id
stringlengths 3
8
| url
stringlengths 31
219
| title
stringlengths 1
139
| text
stringlengths 4
215k
|
|---|---|---|---|
1548456 | https://en.wikipedia.org/wiki/Spartacus%20%28The%20Farm%20album%29 | Spartacus (The Farm album) | Spartacus is the debut studio album by British rock band the Farm, released on 4 March 1991 through Produce Records. Following a variety of member changes and single releases, the band solidified their line-up in 1987; after a record deal fell through, they opted to start their own label, Produce Records. They recorded the bulk of their debut album in London with former Madness frontman Graham "Suggs" McPherson as producer, while one track from 1987 was produced by the Housemartins members Paul Heaton and Stan Cullimore. Spartacus is a baggy and dance-rock album that takes influence from the work of Buzzcocks, the Clash and the Jam.
Spartacus received generally positive reviews from music critics, though some of them were split on the album's songwriting quality, while others praised it in the context of the baggy scene. The album topped the charts in the United Kingdom. "Groovy Train" was released as its lead single in August 1990, followed by the second single "All Together Now" in November 1990. "Don't Let Me Down" appeared in April 1991, and was promoted with a supporting slot for Happy Mondays in June 1991 at the Elland Road football stadium in Leeds. They then toured the United States with Big Audio Dynamite and Downtown Science. NME and Vox included the album on their lists of the year's best 50 releases.
Background
Influenced by the likes of punk rock acts such as the Clash and the Jam, Peter Hooton decided to become a musician, initially picking up bass briefly before focusing on singing instead. He joined his friend's brother's band after their frontman failed to show up to a rehearsal. The death of John Lennon, coupled with anger towards the Tory party following a speech by leader Margaret Thatcher, inspired Hooton to become a writer. He started the fanzine The End, which chronicled his poems as well as football news, music and politics. The zine helped Hooton grow his confidence as a wordsmith, which he had shied away from after being ridiculed by his school's English teacher. Hooton's band soon became directionless and he was looking for to form another band; through a mutual friend, he met Steve Grimes, guitarist for local punk rock act the Excitements. After an audition, Hooton joined the Excitements, replacing Martin Dunbar. The rest of the band consisted of bassist Phil Stephenson, drummer Neil Campbell and dancer Thomas. While this was occurring, Phil Jones of zine Time for Action and Mick Potter started contributing to The End as it started becoming popular throughout Liverpool. Hooton played his debut show with the Excitements in 1982 at a friend's party. Despite him wanting to keep The End and the Excitements as separate entities, readers of the zine started attending the band's shows.
Several more local gigs ensued, with them changing their name to the Farm as they rehearsed on a farm plot in Lydiate. As they continued performing their punk rock sound, the band appeared out of place from the post-punk scene in Liverpool, featuring the likes of Echo & the Bunnymen, the Teardrop Explodes and Wah!. Andy McVann, who had seen Hooton's first show, joined the Farm as their drummer. Positive reviews from the music press earned the band their first John Peel session in April 1983, where they performed "Information Man", "No Man's Land" and "Memories". In February 1984, they did another session Peel, playing "Hearts & Minds", "Too Late", "Same Old Story" and "Somewhere". In between these sessions, the band went through multiple bassists until they ended up with Carl Hunter. They then appeared on Oxford Road Show, where they met Graham "Suggs" McPherson and Chas Smash, both formerly of Madness. Around this time, the Farm had little money, surviving off residuals from the Peel sessions. A friend of the Farm's was manning the doors at a Madness show and said the Farm were in need of help. Suggs, who had heard one of the Farm's Peel sessions, let them record some demos at Madness' studio on Caledonian Road, London for free. Suggs would subsequently produce their debut single, "Hearts & Minds", later in the year. Simon Moran, who would later found promoter SJM Concerts, became one of the band's early supporters, helping to organise shows for them.
