone tumor , such as intraosseous lipoma or liposclerosing myxofibrous tumor ,
was suspected based on simple radiographs and magnetic resonance images .
curettage of the lesion and bone grafting was performed .
histologic findings reflected primary intraosseous xanthoma of the proximal femur .
laboratory tests revealed the patient to be normolipidemic , while immunoelectrophoretic fractionation of lipoproteins revealed normal values for alpha , pre - beta , beta , and chylomicrons . at the one - year follow - up
, there was no evidence of local recurrence .
this is the first reported case of primary intraosseous xanthoma of the proximal femur in a normolipidemic patient . |
multiple unerupted teeth are an uncommon condition in which there is more or less permanently delayed eruption of teeth . if the condition occurs due to endocrine dysfunction , proper treatment may result in the eruption of teeth or if associated with cliedocranial dysplasia , then there is no known therapy . in impacted teeth their etiology is multifactorial , including lack of space due to crowding of dental arches and premature loss of deciduous teeth . rotation of tooth buds also occurs resulting in long axis of tooth not parallel to normal eruption path . most frequently impacted teeth are maxillary and mandibular third molars and maxillary cuspids ; also mandibular teeth exhibit more severe impaction than maxillary teeth . in cases where the second and third mandibular teeth are impacted , their occlusal surface contacts each other in a single follicular space and roots pointing in opposite direction are called kissing molars ( km ) or rosette formation . this term is also being applied to describe similar conditions involving first and second impacted molars , and has also been associated with mucopolysacchroidoses . a 35-year - old male patient reported to the department of oral medicine and radiology with a chief complaint of dislodged filling on the upper right back tooth since 2 days . no relevant medical history was reported . missing teeth were detected in relation to 17 , 18 , 27 , 28 , 36 , 37 , 38 , 47 and 48 . on palpation , bony hard region were detected in relation to the same area without tenderness or pain . panoramic radiographs were taken to check the status of teeth ( if any ) in the regions ( figure 1 ) . but it revealed the presence of impacted second and third molars on right and left quadrants of both maxillary and mandibular dental arches . in mandible , the impacted right and left second and third molars showed their occlusal surfaces contacting each other in same follicular space with roots pointing in opposite directions , i.e. , kissing molars . on both right and left sides , the distance between inferior border of mandible and the tooth only about 4 mm . two occlusal radiographs ( true ) also were taken for the localization of position of the lower impacted molars , which showed a slight buccal positioning of 37 and 47 . no prominent cortical bone expansion was detected on both buccal and lingual side of both mandibular quadrants ( figure 2 ) . impaction of teeth is a common condition , among which the most commonly impacted tooth third molars . in cases where the second and third mandibular teeth are impacted , their occlusal surface contacts each other in a single follicular space and roots pointing in opposite direction are called kissing molars or rosette formation . this term is also being applied to describe similar conditions involving first and second impacted molars , and has also been associated with mucopolysacchroidoses . it has been hypothesized that , resorption of bone by cystic formation can result in bone loss along mesial root of the impacted third molar and cause movement and tipping . also presence of a fourth molar ( if present ) can be a predisposing factor . according to a study by aydin et al . , 33.3% of the total km were associated with dentigerous cyst , and suggests that dentigerous cyst formation may inhibit the eruption of first and second molars . so , histopathological evaluation of soft tissues surrounding the crowns of km is very essential . these are inherited metabolic disorders , in which there will be abnormal deposition of mucopolysaccharides in the tissues like , skin , soft tissues of airway , cornea , central nervous system , heart , liver , spleen , bones , ligaments , and other sites due to an enzyme abnormality . but , this case was a solitary radiological finding and there was no reason for a doubt of mucopolysaccharidoses . kissing molars can be classified into 3 types : i ) class i ( impaction of lower first and second molars ) ; ii ) class ii ( impaction of lower second and third molar ) ; iii ) class iii ( impaction of lower third and fourth molar ) . according to this classification , one of the foremost limitation of this classification is that it does not provide us with details regarding depth of the teeth in bone , angulation of individual teeth in relation to the opposite tooth or to the inferior border of mandible , buccal or lingual bone coverage , whether in maxilla or mandible ( location ) , approximation to important anatomic structures ( e.g. , mandibular canal ) , etc . hence there is a requirement for a systematic classification system for classifying km , addressing the above limitation , keeping in view the probable underlying systemic diseases that may alter the diagnostic process and treatment plan . but , as stated in various literatures , the phenomenon of km is an extremely rare phenomenon . when considering study about various impacted teeth , bilateral occurrence of kissing molars can be considered as the rarest . the dentist must have a thorough knowledge about the various forms of impactions including km , because these can be signs of various medical conditions . | the occurrence impacted teeth , single or multiple is very common .
but , phenomenon of kissing molars is an extremely rare phenomenon .
mandibular third molars are the most common impacted teeth .
mandibular first or second molars does not share the same frequency of occurrence .
but , there are rare cases in which the occlusal surfaces of impacted molars are united by the same follicular space and the roots point in the opposite direction , and are termed as kissing molars .
sometimes , these teeth will be associated with pathologies .
this article reports a rare case of mandibular bilateral kissing molars . |
although priapism has been reported as a complication of malignant tumor metastasis , leukemia , sickle cell disease , embolism and spinal canal stenosis [ 1 , 2 , 3 , 4 , 5 ] , there are few reports of priapism as a complication of colorectal cancer in the absence of penile metastasis . here we report a patient with rectal cancer with no penile metastasis in whom chemotherapy resulted in an improvement of priapism . a 65-year - old man was admitted to our hospital for priapism with tenderness of the penis and dysuria . enhanced abdominal computed tomography demonstrated metastatic tumors in the liver , lung , sacrum ( fig . ultrasonography of the penis revealed no tumor and normal blood flow in the penis vessel . chemotherapy ( folfox4 ; levofolinate 25 mg , fluorouracil 250 mg , oxaliplatin 100 mg ) was administered , and although the primary rectal cancer showed no change ( fig . brain or splenic metastasis and hypercalcemia arising from bone metastasis have been reported as rare complications of colorectal cancer [ 6 , 7 , 8 ] . chemotherapy regimens for metastatic colorectal cancer include fluorouracil , leucovorin , either oxaliplatin or irinotecan , and the vegf inhibitor bevacizumab . priapism is a complex involuntary behavioral response that depends on the integration of vascular , endocrine and neurological mechanisms . stimuli for erection can be classified as psychogenic and reflexogenic . when visceral nerves at the sacrum are stimulated electrically , this results in persistent penile erection . nervi erigentes. a second , thoracolumbar erection centre at the level of t12l1 plays a role in psychogenically mediated erections via sympathetic efferent fibers . disturbances in penile blood flow due to metastasis in the penis have been reported to cause priapism . in this case , the cause of priapism might have been micrometastasis in the penis , metastatic tumors that affected the spinal cord , or continuous stimulation of nervi erigentes by a metastatic tumor . chemotherapy , which reduced the metastatic tumor in the sacrum , may also have reduced the level of nervi erigentes stimulation . the results from this case suggest that chemotherapy can be effective for treating rare complications of rectal cancer such as priapism . | a 65-year - old man was admitted with penile tenderness and dysuria due to priapism . enhanced computed tomography revealed metastatic tumors in the liver , lung , sacrum and lymph nodes .
advanced rectal cancer , detected by colonoscopy as a primary tumor , was treated with chemotherapy ( folfox4 ) .
although the rectal cancer showed no change , five months of chemotherapy improveid the priapism , suggesting that chemotherapy can improve rare symptoms of rectal cancer . |
there have been only few reports in the literature describing this rare entity . in this study we report a case of gallbladder neurofibroma presenting as chronic epigastric pain in a young patient . a thirty two year old otherwise healthy man presented to our clinic with chronic epigastric pain symptom after eating . physical examination , laboratory and radiologic workups were unremarkable for signs of biliary tract diseases . past medical and surgical histories were significant only for neurofibromatosis type i. due to persistent symptomatology , the patient was taken to the operating room for a diagnostic laparoscopy followed by laparoscopic cholecystectomy . open conversion was necessitated because of the presence of a gallbladder mass preventing safe anatomic dissection . the postoperative course was unremarkable and the patient was pain free at 3 weeks postoperatively . benign neoplasms such as gallbladder neurofibroma should be included in the differential diagnosis for chronic epigastric pain symptom in a young otherwise healthy patient with neurofibromatosis . neurofibroma is a benign and slowly growing tumor arising in a nerve structure and composed primarily of schwann cells . this benign tumor can occur as a solitary lesion or more commonly is associated with neurofibromatosis type 1 ( nf-1 ) . while most neurofibromas commonly occur as superficial skin or subcutaneous lesions , neurofibromas of abdominal viscera are seen infrequently and when they occur in this location , they are usually associated with nf-1 . despite cholecystectomy having been the most commonly performed operation by general surgeons for many decades , there are only a few reports describing gallbladder neurofibroma in the clinical literature . a 32-year - old man presented to our clinic with a one - year history of epigastric pain and dyspepsia related to meals . . physical examination , liver function tests , abdominal ultrasonography and hepatobiliary iminodiacetic acid ( hida ) scan were otherwise unremarkable for signs of biliary tract pathology . due to the unrelenting symptoms , the decision was made to proceed with diagnostic laparoscopy and possible cholecystectomy . upon exploration of the right upper quadrant , the gallbladder was found to have markedly thickened wall with a dense soft tissue bundle along its medial aspect extending down to the hepatocystic triangle . due to the difficulty in achieving a critical view of the cystic duct and artery , the operation was converted to an open cholecystectomy . the resected specimen measured 8 5 cm with a soft tissue mass protruding from the gallbladder wall ( figs . 1 and 2 ) . neurofibroma extended along the inferior wall of the gallbladder from the cystic duct to the fundus , protruding extraluminally . silk sutures were used to ligate the cystic duct prior to division . surgical pathology revealed a plexiform neurofibroma with noninflamed gallbladder tissues . photomicrograph showed diffuse neurofibroma cells with short fusiform and round shapes within fine fibrillary collagen matrix ( fig . the postoperative course was unremarkable and at three - week followup , the patient had complete resolution of his epigastric symptoms . photomicrograph shows diffuse neurofibroma cells with short fusiform and round shapes within fine fibrillary collagen matrix . benign tumors of the gallbladder are rare and lesions of neural origin are even more unusual . such benign growths include paragangliomas that presumably arise from paraganglia of the gallbladder , neuromas of the cystic duct remnant , or granular cell myoblastomas . neurofibromas are formed by a combined proliferation of all components of peripheral nerve with schwann 's cell usually being the predominant element . on histopathology , they appear as spindle - shaped cells positively stained with immunoperoxidase technique . the incidence of hepatobiliary neurofibromas is lower than that of other digestive organs . in the gastrointestinal tract , neurofibromas are most commonly located in the ileum , followed by the jejunum , duodenum and stomach . in a case described by hochberg et al , the most common sites affected were the jejunum and stomach . gastrointestinal involvement of von recklingshausen 's disease essentially occurs in three forms : ( a ) hyperplasia of the submucosa and myenteric plexus with mucosal ganglioneuromatosis , ( b ) gastrointestinal stromal tumor showing varying degrees of neural and smooth muscle differentiation , ( c ) somatostatin - rich carcinoid of the duodenum with psammoma bodies and which may be associated with pheochromocytoma[35 ] . ultrasononographic imaging often demonstrates either localized thickening of the gallbladder wall or broad based elevation of the mucosa . grossly , the appearance of a gallbladder neurofibroma can be very similar to that of a coexisting cholesterol polyp . based on the literature review presented in table 1 , most neurofibromas are found incidentally following cholecystectomy for symptomatic cholelithiasis or chronic cholecystitis . neurofibromatosis mainly occured in the body of gallbladder and presented as a mural nodule that can protrude either intra or extraluminally . with further technological advances in diagnostic imaging benign neoplasms such as gallbladder neurofibromas should be included in the differential diagnosis for chronic epigastric pain symptom in patients with neurofibromatosis . diagnostic laparoscopy followed by cholecystectomy | context : benign nonepithelial neoplasms of the gallbladder are unusual .
the majority of gallbladder neurofibromas are found incidentally in the gallbladder specimens following cholecystectomy .
there have been only few reports in the literature describing this rare entity . in this study
we report a case of gallbladder neurofibroma presenting as chronic epigastric pain in a young patient.case report : a thirty two year old otherwise healthy man presented to our clinic with chronic epigastric pain symptom after eating
. physical examination , laboratory and radiologic workups were unremarkable for signs of biliary tract diseases .
past medical and surgical histories were significant only for neurofibromatosis type i. due to persistent symptomatology , the patient was taken to the operating room for a diagnostic laparoscopy followed by laparoscopic cholecystectomy .
open conversion was necessitated because of the presence of a gallbladder mass preventing safe anatomic dissection .
surgical pathology revealed plexiform neurofibroma with noninflamed gallbladder .
the postoperative course was unremarkable and the patient was pain free at 3 weeks postoperatively.conclusions:benign neoplasms such as gallbladder neurofibroma should be included in the differential diagnosis for chronic epigastric pain symptom in a young otherwise healthy patient with neurofibromatosis .
diagnostic laparoscopy should be considered in an individual presenting with this condition . |
basal cell carcinoma ( bcc ) is a tumor derived from the non - keratinized cells which originate from the basal cell layer of the epidermis . it is a slow growing tumor with a low rate of metastasis and mortality approaching 0.1% of incidence . these tumors are the most common type of cancer in europe , australia , and the united states , and accounts nearly 75% of all non melanoma skin cancers diagnosed in the united states each year . it is widely accepted that exposure to ultraviolet light ( uv ) is the main contributory factor for the development of bcc . consequently , this entity occurs more often in elderly patients over sun - exposed areas such as the head , neck , and upper chest . bcc is seen less often over covered sites such as the genital area , where it accounts for less than 1% of all bccs . vulvar bcc represents less than 5% of all vulvar neoplasms . as with other bccs , however , possibly due to the often poorly - circumscribed nature of these lesions and that the vulva is considered to be a high - risk site for bcc , the recurrence rate has been reported to be 10 - 20% . consequently , mohs micrographic surgery ( mms ) is a superior surgical option in that it offers greater margin control . although cryosurgery has been described as an alternative treatment for common bccs , it has not been reported for vulvar bcc . an 88-year - old hispanic woman presented to our institution with a painless vulvar ulcer of two years duration that had been unresponsive to medical treatment . she had a medical history of type 2 diabetes mellitus , diabetic retinopathy , hypertension , auricular fibrillation , and chronic renal disease stage iii . the patient referred that the ulcer had increased in size , with occasional pruritus and spontaneous bleeding . the physical exam revealed a 2 1.5 cm non - tender erythematous ulcer with irregular and erosive borders over her right labium majus [ figure 1 ] . complete blood count , venereal disease research laboratory and human immunodeficiency virus ( hiv ) tests were not relevant . punch biopsy performed from the ulcer border reported a solid bcc [ figure 2 ] . because the patient refused mms or any other excisional treatments , liquid nitrogen cryosurgery was performed with a close technique , using a liquid nitrogen handheld device ( cry - ac , brymill cryogenic systems , connecticut , ct , u.s.a . ) attached to a flat 2 cm probe and administering double freeze / thaw cycles until a 5 mm freeze rim was reached at each cycle . the patient continued her follow up visits on post procedure days 7 , 14 , 30 , 60 , 90 , 180 , and 365 [ figures 3 and 4 ] . a control biopsy was performed on post procedure day 90 , which was negative for bcc . no clinical evidence of recurrence was detected at one - year follow up [ figure 5 ] . erythematous ulcer with irregular and erosive borders on the right labia majora islands of basaloid cells with peripheral palisading and clefting are seen hemorrhagic crust in the ulcer base seen 14 days after cryosurger scar tissue is observed three months after cryosurgery no malignancy observed at 1 year follow up bcc of the vulva is relatively rare and comprises about 2 - 4% of all vulvar cancers . uv exposure is thought to be the major contributor in the pathogenesis of bcc ; however , it does not appear to play a major role in the development of bcc of the vulva . suppression of the immune system by way of mutations in tumor suppressor and regulatory genes may be responsible . barrett et al . , reported the importance of p53 mutations in the pathogenesis of bcc in roughly 50% of cases ; such factors that predispose to these gene mutations include advanced age , exposure to ionizing radiation , and chemicals ( such as arsenic ) , inherited genodermatoses , and chronic inflammation . we believe that in this case , the vulvar lichenoid dermatitis could be a contributory factor . although the vulva is considered to be a high - risk site with respect to bcc and mms is the gold standard for treatment , the delicate nature of the area may preclude complete removal by a surgical technique without compromising vital anatomical function . cryosurgery tends to be most useful in the treatment of low risk bcc , although good results have been reported following treatment of high risk lesions . when the lesion is carefully selected and in expert hands recurrence rates may be as low as 1% . however , no descriptions or recommendations for vulvar bcc have been reported when treating with liquid nitrogen cryosurgery . the destruction of bcc with liquid nitrogen cryosurgery uses the effects of extreme cold ( tissue temperatures of minus 50 - 60c ) to effect deep destruction of the tumor and surrounding tissues . individual treatment techniques vary considerably , with both open and closed spray techniques and single or multiple cycles of freezing ( freeze / thaw cycles ) . double freeze / thaw cycles are generally recommended for the treatment of facial bcc , although superficial truncal lesions may require only a single treatment cycle . a study comparing cryosurgery ( 20 seconds freeze , 60 seconds thaw 2 cycles ) to standard surgical excision for head and neck superficial bcc and small nodular bcc found no significant difference in recurrence rates at one year . to reduce the possibility of recurrence or failure of treatment , aggressive treatment is recommended to achieve complete destruction of the tumor at first attempt rather than limiting the destruction to avoid a poor cosmetic result , which leads to under treatment and eventual recurrence . as per our experience with this case , we believe that double freeze / thaw cycles until a 5 mm freeze rim is reached on each cycle is an acceptable recommendation for the treatment of vulvar bcc . to the best of our knowledge , this is the first report of a vulvar bcc successfully treated with liquid nitrogen cryosurgery with no recurrence after one year . since more patients and follow up time are needed to establish its curative rate , we suggest that cryosurgery should not be first line treatment , but could be an alternate treatment in those cases of vulvar bcc where mms or other excisional procedures can not be performed . | basal cell carcinomas ( bcc ) on the genital area account for less than 1% of all bccs .
surgical management is indicated .
recurrence rate of vulvar bcc has been reported to be 10 - 20% .
mohs micrographic surgery ( mms ) is a superior surgical option .
other treatments include radiation and topical immuntherapy .
cryosurgery for vulvar bcc has not been reported .
we present the case of a 88-year - old hispanic woman with a vulvar ulcer that was confirmed as bcc by histopathology and treated with liquid nitrogen cryosurgery .
control biopsy was performed on day 90 was negative for bcc .
no clinical evidence of recurrence was detected after one year .
although , the vulva is considered to be a high - risk site with respect to bcc and mms is the gold standard for treatment , the delicate nature of the area may preclude complete removal by a surgical technique without compromising vital anatomical function .
liquid nitrogen cryosurgery uses the effects of extreme cold to effect deep destruction of the tumor and surrounding tissues .
this is the first report of a vulvar bcc successfully treated with liquid nitrogen cryosurgery .
we suggest this technique could be of benefit as an alternative treatment in cases where excisional procedures can not be performed . |
a 48-year - old woman presented with a vaginal mass that was an incidentally detected lesion during gynecological cancer screening . a physical examination revealed a hard mass on the anterior wall of the vagina , and the laboratory results were unremarkable . mr imaging was performed on a gyroscan intera 1.5 t unit ( philips , best , the netherlands ) . axial and coronal t1-weighted images ( tr 739/te 25 ) with a 5 mm slice thickness as well as axial and coronal t2-weighted images ( tr 4218/te 100 ) with a 5 mm slice thickness were obtained . in addition , axial and sagittal gadolinium - enhanced t1-weighted images ( tr 139/te 25 ) with a 5 mm slice thickness as well as sagittal dynamic gadolinium - enhanced t1-weighted images ( tr 165/te 4.6 ) with an 8 mm slice thickness were obtained . the mass was demonstrated as a well - defined , oval - shaped mass in the posterior perivesical space that measured 38 35 28 mm . this mass was located posterior to the inferior wall of the bladder and the upper portion of urethra and compressed both structures . furthermore , the mass was located anterior to the vagina and uterine cervix and was separated from these structures ( fig . the mass displayed heterogeneous intermediate signal intensity with focal nodular or curvilinear dark signal intensity areas within the tumor as seen on t2-weighted images ( figs . the signal intensity of the mass was similar to that of skeletal muscle ( fig . after intravenous injection of gadopentetate dimeglumine ( magnevist , schering , erlangen , germany ) , the mass showed strong and homogeneous enhancement on t1-weighted images . on contrast - enhanced dynamic mr images obtained at 30-seconds , 1- , 2- , and 3-minutes after the administration of contrast material , the mass showed fast and persistent enhancement on early and late phase images ( figs . the preoperative diagnosis based on these mr findings included a leiomyoma from the urinary bladder or urethra , a neurilemmoma , and a soft tissue sarcoma . at surgery , a well encapsulated , round , the mass was easily separated from the adjacent organs such as the urinary bladder , urethra , vagina , and uterine cervix . a histological examination of the tumor specimen showed monotonous small round or ovoid stromal cells around the vessels without spindle cell changes . the tumor was characterized by the presence of numerous small- to medium - sized and thin - walled intratumoral blood vessels . a variable number of inflammatory cells and myxoid fibrous stroma were also detected in the lesion . from immunohistochemical analysis , angiomyofibroblastoma predominantly occurs in middle - aged premenopausal women and involves the genital region ( 1 - 6 ) . the most common site is the vulva , followed by the labia major , vagina , periclitoris and perineum ( 3 ) . since an amfb has a benign clinical behavior , it should be differentiated from an aggressive angiomyxoma , cellular angiofibroma , and other myxoid tumors of the genital area where radical surgical treatment is indicated ( 4 ) . to the best of our knowledge , this is the first reported case in the literature of an amfb that arose in the posterior perivesical space . histologically , an amfb is a benign soft tissue tumor of myofibroblastic differentiation and represents neoplastic proliferation of stromal cells ( 1 ) . an amfb is distinguished from an aggressive angiomyxoma by its higher cellularity , by the frequent presence of plump stromal cells , and to a lesser degree with stromal myxoid changes ( 5 ) . to date , only two previous reports have described imaging features of this rare neoplasm . the first reported case was a 24-year - old woman that presented with a round mass that extended to the paraurethral region with homogeneous intermediate signal intensity as seen on a t2-weighted mr image ( 3 ) . the second reported case was a 46-year - old woman that presented with a perineal mass that was mainly well delineated and hyperintense , similar to the ischiorectal fat on a t2-weighted mr image , and homogeneously enhanced on a contrast - enhanced mr image ( 6 ) . the mr findings in our case appear to be quite different from those in previous reports , except for the well - defined margin of the tumor . in our case , we also observed nodular or curvilinear dark signal intensities within the tumor on t2-weighted mr images . the dark signal intensities corresponded well to the areas of hypocellularity and abundant collagenous stroma as seen on the pathological specimen . another important radiological finding is the strong and homogeneous enhancement of the tumor ( 6 ) . in contrast - enhanced dynamic mr images , the mass in our case showed a similar enhancement pattern to the uterus , which was a strong and homogeneous enhancement at early phase and persistent enhancement at late phase . this marked delayed contrast enhancement may be due to a prolonged high concentration of contrast medium in the tumor tissue , caused by delayed washout of contrast medium from the abundant fibrous tissue . in summary , we have presented a case of amfb in the posterior perivesical space and have reviewed the mr imaging features . as seen in this case and in previously reported cases in the literature ( 3 , 6 ) , the mr features for amfb are nonspecific and are similar to the features of the other more common pelvic tumors such as leiomyomas , neurogenic tumors , soft tissue sarcomas , or fibromyxoids or angiomyxoid mesenchymal neoplasms . however , where a well - marginated mass that involves the external genitalia in women shows heterogeneous hypointensity on t2-weighted mr images and intense and delayed contrast enhancement , an amfb should be included in the differential diagnosis . | angiomyofibroblastoma is a rare benign soft tissue neoplasm that predominantly occurs in the genital region of middle - aged women .
we present a case of an angiomyofibroblastoma that involved the posterior perivesical space in a 48-year - old woman .
we have documented the magnetic resonance imaging features of this case . |
a 22 weeks pregnant woman came to us for advice regarding the chance of offspring getting retinoblastoma as her first child had bilateral retinoblastoma . the other offspring was 1 year and 9 months old at the time of presentation with a history of leukocoria in the left eye . she was diagnosed to have bilateral retinoblastoma ; group b in the right eye and group d in the left eye ( international classification of retinoblastoma classification ) . systemic chemotherapy ( four cycles ) and external - beam radiation therapy failed to control the tumor in the left eye and hence the left eye underwent enucleation with ball implant , 8 months after presentation . the right eye was salvaged with good tumor control and the preservation of vision [ fig . 1 ] . clinical findings in the sibling showing bilateral retinoblastoma ( a ) ultrasound b scan of the left eye showing large tumor in visit 1 ( b ) fundus drawing of the left eye showing tumor coded by yellow color ( c ) ultrasound b scan of the right eye showing tumor . ( d ) post treatment regressed tumor in the right eye at last follow up ( 7 years follow - up ) a cytogenetic analysis done at that time revealed male karyotype with 13q14 deletion in the father , and the mother was normal . while the mother was found to be normal , the father revealed a retinoma in his right eye . as direct screening by mutational analysis is time - consuming and needs more sample , prenatal cord blood was taken for molecular linkage analysis for retinoblastoma . the fetus was found to have the defective rb1 allele inherited from the father [ fig . 2 ] and gene tracking ( predictive testing ) in the case of familial retinoblastoma the child was born at 34 weeks and the first ophthalmic evaluation done on the 2 day of life was normal . the child underwent periodic monthly examination under anesthesia until 2 years of age . at 28 months of age , she developed a tumor ( group a ) in the inferonasal retinal periphery of the right eye that was treated with cryotherapy [ fig . the child continued to be under bi - monthly clinical follow - up . visual assessment with lea symbol charts showed the visual acuity of 20/20 in both eyes . at a recent follow - up at 7 years of age , the fundus was stable , and visual acuity maintained in both the eyes . fundus photographs ( retcam ) of the child with defective allele detected on prenatal diagnosis ( a ) fundus photograph of the right eye at 2 days of birth . ( c ) fundus photograph of the right eye at 28 months showing tumor at inferonasal periphery ( d ) post treatment cryo , regressed tumor at 3 months follow - up prenatal diagnosis of retinoblastoma with clinical follow - up has been reported earlier , however , to the best of our knowledge , this is the first report from india to show the clinical correlate of genetic findings on a prenatal diagnosis . it is important for an ophthalmologist to determine the etiology of an unilateral case ( whether it is hereditary or not ) as the management of the patient ( examination of fellow eye , frequency of follow - up and sometimes treatment which should be provided along with genetic counseling ) may be different when compared to a bilateral case . in this case , already having a child with retinoblastoma ( with one eye enucleated ) prompted the mother to undergo a prenatal screening for the next offspring . even though primary prevention was not possible in this situation , prenatal diagnosis with serial ultrasound scans of the fetus could help look for a tumor in the fetal eye at an early stage . if detected in utero , a fetus with retinoblastoma can be delivered early to initiate early treatment and possibly reduce the morbidity and preserve the vision . though the child was identified to have the inherited paternal risk allele hence , it is likely that these children may develop tumor at a later stage of life alarming for careful and regular long - term surveillance . thus , prenatal diagnosis offers early detection of the tumors in the course of the disease and periodic examinations aid in eye salvage . | retinoblastoma is the most common malignant intraocular tumor in pediatric age group if undetected leads to ocular mortality .
prenatal diagnosis is an emerging technology to detect fatal diseases in utero such that subsequent management is planned to reduce the ocular morbidity .
we describe a case demonstrating the importance of prenatal diagnosis in a child with a strong family history of retinoblastoma and importance of a long - term clinical follow - up in these cases . |
infiltration of the nervous system by hematological malignancy , generally lymphoma , is termed as neurolymphomatosis ( nl ) . it 's mostly seen in b - cell lymphomas and rarely in t - cell lymphomas . seventy - two cases of nl caused by nhl were identified in the most comprehensive review that was reported during a 28-year period . neurolymphomatosis is typically presented as neuropathy that may affect cranial nerves , nerve roots / plexus or peripheral nerves with the predilection of the brachial and lumbar plexuses , along the course of peripheral nerves of the extremities , and the trigeminal nerve root . diagnosis of nl is difficult because of the variable presenting symptoms and wide differential diagnosis including the viral , inflammatory or paraneoplastic neuropathy , ( cranial ) neuritis multiplex , leptomeningeal lymphomatosis , nerve root compression , disc herniation , radiochemotherapy , lymphoma - associated vasculitis and degenerative joint disease . furthermore , performing a biopsy of the involved nervous structure may result in permanent nerve damage ; in addition , it may be difficult to obtain , especially in central localizations . although , magnetic resonance imaging ( mri ) typically shows enlargement and enhancement of affected nerves , it does not always provide optimal visualization of lymphomatous involvement of peripheral nerves . fdg pet / ct has been using increasingly in diagnosis , to guide sites for biopsy and in the assessment of response to therapy in nhl . by the help of ct component , it provides important information about anatomical details of less commonly involved peripheral nerves also , especially in cases with nl . a 63-year - old male patient treated for diffuse large b cell type nhl of left testis was in complete remission for 5 years . he was referred to nuclear medicine department for fdg pet / ct imaging to search for possible recurrence . for pet / ct examination , patient was intravenously injected 550 mbq of f18-fdg after 8 h of fasting period . after one hour of waiting period in a silent room , patient was imaged using an integrated pet / ct camera , which consisted of a 6-slices ct gantry integrated on a lso based full ring pet scanner ( siemens biograph 6 ) . the injected dose , injection time and body weight were used to calculate the maximum standardized uptake values ( suvmax ) . pet and fusion images showed bilateral pathological intense fdg uptake in trigeminal nerves with a suvmax of 16,6 [ figure 1 , arrows ] . there were also increased fdg accumulation ( suvmax = 6,4 ) at the d1 spinal nerve root and slightly increased tracer uptake located at spinal cord between the level of d12 and cauda equina . cranial mri revealed thickening of bilateral 5 cranial nerve [ figure 2a and b ] . spinal mri demonstrated pathologic signal changes at the spinal cord between d12 level and cauda equina suspicious for lymphomatous involvement . pet and fusion images showed bilateral pathological increased fdg uptake in trigeminal nerves with a suvmax of 8.9 ( arrows ) consistent with lymphoma involvement . there were also increased fdg accumulation ( suvmax = 6,4 ) at the d1 spinal nerve root and slightly increased tracer uptake at the spinal cord located from the level of d12 to cauda equine suggestive of disease recurrence ( a and b ) cranial mri showed increased signal intensity and thickening of the trigeminal nerves ( arrow ) , suspicious of lymphomatous involvement four clinical patterns of nl with decreasing frequency are painful polyneuropathy or polyradiculopathy , followed by cranial neuropathy , painless polyneuropathy , and peripheral mononeuropathy . in the case of delayed diagnosis or ineffective empiric treatment , it may progress over weeks to several months . cranial neuropathy is a rare presentation of nl which is sometimes hard to diagnose using the conventional imaging modalities . diagnosis of nl depends on histopathological examination showing the infiltration of affected nerves by malignant lymphocytes . nerve biopsy may not be feasible when deep - seated roots or cranial nerves are involved and is often nondiagnostic . csf cytopathological examination may be helpful in a few cases of nl accompanied by meningeal dissemination which constitute 20 - 40% of patients . although mri is the most commonly used imaging method of nl and typically shows enlargement and enhancement of affected nerves after gadolinium administration , it does not always provide the optimal visualization of lymphomatous involvement of peripheral nerves . f-18 fdg whole - body pet / ct imaging is useful for early diagnosis , identifying the distribution of neurolymphomatosis and determination of possible biopsy sites . fdg pet demonstrated nl as nodular or linear hypermetabolic lesions at the affected cranial nerves , nerve roots / plexus or peripheral nerves . diagnostic yield of mri and fdg - pet was reported as 77% and 84% , respectively in nl patients . however , both imaging techniques have diagnostic limitations such as false positivity in infection or inflammation . nl is a challenging diagnosis however pet / ct imaging may allow for accurate determination of the extent of the disease , as in our case . | bilateral trigeminal nerve involvement is a rare presentation of non - hodgkin lymphoma ( nhl ) .
the trigeminal nerve , also called the fifth cranial nerve , leaves the brainstem and exits the base of the skull to supply sensation to the face . in this case , we present a case of a 63-year - old male patient with a history of nhl and a more recent history of headache and trigeminal neuralgia .
the patient underwent pet / ct demonstrating bilateral increased fdg uptake in trigeminal nerves . |
extrarenal calyces are rare anomalies of the upper urinary tract . only 20 cases were reported so far in the literature . the rarity of this anomaly and the complexity of possible associated anomalies often makes the preoperative diagnosis difficult . they are known to be associated with other anomalies , including bifid kidney and renal dysplasia . to the best of our knowledge , only 3 cases have been reported in the literature wherein , it was associated with pelviureteric junction obstruction ( pujo).[24 ] when associated , management options depend on the renal function and presenting symptoms . herein , we are reporting a case where routine preoperative imaging did not throw any light on the diagnosis and was an intraoperative surprise . a 9-year - old male child presented to us with complaints of pain in the left flank for 1 month . an ultrasound of the abdomen showed severe hydronephrosis of the left kidney with a parenchymal thickness of 2 mm with upper ureteric dilation . a radionuclide scan showed a poorly functioning left kidney with a split renal function of 7% with obstructed curves . an ante grade dye study was done , which showed significant stasis in the hydronephrotic kidney and the ureter was not visualized . intraoperatively , a large dilated kidney with papery thin cortex was found with 5 pseudopodia - like projections ( extrarenal calyces ) arising from it and connected to the pelvis ; pujo was noted . the rest of the ureter appeared normal . in view of the complex nature of the lesion and poorly functioning kidney , a right nephroureterectomy was performed [ figure 1 ] . the presence of extrarenal calyces is a very rare anomaly of the upper urinary tract that was first described in 1925 . a few cases were reported in the literature and the exact etiology of this condition is unclear . it has been hypothesized that the anomaly could be due to a disparity resulting from slow development of the metanephric tissue or to a relatively rapid development of the ureteric bud . a kidney with extrarenal calyces is usually associated with other anomalies , such as bifid kidney , renal ectopia , horseshoe kidney , and renal dysplasia . it might be an incidental finding diagnosed at autopsy or may present with complications , such as hydronephrosis secondary to associated pujo , as in our case . because the incidence of this anomaly is quite low and the clinical presentation is very similar to classic pujo , a high degree of suspicion should be kept , especially when preoperative radiologic findings are not classical and show distorted calyceal appearance on preoperative imaging studies . this would safeguard against inadvertent injury of the calyces when operating on a well - functioning kidney . but , when they are associated with complications , such as pujo , as in our case , the management is not standardized . ( 2006 ) mentioned the successful management of pujo associated with extrarenal calyces in a pelvic kidney using transperitoneal laparoscopic reconstruction . the management options may include the following : ( 1 ) to do a classic pyeloplasty and follow the patient , risking failure of pyeloplasty and recurrent urinary tract infection ( uti ) ( as was done in the previous case ) ; ( 2 ) to resect the pelvis and do a ureterocalicostomy with fusion of the calyces ( again associated with extensive dissection and suturing ) ; or ( 3 ) to go ahead with a single - stage nephroureterectomy , thereby preventing the child from further recurrent uti . the management strategies are controversial and should be decided on individual merits and surgeon competence . however , in kidneys with well - preserved function , a renal sparing procedure is worth attempting . | extrarenal calyces are one of the rare renal anomalies associated with the collecting system .
their association with renal ectopia or horse shoe kidney is known .
but , here in , we are reporting an intraoperative surprise , where extrarenal calyces were associated with pelviureteric junction obstruction and routine preoperative imaging did not show any light on the diagnosis . |
the 2010 human influenza a ( h1n1 ) virus pandemic seriously affected many countries , including kuwait . in children , respiratory involvement usually occurs with h1n1 ; extra pulmonary problems are not common.1 liver involvement is rare and needs early identification and treatment . a 9-year - old child was admitted with intermittent low - grade fever , cough , vomiting , and abdominal pain lasting for one week . he received oral antibiotics ; the fever subsided initially but reappeared after a few days , along with jaundice . he was previously healthy , with no past history of liver disease . on examination , he was alert and oriented , his temperature was 39c , he was icteric , appeared toxic , was sweating , had a respiratory rate of 30 breaths / minute , and had congested tonsils ; a respiratory system exam showed prolonged expiration with expiratory rhonchi . there were no signs of meningeal irritation , and the rest of his physical examination was unremarkable . investigations revealed a hemoglobin ( hb ) count of 14.5 g / dl , a total leukocyte count of 3.37 10 , neutrophils 19% , lymphocytes 68% , a platelet count of 255 10 . urinalysis showed mild urobilinogen and ketones , but a urine culture was sterile after 48 hours of incubation . mmol / l , alanine amino - transferase was 1763 u / l , aspartate amino - transferase was 1871 units / l , alkaline phosphatase was 246 units / l , and gamma glutamyl transferase was 107 units / l . g / l , serum ammonia count 74 mmol / l , and serum lactate 2.06 mmol / l . the patient had normal serum amylase and lipase levels , a negative cold agglutinin test , a normal ultrasound of the abdomen , and a negative chest x - ray . nasal and throat swabs for h1n1 were positive by a reverse transcription polymerase chain reaction ( pcr ) test . a hepatitis a , b , and c serological screen was negative , and his serum acetaminophen level was normal . furthermore , an additional work - up to rule out other causes of fulminant liver failure was performed , including negative blood tests for herpes simplex virus pcr , adenovirus pcr , epstein his immunoglobulins ( igg , igm , and iga ) were within normal limits ; he also had a negative antinuclear antibody ( ana ) < 1:40 titer and a negative anti - smooth muscle antibody and anti - liver kidney microsomal antibody ( anti - lkm ) , ruling out the possibility of autoimmune hepatitis . finally , his serum amino acid and urine organic acids were unremarkable . he was treated according to centers for disease control and prevention ( cdc ) guidelines2,3 with tamiflu ( oseltamivir ; genentech , san francisco , ca ) for five days and other supportive measures , including fresh frozen plasma , iv - administered vitamin k , lactulose , and prophylactic intravenous antibiotics . severe infection is characterized by pneumonia , sepsis , septic shock , and multi - organ failure . extra - pulmonary involvement is rare in uncomplicated human infections.1 studies of mouse models suggest multiple organ localization , including the lungs , heart , thymus , liver , and spleen.4 snchez - torrent et al reported h1n1 encephalitis in a 3-month - old infant from spain.5 hepatic involvement is not frequent and accounts for less than 3% of all cases.1 carrillo - esper et al , in 2010 , reported two adult h1n1 patients with hepatic involvement.1 el - shabrawi et al , in 2011 , reported a 10-month - old child with acute myocarditis and fulminant hepatic failure associated with h1n1.6 the subject of the current case report had acute hepatic failure that presented as jaundice , elevated liver enzymes , and coagulopathy . most of the other causes of liver failure had been ruled out by relevant investigations . he responded well to antiviral and other supportive treatment , and showed full clinical and laboratory recovery . no viral replication is needed to produce hepatic damage , as there is evidence of hepatic oxidative stress and a decrease in antioxidant defenses even when the virus is isolated only from the lungs . this might be explained by the production of pro - inflammatory cytokines in the respiratory airway that leads to changes in hepatic metabolism and enzymatic activities.7,8 even though hepatic complications are rare in pediatric h1n1 cases , in reporting this case we would like to draw the attention of pediatric health care professionals to the importance of early recognition , focused investigations , diagnosis , and treatment of complicated human h1n1 infection . | liver involvement in pediatric influenza a ( h1n1 ) infection is rare . focused clinical evaluation and
laboratory tests can rule out or identify hepatic complications early on . here
we report on a 9-year - old boy treated by the gastroenterology , hepatology , and nutrition unit of al - adan hospital s pediatric department .
the patient , who was infected with h1n1 during the 2010 pandemic , showed symptoms of associated acute hepatic failure , was managed conservatively , and recovered completely following treatment .
the author would like to draw the attention of pediatricians to the hepatic aspect of human h1n1 infection in order for them to recognize it early and treat it in a timely manner . |
idiopathic chronic pancreatitis associated with minimal clinical symptoms , icterus and notable hypergammaglobulinaemia was first described in 1961 by sarles et al.1 in 1995 , yoshida et al.2 documented a case of a 68-year - old woman with obstructive icterus , diffusely enlarged pancreas with irregular caliber of pancreatic duct ( without significant stenosis or dilatations ) , significantly increased -globulin levels , and histologically verified pancreatic fibrosis . this disease was labeled autoimmune pancreatitis ( aip ; as a parallel for autoimmune hepatitis ) . aip is currently classified into two subgroups.3 type 1 aip , also known as lymphoplasmacytic sclerosing pancreatitis ( lpsp ) , usually affects men between 50 and 60 years of age , with histological findings of periductal lymphoplasmacytic infiltrates , oblitering arteritis , and excessive fibroproduction.4,5 in 95% to 98% of cases , aip type 1 is accompanied by immunoglobulin g4 ( igg4 ) positivity in tissue samples and/or elevated igg4 levels in blood serum . aip type 1 is frequently combined with simultaneous involvement of extrapancreatic organs ( e.g. , sclerosing cholangitis,6 retroperitoneal fibrosis,7 igg4 positive tubulointestitial nephritis,8 chronic sclerosing sialadenitis,9 and sicca syndrome10 ) and other extrapancreatic lesions . in contrast , aip type 2 is most commonly diagnosed in the fourth decade of life , with the same incidence in men and women and is usually combined with the presence of inflammatory bowel disease . igg4 positive biopsy and/or elevated igg4 serum levels ( diagnostic for aip type 1 ) are usually absent in aip type 2 . besides the lymphoplasmacytic infiltrates , typical histological findings of aip type 2 also include ductuli destructing inflammation with granulocytic epithelial lesions with partial or full obstruction of the pancreatic ducts.11 the presence of icterus is uncommon.12 we present a case report of concurrent findings of aip , igg4 positive mastitis , and mikulicz syndrome . a publication of unidentified case reports is allowed by ethical committee of the university hospital brno . for the last 3 years , she was followed by the department of ophthalmology , university hospital brno for histologically verified mikulicz syndrome . subsequently , salivary function was also tested , but only nonsignificant decrease in function was revealed . in 2006 , the patient noticed right - sided submandibular induration ; extirpation was carried out for suspected malignancy which was ruled out by histological findings of a fibrotised salivary gland . in 2009 , she was examined by the oncology department for recurring mastitis ; biopsy findings showed igg4 infiltrates ( figs 1 and 2 ) . based on the patient 's prior medical history , aip was strongly suspected ; therefore , serum immunoglobulin levels were tested . g / l ) ; igg4 was more than 3-times the normal limit ( 920 mg / l ; normal range , 8 to 140 mg / l ) and rheumatoid factor and antipancreatic duct antibodies also tested positive . according to japanese criteria abdominal sonography and computed tomography revealed the typical picture of aip - an enlarged sausage - like pancreas . the steroid treatment led to a normalization of sonographic finding ( figs 3 and 4 ) . further endosonography confirmed a diffusely enlarged pancreas with rough , unclear outlines , and a small caliber duct . the patient was treated with prednisone at an initial dose of 40 mg for 2 weeks . the dose was then tapered by 5 mg with a maintenance dose of 10 mg of prednisone prescribed for 3 months . the patient has been followed for 1 year after completion of steroid treatment and she is symptoms free with normalized biochemical and sonographic findings . it is widely accepted that aip is a part of multisystem disorder characterized by histomorphologic changes with concurrent presence of immunoglobin igg4 in blood plasma and/or tissues.13,14 as such , the term igg4 related sclerosing disease is used for this entity by some authors.15,16 aip is frequently associated with simultaneous involvement of extrapancreatic organs , in particular the hepatobiliary system,6 kidneys,17 salivary glands , retroperitoneal fibrosis , and pulmonary impairment.7,9,18,19 currently , aip is divided into two subgroups . aip type 1 , which is more common , has symptoms and diagnostic criteria equivalent to disorders described in earlier literature as an autoimmune form of pancreatitis or lpsp.4 this type of aip is often accompanied by concurrent extrapancreatic disorders and has recently been considered to be a part of igg4 associated systemic disease.13 findings of high levels of igg4 immunoglobulin in blood serum and/or affected tissues with their progressive fibrotization are typical for this diagnostic entity . the presented case report documents a patient with histologically verified mikulicz syndrome and recurring mastitis who we diagnosed with concurrent aip . asian criteria20 were used for the aip diagnosis , since the pancreas involvement was not focal and therefore , biopsy necessary for hisort classification system21 was not indicated . while igg4-related sclerosing mastitis has been described before,22 to the best of our knowledge , this is the first reported case of concurrent findings of aip and igg4 positive mastitis . neither aip symptoms , nor mastitis recurred within the 12 months period following termination of steroid treatment . the probability of aip recurrence after steroid withdrawal is 30% to 50%.23 - 25 in this case , steroid , or azathioprine treatment would be indicated.26,27 in conclusion , by adding an additional organ affected with igg4 derived inflammation , our findings support a concept of aip as a systemic igg4 disease with multisystem involvement . | autoimmune pancreatitis ( aip ) type 1 is commonly associated with simultaneous involvement of extrapancreatic organs .
sclerosing cholangitis , sialadenitis , retroperitoneal fibrosis , sjgren syndrome , and other extrapancreatic lesions are often observed concurrently with aip .
high levels of immunoglobulin g4 ( igg4 ) in the blood serum and affected tissues are typical of this diagnostic entity .
we describe a case report of a 58-year - old female with findings of aip ( according to asian criteria ) , igg4-positive mastitis , and histologically verified mikulicz syndrome .
the effect of corticoid therapy supported the diagnosis of aip and simultaneously led to the eradication of recurrent mastitis . to the best of our knowledge ,
this is the first reported case of concurrent findings of aip and igg4 mastitis .
our case report supports the concept of systemic igg4 syndrome with multisystem involvement .
timely diagnosis and appropriate therapy can be effective in a high percentage of patients . |
a 32-year - old male with profound intellectual disability and autism spectrum disorder presented to us from a psychiatric unit following seizures in the context of a new fever . however , in the last 4 months , he required institutionalized psychiatric care due to new behavioral changes , including aggression , shouting fits , and self - injurious behavior , and had developed a tendency to turn his neck from side to side . examination revealed he had a fever of 39.4 degrees celsius and a heart rate of 107/minute and could follow one - step commands . he was observed to have repetitive rotational movements of the neck and brief myoclonic movements in which he would extend his neck and posture his limbs . creatine kinase ( ck ) was elevated at 4,779 u / l , c reactive protein was normal and white cell count was marginally elevated at 11.7910 /l . following the exclusion of other related conditions , including nonconvulsive status epilepticus and intracranial infections , a diagnosis of nms was made , and he was treated with lorazepam and bromocriptine . no further seizures were observed following treatment with levetiracetam ; however , fever , tachycardia , and blood pressure lability persisted . rigidity continued to persist for a month , despite the normalization of ck , before improving . two weeks later , he developed status epilepticus manifesting with gaze deviation and twitching of the hands and jaw . status epilepticus was abolished with midazolam infusion , levetiracetam , phenytoin , valproic acid , carbamazepine , and lamotrigine ; however , he still had intermittent episodes of clinical seizures and tachycardia . anti - glycine receptor antibodies were positive in the serum ( oxford neuroimmunology testing service , oxford university hospitals , united kingdom ) . this finding , together with his clinical features , was consistent with a diagnosis of perm . glutamic acid decarboxylase , voltage gated potassium channel complex ( vgkcc ) , and n - methyl - d - aspartate receptor ( nmdar ) antibodies were negative . a computer tomography scan of the chest , abdomen and pelvis was negative for malignancy . after discharge , he returned to his premorbid status with no further seizures , rigidity or head turning . the dsm - v diagnostic criteria for nms requires the presence of rigidity , changes in mental status , dysautonomia , elevated ck and elevated temperature . these features , with the exception of ck elevation , are frequently present in cases of perm described in the literature . it is therefore unsurprising that our patient was initially diagnosed with nms : he had recent neuroleptic exposure , persistently elevated body temperature , elevated ck and white cell count , and an apparent initial treatment response to lorazepam and bromocriptine . the marked ck elevation up to 17,847 u / l seen in our patient was diagnostically in favor of nms , as it has not been previously described in perm . there was also no csf leukocytosis to suggest a possible immune - mediated inflammatory process , even when repeated at the peak of his illness , whereas csf pleocytosis has been observed in 60% of patients diagnosed with perm . other nms - mimicking conditions , including nonconvulsive status epilepticus , malignant catatonia , serotonin syndrome and intracranial infections , were also considered and excluded during the patient s initial workup before the diagnosis of nms was made . with time , it became evident that our patient s clinical course was atypical of nms . firstly , rigidity and dysautonomia persisted longer than would be expected in nms , given the brief exposure to neuroleptics . secondly , although seizures can occur in nms , refractory status epilepticus is highly unusual . this observation is consistent with prior reports of status epilepticus associated with the anti - glycine receptor antibody . in previously reported cases of perm , a prodrome of painful sensory symptoms and muscle spasms were typically elicited , alerting clinicians to this rare diagnosis . this was particularly difficult to discern in our patient due to his severe intellectual disability . he presented with a 4-month history of behavioral changes and aggression , with new head movements that were thought to be a stereotypy . stereotypies are common in autism and can manifest as violent body rocking and head turning . in retrospect , the development of this new stereotypy was likely a behavioral response to relieve the painful neck rigidity due to perm . besides perm , there have also been increasing reports of other immune - mediated encephalitis presenting with an nms phenotype , including anti - nmdar and anti - vgkcc encephalitis . therefore , there is the potential for neuroleptic use and initial misdiagnosis as nms before progressing to a more fulminant clinical course that includes seizures , encephalopathy , dysautonomia , and movement disorders . our case highlights the need to consider these alternative diagnoses when the clinical picture of nms is atypical , particularly in light of the recent discovery of these antibody - associated disorders . | we present a case of 32-year - old male with profound mental retardation and autism spectrum disorder who had presented with seizures , rigidity and elevated creatine kinase and was initially diagnosed as neuroleptic malignant syndrome ( nms ) .
the patient subsequently had a complicated clinical course , developing refractory status epilepticus , which lead to the eventual diagnosis of progressive encephalomyelitis with rigidity and myoclonus ( perm ) .
we discuss the clinical similarities and differences between nms and perm , and highlight the need to consider alternative diagnoses when the clinical picture of nms is atypical , particularly in this patient group where the history and clinical examination may be challenging . |
anterior segment metastases account for about 7.214.1% of all intraocular metastatic tumors with those to the iris representing 3.67.8% of the cases . the aim of this study is to present the case of a 43-year - old patient with a rare small - cell lung carcinoma metastasis to the iris . a patient with small - cell lung carcinoma and metastases in the brain who had been treated with chemo- and radiotherapy attended an outpatient clinic because of redness of her left eye . based on the ophthalmological examination , a diagnosis of numerous metastatic tumors to the iris was made and the patient was referred for re - chemotherapy . complete regression of the iris lesions was observed after 5 months but unfortunately two months later the patient died , due to progression of her systemic disease . among lung cancers , adenocarcinomas are much more likely to produce distant metastases to the iris than small - cell carcinomas . more than 50% of patients with small - cell lung carcinoma have metastases in the brain . the survival rate in cases of lung cancer with eye involvement is poor and approximates to 7 months . however , since there is a strong probability of angle involvement and subsequent secondary glaucoma , the early onset of treatment can improve the patient 's quality of life during the terminal phase of the disease . a 43-year - old woman , attended the outpatient clinic of the department of ophthalmology , poznan university of medical sciences in september 2009 , because of the redness and slightly decreased vision in the left eye ( le ) . she had a history of small - cell lung carcinoma , diagnosed six months previously , and already treated with chemotherapy ( 5 cycles of cisplatin and etoposide ) and chest irradiation ( total dose of 58 gy ) . however , two months after the initial diagnosis , brain metastases appeared . on ophthalmic examination we noted slightly decreased best corrected visual acuity ( bcva ) to 0.9 and borderline values of intraocular pressure ( iop ) ( 22 mm hg ) of le . anterior segment biomicroscopy of the le revealed a pink , bulky mass on the iris . the tumor involved the lower part of the anterior chamber , reaching up to the pupillary margin , partially covering its aperture . there were also numerous pink , round nodules of different sizes spread over the whole iris ( fig . she received 7 cycles of chemotherapy ( cisplatin and etoposide regimen ) . on the follow - up , one month later , a regression of the metastatic mass was noted with only a few aggregations of pink tissue on the surface of the iris ( fig . at another follow - up , we noted a complete regression of all metastatic nodules with an improvement of bcva ( fig . 3 ) . unfortunately , two months later , the general condition of the patient suddenly deteriorated , because of the recurrence of brain metastases . she died due to a disseminated small - cell lung carcinoma 1 year after the initial diagnosis and 7 months after the iris metastases appeared . the anterior segment examination revealed a tumor mass spread over the whole iris the partial regression of metastatic mass after 7 cycles of chemotherapy the complete regression of all metastatic nodules 3 months later small - cell lung cancer represents 15% of all lung cancers and , contrary to other histological types , it is characterized by a high index of proliferation , short tumor doubling time , a marked tendency to create early blood - related metastases , and high sensitivity to chemotherapy and radiotherapy . small - cell lung cancer can metastasize to the central nervous system , liver , bones and bone marrow . autopsy studies have shown that metastases to the cns occur in over 50% of cases . those to the iris , however , are relatively rare , but if they occur , they coexist with cns metastases in about 44% of cases .