Sometime later, a brass section consisting of Anthony Evans, Steve Levy, George Maher and John Melvin was brought into the band's line-up, shifting their sound towards Northern soul. McVann was involved in a fatal car crash in October 1986; the Farm almost broke up when the brass section left after this incident. In 1987, Roy Bulter filled in McVann's role, and second guitarist Keith Mullen and keyboardist Benjamin Leach were added to the line-up. Bill Drummond, one half of the KLF, who was well versed in the Liverpool scene and the Farm's actives, wanted to become their manager after meeting Hooton in a bar, but ultimately did not. After seeing one of the Farm's performances, Happy Mondays supported them in Liverpool in May 1987. The Farm then went on tour with the Housemartins; they almost signed to the Housemartins' Stan Cullimore's label Fair Play Committee, but the deal fell through when Cullimore decided to write children's books instead. During the discussion state of the deal, Moran wanted 20% of the proposed £25,000 signing bonus, claiming that as their manager he should be paid more; Hooton remarked that they considered him an equal, not a superior. Moran subsequently parted ways with the band at the same time the deal collapsed. "Body and Soul", their next single, was released in 1988 and saw a shift to synth-pop. In an attempt to draw more attention to the band, Hooton concocted a music scene under the name Urchin Rock that would include them and fellow Liverpools bands Rain and the Real People. Hooton then convinced popular journalists to cover the faux movement; it received a lot of press coverage, but did not further the careers of any of the acts grouped under it.
Label and recording
Around the Christmas period in 1989, Paul McKenna, who had been the Farm's merchandise aid, and Hooton had a meeting at the former's flat. McKenna introduced Hooton to Barney Moores, a fan of theirs and son of Littlewoods Pools owner John Moores. Barney Moores had spare money to invest in a business and was interested in helping the band, to which Hooton told him, £25,000 to cover the cost of an album and two singles. Hooton then contacted Kevin Sampson, who had connections around London and was hanging out with Suggs. After a few days, Sampson became the band's manager and travelled from London to Liverpool to set up a meeting. The outcome of it saw the formation of the record label Produce Records with Ian Croft, Wayne Chad, Moors and McKenna as business partners, with Best in Press and Anglo Plugging becoming their press agency and radio plugger, respectively. The label's releases would be distributed by Kent-based company Pinnacle. Part of the money the band received was used to purchase a sampler, in order for them to expand their musical style. Sampson drafted up a eight-page plan that Hooton referred to as "how to get the Farm into the Top 40", which would utilize Anglo Plugging, Madness' studio, booking agent Martin Horn of International Talent Booking, press officier John Best of Savage & Best Management. Hooton admitted that they "didn't know anything" and trusted Sampson's judgement.
Shortly afterwards, the band began working on a cover of "Stepping Stone" (1966) by Paul Revere & the Raiders as their next single. At the suggestion of mixing engineer Terry Farley, who was growing in popularity as a DJ in the acid house movement, the band slowed the track down and incorporated samples from "The Power" (1990) by Snap!. Though the song stalled at number 59 in the UK Singles Chart, the band received a lot of press coverage for it. The Farm tried to record "Higher & Higher" soon after, but were not satisfied with the sound, and decided to work on "Groovy Train" with engineer Mark Saunders instead as the next single. They had played a psychedelic version of "Groovy Train" for a Peel session; for the released version, Farley moved Mullen's guitar from the middle eight to the intro section and added a loop from "The Gas Face" (1989) by 3rd Bass.
Suggs produced nearly every track that would feature on Spartacus, save for "Tell the Story", which had been recorded in 1987 and was produced by Cullimore and Housemartins bandmate Paul Heaton produced. "Hearts & Minds", "How Long", "Sweet Inspiration", "Higher & Higher", "Don't Let Me Down", "Very Emotional" and "All Together Now" were recorded at Mayfair Studios in London in October and November 1990, while "Groovy Train" and "Family of Man" were recorded at Liquidator Studios, and "Tell the Story" was recorded at Fairview Recording Studio in Hull. Kevin Petri engineered the majority of the tracks, except for "Groovy Train" (done by Gary Wilkinson) and "All Together Now" (done by Noel Rafferty). Saunders mixed "Groovy Train" at the Konk studio in London; the majority of the songs were mixed at Westside Studios in London, while "All Together Now" was done at Mayfair and "Family of Man" and "Tell the Story" were remixed at E-Zee, also based in London. Paula David, who was a session vocalist that Suggs knew, and Pete Wylie contributed backing vocals throughout the recordings.