in their study of 40 metastatic iris tumors demonstrated that the most common sites of primary cancer were : breast ( 40% ) , lung ( 28% ) , bronchi carcinoid ( 8% ) , malignant melanoma ( 8% ) , esophagus ( 2% ) , larynx ( 2% ) , prostate ( 2% ) and kidney ( 2% ) . all the iris metastes were unilateral , however , in 35% of cases ipsilateral choroid involvement was noted . there were bilateral choroidal metastases in one case and an orbital involvement in another one . this seems to confirm the theory that they are related to the major arterial circle of the iris and spread via the blood stream . sometimes , with the growing of such a tumor , blood may appear in the anterior chamber with the clinical manifestation mimicking can imitate acute anterior uveitis . the angle involvement will cause secondary glaucoma and painful eye . in our patient intraocular pressure treatment options for iris metastatic tumor include radiotherapy , chemotherapy , local resection ( which can be preceded by tumor irradiation ) , observation or enucleation [ 5 , 8 ] . globe removal should only be advised in the case of a large tumor complicated by refractory secondary glaucoma and pain [ 1 , 5 ] . despite many possible treatment options advanced metastatic tumors the mean survival time after a diagnosis of metastases of lung cancer to the iris is 7 months , which was also observed in our case . the short survival time seems to limit any benefits of screening programs for metastases in the eye . however , early and effective treatment of detected eye pathology in this group of patients can improve their life quality in the terminal phase of the disease . | introductionmetastatic tumors are the most common intraocular malignancies in adults .
anterior segment metastases account for about 7.214.1% of all intraocular metastatic tumors with those to the iris representing 3.67.8% of the cases .
breast and lung are the most frequent primary sites of metastasizing cancer .
the aim of this study is to present the case of a 43-year - old patient with a rare small - cell lung carcinoma metastasis to the iris.case reporta patient with small - cell lung carcinoma and metastases in the brain who had been treated with chemo- and radiotherapy attended an outpatient clinic because of redness of her left eye .
based on the ophthalmological examination , a diagnosis of numerous metastatic tumors to the iris was made and the patient was referred for re - chemotherapy .
complete regression of the iris lesions was observed after 5 months but unfortunately two months later the patient died , due to progression of her systemic disease.discussionamong lung cancers , adenocarcinomas are much more likely to produce distant metastases to the iris than small - cell carcinomas [ 4 ] .
more than 50% of patients with small - cell lung carcinoma have metastases in the brain .
the survival rate in cases of lung cancer with eye involvement is poor and approximates to 7 months .
however , since there is a strong probability of angle involvement and subsequent secondary glaucoma , the early onset of treatment can improve the patient 's quality of life during the terminal phase of the disease . |
patients with obsessive compulsive disorder ( ocd ) have been traditionally described as having a good insight into their symptoms ; they perceive their obsessive - compulsive ( oc ) symptoms as excessive , unreasonable , and distressing . the dsm iv field trial demonstrated that about a quarter of the patients were uncertain about whether their symptoms were unreasonable or excessive , indicating that a broad range of insight exists among patients with ocd . it is now well - recognized that patients with ocd may present with varying degrees of insight , including poor and complete lack of insight into their oc symptoms.[24 ] pathological beliefs appear to be placed along an symptom component properties , they determine obsessions at one end , where beliefs are recognized as irrational . overvalued ideas lie somewhere in the middle , and delusions where the beliefs are considered rational , lie at the other pole . it can be a phenomenological challenge when the thin line of separation between these becomes difficult to discern . ms . s , a 35-year - old , married lady presented with a one - year history of marked social withdrawal , muttering to herself , and suspiciousness . on clarification with her husband regarding her suspiciousness it was found that she kept enquiring from him whether their acquaintances had visited her or not , subsequently she would report about her belief that she felt her acquaintances were not visiting her often , and hence , they could possibly be cheating her , but would not elaborate further . she firmly held on to these beliefs in spite of her husband telling her otherwise . for the last two weeks there had been a worsening of illness , characterized by crying spells , along with two suicidal attempts of high intentionality and lethality . after hospitalization , she was found to be tearful and withdrawn , reported of being fearful and expressed death wishes . an initial impression of psychosis , with a phenomenological inference of delusion of persecution , was made as per the longitudinal course of the illness from the available information , and she was started on tablet risperidone 2 mg . she continued to express fearfulness and did not show much improvement with risperidone . during the course of hospitalization , she was noticed to be repeatedly asking others to forgive her for a mistake she had committed . on further clarification , she elaborated that she had been getting repeated thoughts that she had done something wrong , which could be the reason for her feeling that her acquaintances were not visiting her often . suspicious behavior. she would get these repetitive , anxiety provoking thoughts so often that she started wondering whether she had actually done something wrong . the level of conviction regarding this thought was quite high and she did not feel that this thought was in anyway irrational . hence , she had started feeling , she would constantly ask reassurance from others , would check with her husband as to why a particular acquaintance had not visited her , and would keep repeatedly muttering to herself about this issue . the thoughts were very repetitive , stereotyped , and distressing , while they remained uncontrollable . as the frequency of these thoughts increased , she started feeling sad throughout the day , along with ideas of hopelessness , guilt , and suicidal ideas . subsequently , her diagnosis was revised to obsessive compulsive disorder ( ocd ) , with obsessions of intrusive thoughts / images and compulsion of reassurance seeking as denoted in the yale brown obsessive compulsive scale ( ybocs ) symptom checklist . the ybocs obsession score was 16 and compulsion score was 10 ( ybocs total score of 26 ) . she was started on fluoxetine 20 mg / day , which was increased to 40 mg per day in a week . after two months follow - up , she had significant improvement in her symptoms with the ybocs total score decreasing to 10 . this case demonstrates the importance of eliciting psychopathology in greater detail for specific diagnosis and treatment decisions , especially in the absence of a clear history . the presentation of the case with suspiciousness as the major symptom raised the possibility of psychosis . as there was no morbid illogical reasoning for the belief / thought , delusion was ruled out . additionally , the repetitive nature of the thought , which was stereotyped , causing severe distress , pointed toward a possibility of obsessions . this was supplemented by the compulsive nature of reassurance seeking , which provided some temporary relief to the anxiety caused by the thought . however , the difficulty here was the lack of insight of the patient into this thought phenomenon . even though traditionally viewed as a condition with , egodystonic thoughts recognized as illogical by patients , ocd could present with lack of insight . furthermore , depressive ruminations were usually associated with negative emotions regarding some past event , while in this case the event appeared like an intrusive meaningless thought when it originated . insight in ocd had therapeutic implications such as poorer response to medications and prognostic implications , wherein , schizophrenic spectrum symptoms could lead to worse prognosis . the continuity model between obsessions , overvalued ideas , and delusions seems to be more satisfactory , although it calls for a careful analysis of the phenomenon in clinical settings , for prudent treatment choices . | obsessive compulsive disorder ( ocd ) is commonly regarded as a disorder with good insight .
however , it has now been recognized that insight varies in these patients .
pathological beliefs seem to lie on a continuum of insight , with full insight at one end and delusion at the other .
this can indeed pose a considerable challenge , especially in a scenario where the phenomenon is difficult to discern .
we report a case of ocd , which was initially diagnosed as psychosis . |
a total of 30 anisakis type i larvae were removed from the stomach of 16 patients referred to the department of parasitology and tropical medicine , seoul national university college of medicine , seoul , south korea , from 2000 through 2013 ( table ) . among them , 26 larvae were analyzed by dna sequencing . all patients experienced acute gastric or abdominal discomfort , including epigastric pain and indigestion , and underwent gastroduodenoscopy . during the examinations , some larvae were preserved in 70% ethanol , and others were fixed in 10% formalin before being mounted on slides with glycerin jelly . * all patients underwent gastroduodenoscopy , during which anisakis larvae were removed with biopsy forceps . total genomic dna was extracted by using a dneasy blood and tissue kit ( qiagen , hilden , germany ) ; nested pcr and nucleotide sequencing were performed on the its region ( its1 , 5.8s rrna subunit , and its2 ) according to procedures reported previously ( 13 ) . the pcr product was amplified by using the cosmo labopass x2 pcr premix kit ( cosmo genetech , seoul , south korea ) , and automated dna sequencing was performed by solgent co. , ltd . nucleotide sequences obtained were aligned by using the geneious program , version 6.0.3 ( geneious co. , wellington , new zealand ) . of the 26 anisakis larvae from 15 human patients , 25 showed 100% identity in the sequences of its region ( 244 bp , high - confidence variable positions ) with those of the a. pegreffii sequence available in genbank ( accession no . a. pegreffii nematode infection was diagnosed for 15 of the 16 patients , and a. simplex s.s . our results confirm the presence of a. pegreffii nematode infection in humans in south korea , making this the third country ( after italy and japan ) in which this infection in humans has been identified . this high proportion of a. pegreffii nematode infections in humans is surprising and suggests that most cases of anisakiasis in humans in south korea may be caused by a. pegreffii rather than a. simplex s.s . larvae . to confirm the source of infection , molecular analyses of anisakis larvae extracted from human patients are required in south korea . human infection with a. pegreffii nematodes was first documented in italy by use of pcr - based restriction fragment length polymorphism ( pcr - rflp ) analysis ( 6 ) . the second case was reported from japan ( 10 ) , in which 1 of 100 anisakid larvae extracted from patients in kyushu and hokkaido was identified by pcr - rflp analysis as a. pegreffii . then , in 2009 , a. pegreffii nematode infection was diagnosed for 2 women in italy by pcr - rflp and sequencing of the 28s gene ( 7 ) . in 2011 , a. pegreffii dna was extracted from a paraffin - embedded granuloma from a man in italy ( 8) . also in italy , 8 more a. pegreffii nematode infections in humans were reported in 2013 ( 9 ) . thus , to date , including the 15 cases reported here , a total of 28 cases of a. pegreffii nematode infections in humans have been documented in the literature . the markedly high proportion of a. pegreffii nematode infections identified among patients in south korea ( 25/26 larvae from 15/16 patients ) was not expected because in japan ( kyushu and hokkaido ) , which are geographically close to south korea , anisakis larvae from humans are mostly a. simplex s.s . ( 99/100 larvae from 84/85 patients ) ; only 1 larva was identified as a. pegreffii ( 10 ) . however , it is of note that the species of anisakis larvae detected in fish varied according to the 2 large localities of japan ; from northern japan to the pacific sides and from the sea of japan to the eastern china sea sides ( 14 ) . the former locality , such as hokkaido and eastern japan , showed more a. simplex s.s . than a. pegreffii larvae , whereas the latter locality ( southwestern japan ) , including kyushu and fukuoka ( close to south korea ) , showed more a. pegreffii than a. simplex s.s larvae ( 14 ) . this finding might partly explain the discrepancy between the anisakis larvae species that infect humans in south korea and japan . when the pathogenic potential of a. simplex s.s . larvae for human patients was compared with that of a. pegreffii ( 11 ) , it was found that a. simplex s.s . larvae had greater potential than a. pegreffii larvae to survive acidic gastric juice and to penetrate the human stomach , small intestine , and colon . however , further studies are needed to elucidate this finding . another clinicopathologic concern associated with anisakiasis in humans is the potential for a. simplex s.s . and a. pegreffii larvae to elicit gastroallergic reactions . these reactions are characterized by urticaria on the arms and abdomen and by angioedema or anaphylaxis when the live parasite attempts to penetrate the gastric mucosa ( 9 ) . however , because of an increasing tendency toward anisakis nematode allergy among patients in south korea ( 15 ) , attention should be paid to this clinical feature . the study highlights the need to perform molecular analysis for each larva extracted from human patients in this country . | anisakiasis in humans in south korea has been considered to be caused exclusively by the larvae of anisakis simplex sensu stricto and pseudoterranova decipiens .
recently , however , dna sequencing of larvae from 15 of 16 anisakiasis patients confirmed the cause to be anisakis pegreffii infection . molecular analysis should be performed for all extracted larvae . |
calcium channel blocker ( ccb ) toxicity is associated with refractory hypotension and myocardial depression which can be fatal . amlodipine is a dihydropyridine ccb that inhibits calcium entry into slow l - type calcium channels in vascular smooth muscle , the myocardium , and pancreatic beta cells . the hemodynamic consequences of ccb toxicity are peripheral vasodilation , decreased contractility , and bradycardia . suppression of insulin release from the pancreas leads to hyperglycemia and to decreased free fatty acid utilization by the myocardium . ccb 's undergo extensive first pass metabolism and 90% of the parent drug is metabolized in the liver . amlodipine is 95% protein bound and so can not be dialyzed . in therapeutic concentrations , amlodipine has a half - life of 30 50hrs . after ccb overdose , however , hepatic enzymes become saturated and so the half - life of amlodipine can be even longer . a thirteen year old , 61 kg young woman intentionally ingested thirty 10 mg tablets of amlodipine , six bottles of beer , and an unknown quantity of barbiturates . she presented to the emergency department ( ed ) six hours after the ingestion complaining of tiredness and increased heart rate . she had a blood pressure of 73/34 ( mean 47 ) mmhg , heart rate of 103/min , and respiratory rate of 16/minute . her blood pressure did not improve despite the administration of multiple boluses of normal saline , two grams of calcium chloride , and infusion of norepinephrine ( 0.1 mcg / kg / min ) . the patient was transferred to the pediatric intensive care unit ( picu ) . on admission to the picu she was hypotensive and drowsy , but would awaken and respond to questions . , the patient had worsening metabolic and lactic acidosis [ table 1 ] , increased creatinine concentration , oliguria , and decreased mental status . the norepinephrine infusion was increased ( 0.4 mcg/ kg/ min ) and epinephrine infusion ( 0.1 mcg / kg / min ) was added . insulin ( 0.1 unit/ kg/ hour ) and dextrose ( d12.5 at 100 cc / hr ) were then infused . due to evidence of decreased end organ perfusion and persistent refractory hypotension , which was expected to last at least 48 hrs after the ingestion of amlodipine , the patient was electively placed on veno - arterial extracorporeal life support ( va ecls ) 15 hrs after the ingestion and 9 hrs after presentation to the ed . the patient was induced with fentanyl 10 mcg/ kg iv , paralyzed with rocuronium and intubated a 17 french ( fr ) arterial cannula was placed in the right femoral artery . a 12 fr arterial cannula was placed distal to this site to maintain perfusion to the right lower extremity . a goretex graft was used during the insertion of the arterial cannulas to facilitate subsequent decannulation . ecls flow was initiated slowly and increased to 70 cc/ kg / min as tolerated . heparin was infused to maintain the activated clotting time 160 - 180 seconds . over the subsequent 24 hrs the ecls flows were decreased and the patient was successfully decannulated after 57 hrs on ecls . the cardiovascular symptoms of ccb overdose are hypotension , due to peripheral vasodilation , myocardial depression , and bradycardia . intentional ccb overdose is often exacerbated by the ingestion of other drugs , e.g. , tricyclic antidepressants , or - blockers , which exacerbate ccb toxicity . in the case treatment of ccb overdose includes initial stabilization and resuscitation . gastric decontamination with activated charcoal and polyethylene glycol is indicated if the patient presents within two hours of ingestion or if a delayed release preparation has been ingested , supportive therapy initially includes the administration of iv crystalloid . the antidote for ccb overdose is iv calcium chloride ( 20mg / kg , up to 1 gram ) or iv calcium gluconate ( 50 mg / kg , up to 1 gram ) in an attempt to increase circulating calcium and overcome blockade of calcium channels . insulin resistance occurs after ccb overdose and decreases intracellular glucose stores and increases fatty acid oxidation . insulin activates calcium and potassium channels and increases intracellular atp , which improves myocardial contractility , and inhibits the release of pro - inflammatory mediators . in our patient , there was no hemodynamic improvement within two hours of starting insulin therefore the patient was placed on ecls . glucagon has been used to treat ccb overdose , although this is an unlabelled use of the medication . glucagon bolus followed by an infusion has been used with favorable response by doyon et al and helps to improve the metabolism of cardiac myocytes and thus improves contractility . levosimendan sensitizes myocytes to calcium by binding to troponin c and increasing the availability of calcium to actin and myosin fibers . varpula et al , reported the administration of levosimendan in two patients with ccb toxicity and refractory hypotension . both patients had in improvement in their mean arterial pressure within 60 to 90 minutes and were weaned off inotropic support within 12 hours . ecls has been reported twice in cases of refractory ccb overdose , once due to diltiazem overdose and once due to verapamil and propranolol overdose . both cases involved 16 yr old females with ccb overdoses who were emergently cannulated onto ecls due to cardiac arrest and subsequently decannulated with no evidence of neurologic deficit . the patient outlined in this report was electively cannulated and subsequently decannulated in less than 72 hrs . ecls is useful because it restores end organ perfusion and allows metabolism and excretion of the ccb . experimental therapies such as the administration of glucagon , insulin and levosimendan , have also been reported . ecls may be indicated if a patient with ccb overdose continues to have refractory and severe hypotension despite conventional and experimental therapies . | calcium channel blocker ( ccb ) toxicity is associated with refractory hypotension and can be fatal . a 13 year old young woman presented to the emergency department(ed ) six hours after an intentional overdose of amlodipine , barbiturates , and alcohol .
she remained extremely hypotensive despite the administration of normal saline and calcium chloride and despite infusions of norepinephrine , epinephrine , insulin , and dextrose .
due to increasing evidence of end organ dysfunction , extracorporeal life support ( ecls ) was initiated 9 hours after presentation to the ed . the patient 's blood pressure and end organ function immediately improved after cannulation .
she was successfully decannulated after 57 hours of ecls and was neurologically intact .
patients with calcium channel blocker overdose who are resistant to medical interventions may respond favorably to early ecls . |
this provocative question is raised by the attempt to identify patients who could benefit most from nutrition support . this initiative is of great potential value , as the current scores used to assess the risk of development of malnutrition in hospitalised patients ( for instance , nutritional risk screening ) do not take into account the severity of critical illness . basically , although the work by heyland and colleagues applies lord kelvins ' paradigm ' if you can not measure it , you can not improve it ' , it is still unlikely to answer daily clinicians ' concerns , for several different reasons . first , the appropriate amount of calories and protein is a matter of intense debate , since the recent release of the landmark epanic trial . in contrast to some expectations deducted from observational data linking the magnitude of the caloric debt , calculated as the difference between caloric intake and resting energy expenditure , to a higher number of complications , the epanic trial demonstrated in the largest sample of critically patients ever enrolled in a nutritional study in critically ill patients that the provision of calories matching the resting energy expenditure was associated with a poorer outcome than when hypocaloric feeding was administered . these challenging findings are consistent with other recent and older observations of unaltered outcome by hypocaloric feeding [ 6 - 9 ] . different findings were recently presented by heidegger and colleagues : in a highly selected subgroup of patients in whom the tolerance of enteral nutrition prevented the provision of more than 60% of the caloric target over 4 days ( 15% of the screened patients ) , supplemental parenteral nutrition infused at a rate tightly adapted to match the caloric goal was associated with a decrease in the rate of infection and in the time on ventilation . from these recent and apparently contradictory findings , the current guidelines agree to recommend early enteral nutrition whenever possible in any patient unable to match a reasonable portion of his caloric needs , regardless of his current nutrition status . where recommendations need to be updated is in the definition of the desirable timing to reach a predefined target , and the right place for parenteral nutrition when enteral feeding is contraindicated or poorly tolerated . for instance , the effects of caloric intake could differ in patients with different ranges of admission body mass index , as suggested by the retrospective observation of alberda and colleagues . obviously a more accurate assessment of the magnitude of the nutrition risk by scores such as the nutrition risk in the critically ill ( nutric ) score will help to solve these issues . the second issue raised by the publication of the article by heyland and colleagues is even more challenging : which outcome variable will be accurate enough and specific enough to validate a nutritional risk score in the icu ? short - term and long - term mortality and lengths of stays are easily available , but are likely to be confounded by several factors not directly related to nutritional status . some objective measurements of the muscle function of the patients at hospital discharge ( for example , 6-minute walking distance or handgrip strength ) as well as subjective assessments of physical functioning could represent a more accurate index for the erosion of lean body mass . in any case , this key question should be solved in order to validate the score using a meaningful outcome variable . the inclusion of more nutrition - related indices in the model , such as the tolerance to enteral feeding , or the magnitude of the catabolic response ( for example , insulin resistance , nitrogen balance ) could enhance the specificity of a nutritional score , while the use of nonspecific severity scores ( acute physiology and chronic health evaluation ii and sequential organ failure assessment ) in the calculation of the nutric score could decrease its potential predictive accuracy . third , the use of scores is quite popular in some countries but not in others , where these are considered irrelevant and mostly unable to improve the outcome of patients . of course , the value of scores is quite high for characterising patients included in research protocols . in daily practice , the time spent collecting data manually should be justified by a benefit in terms of outcome , or resource utilisation . increasing the awareness of the healthcare providers towards the risk of acquisition of malnutrition is a major issue . the best therapeutic option to prevent the loss of lean body mass , however , probably involves several components including nutrition therapy , shortening of sedation , or muscle paralysis and early physical rehabilitation . the severe anabolic resistance of critically ill patients , resulting in a very high susceptibility to complications , implies a multifaceted therapeutic approach , including adequate nutrition therapy once it has been redefined . in summary , we might expect from the use of nutric an increased awareness towards nutritional issues and the availability of a useful research tool . | the description of a new score of nutrition risk in critically ill patients in the previous issue of critical care is very appropriate and timely .
however , the use of this score will probably not help the clinician to improve the prescription of nutrition therapy , especially when major uncertainties are raised about the definition of adequate nutrition .
the validation of the score will require the use of outcome variables susceptible to influence by nutrition , such as surrogate markers of muscle function .
meanwhile the educational value of a score of nutrition risk is undisputed in settings where the use of scores is incorporated into the usual practice . |
intracranial dural arteriovenous fistulas ( avfs ) constitute 1015% of intracranial vascular anomalies [ 1 , 2 ] . avf with retrograde cortical venous drainage has a high risk of developing an aggressive clinical course with intracranial hemorrhage [ 1 , 3 ] . hemorrhagic presentation with acute subdural hematoma ( asdh ) due to dural avf is very rare [ 4 , 5 ] . we report an unusual case of dural avf presenting as asdh and discuss the clinical features with the aid of a literature review . a 56-year - old man presented with disturbance of consciousness after manifesting clouded consciousness , during which he could not open his eyes spontaneously without anisocoria . computed tomography revealed a right asdh of 1.5 cm in diameter and a 15-ml oval subcortical hematoma in the right occipital lobe associated with slight perifocal edema . we planned our strategy of emergent removal of asdh after diagnosis of the hemorrhagic source . digital subtraction angiography was performed emergently and demonstrated a dural avf located in the right occipital convexity . the main feeding arteries were the right middle meningeal artery , parietal branch of the superficial temporal artery and meningeal branch of the right occipital artery ( fig . shunt flow was not markedly high and drained into the superior sagittal sinus and vein of galen via cortical veins on the occipital lobe associated with venous pouches and cortical reflux . asdh removal was planned after obliteration of the hemorrhagic source of dural avf by endovascular treatment because the consciousness level was not aggravated under hyperosmotic fluid administration , and endovascular embolization could be performed immediately after dsa . venous pouches were suspected ruptured points and were occluded with diluted n - butyl cyanoacrylate . craniotomy was subsequently performed and the subdural hematoma was evacuated with external decompression within 1 h after transarterial embolization . the postoperative course was uneventful , and cranioplasty was performed after recovery from brain edema . we reviewed 9 cases of nontraumatic dural avf associated with asdh from the previous literature , including the present case ( table 1 ) [ 1 , 2 , 3 , 4 , 5 ] . four of 9 cases were associated with subcortical hematoma and 4 of 9 were pure asdh . four cases were classified as cognard type iii , 3 as iv and 1 as iib . six of 9 cases had direct venous drainage into cortical veins . in our present case , venous ectasias might have had a fragile venous wall and was suspected of being a rupture point . the hemorrhagic pattern showed that the dominant location was subdural hematoma associated with a small amount of subcortical hematoma . the hemorrhagic point might be the subpial cortical vein draining into the superior sagittal sinus under venous high pressure due to arterial shunt flow . a further hypothesis is that venous high pressure might aggravate cortical reflux and partial venous congestion might cause limited subcortical hemorrhage and simultaneously rupture at the fragile wall of the venous ectasias in the subdural space . | dural arteriovenous fistula ( avf ) presenting with subdural hematoma is relatively rare .
we report a case of dural avf presenting as acute subdural hematoma ( asdh ) and provide a review of the literature . a 56-year - old man presented with disturbance of consciousness .
computed tomography demonstrated a right asdh and a small right occipital subcortical hematoma .
cerebral angiography showed a dural avf on the occipital convexity draining into the cortical veins .
emergent endovascular embolization was immediately performed and the shunt flow disappeared .
hematoma removal and external decompression were safely conducted .
combined therapy successfully recovered the patient 's consciousness level .
this rare case of dural avf presenting with asdh was treated with combined treatments of endovascular and open surgery . |
we present the case of a patient who underwent successful repeated tumor resections for 3 different kinds of metachronous carcinoma of the biliary tract . to clarify predispositions toward carcinogenesis in the biliary tract , immunohistochemical staining a 28-year - old woman underwent cholecystectomy in march 1979 at our hospital due to carcinoma of the gallbladder that displayed diffuse spread without lymph node involvement . histology of the tumor was papillary carcinoma and the depth of the tumor was limited to the mucosal layer ( fig . the patient remained disease - free for 18 years after surgery , but was then hospitalized again due to epigastric pain . laboratory data were all within normal ranges , except for serum ca199 at 90 iu / ml . a low density area measuring 5 4 cm was detected in the left hepatic lobe on computed tomography ( ct ) ( fig . 2a ) . furthermore , tumor shadows were observed in the common bile duct on endoscopic retrograde cholangiopancreatography . neither pancreaticobiliary maljunction ( pbm ) nor primary sclerosing cholangitis ( psc ) was present ( fig . all tumors were successfully removed via left hepatic lobectomy combined with pylorus - preserving pancreatoduodenectomy in may 1997 . macroscopically , resected specimens displayed a variety of tumors , with a tumor arising from the remnant cystic duct and a tumor in the common bile duct identified as pedunculated polypoid tumor associated with widespread tiny granular lesions . histology of the hepatic tumor was intrahepatic cholangiocarcinoma ( icc ) that had invaded the ligamentum teres hepatis , associated with mucosal spread along the left hepatic duct , and represented poor cell differentiation , while pedunculated polypoid tumors were identified as papillary adenocarcinoma . follow - up ct detected a minute but gradually enlarging low - density area in the posterior segment of the liver . the resected tumor measured 2.1 1.9 cm and displayed intraductal spread forming a small tumor mass . findings of histology and immunohistochemical staining for expression of p53 and cyclooxygenase- 2 ( cox-2 ) protein are summarized in table 1 . cox-2 protein expression was negative in all cancer cells , non - cancerous biliary epithelial cells and mucosal dysplasia . the present case is extremely rare , as 3 different kinds of carcinoma developed metachronously over the course of 25 years . long - time intervals between the onsets of the individual tumors substantially support the hypothesis that they are nonmetastatic tumors that developed independently . the exact mechanism of carcinogenesis in this patient remains unclear , since the patient displayed neither pbm nor psc , both of which are widely accepted as strong risk factors for carcinoma of the biliary tract . previous reports show that patients with pbm tend to have synchronous multicentric biliary carcinoma , and metachronous carcinoma sometimes develops even after resection of choledochal cyst associated with carcinoma [ 1 , 2 , 3 ] . to clarify the predisposition toward carcinogenesis in the biliary epithelium , cox-2 expression has been confirmed to promote carcinogenesis by producing prostaglandin e2 in an intestinal polyposis model [ 4 , 5 ] , and p53 mutations are involved in carcinogenesis in the biliary epithelium [ 6 , 7 ] . however , cox-2 protein expression was not observed both in noncancerous biliary epithelial cells and cancer cells , and p53 dysfunction appears unrelated to the multicentric origins of carcinogenesis in this patient . the only interesting histological finding we could identify was the concurrence of widespread mucosal dysplasia in the common bile duct ; a dysplasia - carcinoma sequence has been assumed as the main route of carcinogenesis , like the adenoma - carcinoma sequence in familial adenomatous polyposis and colon carcinoma . thus the exact mechanism of carcinogenesis remains to be elucidated in this patient ; however , many reports have offered clinical evidences of metachronous carcinoma which developed at the site of hepaticojejunostomy or at intrahepatic or terminal bile ducts a long time after the initial surgery . patients who have once experienced papillary carcinoma in the biliary tract might have a long - term risk of carcinogenesis . morphologically , second tumors usually display a papillary type similar to the primary tumor , and the depth of tumor is superficial without tumor invasion to neighboring organs . aggressive surgical approach to the treatment of such tumors is technically possible and a rational therapeutic option that offers a chance of long - time survival for patients . close monitoring for recurrence is warranted for early detection of tumors that might be effectively treated with repeated resection . | we here report on a case of metachronous multicentric carcinomas of the biliary tract treated 3 times with curative surgery over 23 years .
a 28-year - old woman underwent cholecystectomy because of papillary carcinoma of the gallbladder .
after 17 years , 3 carcinomas developed in the biliary tract : intrahepatic cholangiocarcinoma of the left liver , common bile duct carcinoma , and remnant cystic duct carcinoma .
they were successfully removed via left hepatectomy combined with pylorus - preserving pancreatoduodenectomy .
furthermore , another intrahepatic cholangiocarcinoma developed 6 years after the second surgery , which was removed again via partial resection of the posterior segment of the liver .
histological findings of carcinomas represented various grades of cell differentiation .
no predisposition toward carcinogenesis was found , since neither pancreaticobiliary maljunction nor primary sclerosing cholangitis was present , and the overexpression of cyclooxygenase-2 was negative in all resected specimens .
close monitoring for recurrence is warranted for early detection of metachronous carcinoma that might be effectively treated with repeated resection . |
primary nasopharyngeal adenocarcinomas ( npacs ) are extremely rare malignant tumors accounting for 0.38% to 0.48% of all malignant nasopharyngeal neoplasms and 0.70% of all nasopharyngeal carcinomas . these properties mean that the treatment of choice for these tumours is total surgical resection of the primary tumor , and this has an excellent prognosis . traditionally , because of the anatomic complexity of the nasopharynx , resection of nasopharyngeal tumors has used an external approach . however , here we suggest that an alternative exclusively endoscopic surgical strategy should be considered . this is because this tumor type is pedunculated , histologically relatively non - aggressive and , further , we have now refined our existing published endoscopic technique and successfully used it to resect different types of tumour [ 2 - 9 ] . here we describe our exclusively endoscopic approach for the resection of primary nasopharyngeal adenocarcinoma . to the best of our knowledge , this is the first time to excise the nasopharyngeal adenocarcinoma via the strictly endoscopic approach . the first case is a 28-year - old female with the symptoms of nasal bleeding for about 3 weeks . was noted by nasopharyngoscopic exam and biopsy with magnetic resonance imaging ( mri ) was performed . mri showed an approximate 1.5 cm pedunculated nodule attaching on the left lateral wall ( fig . 1 ) . the second case is a 58-year - old male with the symptoms of blood tinged sputum for about 1 month . mri showed an approximate 2.2 cm pedunculated nodule occupying the nasopharyngeal airway , from the nasopharyngeal roof . the pathologic biopsy report of both patients showed low - grade papillary adenocarcinoma composed of papillary fronds lined by pseudostratified columnar cells with bland unclei . according to the preoperative pathologic biopsy the operations were performed under general anesthesia with our patient placed in a semi - sitting position . prior to surgery , the nasal turbinates were decongested using cotton packs saturated with 1:100,000 bosmin for 15 minutes . the posterior half of the nasal septum , vomer , and inferior turbinate of the lesion site were excised to create a working space for the endoscope and to expose the tunour . endoscope versatility has improved considerably in recent years , and by using a 4 mm diameter , 0 degree , 30 degree , and 70 degree angle endoscope ( karl - storz , tuttlingen , germany ) , it was possible to remove the exposed tumor completely leaving an adequate mucosal surgical margin . the lateral wall of the nasal cavity ( including part of the eustachian tube ) , the roof ( deep to the periosteum of skull base ) , and the posterior wall ( deep to prevertebral fascia ) were totally resected by a continued - wave , contact type of diomed 25 diode laser ( diomed co. , cambridge , uk ) . frozen sections prepared from the surgical margin tissue were assessed during the nasopharyngectomy to assess whether all the tumor had been removed . the wound surface was covered with a free mucosal flap harvested from the inferior nasal turbinate and held in place by absorbable gelform . the nasal cavity was packed with nasal packing and a balloon - inflated foley catheter for 72 hours after the operation . the 2 operations were performed successfully and all surgical resection margins were free of tumor . total operation times were 100 and 90 minutes respectively , and the patients were discharged from hospital only 4 to 5 days after surgery . as the resection margins were clear there was no need to perform postoperative radiotherapy or chemotherapy . one of the patients ' mri pre- and postsurgery is shown in fig . 1 . low - grade papillary adenocarcinoma is one histologic pattern of the polymorphous low - grade adenocarcinoma . with a very low tendency for aggressive behaviour of this carcinoma , the recommended treatment of low - grade papillary adenocarcinomas is currently surgical excision , and the results are excellent . lymphatic spread been not been described in any case , so neck dissection is not normally necessary unless there is clinical evidence that suggests lymph node involvement has occurred . if it has not been possible to surgically resect all the tumor then adjuvant radiotherapy should be carried out to prevent tumor recurrence . in this study , the 2 tumors were excised radically with adequate margins , thus the postoperative radiotherapy was not performed . nasopharynx anatomical structure is extremely complex and so existing surgical techniques use a variety of open procedures including facial translocation , midfacial degloving , maxillary swing , lateral rhinotomy , or a transpalatal approach . the surgical approach that is used depends upon both the tumor extension and the surgeon 's experience and preference . in 2007 , we have reported the minimally invasive endoscopic nasopharyngectomy in the treatment of recurrent t1 - 2a nasopharyngeal carcinoma . because of the pedunculated shape of nasopharyngeal adenocarcinomas , the relatively benign histological features of this type of tumour and also given the recent improvements in endoscopic technique and instruments [ 2 - 9 ] , we think the exclusively endoscopic approach is feasible for selected nasopharyngeal adenocarcinoma . however , it is not the intent of this report to suggest that the exclusively endoscopic approach is superior to the conventional open approaches . instead , the goal of this study is to highlight the experience with the minimally invasive endoscopic approach at the early juncture . with respect to the anatomic limitations of exclusively endoscopic excision of nasopharyngeal adenocarcinoma , these would include tumor invasion to the central skull base bone superiorly , the pharyngobasilar fascia laterally , the prevertebral fascia posteriorly , and oropharynx inferiorly . if the extent of the tumor is found to be far beyond the nasopharynx during operation , we believe endosopic nasopharyngectomy can be changed to conventional open surgery without difficulty . first , primary nasopharyngeal adenocarcinomas are extremely rare ; we can not analyze the quality of life between our 2 cases and similar cases operated with a conventional open procedure . second , to gain a conclusive result , we need a larger series of patients with longer follow - up . however , the early results appear encouraging . not only for the early recurrent nasopharyngeal carcinoma we find that the procedure is curative , cuts down the length of the operation , decreases wound - related complications , shortens hospital stay , and moreover gives a better cosmetic outcome . | we reported two patients with nasopharyngeal adenocarcinoma resected by using the exclusively endoscopic approach .
case reports and a review of the world literature concerning nasopharyngeal adenocarcinoma .
the tumors were resected successfully via the exclusively endoscopic approach and no conversions to the conventional approach were necessary .
the two patients were followed up for 26 and 18 months respectively , and no recurrence was noted without postoperative chemotherapy or radiotherapy . to the best of our knowledge ,
this is the first report of endoscopic resection of nasopharyngeal adenocarcinoma .
our experience revealed that not only for the early recurrent nasopharyngeal carcinoma , the exclusively endoscopic nasopharyngectomy can be expanded for the resection of selected nasopharyngeal adenocarcinoma . |
injection of lipopolysaccharide into volunteers is followed by acute rises of monocyte - derived proinflammatory cytokines , including tumour necrosis factor , il-1 , and il-6 . although the concentration of these cytokines falls to normal within a few hours , the secondary effects of their release can be devastating . these effects include fever , leukocyte and endothelial activation , leukocyte margination and transmigration , leukocyte maturation , metabolic and endocrine effects , and enhanced procoagulant activity at the endothelial surface all features of sepsis syndrome . cytokines are released into the circulation in human septic shock , and the levels in both septic shock and meningococcaemia correlate with disease severity and mortality . chemoattractant cytokines , or chemokines , also play an important role in the recruitment and regulation of the leukocyte traffic during acute inflammatory responses . chemokines are structurally homologous proteins with a molecular mass between 6 kda and 14 kda , divided into four subfamilies ( cc , cxc , cx3c , and c ) on the basis of the arrangement and number of cysteine motifs . the cc chemo - kines monocyte chemoattractant protein 1 ( mcp-1 ) and macrophage inflammatory protein 1 ( mip-1 ) are chemo - attractant for monocytes , whereas the cxc chemokines il-8 and growth - related ongogenes alpha are chemoattractant for neutrophils . chemokine production is induced in monocytes by lipopolysaccharide from gram - negative bacteria such as the meningococcus . there has so far been only one published account of the chemokine response in meningococcal disease . this investigation demonstrated that in patients with fulminant meningococcal septicaemia , mcp-1 , mip-1 , and il-8 levels were significantly higher than in cases of distinct meningitis or mild systemic meningococcal disease and correlated with plasma lipopolysaccharide concentrations . however , more formal descriptions of disease severity or outcome were not provided . in the previous issue of critical care , vermont and colleagues presented a simple but well - executed observational study describing the levels of the chemokines mip-1 , mcp-1 , il-8 and growth - related ongogenes alpha in the serum of 58 children with meningococcal sepsis . significant correlations were demonstrated between admission chemokine levels and the paediatric risk of mortality score , the disseminated intravascular coagulopathy score , the sequential organ failure assessment score and laboratory parameters of disease severity . additionally , nonsurvivors had much higher levels of chemokines compared with survivors , and chemokine levels predicted mortality with a high degree of sensitivity and specificity . prediction of mortality with chemokine levels was vastly superior to the prediction with tumour necrosis factor alpha levels . there are some limitations of the study ; no control group of other critically ill children was included and , of the 58 patients included , 38 were involved in a placebo - controlled dose - finding study of protein c concentrate . although the involvement of patients in the protein c study may have had some impact on the chemokine levels measured at 24 hours , most of the paper is taken up with an investigation of chemokine levels at admission to the paediatric intensive care unit , which will have been unaffected by protein c administration . additionally , the extent of the changes in chemokine concentrations and the correlations seen were so impressive as to mitigate against the absence of a control group of cases of children without meningococcal disease . the findings are important because they are consistent with the current view of the pathophysiology of severe sepsis and of the redundancy built into the inflammatory response . they also indicate another potential mechanism for risk stratification in future trials of novel therapies in sepsis . previous trials of immunomodulatory therapy in sepsis , performed in the 1990s , were not successful . trials of recombinant bactericidal / permeability - increasing protein and recombinant human activated protein c have more recently also failed to demonstrate any benefit . inclusion of too many low - risk patients may have contributed to the failure of these trials . risk stratification should ideally include considerations of timing , disease severity and of the proinflammatory or anti - inflammatory state but should also be immediately available at the bedside . standard tests such as neutropaenia and thrombocytopaenia may currently offer the best risk stratification , but the study of vermont and colleagues raises the potential for specific risk assessment by looking at levels of chemokines . the search for specific groups of patients likely to benefit from novel therapies will be critical for future trials . as grau and maennel stated in the 1990s , the key will be to ' inject the right inhibitor , at the right dose , in the right patient subgroup and most importantly in the right time window ' . to do this effectively , it is necessary to define who will benefit from therapy by elucidating the basic mechanisms of the host response to infection and the subgroups of patients most likely to respond to therapy . only then will a logical approach to reducing the mortality from sepsis , both meningococcal and otherwise , be possible . il = interleukin ; mcp-1 = monocyte chemoattractant protein 1 ; mip-1 = macrophage inflammatory protein 1. | in the previous issue of critical care , vermont and colleagues presented a simple but well - executed observational study describing the levels of chemokines in the serum of 58 children with meningococcal sepsis .
the chemokine levels correlated with disease severity and outcome .
significant correlations were demonstrated between admission chemokine levels and the paediatric risk of mortality score , the disseminated intravascular coagulopathy score , the sequential organ failure assessment score and laboratory parameters of disease severity .
additionally , nonsurvivors had much higher levels of chemokines compared with survivors , and the chemokine levels predicted mortality with a high degree of sensitivity and specificity .
the findings are important as they indicate a possible mechanism for risk stratification in future trials of novel therapies in human sepsis , which as yet have not been successful . |
a 68-year - old male presented with left mandibular area pain due to third trigeminal neuralgia . he had underdone conventional radiofrequency lesioning in the left third branch of the trigeminal nerve for trigeminal neuralgia one year previously . however , at the time of his presentation , he was reporting pain in the same area of 40/100 using the vas ( visual analogue scale ) score . we decided to proceed with medical treatment including carbamazepine 200 mg three times a day , tramadol ( 37.5 mg)/acetaminophen ( 325 mg ) combination three times a day , and nortriptyline 10 mg one time a day because his pain was mild . on his second day of medication , a mild fever and general weakness had occurred . on his fourth day after beginning the medication , an oral rash and bullae on the cheek , neck , forearm and leg , the patient visited the emergency room and was admitted with a presumptive diagnosis of sjs . further history revealed that he had discontinued medication including carbamazepine 200 mg one year previously on his own due to pruritus after taking the medication once . , the patient displayed pruritic and stinging erythema and painful crursted erosions on both lips , with several flaccid and ruptured bullae on the left cheek , neck , forearm , and leg ( fig . laboratory examination revealed mild leukocytosis , and alanine aminotransferase , c - reactive protein , and potassium were mildly elevated . carbamazepine was withdrawn and prednisolone 125 mg / day was started . a skin biopsy performed on the third day after admission , demonstrated subepidermal bullae formation with epidermal necrosis and minimal perivascular lymphohistocytic infiltration in the upper dermis and the correct diagnosis of sjs was established . on the eighth day the patient was discharged in good condition , with generalized desquamation and incomplete peeling of the skin on the neck , forearm , and face . two weeks after discharge , he underwent conventional radiofrequency lesioning of the left third branch of the trigeminal nerve . trigeminal neuralgia involves severe , lancinating pain , triggered by non - nociceptive stimuli , in the distribution of one or more divisions of the trigeminal nerve . although sjs has multiple etiologies , it is commonly triggered by viral infections ( herpes simplex virus is the infectious agent more commonly involved ) and neoplasias ( carcinomas and lymphomas ) . however , the most common cause is the use of medications . among the drugs implicated more often are allopurinol , antibiotics , anticonvulsants , and non - steroid anti - inflammatories . recently , in a seven - year study , devi et al . concluded that anticonvulsants were the cause implicated most in sjs especially in the first eight weeks of treatment , and the main drug responsible ( more than 80% ) was carbamazepine . the increased number of prescriptions of carbamazepine for the control of pain may be the reason for the increased frequency of sjs due to carbamazepine . the authors observed an association for acetaminophen ( paracetamol ) with a relative risk of 1.2 . in addition , tramadol showed a high relative risk , but there was also a high percentage of co - medication of the drug with other highly suspected drugs ( 57% ) , suggesting potential confounding by co - medication . at present , the mechanisms by which sjs develops are not well understood . sjs usually occurs during the first course of drug ingestion ( without prior sensitization ) . t - cells are already present in the body before drug exposure and elicit a robust immune reaction on carbamazepine antigenic stimulation . typically , the initial presentation is marked by symptoms of fever , myalgia , and general weakness for 1 to 3 days before the development of cutaneous lesions . the rash spreads rapidly and is usually maximal within four days , sometimes within hours . the initial skin lesions are usually poorly defined macules with darker purpuric centers that coalesce . however , skin biopsy helps confirm the diagnosis , usually excluding bullous diseases not related to drug therapy . early on , there is full - thickness epidermal necrosis and detachment , with an only slightly altered underlying dermis . the main therapeutic action in sjs is early recognition of the drug reaction and withdrawal of the drug , since any delay can be seriously deleterious to the patient . there is no universally accepted , definitively effective , specific treatment for acute sjs other than supportive care . they may be beneficial in the early stage of sjs but may increase the risk of infection , prolong wound healing , or even increase mortality , if bullous eruption or mucosal erosion is fully developed . although some retrospective studies have suggested that intravenous immunoglobulin may be effective in stopping the progression of sjs , other studies showed limited benefit on the mortality rate or progression of the disease . the patient in this case was given the same drug ( carbamazepine ) twice , but the degree of his cutaneous reaction was greater with the second exposure , when he developed sjs . on his first exposure to the medication , he took one dose of carbamazepine 200 mg . the second time we assumed that sjs did not occur on the first administration of carbamazepine because the patient stopped taking the medication after a single dose , which is not enough dosage to trigger hypersensitivity reaction . huang et al . also reported a case of fetal toxic epidermal necrolysis induced by carbamazepine treatment in a patient who previously had carbamazepine - induced sjs . it has been reported that higher daily doses of some drugs are associated with an increased risk of sjs compared to lower doses , as is the case for allopurinol . however there is as yet no evidence about the relationship between carbamazepine dosage and sjs . it is important to note that carbamazepine readministration should be avoided in patients with a previous history of sjs or adverse skin reaction to carbamazepine through the obtaining of an accurate medical history . in addition | stevens - johnson syndrome ( sjs ) is a rare but life - threatening skin reaction disease and carbamazepine is one of its most common causes .
we report a case of sjs secondary to carbamazepine in a patient with previous pruritus due to carbamazepine which was given for treatment of trigeminal neuralgia .
we would like to caution all providers that carbamazepine readministration should be avoided in the patient with a previous history of sjs or adverse skin reaction .
in addition , we strongly recommend gradual titration when initiating treatment with carbamazepine . |
the gold standard treatment for cholelithiasis is currently laparoscopic cholecystectomy ( lc ) . during the learning curve phase , lc bile duct injuries appear to be more numerous and severe than those caused by open cholecystectomy . complication produced by the sectioning of a nonvisualized duct of luschka are uncommon during lc , although the true incidence is unknown , especially because published studies focus on so - called major biliary lesions . from 1999 through 2003 , we performed 1351 lcs in our department and observed 2 cases ( 0.15% ) of bile leakage due to duct of luschka injury . a 51-year - old man was referred to our department for repeated colic abdominal pain in the right hypochondrium . he had a history of hepatic and renal polycystosis that produced severe chronic renal insufficiency . he underwent a surgical laparoscopy that revealed multiple cysts of various sizes on both lobes of the liver . laparoscopic defenestration of the dominant hepatic cysts and laparoscopic cholecystectomy were performed . in the postoperative period , the patient was afebrile and experienced diffuse moderate pain of the whole abdomen , with no other symptoms . two abdominal ultrasound scans showed a small amount of liquid in the abdominal cavity ; the blood analysis results were normal . the liquid was assumed to derive from the fenestrated cysts . on the sixth postoperative day , the patient reported the abrupt onset of intense abdominal pain , and a new ultrasound scan showed an increase in the abdominal liquid . an exploratory laparotomy revealed biliary peritonitis due to bile leakage from the duct of luschka in the liver bed . the duct of luchska was then closed , with thorough lavage of the abdominal cavity . the second postoperative period was free of complications , and the patient was discharged from the hospital 5 days after the second surgery . a 74-year - old man with a history of prostatism , right inguinal herniorrhaphy , and traumatic subdural hematoma was referred to our department for repeated biliary colic and recurrence of a right inguinal hernia . the immediate postoperative period was unfavorable : the patient was apyretic but presented with nausea , vomiting , and diffuse abdominal discomfort of low intensity . on the fourth postoperative day , emergency laparotomy revealed generalized choleperitoneum due to biliary leakage from a duct of luschka , which was sutured . the second postoperative period was satisfactory , and he was discharged from the hospital 5 days after the second surgery . the duct of luschka , first described in 1863 , is an accessory bile duct originating in the right hepatic lobe , which is located very close to the gallbladder bed and drains into the right or common hepatic duct . duct of luschka injury can cause a choleperitoneum , biloma , or subphrenic or subhepatic intraabdominal abscess . the true frequency of the duct of luschka in the population is unknown and ranges from 1% to 50% according to published series . injury during lc is usually produced by an excessively deep plane of dissection and by the particular anatomical localization of this accessory duct . in the classification of iatrogenic injuries of the biliary tree by strasberg et al , wider than the classification by bismuth , duct of luschka injury is included in type a. the real incidence is difficult to estimate . a systematic review by strasberg et al reported 270 iatrogenic injuries of the biliary tree and classified 62 as type a , of which 15% ( 12 cases ) were duct of luschka leaks , 4.4% of all of the iatrogenic bile duct injuries and 0.047% of the lcs performed . a review by deziel described 48 injuries to aberrant bile ducts ( 10.4% of total bile duct injuries and a strasberg type - a bile duct injury is not usually identified during an lc and clinically manifests in the first postoperative week . three clinical patterns of presentation exist : abdominal pain with fever and symptoms of local or general sepsis , or both , external bile fistula , and mild nonspecific symptoms . very elevated bilirubin levels are uncommon in these patients . among type a injuries , latent clinical symptoms are more common in the duct of luschka than in cystic duct leakage , as in the present cases . numerous diagnostic methods have been used to detect these injuries , including abdominal ultrasound and computed tomography , endoscopic retrograde cholangiopancreatography , percutaneous transhepatic cholangiography , and hepatic iminodiacetic acid scan . nevertheless , careful clinical examination is still of utmost importance . in our first case , a correct diagnosis was delayed by our assumption that the scant abdominal liquid derived from fenestrated cysts . treatment with sphincterotomy , endoscopic insertion of a biliary stent , and percutaneous drainage of the biloma is usually effective in a large percentage of patients . in patients who present with acute abdomen , as in our cases , or who are not cured by noninvasive treatments , exploratory laparotomy is the best approach and is carried out in 30% to 56% of cases . the surgical treatment consists of a lavage of the abdominal cavity , closure of the duct of luschka , and intraoperative cholangiography to that confirm the biliary tree is intact . | complications produced by the sectioning of a nonvisualized duct of luschka are uncommon during laparoscopic cholecystectomy . from 1999 through 2003
, we performed 1351 laparoscopic cholecystectomies in our department and observed 2 cases ( 0.15% ) of bile leakage due to duct of luschka injury .
injury during laparoscopic cholecystectomy is usually produced by an excessively deep plane of dissection and by the anatomical localization of this accessory duct .
clinical symptoms are scarce after duct of luschka injury .
numerous diagnostic methods have been used to detect these injuries . nevertheless , careful clinical examination is still of the utmost importance.noninvasive treatments are usually effective . in patients who present with acute abdomen , as in our cases , or who are not cured by noninvasive treatments ,
exploratory laparotomy is the best approach .
the surgical treatment consists of a lavage of the abdominal cavity , closure of the duct of luschka , and intraoperative cholangiography to confirm that the biliary tree is intact . |
we report the case of a 27-year - old indonesian chinese male who was referred to the dermatology unit for a non - pruritic rash on the upper and lower limbs for approximately 10 months duration . he has a significant past medical history of chronic myeloid leukaemia with a bcr - abl kinase mutation diagnosed 3 years ago . he was first started on imatinib 3 months after the diagnosis with a change to nilotinib 3 years later due to imatinib resistance . the patient had been receiving nilotinib 400 mg twice a day for 3 days prior to the onset of the rash , which persisted throughout the course of nilotinib . , the patient had extensive rough , brown , follicular papules over the trunk , upper and lower limbs ( fig . 1 , fig . the rash was more widespread over the extensor portion of the upper limbs ( fig . keratosis pilaris was diagnosed and the patient was started on a topical ammonium lactate cream . nilotinib was continued in view of the critical role of the medication in the treatment of his chronic myeloid leukaemia . keratosis pilaris is a common genetic skin disorder characterised by keratinisation of the hair follicles of the skin . it is inherited in an autosomal dominant fashion , although no specific gene has been identified . it typically presents as small , rough , brown folliculocentric papules distributed over characteristic areas of the skin , particularly the outer - upper arms and thighs . it has been associated with ichthyosis vulgaris as well as other atopic conditions like asthma or atopic dermatitis . nilotinib is a second - generation bcr - abl tyrosine kinase inhibitor ( tki ) that is approved for the treatment of imatinib - resistant chronic myeloid leukaemia expressing the bcr - abl mutation . although structurally similar to imatinib , it is approximately 1030 times more potent than imatinib at inhibiting bcr - abl tyrosine kinase activity . it also inhibits other kinases important in the proliferation of malignancies , e.g. abl - src9 , which helps it overcome bcr - resistance in cases of advanced chronic myeloid leukaemia . although these medications are generally well tolerated , cutaneous adverse drug reactions occur in approximately 34.3% of patients receiving nilotinib , with 2.6% of them exhibiting a high - grade rash . notably , compared to a previous case series report , our patient did not have any pruritus nor alopecia . the mechanism of these reactions are not well understood , although c - kit , which is one of the targets of tkis , has been possibly attributed since it is not only expressed in cancer cells , but also similarly in basal skin cells and melanocytes . such reactions may influence the compliance to nilotinib therapy , thereby affecting the oncologic outcome . although it is reported to be present in approximately 23% ( n = 9 ) of cases of adverse cutaneous reactions following such drug therapy , we believe greater emphasis is needed in the recognition of such an association , especially in the absence of accompanying suggestive symptoms , e.g. pruritus . appropriate treatment should be instituted in order to increase compliance to therapy and achieve a good oncologic outcome . | nilotinib is a second - generation bcr - abl tyrosine kinase inhibitor ( tki ) that is approved for the treatment of imatinib - resistant chronic myeloid leukaemia expressing the bcr - abl mutation .
cutaneous adverse drug reactions occur more frequently in patients using this medication
. we present a case of nilotinib - induced keratosis pilaris that did not have accompanying symptoms of alopecia or pruritus .
greater recognition of this association is needed so that appropriate treatment can be instituted to ensure a good oncologic outcome . |
the lips are not only a major esthetic component of the face , but are also important for facial expression , speech and eating . these goals are easily attained following repair of small lip defects . however , restoring these characteristics of the lips in large defects remains a more arduous task . this is a sensate axial musculomucocutaneous flap based upon the superior and inferior labial arteries . it provides good oral competence and is useful for closing one - half to two - third defects of the upper lip and defects up to three - quarters of the lower lip . it is ideal in situations where no new lip tissue is required in central defects or lateral defects that involve the commissure . the blood supply is more robust than the abbe flap , but the esthetic outcome is inferior . because new lip tissue is not recruited , microstomia may result after closure of larger defects . a semicircular incision of adequate length to close the defect the skin incisions are made with a scalpel , and careful mobilization of subcutaneous tissues is achieved using electrocautery . by spreading the orbicularis oris muscle longitudinally along the line of the incision , or on a plane parallel to the fibers , separation from the adjacent musculature is attained while maintaining the nerves and vessels intact . laterally , at the level of the commissures , the skin is incised only down to subcutaneous tissue . careful dissection is needed to identify and preserve the labial arteries and buccal nerve branches . the flaps are rotated medially to close the defect , and a stay suture is placed after meticulous re - approximation of the vermilion border . the defect is closed in three - layers approximating mucosa , muscle and skin . ( c ) bilateral karapandzic flaps sutured in place complications of this technique include microstomia and visible scarring . secondary revision of the commissure is often indicated to prevent oral crippling in feeding , hygiene maintenance and denture placement . the circumoral scarring after this procedure is more noticeable because the scars do not lie in natural skin creases . this is a sensate axial musculomucocutaneous flap based upon the superior and inferior labial arteries . it provides good oral competence and is useful for closing one - half to two - third defects of the upper lip and defects up to three - quarters of the lower lip . it is ideal in situations where no new lip tissue is required in central defects or lateral defects that involve the commissure . the blood supply is more robust than the abbe flap , but the esthetic outcome is inferior . because new lip tissue is not recruited , microstomia may result after closure of larger defects . a semicircular incision of adequate length to close the defect is extended from the defect toward the commissures . the skin incisions are made with a scalpel , and careful mobilization of subcutaneous tissues is achieved using electrocautery . by spreading the orbicularis oris muscle longitudinally along the line of the incision , or on a plane parallel to the fibers , separation from the adjacent musculature is attained while maintaining the nerves and vessels intact . laterally , at the level of the commissures , the skin is incised only down to subcutaneous tissue . careful dissection is needed to identify and preserve the labial arteries and buccal nerve branches . the flaps are rotated medially to close the defect , and a stay suture is placed after meticulous re - approximation of the vermilion border . ( c ) bilateral karapandzic flaps sutured in place complications of this technique include microstomia and visible scarring . secondary revision of the commissure is often indicated to prevent oral crippling in feeding , hygiene maintenance and denture placement . the circumoral scarring after this procedure is more noticeable because the scars do not lie in natural skin creases . a 35-year - old female visited to our department with the complaint of spilling over of food and fluids during meals and inability to achieve a competent lip seal so much so that she had to take her meals very slowly , that too in a recumbent position . she had a history of road traffic accident around 4 months back , in which some teeth were avulsed , some were fractured , that had to be extracted and she had lost left half of the lower lip in addition to fracture left femur and various deep abrasions all over the body . on examination there were numerous small scars over the left side of the face especially in the lower half around the ala of the nose . we planned to reconstruct the left half of her lower lip by means of bilateral karapandzic flaps . the surgical procedure was explained to her in detail as well as the possibility of microstomia . after a written informed consent , the surgical procedure was performed under general anesthesia . the preoperative [ figure 2 ] , intra - operative [ figures 35 ] and postoperative photographs [ figures 69 ] are attached along with . post operatively , as the continuity of the lower lip was restored , her function improved and she was able to take her meals without spilling over . there was microstomia of a very mild degree that was not objectionable to the patient . pre - operative photograph intra - operative photograph showing preparation of the defect for coverage by adjacent flaps intra - operative photograph showing harvested bilateral karapandzic flaps to be apposed in position both flaps sutured in position 8 days postoperative photograph depicting healing 6 months postoperative photograph depicting healing 2 years post - treatment photograph depicting mouth opening 2 years post - treatment photograph depicting healing karapandzic flap is a good , robust flap for lip reconstruction when there is adequate cheek tissue for mobilization and when no new additional lip tissue is required . the only disadvantage is poor aesthetics as the final closure does not lie in the skin creases and microstomia that could be a problem if the defect to be reconstructed is large enough . | for full - thickness lip defects , the choice of reconstructive option depends on the size of the defect .
defects of one - quarter to one - third of the upper lip can be closed primarily .
largerdefects measuring one - third to two - thirds of the lower lip width may be closed with the karapandzic , abbe or estlander flaps .
if the commissure is involved , both the karapandzic and estlander flaps may be used ; however , the karapandzic is probably the better choice because it is better at maintaining oral competence . in the case of larger lower lip defects ( more than two - thirds of the lip )
, if there is sufficient adjacent cheek tissue , the surgeon may employ the karapandzic ( for defects up to three - fourths of the lower lip width ) or the bernard - burow 's techniques ( to reconstruct the entire lower lip ) . a case of post - traumatic , lower lip defect , reconstructed with a bilateral karapandzic flap
is presented here . |
kyphoplasty is a surgical technique for height restoration and cement augmentation of vertebral bodies following osteoporotic vertebral compression fractures or osteolytic lesions.1,2,3,4 most studies reveal a low rate of procedure - related adverse events.5,6,7 however , when fluoroscopic imaging is used , radiation exposure of the surgeon and patient are of concern . many of the complications of kyphoplasty have to do with inaccurate cannula placement . to examine the proposition that computer - guided cone - beam ct technology could be used to perform balloon kyphoplasty and subsequently reduce patient and physician radiation exposure from that occurring with the fluoroscopic technique without prolonging the procedure or foregoing acceptable positioning of cannulas within pedicles . inclusion criteria : a cadaveric study to examine the use of cone - beam ct and fluoroscopic assistance during a kyphoplasty . exclusion criteria : cadavers with spinal malformations and/or deformities were excluded from this study . cone - beam ct provided imaging assistance on one of the cadavers and fluoroscopy for the second cadaver . in each of the two cadavers , the vertebra t69 ( thoracic ) and t11l2 ( thoracolumbar ) were selected . kyphoplasty : the thoracic and the thoracolumbar vertebral pedicles were accessed by placing a jamshidi needle percutaneously in the pedicle and then a guide wire . subsequently , both cone - beam ct and fluoroscopic images in each cadaver respectively were taken at each level when the cannulas were in the proper position . cone - beam ct : the procedure was guided through images obtained from the breakaway o - arm ( medtronic inc . , louisville , co ) . a high - speed drill , guided with navigation system ( medtronic inc . , louisville , co ) was used to percutaneously bore a pilot hole down the center of the target pedicle and then place a guide wire in the pilot hole . when the cannulas were in proper placement in the pedicle of both the cadavers , ap and lateral x - rays were taken to assess position of the cannulas . outcomes and analysis primary outcomes : procedure time , radiation exposure to the surgeon and cadaver , and acceptable positioning of cannula within pedicles was assessed during the procedure for both cone - beam ct and fluoroscopic assistance . additional information regarding technical and methodological aspects can be found in the web appendix at www.aospine.org/ebsj . the time required to perform each procedure with fluoroscopy and cone - beam ct was not significantly different ( table 1 ) . radiation exposure to cadaver from the cone - beam ct was equivalent to the exposure to a patient undergoing a kyphoplasty would experience during cannula insertion ( table 1 ) . assessment of the cannula position revealed no cannula malpositions or procedure - related complications for either technique . a cone - beam ct image profile includes images from a single rotation of the cone beam around the cadaver , as well as a digital image that projects instrumental targeting trajectory ( fig . . cone - beam ct image as displayed on the stealth navigation workstation screen position of cannulas were assessed in anteroposterior ( ap ) and lateral views during fluoroscopic imaging . radiation is a concern to both the surgeon and patient during a kyphoplasty with minimal available information regarding cone - beam ct exposure.8,9 both fluoroscopy and cone - beam ct assisted in allowing the acceptable placement of the cannula within pedicles , without a significant difference . these conditions included whether the cannula remained within the pedicle or if it violated the cortical boundaries of the pedicle . when helpful , the system provides imaging assistance with projection of trajectory for cannula placement . limitation : the study may have not included enough cadavers to detect possible surgical performance problems . with this possibility , there may have been differences in procedure time . fluoroscopy and cone - beam ct imaging both provide necessary imaging assistance to perform a kyphoplasty . cone - beam ct provides additional tools which may be beneficial in minimally invasive procedures and zero radiation exposure to the surgeon . a multicenter trial utilizing both fluoroscopy and cone - beam ct during a kyphoplasty may provide stronger evidence for the accuracy and benefit of the two imaging options . using the cone - beam ct kyphoplasty technique :
fluoroscopy and cone - beam ct have similar imaging capabilities with equivalent time and accuracy . | study design : equivalence trial ( irb not required for cadaveric studies).objective : to compare computer - guided and fluoroscopic kyphoplasty .
factors of interest were radiation exposure , position of cannula within pedicles and procedure time.methods : kyphoplasty was performed on two cadavers .
computer - navigated , cross - sectional images from a cone - beam ct were used for one and fluoroscopic imaging for the other . in each , t69 and t11l2 vertebrae were selected . for both imaging methods , anteroposterior and
lateral x - rays were taken . radiation exposure for both procedures
was measured by four dosimeters .
procedure time , radiation to surgeon and cadaver , and position of cannula placement within pedicles were recorded .
the surgeon wore one under the lead gown , another on the lead gown at shoulder level , and a third as a ring on the dominant hand .
a dosimeter was also placed on the cadaver.results : the radiation from the cone - beam , computer - guided imaging system was 0.0 mrem to the surgeon and 0.52 rads to the cadaver .
using fluoroscopic imaging , surgeon 's and cadaver 's exposure was 5 mrem and 0.047 rads , respectively .
procedure times were similar and neither device resulted in cannula malposition.conclusions : cone - beam ct appears as accurate as the fluoroscopy ; radiation exposure to the surgeon is eliminated , and radiation levels to the patient are acceptable . |
patients are often asymptomatic and the anomaly is discovered during imaging studies carried out for other reasons . however , when symptoms are present , they are related to hydro - nephrosis , infection , or calculus formation . the incidence of renal tumor in a horseshoe kidney is higher than in normal population . we present a case of renal cell carcinoma ( rcc ) in a horseshoe kidney . presence of the kidney malformation can change the surgery plan for preserving the organ without removing any functional tissue . a 62-year - old male patient presented to our institute , as a referral case from another hospital , with an abdominal mass . computed tomography ( ct ) scan of abdomen and pelvis was performed utilizing routine ct renal mass protocol . the scan revealed presence of a horseshoe kidney anomaly with a well - enhanced isthmus [ figure 1a ] . by using a power injector , we administered 150 ml of intravenous contrast material at a minimum rate of 3 ml / s . using , a multi - detector row ct scanner , contrast material - enhanced imaging was performed during the corticomedullary and nephrographic phases of enhancement using scanning delays of 40 s and 100 s , respectively . large lobulated mass was identified in the left side of the horseshoe kidney associated with an area of central cystic necrosis . the mass measured about 12 cm 13 cm 15 cm in anterior - posterior , width , and crainio - caudal maximum dimensions , respectively [ figure 1b and c ] . the renal vein and intravenous vena cava were patent and there was no evidence of significant enlarged intra - abdominal lymph nodes . the diagnosis made was rcc with a horseshoe kidney and patient was sent for urology consultation and surgical resection . ( a - c ) ct scan images of the abdomen obtained at the level of inferior mesenteric artery . ( a ) before administration of the contrast material shows a horseshoe kidney anomaly ( arrow ) . post - contrast images in b ) axial and c ) coronal planes show a large mass arising from the left part of the horseshoe kidney ( arrow ) . the mass is multi - lobulated and heterogeneous in attenuation with a central area of cystic necrosis hemi - nephrectomy was performed at our institute . follow - up ct scan of the abdomen and pelvis obtained in the post - operative period revealed resection of the previously described large mass within the left part of the horseshoe kidney . single selected axial computed tomography scan image of the abdomen performed in the post - operative period shows resection of the large mass in the left part of the horseshoe kidney with organ preserving surgery . the surgically removed gross specimen was a large mass , which had replaced more than 2/3 of the left side of the horseshoe kidney . the mass was lobulated and variegated , ranging from tan and yellow to dark brown . pathology specimen shows a large multi - lobulated mass associated with an area of hemorrhage and cystic necrosis . hematoxylin - eosin ( h and e ) stained histology slides of the above described mass revealed clear cell rcc with prominent borders and profuse network of small , thin - walled sinusoid - like blood vessels [ figure 4a and b ] . hematoxylin and eosin stained slides of the clear cell renal cell carcinoma ( rcc ) mass in a horseshoe kidney . ( a ) at 6 magnification shows the tumor margin ( arrow ) in relation to the reminder of the kidney , ( b ) at 300 shows clear cells with prominent cell borders ( black arrow ) and vascularity ( yellow arrow ) no genetic determinant is known , although , it has been reported in identical twins and in siblings within the same family . horseshoe kidney consists of two distinct functioning kidneys on each side of the mid - line , connected at the lower poles by an isthmus of functioning renal parenchyma or fibrous tissue that crosses the mid - line of the body . nearly , one - third of all patients with a horseshoe kidney remain asymptomatic and the pathology is discovered incidentally during physical examination or ct and ultrasound scans . when symptoms are present , they are related to hydro - nephrosis , infection , or calculus formation . the incidence of renal tumor in a horseshoe kidney is approximately 3 to 4 times greater than in normal population , and is possibly the result of chronic obstruction , lithiasis , and infection . the tumor can localized at any part of the kidney but it mostly found within the isthmus . ct utilizing routine renal mass protocol is the primary imaging modality of choice for localization and staging of any renal tumor . however , in case of rcc and horseshoe kidney , ct angiography is highly recommended to check the renal vascularity , which generally varies and is essential for pre - operative planning . if ct scanning is performed specifically to evaluate a known renal mass , the study must include an unenhanced examination prior to the administration of intravenous contrast material . after administration of contrast , scans are taken at intervals of 40 s and 100 s during the enhancement phase . the dataset can be manipulated by using a 3d workstation to produce volume - rendered and 3d images when necessary . it is becoming increasingly important for radiologists to produce 3d reconstructed images as more laparoscopic surgery is being performed for the treatment of renal cancer , and these images are helpful in such procedures . thus , pre - operative surveillance is highly recommended for early identification of metastatic activity and positive surgical margin . surgical approach is through the mid - line in order to have better exposure of the isthmus for isthmectomy . clear cell rcc , the pathology subtype , as found in our case , is typically a solitary tumor and the tumor commonly presents as bosselated , well - circumscribed mass with fibrosis and with a capsule or pseudo - capsule . lipid - rich cells in clear rcc impart the classical golden yellow color seen on gross pathology analysis . clear cell rcc may exhibit a variety of histo - architectural patterns including , solid , alveolar , and acinar forms . horseshoe kidney is the most common renal fusion anomaly and is more predominate in males and it is detected mostly as incidental finding on ct or us examination . rcc is one of the malignancies associated with this malformation , as was seen in our case . | renal cell carcinoma ( rcc ) is encountered in about 3% of all adult neoplasms .
presence of any kidney malformation can change the plan for surgical treatment of rcc with organ preserving surgery .
we report a case of clear cell rcc in a horseshoe kidney .
computed tomography scan revealed a horseshoe kidney anomaly with a large mass in the left side .
the diagnosis of rcc was confirmed by pathology and histology findings . |
an otherwise healthy 64-year - old caucasian man presented with worsening right inguinal pain since 3 months . a computed tomography scan showed a 7 7.5-cm mass infiltrating the right psoas muscle , a right - sided hilar lung lesion , enlarged ipsilateral mediastinal lymph nodes and a 4.5 3-cm adrenal mass . a bronchoscopic biopsy confirmed a poorly differentiated carcinoma , positive for p63 , ck5/6 and negative for ttf-1 ( thyroid transcription factor-1 ) on immunohistochemical staining ( fig . the pathology report stated a poorly differentiated squamous cell carcinoma ( scc ) of the lung , and systemic therapy was initiated . unfortunately , the patient progressed after two cycles of first - line chemotherapy with carboplatin and paclitaxel and subsequently received palliative radiotherapy with 50 gy for the psoas metastasis and the primary tumour . in addition , an epidermal growth factor receptor ( egfr ) mutation analysis from the initial tumour material revealed an activating point mutation in exon 21 ( p.l858r ) . the egfr tyrosine kinase inhibitor ( tki ) erlotinib was started resulting in a partial remission after 8 weeks of therapy , and the patient became asymptomatic and unrestricted in his physical activity ( fig . twenty - two months later , he developed multifocal progression with lung and liver metastases . a bronchoscopic rebiopsy showed small nests of undifferentiated tumour cells with weak immunoreactivity of some tumour cells for p63 , ck5/6 and also positivity of some tumour cells for ttf-1 , suggesting a mixed squamous / glandular immunophenotype ( fig . d ) . third - line chemotherapy remained unsuccessful , and the patient died 33 months after initial diagnosis . median survival rates in chemotherapy - refractory , unselected patients are less than 6 months with either erlotinib or chemotherapy . if egfr mutation testing had not been performed , our patient would have likely missed the opportunity of having a symptom - free period of almost 2 years with egfr tki therapy . several factors are known to be associated with the presence of an activating egfr mutation : female gender , non - smoking history , asian ethnicity and adenocarcinoma . the incidence of egfr mutations in scc is rare , particularly in caucasian patients ( < 5% ) . a study on 95 resected pure scc patients suggested that egfr mutations are usually absent . according to the recent esmo guidelines , molecular testing is recommended in never or former light smokers ( < 15 pack - years ) with scc of the lung . since none of these clinico - pathological criteria applied to the patient , the egfr mutation has not been determined at initial diagnosis . the pathological diagnosis of lung tumours is based on the 2004 who criteria . of note , this classification was established on resected tumour material , which is available in only 30% of non - small cell lung cancer ( nsclc ) patients . the morphological diagnosis of scc was not possible due to the lack of keratinisation and intercellular bridges . therefore , immunohistologic staining to assist in the identification of the histological subtype is recommended . although a high correlation with scc and positive immunoreactivity for ck5/6 and p63 have been reported , the correct wording of the initial pathology report should have been nsclc , not otherwise specified ( nos ) favouring scc according to the immunohistologic markers [ 6 , 7 ] . this classification has recently been proposed for small biopsies / cytology samples to clarify whether diagnosis was based on morphology or special stains . however , only patients with adenocarcinoma ( i.e. morphological diagnosis ) , nsclc nos favouring adenocarcinoma ( i.e. special stains ) and patients with nsclc nos are generally considered for egfr mutation testing in clinical practice . in patients with a clear morphological diagnosis of scc or nsclc it is very important to keep in mind that all current clinical trials justifying the importance of the distinction between histologic types are based on light microscopy alone , and our knowledge on the incidence of activating egfr mutations in patients with true nsclc nos and nsclc nos favouring adenocarcinoma or scc according to immunohistochemical marker profile is limited [ 8 , 9 , 10 , 11 ] . our case raises the question whether egfr mutation testing should be advocated in all patients with a bioptic diagnosis of nsclc who morphologically lack glandular or squamous differentiation ( i.e. nos ) , independent of the results of specific stains , particularly in patients with clinical characteristics commonly associated with an egfr mutation such as a remote smoking history in our patient . rebiopsy after progression on egfr tki therapy immunohistochemically suggested the presence of a mixed adenosquamous subtype , a condition described in approximately 5% of nsclc on resected tumour tissue . although bronchoscopic biopsies have the advantage of being minimally invasive compared to surgical biopsies , they carry the risk of containing a variable amount of tumour tissue that may not be representative for the tumour burden as a whole , and a mixed adenosquamous subtype may be overlooked ( sampling error ) . our case illustrates the importance of a multidisciplinary approach and close collaboration among pulmonologists , pathologists and oncologists in treating patients with stage iv nsclc . due to tumour heterogeneity , every effort should be made by the experienced pulmonologist to obtain sufficient material from different areas of the tumour . in our opinion , a remote smoking history in a patient with nsclc nos favouring scc should also lead to egfr mutation testing to allow highly effective therapy to be offered to mutation - positive patients . genetic analyses such as high - throughput gene profiling and mirna studies hold promise in supporting classification of lung cancer subtypes and have the potential to assist the classical morphologic and immunohistochemical diagnosis in the near future . | we report the case of a 64-year - old ex - smoker with metastatic poorly differentiated squamous cell carcinoma ( scc ) of the lung and an epidermal growth factor receptor ( egfr ) mutation in exon 21 ( p.l858r ) who achieved prolonged clinical benefit from treatment with an egfr tyrosine kinase inhibitor ( tki ) .
the initial diagnosis of scc of the lung obtained by bronchoscopic biopsy was based on immunohistochemical staining only with positivity for cytokeratin ( ck ) 5/6 and p63 because morphological diagnosis was not possible .
patients with non - small cell lung cancer ( nsclc ) , not otherwise specified ( nos ) favouring scc are usually not tested for the presence of egfr mutations , and therefore may not receive egfr tki therapy .
a bronchoscopic rebiopsy showed small nests of undifferentiated tumour cells with weak immunoreactivity of some tumour cells for ck5/6 , p63 and no positivity of some tumour cells for thyroid transcription factor-1 .
these findings suggested a mixed squamous / glandular immunophenotype that has been missed at the initial biopsy .
our clinical case illustrates the problem of tumour heterogeneity encountered in small bronchoscopic biopsies and the difficulties of evaluating the histological subtype in poorly differentiated carcinomas .
initial bronchoscopy should be performed by an experienced pulmonologist who attempts to obtain sufficient material from different areas of the tumour . in the era of targeted therapy , a remote smoking history in a patient with nos favouring scc
should also lead to egfr mutation testing to allow highly effective therapy to be offered to mutation - positive patients . |
diabetes affects almost every tissue in the body and causes significant organ dysfunction that results in diabetes - related morbidity and mortality . coronary artery disease is the leading cause for the increased cardiovascular morbidity and mortality in diabetes , and atherosclerosis of the coronary vessels is its initial pathogenetic mechanism . coronary artery disease and hypertension can account for most of the myocardial abnormalities that occur in diabetes . however , postmortem , experimental , and observational studies also provide evidence for a specific cardiomyopathy in diabetes , which may contribute to myocardial dysfunction in the absence of coronary artery atheroma . this is also sustained by the fact that patients with diabetes , independently of the severity of coronary artery disease , have increased risk of heart failure in comparison with subjects without diabetes . in general diabetes affects the heart in 3 ways : ( 1 ) coronary artery disease due to accelerated atherosclerosis ; ( 2 ) cardiac autonomic neuropathy ; and ( 3 ) diabetic cardiomyopathy ( dcp ) . although there is high awareness among clinicians about the first two disease entities , diabetic cardiomyopathy is poorly recognized by most physicians . dcp , first defined by rubler in 1972 , is characterized by the myocardial dysfunction in the absence of coronary artery disease , hypertension , or valvular heart disease . it is associated with both type 1 and type 2 diabetes mellitus ( t1 dm and t2 dm ) . as in the case that we report here , dcp may be subclinical for a long time , before the appearance of clinical symptoms or signs . we present the case of a 39-year - old man that was admitted in our clinic due to a stroke . according to its past medical history , the patient was diagnosed in the primary care setting with elevated blood glucose levels , about 8 months before the stroke . the rest of his past medical history was free of any other diseases . according to the information we have , at that time the patient was given lifestyle advice on dietary and physical activity , by the primary care physician . he was also strongly encouraged to lose weight as the patient had body mass index of 34 ( bmi = 34 ) . unfortunately , there is no record of the specific glucose values identified at that time . we do nt know also , the time period that this patient had deranged blood sugar levels , since , according to what he reported , he did nt have any medical blood tests done over the past 10 years . during his admission to the hospital , the patient was afebrile , well - oriented in time and space , with paresis of the right upper and lower limbs . his arterial blood pressure was 140/90 mmhg , electrocardiogram ( ecg ) with sr and his pulse was regular . his bmi at that time was the same with the bmi originaly calculated about 68 months ago . his medical history was free of any other diseases , apart from the hyperglycemia mentioned earlier . the computed tomography ( ct ) brain scan revealed an extensive ischemic infarct of the left parietal lobe in the supply zone of the left middle cerebral artery . his biochemical tests results were : white blood cell count ( wbc ) = 9000/l , hematocrit value ( hct ) = 44,8% , serum glutamic oxaloacetic transaminase ( sgot ) = 33u / l , serum glutamic - pyruvic transaminase ( sgpt ) = 21u / l , -gt : 53u / l , blood glucose level : 187 mg / dl . during the 2 day of hospitalization we performed an ecg . we found an enlarged left atrium , an enlarged hypokinetic left ventricle with an ejection fraction of 30% and a large thrombus in it as well as an enlarged right ventricle . warfarin was added to his drug therapy , that already included antiplatelet agents . during his stay in the hospital , the diagnosis of dm for the first time was made and his glycosylated hemoglobin level ( hba1c ) was 10.42% . the patient followed a stable clinical course with a progressive improvement in his motor functions . he is now on motor physiotherapy and a regular medical follow - up for his diabetes , his heart failure and the stroke . dcp is defined as the cardiovascular damage present in diabetes patients , which is characterized by myocardial dilatation and hypertrophy , as well as a decrease in the systolic and diastolic function of the left ventricle , and its presence is independent of the coexistence of ischemic heart disease or hypertension . as in the case of our patient , dcp may be subclinical for a long time , before the appearance of clinical symptoms or signs . various proposed mechanisms include metabolic disturbances , insulin resistance , microvascular disease , alterations in the renin - angiotensin system ( ras ) , cardiac autonomic dysfunction and myocardial fibrosis . chronic hyperglycemia is thought to play a central role in the development of dcp , although multiple complex mechanisms and an interplay of many molecular and metabolic events within the myocardium and plasma contribute to the pathogenesis . the main metabolic abnormalities in diabetes are hyperglycemia , hyperlipidemia and inflammation , all of which stimulate generation of reactive oxygen or nitrogen species that cause most of the diabetic complications , including diabetic nephropathy and dcp . several adaptive responses caused by these metabolic abnormalities finally result in cardiac dysfunction and heart failure . however , proper treatment of diabetes and its metabolic abnormalities in the primary care setting reduces the rates of dcp , myocardial infarction , and associated cardiovascular death . since dcp is now known to have a high prevalence in the asymptomatic diabetic patient , screening for its presence at the earliest stage of development would be appropriate in order to prevent the progression to congestive heart failure and further significant complications . as this high - risk diabetic population is constanly rising , increasing the awareness of physicians for the serious metabolic complications of diabetes , especially in the primary care setting , will help in taking appropriate and early action towards the prevention of full - blown disease and decreasing disability and mortality . | diabetic cardiomyopathy ( dcp ) is defined as the cardiovascular damage present in diabetes patients , which is characterized by myocardial dilatation and hypertrophy , as well as a decrease in the systolic and diastolic function of the left ventricle , and its presence is independent of the coexistence of ischemic heart disease or hypertension . as in the case of the patient that we present here , dcp may be subclinical for a long time , before the appearance of serious clinical symptoms , signs and complications .
dcp is poorly recognized by most physicians .
currently , there is no specific treatment for this pathologic entity .
however , proper treatment of diabetes and its metabolic abnormalities in the primary care setting reduces the rates of this serious metabolic complication of diabetes . as this high - risk diabetic population is constantly rising , increasing the awareness of physicians for the serious metabolic complications of diabetes , especially in the primary care setting , will help in taking appropriate and early action towards the prevention of full -blown disease and decreasing disability and mortality . |
lung infection with aspergillus manifests in a variety of patterns , the most important of which are allergic bronchopulmonary aspergillosis , chronic necrotizing aspergillus pneumonia , aspergilloma and invasive aspergillosis . however , it is associated with a high risk of mortality , mostly due to late or missed diagnosis or lack of safe effective treatment . unlike the pulmonary forms of the disease , majority of the reported cases of pleural aspergillosis have been in the presence of some underlying lung pathology or surgical procedure . the most common preceding conditions are pre - existing tuberculosis ( 87% ) , bronchopulmonary fistulas ( 74% ) , pleural drainage ( 56% ) and lung resection ( 17% ) . here , we report pleural aspergillosis occurring in a young healthy male , with no prior evidence of lung damage . an extensive pubmed search revealed no similar case report in the english literature . a 16-year - old indian boy presented to the out - patient department of our hospital with complaints of low - grade fever , dry cough and left sided chest discomfort of 6 weeks duration . there was no history of bronchial asthma , diabetes mellitus , previous hospitalization or surgical intervention . on examination , left sided movements were decreased , percussion note was stony dull and air entry was absent . on investigating , his routine hematological and biochemical parameters were normal ( hemoglobin 11 g / dl , total leucocyte count p52 l40e8 , blood sugar ( fasting ) 86 mg / dl , blood sugar ( post - prandial ) 148 mg / dl , t. bilirubin-0.4 mg / dl , aspartate aminotransferase - 26 iu / ml , alanine aminotrans ferase 38 iu / ml , blood.urea-26 mg / dl , s. creatinine-1.0 mg / dl ) . mantoux test and serology for human immunodeficiency virus were negative . diagnostic intercostal drainage revealed frank brownish pus and tube thoracostomy was performed draining 1000 ml pus on the 1 day itself . the pus and induced sputum stained negative for pyogenic organisms and acid fast bacilli ( afb ) . considering the fact that the patient belonged to a high incidence area for tuberculosis , a therapeutic trial of anti - tuberculosis treatment was started . however , at the end of 2 months of treatment , his induced sputum and pleural fluid again stained negative for afb . culture of the sputum sample was also negative for afb . despite treatment and drainage with a broad intercostal drainage tube ( icd ) the sputum smears were negative , but pus smears showed septate fungal hyphae and grew a. fumigatus in culture [ figure 2 ] . smears from the culture showed septate hyphae and conidiophores confirming pathogenic role of the mould . flexible bronchoscopy was done and bronchial wash was subjected to microbiological studies . both fungal smear and culture patient was thus diagnosed as pleural aspergillosis in the absence of invasive pulmonary aspergillosis or any other obvious predisposing factors . within 4 weeks , the patient showed signs of recovery with reduction in cough and chest pain [ figure 3 ] . the pyopneumothorax showed signs of resolution and the icd was removed after 6 weeks of starting treatment . patient was maintained on oral voriconazole for 9 months and showed no signs of relapse 1 year later . chest radiograph anteroposterior view showing left pyopneumothorax with collapsed left lung photograph of culture of the pus in sabouraud 's dextrose agar in duplicate at 25c and 37c . both test tubes showed luxurious bluish - green growth with a suede - like surface diagnostic of aspergillus fumigatus chest radiograph taken 1 month after treatment initiation showing well - expanded left lung with intercostal tube in situ we conducted a thorough search for the source of the a. fumigatus infection in our patient and found that the boy had a carious tooth . on culture in blood agar , streptomyces spp . in addition , the carious material was cultured in sabouraud 's dextrose agar medium and it grew a. fumigatus . we thus hypothesize that at some point in time the patient could possibly have aspirated the carious material , which would have infected the pleura subsequently without direct invasion of lung parenchyma . we thus , report this case in view of the extreme rarity of pleural aspergillosis in patients with otherwise healthy lungs . it is a rare entity and usually occurs in the presence of disruption of local pulmonary defence mechanisms , most often due to tuberculosis . found that an established empyema and a bronchopleural or pleurocutaneous fistula were the two clinical settings most commonly associated with pleural aspergillosis . in our case , infection of the pleura occurred in the absence of any lung pathology in an otherwise healthy individual . the growth of a. fumigatus in the culture of the carious material from the tooth is a useful clue to the origin of the infection and the sequence of events , which could have followed . we hypothesize that micro aspiration of the fungal elements led to direct seeding of the pleura ( as no lung pathology was seen on the chest radiograph or the bronchial wash microscopy ) . an extensive pubmed search revealed no case in english literature , which did not have evidence of previous injury to the pleura . karthik and sudarsanam reported a case of pleural aspergillosis caused by aspergillus terreus in an indian patient who was an old case of pulmonary tuberculosis . they treated the patient with intercostal drainage and amphotericin - b ( amb ) ( 1 mg / kg for a total of 1.5 g ) . however , the patient did not significantly improve and subsequently underwent a left lung decortication surgery . early administration of antifungal agents and pleural drainage are helpful in improving the outcome of patients . amb has been the mainstay conventionally , but the major limitation has been the toxicity associated with its administration ( nephrotoxicity , phlebitis , hypokalemia , hypomagnesemia , anemia ) in nearly 80% of patients . stern et al . used voriconazole 200 mg twice - a - day for 2 weeks in a 70 kg patient of pleural aspergillosis , which was later increased to 300 mg twice - a - day . they demonstrated that voriconazole penetrated pleural fluid and sterilized the pleural cavity well wherein , their patient was completely cured after 6 months . hence , clinical suspicion and early detection of fungal cause of a non - responsive empyema may improve the clinical outcome of such patients . we report this case in view of the extreme rarity of its occurrence in previously normal lungs . | pleural aspergillosis is a rare entity , with most of the cases occurring on a background of lung disease or surgery .
we report a case of a 16-year - old boy who developed pleural aspergillosis in the absence of any obvious pre - disposing factors .
patient presented with fever , dry cough and left sided chest discomfort of 6 weeks duration .
a chest radiograph revealed features of the left pyopneumothorax . despite being started on presumptive antituberculous treatment and intercostal drainage his symptoms failed to resolve .
the sputum and pus were then subjected to fungal smears and culture , which indicated growth of aspergillus fumigatus .
we report this case in view of the extreme rarity of pleural aspergillosis occurring in a young healthy individual with no evidence of prior lung pathology .
furthermore , the source of infection was traced back to a very unusual possible focus a decayed tooth infected with a. fumigatus , thus making the case even more interesting . |
a 28-year - old man presented with abdominal pain that had persisted for the past three months . abdominal computed tomography scan revealed a cystic mass in the right hepatic lobe ( fig . serologic testing for hydatid cysts was not performed . however , the clinical impression was a hydatid cyst . a right hemihepatectomy was performed , and the resected specimen was sent for intraoperative consultation . the smears showed many protoscolices in the shape of a mushroom , with hooklets ( fig . fragments of laminated membranes stained pinkish - red on hematoxylin - eosin stain . therefore , the diagnosis of a hydatid cyst was made . histologic examination revealed that the cyst wall was composed of an outer laminated membrane and an inner germinal layer ( fig . the surrounding liver parenchyma showed a fibrinous wall and inflammatory cells infiltration including lymphocytes , eosinophils , and histiocytes . the patient has been alive for 16 months following this surgery without evidence of recurrence . humans are accidental intermediate hosts and become infected by ingestion of food contaminated with eggs shed by dogs or foxes . after ingestion , the eggs of e. granulosus hatch , and the larval oncospheres pass to the liver by the portal vein . the majority occurs in the right lobe , but they may be multiple and involve all lobes of the liver . it varies from a few millimeters to many centimeters in diameter.1 because of its slow growth , the diagnosis may be delayed for months to years after the initial infection . the adult e. granulosus is a small tapeworm capped by a scolex at the anterior terminus , and measures 3 to 5 mm in length . four suckers and a double crown of 28 - 50 hooks emerge from the scolex.9 the cyst wall has a laminated membrane lined by a germinal layer . the germinal layer is 10 to 25 m in thickness and contains nuclei . in korea , hydatid cysts are uncommon and are typically imported by travelers or workers from endemic areas.2 - 4 in the present case , the patient was a foreign worker who had lived the first 26 years of his life in an endemic area . cytologically , protoscolices , hooklets , and fragments of the laminated membrane are commonly found in hydatid cysts.5 - 8 in some cases , only laminated membranes were present in the inflammatory background.10 - 12 in the current case , protoscolices , hooklets , and laminated membranes were identified and the background showed necrotic debris and inflammatory cells . the liver is the most frequently involved organ . in cases of hydatid cysts that involve atypical locations and other organs , the diagnosis can be difficult . fnac appears to be a safe and useful method in the diagnosis of hydatid cyst , although arguments regarding this issue persist.13 cytologic diagnosis of hydatid cysts has been reported in the lung,14 omentum,15 muscle,16 soft tissue,10,12 brain,17 orbit,18 and joints.11 the differential diagnosis of hepatic hydatid cyst includes abscess , hemangioma , and non - parasitic cysts such as solitary bile duct cyst and hepatobiliary cystadenoma . hydatid cyst should be considered when fragments suggestive of a laminated membrane are present on smears without evidence of protoscolices.12 a definite diagnosis of hydatid cyst is confirmed by identification of protoscolices , refractile hooklets or fragments of a laminated membrane . surgical excision of the intact hydatid cyst without rupture is the treatment of choice , to reduce the chance of seeding and recurrence.9 there have been significant advances in the knowledge of echinococcus biology and the development of more specific and sensitive immunological tests.19 early diagnosis of hydatid cyst by serology may provide opportunities for early treatment and more effective chemotherapy.20 in conclusion , we presented the cytological features in a case of a hepatic hydatid cyst . it is important to include hydatid cyst in the differential diagnosis of cystic lesions in the liver , particularly in those who have lived or traveled in endemic areas . | hydatid cysts ( echinococcosis ) are caused by an infestation with larval tapeworms of the genus echinococcus .
the disease is extensively distributed worldwide , and it has been rarely reported in korea . we describe the cytologic features of a case of hepatic hydatid cyst in a 28-year - old male .
computed tomography revealed a cystic mass in the right lobe of the liver .
a right hemihepatectomy was performed .
the aspirated fluid from the hepatic cystic mass was clear .
the smears showed protoscolices , hooklets , and a laminated membrane . |
malignancy is a recognized complication of renal transplantation . in australia , it is estimated that 25% of all renal transplant recipients surviving for 20 years will develop a non - skin cancer . renal cell carcinoma ( rcc ) accounted for 4.6% of de novo cancer in solid organ transplant recipients , but the majority occurred in native kidneys and less than 10% in allograft kidneys . a number of case reports have been published on partial nephrectomy as a treatment option particularly when the rcc is less than 4 cm [ 36 ] . we report a case of rcc in a kidney allograft compromised by previous segmental infarction and chronic allograft nephropathy ( can ) , which was treated successfully with nephron - sparing partial nephrectomy . a 47-year - old woman with end - stage renal disease due to reflux nephropathy underwent deceased donor renal transplantation in 1994 . sirolimus was changed to tacrolimus 2 years later due to heavy proteinuria ( 4.5 g / day ) . eleven years after transplantation , a 3.3 cm mass was found in the lower pole of the renal allograft during transabdominal ultrasound for investigation of pelvic pain . magnetic resonance imaging confirmed the presence of a complex cystic mass that was highly suspicious for a rcc . there was no radiological evidence of local and distant metastases or involvement of the native kidneys . at that time post - surgery , she developed acute tubular necrosis of the allograft and required three haemodialysis sessions . she subsequently made an uneventful recovery with serum creatinine 272 mol / l on discharge . three years after surgery , there is no evidence of rcc recurrence and she remains free of renal replacement therapy . traditionally , the treatment for rcc arising from kidney allografts has been allograft nephrectomy , withdrawal of immunosuppressive therapy and resumption of dialysis . however , recent data suggest that partial nephrectomy is emerging as a viable alternative option . butler et al . reported that radical nephrectomy and partial nephrectomy provided equally effective treatment for single , localized rcc of less than 4 cm in native kidneys . one long - term follow - up study has found the cancer - specific survival to be 100% at 10 years in patients who underwent partial nephrectomy with tumours less than 4 cm . rcc involving transplant recipients appear to have similar biological behaviour as those involving patients without immunosuppression . as a result , the use of partial nephrectomy has been extrapolated into the management of rcc in kidney allografts . there were 18 cases of tumour in renal allografts treated by partial nephrectomy reported in the worldwide literature . of these cases , 13 ( 81% ) had rcc , 2 had oncocytoma , 1 had angiomyolipoma and the pathology was not reported in 2 cases . of the rcc cases , 11 cases ( 85% ) were small lesions measuring less than 4 cm while one was 6 cm and the other 9 cm . mean time of diagnosis after transplantation was 11.1 years ( range : 1 month to 21.5 years ) . in this series , mean follow - up after partial allograft nephrectomy was 32 months ( range : 0.5138 months ) with no patient reported to develop local recurrence , renal failure or distant dissemination . although the data are limited , the evidence so far indicates that nephron - sparing surgery provides a durable cancer control of tumours less than 4 cm without significant compromise to graft function . therefore , partial graft nephrectomy may be proposed as the treatment of choice for tumours less than 4 cm . this would avoid returning patients to dialysis that is associated with inferior life expectancy and quality of life when compared with a functioning graft . moreover , partial graft nephrectomy avoids overtreatment of unexpected non - malignant tumours . in the majority of previous cases , partial graft nephrectomy was performed on good functioning allograft with serum creatinine between 79 and 158 mol / l . however , in the case described , the graft function is compromised because of segmental infarction and can . partial graft nephrectomy in allograft kidneys with severe compromised function has only been reported in two previous cases , one with creatinine of 211 mol / l and 222 mol / l in the other . graft function in these two cases was still preserved after 6 and 22 months , respectively . to our knowledge , the described case is the first to have undergone successful partial allograft nephrectomy in the setting of segmental infarction . it is performed in a non - nave surgical field where severe inflammation and scarring are usually present , making kidney mobilization , pedicle control and parenchymal resection often difficult . the continuous perfusion of the allograft with the cooled ross solution preserved the residual kidney function , as seen in the merkel 's case and the current case . this continuous perfusion also made it easier to identify and individually ligate all vessels in the cut surface to minimize blood loss . intra - operative ultrasound can assist in gaining satisfactory clearance and preserve renal parenchyma for optimal renal function . it also allowed exact determination of the extent of these lesions if polycentricity is present . rcc arising from a renal allograft is rare . data are accumulating to suggest that preservation of renal function can be achieved by partial nephrectomy without sacrificing control of the malignancy . | the increased risk of malignancies is a well - recognized complication of organ transplantation .
when renal cell carcinoma ( rcc ) occurs in kidney transplant recipients , less than 10% of it affects the allograft .
recent experience suggests that partial allograft nephrectomy for tumours less than 4 cm may be considered the treatment of choice .
we report a case of a 3.3 cm rcc discovered in a renal allograft .
limited allograft function was due to segmental infarction after transplant surgery and chronic allograft nephropathy .
she underwent successful partial allograft nephrectomy . at 36 months post - surgery , there is no evidence of rcc recurrence and she remains free of renal replacement therapy . |
laparoscopy represents the gold standard for the diagnosis and treatment of a nonpalpable intraabdominal testis ( npat ) , which makes up around 20% of cases of undescended testis . with the evolution of minimally invasive surgery , the operative approach toward orchidopexy for npat has shifted from a traditional open approach to a multiport and single laparoscopic technique . the aim of this study was to evaluate the feasibility of orchidopexy for an npat by use of a surgical glove port and conventional rigid instruments . we retrospectively reviewed all cases of patients with npat who had undergone laparoendoscopic single - site ( less ) orchidopexy at our department between january 2013 and september 2014 . throughout the study period , less all families consented to the single - incision approach and possible conversion to multiport laparoscopy . the medical records of the patients were reviewed , and data concerning age , weight , operative time , complications , and surgical outcome were collected . as we previously described , we initially made a transumbilical glove port using a flexible ring ( fr ) , a rigid larger ring ( rr ) , one powder - free surgical glove , a wire - to - skin , and standard laparoscopic trocars . the fingertips of the glove were cut off where the trocars were inserted and fixed by a vicryl 3/0 ligature wire . then , the open end of the glove was passed through the fr and turned around it in the middle of the glove ( fig . a 1-cm incision was made at the level of the umbilicus without dissection of subcutaneous tissue . after the incision , the inner fr , fitted with the glove , was introduced into the abdomen . a 30 angle laparoscope with 3-mm or 5-mm straight rigid instruments identical to those for conventional laparoscopy including graspers , scissors , and electrocautery was used to perform our less orchidopexy ( fig . we opted for the first stage of two - stage fowler - stephens orchiopexy if the testis was closer to the iliac vessels . their age ranged from 9 months to 24 months ( mean age , 18 months ) . all patients had a nonpalpable unilateral undescended testis , which was on the right side in 14 patients and on the left side in 6 patients . seventeen patients underwent laparoscopic orchidopexy without vessel division as a one - stage procedure and 3 patients had less fowler - stephens orchidopexy for the first and the second stage . average operating time was 57 minutes , with extremes ranging from 40 to 80 minutes . the mean operative time for those undergoing one - stage orchidopexy was 57.11 minutes ( range , 40 to 80 minutes ) , that for primary fowler - stephens orchidopexy was 24 minutes ( range , 20 to 26 minutes ) , and that for second - stage surgery was 56.66 minutes ( range , 56 to 58 minutes ) . neither intraoperative nor postoperative complications were seen and the patients were discharged within a few hours of surgery . no patients were lost to follow - up . the total duration of the follow - up period ranged from 3 months to 1 year , 6 months . one patient had atrophy after the fowler - stephens orchiopexy procedure , and two cases had reascension of the testicle . no scoring was done to evaluate the final scar . however , the umbilical incision was nearly invisible and much appreciated by the parents . the question arises , why did we choose this technique to perform orchidopexy for npat ? in fact , society pushes us to remain up to date and even be ahead of our time , but not at any price , in terms of potential complications and financial costs , especially in the pediatric population . it is for these reasons we chose less , which has gained popularity over the last decade . in addition , these approaches offer documented benefits including improved cosmetic outcomes , decreased pain , and the ability to easily perform combined procedures without having to place additional ports . less procedures can be performed with the r - port , uni - x port , and sils port , which are very costly . the alexis wound retractor , curved instruments , and flexible - tip laparoscope are not available in our country . therefore , we chose a less expensive access method to perform orchidopexy for npat , known as a " surgical glove port " or " homemade single - port , " which was described previously for the completion of various procedures in adults . our technique may be an alternative to the costly commercially available single - port systems , especially in a developing country . to our knowledge , this technique has been previously used for orchidopexy in a pediatric population by only four authors . sultan et al . used an r - port in a 2-year - old boy ; raju et al . and de lima et al . used rigid instruments in an 18-month - old child and for 3 boys , respectively ; and noh et al . reported a series of 17 patients in which a multichannel single port and flexible tip laparoscope were used . all of these studies showed less orchidopexy in children to be feasible , safe , and scarless , with no intraoperative complications . in terms of technical considerations , the single - incision technique allows adequate visualization and counter traction for performing orchidopexy , especially with a standard instrument . the mean operative time for less orchidopexy in this report was longer than in the series reported by noh et al . , probably because of the use of the flexible tip laparoscope , but it was shorter than the time reported by raju et al . , who reported a technique using standard trocars through a single umbilical incision with an intraabdominal time of 126 minutes . in fact , when the first 10 operative single - incision cases were compared with the second 10 cases , a trend toward a shorter operative time was noted , but this was not statistically significant . recently , zani et al . reported that less seems to be associated with more postoperative pain than standard laparoscopy . the postoperative pain score was not analyzed because this score did not correlate with the requirement for additional analgesics . this is one of the largest series of pediatrics patients to undergo less orchidopexy and the only pediatric study to have been done with a surgical glove port . our results demonstrate the safety and feasibility of this procedure , which can be an alternative to costly commercially available single - port systems , especially in a developing country . | purposewe review the literature and describe our technique for laparoendoscopic single - site orchidopexy using a glove port and rigid instruments .
we assessed the feasibility and outcomes of this procedure.materials and methodswe retrospectively reviewed the case records of all children who had undergone laparoendoscopic single - site orchidopexy by use of a surgical glove port and conventional rigid instruments for a nonpalpable intraabdominal testis between january 2013 and september 2014.resultsdata from a total of 20 patients were collected .
the patients ' mean age was 18 months .
all cases had a nonpalpable unilateral undescended testis .
fourteen patients ( 70% ) had an undescended testis on the right side and six patients ( 30% ) had an undescended testis on the left side .
seventeen patients underwent primary orchidopexy .
three patients underwent single - port laparoscopic fowler - stephens orchidopexy for the first and the second stage .
average operating time was 57 minutes ( range , 40 to 80 minutes ) .
no patient was lost to follow - up . at follow - up
, 2 testes were found to have retracted out of the scrotum and these were successfully dealt with in a second operation .
one testis was hypoplastic in the scrotal pouch .
there were no signs of umbilical hernia.conclusionssingle-port laparoscopic orchidopexy using a glove port and rigid instruments is technically feasible and safe for various nonpalpable intraabdominal testes
. however , surgical experience and long - term follow - up are needed to confirm the superiority of this technique . |
the main therapeutic approach is adrenalectomy and extraction of the tumor from the inferior vena cava and the right atrium . this requires a precise evaluation of the extent of spread of the tumor , a meticulous pre - operative planning and a combined team including general and cardiac surgeons and a cardio - pulmonary bypass team . jugular venous pulse and heart sounds were normal . a soft murmur compatible with tricuspid regurgitation was heard . abdominal ultrasound revealed a cirrhotic liver with an enlarged portal vein , splenomegaly and ascites . a large uniform , echodense , immobile mass ( area- 3.3 cm ) , attached to the interatrial septum was seen in the right atrium ( figure 1 ) . the inferior vena cava was mildly enlarged and an elongated mass attached to its wall was seen . the patient was operated and combined cardiac and abdominal procedures were performed , monitored by transesophageal echocardiography , which did not add any additional information . inferior vena cava and right atrium were exposed and a large mass extending from the hepatic portion of the inferior vena cava to the right atrium was removed . postoperative course was complicated by massive bleeding and coagulopathy and the patient died few hours after the operation . we describe a rare case of adrenocortical carcinoma that extended to the inferior vena cava and the right atrium . tumors that affect the right atrium include primary neoplasms and secondary tumors such as hypernephroma , hepatoma , testicular sarcoma and melanoma . adrenal carcinoma may also extend to the renal veins and the inferior vena cava , usually accompanied by a thrombus . most of the described cases of adrenal carcinomas extending to the right atrium including the present case were right - sided [ 4,6,7,9 - 15 ] . this is explained by the direct course of the right adrenal vein to the inferior vena cava . other forms of cardiac involvement include infiltration of the inter - atrial septum , and a malignant pericardial effusion . the main clinical manifestations of vena caval and right atrial extension of the tumor include peripheral edema , ascites and hepatomegaly as in our case . a patient with bouts of dyspnea and cyanosis due to a patent foramen ovale and a right atrial tumor was described . due to the tendency of the tumor to disseminate , a precise pre - operative assessment is essential . evaluation should involve various additional modalities such as ct , [ 4,6 - 8 ] venography and mri . echocardiography is a very useful tool in the assessment of cardiac tumors [ 5,7,8,10,13,16,17,19 - 22 ] . in the present case transthoracic echo identified the cardiac involvement , leading to change in the operative approach by adding cardiac surgeons to the operation . transesophageal echo can provide high quality images of the inferior vena cava and right atrial involvement , and direct the surgeons in the removal of the neoplasm from both sites . in cases in which a good quality transthoracic study is positive for cardiac involvement , transesophageal study can be performed only intraoperativlely , to monitor and direct surgery in the operative arena . a patent foramen ovale should be looked for before putting the patient on by - pass . we suggest that adrenal carcinoma , although very rare , should be included in the differential diagnosis of right atrial tumors . once an adrenal tumor is detected , the work - up should include echocardiography , which is of a paramount importance in the evaluation of cardiac involvement , operative planning and follow - up . none declared . there are no financial or other relations that could lead to a conflict of interest . | backgroundadrenocortical carcinoma is a rare , highly malignant tumor
. cardiac involvement of the tumor is very rare .
echocardiography facilitates the evaluation of the cardiac involvement of the tumor.case presentationwe describe a patient with an adrenal tumor .
transthoracic echo showed its extension into the right atrium . accordingly , a combined abdominal and cardiac operation was performed , monitored by transesophageal echocardiography.conclusionthis case highlights the importance of echocardiography in revealing the cardiac involvement by this tumor and in planning the operative procedure . |
trichotillomania ( ttm ) is a type of impulse control disorder , characterized by recurrent pulling of hair , which leads to pleasure and relief of tension . prevalence rates of this condition range between 1% and 13.3% , with initial mean age of onset between 10 years and 13 years and a notable peak at 12 - 13 . the disease leads to hair loss , which may sometimes be severe and lead to significant social and functional impairment . the etiology of the disease is still unknown , although some have suggested a genetic component . this was based on a limited number of reports on familial hair pulling and one twin concordance study . we hereby describe a case of familial ttm in three generations , thereby underlining the familial basis for this disorder . a 13-year - old male presented with 1-year history of focal hair loss in the mid - frontal scalp . he was previously treated with local steroids for presumed alopecia areata , with no improvement . examination revealed a patchy area of hair loss , with several short broken hairs of varying lengths [ figure 1a ] . on dermoscopy examination of the scalp , we found the typical features of ttm , including short hairs with trichoptilosis , broken hair ( different lengths ) and black dots [ figure 1b ] . histological examination showed trichomalacia with irregularly shaped hair follicles and melanin pigment casts [ figure 1c and d ] . upon further questioning , the father admitted repeated pulling of his beard hairs since puberty , with mild - to - moderate severity of symptoms . the 60-year - old paternal grandfather also suffers from severe recurrent hair pulling of his beard since puberty , which sometimes precludes him from leaving home . ( a ) patchy area of hair loss on the scalp , with several short broken hairs of varying lengths ; ( b ) dermoscopy of the scalp lesion demonstrating short hairs with trichoptilosis , broken hair ( different lengths ) and black dots ; ( c - d ) low ( c ) and high ( d ) magnification histopathology of the scalp lesion demonstrating the presence of trichomalacia with irregularly shaped hair follicles ( arrows , c ) and melanin pigment casts ( arrows , d ) it is believed that the etiology of ttm is complex , involving biological , psychological and social factors . this was based on a limited number of reports on familial ttm and one twin concordance study . in this twin study , respective concordance rates for monozygotic and dizygotic twin pairs were 38.1% and 0% for diagnostic and statistical manual of mental disorders iv criteria and 58.3% and 20% for non - cosmetic hair - pulling , leading to a heritability estimate of 76.2% . rare variations in slitrk1 were associated with disorders of the obsessive - compulsive spectrum and among them also ttm . mouse models also suggested a relationship between mutations in hoxb8 and sapap3 and ttm - like behavior in mice . although several cases of familial ttm have been reported , to our knowledge , this is the first report of ttm in a three - generation family . this report strengthens the possibility that ttm is a genetic disease , probably with a complex inheritance pattern . it also underlines the importance of proper family history taking when examining a ttm patient . | trichotillomania ( ttm ) is a type of impulse control disorder , characterized by recurrent pulling of hair .
the etiology of ttm is complex , but a genetic contribution to this condition was advocated based on a limited number of reports on familial ttm .
we report a 13-year - old male with history of focal hair loss in the scalp .
examination showed a patchy area of hair loss , with several short broken hairs of varying lengths .
dermoscopy and pathology examinations were consistent with ttm .
upon further questioning , his father admitted repeated pulling of his beard .
the paternal grandfather also suffers from severe hair pulling of his beard since puberty . to our knowledge
, this is the first report of ttm in a 3 generation family .
this report strengthens the possibility that ttm is a genetic disease , probably with a complex inheritance pattern .