Composition and lyrics
Musically, the sound of Spartacus has been described as baggy and dance-rock, taking influence from the work of Buzzcocks, the Clash and the Jam. AllMusic reviewer Stephen Thomas Erlewine said it had all of the hallmarks of baggy, from "its rolling, neo-psychedelic grooves" to the "blissfully colorful pop hooks". The album's title was taken from the 1960 film of the same name; Grimes in relation to the plot of the film, the name worked as a "very tongue-in-cheek analogy between the Farm, who, like, for years didn't have a record label and then decided to do it ourselves... Basically, in spite of all the major record companies". He said McVann's death influenced some of the tracks on the album, such as "Don't Let Me Down".
The album's opening track, "Hearts & Minds", was slowed down from its original form, which had an offbeat reggae atmosphere to it. Its title alluded to a rally cry spoken by celebrities and politicians of the time; two years before including it on the album, Hooton said that some lyrics were added to "incorporate the plastic gangster fraternity". Though NME reported that the band had used samples from Taxi Driver (1978), Hooton was adamant that they used impersonators for the audio clips. "How Long" recalled the work of U2, while part of its lyrics referred to Hooton and drummer Boulter visiting the Berlin Wall in East Berlin. Hooton explained that the song talked about politicians rooting for change as long as it served their own ambitions. "Sweet Inspiration" was written around the release of Nelson Mandela and is about political prisoners that stand up for their beliefs even when confronted by authority figures. Discussing "Groovy Train", Grimes said it was an interpretation of people that Hooton knew during school that used to be political, but after acid house, "they've just forgotten about all their politics and just though, 'Sod this! Let's just have a good time.... Hooton wrote the lyrics in the weeks following an encounter with a girl at a nightclub in Liverpool. Journalist Paul Lester wrote that the song consisted of an "iridescent African hi-life [atmosphere], quintessentially baggy 'Funky Drummer' shufflebeat and slashing" Steve Jones-aping guitarwork.
"Higher & Higher" talks about a person facing rejection, which Hooton compared to "Should I Stay or Should I Go" (1982) by the Clash. "Don't Let Me Down" targeted Britain's underclass, anchored by as gospel-like backing vocals. The first verse of it grew out of an older, abandoned song titled "That's the Way We Were", with some lines specifically referring to McVann. Hootson said "Family of Man" asks the question of "why don't the police join the family of man, instead of punishing people at every opportunity?" "Tell the Story", which was an update on "Same Old Story", evoked the sound of fellow Liverpool act the Pale Fountains with its acoustic production. Journalist Bob Stanley wrote that the song's lyrics propose that the "derelict buildings and waste-ground tell a truer story about the band's hometown than thousand Jimmy Tarbuck-fuelled platitudes". It initially had six verses, which were then edited down to two for the final version"; Hooton said it referred to the slade trade and the planned redevelopment of Liverpool's Royal Albert Dock. "Very Emotion" evolved out of their 1985 song "Steps of Emotion", and was dedicated to their technician Ray Toohey. He had been involved in a peaceful protest in regards to Risley Remand Centre, but was arrested and imprisoned for 30 months. The band changed the song's lyrics to reflect Toohey's situation, with influence from "Stay Free" (1978) by the Clash.
"All Together Now" began as "No Man's Land", which Hooton had written after the reaction from right-wing press towards Michael Foot wearing a coat that resembled donkey jacket in November 1981. Alongside this, Hooton had read newspaper articles about the Christmas truce during the First World War, which he learned about from training as a history teacher. "No Man's Land" consisted of six verses sections and lacked a defined chorus. For a few years, Grimes wanted to pair the words with the music of a TV advert, which featured a version of Pachelbel's Canon in D. The band did not attempt to match them until after they had bought the aforementioned sampler; while it worked, the song still was void of a chorus section. They refined the song while in the studio, where they came up with an appropriate chorus. At Suggs' recommendation, the six verses were cut down to three, and half of the music for the chorus was similarly dropped. He then included a sample of Sid Vicious' rendition of the 1969 song "My Way" during the middle eight. At Farley's suggestion, the band wanted to include a beat they knew from a hip hop record. As they were unable to recreating it in a London studio, a member of their entourage was tasked with going to Hooton's house in Liverpool to retrieve it. When they sampled the drum loop, they found that it was partially out of synch with the music they had recorded.