it also highlights the importance of appropriate family history taking when examining a ttm patient . |
pressure exerted by the growing uterus may cause herniation of abdominal organs such as stomach , spleen , intestine , etc . , into the thoracic cavity through a defect in the diaphragm . this defect may be inherent to the diaphragm or caused by rupture of it . presentation of this rare condition mimics pneumothorax and tension pneumothorax , though the management is entirely different . a 28-year - old primigravida , at 31 weeks of gestation and no other co - morbidity , had an acute onset of upper abdominal pain and recurrent vomiting for one day . her blood investigations were normal , except for a raised total leukocyte count ( 16,800/l ) . her chest x - ray revealed left hydropneumothorax with mediastinal shift to the right [ figure 1 ] . she was having hypoxemia , dyspnoea , tachycardia , even on rest , with aggravation in supine position . intercostal drain ( icd ) was placed in the left 5 intercostals space , in mid - axillary line [ figure 2 ] . ct scan and mri could not be done as patient was not able to lie down and the family expressed unwillingness to expose the patient to further radiations . differential diagnosis of left pulmonary bulla , left pulmonary cyst , and tension gastrothorax were made . multiple attempts for placement of nasogastric tube were made but failed , as the patient was very uncooperative and did not tolerate removal of the oxygen supply . patient and family were counselled about the need for urgent delivery of the baby by caesarean section . she was given two doses of betamethasone 12 mg , 24 hours apart . patient was not allowed to take food through the mouth and was feed through the parenteral route . patient was intubated with single lumen endotracheal tube after rapid sequence induction and ventilated with pressure control mode . after closure of uterus and good uterine contraction , abdominal cavity was explored along with the diaphragm . there was herniation of stomach , spleen , and part of colon into the left hemithorax , due to rupture of left hemidiaphragm . left lung was fully inflated and an implantable cardioverter defibrillator ( icd ) placed before closure of the thorax . patient was shifted to the ward in a stable condition on the fourth day after the operation . chest x - ray of a 28-year - old pregnant female shows herniation of the stomach into the left hemithorax ( horizontal arrow ) , with air fluid level ( vertical inverted arrow ) and mediastinal shift to the right side ( arrow head ) . left tension gastrothorax with left intercostal drain . chest x - ray of a 28-year - old pregnant female shows herniation of the stomach into the left hemithorax ( vertical arrow ) , with intercostal drain ( horizontal arrow ) and mediastinal shift to the right side ( arrow head ) . herniation of stomach with or without other intra - abdominal organs into the chest is called gastrothorax . subsequent distension of the stomach or intestine in the chest may cause respiratory distress , mediastinal shift , and hemodynamic compromise leading to tension gastrothorax . this increased iap can force the intra - abdominal content into the chest through a defect in the diaphragm . rupture of the diaphragm without a history of trauma is rare and can lead to lethal complication in pregnancy . there is very little data regarding the incidence of gastrothorax and tension gastrothorax associated with pregnancy . also , it is very difficult to establish the diagnosis of diaphragmatic rupture . the former presents as nausea , vomiting , and abdominal distension and the latter manifests as palpitations , dyspnoea , cough , or chest pain . the variety of symptoms , rarity of the condition , and absence of trauma make the diagnosis of diaphragmatic rupture difficult . tension gastrothorax can even be misdiagnosed as tension pneumothorax or hydropneumothorax with subsequent placement of icd . the first chest x - ray of our patient showed an air fluid level [ figure 1 ] so an icd was placed [ figure 2 ] . the definitive treatment for tension gastrothorax is repair of the defect , but emergent decompression with a nasogastric tube ( ngt ) may be required . as the patient was extremely dyspnoeic , uncooperative , and period of gestation was more than 32 weeks , we decided to perform elective lscs after steroid therapy . all the preparations for thoracotomy were completed before caesarean section . to prevent any further complications , we decided to perform thoracotomy and repair the diaphragm rupture , after uterine closure . . a high index of suspicion of the possibility of tension gastrothorax should be present when pregnant patients present with respiratory distress and hemodynamic instability along with a typical chest x - ray . | gastrothorax is characterized by herniation of the stomach and other abdominal contents into the thoracic cavity either through the oesophageal hiatus or ruptured diaphragm .
when gastrothorax causes pulmonary and hemodynamic compromise , due to compression of lungs and mediastinal structures , it is named as tension gastrothorax .
diagnosis of tension gastrothorax is often complicated during late pregnancy , because of unusual presentation , altered physiology , absence of trauma , hesitation about radiation exposure , and rarity of the condition .
we report a case of a patient , in her 32nd week of pregnancy , who presented with left tension gastrothorax .
lower segment caesarean section was planned after steroid therapy , with all the preparations for thoracotomy .
intra - operatively , stomach , spleen , and colon were found herniated in the left hemithorax , through a ruptured left hemidiaphragm .
thoracotomy was done immediately after caesarean section , with reduction of herniated contents and repair of the defect in the diaphragm .
the patient and her baby were discharged in stable condition 2 weeks after thoracotomy . |
intussusception is a common cause of intestinal obstruction in children between the ages of 6 and 36 months . although idiopathic intussusception is most common in children , recent studies show adenovirus as a possible risk factor . further , conditions such as meckel s diverticulum , polyps , or small bowel lymphoma are other known etiologies . however , traumatic intussusception is quite rare . a recent review of the english literature revealed 23 cases of intussusception caused by abdominal trauma , with only 8 cases in preadolescents . because the typical presentation of sudden onset of intermittent and severe cramping , vomiting , rectal bleeding , and a sausage - shaped abdominal mass are unusual in traumatic intussusceptions , we need to pay greater attention to avoid a delayed diagnosis . if the intussusception is not treated promptly , the vascular perfusion of the bowel may be compromised , resulting in bowel ischemia and possibly perforation . in the present report , we introduce the case of a 4-year - old girl who presented with intussusception after abdominal blunt trauma ; in addition , we present a review of the literature . a 4-year - old girl without underlying disease was admitted to the emergency department one day after blunt right upper abdominal trauma caused by a bicycle accident . she complained of right upper abdominal pain but had no vomiting or diarrhea . on initial examination , there was mild abdominal distension and right upper quadrant tenderness with a scratch wound . except for these findings , the physical examination was normal without fluid collection on focused assessment with ultrasonography for trauma ( fast ) . the patient s white blood cell count was mildly elevated at 8,900/l , hemoglobin level was 12.9 g / dl , platelet count was 211,000/l , erythrocyte sedimentation rate was 11 mm / hr , and c - reactive protein level was 3.44 mg / dl . on abdominal radiography , a mass - like lesion was observed in the right upper quadrant ( fig . 1 ) . we could not suspect that the abnormal finding was associated with trauma . for this reason , we consulted the general surgeons and pediatricians and requested radiology for abdominal ultrasonography . the radiologist confirmed ileocolic intussusception ; fortunately , enteric perfusion was preserved , and other complications were not noted ( fig . 2 ) . we decided to perform air reduction , after which the intussusception was successfully reduced . intussusception is a well - known medical condition , but traumatic intussusception is extremely rare . the mechanism underlying traumatic intussusception is unknown but has been proposed to be either a pathological peristaltic wave , localized spasm of a bowel segment , intramural hematoma , or edema after the trauma . the present case had no history of abdominal disease and no structural abnormalities such as bowel wall edema or hematoma ; therefore , we suggested that the cause was pathological peristalsis or localized spasm . classical intussusceptions commonly occur in the ileocolic region , with symptoms of intermittent cramping abdominal pain , a palpable abdominal mass , nausea , bloody stool , and fever the small bowel is commonly involved , and hematochezia and a palpable abdominal mass are present in less than half the cases . in previous studies , intussusceptions occurred most often near the ileoileal ( 4 cases ) , jejunoileal ( 3 cases ) , or jejunojejunal ( 1 case ) bowel segments . interestingly , the ileocolic segment was involved in the present case ( table 1 ) [ 2,3,5 - 10 ] . most diagnoses of intussusception are confirmed using abdominal ultrasonography , with sensitivity , specificity , positive predictive value , and negative predictive value of 97.9% , 97.8% , 86.6% , and 99.7% , respectively . however , emergency physicians generally perform fast , which does not examine the bowel , in trauma patients instead of routine ultrasonography . therefore , intussusception may be misdiagnosed , unless we pay attention to abdominal pain . traumatic intussusceptions are usually treated with surgery ( manual reduction , bowel resection , and hematoma removal ) . only 1 patient was managed conservatively with nasogastric tube decompression , bowel rest , total parenteral nutrition , and close monitoring in the pediatric intensive care unit . in our case , successful radiological reduction was performed using pneumatic reduction . to the best of our knowledge , we suggest that air reduction can be performed depending on the location of the lesion . this case is unique , considering an intussusception involving the ileocolic segment where air reduction is appropriate . furthermore , ultrasonography revealed no other complications associated with blunt trauma . in all of the traumatic intussusceptions found in our literature review , the outcomes were favorable with no reports of complications intussusception is a well - known medical condition , but traumatic intussusception is extremely rare . the mechanism underlying traumatic intussusception is unknown but has been proposed to be either a pathological peristaltic wave , localized spasm of a bowel segment , intramural hematoma , or edema after the trauma . the present case had no history of abdominal disease and no structural abnormalities such as bowel wall edema or hematoma ; therefore , we suggested that the cause was pathological peristalsis or localized spasm . classical intussusceptions commonly occur in the ileocolic region , with symptoms of intermittent cramping abdominal pain , a palpable abdominal mass , nausea , bloody stool , and fever . however traumatic intussusception presented with different clinical manifestations . the small bowel is commonly involved , and hematochezia and a palpable abdominal mass are present in less than half the cases . in previous studies , intussusceptions occurred most often near the ileoileal ( 4 cases ) , jejunoileal ( 3 cases ) , or jejunojejunal ( 1 case ) bowel segments . interestingly , the ileocolic segment was involved in the present case ( table 1 ) [ 2,3,5 - 10 ] . most diagnoses of intussusception are confirmed using abdominal ultrasonography , with sensitivity , specificity , positive predictive value , and negative predictive value of 97.9% , 97.8% , 86.6% , and 99.7% , respectively . however , emergency physicians generally perform fast , which does not examine the bowel , in trauma patients instead of routine ultrasonography . traumatic intussusceptions are usually treated with surgery ( manual reduction , bowel resection , and hematoma removal ) . only 1 patient was managed conservatively with nasogastric tube decompression , bowel rest , total parenteral nutrition , and close monitoring in the pediatric intensive care unit . in our case , successful radiological reduction was performed using pneumatic reduction . to the best of our knowledge , we suggest that air reduction can be performed depending on the location of the lesion . this case is unique , considering an intussusception involving the ileocolic segment where air reduction is appropriate . furthermore , ultrasonography revealed no other complications associated with blunt trauma . in all of the traumatic intussusceptions found in our literature review , the outcomes were favorable with no reports of complications . | the typical presentation of intussusception includes intermittent severe abdominal pain , vomiting , rectal bleeding , and the presence of an abdominal mass .
we present a case of intussusception after abdominal blunt trauma along with a literature review .
a 4-year - old girl was admitted to the emergency department after a bicycle accident .
she complained of progressively worsening abdominal pain , but there was no vomiting , fever , bloody stool , or abdominal mass .
she was finally diagnosed with traumatic intussusception by ultrasonography and treated with air reduction .
because the typical symptoms are unusual in traumatic intussusception , close attention must be paid to avoid a delayed diagnosis . |
the presence of anomalous coronary arteries is observed in approximately 1% of patients undergoing coronary angiography ( cag).1 ) in these patients , the identification of the stenotic ostium and revascularization is difficult , particularly in the emergency setting of primary percutaneous coronary intervention ( pci ) . herein , we report a case of acute myocardial infarction with anomalous separate origin of the left anterior descending artery ( lad ) and left circumflex artery ( lcx ) from the left coronary aortic sinus . a 59-year - old man with hypertension and type 2 diabetes mellitus visited our emergency room with chest pain that had been started 2 hours prior to his visit . his electrocardiogram showed st - segment elevation on lead v 1 - 4 ( fig . total creatine kinase ( ck ) was elevated to a peak of 4145 units / l and the ck - mb fraction was 419 ng / ml . an emergency cag was performed through the right radial artery using a judkins left catheter . the cag showed a normal right coronary artery ( rca ) and a normal lcx , but no visualization of the lad . initially , we considered that the ostium of lad was totally occluded , but a guide wire could not pass the site through to the lad ostium ( fig . on repeated angiography from the coronary sinus , fortunately we found the separate lad ostium directly from the left coronary aortic sinus beside the lcx ostium without the left main trunk ( fig . for the demonstration of precise anatomical course and correlation of coronary arteries , coronary computed tomography ( ct ) angiography was performed with 64-row multidetector ct . it showed an absence of a left main trunk with an anomalous separate origin of lad and lcx from left coronary aortic sinus ( fig . coronary artery anomalies are the result of changes that occur during the third week of fetal development and have an overall prevalence from 0.3% to 1.3% . in particular , acute myocardial infarction is a rare clinical presentation in patients with coronary artery anomalies.2)3 ) cademartiri et al.4 ) assessed the prevalence of coronary artery anomalies in patients using coronary ct angiography . in their study , the coronary artery anomaly incidence rates were 86.6% for an rca anomaly , 9.2% for the left coronary anomaly , and 4.2% for a balanced case . anomalies of the left coronary are of much lower incidence than those of the right coronary . in general occasionally , more potentially serious anomalies may lead to myocardial ischemia , myocardial infarction , and even sudden cardiac death.5 ) angiographic recognition of unsuspected coronary anomalies is considered important for making an appropriate diagnosis and managing acute myocardial infarction in primary pci . repeated failures to identify the anomalous origin of coronary arteries can lead to inadequate diagnosis and prolonged procedures , which can result in serious complications.6 ) although their incidence is low , clinicians should always take into consideration coronary artery anomalies . coronary ct angiography is particularly useful to clarify the relationship between coronary arteries and great vessels and the correct position of coronary arteries ostia . currently , the ideal imaging tool for the diagnosis and delineation of coronary artery anomalies is coronary ct angiography.7 ) in this case , it was very difficult to find the ostium of the obstructed anomalous lad during primary pci . coronary ct angiography precisely demonstrated a separate origin of lad and lcx from the left coronary aortic sinus after pci . | coronary artery anomalies are rare presentations in primary percutaneous coronary interventions of acute myocardial infarction . herein , we report the case of a 59-year - old man with acute anterior myocardial infarction who had anomalous separate origin of left anterior descending artery ( lad ) and left circumflex artery ( lcx ) from the left coronary aortic sinus .
coronary angiography showed a normal right coronary artery and lcx , but no visualization of the lad .
after several unsuccessful attempts to cannulate the lad , we found the lad ostium located by the side of the lcx ostium .
there was total occlusion at proxymal lad .
coronary computed tomography angiography demonstrated the precise , separate origin of lad and lcx from the left coronary aortic sinus . |
chronic suppurative otitis media ( csom ) is still the most common ear disease in developing countries . antibiotics in the treatment of otitis media have significantly decreased the incidence of complications ; however , the rate of complication of squamous - type csom is still significant in southeast asia.1 a common complication is acute mastoiditis,2 which may lead to further complication such as abscesses in the neck and brain . among them , bezold abscess comprises 1.3% of complications of csom.2 bezold abscess is defined as a complication of acute mastoiditis when the disease passes inferiorly through the medial aspect of the mastoid tip into the sheath of the sternomastoid muscle . few cases have been reported of further spread of bezold abscess into various other part of the body including intracranial spread . singh et al3 reported a case of anterior chest wall abscess secondary to bezold abscess . similarly , saha et al4 and dodonova and triantafilidi5 reported cases of spread of otogenic abscess to the lung ( lung abscess ) . development of lung abscess can be explained as the progression of later sinus thrombophlebitis and is a serious complication of csom . common signs and symptoms of bezold abscess are fever , otalgia , and swelling at the cervical region , otorrhea , restricted cervical mobility , and hypoacusis . computed tomography ( ct ) is a useful test in this disease , because it allows the identification of pus collections in the cervical region and mastoid involvement.6
this report describes a case of bezold abscess that further spread as scapular abscess and lumber cellulitis as a complication of csom . a 14-year - girl from rural area of nepal presented with foul - smelling purulent left ear discharge of 1-year duration and decreased hearing in same ear of 6-month duration . she developed painful swelling in left cervical area with restricted neck movement and high - grade fever of 3 days earlier . she also complained of swelling over the left scapular area of 1-day duration . on physical examination , the patient was febrile ( 102f ) and with single , diffuse , 8 6-cm swelling in left side of neck ( fig . 1 ) extending from the left mastoid tip to the lower attachment of the left sternomastoid muscle with erythematous overlying skin . otoscopy revealed outer attic wall destruction with cholesteatoma . digital radiography showed air shadow in subcutaneous planes in the left side of the chest . a ct scan revealed air fluid collection in the left mastoid and middle ear cavity ( fig . fluid collection with air foci within was also noted in soft tissue adjacent to left mastoid cavity and extending into neck , suggestive of abscess . ultrasonography ( usg ) of the neck showed multiple enlarged lymph nodes in the left side of neck in a posterior triangle , the submandibular area , along the jugular vein . adjacent soft tissues were edematous with increased vascularity . no definite pocket of collection was noted . left modified radical mastoidectomy with type iii tympanoplasty a small area of defective bone was found at the mastoid tip , through which there were communications between the mastoid cavity and the abscesses in the neck . thick , foul - smelling pus ( 20 ml ) was drained through tip cells and digastric ridge . the patient was kept under broad - spectrum intravenous antibiotics . despite antibiotic therapy , on the second postoperative day scapular swelling increased and the patient developed swelling at left lumber area . usg was repeated , focusing on the left scapular region , which showed a 34.7 8.7 35.3-mm collection in the left scapular region ( fig . then 300 ml of thick foul - smelling pus was drained from the scapular area ( fig . computed tomography scan of temporal bone axial cut showing normal right tympanomastoid area with destruction and clouding of left tympanomastoid area .
incision and drainage ( i&d ) of scapular abscess . however , some patients with otitis media develop serious complications due to delay in diagnosis on the part of physicians , inadequate antibiotic therapy , increased bacterial resistance , negligence by the patients , and concomitant presence of cholesteatoma.7 although cholesteatoma is a benign disease histologically , its behavior may be aggressive locally , and its invasive properties are associated with significant bone destruction leading to other complications like mastoid abscess , meningitis , brain abscess , labyrinthitis , and facial nerve paralysis . inflammation and infection may result in necrosis of mastoid process through the digastrics groove . the pus is prevented from reaching the surface by neck musculature but can track along the fascial planes of digastrics or sternomastoid muscle leading to various abscesses like luc 's abscess , citelli 's abscess , and bezold abscess.8 further spread of bezold abscess is extremely rare . singh et al had reported a case of anterior chest wall abscess secondary to bezold abscess.3 the mechanism of spread of bezold abscess to scapular abscess and lumber cellulitis is not known . in case of abscess in any part of body with bezold abscess , csom has to be suspected as one of the primary source of infection . | introduction suppurative otitis media is still the most common ear disease in developing countries .
otogenic complications of this disease have decreased considerably because of the advent of antibiotics , and few rare complications have been encountered .
objective to report a case of a patient with scapular abscess and lumber cellulitis that had progressed from bezold abscess as a complication of squamous - type chronic suppurative otitis media
.
resumed report a 14-year - old girl presented with foul - smelling , purulent , left ear discharge of 1-year duration and decreased hearing on same ear of 6-month duration .
she developed painful swelling in left side of neck with restricted neck movement and high - grade fever of 3-day duration and swelling over the left scapular area of 1-day duration .
the examination and investigation diagnosed squamous - type chronic suppurative otitis media with bezold abscess progressing to scapular abscess and lumber cellulitis .
final comment chronic suppurative otitis media can lead to abscess in any part of body . |
the published reports usually come from small , single - institution series [ 2 , 3 , 4 , 5 ] . among the primary scrotal cancers , the overall survival ( os ) rate is worse in patients with squamous histologic subtype , compared with other subtypes of scrotal cancer . typically scrotum carcinoma occurred in the sixth decade of life , presenting with a visible skin lesion , slow - growing and painless nodule . only 25% of inguinal nodes at presentation are metastatic . in terms of treatment modalities , wide local excision of the primary lesion with a 2-cm clearance margin is the primary treatment option . , we report a case of a 60-year - old patient with scrotal carcinoma who achieved palliative tumor control and symptom relief after surgical treatment followed by postoperative concurrent chemoradiotherapy . a 60-year - old man presented at our inpatient department on october 27 , 2011 , with a 20-month history of an ulcerated lesion on the left side of the scrotum . prior to admission , he was previously treated with antibiotics in private clinics , but the ulcer was uncontrolled and even deteriorated with drainage , small amount of bleeding and pain . he had a history of nonmarital sex and no history of sexually transmitted disease or trauma in the scrotal area . physical examination found an oval - shaped , ulcerated - bleeding lesion on the left side of the scrotum , measuring 5 3 cm in size , and 23 mm in depth . an unmovable , mild tenderness , and enlarged lymph node was found in the left inguina , with a size of 4 3 cm . magnetic resonance imaging ( mri ) of abdomen and pelvic cavity showed abnormal changes of bilateral scrotum and multiple enlarged lymph nodes in the left inguinal region ( fig . the patient underwent local excision of the skin lesion with a 2-cm margin of normal tissue and incomplete resection of enlarged lymph nodes in left inguina . pathological analysis of the surgical specimen confirmed the diagnosis , showing well - differentiated squamous cell carcinoma of the scrotum and lymph node metastasis ( fig . 2 ) . the patient received rt at left inguinal region , but not at scrotum , to preserve sexual function after operation . a total dose of 60 gy in 33 fractions was given within a 6.5-week period . concurrent chemotherapy with cisplatin ( 30 mg / m / week ) was administered during rt course . after the treatment was completed , the lymph nodes of left inguinal region were less adhesive to the surrounding tissues without tenderness . five months after the treatment , the size of the lymph node was dramatically decreased , remaining 1 cm in diameter , with no signs of tumor progression . scrotal carcinoma is a rare tumor with an overall annual incidence of approximately 1.5 per 1,000,000 persons in western countries . wright et al collected 471 cases of scrotal cancer from 1973 to 2002 and found the most common histologic types were squamous cell carcinoma ( 32% ) , extramammary paget 's disease ( 21% ) , basal cell carcinoma ( 18% ) , and sarcoma ( 18% ) . squamous cell carcinoma was more common in black men than in white men ( 69 vs. 31% ) . previous studies have found it was most commonly associated with exposure to environmental carcinogens such as chimney soot , tars , paraffin , and some petroleum products . the patient we report here had a 20-month chronic inflammation at scrotum , suggesting the chronic inflammation may contribute to the onset of this disease . in general , survival was worse in patients with squamous histologic features , compared with other histologic subtypes . johnson et al . analyzed 766 patients with scrotal cancer and found median os by histologies was 143 months for basal cell carcinoma , 165 months for extramammary paget 's disease , 180 months for sarcoma , 136 months for melanoma , 115 months for squamous cell carcinoma , and 114 months for adnexal skin tumor . patients with low - risk scrotal cancer experienced a median os of 166 months , while patients with high - risk scrotal cancer experienced a median os of 118 months . all patients were treated with wide surgical excision without adjuvant therapy . after an average follow - up of 47 months , one patient developed left inguinal lymph node metastasis at 21 months that was successfully treated with bilateral inguinal lymphadenectomy . one patient developed bilateral pulmonary metastasis at 48 months and was palliatively treated with chemotherapy . the neoadjuvant therapy ( both chemo- and radiotherapy ) has also been recommended to downstage ( reduction of the tumor size and lymph node status , thus improving the stage of the disease ) a very large lesion in order to achieve complete resection [ 12 , 13 ] . adjuvant rt in combination with chemotherapy ( methotrexate , bleomycin and cisplatinum ) for four cycles is also recommended to achieve a better disease - free survival . the prognosis in squamous cell carcinomas depends on various factors like age of the patient , size , grade and stage of the tumor , and the extent of surgery . it has been reported that the status of surgical margin is an important predictor for local and/or regional tumor control . in scrotal carcinoma , it has been reported that the surgical margin is still positive despite wide excision with a 2-cm margin . thus , to minimize disease recurrence rate , it is important to ensure a negative margin has been achieved during surgical resection , in our case , the surgical margin of scrotum was negative but inguinal lymphadenectomy was incomplete . in this setting , postoperative concurrent chemoradiotherapy was important and necessary . in summary , for a patient with scrotum carcinoma and inguinal lymph node metastasis , surgical treatment followed by adjuvant chemoradiotherapy may achieve palliative tumor control and symptom relief . however , close follow - up is warranted to evaluate long - term treatment outcomes . | scrotal carcinoma is a rare tumor .
we report one case of such disease in a 60-year - old man presenting with an ulcerated - bleeding lesion on the left side of the scrotum and an enlarged lymph node in the left inguinal region .
biopsy of the ulcerated lesion found squamous cell carcinoma of the scrotum .
he underwent initial tumor resection and left inguinal lymph node biopsy followed by postoperative concurrent chemoradiotherapy .
postoperative pathological examination confirmed well - differentiated squamous cell carcinoma of the scrotum and lymph node metastasis .
five months after the treatment , the size of the lymph node was dramatically decreased , with no signs of tumor progression . surgical treatment combined with concurrent chemoradiotherapy
may be an appropriate management approach to achieve palliative symptom relief for this disease . |
endodontically treated teeth should be restored since there is a loss of structure , changes in physical characters , dehydration and altered esthetic of remaining tooth structure . post and core with full coronal restoration is a common method to restore coronal portion of lost tooth structure . dowel is a post placed in the root of a non - vital tooth to retain core portion.1 endodontic post can be metallic or nan - metallic , custom made or prefabricated , esthetic or non - esthetic . custom and metallic post was widely used to strengthen the endodontically treated teeth . with increase demand for esthetic and better physical quality , various tooth - colored posts such as glass fiber reinforced post , carbon fiber post , zirconia post , and composite post were developed.1,2 modulus of elasticity for stainless steel and titanium posts are 20 and 10 times greater than dentine , whereas glass fiber reinforced post are bonded to composite core and have modulus of elasticity nearly equal to that of dentine hence reduces possibility of root fracture.2 there are very few published studies comparing fracture resistance of the metal and fiber posts . hence the present study was aimed to compare the fracture resistance of endodontically treated teeth restored with different posts such as custom made , metallic , fiber reinforced and carbon reinforced posts . totally 40 extracted maxillary incisors free from caries , fracture and cervical abrasion were collected for in vitro study and stored in normal saline at room temperature ( 24 - 28c ) . the selected teeth were randomly assigned into four experimental groups with ten in each group ( group a : custom post , group b : stain less metal post , group c : fiber reinforced post , group d : carbon fiber reinforced post ) . post space preparation was done by removing the gutta - percha with peeso - reamer and leaving 4 mm of gutta - percha apically . in group the post space was treated with chelating agent ( glyde germany ) , and subsequently irrigated with 5.25% sodium hypochlorite to remove the smear layer . the post and core were cemented with dual cure adhesive cement ( panvia f , kuraray , osaka , japan ) . in group b , c and d after post space preparation , selected posts ( stainless steel , glass fiber reinforced and carbon reinforced posts ) were cemented with dual cure resin cement and composite core build - up was done to the height of 5 mm . all specimens were mounted on the acrylic block , and subjected to the compressive force at 1 mm diameter at an angle of 130 to long axis of the tooth using instron universal testing machine . data were tabulated and statistically analyzed using analysis of variance and t - tests ( spss version 21 , ibm ) . in the present study carbon fiber reinforced posts and glass fiber reinforced posts showed highest fracture resistance as compared to custom post and metal posts ( table 1 ) . table 2 showed that there was no significant difference between glass fiber ( group c ) and carbon fiber posts ( group d ) and between custom post ( group a ) and metal posts ( group b , where as between other groups it is statistically significant ( p > 0.001 ) . mean , median and standard deviation values for fracture resistance in different groups ( mpa ) . comparative evaluation between experimental groups . esthetic , functional , and structural rehabilitation of pulpless teeth is critically important for successful endodontic therapy.1 clinically , longevity of post - core - crown system for endodontically treated teeth depends on the design , length and diameter of the post , ferrule effect , cementation and amount of remaining tooth substance.2 since many years custom post was used commonly for restoring endodontically treated teeth . prefabricated posts are as available as metallic or fiber posts . in 1992 , glass fiber posts were introduced . fiber posts are strong , improves esthetics , reduces corrosion and toxicity.2,3 glass fiber posts are composed of unidirectional glass fibers embedded in a resin matrix which increases the post strength without changes in modulus of elasticity . in a glass reinforced fiber posts stress is distributed in broader surface area , hence reduces the chances of root fracture.2 in the present study , carbon fiber reinforced posts and glass fiber reinforced posts showed highest fracture resistance as compared to custom post and metal posts ( table 1 ) . table 2 showed that there was no significant difference between glass fiber ( group c ) and carbon fiber posts ( group d ) and between custom post ( group a ) and metal posts ( group b , where as between other groups it is statistically significant ( p > 0.001 ) . results of our study is in agreement with the study by dean et al . in vitro study , who observed no root fractures with carbon post , 50 % of teeth had root fracture with cast post.4 similarly fredriksson et al . and preethi and kala observed good clinical success with carbon posts and glass fiber posts.2,5 makade et al . concluded that , glass fiber post is better compared to metal posts.1 our results are consistent with kantor and pines , sirimai et al . and sidoli et al.6 - 8 robbins recommended use of post to increase the fracture resistance.9 whereas martinez - insua et al . observed significantly higher fracture strength with cast post and core as compared to carbon fiber posts.10 ferrari et al . concluded that composite posts systems are superior to cast post and core system , and they observed 14% failure with cast post system.11 adanir and belli concluded that for clinical success , posts shorter than clinical crowns should be avoided12 jalalian and mirzaei concluded from their study that , fiber posts with larger diameter adhere to the root structure more efficiently.13 makade et al . found that teeth restored with cast post and core found to have cervical and middle third root fracture whereas glass fiber posts demonstrated only core fracture.1 garhnayak et al . concluded that incorporation of ferrule offered some degree of stress reduction in post restored teeth.14 present in vitro study helps to know about the physical quality of different types of posts which can be useful in post selection and clinical successful outcome of endodontic therapy it is concluded that carbon reinforced fiber post and glass fiber posts showed good fracture resistance compared to custom made and metal posts . this in vitro study | background : posts are used to enhance crown buildup in pulpless teeth with destructed crown portion .
different types of post are used in endodontically treated teeth .
the aim of the present in vitro study was to evaluate fracture resistance of custom made , metal , glass fiber reinforced and carbon reinforced posts in endodontically treated teeth.materials and methods : an in vitro study was carried out on extracted 40 human maxillary central incisor teeth , which was divided into four groups with 10 samples in each group with custom made , metal post , glass fiber reinforced , and carbon reinforced posts .
the samples were decoronated at cemento - enamel junction and endodontically treated .
post space was prepared and selected posts were cemented .
the composite cores were prepared at the height of 5 mm and samples mounted on acrylic blocks .
later fracture resistance to the compressive force of samples was measured using universal testing machine.results:the maximum resistance to the compressive force was observed in carbon reinforced and glass fiber reinforced posts compared others which is statistically significant ( p > 0.001 ) and least was seen in custom fabricated post.conclusion:it is concluded that carbon reinforced fiber post and glass fiber posts showed good fracture resistance compared to custom made and metal posts . |
ocular trauma , although relatively rare , is a proven etiology of focal corneal stromal edema . not many cases have been reported since it was described in 1978 by cibis et al.1 ocular manifestations include lesions of transient , gray - white , endothelial ring - shaped opacities with focal corneal stromal edema and most cases show remission within a few days with conservative management.2 here we report a case of traumatic corneal stromal edema discovered by anterior segment optical coherence tomography ( as - oct ) . a 31-year - old man presented to our clinic for an ocular trauma to his left eye . the patient had a blast injury which occurred on the previous day by a plastic bottle cap when trying to open a beverage bottle . his best - corrected visual acuity ( bcva ) was 20/200 os ( left eye ) . anterior segment examination showed an epithelial defect , which implies a direct injury to the cornea . a marked focal stromal edema accompanied by descemet s membrane folds were located at 10 oclock in the paraxial area , about 4 mm apart from the corneal center ( figure 1a ) . grade 1 gross hyphema was observed . as - oct ( as - oct ; carl zeiss meditec ag , jena , germany ) revealed marked corneal swelling of the lesion ( figure 1b ) . the stromal edema resolved , showing no signs of epithelial defect , although small opacity remained ( figure 1d ) . as - oct revealed complete resolution of corneal swelling ( figure 1e ) . despite the resolution of corneal edema , however , specular microscopy ( sp-9000 ; konan medical , tokyo , japan ) showed substantially decreased endothelial cell density in the lesion compared to the fellow eye ( 2,062 versus 2,959 mm ) ( figure 1f ) . one month later , the patient s 2959 cells / mm bcva improved to 20/25 os . there were no signs of corneal edema and no further decrease in endothelial cell density . a diffuse corneal edema and its recovery is often observed in patients with eye injury caused by ocular trauma . the main etiologies of transient diffuse stromal edema include post - traumatic inflammation inside the anterior chamber and persistently increased intraocular pressure . however , a local corneal edema accompanied by substantially decreased endothelial cell is a rare and notable case . this case differs from traumatic corneal endothelial rings in that there is no distinct endothelial ring lesion on slit lamp examination . furthermore , despite the difference in corneal morphology , this case shares a similarity with the traumatic corneal endothelial rings : the corneal lesion was caused by traumatic endothelial cell damage in this case . to our knowledge , only one case of traumatic corneal endothelial rings with imaging of as - oct has been reported,3 in which the as - oct revealed a ruffled disruption to the endothelial cells directly posterior to the stromal thickening . endothelial cells around the traumatic lesion undergo the greatest torsion and energy absorption as the cornea moves axially posterior and then relaxes to its original position.4 this process could have induced the damage and inflammation of the corneal endothelial cells . another possible mechanism that caused the injury would be a direct contact between the corneal endothelium and a lens or iris . the proper functioning of the corneal endothelium is regarded to be crucial to the maintenance of corneal clarity . once damaged , the endothelium is not able to recover from the injury . therefore , significant endothelial damage may lead to severe complications such as persistent corneal edema and bullous keratopathy at a later stage . in conclusion , permanent corneal endothelial cell loss could occurs by traumatic mechanism , which manifests as corneal stromal edema in the early phase of trauma . corneal endothelial layer evaluation using specular microscopy and as - oct can be useful for diagnosing and monitoring the damage to cornea . | a 31-year - old man presented to our clinic for an ocular trauma to his left eye .
his best - corrected visual acuity was 20/200 os ( left eye ) .
anterior segment examination showed an epithelial defect , which implies a direct injury to the cornea . a marked focal stromal edema accompanied by descemet s membrane folds
were located at 10 oclock in the paraxial area , about 4 mm apart from the corneal center .
anterior segment optical coherence tomography ( as - oct ) revealed marked corneal swelling of the lesion .
five days later , the patient s best - corrected visual acuity improved to 20/50 os .
the stromal edema resolved showing no signs of epithelial defect , although small opacity remained .
as - oct revealed complete resolution of corneal swelling . despite the resolution of corneal edema ,
however , specular microscopy showed substantially decreased endothelial cell density in the lesion compared to the fellow eye . here
we report a case of traumatic corneal stromal edema discovered by as - oct . |
a full - term newborn indian female , after caesarean section , was referred to us 16 h after delivery for eye discharge , inability to open eyelids completely and abnormal overriding of upper eyelids on lower eyelids that was observed immediately after birth . the parameters at birth were as follows : birth weight 3200 g , length 48 cm , head circumference 38 cm and apgar score 10/10 . ocular examination of child asleep showed elongated , bulky upper eyelids and upper eyelids overlapping on lower eyelids , 6 mm ou [ video 1 ] , [ fig . the ocular anthropometric measurements on the first postnatal day were as following : vertical palpebral fissure in awakening state 5 mm , horizontal palpebral length 18 mm , horizontal length of upper eyelid 24 mm , and midpoint vertical upper eyelid height 10 mm in both eyes . the upper eyelids were easily everted by gentle pulling of the skin of the upper eyelid toward the forehead [ fig . 2 ] . the both upper eyelids had a tendency for spontaneous complete eversion on crying and yawing [ fig . 3 ] . both cornea were clear and did not show staining with rose - bengal or fluorescein stain . discharge from eyelids and cul - de - sac was sent for culture and sensitivity . the newborn was treated with topical gatifloxacin 0.3% , qid ; carboxymethyl cellulose 1% , 6 times a day and 1% tetracycline eye ointment , qid . the next day culture of conjunctival and eyelid discharge grew staphylococcus aureus , sensitive to ampicillin , ciprofloxacin , gatifloxacin , tobramycin and gentamycin . correction 4 mm overriding of eyelids was noted on both sides within first 48-h of the postnatal period . at 7 postnatal day child 's eyelids position became normal without any residual blepharoptosis [ fig . clinical photograph of neonate with bilateral congenital eyelid imbrication and floppy eyelid syndrome showing overlapping of upper eyelids on lower eyelids on eye closure . . clinical photograph of neonate with bilateral congenital eyelid imbrication and floppy eyelid syndrome shows eversion of upper eyelids with minimum efforts . . clinical photograph of neonate with bilateral congenital eyelid imbrication and floppy eyelid syndrome showing spontaneous eversion of both upper eyelids while yawing and tarsal conjunctival mild hyperemia . clinical photograph of neonate with bilateral congenital eyelid imbrication and floppy eyelid syndrome showing complete resolution of overlapping of upper eyelids on lower eyelids and laxity of upper eyelid medial and lateral canthal tendon . ceis is a rare eyelid malposition disorder and characterized by overriding of upper eyelid eye on lower . acquired imbrication eyelid syndrome is common in adults above the age of 40 years and usually seen in patients who underwent lateral tarsal strip procedure for lower eyelid laxity and floppy eyelid syndrome . it is characterized by overriding of upper eyelids on lower eyelids , apparent congenital entropion of both lower eyelids and tarsal conjunctival hyperemia . instillation of artificial tear substitutes may be helpful in relieving the foreign body sensation from skin and eyelashes . our case is different from previously reported three cases because of associated ophthalmia neonatorum and blepharoptosis [ table 1 ] . in the present case , overriding of upper eyelid on the lower eyelid spontaneous tightening of canthal tendons and involutional changes in upper eyelids during early postnatal period thought to be responsible for correction of blepharoptosis . in acquired floppy eyelid syndrome , clinical presentation of reported cases of congenital eyelid imbrication syndrome previous researcher thought that postnatal growth of the bony orbit may contribute to the spontaneous tightening of canthal tendons resulting in correction of the ceis . we feel postnatal growth of the bony orbit have no contribution in spontaneous correction of eyelid imbrication because orbital growth in 1 week is not so much significant to correct 6 mm of overriding of eyelids as seen in our case . moreover , 4 mm overriding correction was observed within first 48-h of the postnatal period . we observed that upper eyelids looks , elongated , floppy and odematous at day one which became erythematous and firm on day 7 . we feel whole the eyelids were bulky and floppy and underwent involutional changes under the influence of unknown effect in 1 week of life and resulted in tightening of laxed canthal tendons and normalization of size and tone of upper eyelids . spontaneous eversion of the eyelid is a classical feature of floppy eyelid syndrome . in ceis , spontaneous eversion . it may be more appropriate to use the term congenital lax upper eyelid syndrome instead of ceis / cfes . the combination of ceis and cfes should be considered in the differential diagnosis of congenital eyelid malposition . an ophthalmologist should be familiar with ceis and its possible complications such as corneal epithelial defect and even ulcers . | congenital eyelid imbrication syndrome ( ceis ) is an extremely rare , benign , transient , self - limiting eyelid malposition disorder .
the classic triad of signs in patients with a ceis consists of bilateral upper eyelids overriding the lower eyelids when child was in sleep , bilateral medial and lateral canthal tendon laxity and tarsal conjunctival hyperemia .
we report a third case of congenital combined eyelid imbrication and floppy eyelid syndrome in healthy neonate that was resolved within a week with conservative treatment . |
limited knowledge exists concerning the migration and health of women as children , adults , and elders . existing models of women 's health and care fail to consider in their simplicity the cultural values , norms , structural facilitators , and constraints . such models overlook the needs , responses , and experiences of girls and women who migrate from childhood to old age . for example , the biomedical model is based on assumptions that advances in biomedicine that integrate the multiple factors of health and disease are all that is needed to cure women of disease . while reducing morbidity and mortality rates , this model overlooks gender differences , gender - specific issues , and the social , historical , and cultural aspects of health and illness and places responsibility for managing health and illness on the healthcare provider . internationally , healthcare systems tend to focus primarily on a reproductive / maternal model of health - care . the maternal health model has helped to decrease maternal mortality and morbidity as well as women 's morbidity and mortality in general . however , it has minimized a life span view of women 's health issues to those relating only to pregnancy and reproductive health . it has made women in nonreproductive life stages invisible in healthcare systems , ignoring the needs of girls and elderly women . this model also overlooks many other needs of migrating women including their work , caregiving , spousal / partner , and community roles . it supports a limited notion of women 's spheres of functioning and influence as only maternal . cultural models view females throughout the life span and within their cultural contexts but fail to recognize women 's individuality and diversity in how they conform to traditional values and norms . in this model , women 's responses and explanatory frameworks of health and illness are products of the norms and values of their society . cultural models may stereotype women based on their culture and may immobilize providers who attempt to change adverse healthcare conditions . a more integrative view is needed to help health - care providers and researchers to more fully understand the multidimensional experiences and challenges that impact the health of women who migrate . such a view must consider the diversity that exists among every subgroup of migrant women . the transition experience from home to sometimes very different host locations can not be overlooked . a life span perspective and the experiences perceived to be related to age of migration should span from infancy to old age . work experience and work environment must be considered as well as the marginalization that can occur in the new settings in which migrant females find themselves . each component provides a unique insight into the understanding of women 's response to health and illness and to the healthcare system providing a more holistic approach . the impact of migration on health is complex , affecting those who migrate as well as spouses and/or children who are left behind . the effect of migration involves broader issues of access to healthcare services and availability of linguistically and culturally appropriate care . impact on health also includes types of illnesses that women are exposed to which is directly related to the types of jobs they have . their precarious legal status may compel them to continue to work while ill because they fear losing their employment and income . though most host countries offer medical services to them , migrants usually must bear the cost . in general , the health status of migrant women depends a lot on their health education , occupation , access to services , and what is known about them in their host countries . healthcare provider knowledge of language , culture , and levels of discrimination and racism also impacts their health . migrant women often come from the countries where poor health is a fact of life . health status may be further compromised by the stress of adjusting to a new country and experiencing violence and sexual exploitation . a migrant woman 's mental and physical health may be affected by certain working environments , abusive employers , and domestic violence . the greater vulnerability of women to sexual abuse and violence also places them at risk for sexually transmitted diseases , including hiv , and posttraumatic stress disorder associated with sexual violence . their reproductive health needs often go unnoticed and unprotected even in well - organized refugee and migrant situations , and the insensitivity of health staff to the needs of immigrant women from other cultures that differ from that of the host country often is more pronounced in refugee and migrant contexts than it is in general . research also has suggested that women experience higher levels of stress than men because they receive less assistance with personal and job - related problems than do men . ethnic / racial differences also exist , with asian women in the united states and canada reporting the highest level of depression compared to women from other ethnic groups due to increased social pressures and conflicting gender roles . though migration in and of itself is not a risk to health in a world defined by profound disparities , it is a part of society , and governments must face the challenge of integrating the health needs of female migrants into national plans , policies , and strategies , taking into account their human rights , including their right to health . concern for the impact of migration on women 's health must become a growing international concern in the 21st century as it affects the well - being of future generations worldwide . the impact of migration on women 's health is a significant public health challenge that current governments and societies must face . health promotion and disease prevention have not kept pace with the volume , speed , diversity , and disparity of current migration patterns , especially among women across the life span . health monitoring of women in all migration - related situations has to be given greater priority with a renewed consideration that includes females from infancy through adult stages . similarly , much more attention at a health policy level is called for if the rights of female refugees and migrants are to be protected and their contribution to the health and social development of future generations is to be acknowledged and promoted worldwide . nations ' healthcare systems and policies must acknowledge and adapt to the feminization of the migrant population and its diversity and multicultural needs , promote gender health equity , and extinguish barriers to accessible healthcare . failure to do so will continue to marginalize migrant women in society , infringe on their rights , and contribute to poor public health practice . addressing the health needs of migrant women will improve their health status , prevent stigma , reduce long - term health and social costs , protect global public health , facilitate integration , and contribute to the social and economic development of future generations . | demographers are slowly bringing the migration of women to the forefront as women become the majority of migrants worldwide .
migration can provide new opportunities for women on their own or jointly with their spouses to improve their lives , escape oppressive social relations , and support children and other family members who are left behind .
it also can expose women to new vulnerabilities resulting from their precarious legal status , abusive working conditions , and health risks.1 migrant women are triply disadvantaged by race / ethnicity , their status as nonnationals , and gender inequalities.2 |
ten percent ( 215% ) of all acute cholecystitis is not associated with cholelithiasis . acute acalculous cholecystitis ( aac ) has classically been thought of as a disease of the critically ill patient , usually past their 6th decade and receiving intensive care support for another condition . increasingly , however , aac is being recognized in younger patients with no significant comorbidity . chronic acalculous cholecystitis ( cac ) , chronic biliary symptoms without radiographic evidence of stones , is also being increasingly diagnosed as a disease entity . the evidence to support cholecystectomy as the treatment of choice for cac is developing ; however , the previously reported short - term benefits may not be reflected to the same degree in longer - term follow - up studies . the findings suggesting cac , on the other hand , are rather more nebulous and it has , therefore , been previously considered a diagnosis of exclusion . we have recent experience of 3 cases where cac has been the final diagnosis , with the repeated abdominal sonographic findings being of a nonvisible gallbladder . we maintain a detailed prospective record of all laparoscopic procedures undertaken by a single surgeon in a tertiary paediatric setting . a cohort of cholecystectomies undertaken laparoscopically over a 15-year period is reviewed with emphasis on the clinical presentation and ultrasonographic findings . fifty - four cases with mean age of 12.32 years ( sd 3.82 ) , male : female ratio of 1 : 2 , underwent laparoscopic cholecystectomy . there were no conversions to open surgery and mean operating time is recorded as 81 minutes . a gallbladder was clearly seen in all but 3 cases with cholelithiasis documented in 46 cases ( table 1 ) . the 3 cases ; 2 females and a male aged 16 , 17 , and 8 years , respectively , with recurrent ruq pain had undetectable gallbladders on repeated ultrasonography . the studies were performed in the fasting state , by skilled operators , over at least an 8-month period . these three children were all referred from the medical team after extensive investigation to exclude other causes of their pain , all underwent at least 2 abdominal ultrasound examinations by radiologist experienced in paediatric sonography . after a prolonged observation period , all successfully underwent laparoscopic cholecystectomy . in terms of the procedures themselves , the operating surgeon subjectively graded the difficulty level in each case as standard , moderately difficult , or difficult . of the nonvisible gallbladders , 2 were difficult and 1 standard . this is in the context of 31% of the other procedures being recorded as moderately difficult and 20% as difficult . the difficulties recorded were ( 1 ) gallbladder stuck to gallbladder bed and ( 2 ) foreshortened cystic duct difficulty with dissection . there was one complication recorded in the nonvisible gallbladder group , in a child with previous abdominal operations to place ventriculoperitoneal ( vp ) shunts ; an iatrogenic small bowel perforation was noted and repaired . discharge home was not delayed beyond 24 hours postoperatively in any of this group and recovery was otherwise uneventful . this child is the only one of this group that complains of any ongoing abdominal pain ; however , this is central and functional rather than in the right upper quadrant . ten percent of the cholelithiasis group had some degree of abdominal pain at follow - up visits . histology demonstrated a markedly fibrotic and thickened gallbladder wall in all 3 cases , with microscopic features to support chronic inflammation . the diagnosis of cac is suggested by these histological features in the excised specimens in the 3 cases of nonvisible gallbladder . previously published reports show a pattern of cac presenting in otherwise fit children , in our small series one patient had treated hydrocephalus . the frequency of cac as a proportion of all children with cholecystitis is not well defined , but seems to be significantly higher than in adults and may be as high as 30% . cholecystitis is , however , a relatively uncommon pathology in children ; therefore , paediatric cac is an even rarer phenomenon . biliary dyskinesia ( bd ) is characterized by symptomatic biliary colic in the absence of gallstones . in this situation , therefore , we would propose that bd be considered to as a clinical diagnosis and cac a histological one . the treatment recommended by many for bd is cholecystectomy and the short - term outcomes are good , although there is some doubt about the longer - term efficacy of this treatment for bd in children . sonographic findings in cac are often normal , other imaging modalities that may provide more information include cross - sectional imaging ( magnetic resonance ( mr ) , computed tomography ( ct ) ) and scintigraphy or sonography with cholecystokinin ( cck ) administration to calculate the gallbladder ejection fraction . these later 2 tests are reported to be the more definitive in diagnosing cac [ 810 ] . cross - sectional imaging , particularly mr , can be difficult to obtain in younger children without general anaesthetic , ct is much quicker but has the dual negatives of less useful information and a relatively high dose of ionizing radiation . the literature discussing imaging in cac does not seem to touch on the chronically contracted , sonographically nonvisible gallbladder . one of our patients with previous vp shunts had cac and underwent a difficult and complicated laparoscopic cholecystectomy . there is no good evidence linking the presence of a vp shunt to cac ; however , the presence of dense upper abdominal adhesions is well reported in these cases and this may go some way to explaining the complex nature of that case . the other two cases in the nonvisible gallbladder group and indeed all other cases in this series had no recorded early complications . the patients were selected from a cohort of children who had undergone cholecystectomy , a small proportion of these children had been noted to have a ultrasonographically nonvisible gallbladder . a formal study examining the potential link between this finding in children with symptomatic gallbladder dyspepsia and the diagnosis of cac would be difficult to establish prospectively due to the rarity of these circumstances . this is a small series of paediatric cholecystectomies with an interesting observation ; that in 3 cases the gallbladder could not be seen on repeated competent ultrasound examinations in the context of recurrent right upper quadrant abdominal pain . we would like to propose that early consideration is given to performing laparoscopic cholecystectomy when a child presents with intractable gallbladder dyspepsia and a nonvisible gallbladder on ultrasound scan . sonographic nonvisualisation of the gallbladder in patients with intractable gall bladder dyspepsia may suggest the possibility of a chronically scarred organ for which a cholecystectomy is indicated . | 90 percent of symptomatic patients undergoing cholecystectomy have cholelithiasis with 10% categorized as asymptomatic cholecystitis . in both instances ,
the gallbladder is evident on ultrasonography . in children with symptomatic biliary dyspepsia
, the decision to proceed to cholecystectomy is made difficult if choleliths are not seen on ultrasonography .
this decision is made even more difficult if the gallbladder itself is not seen on repeated imaging . in a cohort of 54 cholecystectomies , 3 cases , with recurrent right upper quadrant pain and undetectable gallbladders on repeat ultrasonography , were identified .
after prolonged observation all underwent successful cholecystectomy .
histology demonstrated a markedly fibrotic and thickened gallbladder in all .
given this experience , we suggest that nonvisibility of the gallbladder , in fact , maybe be a feature of a chronic acalculous cholecystitis .
we advise consideration of cholecystectomy for chronic biliary dyspepsia where repeat ultrasonography fails to demonstrate a gallbladder . |
we report a case of a 63-year - old male who presented to the outpatient department with complaints of hoarseness of voice and throat pain of three months duration . clinical , otorhinolaryngological and cytological examination revealed squamous cell carcinoma of supraglotic larynx ( stage t2 n1 m0 , t = tumor , n = lymph node , m= metastasis ) . he was treated with radiotherapy to neck ( field : 1 cm above mandible to clavicle , laterally vertical line through mastoid process ) with a dose of 68 grey in 34 fractions over seven weeks with 6 mega volt photon . no evidence of disease could be detected clinically or by imaging at the first follow up . he presented two years following initial treatment with swellings over the left inguinal region and left side of neck of one month duration . pallor was present . examination of the left inguinal region revealed a 6 cm by 5 cm nontender swelling , firm to hard in consistency with irregular surface and margin . it was clinically suspected to be matted left inguinal lymph nodes ( figure 1 ) . level iii neck ( jugulodigastric ) lymph nodes on the left side were palpable , hard , and nontender . there was no evidence of the disease process on otorhinolaryngological examination . all the hematological indices were within normal limits except hemoglobin ( 8 gm / dl ) . a thorough work - up ( chest rhoentgenogram , computerized tomography of brain , abdominal sonography , colonoscopy , gastrointestinal endoscopy and fibre - optic laryngoscopy ) did not suggest any evidence of other metastases . fine needle aspiration cytology from left inguinal and cervical lymph nodes revealed metastatic poorly differentiated squamous cell carcinoma . the patient was admitted and cytotoxic chemotherapy with paclitaxel and cisplatin was instituted . unfortunately , the general condition of the patient deteriorated after completion of two cycles of chemotherapy and , despite the best available treatment , the patient expired . laryngeal carcinoma is staged according to the extent of the original tumor site and its local spread ( t ) , lymph node involvement ( n ) , and the presence of metastases ( m ) . t1 is the tumor limited to one sub - site of supraglottis , such as ventricular bands , arytenoids , suprahyoid epiglottis , infrahyoid epiglottis , aryepiglottic folds , with normal vocal cord mobility . t2 includes the tumors invading mucosa of more than one adjacent aforementioned subsites of supraglottis . t3 includes the tumors limited to larynx with vocal cord fixation and/or to tumors invading either the postcricoid area or the preepiglottic tissues . t4 describes tumors invading the thyroid cartilage , and/or extends into soft tissues of the neck , thyroid , and/or esophagus . n1 means metastasis in a single ipsilateral lymph node , 3 cm or less in its greatest dimension . n2 includes metastasis in a single ipsilateral lymph node , more than 3 cm but less than 6 cm in greatest dimension , or in multiple ipsilateral lymph nodes , none more than 6 cm in the greatest dimension , or in bilateral or contralateral lymph nodes , none more than 6 cm in greatest dimension . m0 indicates no metastases , m1 indicates presence of distant metastasis such as lungs , brain , liver etc.1 supraglottic laryngeal carcinomas are common and have a good prognosis.1 relapse is uncommon in early stage presentation.2,3 advanced stage cancer do recur predominantly locally or locoregionally . contiguous spread to cervical lymph nodes , especially level iii and iv , can occur . the reported overall three - year survival rate of supraglottic cancer was 60% and the five - year survival rate was 51.2% with nodal metastases and 64% without.4,5 forty - five percent of the patients with histologically confirmed nodal metastases survived three years . the reported five - year relapse - free survival rate ( rfs ) is 53% and corrected survival ( cs ) rate is 83% for t2 tumors versus rfs of 39% and cs of 52% for t4 tumors.6 age more than 60 was associated with a 2.2 times higher risk of dying due to laryngeal cancer . a retrospective tumor registry analysis of patients with squamous cell carcinoma ( scc ) of the larynx and hypopharynx reported that the age , sex , and tumor differentiation did not affect the incidence of distant metastases.7 the overall incidence of distant metastases was 8.5% with the following distribution : glottis 4.4% , supraglottis 3.6% , subglottis 14% , aryepiglottic fold 16% , pyriform sinus 17% and posterior hypopharynx 17.6%.7 the overall five - year disease - specific survival for distant metastases was 6.4% . distant metastases were related to advanced local disease ( t3 + t4 ) , lymph node metastases at presentation , tumor location ( hypopharynx ) and locoregional tumor recurrence . a meta - analysis of variables that predispose to a higher incidence of distant metastases include tumor location ( hypopharynx more than larynx ) , advanced primary disease ( t3 + t4 ) , regional disease , locoregional recurrences , and advanced regional metastases ( n2 + n3 ) . the most common site of distant metastasis via blood stream is the lung ; however , metastsases to the brain , the adrenal , and the liver have also been reported.8 metastasis to inguinal lymph nodes , as in our case , is very rare.9 the probable explanation of this metastasis is the retrograde lymphatic spread through thoracic duct , para - aortic lymphatic channels to inguinal lymph nodes . | head and neck cancers are common among men in developing countries . among head and neck cancers in the united states ,
supraglottic laryngeal cancer accounts for 12,500 new cases per year .