Release
By mid-1990, the Farm were being slotted into the baggy scene, much to the chagrin of Hooton. After some persuading from Sampson, the band travelled to Ibiza, where they would shoot A Short Film About Chilling... Ibiza '90. The location was rising in popularity amongst the British youth and dance cultures. The film coincided with the "Groovy Train", helping to grow the band's stature. "Groovy Train" was released as the lead single from Spartacus on 20 August 1990. The CD and 12-inch vinyl versions included different remixes of "Groovy Train"; the CD version also featured a remix of "Stepping Stone". The music video for it featured Bill Dean singing into a piece of rock at a Southport fun fair, cut with some footage of their trip to Ibiza. The success of the track allowed the band to appear on Top of the Pops twice. Produce Records had received offers from various labels to buy them out, including from Sony Music Entertainment, but all of these were declined. While this was occurring, Produce Records were receiving orders to license out the "Groovy Train". One such request was from Sire Records, which was operated by Seymour Stein. He had been to several of the band's performances, which led to them being signed to the label. Up to that point, the song had some success at Modern Rock stations in the United States as an import release.
"All Together Now" was released as the second single from Spartacus on 26 November 1990. The CD edition featured remixes of the song by Farley & Pete Heller and Rocky & Diesel. The music video for "All Together Now", directed by Angus Cameron, sees the band and members of their families drinking in a pub. It was shot in a locale next to Shepherd's Bush Empire in London; they were concerned that if they tried to do it in Liverpool, too many people would try to gain entry. In January 1991, the Farm supported Happy Mondays at the Great British Music Weekend festival, which featured a line-up of Madchester-related acts. Following this, they embarked on a UK tour in February and March 1991. A launch show was scheduled for 7 February 1991, but was cancelled because of a dispute between the band and Flying Records, where the latter had not paid the band for an earlier show. Ahead of the album's release, promotional remixes of "Very Emotional" and "Higher & Higher" done by Farley and Heller were released as a white label 12-inch vinyl record.
After initially being planned for release on 25 February 1991, Spartacus was released on 4 March 1991 through Produce Records in the UK. The album's artwork was created by Hunter, who had experience from attending a graphic art school. Grimes explained that the band were being referred to in the British music press as a "very unglamorous band. We should be, like, working in a building profession, or we should be electricians, that type of thing". He decided that since the press thought that they looked like ordinary people, they would make the artwork "as something you'd see in a supermarket, that you wouldn't look twice at". It featured the Farley and Heller remixes of "Very Emotional" and "Higher & Higher" as additional tracks; the vinyl version limited the remixes to 30,000 copies. To promote the album, the band appeared on the Nicky Campbell show for BBC Radio 1, where they performed "Don't Let Me Down" and "How Long". Around this time, they released their first video album, Groovy Times; it consisted of a live performance of the entire album shot at the London Astoria in December 1990. It also included interviews and the music videos to "Stepping Stone" and "Groovy Train".
Hooton, while appreciative of the attention the band was receiving, felt burnt out from interviews, causing him to lose his voice. The other members of the band similarly suffered from restlessness; Hooton recounted how they were performing in Brighton the same night that the album went to number one "and I don't think we celebrated. We all became blasé even when everywhere on the tour was sold out". "Don't Let Me Down" was released as the album's third single on 22 April 1991; remixes of by Farley and Rocky & Diesel were included as its B-sides. Sampson was insistent on reissuing "Stepping Stone" instead of releasing "Don't Let Me Down", while everyone else at Produce Records were in favour of "Don't Let Me Down". The band were concerned they would be seen as sell outs if they went with Sampson's proposal; though they later admitted that his idea would have been a better choice. The music video for "Don't Let Me Down" was filmed in London and starred Frankie Howerd as the band liked his performance in Up Pompeii! (1969). They had to change one of the lyrics, from "stand up and fight" to "stand up, stand up", as the song would not receive airplay or TV airings due to the Gulf War.
Sire Records released Spartacus in the US on 30 April 1991. Warner Bros. Records product management vice president Steven Baker said Reprise Records was drafted in to help the band at alternative radio in the hopes of having them crossover to top 40 stations. Initially support came from the "Groovy Train" video being on active rotation at MTV. On 1 June 1991, they supported Happy Mondays at the Elland Road football stadium in Leeds. On 3 September 1991, "Groovy Train" was released as a single in the US; it featured remixes of "Groovy Train", "All Together Now" and "Stepping Stone", alongside the non-album single "Mind". As Sire did not like the original music video for "Groovy Train", another one was shot with the band travelling around Manhattan on a London-themed bus. Shortly afterwards, they went on a US tour alongside Big Audio Dynamite and Downtown Science.