it responds favorably to radiotherapy with or without chemotherapy depending on the stage of disease .
recurrence is local or locoregional .
we report a unique case of carcinoma of the larynx with rare distal recurrence in the left inguinal lymph nodes . |
a 62 years old man was admitted to our center . he began to show symptoms of muscle weakness , like gait difficulty , diplopia , dysphagia , and fatigue , 3 months prior to the admission . he had no signs of systemic malignancy including weight loss , decreased appetite , cough , or hemoptysis . proximal muscle weakness in both upper and lower limbs , generalized hyporeflexia , and bilateral asymmetric ptosis were noted . in cervical and lumbosacral magnetic resonance images we performed standard repetitive nerve stimulation ( rns ) test , which is one of the most sensitive diagnostic tests in patients with nmj disorders , to evaluate patient 's muscle weakness . we first performed nerve conduction study ( ncs ) in upper and lower limbs that were normal in distal latency , velocity and amplitude . then 3 hz ( slow ) rns test performed in two warm ( 33 - 35c ) trapezius muscles , that were immobilized as best as possible for 10 impulses ; then it was repeated three times , 1 minute apart . more than 10% of decrement was seen in amplitude and the area of the first to the fourth cmap ; that was reproducible in all three times . after 10 seconds of maximal voluntary contraction , slow rns ( physiologic modeling of rapid rns ) was performed . to demonstrate post - exercise exhaustion , the muscle was maximally exercised for 1 minute . after these procedures , needle electromyography was done in upper and lower limb muscles ; that was normal in every parameter . rns test findings in reported patient with non - smal cell carcinoma needle electromyography findings in reported patient with non - smal cell carcinoma antibody against acetyle choline receptor was positive . after these findings , to evaluate the presence of thymoma , chest ct scan was done . no evidence of thymoma was noticed ; but an incidental lung tumor was seen ( figure 2 ) . lung closed biopsy disclosed non - smal cell carcinoma . chest ct scan findigs findings in reported patient with non - smal cell carcinoma there are few reports on primary lung carcinomas which complicate mg , in the medical literature.16 according to literature review , there are two types of association between lung cancer and mg . the more common is the occurrence of lung cancer in mg patients after many years of treatment that can be a coincidental finding.19 another type is presentation of cancer simultaneously with mg , which is a rarer report.911 in our case , the opening symptoms of lung cancer showed myasthenic type . it is generally believed that the prevalence of simultaneous occurrence of mg with extrathymic tumors is incidental ; the incidence of extrathymic malignancies in mg patients has been reported to be different from that in a normal age - matched population not significantly.414 to date , no one has found causal relationship between lung cancer and mg . similarly , there has been no supporting evidence that simultaneous mg with lung cancer might be one of the paraneoplastic syndromes such as lambert - eaton myasthenic syndrome with small cell lung cancer . in conclusion , this case was a typical mg but his symptoms were the only clinical presentation of his underlying lung cancer ; it means that mg can be a paraneoplastic syndrome , such as lambert - eaton myasthenic syndrome . vs carried out the design of the study , found the patients , carried out the physical examinations , carried out the diagnoses and participated in manuscript preparation . mg provided assistance in the design of the study , carried out the tests ( emg , mcv ) and participated in manuscript preparation . zr provided assistance in the design of study and the data analyses , and participated in manuscript preparation . | a male patient with muscle weakness had clinical findings of ptosis , diplopia , proximal leg weakness , and positive repetitive nerve stimulation ( rns ) test .
he demonstrated positive acetylcholine receptor antibody .
this lung cancer patient was presenting myasthenia gravis .
the causal association between non - small - cell lung cancer and non - thymomatous myasthenia gravis has not been clarified yet . to date , there has been no evidence supporting the speculation that association of myasthenia gravis with lung cancer might be one of the phenotypes of paraneoplastic syndrome . |
retained surgical sponge or gauze is also known as gossypiboma , meaning a mass within the body composed of a cotton matrix surrounded by a foreign body reaction . however , a recent study estimated the incidence of retained surgical foreign bodies ( rsfb ) as 1 in 5500 operations . although a broad spectrum of gastrointestinal complications have been reported in the literature , intraluminal migration of a retained surgical sponge is considered rare . the aim of this article is to report our personal experience of such a rare case , presenting features , and how to avoid such complications . 29-year - old woman was referred by her gynecologist with a history of diffuse colicky abdominal pain , nausea , repeated vomiting , constipation and progressive abdominal distention for 7 days prior to hospitalization . she had undergone an emergency cesarean section 9 months previously at a private hospital and since that time she had been complaining of recurrent attacks of nonspecific abdominal pain and occasional episodes of vomiting especially after heavy meals from which she had lost 10 kg since delivery . the patient had attended emergency departments at different institutions with similar complaints and had been discharged home after each occassion , but her symptoms passed undiagnosed . five days prior to admission , abdominal roentography was done at an emergency department for her abdominal complaint , which showed radio - opaque density in the pelvis ( fig . 1 ) , but it was mistakenly overlooked and she was discharged home with a diagnosis of nonspecific abdominal pain .
figure 1:a radio - opaque mark visible at the pelvis ( an arrow ) . a radio - opaque mark visible at the pelvis ( an arrow ) . upon admission , she was afebrile , vitally stable , and her abdomen was distended and tympanic . laboratory investigations showed a white blood cell count of 10 700 cells / ml and a sodium level of 123 mmol / l , while other biochemical parameters were within normal limits . abdominal roentography revealed dilated small intestinal loops with a finding of a radio - opaque density in the abdomen ( fig . 2 ) . a diagnosis of small intestinal obstruction most likely caused by retained surgical sponge was made . on abdominal exploration , the small intestine was dilated down to the ileum with an intraluminal mobile mass felt in the distal ileum ( fig . 3 ) . before proceeding for mass removal , at around 80 cm from the duodenojejunal junction , there were two adjacent segments of the jejunum adherent to each other and both were adherent to the peritoneal wall by fibrous adhesions . consequently , adhenolysis , enterotomy and removal of the mass , which was manually pushed there ( fig . 4 ) , followed by resection and anastomosis of the compromised jejunal segment , were achieved . 5 ) . however , apart from the isolated area of adhesion , exploration of the rest of the abdominal cavity did not show any lesions in the peritoneal cavity or perforation or fistula or pelvic collection . the authors concluded that the transluminal migration of the sponge most likely occurred from that adherent part of the jejunum . the postoperative period was uneventful and the patient was discharged on the seventh day of her hospitalization in good condition . figure 2:proximal small intestinal dilatation with the radio - opaque mark migrated proximally to the abdomen ( arrow ) , indicating its mobile nature . figure 3:intraluminal foreign body visible at the ileum with an intact normal wall ( forceps ) . figure 4:intraoperative removal of the foreign body from the jejunum ( arrow ) . proximal small intestinal dilatation with the radio - opaque mark migrated proximally to the abdomen ( arrow ) , indicating its mobile nature . intraluminal foreign body visible at the ileum with an intact normal wall ( forceps ) . pathologically , there are two types of foreign body reactions in gossypibomas described in the literature . one of them is an aseptic fibrous response resulting in adhesion , encapsulation and granuloma . symptoms of this type are more severe and they clinically present earlier . in rare instance , a surgical sponge may completely migrate into the intestinal lumen without any apparent opening in the intestinal wall . various hypotheses have been proposed to explain how the presumed transvisceral migration of such a foreign body might occur . a hypothesis based on experimental study proposed four stages in the process of migration . initially , it is foreign body reaction , when the sponge is walled off by the omentum and some loops of intestine . followed by secondary infection , when cotton filaments reach the intestinal lumen , cytolysis occurs . then invasion of the sponge into the lumen occurs at the stage of mass formation . finally , is the remodeling stage , when a fibrotic scar is formed at the site of migration . patil and colleagues suggested that an increased pressure of the intra - abdominal mass on the bowel loops can lead to necrosis of the intestinal wall partially or entirely . more is being discovered about the risk factors associated with increased incidence of rsfb ; emergency , prolonged surgical procedure , unplanned change in the course of a surgical procedure , involvement of more than one surgical team and patients with higher body - mass index [ 7 , 8 ] . multidisciplinary approaches and new technologies may help reduce this low - frequency but clinically significant event . surgical counting technique , radiographs of the anatomic region corresponding to the operative field and , more recently , specialized radio - frequency ( rf ) system consisting of an rf detector and rf labeled surgical sponges . however , there are no known methods of them entirely eliminating the occurrence of rsfb . different hospitals utilize different methods to account for the surgical materials that are placed in the body . meticulous counting and routine use of surgical textile materials that should be impregnated with radio - opaque markers , in addition to thorough exploration of the surgical sites at the conclusion of the operation , should reduce the incidence of rsfb . unfortunately , 88% of rsfb cases occur after correct surgical counts , indicating that manual counting alone is not a reliable mechanism in eliminating rsfb . although intraoperative roentgenograms are not routinely required , a cost - effectiveness analysis of routine radiographs after emergent operations found that intraoperative radiography was both less costly and more effective than the traditional counting strategy because of institutional costs and legal fees associated with retained surgical sponges . a modern technological advance designed a specialized rf system to eliminate errors in the sponge count by removing the human error factor . the sensitivity and specificity of rf device technology were found to be much higher than those of surgical sponge counts or published findings on the use of intraoperative radiographs to identify retained surgical sponges . written informed consent was obtained from the patient for publication of this case report and accompanying images . the authors declare that they have no conflicting interest and have not been supported or funded by any drug company . | despite near - universal implementation of protocols for surgical sponges , instruments and needles , incidents of retained surgical foreign bodies ( rsfb ) continue to be a significant patient safety challenge .
we report a case of a 29-year - old woman who presented with small intestinal obstruction caused by complete intraluminal migration of a retained surgical sponge into the intestine 9 months after cesarean section .
the diagnosis was confirmed by plain abdominal radiograph .
the patient underwent exploratory laparotomy , sponge removal and became completely asymptomatic .
although safety standards for hospital employees have been developed during the past decades , no detection system to date has been evaluated as a replacement for traditional manual counting protocols and procedures .
the best approach is the prevention of this condition , which can be achieved by implementation of standardized institutional regulations and strict adherence to them .
perhaps , with increasing use of the new technologies as adjunct to the counting , the incidence of rsfb will fall dramatically . |
an 18-year - old male reported to outpatient department of deepa nursing home on december 13 , 2013 with the complaint of fever , malaise , myalgia , and unilateral tenderness on the right side of the face with overlying facial edema since 2 days . the pain and swelling were associated with earache and difficulty to eat , swallow , and talk with difficulty in opening the mouth [ figure 1 ] . swelling on the right side of the face ( frontal view ) general physical examination revealed a well - built stature . on intra oral examination , the orifice of stensen 's duct appeared red and swollen . past medical history revealed that the patient was hospitalized for malaria and treated without any complications 5 years back . the diagnosis was then confirmed with positive serologic test for igm antibody , and igg antibody with a 4-fold rise in titers . seven days following the initial symptomatic treatment for fever and parotid swelling , the patient was hospitalized for fever with a temperature of 100.7f , nausea , vomiting , and painful left scrotal swelling [ figure 2 ] . swelling on the right side of the face ( lateral view ) the patient denied any urinary complaints of dysuria or urethral discharge . considering the patient 's age and the history , there was no record to suggest a sexually transmitted illness . on examination , the left testis was enlarged measuring 8 cm 7 cm 7 cm , tender and hard in consistency [ figure 3 ] . right scrotal swelling the right testis and cord were normal . in the routine laboratory investigations , it was observed that white cell count was raised to 11,700/mcl , and c - reactive protein to 27 mg / l . blood and urine cultures showed no significant growth . considering the clinical examination of the scrotum which showed a swollen and edematous right testis and epididymis , features exhibiting of epididymo - orchitis , the patient was treated with anti - inflammatory medications , pain medications , and bed rest with an elevated scrotum and ice packs applied to the area . clinically , mumps can be defined as an illness with acute onset of unilateral or bilateral tender , self - limited swelling of the parotid and/or other salivary gland ( s ) , without other apparent cause . hippocrates in 5 century b.c . , described mumps as bilateral or unilateral swelling near the ears . mumps is caused by an rna virus of the genus rubella virus belonging to the family of paramyxoviridae . the mode of transmission of the viruses can be through the human reservoir by direct contact , airborne droplets , fomites infected by saliva , and possibly by urine . the possible complications of mumps are aseptic meningitis , encephalitis , hearing loss , orchitis , oophoritis , parotitis or other salivary gland swelling , mastitis or pancreatitis . they are the most common clinical manifestations after parotitis in adolescent boys and adult men , usually in the age group of 1529 years . 80% of all mumps orchitis cases , symptoms are first seen in the first 8 days of the parotid swelling but occasionally may precede it and rarely may manifest itself present even without the parotid swelling . it results in severe pain , swelling , and tenderness at the affected site and is often associated with high fever , nausea , vomiting , and abdominal pain . it resolves over a week , though , gonadal tenderness may persist for a long time . in about 2030% of cases it can lead to oligospermia , azoospermia , and asthenospermia ( defects in sperm movement ) . unilateral orchitis can drastically , but only briefly diminish the sperm count and alter the mobility , and morphology of the sperm . impairment of fertility is estimated to occur in about 13% of patients while 3087% of patients with bilateral mumps orchitis experience infertility . studies by adamopoulos et al . on the levels of various hormones in mumps orchitis , have found low testosterone levels , elevated luteinizing hormone ( lh ) levels and an exaggerated pituitary response to lh - releasing hormone stimulation in the acute phase of mumps orchitis . after 1012 months of the acute phase of the disease the basal testosterone concentration returned to normal level but the mean basal follicle stimulating hormone ( fsh ) and lh concentrations remained significantly high . on the other hand , the link between mumps orchitis and anti - sperm antibodies has been unclear while the antibodies are suspected to impair fertility . histologically , it has been suggested that testicular atrophy is due to parenchymal inflammation due to virus in the testicular glands leading to separation of seminiferous tubules and perivascular interstitial lymphocyte infiltration . a barrier against edema if formed by tunica albuginea leads to rise in intratesticular pressure and pressure - induced testicular atrophy . the use of steroid in patients with mumps orchitis is not advised as , the steroids could further lower the level of testosterone and increase the level of fsh and lh , aggravating testicular atrophy . mumps can be prevented by immunization with measles , mumps , and rubella ( mmr ) vaccines for mmr into one shot . the majority children who receive the vaccine acquire immunity to all three diseases ( over 99% for measles and 95% for mumps and rubella ) . the vaccination is recommended in two doses with the first dose given at 1215 months of age . as of today this is because the routine coverage by mmr is common which act like natural booster in vaccines . the second dose may be given 4 weeks after the first , but it is usually given at 46 years . a time may come in coming years when the routine coverage of mmr will go up and will lead to drastic reduction in natural infections and decrease the natural boosting , and at such a time booster of mmr at 5 years is recommended . mumps orchitis is a severe complication of mumps which can lead to sterility in postpubertal males . immunization and education regarding its complications is the best policy to avoid mumps - related complications . | mumps is a relatively mild short - term viral infection of the salivary glands that usually occurs during childhood .
meningitis / encephalitis is a well - known complication of mumps , but involvement and infection of the testis in adolescent boys and adult men are rare .
we report a case of an 18-year - old male patient with mumps associated epididymo - orchitis on the left side .
the diagnosis was confirmed clinically and serologically by igg and igm titers .
the symptoms were resolved after the administration of anti - inflammatory and pain medications with bed rest and ice packs applied to the area . |
till date to our knowledge and available literature only three cases of lymphangiosarcoma arising in post filarial lymphedema have been reported . cutaneous angiosarcoma is an uncommon aggressive tumor of the capillary and lymphatic endothelial cell origin . post mastectomy chronic lymphedema is the most frequent setting in which lymphedema related lymphangiosarcoma develops . though this tumor has also been described in traumatic , post surgical and congenital lymphedema , it has been encountered in patients with filarial lymphedema very rarely . we are reporting a case of lymphangiosarcoma developing in a 36 year old female who had a past history of filariasis since 20 years . a 36 year old female patient had bilateral lymphedema following filarial infection since 20 yrs . she came with a complaint of fungating mass on left leg . to start with it was reddish nodule which progressed into a fungating mass within a span of 4 months . on physical examination patient had extensive skin thickening and an fungating soft tissue mass measuring 10 cm 7 cm in the medial aspect of the left leg [ figure 1 ] . clinical photograph of patient with bilateral lymphedema ( a ) and left leg fungating mass ( b ) a skin biopsy was performed which showed a tumor composed of numerous pleomorphic spindle cells lining the anastomozing blood vessels [ figure 2 ] . focal areas of dystrophic calcification in the form of calcosphere were seen consistent with old filarial infection . on immunohistochemistry , tumor cells were positive for cd34 , cd31 , vimentin , and negative for cytokeratin ( ck ) which confirmed our diagnosis of angiosarcoma . photomicrograph showing numerous pleomorphic spindle cells lining anastomozing blood vessels with overlying skin ( h and e ) 100 ( a ) and 400 ( b and c ) patient undergone below knee amputation without any adjuvant therapy . the follow up of the patient till date show no evidence of recurrence or metastasis . angiosarcoma can develop from the endothelium of lymphatics ( lymphangiosarcoma ) or blood vessels ( hemangiosarcoma ) . this subclassification is often very difficult to make , however , since there apparently is no difference in the clinical activity . stewart and terres in 1948 were the first to describe a cases of lymphangiosarcoma arising in a case of post mastectomy chronic lymphedema . in a review of lymphangiosarcoma arising in a setting of chronic lymphedema in 1972 . infectious causes for the tumor was implicated in only two cases of which one was tuberculosis and the other unknown [ table 1 ] . cases of lymphangiosarcoma reported after filariasis in our case , patient gave history of chronic filarial infection in past with subsequent development of bilateral lymphedema 20 year back . there was no history of leg or groin trauma , surgery , radiation or lymphadenopathy before development of lymphedema . we found few foci of dystrophic calcospheres spread within the lesion which represents mineralized degenerated worms although we did not identify the viable parasite , the patient 's history and tissue diagnosis is suggestive of chronic filarial infection . filariasis which is endemic in our country often leads to lymphedema . in a review of large cases of filarial lymphedema in 1966 devi and bahuleyan ( 1977 ) were the first to report a case of lymphangiosarcoma of the lower extremity associated with chronic lymphedema of filarial origin . they attributed chronic lymph stasis as the underlying mechanism for this neoplasm . till date to our knowledge and available literature only three cases of lymphangiosarcoma arising in post filarial lymphedema have been reported . in all the cases , the lower limb was affected and lymphangiosarcoma developed after lymphedema of many years duration . it has been shown in animal models that the environment produced by longstanding lymphedema is conducive to atypical vascular proliferation , with mutations eventually leading to malignant transformation of the endothelial cells . alternatively , the lymphedema may impair local immunity , preventing immune detection and destruction of the malignant - tumor cells . the natural history of angiosarcoma associated with chronic lymphedema is repeated recurrence and eventual metastasis , usually to the lungs . the clinical outcome is poor , with less than 10 percent of the patients surviving longer than five years after the diagnosis . the recommended treatment for a tumor of this type in an extremity is amputation , with or without radiation therapy and chemotherapy . lymphangiosarcoma developing in a setting of filarial lymphedema is very rare.patients whose lynmphangiosarcoma is associated with filarial lymphedema in endemic areas may go unnoticed and undiagnosed due to lack of recognition and proper medial care.even though the number of cases is small and the follow up is limited , it seems that lymphangiosarcoma developing in the background of filarial lymphedema remains localized for relatively long periods.therefore , more cases must be studied to understand the behavior of lymphangiosarcoma in this particular setting . patients whose lynmphangiosarcoma is associated with filarial lymphedema in endemic areas may go unnoticed and undiagnosed due to lack of recognition and proper medial care . even though the number of cases is small and the follow up is limited , it seems that lymphangiosarcoma developing in the background of filarial lymphedema remains localized for relatively long periods . therefore , more cases must be studied to understand the behavior of lymphangiosarcoma in this particular setting . it has been shown in animal models that the environment produced by longstanding lymphedema is conducive to atypical vascular proliferation , with mutations eventually leading to malignant transformation of the endothelial cells . the clinical outcome is poor , with less than 10 percent of the patients surviving longer than five years after the diagnosis | we are reporting a case of 36 yr old female with chronic filarial lymphedema of both legs .
subsequently she developed lymphangiosarcoma of her left leg which was confirmed histologically and on immunohistochemistry .
only three more cases of lymphagiosarcoma occurring in patients with filarial lymphedema are reviewed from available literature . |
a 44-year - old man , who had a medical history of panic disorder , visited another hospital due to dyspnea on mild exertion . a coronary angiography showed a single coronary artery originating from the right coronary ostium . a single coronary artery bifurcated into the right coronary artery and left main coronary artery . the left main coronary artery coursed between the main pulmonary artery and aorta before bifurcating into the left descending artery and circumflex artery . we thought that panic symptoms or dyspnea on exertion might be a sign of myocardial ischemia due to compression of the left main coronary artery by the pulmonary artery and aorta . we decided that surgical treatment was the best option due to the high risk of sudden death associated with a coronary anomaly . under general anesthesia we dissected the left main coronary artery between the aorta and the main pulmonary artery on the beating heart . the proximal left main coronary artery was bifurcated from a single coronary artery that originated from the right coronary sinus . under cardiopulmonary bypass , only one coronary ostium was observed in the right coronary sinus , and a single coronary artery originated from the ostium . a 5-mm arteriotomy was made to the left main coronary artery at the site in which the left coronary ostium should have been located . neo - ostium formation was performed with a 5-mm puncher in the left coronary sinus . anastomosis between the neo - ostium and the left main coronary arteriotomy site was performed using a 7 - 0 prolene continuous running suture ( fig . the aortic cross clamping time was 88 minutes , and total cardiopulmonary bypass time was 117 minutes . follow - up computed tomographic angiography before discharge showed good patency of the neo - ostium in the left coronary sinus without stenosis at the anastomosis site ( fig . the patient remained asymptomatic without any complications or events for 15 months after the surgery . angelini reviewed 1,950 coronary angiographies and reported that the incidence of right coronary artery originating from the left coronary sinus was 0.92% and vice versa was 0.15% , with a total incidence of 1.07% . patients are usually asymptomatic . however , it may cause angina , syncope , and even life - threatening complications such as myocardial infarction or ventricular fibrillation . thus , we must consider surgical treatment or intervention if signs of myocardial ischemia are present . several surgical techniques can be utilized to treat coronary anomalies , such as coronary reimplantation to the original sinus , coronary artery bypass graft ( cabg ) , pulmonary artery translocation , unroofing , and neo - ostium formation . in this case , the left main coronary artery was bifurcated from a single coronary artery originating in the right coronary sinus . furthermore , the left main coronary artery passed between the pulmonary artery and aorta to reach the left heart . cabg , coronary reimplantation , unroofing or neo - ostium formation could therefore have been considered as viable surgical options . coronary reimplantation is one of the most physiologically beneficial repairs , but is technically difficult , and stenosis may occur at the site of anastomosis . cabg is technically feasible , but the arterial conduit has a competitive flow problem if no stenotic lesions are present on the natural coronary artery . also , a vein conduit may be problematic if the patient is young because of long - term patency . however , extended unroofing may cause valve insufficiency if the anomalous coronary artery is located under the valve commissure . unroofing was not proper for our case because a separated left main coronary artery originated from a single coronary artery , not the right coronary sinus . neo - ostium formation in the left coronary sinus without unroofing was considered to be a proper surgical treatment in this case . successful surgical treatment of anomalous of coronary anomaly depends on expertise in anatomic and hemodynamic pathophysiology , in addition to the selection of the appropriate surgical treatment option . we report that this case was successfully treated with neo - ostium formation in anomalous origin of the left coronary artery from the right coronary system . | anomalous origin of a coronary aortic artery is a rare cardiac anomaly . although it can cause angina , syncope , and palpitations , most patients are asymptomatic .
this anomaly requires surgical treatment or intervention because it is associated with sudden death .
several surgical techniques , such as coronary reimplantation , coronary artery bypass grafting ( cabg ) , unroofing , and neo - ostium formation , have been proposed as treatments .
we report a case surgically treated with neo - ostium formation in anomalous origin of the left coronary artery from the right coronary sinus . |
the condition of lumbar stenosis results from a formation of a neural arch that is abnormally small in diameter , and triangular rather than round in shape . developmental narrowing of the lumbar vertebral canal has been known to cause radicular syndrome , with symptoms correlating to the severity and level of the stenosis on imaging ; compression in the l3-l4 space affects the l4 nerve root , while compression in the l5-s1 space affects the s1 nerve root . previous studies have indicated that in rare instances , the level of lumbar stenosis on imaging does not correlate with the level of symptomatology . we report a patient who presented with l5 and s1 radiculopathy in the setting of severe l3-l4 stenosis . a 55-year - old gentleman presented with a several month history of bilateral lower extremity leg pain concomitant with numbness and weakness in both of his lower extremities . he complained of pain radiating down into his posterior thigh , calf and into the foot bilaterally . social history was pertinent for a 40-pack - year smoking history and an occupation of a heavy machine operator . his pain symptoms were minimal with sitting or lying down , but pronounced with prolonged standing and walking . on examination , his motor strength was full except for dorsiflexion and plantar flexion , which were 3/5 bilaterally . deep tendon reflexes were 1 in patellas and absent in his ankles ; he also had sensory deficits in his foot . lumbar spine mri revealed evidence of grade i spondylolisthesis of l3 and l4 resulting in severe spinal canal stenosis , with no stenosis at l5-s1 [ figure 1 ] . lumbar flexion and extension imaging demonstrated no evidence of increased subluxation despite the grade i spondylolisthesis . emg revealed evidence of active and chronic l5 and s1 radiculopathy , with active denervation and moderate chronic denervation in the medial gastrocnemius muscles bilaterally ( left worse than right ) . ( a ) l3-l4 level , ( b ) l4-l5 level , ( c ) l5-s1 level given the patient 's clinical and imaging findings , which did not demonstrate significant instability , the decision was made to perform bilateral hemilaminotomy to decompress l3-l4 . due to his smoking history , he was not offered a fusion ; however , given his motor weakness , it was believed that decompression would offer him the best chance of regaining full dorsiflexion and plantarflexion function . he was subsequently taken to the operating room , where bilateral partial l3-l4 hemilaminotomy was performed . due to a small left l4-l5 disc hernation on mri [ figure 1b ] , there was no operative involvement at l5-s1 , and no spinous processes were taken in order to avoid disruption of his posterior tension band . postoperatively , the patient regained full strength in dorsiflexion and plantarflexion bilaterally , and noted marked improvement in his preoperative symptomatology . this case represents a rare instance of upper lumbar spinal canal stenosis manifesting with lower nerve root pathology . the first report of such an instance occurred in 1998 , involving an l5 radiculopathy secondary to l1-l2 and l2-l3 lumbar stenosis . a recent study , examining eight patients with this phenomenon , found that l5 was involved in six cases , while s1 was involved in the remaining two cases ; in all eight cases , operative decompression improved symptoms . additional reports have demonstrated l5 radiculopathy secondary to upper lumbar disc herniation as opposed to stenosis . of the nine previous stenosis cases reported , seven involved radiculopathy at l5 and two involved s1 [ table 1 ] . this case represents the first report of multilevel radiculopathy secondary to upper lumbar stenosis , with only the third instance of s1 radiculopathy from upper lumbar stenosis to be reported . in seven of the previous nine cases ( 77.8% ) , fusion rather than laminectomy / laminotomy was performed [ table 1 ] . however , in this patient , given his smoking history , the potential long - term downside of performing a fusion led to the decision to perform decompression without fusion . furthermore , he demonstrated no instability on flexion / extension lumbar spine x - rays . to aid in preventing development of instability , particularly in the setting of this patient 's grade i l3-l4 spondylolisthesis , laminotomy rather than full laminectomy was performed in order to preserve the posterior tension band at l3-l4 . it is our hope that smoking cessation can be initiated during the postoperative period , such that should the patient eventually become unstable in the future , a fusion operation at that time would be much less likely to fail and more likely to result in a good postoperative outcome . although a left l4-l5 microdiscectomy was performed , it is unlikely that this pathology was a significant contributor to his preoperative symptomatology , as it would be unable to account for the dramatic improvement in his right - sided as well as left - sided preoperative l5 and s1 symptomatology . consequently , it is most plausible that this patient 's bilateral l5 and s1 radiculopathy was secondary to the l3-l4 stenosis alone . literature review of reported cases of upper lumbar spinal stenosis manifesting as lower nerve root radiculopathy this is the first report of multilevel lower nerve root radiculopathy secondary to upper lumbar spinal canal stenosis . this case underscores the importance of carefully examining the spinal canal levels superior to the level of radiculopathy on imaging studies , as decompression of lumbar stenosis at these levels may result in resolution of radicular symptoms . | lumbar stenosis is a common disorder , usually characterized clinically by neurogenic claudication with or without lumbar / sacral radiculopathy corresponding to the level of stenosis .
we present a case of lumbar stenosis manifesting as a multilevel radiculopathy inferior to the nerve roots at the level of the stenosis .
a 55-year - old gentleman presented with bilateral lower extremity pain with neurogenic claudication in an l5/s1 distribution ( posterior thigh , calf , into the foot ) concomitant with dorsiflexion and plantarflexion weakness .
imaging revealed grade i spondylolisthesis of l3 on l4 with severe spinal canal stenosis at l3-l4 , mild left l4-l5 disc herniation , no stenosis at l5-s1 , and no instability .
emg revealed active and chronic l5 and s1 radiculopathy .
the patient underwent bilateral l3-l4 hemilaminotomy with left l4-l5 microdiscectomy for treatment of his l3-l4 stenosis .
postoperatively , he exhibited significant improvement in dorsiflexion and plantarflexion .
the l5-s1 level was not involved in the operative decompression .
patients with radiculopathy and normal imaging at the level corresponding to the radiculopathy should not be ruled out for operative intervention should they have imaging evidence of lumbar stenosis superior to the expected affected level . |
most insulinomas are benign , single and small , measuring less than 2 cm in diameter . differentiation between benign and malignant insulinomas by histologic finding was difficult , therefore malignant insulinomas were diagnosed only by metastasis to lymph nodes or other organs . hence we report a patient of a large malignant insulinoma with peripancreatic lymph node metastases and characterize it s endosonographic , immunohistochemical and electron microscopic features . a 53-year - old woman presented with recurrent dizziness and loss of consciousness upon skipping meals for several months . the results of complete blood counts , tumor markers , thyroid function test , parathyroid hormone , calcium , gastrin , prolactin and brain computed tomography ( ct ) were normal , but the random glucose level was 39 mg / dl . on 72-hour fasting test , she demonstrated cold sweat , disorientation , and dizziness at 5 hours with 25 mg / dl of serum glucose level . the plasma insulin - to - glucose ratio was 1.41 ( table 1 ) and symptoms were immediately relieved following glucose administration ( figure 1 ) . a hypoechoic , heterogeneous echoic mass was discovered at the tail of the pancreas ( figure 2 , 3 ) . the mass measuring 5.84.74.5 cm in dimension ( figure 4 ) was composed of uniform bland cuboidal cells with granular eosinophilic cytoplasm and round nuclei ( figure 5a ) . immunohistochemically , cytoplasm of tumor cells were strongly immunoreactive to insulin ( figure 6a ) but not to somatostatin and glucagon . on ultrastructural study , atypical secretory granules were easily found in the cytoplasm ( figure 7a ) . amyloid deposits were showed both by electron microscopy ( em , figure 7b ) and congo red stain under polarizing microscopy ( figure 8) . immediate after surgery , the levels of insulin and glucose were normalized and the postoperative course was uneventful and without any complication ( table 1 ) . during 18-months of follow - up , she remains with no evidence of recurrence . insulinomas are the most common pancreatic endocrine tumors ( pets ) and only less than 10% are malignant . malignant insulinoma could be suspected clinically if the size of the tumor is 3 to 6 cm or larger and confirmed bythe evidence of metastasis which is mostly found in the liver , lymph nodes , or both . a large variety of imaging modalities for the preoperative localization have been used , but the average accuracy remains low . recently , eus is a new convenient diagnostic method for the localization of a pancreatic mass . differentiations between benign and malignant insulinoma by eus depend upon size , heterogeneity of internal echo , multinodular structure , cystic transformation or necrosis and vascular invasion . in our case eus findings that demonstrated large - sized , low - echoic mass with heterogeneous internal echo evoked a possibility of malignancy . the ki-67 li is known to be less than 5% in benign tumors , but it was estimated as 13% in this tumor which could be a predictable feature of a malignant tumor . more than half of the pets secrete multiple hormones ( insulin , glucagon , somatostatin ) , nevertheless , the clinical manifestations are nearly always derived from hypersecretion of only one of these hormones . in our case , the tumor cells were only immunoreactive to insulin , therefore , seemed to be as a pure insulinoma . ultrastructurally , our tumor was devoid of typical insulin - secreting granules and only showed a decreased number of atypical secretory granules comparing with normal islet cell . because atypical granule could be regarded as an incomplete form in the maturation process and stored with a small amount of functional insulin , these findings might be correlated with long , insidious , endurable clinical symptoms and malignant potential . however , high li , heterogeneous eus findings , capsular invasion with large tumor and pure atypical secretory granules might be other valid diagnostic clues for diagnosis of malignant insulinoma . those were thought to be the result of uncontrolled insulin or proinsulin release with decreased storage capacity . distal pancreatectomy with splenectomy was performed because of the unfavorable eus findings . for patients with benign insulinoma , the long - term cure rate is about 88.697.5% by surgical treatment , and patients with malignant insulinoma have a 4966% of 5-year survival with 7.5-year of overall survival . the patient has remained well for 18 months after surgical excision of the tumor , despite some unfavorable prognostic factors such as lymph node metastases , capsular invasions and high li . | malignant insulinoma in the beta cells of the pancreatic islet is rare and usually presented as hypoglycemia .
we report a case of large malignant insulinoma in a 53-year - old korean woman .
a presumptive clinical diagnosis was made before surgery , based on the high plasma insulin - to - glucose ratio and a large solitary heterogeneous pancreatic mass by abdominal computed tomography and endosonography .
the tumor measured 5.84.74.5 cm in dimension and showed capsular invasions and metastases in two of four peripancreatic lymph nodes .
the tumor cells were strongly immunoreactive to insulin and had a high ki-67 labeling index ( 13% ) and atypical membranous electron - dense granules , ranging from 120 to 400 nm in diameter , in the cytoplasm on electron microscopy .
the patient was treated by distal pancreatectomy with splenectomy and rapidly recovered without neurohypoglycemic symptoms .
this case showed not only lymph node metastases , the most reliable parameter for malignancy in pancreatic endocrine tumors , but also other valid diagnostic clues , such as high ki-67 labeling index , heterogeneous enodosonographic findings , capsular invasions with large tumor and pure atypical secretory granules . |
the calcifying epithelial odontogenic tumor ( ceot ) is a rare benign tumor of the jaws first described by pindborg in 1955 and also referred as pindborg tumor . the clear cell variant of ceot was first reported by abrams and howell in 1967 . topographically two entities have been distinguished : intraosseous ( central ) and extraosseous ( peripheral ) . twelve central lesions have been reported of which only three cases have been reported in maxilla . typically , ceot has been described as slow growing , benign and locally aggressive tumor . hicks et al . , suggested that clear cell variant may show more aggressive behavior with higher recurrence ( 22% ) . clear cells are present as cellular components of the epithelial lining of lateral periodontal and gingival cysts in adults , or they may be found as clear - cell rests of the dental lamina within the connective tissue wall of these cysts . philipsen and reichart reviewed 181 cases of pindborg tumor , 15 of which are clear cell containing lesions . some authors have classified cceot as separate clinical entity . in this paper , a rare case of cceot of posterior maxilla is reported and clinical , radiographic histological features of the same are discussed . a 36-year - old indian woman reported to our department with painless , slow growing swelling of right upper jaw and loss of upper teeth due to mobility . the swelling was about 3 2 cm with normal color , intact mucosa and indentations of opposing tooth [ figure 1 ] . opg showed 3 3.5 cm mixed radiolucent - radiopaque lesion in the posterior maxilla with impacted teeth . radiographically driven snow computed tomography ( ct ) revealed radiolucent - radiopaque mass in the right maxilla invading the cortex [ figure 3 ] . intra oral photograph showing solitary swelling in right posterior maxillary region snow - driven , radiolucent - radioopaque lesion seen in right maxilla in orthopantomogram computed tomography scan showing radiolucent - radiopaque mass in the right maxilla invading the buccal cortex an incisional biopsy was taken from the lesion . hematoxylin and eosin stained sections showed fibrous connective tissue stroma with islands of polyhedral epithelial cells containing nuclei of varying form and size . extracellular eosinophilic amyloid like material was found containing concentric calcifications in the form of liesegang rings [ figure 4 ] . initial histology sections showing liesegang rings ( h&e stain , 200 ) considering the age of the patient , esthetic concern and benign nature of ceot , curettage of the lesion along with the associated tooth was performed under general anesthesia ( ga ) . intranasal biopsy was performed , revealed clear cells in the stroma of ceot confirming the diagnosis of clear cell ceot [ figure 6 ] . recurrence evident in ct photomicrograph of intranasal biopsy showing liesegang rings and clear cells ( h&e stain , 100 ) clear cell variant of ceot is a rare entity and central cceot occurring in maxilla is rarest entity . an extensive review of literature on clinical and radiologic features of cceot has been done by anavi et al . equal distribution in males and females , age range of 14 - 68 years ; and of the 12 central lesions , nine involving the mandible and three in maxilla ( 75:25 ) have been reported . the typical clinical presentation of cceot is painless swelling of the jaw causing cortical expansion . radiological features of ceot is unilocular or multilocular lesion with mixed radiolucent and radiopacity of various density . clinical features and radiological features of the case presented are consistent with that of the other cceot reported . the three maxillary lesions described were radiolucent in opg , in the presented case lesion was typically of driven snow appearance . histological sections of ceot containing islands of polyhedral epithelial cells , having nuclei of varying form and size with extracellular eosinophilic material amyloid and concentric calcifications within the connective tissue matrix in the form of liesegang rings are typical . clear cell variant consists of sheets or cords of clear cells with foamy cytoplasm in the matrix . these features were detected in the case presented confirming the diagnosis of clear cell variant . other variants of ceot described include pigmented , langerhan cells containing and non - calcifying variants . the clear cell variant tends to be more aggressive and shows higher recurrence rates than conventional ceot . the surgical management modalities in 19 reported cases were complete or partial resection in seven patients ( 37% ) , excision in seven ( 37% ) , enucleation in four ( 21% ) and curettage in one case ( 5% ) . waldron et al . , and hicks et al . , have reported that occurrence of the clear cells may prove to be a sign of increased tumor aggressiveness indicating a more radical approach . recurrence of tumor following curettage in our case strongly supports the data and enbloc resection is recommended . evidence supports that clear cell variant is a distinct entity , has more aggressive biological behavior and higher chances of recurrence . hence , it is important that presence of clear cells be included in histopathological diagnosis . the identification of clear cell directs the surgeon towards more definitive surgical excision of the lesion . maxillary lesions should be treated more aggressively because they grow faster and possess close proximity to important structures . | the calcifying epithelial odontogenic tumor ( ceot ) is a rare benign tumor of the jaws .
pindborg 's tumor having clear cells is extremely rare .
twelve central lesions have been reported of which only three cases have occurred in maxilla .
clear cell variant is a distinct entity , has more aggressive biological behavior and higher chances of recurrence .
hence it is important that presence of clear cells be included in histopathological diagnosis . here
we present a rare case of clear cell ceot having aggressive behavior . |
the patient was an infant male born at 38 and 5/7 weeks estimated gestational age to a healthy 29-year - old woman following an uncomplicated pregnancy . the patient was noted to have an intermittent moist cough several hours following birth , with rhonchi transmitted from the upper airway audible throughout all lung fields . pulse oximetry was obtained during the discharge physical exam and the patient was noted to be hypoxemic with an oxygen saturation of 88% . respiratory rate varied between 40 and 55 breaths per minute . auscultation of the chest revealed normal breath sounds and no evidence of a cardiac murmur . the infant was admitted to the level two nursery and further diagnostic evaluations were obtained . complete blood count , cerebral spinal fluid ( csf ) cell count , and venous blood gas were within normal limits . antibiotics were started empirically for a presumed neonatal pneumonia , but were discontinued after 6 days due to negative culture results and a lack of clinical change during the course of antibiotic therapy . supplemental oxygen was provided via nasal cannula at an initial flow rate of 2 liters per minute ( lpm ) . pediatric pulmonology consultation was obtained on hospital day 5 and a nasal brush biopsy of the inferior turbinate was obtained for electron microscopy ( em ) analysis of the cilia . a 3.0-mm disposable cytology brush was used to obtain the nasal epithelial sample from the right nares . nasal suctioning , performed with a 10 french catheter advanced 4 - 6 cm into each nare , repeatedly obtained thick nasal secretions . the patient began to tolerate trials of room air immediately following nasal suctioning with progressive clinical improvement as nasal suctioning was performed initially every 4 hours and spaced to every six hours . supplemental oxygen was permanently discontinued 60 hours after nasal suctioning was first initiated , with pulse oximetry recordings consistently above 95% on room air . the patient was discharged home on day 11 of life with instructions to continue nasal suctioning four times daily . results of the em studies were available on the day of discharge and confirmed the diagnosis of primary ciliary dyskinesia ( pcd),noted by the absence of inner dynein arms [ figure 1 ] . pcd is a predominantly autosomal recessive inherited disorder that renders ciliary processes in the body ineffective . this leads to dysfunction in mucus clearance in the sinopulmonary tracts , recurrent otitis media , and male infertility . defective embryonic cilia result in random lateralization of the viscera with approximately 50% of cases having situs inversus or other forms of heterotaxy . the estimated prevalence of pcd is 1 in 15 - 30,000 live births ; however , due to underdiagnosis this is likely an underestimate . review of the literature and previous case reports presents early neonatal diagnosis almost exclusively in patients with a finding of some form of situs inversus on prenatal ultrasound or neonatal cxr.[46 ] despite more than 75% of full - term neonates with pcd having symptoms of neonatal respiratory distress in the first few days of life , it is the latter physical finding in the neonatal period that usually leads to the suspicion and ultimate testing for the disease . even so , in a review of the age at diagnosis and the symptom history of children with pcd in a pediatric pcd clinic in the uk , coren et al . calculated the mean age of diagnosis to be 6 years in cases that lacked situs inversus and still 4.4 years in those children with this known lateralization defect . our patient showed a normal left - sided cardiac silhouette on cxr and echocardiogram with normal structure of the heart . however , his older sibling was previously diagnosed with kartagener syndrome ( pcd with situs inversus ) , giving practitioners in this case a higher index of suspicion for pcd in the patient . while it has been noted for over 30 years that pcd should be recognized in the differential diagnosis for neonatal respiratory distress , testing and diagnosis diagnosis of pcd by nasal biopsy has been previously reported.[35 ] nasal brush sampling is a relatively noninvasive means for obtaining ciliated epithelium for em analysis and does not require sedation . it is a simple test that should be performed when pcd is considered in the differential diagnosis of neonatal respiratory distress . although there is a paucity of research demonstrating conclusive cause and effect , general consensus suggests that failure to diagnose and treat pcd can lead to progressive and permanent lung damage due to repeated infections and obstruction of airways leading to bronchiectasis . other complications of this disorder include chronic otitis media , rhinosinusitus , atypical asthma , and pneumonia . early diagnosis and , therefore , treatment can be paramount to decrease morbidity in this condition as this case demonstrates . we report here a case of a neonate with pcd as the underlying cause of persistent hypoxemia . the combination of relatively narrow nasal passages along with obligate nasal breathing in neonates likely contributed to nasal airflow obstruction . persistent hypoxemia was the only significant finding that led to a prolonged hospital course in this patient . frequent nasal suctioning with saline drops proved to be successful treatment for the persistent hypoxemia . mucosal edema , trauma , bradycardia , and laryngospasm are known complications from nasal suctioning . however , when used judiciously , nasal suctioning can be an effective treatment for nasopharyngeal obstruction caused by thickened secretions . to our knowledge , this is the first report that describes the successful treatment of hypoxemia in a neonate with pcd . in summary , patients with pcd may present with a wide spectrum of respiratory signs and symptoms in the neonatal period . the diagnosis of pcd should be considered in any neonate with unexplained persistent respiratory findings . nasal congestion with airflow limitation and subsequent hypoxemia may be a manifestation of pcd in the neonate , which improves with nasal suctioning . | primary ciliary dyskinesia ( pcd ) is a genetic disorder that manifests clinically with chronic sinopulmonary and otologic disease . despite the majority of patients presenting with respiratory symptoms in the neonatal period ,
the diagnosis is often delayed until several years of age .
we report the case of a 5-day - old male who was diagnosed with pcd by electron microscopic evaluation of cilia obtained from nasal brush biopsy .
this case also demonstrated the successful treatment of persistent hypoxemia with frequent nasal suctioning . |
granular cell tumor ( gct ) is an uncommon benign tumor , affecting the skin and internal organs . the tumor is usually asymptomatic although some patients may experience mild pruritus or pain . a case of a large solitary painful gct a 48-year - old housewife presented to us with a painful solid mass over her upper back present for the preceding 2 years . starting as a pea - size swelling , it increased gradually in size and became more painful . there was no history of prior trauma or any discharge from the lesion [ figure 1 ] . well - defined , yellowish hard nodular lesion with smooth irregular surface over midline in the upper back on examination , there was a well - defined , very tender , yellowish , hard lesion of about 3 cm diameter , having a smooth irregular surface located over the midline in the upper back . fine - needle aspiration cytology ( fnac ) showed large round to oval cells with vesicular nuclei . the cells were characterized by abundant , coarsely granular and amphophilic cytoplasm ; with eccentrically located small vesiculated nuclei and prominent nucleoli . there was neither any mitotic figure nor spindling of the lesional cells [ figures 2 and 3 ] . photomicrograph showing sheets of large polygonal cells infiltrating into the dermis ( h and e , 10 ) photomicrograph showing sheets of large polygonal cells with centrally placed small round to oval vesiculated nuclei with abundant granular eosinophilic cytoplasm without any mitotic figures ( h and e , 40 ) routine laboratory tests , blood biochemistry panel and imaging studies were within normal limits . it was long debated whether the tumor originates from muscle , fibroblast , histiocyte , neural crest or nerve sheath . however , it is now accepted to be of neural sheath origin , indicated by s-100 protein , peripheral nerve myelin protein , such as p2 and po protein positivity . although common during the third and fourth decades of life , gct can occur at any age . are found in the tongue while skin and subcutaneous tissue share one third of the cases . other sites such as esophagus , stomach , larynx , bronchus , uvea , muscle and pituitary stalk may be involved . gct usually presents with a well - circumscribed , solitary , raised , firm nodule of 0.5 to 3.0 cm diameter with a smooth , rough or verrucous surface . it usually remains asymptomatic , but sometimes may be associated with mild pruritus or tenderness . the characteristic cytologic findings are large , pale oval , round , bipolar or polygonal cells with abundant fine or coarsely granular , eosinophilic cytoplasm , inconspicuous cell border , eccentrically located nuclei , fine nuclear chromatin and indistinct nucleoli . histopathology shows the same cellular architecture , pseudoepitheliomatous hyperplasia and cords of cells infiltrating into the dermis . on immunohistochemistry , the tumor cells are positively stained with vimentin , neuron - specific enolase , s-100 , myelin protein , p75 nerve growth factor , calretinin , nki / c3 and pgp9.5 . malignant gct is found in only 1 to 2% of cases , indicated by large size , rapid growth , lymph node involvement , necrosis and cytologic features of malignancy . as mitoses are normally found in gct , they are not considered to be the marker for malignant transformation . an important feature of malignancy in a granular cell tumor is spindling of lesional cells . our case presented with a well - defined very painful nodular lesion with a smooth , but bosselated surface . we referred the patient to plastic and reconstructive surgeon for complete excision and follow up . our case presented with an extremely painful and very tender swelling , an uncommon finding . | granular cell tumor is a distinctly rare neoplasm of neural sheath origin
. it mainly presents as a solitary asymptomatic swelling in the oral cavity , skin , and rarely internal organs in the middle age .
histopathology is characteristic , showing polyhedral cells containing numerous fine eosinophilic granules with indistinct cell margins .
we present a case of granular cell tumor on the back of a 48-year - old woman which was painful , mimicking an adnexal tumor . |
intrauterine growth restriction ( iugr ) is a common diagnosis in obstetrics and carries an increased risk of perinatal mortality and morbidity . we present a case of early onset iugr related to an excessive long umbilical cord ( eluc ) , without any other abnormalities . a 22-yearold woman visited our hospital for the prenatal care of her first pregnancy . at 25 weeks there was no history of any medical condition nor any abuse that could explain the iugr in this on ultrasound structurally normal fetus . doppler velocimetry in the umbilical artery and the middle cerebral artery always was within normal limits . the amniotic fluid index was normal and amniocentesis showed a normal karyotype , 46 xx . this was performed using an extraamniotic balloon , followed after 6 h by extraamniotic administration of prostaglandin ( 0.5 mg dinoproston , prepidil gel , pfizer , belgium ) . on the patients demand , dilation progressed slowly , after 12 h fetal bradycardia , to 60 bpm , developed , with normalization at 8 min . at that moment cervical dilation was 4 cm and monitoring for st - analysis was placed ( figure 1 ) . but it had to be interrupted because of a suboptimal pattern at the cardiotocography . because of not progressive labor and the impossibility to raise the uterotonica , the gynecologist decided to perform caesarian section . the patient delivered a female infant weighing 1550 g , with an apgar - score of 9 after 1 and 5 min and 10 after 10 min . the ph - values on the umbilical cord blood samples were normal ( arterial 7.31 and venous 7.35 ) . macroscopic evaluation of the placenta showed an excessively long umbilical cord , measuring 125 cm , a size of 13 cm by 13 cm and a thickness of 2 cm ( figure 2 ) . the weight of the placenta was 270 grams , which is small for 37 weeks of pregnancy ( < p10 ) . microscopic evaluation showed a normal maturation of the villi , normal decidua , but a subchorial thrombus , perivillous fibrin deposition and a placental infarction . iugr is a common diagnosis in obstetrics and carries an increased risk of perinatal mortality and morbidity . decreased intrauterine growth may have a negative effect on brain growth and mental developmental potential . it is important to identify iugr because proper evaluation and management can result in a favorable outcome . this case illustrates the association between an extremely long umbilical cord and intrauterine growth restriction . it is known that in an excessive long cord , the risk of clinical umbilical cord entanglement ( i.e. true knots or cord loops around the neck or body parts ) and circulatory stasis and vascular thrombosis is higher . this can cause perinatal complications , like intrauterine growth restriction , neurological complications and fetal death . we talk about a short umbilical cord if it is less than 30 to 40 cm and a long one from 70 to 80 cm . the umbilical cord is responsible for the transport of nutrition , oxygen and fluid necessary for the intrauterine existence of a fetus . so it s not surprising there is an association between gross cord abnormalities and adverse perinatal outcome . it is assumed that length of an umbilical cord is determined by environmental as well as genetical factors . this suggests that umbilical cord length is already established early in pregnancy and so it could be a reliable parameter during the ultrasound follow up in prenatal care . they found an association between eluc and women with systemic diseases and with postpartum and perpartum complications . there was also a significant correlation with higher birth weight , adverse neonatal outcome , low apgar - scores , male fetuses , fetal anomalies and cord entanglement . fetal and neonatal mortality and iugr were seen in a higher number in the elucgroup , but there was no statistical significance . but tantbirojn et al . did an evaluation of placentas with gross cord abnormalities and their relationship to adverse clinical outcomes and stasis - associated histologic changes in the placenta . they found that gross cord abnormalities were significantly associated with stillbirth , intrauterine growth restriction , nonreassuring fetal tracing , meconium - stained amniotic fluid , and increased rate of emergency cesarean section . at microscopic evaluation , cases with gross cord abnormalities showed a statistically significant association with both ectasia and thrombosis in the fetal vasculature , as well as changes of fetal thrombotic vasculopathy in the terminal villi . considering individual gross cord abnormalities , long cord and nuchal cord had the highest rate of thrombosis - related histopathology . finally , cases with both abnormal cords and histologic thrombosis had significantly higher rates of adverse outcomes , including iugr and stillbirth . we can found this association of an abnormal cord , histologic thrombosis and iugr also in our case . unfortunately these histological findings are only detectable postpartum , but it is not unimaginable to examine the umbilical cord during prenatal care . ultrasound evaluation of the umbilical cord should not be very incriminating in the assessment of a fetus in the prenatal care . aasia saleemuddin describes that in a study of placentas reviewed for adverse neurodevelopmental outcome , fetal thrombotic vasculopathy showed to be most commonly associated with grossly abnormal umbilical cords ( including excessively long umbilical cords , nuchal cords , or cords showing hypertwisting and/or abnormal insertions ) which predispose to cord compression and compromise fetal blood flow . it is remarkable that fetal thrombotic vasculopathy was originally suspected to be mainly a marker for fetal and/or maternal thrombophilia , but however , later studies found similar rates of fetal / maternal thrombophilias in placentas with or without fetal thrombotic vasculopathy . andres et al described an association between massive perivillous fibrin deposition , also called maternal floor infarction , and iugr . mana taweevisit presented a case of a 37-week male stillborn fetus whose placenta had an excessively long umbilical cord and no other cord abnormalities associated with fetal thrombotic vasculopathy ( ftv ) . this case illustrates the unusual occurrence of ftv of such severe extent in association with eluc leading to fetal demise . this case illustrates that eluc alone may be enough to predispose the placenta to massive ftv . we present this case to emphasize the role of umbilical cord length as a predictor of adverse perinatal outcome . a lean or hypo - coiled umbilical cord has been described as a factor contributing to iugr and perinatal complications . studies have been published on the relation between umbilical cord thickness even from the first trimester and perinatal outcome , and prenatal indices for coiling and umbilical cord diameter have been published and related to fetal outcome , but no simple and reliable methods has been developed to evaluate umbilical cord length sonographically , only sophisticated experimental models not yet applicable in clinical medicine have been developed . more research is needed to evaluate the role of umbilical cord length and to determine the possibility to develop simple methods , for which we propose for instance the number of transverse cuts through the umbilical cord in the four quadrants such as used in the amniotic fluid index , to measure umbilical cord length during routine sonographical examination or in cases of iugr . | we present a 37-week female baby , known with intrauterine growth restriction since 25 weeks of pregnancy , born with a placenta with an excessive long umbilical cord ( eluc ) , without any other abnormalities .
eluc is mostly an incidental finding after delivery , but represents a potentially detectable intrauterine cause of growth restriction .
a system that allows ultrasound measurement of the length of the umbilical cord could highly increase antenatal diagnosis of eluc . |
pneumoperitoneum in a neonate is a serious condition that typically indicates bowel perforation including necrotizing enterocolitis , perforated appendicitis , or spontaneous intestinal perforation . another cause of pneumoperitoneum is an air dissection from the respiratory tract in the ventilated neonate . on the other hand , some neonatal intestinal perforation does not show the typical features of peritonitis and perforated meckel 's diverticulum ( md ) in neonates is sometimes the case which is difficult to diagnose . a male twin baby weighing 1970 g was born at 34 weeks and 2 days gestation by caesarean section . on the 1 day of life , his vital signs were stable , and the abdomen was palpated soft without tenderness . there was no metabolic acidosis , and the c - reactive protein level was 0.05 mg / dl . on the 2 day of life , his vital signs were still stable , but abdominal radiographs showed increased free peritoneal gas and ultrasonography showed an increase in ascites . the alexis wound retractor xs ( applied medical , rancho santa margarita , ca , usa ) was inserted into the abdomen through an omega - shaped circumumbilical incision and a free access ( top corporation , tokyo , japan ) was mounted on it . the camera port was inserted through the free access and two 3-mm trocars were placed for working ports besides . after pneumoperitoneum establishment , turbid bilious ascites was detected and wide ranged investigation under laparoscopy showed no evidence of gastric , duodenal , or colonic perforation , which indicated perforation of a small intestine [ figure 2a ] . then , the free access was dismounted , and the small intestine was exteriorised through the alexis retractor . a perforated md was detected , and intestinal fluid was leaking from the evaginated tip [ figure 2b ] and the md existing part of the intestine was resected . pathological examination of the diverticulum showed no evidence of acute inflammation and no heterotopic mucosa . radiograph taken on day 0 after intubation demonstrating slight pneumoperitoneum ( arrows ) ( a ) laparoscopy showed abdominal cavity covered with ingrained turbid bilious ascites with an excellent view . ( b ) perforated tip of the meckel 's diverticulum exteriorised from the umbilical multiuse single - site port intestinal perforation is a rare condition of md that reportedly occurs in < 10% of symptomatic cases . symptomatic md is rare in neonates , accounting for < 20% of all paediatric md cases . in children , the most common presenting symptom is melena , followed by bowel obstruction , diverticulitis , and umbilical discharge . there is only one report of laparoscopic treatment for a neonate md , which showed intestinal obstruction . in neonates , the perforated tip of the md is branched away from the main portion of the intestine , so not much of the volume of the meconium drained into the abdominal cavity . surgical options for a neonatal pneumoperitoneum range from peritoneal drainage to the major laparotomy with bowel resection or proximal jejunostomy . most of these options used to require an extensive transverse abdominal incision to thoroughly investigate the whole abdominal cavity . therefore , a wait and see approach was usually taken , which extended the fasting period and was not beneficial to their future neurodevelopment . on the other hand , diagnostic laparoscopy could reveal ascites as well as bowel perforation with an intra - umbilical incision with inconspicuous scar . furthermore , the site of bowel perforation could be predicted by the presence of a sentinel collection of pus . thereupon , a multiuse single - site port on the umbilicus is useful for making the right diagnosis with a minimum incision , and this approach also provides a chance of treating the perforated intestine by exteriorizing the site from the umbilicus . we believe that a neonate with suspected intestinal perforation of unknown aetiology , especially suspected intestinal perforation with little or no peritonitis symptoms , should be subjected to diagnostic laparoscopy to minimise the fasting period . although the neonatal abdominal cavity is very narrow , the use of a multiuse single - site port on the umbilicus has good cosmetic results and enables extracorporeal bowel resection from the port site . | pneumoperitoneum in a neonate is a serious condition for which bowel perforation is indicated in most cases . because the transdiaphragmatic air dissection could occur in some ventilated neonates without peritonitis , making the right diagnosis is sometimes difficult , and exploratory laparotomy is often necessary
.
here , we report the first case of neonatal pneumoperitoneum caused by a perforated meckel 's diverticulum in which diagnostic laparoscopy was useful in achieving minimal access surgery . using a multiuse single - site port on
the umbilicus could enable the extraction of a certain length of a small intestine with good cosmetic results .
this method would decrease the hurdles of early surgical interventions for the suspected perforation of unknown aetiology and shorten the fasting period , which is beneficial for the neurodevelopment of small neonates . |
an 8-year - old girl presented with a progressively enlarging mass in the right conjunctival fornix composed of normal appearing eyelashes . the patient had a history of aberrant conjunctival eyelash growth that had caused recurrent conjunctivitis in her right eye over the past few years . the mass was surgically removed and the pathology report revealed it to be a conjunctival dermoid . mature hair follicle growth from the conjunctiva is another possible presentation of a conjunctival dermoid that can be cured by simple surgical excision . dermoids are the most common orbital tumor of childhood.1 this mass can have numerous ocular presentations and can occur in a variety of locations ; the classic example is lesions occurring on the superotemporal orbital wall . dermoids have also been reported on the inferotemporal cornea , the caruncle and the conjunctiva.2,3 while these heterogeneous presentations are classified under the general heading of dermoid , depending on the location , each can have a different underlying histology . proper identification of dermoid type can be important both for preoperative surgical planning and postoperative prognosis . an 8-year - old hispanic girl was referred to our institution for a growth in her right conjunctival fornix . her mother had noticed the mass over the past few months and felt that it was enlarging . our patient did not have any other medical conditions and denied undergoing prior trauma or surgery . her only ocular history involved multiple , recurrent episodes of redness in the right eye that were diagnosed and treated as either bacterial or viral conjunctivitis by the referring physician . the mother also reported that she had discovered pieces of hair in her daughter s right eye tear film over the past couple of years . on presentation , the patient s eye looked relatively normal , and she had uncorrected visual acuity of 20/20 in both eyes , with an otherwise unremarkable gross examination . slit lamp examination of her right eye revealed a mildly injected palpebral conjunctiva with a moderate - sized , fibrous , tan - colored mass that had arborizing , centrally coursing blood vessels . upon manipulation of the mass , a large tuft of normal appearing eyelashes emanated from the inferior conjunctival fornix ( figure 1 ) . the mass was easily mobile , firm and non - fluctuant , so a decision was made to surgically remove the mass . the patient was taken to the operating room , and the base of the mass was carefully resected with sharp westcott scissors . the tumor had a wide based pedicle and was easily removed . the remaining conjunctival edges were easily reapproximated without tension , so no sutures were placed . on post - operative day one , the patient was comfortable and the conjunctival fornix was completely healed . she returned for her post - operative month one visit and had a pristine inferior conjunctival fornix , without any evidence of tumor recurrence . the pathology specimen revealed nonkeratinized stratified squamous epithelium with multiple goblet cells and an underlying chronic mononuclear inflammatory cell reaction . the bulk of the lesion was made of relatively loose , irregular connective tissue with multiple small hair shafts in longitudinal and transverse cross - section and a small amount of adipose tissue . the pathology report was consistent with dermoid choristoma of the conjunctiva ( figure 2 ) . the differential diagnosis for a pediatric conjunctival tumor includes nevi ( 64% ) , choristomas ( 10% ) , vascular tumors ( 7% ) , juvenile xanthogranulomas ( jxg ) and lymphoid masses.4 the presence of normal conjunctival epithelium , hair shafts , and adipose tissue in our patient was consistent with a choristoma . the clinical picture of the tan , fibrous mass with central vessels could have been mistaken for a pyogenic granuloma , but the patient had no history of surgery or trauma , and histopathology did not report any granulation tissue . our patient s dermoid was composed of sequestered conjunctival tissue and not typical epidermal tissue . a literature search for dermoid choristoma , conjunctival dermoid , and the main distinction between these two dermoid types depends on the presence or absence of two elements : keratin and goblet cells . conjunctival dermoids have goblet cells interspersed amongst non - keratinized stratified squamous cells . in contrast , epidermal dermoids are composed of keratin producing stratified squamous cells without any goblet cells . while initially , this seems like a rather small distinction , there are a few salient features worth noting . conjunctival dermoids are rare tumors with martinez et al finding only 14 cases in the literature in 1998.5 we found no other cases in the literature since then and this case is the first described one presenting with externalized hair follicles in the conjunctival fornix . the largest case series published in the literature involved 7 cases over a 50-year period . jekobiec et al reviewed all dermoid cysts at their institution from 1929 to 1977 and reanalyzed the corresponding pathology slides to confirm or refute the original diagnosis.1 twelve of the 128 cases were given a new diagnosis because they had a non - keratinized cyst lining with conjunctival elements . of these 12 , five were determined as cysts and the other seven were classified as dermoids ; the distinction between the two depended on the presence or absence of adnexal structures . these seven conjunctival dermoids were noted to be unique in that they presented in a different location ( superonasal vs. superotemporal ) compared to epidermal dermoids , and did not cause adjacent bony defects on radiography . the authors also mentioned how easily these tumors were removed because they had no surrounding attachments . similarly , our patient s surgery was relatively simple and she enjoyed an excellent result . orbital and corneal limbal dermoids are made of keratin producing epithelial cells , with the former causing bony erosion , and both are much more difficult to remove as compared to our experience and that of jekobiec et al.6 understanding the distinction between the two types of dermoids can be important for both pre - operative surgical planning and patient counseling . in conclusion , mature hair follicle growth from the conjunctiva is another possible presentation of a conjunctival dermoid that can easily be cured by simple excision . | purposeto describe a previously unreported presentation of a conjunctival dermoid.case reportan 8-year - old girl presented with a progressively enlarging mass in the right conjunctival fornix composed of normal appearing eyelashes .
the patient had a history of aberrant conjunctival eyelash growth that had caused recurrent conjunctivitis in her right eye over the past few years .
the mass was surgically removed and the pathology report revealed it to be a conjunctival dermoid .
the patient had an excellent surgical result with normal cosmetic appearance.conclusionmature hair follicle growth from the conjunctiva is another possible presentation of a conjunctival dermoid that can be cured by simple surgical excision . |
lynch syndrome ( also known as hereditary nonpolyposis colorectal cancer [ hnpcc ] ) results from mutations in mismatch repair genes ( mlh1 , msh2 , msh6 , or pms2 ) and is associated with a variety of extra - colonic sites , like endometrium , stomach , ovaries , urinary tract and kidneys , biliary tract , pancreas , small intestine , brain and skin.1 endometrial cancer is the most common malignant disorder observed after hnpcc . considering that lynch syndrome is an autosomal - dominant inherited cancer syndrome , identifying a family history using genetic counseling can lead to further tests based on the current guidelines ( revised amsterdam2 or bethesda3 criteria ) . and identification of individuals who have increased risk of occurring hereditary cancers would enable screening and early detection of cancer , which may reduce disease - specific mortality . recording a patient 's family history is the first step in the work - up of lynch syndrome patients . however , recording an accurate family history is often neglected or inconsistent.4,5 it can be challenging to advise patients to proceed with additional testing when they do not have a family history of cancer . screening for colorectal cancer in hnpcc has been proven to improve survival and the cost - effectiveness of treatments , but the benefits of screening for gynecological cancers in lynch syndrome patients have not yet been proven . additionally , there is no consensus regarding the optimal screening tests to perform based on country or patient ethnicity . here , we present a case of endometrial cancer in a lynch syndrome patient that did not have a family history of cancer . a 55-year - old korean woman was admitted to a local clinic for vaginal bleeding . an endometrial biopsy revealed the presence of adenocarcinoma ( endometrioid type , grade 1 ) . the patient received pelvic magnetic resonance imaging , computed tomography scan , and other diagnostic tests . the patient had a cancer antigen 125 ( ca 125 ) level of 9.06 u / ml and no other abnormal masses were visible in imaging tests . complete surgical staging including total hysterectomy , bilateral salpingo - oophorectomy , washing cytology , and pelvic lymph node dissection was performed . the operation was concluded after confirming a frozen biopsy of the pelvic lymph node was not cancerous . although this patient had no family history of cancer ( her three sisters and parents were alive without any cancer diagnoses at the time of counseling ) , screening immunohistochemistry ( ihc ; mlh1 , msh2 ) was performed due to the genetic risk of lynch syndrome . the results indicated that mlh1 was positive in 90% f the sample and msh2 was negative ( fig . 1 ) . the tissue pathology reported the tumor stage was ia and adjuvant treatment was not recommended . according to diagnostic algorithms and after genetic counseling , microsatellite instability ( msi ) and gene sequencing were performed . msi was analyzed for five markers ( bat25 , bat26 , d2s123 , d5s346 , and d17s250 ) . the results indicate there were two unstable markers ( bat25 and bat26 ) , and the patient was scored msi - high ( unstable ) . further gene sequencing analyses revealed one missense mutation ( c.23c > t [ p.thr8met ] ) ( fig . this case demonstrates that lynch syndrome - related cancer can occur in a patient despite the lack of any family history . this is the first case report of an endometrial cancer patient with a lynch syndrome germline mutation without family history in korea . the risk of developing a second cancer is approximately 25% after 10 years and 50% after 15 years following the initial diagnosis of lynch syndrome.6 therefore , the patient and her family were offered cancer screening and genetic counseling . approximately 2% to 5% of endometrial cancers may be caused by an inherited susceptibility.7 in lynch syndrome carriers , the lifetime risk of endometrial cancer has been estimated to be 42 to 54% , and may equal or exceed the risk of colorectal cancer.8 lynch syndrome is caused by a germline mutation in one of the dna mismatch repair genes ( mlh1 , msh2 , msh6 , and pms2 ) , and accounts for the majority of inherited cases.7 in younger patients , the incidence of endometrial cancer increases to 9% and better survival rates.9,10 information on family history is important for identifying individuals that could benefit from genetic counseling and predictive genetic testing after counseling and describing the risk and benefits obtained from these results , further confirmative tests for detection of a pathogenic mutation in one of the dna mismatch repair genes were performed with the patient 's permission . with the advances in molecular biology now available for the diagnosis of genetic cancers , clinicians can help prevent these cancers by counseling patients and prescribing adequate and appropriate tests . in known mutation carriers without any colorectal adenomas , screening colonoscopy appears to be the most reasonable choice.11 however , prophylactic subtotal colectomy remains an option for patients who have significant anxiety about cancer risk or concern about the safety of repeated colonoscopies . additionally , colectomy can be used if the patient is unable to receive periodic surveillance colonoscopies.12 more information is required to determine the appropriate genetic tests for counseling and prevention according to the country and ethnicity of the patient . it is also important to identify patients with lynch syndrome because families of mutation carriers may benefit from genetic counseling , testing , and intensified cancer surveillance . in conclusion , gynecological oncologists should provide information of the genetic cancer risk to endometrial cancer patients in an effort to prevent second cancers in patients and family with lynch syndrome . patients should undergo the correct genetic tests and should be counseled appropriately , which is important for reducing cancer mortality and costs . | lynch syndrome is a genetic malignancy syndrome affecting the colon , endometrium , and other organs .
it is difficult to find a lynch syndrome patient without any family history of cancer .
we have recently examined an endometrial cancer patient with a msh2 gene mutation without a family history of cancer .
a 55-year old korean woman was admitted to a local clinic for vaginal bleeding .
an endometrial biopsy revealed the presence of adenocarcinoma ( endometrioid type , grade 1 ) .
after surgical staging , no further adjuvant therapy was required .
analysis of the tissue using immunohistochemistry ( ihc ) showed the endometrium stained negatively for msh2 .
microsatellite instability ( msi ) was analyzed for five markers .
the patient was scored as unstable .
further , additional gene sequencing revealed one missense mutation in c.23c > t ( p.thr8met ) .
this is the first case of lynch syndrome endometrial cancer in korea in which the patient does not have any family history of cancer . |
a 16-year - old boy visited to our neurology clinic with a 12-month history of a clicking noise in the both ears and palatal discomfort . the clicking resembled the sound of snapping fingernails and was externally audible at a distance of 50 cm . he denied any voluntary control over this movement as well as any sensation of urge before the movement . he complained of throat fullness in daytime . on neurologic and otolaryngologic examination , rhythmic contraction of whole soft palate muscles the movement was able to be suppressed for a few seconds by touching the back of his neck , but it could soon return after the voluntary suppression . in addition , the entrainment at each slow and fast finger tapping with external pace was found ( video ) . needle electromyography ( emg ) of tvp muscle showed rhythmic contractions with a frequency of 2.6 hz with amplitude of 150 v ( figure 1 ) . there were no abnormal results in other laboratory , audiologic tests , and brain magnetic resonance imaging . after diagnosis of ept , despite of medications including benzodiazepines , muscle relaxants , and anticonvulsants for 1 month , his symptoms were not changed at all . therefore , we started to inject 15 units of bta ( botox , allergan , inc . , though the success of the first bta therapy was lasted about 10 weeks , the additional injections of bta were needed for 3 times due to recurrence . the dosage of bta was finally elevated to 20 units and there were 4 times injection of bta at interval of 3 months , but the presenting symptoms showed again . his involuntary movements were clinically closed to ept because of ear click perceived as objective tinnitus , bilateral involvement , no brain lesions and involvement of tvp muscle by emg . although no single clinical finding is pathognomonic for pmds , several features are quite helpful.10 in general , pmds are characterized by distractibility , entrainment , coactivation sign , variable frequency , amplitude and direction , increase with attention , and poor response to medications.8,11 this patient also showed entrainment of soft palate muscle contraction to external paced finger tapping . furthermore , pmds have particular histories including precipitating factor or trivial trauma preceding acute onset , emotional trigger , psychological stressors and psychiatric comorbidities such as anxiety disorders.8 in this patient , mild trauma ( e.g .. voice abuse ) before onset suggest to psychogenic type of ept rather than primary type . in our case , the only difference from usual psychogenic pt is that this abnormal movement was not well responded to treatment . psychogenic pt is usually reported to have good response to non - physiological treatment or placebo.8 in summary , bilateral objective tinnitus , bilateral tvp muscles involvement , mild trauma before onset , and entrainment of soft palate contraction suggest a psychogenic ept . | essential palatal tremor ( ept ) is a rare disorder which shows rhythmic involuntary movement of the muscles of soft palate , especially tensor veli palatini muscle .
ept is classified by two subtypes , which is primary and secondary ept .
secondary ept includes psychogenic type .
we describe a case of intractable psychogenic ept . |
desmoplastic fibroma of bone is a rare locally aggressive but non - metastatic tumor which was first described by jaffe in 1958 ( 1 ) . the most commonly involved site is the mandible , followed by the femur and pelvis . in this case report bone tumors of the clavicle are rare , especially desmoplastic fibromas involving the clavicle are extremely rare , with only 2 cases reported in the literature before 1985 ( 2 ) . we present here this unusual tumor with radiologic findings from conventional radiography , magnetic resonance imaging ( mri ) and histopathology . a 28-year - old man , with a history of sudden right shoulder pain during forceful flexion of his upper arm visited our hospital complaining of tenderness , resting pain , and limitation of range of motion due to pain . initial work - up with plain radiograph demonstrated an oval shaped osteolytic lesion on the medial one - third of the right clavicle with pathologic fracture ( fig . the lesion showed hypointense to isointense signal compared to its adjacent muscle on t1-weighted images , and hypointense to isointense signal on t2-weighted images . the mass showed a expansile bulging contour with endosteal erosion and periosteal reaction with enhancement . the aggressiveness of the tumor could not be evaluated easily due to the combined fracture . our initial impression was benign primary bone tumor with low aggressiveness rather than malignant tumor . histologically , the tumor was generally hypocellular to moderately cellular and composed of bland fibroblasts in a background of numerous thick and wavy collagen fibers . multiple sections of the tumor presented no evidence of cellular pleomorphism , changes in the nuclear cytoplasmic ratio , nuclear hyperchromasia , or mitotic activity . despite its bland appearance , the tumor showed multifocal soft tissue extension ( fig . thus , the tumor was diagnosed as a desmoplastic fibroma of bone , which is considered as an intraosseous counterpart of soft tissue desmoids . finally , a wide resection including the lesion and adjacent tissues was done with an allogenous fibular bone graft and an autogenous corticocancellous iliac bone graft . desmoplastic fibroma is a rare benign primary bone tumor , which histologically similar to the soft tissue desmoid tumor . the incidence of desmoplastic fibroma is reported to comprise 0.1 - 0.3% of all primary bone tumors . the mandible ( 22% ) , pelvic bones ( 13% ) and long bones such as the femur ( 15% ) , radius ( 12% ) , tibia ( 9% ) are known as the most frequent sites of involvement ( 2 , 3 ) . on the other hand , furthermore , the majority of tumors , such as myeloma , osteosarcoma , and ewing 's sarcoma , are malignant ( 4 , 5 ) . therefore , desmoplastic fibromas involving the clavicle are extremely rare , with only 2 cases reported in the literature before 1985 ( 2 ) . pathologic fractures are reported in 9 - 15% of cases ( 6 - 8 ) . in the literature , the most consistent radiographic findings are well defined non - sclerotic marginated geographic lesions ( 94% ) , with internal pseudotrabeculation ( 91% ) and bone expansion ( 89% ) ( 7 , 8) . on mr imaging , histologically fibrous tissues are expected to show t2 shortening , and the majority of reported cases have shown hypointense or isointense signal on t1-weighted images , compared to the adjacent muscle , as well as hypointense or isointense signal on t2-weighted images . after intravenous gadolinium contrast administration , the mass shows a heterogeneous enhancement pattern , and these enhancement patterns seem to reflect the variable composition of the cellular part and collagenous matrix ( 9 , 10 ) . in our case , the mass showed hypointense to isointense signal on both t1 and t2 weighted images with a heterogeneous enhancement pattern , and showed enhancement of the adjacent bone marrow and periosteal soft tissue beyond the cortex . on plain radiograph , this well - defined non - sclerotic marginated geographic lesion can not be differentiated easily from various benign and malignant tumors . however , on mri , radiologic features of a predominantly osteolytic lesion with prominent t2 shortening makes the diagnosis of demoplastic fibroma plausible ( 9 ) . this t2 shortening is a differential feature from common clavicle tumors such as myeloma , osteosarcoma , and ewing 's sarcoma . but , some rare clavicle tumors such as non - ossifying fibroma , fibrous dysplasia , giant cell tumor , low - grade fibrosarcoma , and malignant fibrous histiocytoma also could show t2 shortening , so they needed to be included in differential diagnosis . generally , non - ossifying fibroma and giant cell tumor show hyperintense signal on t2-weighted image . low - grade fibrosarcoma and malignant fibrous histiocytoma mostly show ill - defined border and soft tissue extension . in summary , we report a desmoplastic fibroma of the clavicle presented with pathologic fracture . desmoplastic fibroma should be considered in the differential diagnosis of a locally aggressive lesion with hypointense signal on t2-weighted images , although its involvement of the clavicle is very rare . | desmoplastic fibroma of bone is a rare locally aggressive , but non - metastatic tumor . in this case report
, we present a desmoplastic fibroma in an unusual location , the clavicle .
desmoplastic fibroma involving the clavicle is extremely rare , with only 2 reported cases before 1985 .
we report the imaging findings of a desmoplastic fibroma of the clavicle with a review of the relevant literature . |
a first experiment which was fundamental , described in 1973 , discusses the immune response to various antigens of an asterid : asterina gibbosa . it indicated ( leclerc , 1973 ) , more exactly , the specific immunocytochemical response to hrp ( horse - radish peroxydase ) of the sea star . the general idea that emerged from the experiments made in our laboratories was that echinodermata ( leclerc and brillouet , 1981 , delmotte et al . , 1986 , leclerc , 2012 ) , as exemplified by sea stars ( asterina gibbosa and asterias rubens ) , possessed an immune system able to mount cellular and humoral - specific responses after stimulation with a foreign antigen . in 2011 sea star antibody was shown to correlate to ig kappa genes ( leclerc et al . , 2011 ) and in 2013 a true candidate ig kappa gene was found ( leclerc et al . , 2013 ) . we report the sequence and deduced amino - acid composition of the sea star ig kappa gene . we used the experimental protocol concerning the smart kit pcr cdna synthesis ( clontech ) on the candidate gene cdna sequence ( leclerc et al . , 5cagtcattaaaaggacatgataatttcggaccgggtctttaatattacaatgactgctgctatgcgtggc aacatggcgtctctatggatgttcttctttgtcgtggggataactttacaacggagtttggcgatttaca cgtttcgcgagcaaccgtcggacactagcgcgttgcaggggagcacagtggtgcttcactgctccgttga gcagtacataaacaccacggccatcgtttggtggagccgtgactcggtcatcagccacaacaaagacctg aaactgtccagtctaaacaccgaccagctccaaaggtactcgatttcaggcgacgcatctcggggggaat tcaaccttagaatagtgaactttaccgccacagacgccgccagttaccgctgtcagatgtttgcg3 we purified the polya fraction , according a specific kit and generated the c dna with an oligodt . a non - specific amplification was performed and followed by a specific one with an oligo 956 forward ( 53 ) 5-cagattcagaaacacatgtatttcc-3 and then an oligo 957 reverse ( 53 ) 5-tttagcatggcatgtaaagacacc-3 , always requested for this experiment ( clontech ) . the pcr products showed , in agarose gel , many bands for the negative control , and one band ( 400 bp ) for the specific pcr . the results show that the revealed gene , after sequencing , shows only little gene described in the previous paper ( leclerc et al . , 2013 ) it is enough to decipher this gene to realize it ; here is the sequence as shown in fig . 1 . based on sander 's review ( sander and schneider , 1991 ) , we propose that this gene relates to immunoglobulins as it contains 2 typical cysteines of the domains of ig , without being able to assert , at the moment , if it is about a heavy or light chain of immunoglobulins . a single indication ( delmotte et al . , 1986 ) favors the light chain due to the observed molecular weight ( 30,000 da : delmotte et al . another antigen such as hapten ( leclerc and brillouet , 1981 ) could produce another type of antibody currently , we do n't know , at the moment , if there are several types of antibody in the sea star a. rubens . what we are sure , on the other hand ( because there is a gene ( the sea star ig kappa ) ) , the function of which is the one of the defenses of the sea star against the immunopathogenicity attacks ; the hrp , in the present case . in terms of amino - acid , our gene could present 118 amino - acids as shown in fig . this is slightly smaller than the true ig kappa region v - iv s107b which is reported to be 129 amino - acids found in mammals . in conclusion , this antibody gene of sea star calls back the mouse ig kappa region v - iv s107b precursor gene but is different from it by the number of amino - acids ( 118 instead of 129 aa ) . our data contributes to knowledge the molecular and genetic bases of non - self recognition by invertebrates which will allow further comprehension of the evolution of mhc antigens and immunoglobulins . | the sea star asterias rubens reacts specifically to the antigen : hrp ( horse - radish peroxydase ) and produces an antibody anti - hrp .
we previously identified a candidate ig kappa gene corresponding to this manuscript .
we show now the gene referred to as : sea star ig kappa gene in its specificity . |
a 42-year - old man , who had complained of seizure and headache , was admitted to another hospital , where angiography and ct revealed an avm in the left occipital lobe , with hematoma ( fig . preembolic cerebral angiography revealed a left - sided occipital avm fed by the left posterior parietal artery and branches of the left posterior cerebral artery ( fig . after local anesthesia , a 6-fr guiding catheter was positioned in the high cervical internal carotid artery using the femoral approach and the seldinger method . to prevent systemic coagulation , 5000 units of heparin was used , and to ensure that the anticoagulative effect was adequate , an activated clotting time of greater than 300 seconds was employed . throughout the procedure , all catheters were continuously flushed with saline . using a flow - directed 1.8-fr magic catheter ( balt , montmorency , france ) and a hydrophilic terumo 0.010 wire ( terumo , tokyo , japan ) , selective catheterization was performed . the tip of the magic catheter was j - shaped , with steaming , and initial embolization was attempted via the left posterior parietal artery ; for assessment of this vessel , a 1.8-fr magic catheter combined with a terumo 0.010 wire was employed . using a mixture of 1 ml of histoacryl and 3 ml of lipiodol , embolization was successfully performed . guided by a terumo 0.010 wire , a 1.8-fr magic microcatheter was advanced by flow control through the left vertebral artery into a branch of the posterior cerebral artery . the wire did not extend beyond the tip of the catheter , as commonly occurs in the standard microcatheter / wire system , and the microcatheter was subsequently advanced into a turn approximately 1.5 cm from the nidus , at which point it failed to progress . at this juncture , a lateral injection demonstrated no evidence of extravasation , but an anteroposterior injection revealed the extravasation of contrast medium at the point at which the parieto - occipital branch changed direction , at the a site of the microcatheter tip , approximately 1.5 cm from the nidus ( fig . the position of the magic microcatheter was not changed and angiography was again performed ; this time neither occlusion of the parieto - occipital branch nor contrast medium extravasation at the rupture site was seen . we believe that arterial rupture had occurred at the point at which the parieto - occipital branch turned sharply , approximately 1.5 cm from the nidus . because no changes had been made to the microcatheter or position of the wire , the reason for perforation was thought to be over - injection rather than catheter wedging . the tip of the magic catheter was located extravascularly , so in order to occlude the site of arterial rupture , the distal portion of the microcatheter was positioned at the perforation site . the extravascular compartment were sealed with a small amount of a 40% mixture of histoacryl and lipiodol , injected through the same magic catheter ( fig . control vertebral angiography revealed occlusion of the perforation site , with subtle narrowing at the point at which the parieto - occipital branch changed direction . this vessel was reselected and the feeder , including the sealed perforation site , was occluded . the remaining feeders of the posterior cerebral artery were occluded with a 25% mixture of histoacryl and lipiodol . control angiography of the vertebral artery after embolization revealed complete anatomic cure of the avm . after embolization and surgery , two days later , the patient no longer complained of neurologic symptoms or headache . although several reports have dealt with the vascular perforation that can occur during neurointerventional procedures , none has -to our knowledge- described vessel perforation by a flow - directed microcatheter itself and management of the perforation using this same microcatheter . the outcome of vascular perforation has ranged from asymptomatic to massive hemorrhage and death ( 2 , 3 ) . rupture of a vessel is usually related to guidewire manipulation and the use of steerable microcatheters such as the tracker catheter ( 2 , 3 ) . for the embolization of brain avms , the variable , stiff , guidewire - guided microcatheter has thus been gradually replaced by the very floppy , flow - directed catheter ( 4 ) . since january 1996 , we have used the hydrophilic terumo 0.010 wire in conjunction with the 1.8-fr magic microcatheter for superselective catheterization of the nidus of avms . the wire does not extend beyond the catheter tip , as is commonly seen in standard microcatheter / wire systems . endovascular embolization using flow - directed microcatheters has undergone considerable technical evolution in recent years , and during avm - related procedures , periembolic complications are now less frequent than before . even so , during endovascular embolization using flow - directed microcatheters , perforation of a vessel may occur at vessel angulations or in associated aneurysms -whether congenital , flow - related feeder , or intranidal -due to the fact that the wire is stiffer than the microcatheter ( 5 ) . the mechanisms involved in arterial perforation during neurointerventional procedures have been described in several reports ( 2 , 6 ) and fall into three groups : mechanical perforation of a normal vessel , mechanical disruption of a dysplastic vessel or aneurysm , and fluid overinjection ( 2 ) . we consider that in our case , perforation occurred due to the overinjection of contrast medium at a sharp angulation . the management of arterial rupture occurring during embolization has included surgical closure of the perforation , closure with various embolic materials , or conservative management(2 ) . we believe that the most expeditious treatment is occlusion of the perforation by embolization via the offending catheter . despite new developments in the field of flow - directed microcatheters and associated techniques , prompt recognition and closure of the perforation site by embolization via the offending catheter are essential . | we present a case in which an arterial rupture occurring during embolization of an arteriovenous malformation of the left occipital lobe with a flow - directed microcatheter , was successfully sealed with a small amount of glue .
we navigated a 1.8-fr magic catheter through the posterior cerebral artery , and during superselective test injection , extravasation was observed at the parieto - occipital branch .
the catheter was not removed and the perforation site was successfully sealed with a small amount of glue injected through the same catheter .
prompt recognition and closure of the perforation site is essential for good prognosis . |
a 53-year - old indian male employed in dubai , uae presented
with a sudden onset of foreign body sensation in his left eye while
at work for which he used an eyewash from the first - aid kit . this
was followed by an acute bout of pain , redness and watering which
was attributed to the eyewash being past the expiry date . the
patient was referred by the treating emergency physician with
a suspected bleb and to rule out chemical conjunctivitis . the patient
did have a history of longstanding generalized episodic itching
over six to nine months with localized subcutaneous swelling
lasting for a few seconds to five minutes and affecting the hands ,
chest and neck . slit - lamp examination revealed conjunctival chemosis with
a live worm in the subconjunctival space adjacent to the nasal
limbus , responding to light and to gentle pressure over the
conjunctiva with a cotton swab . the head end was coiled up at the
nasal limbus at the 9 oclock meridian [ fig . 1 ] while the tail end
was coiled up at the temporal limbus at the 3 oclock meridian
giving the appearance of two separate worms . a nick
was made in the conjunctiva and the live worm was removed in
toto using a blunt forceps [ fig . 2 ] . histopathological examination carried out
elsewhere at an overseas parasitology laboratory reported an
adult female dirofilaria repens [ fig . 3 ] . complete blood picture and erythrocyte sedimentation
rate ( esr ) were within normal limits with no evidence of
eosinophilia . symptoms resolved promptly following surgical removal with
no ocular or systemic recurrences over a follow - up of one year . the
worms may be subcutaneous as dirofilaria repens or may be
deep - seated as dirofilaria imitis which frequently results in
pulmonary dirofilariasis . dirofilaria repens is a natural parasite
of carnivorous animals , primarily dogs , foxes and cats . dirofilariasis is often reported from european countries
surrounding the mediterranean region . a review of world
literature14,15 reports over 780 documented cases in
diverse geographical locations with italy , sri lanka and some countries
of the former soviet union being the most affected areas . dirofilariasis has been reported to be associated with travel
to foreign lands.2,3 a history of
migratory swellings and travel to endemic areas should arouse the suspicion of its possible
diagnosis.16 in india , dirofilariasis is predominantly reported
in published literature in southern india with reports from
kerala,17 karnataka10 and tamil nadu.11 being an inhabitant
of kerala and working in dubai , in this patient it is unclear if
he contracted the infection from his bi - annual visits back to
his home country , through the frequently imported african
machinery as a part of his occupation or locally in dubai itself
which is not a known endemic area . migratory subcutaneous dirofilariasis2 has been frequently
reported , however , simultaneous ocular involvement has
not been documented . while it has not been clinically
documented , this patient did have a past history suggestive
of a subcutaneous involvement six to nine months prior to the
ocular manifestations . surgical removal of the worm is curative18 - 20 and a
technically simple procedure . we were able to carry out this procedure
uneventfully in an outpatient setting minor procedure room
under topical anesthesia with lignocaine . identification was done using standard histopathological
methods by diagnostic evaluation of microscopic cross - sections
and macroscopic characteristics of the worm . dirofilarial worms
are identified by their thick laminated cuticle , broad lateral
chords and large muscle cells . direct polymerase
chain reaction ( pcr ) protocols may aid in identification in
instances of tissue degeneration or poor specimen preservation
practices and may have a clinical application as a routine
diagnostic aid.21 in conclusion , we report the first incidence of a live
subconjunctival dirofilariasis in the arabian peninsula .
surgical removal and management along previously described
guidelines led to satisfactory resolution of symptoms with a
good clinical outcome . | a rare occurrence of ocular subconjunctival dirofilariasis in a
53-year - old healthy indian male working in dubai , uae presenting
with an acute red eye is reported .
surgical excision under topical
anesthesia was carried out uneventfully in the outpatient clinic . the
live worm removed from the subconjunctival space
was identified
as dirofilaria repens on the basis of microscopic examination and
histopathology .
surgical excision of subconjunctival dirofilariasis
is safe in an outpatient setting and curative precluding the need
for further systemic antihelminthics . |
a 74-year - old woman presented to the pain clinic with a history of chronic left sided sciatic pain that also restricted her mobility . she had been treated with nonsteroidal antiinflammatory drugs , pregabalin , tramadol , and acetaminophen without much relief . in addition this slim pleasant lady had limited left leg raising with tenderness in her lower back . after the death of her husband the routine laboratory results ( blood cell count , urea and electrolytes , and clotting studies ) were within normal limits . in the clinic , after discussion with the patient , we decided to perform lesi the next week , and duloxetine 60 mg / day was prescribed . taking full aseptic precautions , the correct placement of the epidural needle was confirmed by an epidurogram with the radio - contrast ( omnipaque ) , after which 10 ml of 0.9% normal saline ( ns ) containing 80 mg methyl prednisolone was injected into the epidural space . after the procedure , she was observed in the recovery room for an hour and then discharged home and advised to continue her medication and return to the pain clinic after 4 weeks . three days after the lesi , she was contacted on the phone to inquire about her wellbeing , and she reported some reduction in pain and was able to sleep . three days later , she came to the hospital in the morning , with a 24 hour history of severe headache and being unable to sleep despite extra doses of acetaminophen . along with the headache , she also complained of persistent nausea and one episode of vomiting . the headache was continuous , not throbbing in nature , felt over her occiput , both temples , vertex , and forehead and not associated with neck pain or stiffness . the pain was relieved a bit in the sitting position . with a normal body temperature , she was alert , well orientated , a bit restless with no neurological deficit on examination . except for some puffiness around her eyes , her clinical examination was normal and she appeared to be euvolemic . her blood tests revealed severe hyponatremia ( sodium 112 mmol / l , normal range : 135 - 145 mmol / l ) with low serum osmolality of 248 mosmol / kg ( normal range 280 - 295 ) . the remaining electrolytes , urea , creatinine , and blood counts were within normal limits , and her urine osmolality was 328 mosmol / kg . she was diagnosed to have duloxetine induced syndrome of inappropriate antidiuretic hormone secretion ( siadh ) causing severe hyponatremia ( figure 1 ) . her treatment started with intravenous ( iv ) acetaminophen 1 gm and granisetron 1 mg and iv infusion of 3% hypertonic saline commenced at the rate of 50 ml / hour . eight hours later , her headache was still bad but the nausea improved , and serum sodium improved to 118 mmol / l . she then received codeine 30 mg intramuscular along with a second 1 gm dose of iv acetaminophen . eighteen hours after her hospital admission , the serum sodium further improved to 122 mmol / l . she had a bowl of soup , she took her daily medications except duloxetine and slept for another few hours . the next morning , 30 hours after her admission , she described her headache as heaviness instead of pain . with a serum sodium of 128 mmol / l , she was kept under observations for another 36 hours , when her headache completely resolved , and with serum sodium at 130 mmol / l , she was discharged home . headache is high on the list of almost all informed consents taken for epidural injection.1 the most common cause of headache after epidural injection is an inadvertent dural puncture . this headache , also called post dural puncture headache ( pdph ) is due to csf leakage , and low intracranial pressure . this typically presents as a postural headache that is aggravated in the sitting and standing position and relieved by lying down . a pdph may occur up to 5 days after the procedure is performed.2 any atypical headache after an epidural procedure should be taken seriously and its cause should be identified ( table 1 ) . clinically , this headache did not mimic headaches that develop as a complication of the epidural injection , such as pdph or meningitis . the probable diagnosis of siadh was based on euvolemia , hyponatremia with low serum and high urine osmolality , and duloxetine appeared to be the most likely cause of siadh in our patient . duloxetine is a serotonin - norepinephrine reuptake inhibitor ( snri ) , which was introduced a decade ago in north america for the treatment of major psychiatric disorders.3 later its indications expanded to include various painful conditions such as neuropathic pain and fibromyalgia.3 maramattom in 20064 reported the first case of duloxetine induced siadh in a woman , where the drug was used as an antidepressant . thereafter many cases of duloxetine induced siadh have been reported in the literature.5 - 8 though hyponatremia is a rare side effect of duloxetine , elderly females with a low body weight appear to be more susceptible.7 duloxetine is a relatively new drug in the management of chronic pain , and appears to be a cost - effective post - first - line treatment for chronic low back pain.9 worldwide , the use of snri has increasingly become common in chronic pain patients , especially in patients with diabetes with painful neuropathy and sciatica . because of the risk of developing siadh , it would be advisable to monitor serum sodium in patients who are taking snris . fortunately , our patient , apart from headache and nausea did not have any other cns symptoms ( lethargy , disorientation , convulsion , coma ) . the siadh can cause brain edema , an increase in intra cranial pressure , and may lead to brain stem herniation.10 there was clinical suspicion of raised intracranial pressure in our patient , because of pain relief in the sitting position and as the headache was associated with nausea and vomiting , we decided not to perform a diagnostic lumbar puncture . symptomatic hyponatremia is a medical emergency and we started its treatment immediately with 3% hypertonic saline with a goal of slowly raising the serum sodium concentration , not more than 5 rapid correction of hyponatremia may seriously harm the patient by causing demyelination of neurons . in conclusion , our case is that of post epidural injection headache not caused by the epidural procedure per se , but coincidently caused by a duloxetine induced hyponatremia . case reports will only be considered for unusual topics that add something new to the literature . written informed consent for publication must accompany any photograph in which the subject can be identified . figures should be submitted with a 300 dpi resolution when submitting electronically or printed on high - contrast glossy paper when submitting print copies . the abstract should be unstructured , and the introductory section should always include the objective and reason why the author is presenting this particular case . | headache is a potential complication of epidural injection .
we report a patient who developed headache 5 days after a lumbar epidural steroid injection , which was not related to the epidural procedure , but caused by duloxetine induced hyponatremia .
antidepressant drug induced headache should be considered in the differential diagnosis of post dural puncture headache . |
a 15-year - old boy diagnosed as intracranial germ cell tumor underwent surgery , followed by cranial radiotherapy ( 45 gy ) and later treated with bleomycin , etoposide and cisplatin(bep ) regimen . after third cycle of chemotherapy , he developed asymptomatic erythematous rashes over the back , chest and thighs , which later subsided with persistence of hyperpigmentation [ figure 1 ] . hyperpigmentation of flagellate erythematous rash over the back and thigh bleomycin is a chemotherapeutic antibiotic associated with various skin related toxicities such as raynaud 's phenomenon , flagellate erythema , and sclerodermoid reaction . in the acute stage they are erythematous rashes later may persist as hyperpigmentation marks . other conditions which may be associated with flagellate erythema are docetaxel , adult still 's disease , dermatomyositis and ingestion of shiitake mushrooms . during the acute phase , topical with or without oral steroids | bleomycin is a chemotherapeutic antibiotic used in various malignancies .
its toxicity is mainly lung and skin with marrow sparing effect .
here we would like to describe a characteristic skin reaction developed because of bleomycin in a case of intracranial germ cell tumor .
flagellate erythema which is a self - limiting toxic reaction can cause residual hyperpigmentation . |
fusion is defined as union between the dentine and/or enamel of two or more separate developing teeth . it can be complete with the formation of one abnormally large tooth or incomplete , with the fusion of crown or fusion of roots only . the prevalence of this anomaly is estimated as 0.5 - 2.5% in the primary dentition with a lower prevalence in the permanent dentition . fusion of primary teeth can appear in several ways , usually involving two teeth , but occasionally three . primary triple teeth suggest an idiopathic abnormality in the distribution of the dental material originated very early in the dental development . it can be an early double fusion between three tooth germs , initially separate , but enclose proximity and developing synchronically . rarely supernumerary teeth may be fused to normal teeth in the arch , usually by medial or lateral fusion . supernumerary teeth are seen in frequently in the primary dentition with the prevalence rate of 0.2 - 0.8% . problem associated with fused teeth includes esthetics , caries , periodontal disease , malocclusion , delayed exfoliation ; impaction of their successor , other developmental and functional problems . this article reports the case of unusual fusion of three teeth in a 10-year - old boy involving one supernumerary , maxillary right deciduous central and lateral incisor . a 10-year - old boy reported to the dental clinic with the chief complaint of large tooth in the maxillary anterior region of the jaw . no other member of the family was affected with similar dental anomaly and patient was mentally challenged . intraoral examination revealed that the patient was in mixed dentition phase along with fusion of the maxillary right primary central incisor and primary lateral incisor with an additional ( supernumerary ) tooth [ figure 1 ] . the child 's dentition revealed angle 's class 1 molar relation on both right and left side . maxillary right permanent central incisor was erupted , but it was in cross - bite relationship . clinical examination revealed missing right permanent lateral incisor and there was no history of previous extraction , of this tooth . further investigation included intraoral periapical radiograph of maxillary anterior region [ figure 2 ] . based on clinical and radiographical findings pre - operative intraoral photograph pre - operative intraoral maxillary occlusal view depicting triple fusion the treatment plan was aimed at removal of fused teeth . under sedation , macroscopically , root resorption was evident on apical portion of maxillary right primary lateral incisor . for histological examination , the extracted teeth were sectioned at three levels : the coronal , middle root and apical levels , respectively . histological view of the coronal section revealed three teeth fused with each other with confluent dentin without intervening cementum and with separate pulp chambers [ figure 4 ] . the middle - third of the roots of three fused teeth also showed confluent dentin without intervening cementum [ figure 5 ] . the apical third of fused teeth showed merging of root canals of the fused teeth [ figure 6 ] . extracted fused teeth coronal section of fused teeth showing confluent dentin without intervening cementum and with separate pulp chambers middle - third of the roots of three fused teeth also showed confluent dentin without intervening cementum the apical third showing merging of root canals of the fused teeth further treatment plan involved thorough oral prophylaxis and correction of anterior cross- bite . after oral prophylaxis and pit and fissure sealant application , a removable hawley 's appliance with z - spring was fabricated for the correction of the anterior tooth cross - bite , but as patient was mentally challenged , cooperation from him was poor as the child was not ready to wear the appliance . again catalan 's appliance was made and cemented on the lower incisors , but the attempt for the correction of cross- bite failed because of insufficient compliance of the patient as he was not occluding his teeth . triple fusion is rarely encountered dental anomaly and is thought to be caused by pressure or force during development of adjacent roots . if the fusion begins before calcification , then the union will involve all components of the tooth , including enamel , dentin , cementum and pulp . if the union begins at later stage of tooth development , then the affected teeth may have separate crowns and fusion may be limited to the roots . it can occur between normal teeth or between normal and supernumerary teeth . in the present case , fusion was seen between maxillary right primary incisors and supernumerary teeth and teeth were incompletely fused involving dentin in coronal , middle and apical portion of the teeth with separate pulp canals . the anomalies of the permanent dentition are strongly associated with anomalies in the primary dentition . the most common problem related to fused teeth is hypodontia of the permanent dentition . in the present case , the maxillary permanent lateral incisor on the affected side was missing . fused teeth can also cause delayed resorption of roots , which may lead to delayed or ectopice ruption of permanent successor . in the present case , fused teeth showed minimal resorption of primary lateral incisor at the apical portion of the root . esthetics of the child is usually the determining factor regarding the decision to retain or extract these teeth depending on the dentition stage either it is deciduous / mixed or permanent dentition stage . in the present case , we decided to extract the fused teeth under conscious sedation since the permanent central incisor of that side was already erupted . as in this case , the child is mentally challenged fixed orthodontic treatment can be anticipated for the desirable occlusion relationship . importance of anomalies in the primary dentition is usually under estimated specially when they are asymptomatic . however , their presence may have marked effect on the permanent dentition as they can indicate future dental anomalies especially hypodontia in the permanent dentition . therefore , treatment of fused teeth is necessary by taking the phase of dentition period under consideration to intercept the ill- effects and improve the dental health of the child . | fusion of teeth is the union of two or more tooth germs , which are usually separated . depending upon the stage of odontogenesis , it can be complete or incomplete
. the present case describes fusion between the maxillary primary right central and lateral incisor with a supernumerary tooth . clinical and radiographic examination revealed the presence of fused triple teeth .
the fused teeth were extracted , sectioned and were visualized under stereomicroscope at three levels and the diagnosis of fusion of three teeth was confirmed histologically . |
melanomas are tumors arising from melanocytes , which are derived from neuroectoderm located in the basal layers of skin , skin annexes , and more rarely in the mucosal membrane . common sites for melanomas are head , neck and the lower extremities , less common sites being the oral mucosa , nail beds , conjunctiva , orbit , esophagus , nasal mucosa or nasopharynx , vagina and leptomeninges . sinonasal malignant melanoma is an extremely rare tumor , with primary mucosal melanoma being more aggressive than its cutaneous counterpart . it accounts for less than 1% of all western melanomas and < 5% of all sinonasal tract neoplasm . we report a case of primary mucosal malignant melanoma of the nasal cavity in a 68-year - old male for its rare occurrence . a 68-year - old male , farmer by occupation , presented with the complaints of nasal blockage and intermittent streaking of blood from left nostril for six months . there was no relevant past medical / family history . on examination , there was swelling of the left alar region . anterior rhinoscopy showed a shiny polypoidal mass in the left nasal cavity which was friable and bled on touch . evaluation of the case demonstrated only mild anemia with otherwise normal baseline hematological and biochemical profile . computed tomographic ( ct ) scan showed an enhancing soft tissue lesion in left nasal cavity with a suggestive diagnosis of a polypoidal mass not otherwise specified . the smear showed large epithelioid and few spindle cells showing hyperchromatic nuclei , macronucleoli and both intra- and extra - cellular melanin pigments that led to a provisional diagnosis of malignant melanoma [ figure 1 ] . the tumor was polypoidal and capsulated which ruptured during removal and hence it was removed in pieces . the tumor was attached with a broad base and was found on the inferior turbinate of left nasal cavity . after removal of tumor , the gross examination revealed several bits of blackish , irregular , soft and friable tissue , totally aggregating to form 5 cm 6 cm mass . the hematoxylin and eosin stained section showed the tumor was composed of epithelioid and spindle cells which were medium to large in size , arranged in lobules and small bundles . both extra and intracytoplasmic melanin pigment was noted [ figure 2 ] . scattered mitoses and tumor giant cells were also seen . the case was diagnosed as primary mucosal malignant melanoma . hmb-45 and s-100 positivity further confirmed the diagnosis . the cytological smear showed large epithelioid and few spindle cells showing hyperchromatic nuclei , macronucleoli and both intra and extracellular melanin pigments ( mgg , 1000 ) ( a ) intraoperative tumor - mass before resection . ( b ) section showed medium to large size epithelioid and spindle cells arranged in lobules and small bundles with pleomorphic , hyperchromatic nuclei with prominent nucleoli . sinonasal malignant melanoma is an extremely rare tumor and more aggressive than its cutaneous counterpart . melanocytes in the mucosa of the upper respiratory tract are the progenitors of the lesion . they account for less than 1% of all melanomas and < 5% of all sinonasal tract neoplasms . about 5% of nodular melanomas lack pigment ( amelanotic melanoma ) . the tumor occurs between 50- 70 years of age , and both sexes are equally affected with no race predilection . patients with sinonasal mucosal malignant melanoma do not seem to be part of dysplastic nevus syndrome or xeroderma pigmentosum . melanomas of the mucosal form are often diagnosed late due their hidden location and relatively nonspecific features . the site most frequently involved in the nasal cavity is the nasal septum , and in our case the tumor originated from the inferior turbinate of the nasal cavity , which is one of the less common sites . malignant melanomas of the nasal cavities and sinuses are characterized by early and repeated recurrences . at presentation , 70 - 80% of cases are localized , 10 - 20% have regional lymph node , and < 10% have distant metastasis . however , during the course of disease , an additional 20% may develop nodal metastasis and 40 - 50% may develop distant metastasis to lungs , brain , bone and/or liver . vascular and neural invasion is seen in 40% cases . however , in our case , the tumor was localized to the left nasal cavity . however , the most common and prognostically significant staging system in use is : stage i- localized tumors , stage ii- tumors with lymph node metastasis , and stage iii- tumors with distant metastasis . tumor thickness or depth of invasion can not be accurately assessed due to the lack of a well - defined reference point for the surface in the respiratory mucosa , frequent ulceration , tissue fragmentation and poorly oriented specimen . metastatic melanoma to the sinonasal tract , although highly uncommon , must always be excluded , as the prognosis is even poorer . the comparative genomic hybridization ( cgh ) profiles of sinonasal mucosal melanomas show remarkably consistent alterations : chromosome arm 1q is gained in all tumors and gains of 6p and 8q are present in 93 and 57% , respectively . surgery is the cornerstone of therapy , although wide free margins of resection are difficult to achieve . local dose escalation with intensity modulated radiotherapy ( imrt ) yields good treatment results with respect to local and distant tumor control as well as survival , while treatment - related toxicity can be minimized . local , regional recurrences and distant metastasis still occur despite the implementation of aggressive treatment , including surgery , radiation and adjuvant therapy . five - year survival rate is between 20 and 46% . other poor prognostic factors include : advanced age , obstructive symptoms , tumor size > 3 cm , location in paranasal sinuses and nasopharynx , vascular invasion into skeletal muscle and bone , high mitotic count , marked cellular pleomorphism and distant metastasis . primary mucosal malignant melanoma of the nasal cavity is a rare , aggressive tumor with poor prognosis and late detection . so , early diagnosis with high index of suspicion is essential for the management of the condition . | sinonasal malignant melanoma is of unusual occurrence .
common sites for melanomas are head , neck region , and the lower extremities as they are exposed to sunlight , which is one of the predisposing factors .
we report a case of primary mucosal malignant melanoma of the nasal cavity in a 68-year - old male for its rare occurrence .
the primary knowledge of its existence and evaluation of its cytological features are important for a correct preoperative cytological diagnosis and thereby clinical implications for appropriate therapeutic intervention .
the cytological features when evaluated along with clinical , histopathological and immunohistochemical features are sufficiently diagnostic .
the rarity of its occurrence warrants its mention . |
to report high resolution spectral domain optical coherence tomography ( sd - oct ) findings in a case with bilateral photic maculopathy and resultant central scotoma following pterygium excision . a 38-year - old man with a history of pterygium excision complained of visual disturbance and annoying central scotoma in both eyes . although he had subtle funduscopic and angiographic changes , sd - oct precisely showed disruption of the photoreceptors inner segment / outer segment in the foveal center . phototoxic macular damage following ocular surgeries may be diagnosed with difficulty due to subtle funduscopic findings . sd - oct is a precise imaging in revealing characteristic retinal alterations in different foveal injuries . ophthalmologists should be aware of the possibility of photic maculopathy following various ophthalmic operations including pterygium surgery . exposure to an intense light source such as the operating microscope may result in phototoxic retinal injury . operating microscope - induced retinopathy has been reported following extracapsular cataract extraction , phacoemulsification , penetrating keratoplasty , vitrectomy and pterygium excision . spectral domain optical coherence tomography ( sd - oct ) is useful in revealing characteristic retinal alterations in various foveal injuries . in this report , we present high resolution sd - oct findings in a case with operating microscope - induced bilateral photic maculopathy following uncomplicated pterygium excision . a 38-year - old man was admitted to our clinic complaining of visual disturbance and annoying central scotoma in both eyes , with a history of pterygium surgery with conjunctival autograft of the right and left eyes at a 4-week interval respectively , 12 months earlier . according to his operation reports , the procedure was done using an injection of lidocaine 2% under the pterygium bed and additional aliquots in the area of the donor site while supplemental nasal oxygen had also been utilized . coaxial illumination of a topcon oms-610 microscope ( topcon corporation , japan ) from a 50-watt halogen bulb fitted with ultraviolet filters was used during the entire procedure . two weeks after the operation of the left eye , the patient experienced bilateral central scotoma in his visual field but because of unremarkable fundus examination his symptom was not taken serious and the scotoma persisted without any change . the refractive error was 0.50 diopter of astigmatism in each eye and corrected visual acuity was 20/30 . detailed fundus examination showed subtle bilateral central foveal pigment stippling which correlated with a small hypofluorescent spot in fluorescein angiography . the sd - oct study disclosed preserved foveal contour and a normal vitreoretinal interface with a disruption of the hyper - reflective layer of the photoreceptors inner segment - outer segment ( is - os ) in both eyes [ figures 1 and 2 ] . ( a ) fundus autofluorescence , ( b ) fundus photography , ( c ) fluorescein angiography , and ( d ) sd - oct imaging of the right eye . small region of central foveal pigment stippling is shown on the color fundus photography which is compatible with a tiny hypofluorescent spot in the autofluorescence and fluorescein angiography imagings . sd - oct shows disruption and loss of the hyper - reflective inner segment - outer segment layer under the fovea . ( a ) fundus autofluorescence , ( b ) fundus photography , ( c ) fluorescein angiography , and ( d ) sd - oct imaging of the left eye . small region of central foveal pigment stippling is shown on the color fundus photography which is compatible with a tiny hypofluorescent spot in the autofluorescence and fluorescein angiography imagings . sd - oct shows disruption in the inner segment - outer segment layer under the fovea . photic maculopathy has been well documented in sun - gazing and it is also reported in different ocular surgeries particularly in the setting of anterior segment procedures . in contrast to coaxial light , oblique illumination contributes minimally to retinal injury . although duration threshold to produce a phototoxic lesion by coaxial light has been estimated to be as short as 7.5 minutes , it depends on illumination intensity , media clarity , pupil size , immobility of the eye with retrobulbar anaesthesia during surgery , use of photosensitizing agents and the use of supplemental oxygen . in the present case , use of coaxial light for surgical field illumination during entire procedure , clear ocular media , no corneal coverage during operation and utilization of supplemental oxygen were predisposing factors to photic maculopathy . the sd - oct disclosed loss of the hyper - reflective is - os layer of the central fovea in both eyes manifesting as a cyst like lesion under the fovea . unilateral photic maculopathy following pterygium excision has previously been reported in a 27-year - old woman with retrobulbar anaesthesia . herein , we present sd - oct findings of bilateral photic maculopathy following pterygium excision ; the operations were done under local anaesthesia . knox cartwright et al have reported recovery of photic maculopathy induced visual scotoma during 6 - 12 months following prolonged exposure to the operating microscope light ; however the symptoms of our patient persisted for one year following injury . although our case had no significant funduscopic or angiographic findings , sd - oct precisely localized the main site of retinal damage correlating with patient 's symptoms . in summary , ophthalmologists could encounter photic maculopathy following a variety of ophthalmic operations including pterygium surgery . during the operation , minimal utilization of coaxial microscopic light , corneal covering and minimal use of supplemental oxygen in young patients | purpose : to report high resolution spectral domain optical coherence tomography ( sd - oct ) findings in a case with bilateral photic maculopathy and resultant central scotoma following pterygium excision.case report : a 38-year - old man with a history of pterygium excision complained of visual disturbance and annoying central scotoma in both eyes .
although he had subtle funduscopic and angiographic changes , sd - oct precisely showed disruption of the photoreceptors inner segment / outer segment in the foveal center.conclusion:phototoxic macular damage following ocular surgeries may be diagnosed with difficulty due to subtle funduscopic findings .
sd - oct is a precise imaging in revealing characteristic retinal alterations in different foveal injuries .
ophthalmologists should be aware of the possibility of photic maculopathy following various ophthalmic operations including pterygium surgery . |
the incidence of trocar site hernia is reported to be 0.11~0.84% after laparoscopic cholecystectomy.(1,2 ) fear(3 ) first reported a trocar site hernia in his large series on laparoscopic surgery . maio and ruchman(4 ) reported a trocar site hernia with small - bowel obstruction immediately after cholecystectomy ; this was the first report of a trocar site hernia in digestive surgery . since then many reports have been published on cholecystectomy , and more recently on gastrointestinal surgery . we report a patient who had an abdominal wall mass at a previous trocar site after laparoscopic distal gastrectomy . a 50 year - old women visited the hospital after a mass was detected in her right flank area . six months previously she had undergone laparoscopic - assisted subtotal gastrectomy for an early gastric cancer located in her gastric antrum . we found a 4.53.5 cm mass at the previous right lower 12 mm trocar site on computed tomography ( ct ) scan . the mass showed fat density on the ct scan and it was located between the external and the internal oblique muscle of the abdominal wall ( fig . the post - operative findings showed that the mass was located between the external oblique muscle and the internal oblique muscle and that it was oval shaped with a size of 4.53.3 cm ( fig . although the incidence of gastric cancer and the mortality associated with this disease have decreased gradually in east asia , it remains the second most frequent cause of death in korea . recently , the inclusion criteria for laparoscopic assisted gastrectomy have been enlarged , which has led to an increase in the number of publications describing laparoscopic treatment of advanced gastric cancer.(5,6 ) we previous reported trocar site recurrence after laparoscopic gastrectomy in advanced gastric cancer patients.(7 ) so , when a mass at a trocar site is uncovered , it is worth considering trocar site recurrence after a previous cancer operation . however , the density of the mass on the ct scan in the present case corresponded to fat density , and the mass was located between the external oblique and the internal oblique muscle . we concluded the mass had herniated from the abdominal omentum , because it was located between the external and the internal muscle , and the fascia of the internal oblique and the transversalis muscle had defects . most tracar - site hernias involve trocars of at least 10 mm , but a few cases of not only 5 mm trocars but also 3-mm trocars have been reported.(8,9 ) in the survey of the american association of gynecologic laparoscopists,(10 ) of 840 trocar site hernias , 725 ( 86.3% ) occurred in sites where the diameter was at least 10 mm . only 92 hernias ( 10.9% ) occurred at the site of insertion of trocars with a diameter of more than 8 mm but less than 10 mm , with 23 ( 2.7% ) occurring in sites where the trocars were smaller than 8 mm ( they estimated that 41.3% of all trocars were at least 10 mm . ) . the risk of a trocar site hernia is no different than a veress needle , open access or blunt and cutting trocars . a slowly absorbable or non - absorbable suture is recommended for the prevention of hernias . the fascia should be sutured in all trocar sites 10 mm , but all port sites should be sutured regardless of trocar size in children ( age<6 years ) . diabetes and smoking are possible risk factors , but not obesity . we conclude that patients with trocar site masses exhibiting fat density on a ct scan could be followed up without surgery , and that fascial defects located at 10-mm or larger trocar sites should be closed whenever possible to prevent hernia formation . | a trocar site hernia is a rare complication .
we report a patient who had an abdominal wall mass at a previous trocar site after laparoscopic distal gastrectomy .
it was diagnosed as omental herniation and fat necrosis .
we conclude that patients with trocar site masses exhibiting fat density on a computed tomography scan could be followed up without surgery , and that fascial defects located at 10-mm or larger trocar sites should be closed whenever possible to prevent hernia formation . |
a 12-year - old boy with deformity of the chest wall was admitted to the pediatrics clinic . the physical examination on admission revealed asymmetry in his chest and neck ; there was also a sacral dimple and hypoplasia of the right thumb ( fig . routine cervical spine films and the postero - anterior ( pa ) chest film were obtained to search for the etiology of the neck and chest asymmetry . cervical radiography showed partial vertebral body fusion associated with neural arch fusion of c2-c4 and the wasp - waist sign , and bilateral cervical ribs were noted at the level of c7 . the pa chest film revealed rib fusion on the right side at the 1 - 2 and 8 - 9 rib level . he underwent axial multislice - helical computed tomography ( mct ) with 3-dimensional ( 3d ) reconstructions in order to evaluate the lesions in detail , and also for the differential diagnosis for some of the syndromic disorders that were causing these deformities . we also observed partial body fusion of t1-t2 on the 3d sagittal image ( fig . 1e ) , and this finding was not revealed by plain radiography , ct or the mr images . spina bifida of l5 , lumbalization at the right side of s1 and a sacral curve defect were demonstrated with the 3d - ct scan , and the ct was performed because of the sacral dimple ( fig . the mri examination depicted levels of cervical fusion enlargement of the spinal canal and dural sac ectasia ( fig . the echocardiographic examination revealed mitral valve prolapsus , and the ultrasonographic examination of the abdomen was normal . intravenous urography ( ivu ) was performed because of his enuresis nocturna , and it identified a triple renal pelvis in the left kidney ( fig . klippel - feil syndrome is a complex disorder that consists of congenital fusions of the cervical vertebrae with the patients having a short neck , limitation of the movement of the head or the neck and a low posterior hairline . this syndrome is a result of failure of the normal segmentation of the cervical somites during the 3rd to 8th weeks of gestation ( 2 ) . klippel and feil first reported the clinical features of this syndrome in 1912 . in 1919 , feil described additional cases and he distinguished kfs into three different groups according to the degree of involvement ( 1 , 2 ) . massive fusion of many of the cervical and upper thoracic vertebrae was designated as type i , the fusion at one or two interspaces with occipitoatlantoid fusion , hemivertebrae or other abnormalities in the cervical spine as deemed type ii , and last , cervical fusion in combination with lower thoracic or lumbar fusion was deemed as type iii ( 1 - 3 ) . klippel - feil syndrome includes a complex of anomalies such as scoliosis ( 60% ) , renal anomalies ( 35% ) such as agenesis , dysgenesis , renal ectopia , malrotation , duplication and sprengel 's deformity ( 30% ) , deafness ( 30% ) , congenital heart disease ( 14% ) such as atrial septal defect and coarctation , cranial and facial asymmetry ( 13% ) and cleft palate ( 10% ) ( 1 , 5 ) . the important symptoms and anomalies are usually revealed incidentally on radiological examinations in the mild cases . however , the patients may develop neurological symptoms that are secondary to the degenerative disc disease of the adjacent mobile segments , spinal instability from the hypermobility or from trauma , and spinal stenosis in later decades of life . therefore , the early diagnosis of kfs is important because of the high risk for other associated diseases in the affected patients ( 1 , 4 ) . the anterior concave indentation at the site of the absent or reduced interspace between the fused vertebrae is known radiologically as the wasp - waist sign . nguyen et al . ( 1 ) studied cervical spine radiographs of 33 patients with kfs for the patterns of bony fusion and the presence of wasp - waist sign . they reported that the wasp - waist sign was associated with complete vertebral fusion in kfs . in our case , we demonstrated the presence of wasp - waist sign on the 3d ct images . thomsen et al . ( 2 ) reported that most of the skeletal anomalies are found in type ii kfs ( 2 ) . our patient was consistent with type ii kfs because of the multiple skeletal anomalies without lower thoracic or lumbar fusion . a high incidence ( 64% ) of genitourinary - tract anomalies that are demonstrated by ivu and on the physical examination are encountered in patients with kfs . the incidence of these anomalies in the three types of the syndrome are essentially same and unilateral renal agenesis is the most common abnormality ( 3 , 6 ) . many kinds of congenital cardiac anomalies are also prominent in this syndrome , and ventricular septal defect is the most commonly encountered lesion ( 7 ) . to the best of our knowledge , only one case has been reported in the literature showing prolapse of the mitral valve associated with kfs ( 8) . ct scans can delineate fine skeletal structures in great detail with its ability for multislice scanning , and ct may assume a new role for this purpose because of its superior 3d spatial resolution ( 9 ) . nowadays , volume rendering is the preferred technique for the musculoskeletal system examinations , and it can improve visualization and better demonstrate subtle findings . this situation may alter the medical management in a significant number of cases ( 9 ) . the utilization of the spiral technique has allowed rapid procurement of overlapping slices for 3d reconstruction of the data without any additional radiation exposure to the patients ( 10 ) . the disadvantages of this technique are the additional costs associated with the necessary software and the time needed to perform satisfactory reconstructions on the workstation . we found that 3d ct clearly showed the skeletal abnormalities and it helped us make a clear and easy diagnosis in our case . therefore in our opinion , the diagnostic value of using multislice ct in the cases with skeletal anomalies such as kfs overcome the disadvantages of this technique . in conclusion , kfs is a clinical and radiological entity with numerous associated anomalies and a variety of complications . the pattern and locations of the fusions provide the diagnostic guidelines for the radiological differential diagnosis . we believe that 3d - ct is helpful in the diagnosis of kfs , and especially in the atypical clinical cases , for delineating the skeletal abnormalities associated with kfs . | we present here the case of a 12-year - old boy who had klippel - feil syndrome with renal , cardiac and multiple skeletal anomalies , and we show the relevent three - dimensional computed tomography images .
our patient had a triple renal pelvis , mitral valve prolapsus , multiple cervical vertebrae fusions , cervical ribs , hypoplasia of the right thumb , spina bifida of l5 , lumbalization at the right side of s1 and a sacral curved defect . in this study , we discuss the atypical clinical features and the diagnostic value of three - dimensional ct for evaluating the skeletal anomalies of the klippel - feil syndrome cases . |
starting in 2000 , pegylated interferon- ( peg - ifn ) has been the treatment of choice for chronic hepatitis c virus ( hcv ) infections . , we report for the first time a patient who experienced a relapse of vogt - koyanagi - harada ( vkh ) disease during treatment with peg - ifn and ribavirin therapy for hcv infection . a 60-year - old woman was referred to our department for fundus examination on june 25 , 2008 , and was scheduled to begin peg - ifn and ribavirin therapy for chronic hcv infection . she had been diagnosed with vkh disease in 1991 and had been treated for 15 months with both injection and oral steroid therapies ( fig . 1a , b ) . after the initial treatment , no further symptoms or evidence of the disease were observed over the next 17 years . at the time of the examination , she had no symptoms , and her visual acuity was 1.2 in her right eye and 1.0 in her left eye . the fundus of both eyes showed a sunset appearance , but slit lamp and fundus examinations showed no active inflammation . based on our findings , treatment with peg - ifn and ribavirin was started . at 3 weeks after the start of the therapeutic intervention , the patient complained of visual blurring , eye pain , and an increased hearing loss . her visual acuity was reduced to 0.2 in her right eye and remained at 1.0 in her left . fluorescein angiography showed multiple leakage of fluorescein dye from the choroid into the subretinal space ( fig . 2c , auditory acuity was mildly diminished in both ears . as we diagnosed a relapse of the patient 's vkh disease , we began administration of intravenous pulses of methylprednisolone ( 1,000 mg / day for 3 days ) , followed by daily oral corticosteroids , which were then tapered off over time . two months after the symptoms first appeared , her visual acuity returned to 1.0 in both eyes without ocular inflammation and remained stable thereafter for more than 15 months . over the last decade , peg - ifn and ribavirin therapy has become the standard treatment for hcv . ifn- belongs to the type 1 interferon family , which is involved in the host 's natural defense against viruses , bacteria , and neoplasia . recent publications have emphasized the effects of ifn- on refractory uveitis , including vkh disease . although the mechanisms of its efficacy are believed to be multifactorial , they have not yet been well elucidated . in contrast , several autoimmune disorders , such as sarcoidosis , mooren 's ulcer , graeve 's disease , systemic lupus erythematosus , type i diabetes or rheumatoid arthritis , have been observed during ifn- and ribavirin therapy . these cases have been attributed to immunomodulatory actions related to the therapy [ 3 , 4 ] . there have been some reports stating that vkh disease occurs after ifn therapy for hcv . in these reports , the disease was indicated to have emerged 3 months to 2 years after the start of ifn therapy [ 5 , 6 , 7 ] . in the current case , however , we identified the relapse of vkh disease at only 3 weeks after starting ifn therapy , even though the disease had been dormant for 17 years . the immunological activities of ifn , including enhanced lymphocyte cytotoxity , increased expression of major histocompatibility class i antigens , production of proinflammatory cytokines , and differentiation of antigen - presenting cells , may predispose susceptible individuals to the development of an autoimmune disorder [ 3 , 4 , 5 ] . moreover , ifn- can cause an immune response shift to t - helper-1-type predominance and alter the expression of histocompatibility class i and ii antigens , possibly leading to the development of vkh disease [ 5 , 8 ] . in addition , administration of ifn- may lead to the development of vkh disease via an increase in the production of endogenous ifn- , and it has been reported that serum endogenous ifn- titers are significantly elevated in vkh disease patients [ 9 , 10 ] . these possible mechanisms may explain how ifn exacerbates preexisting autoimmune conditions and leads quickly to the relapse of vkh disease , as shown in this case . in conclusion , when ifn therapy is administered to hcv patients , especially those who have a history of vkh disease must be closely monitored for ophthalmologic complications due to immediate relapse of vkh disease . | a 60-year - old woman , who had been diagnosed with and treated for vogt - koyanagi - harada ( vkh ) disease 17 years before , was receiving pegylated interferon- ? and ribavirin therapy for chronic hepatitis c virus .
three weeks after the start of therapy , she complained of visual blurring , eye pain , and an increased hearing loss .
based on a slit lamp and fundus examination , she was diagnosed with a relapse of vkh disease .
after discontinuation of the pegylated interferon- and ribavirin therapy and administration of corticosteroid therapy , her visual acuity returned to 1.0 in both eyes without ocular inflammation , and remained stable thereafter . when interferon therapy is administered to hepatitis c virus patients , those who also have a history of vkh disease must be closely monitored for ophthalmologic complications . |
the following antibodies were used for immunoblot analysis : mouse monoclonal anti - irtks ( sc-100680 ) and anti - nfatc1 ( sc-7294 ) ( santa cruz biotechnology ) ; mouse monoclonal anti-tubulin ( sigma ) . raw264.7 macrophages were cultured under 5% co2 at 37c in -minimum essential medium ( -mem ) supplemented with 10% fetal bovine serum ( fbs ) and penicillin - streptomycin . for stromal cell - free osteoclast formation , nonadherent cells were plated at a density of 1 10 per well ( bone marrow ) or 3 10 per well ( spleen ) in 6-well plates and were cultured for 3 d in -mem supplemented with 10% fbs and recombinant human m - csf ( r&d systems ) at 10 ng / ml . the resulting m - csf dependent macrophages were used as osteoclast precursors . osteoclast differentiation was induced by culture for 3 to 4 d in the presence of recombinant human m - csf and recombinant mouse rankl ( r&d systems ) , each at 10 ng / ml . total rna was extracted from cells with the use of the trizol reagent ( invitrogen ) , and portions ( 0.5 g ) of the rna were subjected to reverse transcription with superscriptii polymerase ( invitrogen ) . the primers used to detect specific transcripts by subsequent pcr are listed in table 1 . the following antibodies were used for immunoblot analysis : mouse monoclonal anti - irtks ( sc-100680 ) and anti - nfatc1 ( sc-7294 ) ( santa cruz biotechnology ) ; mouse monoclonal anti-tubulin ( sigma ) . raw264.7 macrophages were cultured under 5% co2 at 37c in -minimum essential medium ( -mem ) supplemented with 10% fetal bovine serum ( fbs ) and penicillin - streptomycin . for stromal cell - free osteoclast formation , nonadherent cells were plated at a density of 1 10 per well ( bone marrow ) or 3 10 per well ( spleen ) in 6-well plates and were cultured for 3 d in -mem supplemented with 10% fbs and recombinant human m - csf ( r&d systems ) at 10 ng / ml . the resulting m - csf dependent macrophages were used as osteoclast precursors . osteoclast differentiation was induced by culture for 3 to 4 d in the presence of recombinant human m - csf and recombinant mouse rankl ( r&d systems ) , each at 10 ng / ml . total rna was extracted from cells with the use of the trizol reagent ( invitrogen ) , and portions ( 0.5 g ) of the rna were subjected to reverse transcription with superscriptii polymerase ( invitrogen ) . the primers used to detect specific transcripts by subsequent pcr are listed in table 1 . | podosomes and invadopodia seen in osteoclasts and cancer cells , respectively , are actin - rich membrane protrusions .
we recently demonstrated that an adaptor protein , tks5 , which is an established regulator of invadopodia in cancer cells , drives osteoclast - osteoclast fusion as well as osteoclast - cancer cell fusion by generating circumferential podosomes / invadopodia .
this finding revealed an unexpected potential of podosomes / invadopodia to act as fusion - competent protrusions .
fusion of biological membranes involves the intricate orchestration of various proteins and lipids .
recent literature suggests the importance of membrane curvature formation in lipid bilayer fusion . in this study
, we investigated the expression of bin - amphiphysin - rvs161/167 ( bar ) domain superfamily proteins , which have membrane deforming activity , during osteoclastogenesis .
we found that irtks was specifically induced during osteoclast fusion and interacted with tks5 , suggesting the role of irtks in the formation of fusion - competent protrusions via its bar domain . |
a 56-year - old man with a history of hypertension presented with pain in the neck and suprascapular region . the patient gave a history of blunt trauma of this region some two weeks earlier . ultrasound study of the supraclavicular area showed a false aneurysm of the right subclavian artery . the angiogram of the aortic arch performed via the left common femoral artery demonstrated false aneurysm . even selective angiogram of the right subclavian and right common carotid arteries could not precisely visualise the aneurysm neck . then subclavian artery aneurysm was directly punctured under ultrasound guidance , and a selective angiogram was performed . this depicted exactly the false aneurysm neck in the right subclavian artery . in order to avoid thrombin backflow to the subclavian / carotid vessels , a balloon was placed in the right subclavian artery . the balloon was expanded and simultaneously doppler ultrasonography examination under the control of colour - coded ultrasonography was performed in order to verify that the flow in the aneurysm had ceased . this indicated that the catheter balloon was in the proper position and the aneurysm obliteration by thrombin could be securely performed . the control angiogram demonstrated patent subclavian and common carotid arteries . neither the angiogram nor ultrasound demonstrated blood flow within the false aneurysm . on the second day , control ct angiography was carried out , which confirmed the exclusion of the right subclavian artery false aneurysm ( fig . 2 ) . on the first postoperative day , horner 's syndrome signs were observed . follow - up ultrasonography examination was performed following 1 , 3 , 6 , 12 and 24 months . these examinations did not indicate flow within the aneurysm , but gradual diminution of the thrombosed aneurismal sac was observed . computed tomography angiography depicts the right subclavian artery false aneurysm control angiography of computed tomography shows the obturation of the right subclavian artery aneurysm ( an arrow indicates the aneurysm stub ) the most commonly used option is ligation of the proximal part of the subclavian artery . following aneurysm excision , blood flow is usually restored with an inlay prosthesis either a synthetic or an autologous venous graft . in the case of a large massive aneurysm , in such a case blood flow is restored interposition of the subclavian artery to the carotid artery or by carotid - subclavian or subclavian - subclavian bypass . these complicated surgical procedures usually require thoracotomy and sternotomy , often complemented with an additional supraclavicular incision . the use of stent grafts enables simultaneous aneurysm exclusion and anatomical reconstruction of blood flow . the follow - up period of the patients after the operation in general does not exceed 3 years . therefore long - term results are still unknown . open surgery for subclavian artery aneurysm still remains the treatment of choice in the majority of medical centres . endovascular restoration of blood flow distally to the aneurysm is not always possible . in these cases some authors propose an alternative involving coil embolisation of the aneurysmal lumen followed by open surgical bypass , usually carotid - subclavian . in the case of the patient treated in our clinic we used a minimally invasive technique . initially an intra - arterial balloon was expanded in the subclavian artery at the site of the leakage . this aimed at obstructing the flow within the aneurysm in order to effectively protect the subclavian artery from distal embolisation / clotting . then under ultrasound guidance , the sac of the right subclavian artery false aneurysm was injected with thrombin , resulting in complete embolisation of the aneurysm . direct administration of radiological contrast into the aneurysm sac also enabled precise localisation of the site of leakage ( aneurysm neck ) , which was not possible in a classical intra - arterial angiogram . the transcutaneous thrombin administration technique under ultrasound guidance is widely used in treatment of iatrogenic false aneurysms of the common femoral artery , resulting from arterial cannulation prior to the endovascular procedure . such a method in subclavian artery aneurysm management with reference to false aneurysms of the subclavian artery , a covered stent is regarded as the treatment of choice , whilst thrombin administration is a second choice procedure . a recent publication discussed a case of leakage following insertion of a stent graft into the subclavian artery , which was successfully obturated by thrombin injection . for this reason , as well as for fear of potential microembolisation , thrombin injection is relatively rarely used . in order to protect the patient from these complications , an endovascular balloon was expanded in the subclavian artery , with subsequent aneurysm neck closure . this technique had been previously applied in the embolisation of femoral artery false aneurysms . from a vascular surgeon 's point of view , this method of subclavian artery false aneurysm management is relatively simple , efficacious and safe . over a one - year follow - up period the procedure efficacy was confirmed . stent graft implantation , bypass surgery we regard the thrombin injection method as a technically very simple solution . it is also undoubtedly the cheapest one . due to the low incidence of subclavian artery false aneurysms , precise analysis of treatment results | a rare case of a 56-year - old man with posttraumatic false aneurysm of the right subclavian artery is presented .
he was admitted to hospital due to pain in the shoulder .
the diagnosis was made upon ultrasonography and computed tomography ( ct ) results . with ultrasound guidance ,
the aneurysm was punctured and injected with bovine thrombin ( biotrombina 400u , biomed ) . during the injection , the aneurysm neck was occluded by an endovascular balloon placed in the subclavian artery .
complete aneurysm embolisation was confirmed by ultrasound and ct studies .
the postoperative course was complicated by horner 's syndrome which resolved completely within 3 weeks .
the procedure technique is described in detail . |
dermatitis artefacta ( da ) or factitious dermatitis ( fd ) is an artefactual disease caused entirely by a fully aware patient on the skin , hair , nails , or mucosa . seeking commonly seen in da in contrast to external incentives acting as the motivating factor in malingering . we report a case of da in a 38-year - old female with localized alopecia of the right half of eyebrow and anterior part of right side of the scalp . a 38-year - old lady presented with sudden loss of hair on the right side of the scalp with discoloration over the right forehead extending to the right eyelid along with edema of right eyelid of 1-day duration . she complained of ear discharge from the right ear 2 weeks back and subsequently developed tingling and numbness on right side of forehead and scalp . she also complained of occasional attacks of excruciating pain in the same area for which she took analgesics without much relief . she consulted a physician who advised a computed tomography ( ct ) scan of the head which was normal . while eliciting clinical history , she appeared disinterested and kept her eyes closed . on further inquiry , her sister disclosed that her husband was an alcoholic , and they had some financial problems . there was no history of any injury or assault before the onset of the skin lesions . an area of 15 cm 10 cm on the right side of forehead extending to involve the right eyelid and right pinna showed areas of bruising , scalding , edema , and discoloration . there was complete loss of hair involving the lateral half of right eyebrow and anterior part of right frontal and temporal areas [ figure 1 ] . there were no broken off hairs or burnt or charred hairs seen on the affected area or on the periphery of the lesion . hair pull test and hair microscopy of hairs from the margin of the lesion and eyebrows were normal . the recurrent right sided paresthesia and pain suggested the possibility of trigeminal neuralgia involving the right ophthalmic division . on psychiatric evaluation , complete hemogram , liver function tests , renal function tests , and thyroid function tests were within normal limits . we had planned a detailed psychiatric evaluation and psychotherapy , but the patient got discharged at request and failed to come for follow - up . 15 cm 10 cm area on the right side of forehead extending to involve the right eyelid and pinna , showing areas of bruising , scalding , edema , and discoloration with a complete loss of hair involving the lateral half of right eyebrow and anterior part of right frontal and temporal areas a clinical diagnosis of da is made when the clinical presentation of the skin lesions do not conform to those of known dermatoses and are located on easily accessible parts of the skin . in our patient , trigeminal neuralgia along with family problems could have acted as triggering agents for this compulsive act . the right side of scalp and forehead were easily accessible areas but an extension of the lesion to involve the right eye was probably unexpected . burnt or charred hairs were not seen in the affected area nor were bubble hairs seen on hair microscopy . broken off hairs of different lengths and exclamatory hairs were absent thereby excluding the possibilities of trichotillomania , trichoteiromania and alopecia areata . trigeminal trophic syndrome ( tts ) presents with self - induced facial ulcers usually involving the ala nasi associated with anesthesia and paresthesia often following surgical interventions or central nervous system disorders of trigeminal ganglion . the hollow history characteristic of fd and the absence of sensory loss helped us to exclude tts . the well - demarcated area of hair loss of sudden onset is suggestive of shaving off of hairs before traumatizing the area possibly with some hot object . the unique feature of our case is the coexistence of two self - inflicted dermatoses involving the same site . trigeminal neuralgia with depression has been reported as a precipitating factor for da in one of the 28 cases studied by mohandas et al . these patients may be unwilling to acknowledge a psychiatric basis for their physical findings and hence , a trichologist needs to spend time probing into the psychological background as patients often tend to deter a psychiatric referral . the serotonin pathways are involved in the self - injurious behavior and obsessive - compulsive disorders . therefore , selective serotonin reuptake inhibitors are used to treat these disorders along with psychotherapy . doctor should avoid immediate confrontation regarding the suspicion that the lesions are self - inflicted . in our patient , although we tried to avoid questions , which could evoke a suspicion that we were suspecting a self - inflicted cause for the skin lesion , patient and close relatives became uncooperative the moment we suggested a psychological evaluation . a more tactful approach is needed in such cases as a psychiatric referral , especially during the initial visit is counterproductive . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . | dermatitis artefacta ( da ) and trichotemnomania are self - inflicted dermatoses often preceded by psychosocial stressful events . a 38-year - old female presented with sudden loss of hair in the right frontal area along with discoloration and edema of skin . on examination , there was complete loss of hair involving the right frontal area and the lateral half of right eyebrow with skin over that area appearing scalded , edematous , bruised , and discolored . after a detailed medical and psychological evaluation , a clinical diagnosis of da with trichotemnomania
was made .
a tactful multidisciplinary approach is essential in managing such patients as outright referral to a psychiatrist could be counterproductive . |
the dentigerous cyst initially is always associated with the crown of an impacted , embedded , or unerupted tooth . it develops around the crown of the unerupted tooth by the expansion of the follicle when fluid collects or space occurs between the reduced enamel epithelium and the enamel of an impacted tooth . the proportion of 6- to 7-year - old children affected with dentigerous cysts is only 9.1% . dentigerous cysts occur predominantly in the third molar region of the mandible , followed in frequency by maxillary canine , maxillary third molar , and rarely in relation to maxillary central incisor . a 7-year - old boy reported to the department of paediatric dentistry at our institute with the chief complaint of a painless swelling in the left upper jaw since 6 months [ figure 1 ] . on asking for a detailed history , the patient 's guardian reported that the kid was treated for the same problem by a local dentist by the extraction of few teeth in the same area with no relief of problem few months back . on general physical examination , a clinical intraoral examination revealed a diffuse swelling extending from the buccal vestibule distal to the maxillary left deciduous lateral incisor to the maxillary left permanent first molar . the swelling was ill defined , firm on palpation , non - tender , and measured about 3.5 2.5 cm extending into the maxillary vestibule . these teeth were probably extracted by the local dentist assuming it as a case of dental abscess arising from these teeth . preoperative intraoral view the patient had a pre - existing lateral cephalometric radiograph and an orthopantomograph [ figures 2 and 3 ] . both the radiographs revealed a partially formed and unerupted tooth resembling canine with a radiolucent area surrounding it . on aspiration of the swelling , it yielded straw - colour fluid which was sent for biochemical investigation , the result of which was consistent with the diagnosis of a cystic lesion . a provisional diagnosis of the dentigerous cyst was arrived at based on clinical and radiological features . lateral cephalometric view enucleation of the cyst was chosen as the treatment of choice as the patient 's guardians were not ready for a prolonged treatment period . the treatment consisted of extraction of the maxillary left permanent canine , along with en masse removal of the dentigerous cyst . the cystic lining was attached to the cementoenamel junction of the maxillary left permanent canine . the gross specimen consisted of an irregular , wrinkled soft grey piece of a cystic sac measuring approximately 4.5 3.5 0.5 cm , containing the developing canine tooth bud within it [ figures 4 and 5 ] . the patient was asked to return for clinical follow - up once in 15 days . after 7 months , intra - oral healing was normal it [ figure 6 ] and no evidence of bone resorption or radiolucent lesion were observed [ figure 7 ] . the patient was advised for longer follow - up periods for prosthetic and orthodontic rehabilitation . dentigerous cysts of maxilla are commonly associated with the maxillary third molar and not with a canine tooth . in the present case , there have been previous case reports of a dentigerous cyst with a deciduous tooth and with a supernumerary tooth . a case of a large maxillary cyst involving the whole sinus and producing epiphora has been reported by atlas et al . dentigerous cysts are usually solitary , benign odontogenic cysts associated with the crowns of unerupted teeth . it is stated that the dentigerous cyst develops by the accumulation of fluid either between the reduced enamel epithelium and the enamel or in between layers of the enamel organ . this fluid accumulation occurs as a result of the pressure exerted by an erupting tooth on an impacted follicle , which obstructs the venous outflow and thereby induces a rapid transudation of serum across the capillary wall . toller stated that the likely origin of the dentigerous cyst is the breakdown of proliferating cells of the follicle after impeded eruption . . these cysts usually occur in the late second and third decades , are discovered on routine radiography , and predominantly involve mandibular third molars . the second type is inflammatory origin and occurs in immature teeth as a result of inflammation from a non - vital deciduous tooth . bloch suggested that the origin of the dentigerous cyst is the overlying necrotic deciduous tooth . the resultant periapical inflammation will spread to involve the follicle of an unerupted permanent successor ; inflammatory exudates ensue and result in dentigerous cyst formation . these cysts are diagnosed in the first and early part of the second decade either on routine radiographic examination or when the patient complains of swelling or pain . we believe that our case might be classified as the second type of dentigerous cyst . treatment of a dentigerous cyst depends on size , location , and disfigurement and often requires variable bone removal to ensure a total removal of the cyst . even though marsupialisation of the cyst is the treatment of choice for dentigerous cyst in children in order to give a chance to the unerupted tooth to erupt , the major disadvantage of marsupialisation is that pathologic tissue is left in situ , without a thorough histologic examination . although the tissue taken from the window created can be submitted for pathologic examination , there is a possibility of a more aggressive lesion in the residual tissue . but , in this case , as the tooth was almost displaced up to the roof of the developing maxillary sinus far from the alveolar arch with a questionable viability , enucleation with the removal of the displaced tooth was favoured . in summary , dentigerous cyst development associated with an unerupted permanent tooth is not uncommon . dentigerous cysts of maxilla are usually associated with the maxillary third molar and not with a canine tooth . in the present case , the cyst was associated with canine and was almost involving the developing maxillary sinus of the 7-year - old child . these findings are not common in dentigerous cysts , and hence , this case is reported . | dentigerous cysts are the most common odontogenic and developmental cysts arising in the jaws . in this article , we report a rare case of dentigerous cyst arising from an unerupted canine which had invaded a part of the maxilla in a 6-year - old child .
the clinical features , radiographic presentation , and the treatment modality are described . |
end stage renal disease ( esrd ) is a serious health problem among children , especially among children aged < 2 years . it has particular features in terms of etiology and therapeutic modalities . the management of infants with esrd aims , on the one hand , at increasing patients longevity and , on the other hand , at improving growth and life - quality . esrd incidence among children is estimated at 5.5 new cases per million inhabitants per year in europe , 10.6 in canada , and 4 in japan . in developed countries , prognosis of pediatric esrd has improved ; most children can have access to chronic peritoneal dialysis ( pd ) , hemodialysis , or kidney transplantation . conversely , in developing countries , esrd is a serious cause of morbidity and mortality . managing esrd is particularly challenging due to patients late presentation , poor socioeconomic conditions , and inadequate health care infrastructure support . some data found in nigerian series report an incidence of 4 cases / million inhabitants per year . in tunisia , a single epidemiological study , in 1993 , examined the esrd epidemiological aspects , since then no data about ersd among infants has ever been collected . the aim of our study was to describe esrd etiologies and outcomes among tunisian infants . this retrospective study included all infants with the esrd diagnosis who presented to the department of pediatric nephrology at charles nicolle hospital in tunis from january 1998 to december 2013 . esrd patients were defined as those who needed renal replacement therapy ( rrt ) to sustain life . we excluded foreign - born patients , those whose death occurred within a short time . individual patient data included date of birth , gender , primary renal disease , starting rrt date , treatment modality at start of rrt , and important events such as death . we studied 157 children with esrd who were treated in the pediatric department at charles nicolle hospital . 24 children ( 15.2% ) were infants ; the sex ratio was equal to 2 . the mean age of infants with esrd at presentation was 8 months ( range , 121 months ) . laboratory findings were as follows : mean serum creatinine : 5.6 ( 3.19 ) mg / dl , mean blood urea nitrogen : 95 ( 18243 ) mg / dl , and hemoglobin : 6 ( 3.512 ) g / dl . hypocalcemia was noticed in 13 infants and hyperphosphatemia in 20 infants [ table 1 ] . patient 's characteristics at presentation the main causes were congenital anomalies of the kidneys and urinary tract ( cakut ) ( 9 infants ) , inherited renal disease ( 9 infants ) , hemolytic and uremic syndrome ( 3 cases ) , and unknown origin ( 3 cases ) . all patients were treated by pd , all infants had double - cuff straight tenckhoff catheter , 20 infants were treated with continuous ambulatory pd and 4 infants with automated pd ; 17 infants had peritonitis . this study presents esrd etiology and outcome among tunisian infants . to the best of our knowledge , none of the studies have so far focused exclusively on infants with esrd and , therefore , our study adds new insights to esrd etiologies and outcome among tunisian infants . it has particular characteristics in terms of etiology and therapeutic modalities . over the last few years the rising incidence of rrt was attributed to the increase of dialysis provision to younger children by virtue of improvements in techniques for nutritional and dialysis support . the male predominance noted in this study is similar to observations in many other reports . as in the other studies , male predominance is due to the higher proportion of males among patients with cakut . in our series , growth retardation was noticed in 14 patients , but only 9 patients received growth hormone . reports from europe , australia , japan , kuwait , turkey , and the united states show that cakut are the leading causes of esrd and are responsible for between 34% and 52% of esrd cases among children ; esrd in younger children is mostly due to cakut . the high prevalence of inherited renal disease among infants in our study is attributed to the high proportion of consanguinity ( 58% ) . environmental , ethnic , and other differences might explain the different occurrences of primary renal diseases in europe and in other parts of the world as compared with our findings . access to chronic rrt has improved the esrd outcome in developed countries . a tunisian research dated 1997 found that the therapeutic abstention rate attained 19% . in our study , all infants received rrt . a korean study reported a frequency equal to 21.7% of peritonitis among infants undergoing pd . a british study published in 2010 reported that the peritonitis incidence was estimated at 66.66% . long - term survival rate for children with chronic rrt in developed countries is 79% at 10 years and 66% at 20 years . major death causes identified in this study were infections , followed by cardiovascular causes as is reported in the literature . in tunisia , management of children with esrd has known progress in recent years ; yet , mortality rate in infants with esrd is high . the current high rate of mortality can be improved by earlier referral , better nutrition , family support , and enhanced access to treatment modalities . | end stage renal disease ( esrd ) in infants has particular features in terms of etiologies and therapeutic modalities .
the aim of our study is to describe the etiologies and the esrd outcomes among tunisian infants .
this retrospective study was conducted over 15 years ( from january 1998 to december 31 , 2013 ) in the pediatric department at charles nicolle hospital . in total ,
157 pediatric patients had esrd .
the mean incidence was 4.25 million children .
the study involved 24 infants ; the sex ratio was equal to 2 .
the mean age at diagnosis of esrd was 8 months ( range , 121 months ) .
growth retardation was noticed in 14 patients .
the main causes were congenital anomalies of the kidneys and urinary tract ( 9 infants ) and hereditary renal disease ( 9 infants ) .
all patients were treated with peritoneal dialysis ; 16 infants presented peritonitis .
mortality rate was about 28% .
the leading causes of death were cardiovascular diseases and infections . |
although bisphosphonate , a potent inhibitor of bone resorption , is generally safe and effective , it carries the potential risk of over - suppressing bone turnover . a number of reports have been issued regarding insufficiency femoral fractures in patients on long - term bisphosphonate therapy , and recently several studies have reported suspicious relationship between atypical femoral fractures and long - term bisphosphonate medication . however , it is often confused clinically whether is it a fatigue fracture because of implant induced stress concentration or a bisphosphonate - related atypical fracture , especially in a patient with a subtrochanteric fracture who receive bisphosphonate therapy after open reduction and internal fixation , such as dynamic hip screw ( dhs ) system for previous ipsilateral femoral neck or intertrochanteric fracture . in this report , we present a case of progressive femoral insufficiency fracture or stress fracture in a woman on long - term alendronate therapy who had had an ipsilateral femoral neck fracture treated using a dhs . a 76-year old woman visited our out - patient clinic in may 2010 complaining of a left thigh pain while walking . medical history taking revealed a diagnosis of a left femur neck fracture fixed with a dhs in july 2006 , and in january 2010 , she had undergone surgery due to a right distal radius and ulnar fracture and a right femoral intertrochanteric fracture . a physical examination revealed no limitation of range of motion of the left hip joint , and a radiologic evaluation , including a computed tomography scan , showed no suspicious lesion , such as , hypertrophied cortical bone or a fracture line on the left proximal femoral shaft area . however , a bone scan showed increased uptake in the proximal femoral area just below the fixed plate ( fig . she was managed conservative treatment using analgesics , and the anti - osteoporosis medication was continued . in june 2011 , she was transferred from a local hospital due to left thigh pain . the fracture site was located at the contact margin at the end of the plate . the characteristics of fracture were cortical hypertrophy , medical spike , and a transverse fracture line , which are features commonly associated with atypical femoral subtrochanteric fracture . on the other hand , the fracture line is just distal to the dhs plate where the maximal stress is concentrated which is a definite feature commonly presented at stress related fatigue fracture . the fracture was fixed by replacing the 2 hole dhs plate with a with a 6 hole plate . alendronate was stopped after reoperation , and six months after the reoperation the patient was asymptomatic and the fracture had united without any complication ( fig . the above case report is limited in a specific situation that anti - resorptive medication such as bisphosphonate is prescribed for osteoporosis - related fracture after open reduction and internal fixation , but clinically not unusual . newly developed isiplateral subtrochanteric fractures in such patients could be induced not only previously fixated hardware but also anti - resorptive medication . both fatigue fracture due to stress concentration and bisphosphonate related insufficiency or atypical femoral fracture has similar feature of slowly progression . many authors have recommended that fatigue or insufficiency femoral fractures be treated by preventive internal fixation , because it is difficult to fix fracture sites.[4 - 6 ] therefore , the early diagnosis of undisplaced occult fracture is important in terms of starting appropriate treatment . mckiernan et al . concluded that a longer dual - energy x - ray absorptiometry femoral scan might be helpful for detecting atypical subtrochanteric femur fractures based on the idea that the femoral scan field would depict hypertrophied femoral cortex or a transverse fracture line . however , in our case , plain radiography and computed tomography showed no structural abnormality . only a bone scan detected the fracture prior to cortical bone change in the proximal femur . we were not able to perform magnetic resonance imaging due to the presence of the metal implant . in this case , the fracture initiated at just distal to the plate of dhs system . biomechanically , weight stress concentrates on the most distal margin of a plate after internal fixation . we consider that in our case , over - suppression of bone turnover interfered with normal bone healing after microfracture induced by stress concentration . to our knowledge , this is the first study to report on the development of an insufficiency or stress - induced fatigue femoral fracture and to describe the effectiveness of bone scan as early diagnostic modality . in retrospect , the bisphosphonate should have been stopped after we detected the insufficiency femoral fracture . puah and tan reported that a bisphosphonate - associated atypical fracture of the femur spontaneous heal after drug suspension and re - appeared after resumption . most studies that have addressed insufficiency femoral fractures have recommended that physicians should check plain femoral radiographs when patients with a history of long - term bisphosphonate medication complain of persistent thigh pain . we would add that a bone scan be added for early detection purposes when no structural bone abnormality is detected by plain radiography . in these situation , preventive internal fixation before development of displaced femoral fracture could be a beneficial . | a number of reports regarding atypical fractures of the femur have raised questions concerning the possible correlation between long - term bisphosphonate treatment and the occurrence of insufficiency fractures in the proximal femur . however , clinically , it is often confused whether is it a fatigue fracture because of implant induced stress concentration or a bisphosphonate - related atypical fracture , especially in a patient with a subtrochanteric fracture who receive bisphosphonate therapy after open reduction and internal fixation , such as dynamic hip screw ( dhs ) fixation for previous ipsilateral femoral neck or intertrochanteric fracture .
the authors experienced a case of a progressive femoral insufficiency fracture in a woman who had been on fosamax ( alendronic acid with vitamin d ; merck & co. inc , nj , usa ) therapy for four years after ipsilateral femoral neck fracture treated with a two hole dhs system . despite a high suspicion of an insufficiency femoral subtrochanteric fracture by bone scan , the occult fracture progressed to a displaced femoral subtrochanteric fracture one year after .
the fracture site was fixed with a 6 hole dhs plate , and six months after reoperation the patient had no symptoms and the fracture site had united without any complication . |
the abdominal organ herniation trough the right diaphragm is even rarer due to the liver protective function . the case reported concerns about a patient suffering from massive delayed right diaphragmatic hernia with right liver and bowel dislocation . a 41-year - old patient was referred to our emergency department with complaints of wheezing and cough since 1 month . during a previous admission , a diagnosis of right basal pneumonia his medical history was significant for motorcycle accident ~20 years before involving and bladder rupture . a chest x - ray revealed right basal consolidation with inhomogenous opacity at the medium and lower chest area . a computed tomography ( ct ) scan demonstrated massive right diaphragmatic hernia with dislocation of the liver that appeared overturned ~180 , transverse and ascending colon and part of small bowel ( fig . 1 ) .
figure 1:thorax and abdominal ct showing the dislocation of right upper abdominal viscera thorax and abdominal ct showing the dislocation of right upper abdominal viscera he was then admitted to the surgery department for a laparoscopic exploration that confirmed the radiological finding of inveterate right diaphragmatic hernia with an 8 cm defect . because of the impossibility to reduce the liver in abdomen , due to the thoracic adhesions , a right anterolateral thoracotomy was then performed . the liver was uneventfully reinstated and colon and small bowel were replaced in anatomical position . postoperative oxygen saturation was normal and a chest x - ray was performed before discharge and revealed complete re - expansion of the lung . the diaphragmatic hernia is the herniation of abdominal organs into the chest through a diaphragmatic defect . these can be congenital or acquired . acquired diaphragmatic hernia occurs , in most of the cases , as a result of blunt or penetrating thoraco - abdominal trauma . left hemidiphragmatic hernia is more common because liver exerts a protective function against the herniation of the viscera . herniation of the abdominal organs may be completely asymptomatic ; due to this reason , ~66% of diaphragmatic rupture are not recognized at the time of trauma . the chest negative pressure causes the gradual migration of abdominal contents leading to the onset of symptoms . we can classify this clinical condition in two types : type i ( early ) and type ii ( delayed ) . clinical presentation includes gastrointestinal symptoms ( abdominal pain , nausea , vomiting and sub - occlusion ) , respiratory ( dyspnea , orthopnea and chest pain ) or cardiocirculatory ( hemodynamic compromission ) [ 14 ] . the initial diagnostic tool is chest or abdominal x - ray but ct scan is the best modality to assess the extent of dislocation , the size of diaphragmatic defect and the belt - like constriction of abdominal contents , referred to as the collar sign . surgery is always necessary for the treatment ; the approach could be laparotomic / thoracotomic or minimal invasive . in our case , minimally invasive approach was used as a diagnostic tool in order to evaluate the diaphragmatic defect and choose the best approach ( thoracotomic or laparotomic ) . in delayed case , diagnosis may be a compulsory thoraco - abdominal approach in order to lyse adhesions between abdominal organs and thoracic structure . diagnosis of diaphragmatic hernia should always be considered in patient with chest or abdominal trauma because the mortality rate can reach 31% in the first 24 hours following the trauma . it should also be considered many years after trauma in case of onset of typical symptoms . | abstractright diaphragmatic hernia is an uncommon injury following abdominal trauma .
a case of delayed right post - traumatic diaphragmatic hernia is presented .
the patient referred us with wheezing and cough since 1 month .
a chest - abdominal computed tomography scan demonstrated a large diaphragmatic defect with liver and intestinal dislocation .
the patient underwent surgical intervention with diaphragmatic repair .
no complications were observed during admission and follow - up is actually negative for recurrence . |
tamoxifen , a selective estrogen receptor modulator ( serm ) is widely used in hormonal therapy for estrogen receptor - positive breast cancer . the side effects of tamoxifen usage include nausea , vomiting , hot flushes , skin rashes , alopecia and rarely thromboembolism . however , there are very few reports of acute pancreatitis due to tamoxifen - induced hypertriglyceridemia in the literature . a 50-year - old diabetic woman presented with stage iii , estrogen receptor - positive adenocarcinoma of the breast . she was on metformin ( 500 mg twice daily ) and her blood sugars and serum lipid levels were within the normal limits . she received three cycles of adriamycin - based neo - adjuvant chemotherapy followed by modified radical mastectomy . this was followed by three cycles of chemotherapy ( with cyclophosphamide , adriamycin and 5-fluorouracil ) and radiotherapy . three months later she presented with spontaneous onset of severe abdominal pain and vomiting of 5 days duration . on examination , her pulse rate was 115/minute , blood pressure 150/90 mmhg , respiratory rate 25/minute and temperature 100.2f . there was marked tenderness and guarding in the epigastric region and a hepatomegaly ( 2 cm below theright costal margin ) . pertinent laboratory values are as follows : serum amylase 778 iu / l , total cholesterol 785 mg / dl , triglycerides 4568 mg / dl , high - density lipoproteins ( hdl ) 12 mg / dl , alanine aminotransferase 35 iu / l , alkaline phosphatase 200iu / l , total bilirubin 0.8 mg / dl , fasting blood sugar ( fbs ) 166 mg / dl , post - lunch blood sugar ( plbs ) 285 mg / dl , hemoglobin 11.6 g / dl , total leukocyte count 16,500/mm with 85% neutrophils and c - reactive protein 15 ultrasonography of the abdomen showed a bulky pancreas and multiple peri - pancreatic and spleno - renal fluid collections . there were peripancreatic and left paracolic space collections communicating with pelvic and retroperitoneal spaces suggestive of acute pancreatitis [ figure 1 ] . contrast - enhanced computed tomography showing diffuse enlargement of the pancreas with heterogeneous enhancement and peripancreatic fluid collections hypertriglyceridemia secondary to tamoxifen usage was suspected as the cause of acute pancreatitis and the patient was treated with prompt withdrawal of the drug , intravenous fluids and analgesics for 5 days . simultaneously atorvastatin ( 10 mg once daily ) was stared to control the lipid levels . she showed a dramatic improvement with the resolution of her symptoms and return of lipid levels to normal by the end of 1month . the patient was started on letrozole ( 2.5 mg once daily ) and was under strict follow up . it can have a paradoxical estrogenic effect on lipid metabolism resulting in elevated triglyceride and chylomicron levels . increased blood levels of triglycerides causes lodging in pancreatic capillaries , resulting in ischemia and necrosis . the resultant release of pancreatic lipases causes release of free fatty acids from triglycerides followed by an inflammatory response . to our knowledge , the dosage of tamoxifen used in these reports was 20 mg / day in all but one case . in most cases , there was an antecedent history of dyslipidaemia which was lacking in the present case . however , it must be borne in mind that type 2 diabetes and dyslipidaemia may have a common genetic predisposition . the levels of triglycerides that precipitated acute pancreatitis ranged from 900 to 7000 mg / dl . the delay in the onset of symptoms in most of these reports was more than 6 months after initiation of therapy with tamoxifen . the outcome was favorable in most of these reports as was with the present case . an extensive overview on drug - induced pancreatitis by trivedi et al . was based on medication re - challenge to confirm association . however , in our patient no re - challenge was tried due to the fear of precipitating severe form of pancreatitis . a causal relationship with tamoxifen use could be established by the fact that there was no hypertriglyceridemia prior to the initiation of tamoxifen and withdrawal of the drug showed a prompt reversal . some clinicians recommend a reduced dose of tamoxifen ( 10 mg a day ) to lower the risk of hypertriglyceridemia . in a recent study , letrozole showed no significant adverse effects on serum lipid levels in women without hyperlipidaemia at baseline . a great deal of caution must be exercised and regular monitoring of lipid levels performed in predisposed individuals . at the first instance of suspicion , the drug should be discontinued and preferably no re - challenge tried due to risk of inducing acute severe pancreatitis . | tamoxifen has both antagonistic and agonistic tissue - specific actions .
it can have a paradoxical estrogenic effect on lipid metabolism resulting in elevated triglyceride and chylomicron levels .
this can cause life - threatening complications like acute pancreatitis . to our knowledge ,
very few cases of tamoxifen - induced pancreatitis have been reported in the literature .
we report a case of severe hypertriglyceridemia and acute pancreatitis following tamoxifen use .
a 50-year - old diabetic lady was on tamoxifen ( 20mg / day ) hormonal therapy for breast cancer . within 3 months of starting therapy , she developed hypertriglyceridemia and acute pancreatitis .
laboratory values include : serum amylase 778 iu / l , total cholesterol 785 mg / dl , triglycerides 4568 mg / dl and high - density lipoproteins ( hdl ) 12 mg / dl .
tamoxifen was substituted with letrozole and atorvastatin started .
there was a prompt reversal of the adverse effects .
effects on lipid profile must be considered while initiating tamoxifen in predisposed individuals as the consequences are life threatening . |
ketamine , a dissociative anesthetic agent , is an n - methyl - d - aspartate receptor antagonist . ketamine abusers presenting with severe dysuria , frequency , urgency , gross hematuria , and suprapubic pain have been reported worldwide since the first description by shahani et al . . performed augmentation enterocystoplasty ( ae ) in patients with a contracted bladder capacity of less than 100 ml to relieve refractory ketamine - associated bladder pain and lower urinary tract symptoms . ae has been found to be effective for improving symptoms in patients who have exhibited a sustained cessation of ketamine use . limited studies of pregnancy with a vaginal delivery or cesarean section after ae have been published [ 3 - 5 ] . herein , we report the first case of a successful vaginal delivery after ae for ketamine cystitis ( kc ) . a 28-year - old female abused approximately 5 mg of ketamine daily for 1 year starting at the age of 25 . she presented to our urology clinic with complaints of urinary frequency , intermittent gross hematuria , lower abdominal pain ( pain score , 8 out of 10 ) and frequent admissions due to acute pyelonephritis . a 2-day voiding diary revealed 27 voiding episodes in 24 hours and a maximum voided volume of 40 ml . a video urodynamic study revealed a contracted urinary bladder ( cystometric capacity , 39 ml ) without any vesicoureteral reflux . her baseline serum creatinine level was 0.6 mg / dl ( reference range < 1.2 mg / dl ) . a urine culture performed at her first visit showed growth of multidrug - resistant klebsiella pneumonia , which was managed with oral cephalosporins empirically and according to a drug sensitivity test . , uroflowmetry showed a bell - shaped curve with a maximum flow rate of 10.3 ml / sec and a voided volume of 144.7 ml . her antepartum course was uneventful without symptomatic urinary tract infections ( utis ) or other complications . she vaginally delivered a healthy male infant , 3,600 g in weight , 1.5 years after ae . this case demonstrates that sustained abstinence from ketamine allowed a successful ae procedure and led to a promising life with a pregnancy and successful vaginal delivery . effective ae for irreversible kc contributes to increased bladder capacity , minimal postvoid residual urine volume , decreased incidence of febrile utis , and significant relief of bladder pain . the current consensus on the effective treatment of kc is absolute abstinence from ketamine use . continuing users must set complete cessation of ketamine use as the ultimate goal for ae to be successful , since symptoms can flare up after the reuse of ketamine postoperatively . before proceeding to a surgical intervention for irreversible kc , serum creatinine levels , renal sonography , uroflowmetry , and postvoid residual urine volume by ultrasound should be evaluated . a cutoff value for the maximal bladder capacity of less than 100 ml has been suggested for ae . according to chung et al . , all 14 patients who underwent ae for kc had a bladder volume less than 100 ml . the bladder volume of the other 4 patients undergoing ae for kc reported by ng et al . was less than 50 ml . therefore , the review article published by jhang et al . suggested that patients with kc should undergo ae if their bladder capacity is less than 100 ml with low bladder compliance . in our experience , ae for neurogenic bladder due to tethered cord syndrome usually increases the bladder volume to 400 ml . this outcome has not been obtained in ae for kc . in the series published by chung et al . , the mean cystometric bladder capacity increased to 309.258.0 ml 3 to 6 months postoperatively . however , the poorest outcome was only 200 ml . in the series published by ng et al . , 2 patients had a bladder volume greater than 400 ml . however , the other 2 cases exhibited much smaller bladder volumes . one was 250 ml 30 months after ae , and the other one was 150 ml 6 months after ae . we did not remove the original bladder during ae . the remaining hypersensitive bladder in patients with kc might make the patients feel the urge to urinate more frequently than those with neurogenic bladder , who usually do not have intact bladder sensation . only a few case reports dealing with pregnancy and delivery after ae have been published [ 3 - 5 ] . pregnancy after ae is no longer a novel topic , but this is the first reported case of an exketamine abuser with a successful pregnancy after ae . most of the reported cases had the underlying disease of neurogenic bladder related to spinal problems . approximately 50%100% of patients with ae had asymptomatic bacteriuria , but only 4%43% exhibited significant utis . however , the risk of utis in pregnancy is greater due to anatomical changes . serial renal function tests and renal sonography to detect hydronephrosis should also be performed . assessing each patient even given the anatomical alterations that take place after ae , vaginal delivery is feasible for those with a normal continence mechanism . a urologist familiar with the anatomy of ae should be present to assist with cesarean sections in such patients . this case report demonstrated that a promising life with pregnancy and a vaginal delivery is possible following ketamine cessation and successful ae for ketamine - related bladder contracture . | a 28-year - old female with a 1-year history of ketamine abuse developed ketamine - associated urinary symptoms that were refractory to conservative treatment after the complete cessation of ketamine use .
smooth voiding with increased bladder capacity and minimal postvoid residual urine volume were achieved by performing an augmentation enterocystoplasty .
an uneventful pregnancy with the vaginal delivery of a healthy baby occurred postoperatively . |
psychocutaneous diseases can present either as primary psychiatric diseases such as dermatitis artefacta and delusions of parasitosis or as secondary psychiatric conditions such as depression , anxiety or social phobia due to chronic dermatoses like psoriasis , atopic dermatitis , alopecia areata . while in the former group , the diagnosis is usually straight forward , in the latter group such as psoriasis , atopic dermatitis etc the associated psychiatric co - morbidity may be missed or overlooked . unless the dermatologist has a special interest in mental health , in a busy practice , the relevant history is not sought . invisible mental disease in addition to the visible skin disease . in chronic skin diseases , patients feel stigmatized especially when lesions are widespread and may also experience depression . even in clinical remission , some may have anxiety about possible relapse in future . the relationship between mind and skin can be understood on the basis of the neuro - immuno - cutaneous - endocrine network . there is a dedicated european society of dermatology and psychiatry that holds a congress biennially . the association for psychocutaneous medicine of north american too holds regular meetings . in india , this subject has received scantattention . case reports and few studies appear from time to time . whilst dermatologists refer cases to psychiatrists , a dedicated liaison clinic is virtually unknown . we discuss the working pattern of the dermatology - psychiatry - clinical psychology liaison clinic set up at manipal in august 2010 . patients with chronic dermatoses such as psoriasis , eczema as well as those with primary psychiatric conditions were recruited by the dermatologist from the general dermatology out patients and referred to the liaison clinic which functions once weekly from 2:30 to 5:00 pm . the psychologist counseled all patients and if stressors were elicited , coping strategies were taught . both specialists discussed the case with the dermatologist and standard dermatologic treatment with or without psychopharmacologic agents and/or psychological interventions were advised . we examined 175 cases ( 117 females ; 58 males ) aged between 10 and 75 years maximum being in the second and third decade . out of 175 , primary dermatological cases constituted 154 ( 88% ) [ table 1 ] and primary psychiatric 21 ( 12% ) [ table 2 ] . the leading primary dermatosis was psoriasis in 40 ( 23% ) while the leading primary psychiatric disease was neurotic excoriations in 6 ( 3% ) patients . out of 92 ( 53% ) who needed psychologic interventions , only 25 ( 27% ) underwent the same . 12 patients ( 48% ) underwent one session while only 3 ( 12% ) had more than five sessions . forty seven patients ( 30% ) with primary dermatosis had an associated psychiatric diagnosis [ table 4 ] the most common being dysthymia in 22 ( 46% ) . the three leading dermatoses with psychiatric co - morbidity were psoriasis , prurigo / generalized pruritus and chronic dermatitis . a major advantage of a combined clinic is the prompt availability of a psychiatrist , dermatologist and a clinical psychologist at a single visit . the stigma of visiting the psychiatry department although has lessened in recent time , stillexists . our clinic functions in an informal manner without any inhibitions for patients about meeting a mental health professional as there are no boards mentioning the designations of the liaison specialists . the number of patients examined can not exceed four or five as detailed interviews are carried out . a level - one dermatologist is a well informed specialist who can treat psychocutaneous diseases but does not bring about psychological change in the patient while a level two dermatologist is one who liaises with a clinical psychologist or psychiatrist bringing about psychological changes . by liaisoning , patient can be treated in a holistic fashion thereby addressing both the psychological and the physical needs . in our study although stress has been implicated in several dermatoses , psoriasis is the one which is mostly associated with . stress induced derangements of epidermal function may precipitate inflammatory dermatoses . nonpharmacologic interventions are stress reducing adjuncts that can enhance the efficacy of standard dermatogic therapies . some of the therapies useful in dermatologic patients are biofeedback , relaxation training , hypnosis and psycho - education . in our study majority of patients were non - compliant with psychological interventions . probably they did not realize the benefit or were not keen on attending the clinical psychology department . this underscores the need for dermatologists to master selected psychological techniques such as relaxation which can easily be taught to patients in the office . 30% of our patients had psychiatric comorbidity which is in agreement with several studies in psychodermatology . in conclusion , dermatologist should liaise with psychiatrists or clinical psychologists when managing psychosomatic dermatoses . in university teaching hospitals dermatologists should familiarize with selected psychopharmacological drugs and simple nonpharmacologic interventions . screening for common psychiatric conditions such as anxiety and depression | psychodermatology is an emerging specialty in dermatology which deals with the interactions between mind and skin .
psychocutaneous diseases can be either primary psychiatric or primary cutaneous , with various degrees of associations between psyche and skin . unless the dermatologist cultivates a special interest in this field , many an invisible mental disorder may be missed leading to sub optimal treatment of the visible skin condition . though dermatology psychiatry liaison clinics are common in europe and other western countries , it is just an emerging concept in india .
here we describe the working pattern of psychodermatology liaison clinic established in manipal in august 2010 and describe briefly the type of cases attended to . |
in this issue of critical care , yildiz and colleagues reported the first randomized , controlled trial on the efficacy and safety of physiologic doses of steroids in severe sepsis . during the past 5 years , five phase ii trials and a phase iii placebo - controlled trial on cortisol replacement , i.e. prolonged treatment with physiologic doses of steroids , have been completed in patients with vasopressor - dependent septic shock ( table 1 ) . two of them have already been published in peer - reviewed journals , three have been published in abstract form and will be published shortly in peer reviewed journals , and the results of a phase ii trial that has just been completed will be available very soon ( oppert and colleagues , personal communication ) . these trials have consistently shown beneficial effects of cortisol replacement on the amount of vasopressors , on the duration of shock , on the duration and intensity of organ dysfunction , and on the intensity of the systemic inflammatory response . the survival benefit observed with cortisol replacement in several phase ii trials was recently confirmed by the phase iii trial . in all these trials , cortisol replacement was never associated with even a trend toward serious side effects . a confirmatory phase iii , multinational , placebo - controlled trial ( the corticus study ) is under way , and results should be available within the next 3 years . in the meantime , given the consistency of the results across available trials , cortisol replacement should be considered as a standard of care for patients with vasopressor - dependent septic shock . yildiz and colleagues found that , in patients with severe sepsis , irrespective of the need for vasopressors , treatment for 10 days with prednisolone given intravenously twice daily ( 5 mg at 6 a.m. and 2.5 mg at 6 p.m. ) was associated with a 20% absolute reduction in mortality within 28 days . these findings are very challenging , because they suggest that cortisol replacement might be introduced in severe sepsis as well as in vasopressor - dependent septic shock , and that the mechanisms underlying the favorable effects of the treatment might not be limited to a reduction of the need for vasopressors . obviously , a phase iii trial must be set up to confirm the potential survival benefit of cortisol replacement in patients with severe sepsis who are not vasopressor - dependent . recently completed randomized , controlled trials of cortisol replacement in septic shock the study by yildiz and colleagues addressed another important issue , i.e. the need for an adrenocorticotropic hormone ( acth ) test to identify patients with severe sepsis or septic shock who will benefit from cortisol replacement . in this small trial , the effects of steroids were not significantly altered by the results of a short acth test . however , there were only 14 nonresponders ( 5 in the steroid group and 9 in the placebo group ) to the test , i.e. a cortisol increment after a 250-g intravenous bolus of acth of less than 9 g / dl , as previously defined . subsequently , in this subset of patients with occult adrenal insufficiency , the 15.6% absolute reduction in 28-day mortality in favor of the steroid group was not statistically significant . among the six completed trials of cortisol replacement in septic shock , only two reported separate data according to the results of a short corticotropin test , and only one trial was adequately powered to assess the survival benefit of cortisol replacement in patients with occult adrenal insufficiency . in fact , in this trial , cortisol replacement dramatically improved rates of survival for 28 days in the intensive care unit or elsewhere in the hospital in the nonresponders to the acth test but not in those having an increase in cortisol levels of more than 9 g / dl after acth . however , this trial was not adequately powered to allow definite conclusions regarding patients deemed to have normal cortisol response to acth and we therefore need to wait for the results of the corticus study . in the meantime , cortisol replacement should be considered only in vasopressor - dependent septic shock with occult adrenal insufficiency . as the results of the acth test might not be available everywhere at all times , it is recommended that cortisol replacement be started immediately after the acth test is performed , and that in the light of the results of the test , treatment could be continued for up to 7 days in nonresponders and stopped in patients with normal cortisol response to acth . | based on several recently completed randomized controlled trials , cortisol replacement is likely to become a standard of care for vasopressor dependent septic shock .
further studies are needed in order to accomplish whether this treatment should be limited to patients with a blunted cortisol response to corticotrophin . similarly , in patients with severe sepsis who do not need vasopressors , the benefit / risk ratio of cortisol replacement remains to be assessed . |
compared with the general population , adults with intellectual disability experience significant healthcare inequalities including general health screening , mental health support , women 's health screening , and oral healthcare services , and this equally applies to adolescents with intellectual disability [ 2 , 3 ] . the majority of australian adolescents ( 1119 years ) with intellectual disability live with their parents who have the responsibility for the healthcare of their adolescent child [ 4 , 5 ] . parents are concerned about the health of their adolescents with intellectual disability [ 69 ] especially when they can no longer care for them . as adolescents transition out of specialist - based pediatric care , they move to the primary care system and general medical practitioners ( gps ) ; this creates additional parental concerns about their child 's health [ 11 , 12 ] . gps have expressed concern at being expected to take on a similarly intensive role . this study states the major themes expressed by parents regarding the health of their adolescent with intellectual disability . during a cross - sectional descriptive study which examined the effect of health interventions , interviews with parents were undertaken . this was a six - month cross - sectional descriptive study with qualitative and quantitative data collected . qualitative data was collected from adolescents with intellectual disability , parents , and the adolescents ' teachers . were asked about the three main health issues relevant to their adolescent in the next ten years . thirty - two parents participated , of which 31 were mothers , with a mean age of 46 years , with 21% having tertiary qualifications . they were employed in a range of occupations including home duties , teaching , small business , retail , and nursing . their adolescent children were described through gp notes and parent / teacher reporting as having mild ( 3/32 ) , moderate ( 17/32 ) , severe ( 11/32 ) , and profound ( 1/32 ) intellectual disability . only 33% ( 11/32 ) said that their children were strong and healthy and they had no concerns for the future , and 58% ( 18/32 ) said that there were particular areas of their children 's health that made them anxious about the future , those being dependency , general health , challenging behaviour , and increasing support needs . parents made practical observations about the capacity of their children 's independence in future health decisions : he will always be very dependent on us , and the resources we provide and the professional advice we seek . a few parents spoke of independence and how the future was not such a worry for them . the ( health ) diary ( the study intervention ) is his way of telling people about his health without his mum having to talk all the time . there were additional concerns about management of medication , epilepsy management , staying healthy mentally , mobility reduction over time , getting herself to and from the doctor 's when she is not feeling well and knowing when to go , moving her from the child health to adult health system , and maintenance of health checks . another added that her main concern was that of anger management and another because parents perceived that they will need support for their own health as they age : support structures we will need support in place as he and i get older ; advocacy someone else needs to be aware of his health needs ; someone else to know his normal health - related patterns would be helpful . as his primary care - provider these findings are not a comprehensive list of parental concerns , but they contribute to our common understanding of parental health concerns for the future of their adolescent with intellectual disability . | background . parents of adolescents with intellectual disability are concerned about the future health and well - being needs of their children . method .
qualitative data was collected as part of a cross - sectional descriptive study and semi - structured interviews were conducted with 32 parents .
the results were themed . results .
most parents discussed areas of their children 's health which made them anxious about the future .
these concerns were collated into five themes .
conclusion .
the health and well - being themes were dependency , general health , challenging behaviours , and increasing support needs . |
with the rapid progress being made in genome sciences , effective genome engineering holds great promise both in understanding the molecular bases of human diseases and in treating human disorders with identifiable alterations in the genome . since the advent of the effective but clumsy zinc - finger nuclease - based talen ( transcription activator - like effector nucleases ) technology the past few years have witnessed a rapid rise of the rna - guided crispr / cas9 technology from obscurity . crisprs ( clustered regularly - interspaced short palindromic repeats ) are segments of prokaryotic dna containing short sequence repetitions , while bacterial endonuclease cas9 can be programed by a small guide rna ( grna ) to induce a double - strand break at a desired genomic locus that is followed by a protospacer - adjacent motif ( pam ) . the resulting double - strand break can either be repaired by homology - directed repair ( hdr ) or by non - homologous end joining ( nhej ) , which is usually imprecise , resulting in small insertions or deletions ( indels ) . significant efforts are being devoted to optimizing the current crispr / cas9 system and/or to identifying more cas9-like nucleases with better efficiency and specificity . however , a recent report might have changed the landscape of genome - editing technologies . gao f. , et al identified a member of the argonaute endonuclease family , called natronobacterium gregoryi argonaute ( ngago ) , which was shown to effectively carry out dna - guided genome editing in mammalian cells . the argonautes are a family of endonucleases that use 5-phosphorylated short single - stranded nucleic acids as guides to cleave targets . several argonautes isolated from thermophiles can use single - stranded ( ss ) dna guides to cleave dna targets at high temperature . in their study , gao f. , et al demonstrated that the ngago endonuclease was able to bind 5-phosphorylated single - stranded guide dna ( gdna ) of ~24 nucleotides and efficiently generate gdna sequence - specific dna double - stranded breaks at 37 c . ngago was shown to remove several nucleotides in the target region , although it seemingly does not have any exonuclease activity . by assessing the ability of 47 different ssdna guides targeting eight genes in the human genome , the authors subsequently demonstrated that the ngago gdna system exhibited a low tolerance to guide target mismatches , as mismatches between the ssdna guide and target reduced the efficiency of cleavage . a comprehensive analysis of single mismatches at all 24 positions revealed that all positions were important , with positions 8 - 11 being particularly important , and that the presence of three consecutive mismatches eliminated all activity . the authors further showed that ngago , unlike crispr / cas9 , was highly efficient in editing almost any sequence , including g / c - rich genomic sequences . while still at an early development stage , ngago has the following distinctions and potential advantages over the crispr / cas9 system : ( 1 ) ngago utilizes 5-phosphorylated ssdna guides ( ~24 bp ) to cleave supercoiled dna ; ( 2 ) mammalian cells have very low levels of 5p - ssdna , eliminating the possible presence of off - target guides for ngago ; ( 3 ) ngago is seemingly more specific than cas9 , as it completely loses activity when there are three mismatches ; ( 4 ) ngago was about as effective as , if not more effective than cas9 for dna cleavage in mammalian cells ; ( 5 ) ngago is a smaller protein , which is easier to express ; and ( 6 ) ngago does not require a pam and can target gc - rich genomic loci with high efficiency . nonetheless , much more needs to be learned about the ngago system before any conclusions can be drawn about its potential applications . while the use of 5-phosphorylated ssdna as a guide provides a simple and convenient means for in vitro cell - based genome editing , this may limit ngago s utility for in vivo genome engineering unless approaches for efficient and targeted delivery of ssdna guides are devised . it remains to be fully investigated whether ngago can effectively mediate homology - directed recombination with similar or better efficiency compared with crispr / cas9 . it s conceivable that more ngago - like proteins will be found in future studies . for much of the scientific community however it is not important to determine whether ngago will out - compete crispr / cas9 , or vice versa . | while crispr / cas9-mediated genome editing technology has been experiencing a rapid transformation during the past few years , a recent report on ngago - mediated single - stranded dna - guided genome editing may offer an attractive alternative for genome manipulation .
while it s too early to predict whether ngago will be able to compete with or be superior to crispr / cas9 , the scientific community is anxiously waiting for further optimization and broader applications of the ngago genome editing technology . |
the demographic revolution that is sweeping across industrialized countries will dramatically increase the absolute number of older individuals over the next 40 years . identifying patients most likely to benefit from critical care is essential , both to prevent suffering related to unnecessary treatments and to ensure optimal use of finite resources . quality of life may be of greater concern for the elderly than for younger individuals . in this issue of critical care , de rootj et al . review recent data on outcomes of elderly patients admitted to intensive care units ( icus ) , discussing the impact of age , diagnosis , pre - admission functional status and patients ' preferences regarding life - sustaining treatments . they suggest that developing a specific score for predicting long - term outcomes in elderly icu patients would help intensivists identify those patients most likely to benefit from icu admission and would aid decision - making with the patient or relatives . the outcome of elderly patients after icu admission is a complex issue and the quality of survival may be as important as the quantity of survival . as highlighted by de rootj et al . , available outcome studies are heterogeneous , have included various age groups [ 2 - 5 ] and have rarely evaluated the influence of pre - hospital disability . in this editorial , we will discuss two important aspects . , studies that have assessed outcomes of elderly patients have included admitted patients instead of patients triaged for icu admission . patients with severe impairments and the very oldest may be under - represented among admitted patients , which would bias the results toward better outcomes . although age per se is an important determinant of hospital mortality , the most important determinant of icu mortality is severity of the acute illness , as shown by studies taking this important factor into account , ( see , for example ) . age and severe disability have major effects on long - term outcomes . in studies of triaged patients [ 6 - 10 ] , age was an independent factor of icu refusal with non - surgical disease and self sufficiency . the impact of triage , the lack of scoring systems specifically designed for elderly patients and the poor performance of available scores complicate comparisons of outcome studies . evaluating the lack of chance possibly associated with denial of icu admission in older patients is difficult , given the limited reliability of severity scores for predicting hospital mortality . in the overall triaged population , patients with intermediate severity of illness who are denied icu admission have high standardized mortality ratios ( ratio of observed mortality over predicted mortality ) . triage is extremely challenging in older patients , as there is often a complex combination of acute and chronic diseases associated with physical impairments and psychological distress . in this setting , a specific score would be of great interest to quantify two key aspects : the lack of chance associated with icu refusal and prediction of outcomes , including functional dependency , after icu admission . the second important aspect concerns one of the greatest challenges regarding care of the elderly , which is to assist patients in deciding what treatments they want to receive should they experience a life - threatening condition . older patients who survive critical illness at the cost of losing their self sufficiency are frequently distressed by the burden they feel that they impose on their family . as reported by de rootj et al . , the patient 's wishes are usually unknown at the time of triaging to the icu , for reasons including acute cognitive impairment , absence of advance directives , absence of a primary - care physician or under - recognition of pre - existing cognitive impairment . inaccurate estimates by intensivists of patients ' willingness to receive life - sustaining treatment may adversely affect quality of care . characteristics of the patient , including self sufficiency and quality of life , show no correlation with wishes regarding icu admission . even patients with only a small chance of recovery may want to be admitted . in countries where medical paternalism remains an obstacle to patient autonomy , physicians must work harder on encouraging patients with chronic diseases to think about their preferences and to communicate their wishes to their doctors or relatives , in order to improve the match between what they want and what they receive . both the general public and healthcare professionals are interested in the epidemiology of outcomes , social burdens related to care and quality of life in older patients . an improved scoring system would provide new knowledge on the prognosis of older patients with critical illness , thereby improving quality of care . | because the need for intensive care exceeds its availability in several countries , intensivists must admit those patients most likely to benefit .
intensive care unit admissions of elderly patients will increase substantially in the near future . decreased self sufficiency and quality of life are common after hospitalization in older patients and they may require discharge to a nursing home , although some patients feel that life in a nursing home would be worse than dying .
we have much to learn about matching the use of life - supporting treatments to the health - related values of older patients . a specific outcome - prediction score for older patients would help improve quality of care . |
distribution of mullerian anomaly is septet ( 34% ) , bicornuate ( 39% ) , didelphic ( 11% ) , arcuate ( 7% ) , unicorn ( 5% ) , hypoplastic and aplastic and other forms ( 4% ) . uterine didelphys ( class iii ) anomaly is distinguished from bicornuate and septate uteri by the presence of complete non - fusion of the cervix and hemiuterine cavity . heinonen reported that all 26 women with a uterine didelphys had a longitudinal vaginal septum as well . there was preterm delivery in 20% , fetal growth restriction in 10% , and breech presentation in 43% . in a study of tzialidou , predominance of imperforated hemivagina : 69.2% right - sided versus 30.8% left sided septum ; 84.6% previous surgical interventions in the study group , such as partial removal of the septum and re - obliteration , unilateral salpingo - ovariectomy and vaginal drainage of pyometra . they used a single transvaginal surgical procedure , including the removal of the obstructed vaginal septum and marsupialization of the blind hemivagina . here , we report a case of a 19-year - old female patient with complaint of dysmenorrheal , spotting , and severe abdominal pain since past 6 months . the patient also complained that after finishing her last menstruation cycle in november 2012 , she had spotting for 50 days . as she was virgin , no physicians examined her hymen or urogenital area . in some sonographic reports hematocolpos of course , bicornuate uterus and collection of clot in the left horn and cervix was seen too . because of this reason the patient had menstruation cycle from one horn of uterus , but another horn was blocked by an oblique septum so it makes for her hematocolpos and hematometra . finally , magnetic resonance imaging ( mri ) was requested for the patient . in mri mri for hematometra because of transverse vaginal septum as the patient was virgin and virginity in iran has ethical and legal importance , she was examined by giving her a legal certificate from the official physicians , under general anesthesia in alzahra hospital operating room in december 2012 . bicornuate uterus and vaginal septum are congenital defect of the female genital tract . according to the american fertility society classification of mullerian duct anomalies , mullerian anomaly is divided in to seven classes ( unicorn , bicorn , septate , arcuate , didelphys , hypoplastic and apalastic , associated with des ) . external fundal depressions of variable depths are associating with a septate uterus , indicating the coexistence of the two anomalies . sergio is present in the patient with severe dysmenorrheal with septate uterus and cervical duplication and longitudinal vaginal septum . bicornuate uterus can be diagnosis by method of sonography , mri , hsg , hysteroscopy and laparoscopy . bicornuate uterus could be one of the causes of female infertility , the woman can conceive . singh et al , presented the pregnant woman with bicornuate uterus that presented with acute abdomen rule of ectopic pregnancy . also nepal department of obstetrics and gynecology presented the woman with term pregnancy with complete bicornuate uterus and with complete longitudinal vaginal septum . in a case report study of kumar et al , the mri showed bicornuate uterus and cervical agenesis . hysterectomy and repair of the uterovesical fistula was done . | bicornuate uterus has two symmetric uterine cavities that are fused caudally and have some degree of communication between two cavities , usually at the uterine isthmus .
a complete bicornuate uterus has a seperatory cleft of tissue that is extended to the internal os .
lesser degree of septation of the two uterine horns has constitution , a partial bicornuate uterus .
bicornuate uterus is a class of four anomaly of american fertility society classification of mullerian anomalies .
here we report a case of a 19-year - old female patient with complaint of abdominal pain and spotting since 4 months ago .
in sonography it revealed bicornuate uterus and hematocolpos .
the patient underwent general anesthesia and examination that reveal the transverse vaginal septum .
septum removed by resectoscope was successful . |
a 62-year - old man had a transient loss of consciousness ( tloc ) whilst driving . the initial electrocardiogram ( ecg ) ( figure 1a ) was felt to be suggestive of a type 1 brugada and he was admitted for consideration of implantable cardioverter defibrillator ( icd ) implantation . cardiac mr imaging ( cmr ) confirmed the wall motion abnormality and showed a significant area of late subendocardial gadolinium enhancement ( lge ) consistent with an infarct . a cardiac computed tomography ( ct ) showed a zero calcium score and again confirmed normal coronary arteries and an area of hypo enhancement ( figure 1b ) consistent with infarction similar to the lge on cmr . an ajmaline test was carried out and was felt to be negative ( figure 1c ) . it is assumed he suffered a previous silent myocardial infarction in the presence of normal coronary arteries and this resulted in a brugada pattern ecg . careful subsequent review revealed that the type 1 pattern was actually only present in v1 , thus not fulfilling the consensus conference criteria . the cause of the tloc is unknown but he has remained asymptomatic for over 12 months and has resumed driving .
figure 1a ) initial electrocardiogram , suggestive of a type 1 brugada ; b ) cardiac computed tomography , showing an area of hypo enhancement consistent with infarction ; c ) a negative ajmaline test . a ) initial electrocardiogram , suggestive of a type 1 brugada ; b ) cardiac computed tomography , showing an area of hypo enhancement consistent with infarction ; c ) a negative ajmaline test . brugada syndrome is a familial autosomal dominant disease , which has an increased risk of sudden cardiac death and may present with a history of syncope . the diagnosis is made on the ecg showing characteristic cove - shaped st elevation in leads v(1 ) to v(3 ) in the absence of structural heart disease , electrolyte disturbance or ischaemia . type 1 is characterised by a prominent coved st elevation ( > 2 mm above baseline ) followed by a negative t wave in lead v1-v3 and this pattern must be in more than 1 lead . type 2 has a high take off pattern , but has a gradually descending st segment elevation ( > 1 mm above baseline ) with either a positive or biphasic t wave in leads v1-v3 . type 3 has right precordial st segment elevation ( > 1 mm above baseline ) , which is either coved , or saddle back shaped . however , both type 2 and 3 electrocardiogram patterns are no longer considered to be a true brugada syndrome . the ecg pattern is important to identify as the first manifestation of the disease maybe sudden death and this is usually due to either ventricular tachycardia of ventricular fibrillation . it is important to identify which type of brugada pattern is present : type 1 carries a high probability for the disease . the diagnosis of suspected brugada syndrome can be difficult and a type 2 or 3 pattern may only manifest after administration of a sodium channel blocker such as ajmaline . syncope in a patient with a brugada syndrome channelopathy carries significant prognostic implications and warrants consideration of icd implantation . brugada pattern ecg 's have been described with exposure to various chemical agents including certain antibiotics , cocaine and may also be unmasked by respiration or fever . there are multiple causes other than cardiac ischaemia for acquired st elevation in the right precordial leads . in some healthy young people , particularly black men , the st segment can be elevated by 14 mm and this is a normal variant . in addition , left bundle branch block , early repolarisation and ventricular hypertrophy can cause st segment elevation in the right precordial leads . in our case the patient had an ecg pattern , which was suggestive of a type 1 brugada syndrome , and a history of syncope . he was thoroughly investigated with ajmaline testing and ventricular stimulation , which were all normal . the ajmaline test was undertaken to try and confirm the diagnosis , as there was only a suspicion of type 1 brugada syndrome , as it did not fully fit the diagnostic criteria . brugada syndrome can only be diagnosed after elimination of both cardiac and extra cardiac causes . this case highlights the possibility that an underlying structural abnormality may be responsible for a brugada like ecg in the absence of a channelopathy . it is rare for myocardial infarction to cause chronically raised st segments without an aneurysm , but this can occur . having excluded coronary ischaemia with a normal coronary angiogram and ct calcium score , the patient was further investigated with a cardiac mr , which confirmed a wall motion abnormality and showed a significant area of late subendocardial gadolinium enhancement ( lge ) consistent with an infarct . generally an acute anteroseptal or isolated right ventricular myocardial infarction will lead to the electrocardiogram changes seen in our case . we concluded that the patient suffered a previous silent myocardial infarction in the presence of normal coronary arteries and this resulted in a brugada pattern ecg . in addition , if a patient presents with a suspicious ecg and a history of transient loss of consciousness they should be investigated fully so brugada syndrome is not missed . however , great care in ecg interpretation with careful reference to the consensus conference criteria is essential . | syncope in a patient with a brugada syndrome channelopathy carries significant prognostic implications and warrants consideration of implantable cardioverter defibrillator ( icd ) implantation .
we report a case of a 62-year - old gentleman who presented with a transient loss of consciousness and an electrocardiogram ( ecg ) suggestive of type 1 brugada syndrome .
further investigation revealed evidence of a silent myocardial infarction and negative ventricular tachycardia stimulation and ajmaline testing .
careful review of the ecg 's subsequently showed the type 1 pattern was present in only v1 . |
percutaneous vertebroplasty ( pvp ) is now widely used for the treatment of many painful vertebral compression fractures , which are secondary to osteoporosis , multiple myeloma , metastatic tumors , and hemangioma ( 1 ) . severe complications are rare and most are related to the leakage of the bone cement into the spinal canal or the perivertebral venous system ( 1 ) . here we present an interesting case of cement leakage into the venous system during pvp , extending into the inferior vena cava ( ivc ) and then being trapped within a previously placed ivc filter . a 58-year - old female patient with a 1 year history of lung cancer was referred to our department for low back pain , left lower - limb swelling , cough and expectoration . her low back pain was getting aggravated and the pain could not be controlled by analgesics . computed tomography ( ct ) scan of spine revealed osteolytic metastatic lesion in the body of l4 without paravertebral space involvement . ultrasound examination revealed free thrombus in the left iliac - femoral vein . to prevent pulmonary embolism ( pe ) , a permanent ivc filter ( optease , cordis , roden , the netherlands ) was inserted in the ivc , before pvp was scheduled . the pvp procedure was performed under local anesthesia , by using a unilateral approach with a 13-gauge needle ( osteo - site , cook , bloomington , in , usa ) , and it was guided by a digital subtraction angiography ( dsa ) fluoroscopy . when the needle tip reached the one third of the anterior l4 vertebral body , intraosseous venography was performed , which showed a rapid venous filling ( fig . 1a ) : contrast material exited though the anterior external vertebral venous plexuses and emptied into the ivc . we repositioned the needle tip to avoid extravasation . the cement ( coriplast 3 , corin medical , gloucestershire , uk ) was prepared by mixing a 2 g of sterile barium sulfate powder ( made by our hospital ) for opacification , and was injected with a simple syringe during a paste - like viscosity . when the l4 vertebral body was nearly filled , fluoroscopy showed cement leaking into the ivc , and migrating to the filter ( fig . the injection of the cement was interrupted immediately ; a total of 5 ml bone cement had been injected . the low - molecular - weight heparin was given subcutaneously for 3 days after the pvp procedure , and was replaced by warfarin later . after the procedure of pvp , the low back pain of the patient was obviously released . she was discharged 10 days after pvp , and was followed - up at our outpatient department . there were no complications that occurred , which related to the filter , within the 8 months of follow - up . cement leakage is the most frequently reported complication of pvp . the rate of cement leakage , outside the vertebral body , is reported to be 73% , and the rate of venous leakage cases is up to 24% ( 2 ) . although most patients with minor leaks are without symptoms , some disastrous consequences have still been reported ( table 1 ) . inferior vena cava filter is a useful device to prevent pe in patients with deep - vein thrombosis . however , cases with foreign materials being trapped in the filter have not been reported frequently . to the best of our knowledge , there are only two cases of cement getting trapped in filters after pvp or kyphoplasty , reported in the previous literature ( 11 , 12 ) . in herbstreit 's report ( 11 ) , the follow - up ct scan on several days after pvp showed cement reaching the ivc and rendering the filter unremovable in the usual fashion . in agko 's report ( 12 ) , abdominal x - rays at eight weeks follow - up showed that the cement fragment embolized the caval filter . in our report , dsa fluoroscopy observed the whole process that cement migrating into the ivc and being captured in the filter . it is the direct evidence that filter can capture bone cement and prevent it from migrating to the pulmonary circulation . in herbstreit 's report ( 11 ) , removal of the cemented filter via endovascular technology was impossible and the patient underwent cavotomy and surgical extraction of the filter . in our report , due to the history of malignancy , there was no evidence of ivc syndrome , ivc perforation , or pe presented in the procedure and follow - up . surgical attempt at the retrieval of the fiter may pose a prohibitive risk in our case . as such , we decided to administer an anticoagulant treatment , and ask the patient to follow up at the outpatient department . the patient 's left lower - limb swelling subsided 1 week later and there were no complications related to the filter at the 8 months follow - up . some authors emphasized that venography does not preclude the cement leakage exactly because of the difference of viscosity between the contrast material and bone cement . some reports demonstrated no significant differences in the frequency or amount of cement leakage and no differences in the clinical outcome between venography and no venography ( 13 , 14 ) . however , some authors advocated using an antecedent venography to confirm the needle position in the trabecular space , to outline the venous outflow pattern , and to show where to look for the cement migration . we conformed to the latter perspective ( 15 ) . in this case , the direction of cement migration was coincident with the venous blood flow , detected by a venography , which indicated that intraosseous venography predicted the direction of venous cement leakage effectively . according to our experience , cement leakage happened more often in patients with draining veins , which appeared ahead of time on a venography ( 15 ) . in this case , the antecedent venography showed rapid venous filling , which reminded us to prevent cement leakage . bhatia recommended a routine pre - injection of the gelatin clotting agent to reduce the cement leakage during pvp ( 16 ) . in our opinion , this method is more suitable to the vertebrae with rapid venous flow , such as the status of this patient . if this method was used in this patient , venous leakage would have been avoided . in summary , this interesting case illustrates that ivc filter could capture bone cement and prevent it from migrating to the pulmonary circulation . vertebral body venography could predict the direction of the bone cement leakage to the veins , effectively . | a 58-year - old female patient , diagnosed with adenocarcinoma of the lung , underwent percutaneous vertebroplasty at the l4 vertebral body due to painful spinal metastases . because of deep venous thrombosis of the left femoral and iliac veins , an inferior vena cava filter had been placed before vertebroplasty .
bone cement migrated into the venous bloodstream and then was being trapped within the previously placed filter .
this case illustrates that caval filter could capture the bone cement and prevent it from migrating to the pulmonary circulation . |
a 33-year - old male patient reported with chief complaint of a growth on the lower lip since 15 days . the growth was initially small when the patient had first noticed it , but had grown rapidly to attain the present size . clinical examination revealed a well - defined , solitary , pedunculated mass on the lower labial mucosa , facing the incisal margins of lower anteriors . on palpation , the growth was firm in consistency , non - tender , and showed minimal bleeding [ figure 1 ] . solitary , pedunculated mass around 32 cms seen on the lower labial mucosa hard tissue examination revealed generalized attrition which was marked in the lower anteriors . also observed was crowding of lower anteriors causing lingual displacement of 32 and 42 . generalized hard and soft deposits along with stains were also seen particularly in relation to the lower anteriors , indicating a poor oral hygiene . based on the history and clinical examination , a provisional diagnosis of pyogenic granuloma was made and the growth was excised under local anesthesia . histopathologic examination revealed a granulation tissue with proliferation of endothelial cells forming budding capillaries which contained erythrocytes , observed toward the center of the tissue . surface of the growth was devoid of epithelium and was covered by a fibropurulent membrane . the connective tissue comprised delicate collagenous fibers with infiltration of acute and chronic inflammatory cells , chiefly neutrophils and lymphocytes . these findings were consistent with a histopathologic diagnosis of pyogenic granuloma [ figures 2 and 3 ] . low - power view showing ulcerated surface with connective comprising numerous proliferating blood vessels with chronic inflammatory cells ( h and e , 10 ) high - power view showing blood vessels lined by endothelial cells , filled with rbc , proliferating into the connective tissue ( h and e , 40 ) pyogenic granuloma of the oral cavity is a relatively common entity first described by poncet and dor in 1897 as human botryomycosis . pyogenic granulomas commonly occur in the gingiva ( keratinized mucosa ) , often in the anterior segment of the maxillary jaw . other sites in the head and neck occurring extragingivally in which the lesion tends to occur as a result of trauma include the buccal mucosa , the alveolar mucosa of edentulous ridge , the palate , and the lower lip , which are very rare . the floor of the mouth has not been reported as a site as the tongue provides protection against any traumatic injuries and also due to lack of sufficient connective tissue in the mucosa of this region . in the present case , the consistent trauma inflicted by the sharp attrited edges of the lower incisors could have been the etiology behind the development of this lesion . the reasons attributed to such connective proliferations vary from trauma to hormonal factors , which along with poor oral hygiene cause gingival irritation and inflammation and contribute to the development . clinically , the lesion typically appears as red to purple nodular growth depending upon the duration and vascularity of the lesion . the surface of the lesion can show areas of erythema or ulcerations , as was seen in the present case , which indicate impingement of the adjacent teeth during functions such as mastication or speech . although pyogenic granuloma can be diagnosed clinically , atypical presentations lead to inappropriate diagnosis and should be further investigated by biopsy to rule any other serious lesions . the histopathology of extragingival pyogenic granuloma is similar to that occurring in the gingiva , showing proliferating vascular core in connective tissue stroma with the presence of acute or chronic inflammatory infiltrates depending on the etiology and duration and of the lesion . pyogenic granuloma is treated conservatively by surgical excision and must be followed with oral prophylaxis for lesions occurring on the gingiva . the most common etiology for extragingival lesions being trauma or consistent irritation should be treated . other forms of treatment such as nd : yag laser , flash lamp pulsed dye laser , cryosurgery , intralesional injection of ethanol or corticosteroid , and sodium tetradecyl sulfate sclerotherapy have also been proposed . recurrence rate is not infrequent which might be due to incomplete excision , failure to remove predisposing factors , or re - injury of the region . lesions seen on the gingiva must be excised down to the underlying periosteum and etiologic factors must be eliminated in order to achieve a lower recurrence rate . | pyogenic granuloma is tumor - like proliferation to a nonspecific infection . clinically , pyogenic granuloma presents as sessile or pedunculated exophytic mass with a smooth or lobulated surface which has a tendency to bleed easily .
these lesions tend to occur slightly more in females , frequently involving the gingiva of the maxillary region .
histologically , these lesions show an excessive proliferation of vascular type of connective tissue to a nonspecific infection .
the most common treatment is surgical excision with eradication of local irritants .
this case report describes a pyogenic granuloma on the labial mucosa in a 33-year - old male , discussing the clinical features and histopathologic features that distinguish this lesion from other similar oral mucosa lesions . |
systemic lupus erythematosus ( sle ) is an autoimmune inflammatory disorder characterized by a wide variety of associations and an unpredictable course . the association of sle and myeloproliferative and lymphoproliferative malignancies is widely reported in the adult literature.[14 ] most of the data show that the malignancy is detected following the diagnosis and treatment of sle . there is only scarce information available in regards to the association of sle and malignancy in children . usually , sle precedes the onset of lymphoproliferative disease,[58 ] but the neoplasia can occur earlier or even simultaneously . single cases have been described of sle preceding acute lymphoblastic leukemia ( all ) and of sle appearing 5 years after complete remission of all induced by mercaptopurine . we present a case of a 3-year - old boy with sle and coexistent all . to the best of our knowledge , only two such cases of simultaneous presentation of both these diseases are present in literature . a 3-year - old boy was presented with high - grade fever for 30 days . the fever was associated with intermittent episodes of swelling , pain and erythema of small joints of bilateral hands . there was no history of rash , oral ulcer , loose stools , painful micturition , bleeding from any site , sore throat , pyoderma or breathlessness . the child had two elder siblings , both of whom were healthy . on examination , the child had pallor but no icterus , cyanosis , clubbing , lymphadenopathy or edema . the investigations revealed pancytopenia and the smear showed activated lymphocytes ( hb 7.1 g / dl , total leukocyte count=3500/l , mcv=75.1 fl , reticulocyte count= 0.2% , platelet count=1.3410/ l ) , peripheral smear showed normocytic normochromic rbcs with mild anisopoikilocytosis , fair number of microcytic hypochromic cells with few tear drop cells and occasional nucleated rbcs . wbc series showed the presence of 6% blasts and activated lymphocytes and platelet were reduced . ultrasound abdomen confirmed the findings of hepatomegaly ( liver size=11.5 cm , coarsened echotexture ) and splenomegaly ( spleen size=7.5 cm and normal echotexture ) . antinuclear antibody ( ana ) and anti - double stranded dna ( anti - dsdna ) were both positive . these blasts were 1.5 - 2 times the size of lymphocytes with scant agranular cytoplasm , nucleoli with irregular nuclear membrane , five chromatin and 0 - 1 nucleoli . the association of sle and hematological malignancies is widely reported in the adult literature.[14 ] most of the data show that the malignancy is detected after the diagnosis and treatment of sle . usually , sle precedes the onset of lymphoproliferative disease,[58 ] but the neoplasia can occur earlier or simultaneously . this patient described here serves to reiterate the importance of considering all in the differential diagnosis of sle in children . sle was the foremost diagnostic consideration in our patients based on clinical manifestations ( fever , arthritis and anemia ) and serological abnormalities ( ana and anti - dsdna positivity ) . our patient satisfied four criteria for the diagnosis of sle i.e. , arthritis , leukopenia , ana positivity and antibody to dsdna . although many of the clinical and laboratory features in our patient could be accounted for on the basis of all , the major confounding feature was the presence of ana and anti - dsdna . the presence of ana has been reported in patients with malignancies , but positive autoantibodies such as anti ds - dna are not present . anti ds - dna is specific for sle and favors the diagnosis in presence of compatible clinical features . in view of unexplained hepatosplenomegaly , all of these except one case satisfied the revised american college of rheumatology criteria for sle . three of these cases[1416 ] developed sle several years after successful treatment of all . while two cases reported had simultaneous onset of sle and all . one of the cases in this two patient series , did not fulfill 4 criteria for diagnosis of sle . summary of cases in literature of sle associated with all various mechanisms have been postulated to explain the association between sle and malignancies of the lymphoreticular system . the possibilities include a viral infection in a genetically susceptible host , facilitation of the neoplastic process by the autoimmune disorder , and suppression of immune surveillance by cytotoxic therapy . however , the increased susceptibility to malignancy of the lymphoid tissues in lupus appears to be independent of cytotoxic therapy . another possibility is that oncogene activation in the autoimmune diseases could initiate neoplasia . for instance , lymphocytes from patients with sle exhibit increased expression of the proto - oncogenes c - myc and c - myb , transcripts of which are found in large amounts in lymphoid tumors . sle and all could simply be different expressions of the same immunological disorder as , although all is generally not associated with autoantibody formation , children with all have been found with positive test results for ana in conjunction with clinical features of sle . to conclude , findings in our patient serves to illustrate that all in children may mimic sle . a bone marrow examination is therefore prudent in any child with a presumptive diagnosis of sle or any other connective tissue disorders ( ctd ) . particularly if the clinical course is atypical , it is essential to rule out leukemia in any patient who present with clinical features of ctds before starting corticosteroids . | the association of systemic lupus erythematosus ( sle ) and myeloproliferative and lymphoproliferative malignancies is widely reported .
there is scarce information available with regards to the association of sle and malignancy in children .
usually , sle precedes the onset of lymphoproliferative disease , but the neoplasia can occur earlier or even simultaneously .
there are only five pediatric cases of sle and associated acute lymphoblastic leukemia ( all ) reported in literature .
all of these except one satisfied the revised american college of rheumatology criteria for sle .
three of these cases developed sle several years after successful treatment of all .
while two cases reported had simultaneous onset of sle and all , one of the cases in this two - patient series , did not fulfill 4 criteria for diagnosis of sle .
we present a case of a 3-year - old boy with sle and coexistent all . to the best of our knowledge ,
only two such cases of simultaneous presentation of both these diseases are present in literature . |
a 70-year - old male patient was diagnosed with autoimmune pancreatitis in may 2004 . at that time , the serum igg was mildly increased to 1,780 mg / dl ( normal , 694 to 1,618 mg / dl ) . until october 2009 , he had been receiving steroid treatment , and he had a history of recurrence of autoimmune pancreatitis in november 2005 . in july 2010 , a follow - up chest computed tomography was performed and showed abnormal findings with multiple enlarged lymph nodes in the bilateral mediastinal and both hilar areas as well as a small irregular nodular and patchy ground - glass opacity in both of the upper lobes and in the right lower lobe of the lung ( fig . 1 ) . a physical examination showed a 2 cm skin nodule on his left forearm . the laboratory findings were as follows : igg , 1,900 mg / dl ( normal , 694 to 1,618 mg / dl ) ; igg4 , 3.56 g / l ) ; and serum amylase , 258 u / l ( normal , 30 to 110 u / l ) . a biopsy of the skin nodule revealed that it was a subcutaneous lymph node ( fig . 2 ) . this lymph node showed effacement of the lymph node structure with a dense lymphoid infiltrate with marked sinus expansion by histiocyte - like cells with intermediate to large round nuclei , vesicular chromatin , and ample cytoplasm containing small phagocytosed lymphocytes , red cells , and plasma cells ( emperipolesis ) . numerous igg4-positive cells ( approximately 200 igg4 cells / high power field ) were also noted . a bronchoscopic biopsy of the peribronchial lymph nodes was performed and showed a few non - caseating granulomas that were suspicious for dust granulomas with approximately 20 igg4-positive plasma cells . it usually affects lymph nodes , but can also involve a variety of extranodal sites including the skin , lungs , breast , and bone.1 - 5 histologically , the lymph node architecture is altered by massive dilatation of the sinuses and effacement of follicles with histiocyte - like cells showing findings of lymphophagocytosis and emperipolesis.1 clinically , rdd in lymph nodes has been known to be self - limited , although extranodal or multifocal rdd has various outcomes.3 although the etiology of rdd is still unknown , it was recently reported that rdd may be associated with igg4 sclerotic disease.2 - 4,6 igg4-related sclerotic disease is a recently described entity with multi - organ involvement including the pancreas , salivary gland , orbit , hepatobiliary tract , retroperitoneum , thyroid , mediastinum , pleura , mucosa of gastrointestinal tract , and lymph nodes . the disease is characterized by increased serum igg and igg4 levels and the presence of many igg4-positive plasma cells . clinicians are commonly suspicious for a malignant tumor because it usually presents in the form of mass lesions . clinically , the disease is characterized by a good response to steroid therapy.7 - 9 in the present case , the patient had a history of autoimmune pancreatitis . the pancreas is known to be the most commonly involved organ in igg4-related sclerotic disease . autoimmune pancreatitis ( lymphoplasmacytic sclerosing pancreatitis ) is a distinct type of chronic pancreatitis , and it is now widely accepted as one of the igg4-related sclerotic disease.8 several reports have studied the possible relationship between rdd and igg4-related sclerotic disease . kuo et al.4 reviewed 12 cases of cutaneous rdd ( crdd ) and found that crdd showed histopathological features similar to those of igg4-related sclerotic disease . many igg4-positive plasma cells are observed in crdd cases , which suggest that crdd may be related to igg4-related sclerotic disease.4 roberts and attanoos2 also reported a case of pulmonary rdd with a significantly increased number of igg4-positive plasma cells and suggested a possible overlap between rdd and igg4-related sclerotic disease.2 shrestha et al.6 studied the histopathology of pulmonary igg4-related disease with increased igg4-positive plasma cells and autoimmune pancreatitis . they observed characteristic pulmonary findings in the lung of autoimmune pancreatitis including endothelialitis , fibrosis , lymphangitic inflammatory infiltrates with plasma cells , and histiocytes . they also examined other various diseases , including erdheim - chester disease , pulmonary sjgren syndrome , inflammatory myofibroblastic tumor , and nodal or extranodal rdd , to compare to the histologic findings of pulmonary igg4 disease . among these other diseases , 8 of the cases were nodal or extranodal rdd . six out of the 8 cases showed increased igg4-positive cells and a ratio of igg4/igg ( range , 10 to 70% ) . two out of the 3 nodal rdd cases had an igg4/igg ratio of 40% and 70% . the authors suggested further study to determine the possible correlation with igg4-related sclerotic disease and rdd.6 richter et al.3 described a case of extranodal cardiac rdd , and also investigated its possible association with igg4-related sclerotic disease . however , the number of igg4-positive plasma cells within the infiltrates was not increased in that case , therefore , they did not conclude that this type of rdd belongs to the disease spectrum of igg4-related sclerotic disease . these three previous reports have not shown any evidence of other organ involvement with igg4-related sclerotic disease in comparison to the present case . in conclusion , we observed a unique case of rdd with marked increase of igg4-positive plasma cells in a patient with a history of autoimmune pancreatitis . this may suggest a possible close relationship of rdd and igg4 sclerosing disease , although further investigation with a larger number of cases will be necessary for determining the relationship between rdd and igg4-related sclerotic disease . | we describe a rare case of sinus histiocytosis with massive lymphadenopathy ( rosai - dorfman disease ) associated with a six - year history of autoimmune pancreatitis , which was controlled by steroid treatment . the patient presented with multiple , cervical and thoracic lymphadenopathy and abnormal , nodular opacities in the lung .
histologically , rosai - dorfman disease with numerous igg4-positive cells was identified in a subcutaneous lymph node in the patient 's left forearm .
the patient recovered uneventfully with steroid treatment . |