Later in the year, the band failed to sell-out a show in Newcastle; Moran told them that Nirvana was playing a show in the city that same night and affected the attendance as a result. Unbeknownst to the Farm, the success of Nirvana's Nevermind (1991) some months earlier allowed for the success of grunge acts such as Alice in Chains, Pearl Jam and Soundgarden. Hooton explained that they were "reading about it [in the press] and we saw the Melody Maker attacking us and we realised they wanted to get rid" of Madchester and baggy and "replace it with something that they were more comfortable with". Around this time, the band's second video album, Spartacus Live, was released, featuring footage from a show at the Royal Court Theatre in Liverpool in March 1991. "All Together Now" was released as a single in the US on 6 February 1992, featuring remixes of "All Together Now" and a live demo of "Over Again".
Related releases and events
In 1991, a box set of Spartacus three singles, plus "Stepping Stone" and "Mind" was released on 12-inch vinyl under the name Boxsetacus; a CD version followed in 1993. In January 1999, NME reported that Produce Records initiated a legal dispute again BMG Entertainment, claiming that "Macarena" (1993) by Los del Río had ripped off "Higher & Higher". The World Intellectual Property Organization later reported that BMG settled out of court on the matter. In May 2004, Edsel Records released Spartacus as double-CD edition, under the moniker Spartacus... Plus, which included B-sides and remixes. The Farm were originally scheduled to the band performed the album in its entirety on a UK tour in April and May 2012, but this was posponed to September and October 2012. Spartacus was then included in the The Complete Studio Recordings 1983–2004 (2015) box set, which included all of the band's studio albums plus bonus discs of B-sides, remixes and radio sessions. BMG Rights Management released an EP of "All Together Now" remixes to celebrate the song's 30th anniversary. In March 2021, BMG released a digital expanded edition of the album to celebrate its 30th anniversary.
"Groovy Train", "Don't Let Me Down" and "All Together Now" were included on the Farm's second compilation album, Best of the Farm (1998). All of the songs from Sparatacus were included, albeit in a different running order, on their third compilation album, The Very Best of the Farm (2001). This feat was nearly duplicated, sans "Very Emotional", for their four compilation album, All Together Now: The Very Best of the Farm (2001). For their fifth compilation album, Alltogethernow – The Very Best of the Farm (2004), "Very Emotional" was reinstated and "How Long" was not included; the accompanying DVD featured the music videos for "Groovy Train", "Don't Let Me Down" and "All Together Now". The whole album was again included on their sixth and seventh compilation albums, All Together Now: The Very Best of the Farm (2009) and Groovy Train: The Very Best of the Farm (2017).
Reception and legacy
Opinion was split on the quality of Spartacus songwriting. While noting that a few of the songs had been previously released, Andrew Collins of NME wrote that it was "as solid as a rock record, yet roomy enough to accommodate" experimentation on tracks such as "Hearts & Minds" and "Tell the Story". Stanley, in a review for Melody Maker praised the band for having "the most astute lyrics" out of their contemporaries, however, "it's that much sadder that this LP is worthy but dull". Doug Iverson of Toledo Blade felt that aside from the first two singles, "it's doubly disappointing that Spartacus [...] is so lame". In a review for Select, writer Graham Linehan countered this by stating that it "keeps you alert and live. There's very little filler, very few signs of exhaustion". He went on to praise the songwriting quality and mention that their "honey appreciation of what a song danceable and memorable guarantees them a longer shelf-life than most".
Some reviewers viewed the Farm as being superior than the baggy tag let on. Erlewine wrote that the album was "one of the more ridiculous by-products of baggy, [...] yet very little of its charm, character, or substance". He added that since the genre was "never about substance, this is particularly damning". Gary Crossing of Record Mirror echoed a similar statement, praising the band's creativity, remarking that Spartacus was "conclusive proof that the Farm are more than just another baggy band". Journalist John Harris, writing in Sounds, said that when compared to their contemporaries, the Farm were "older, wiser, and in far greater command of a killer commercial sensibility" as Spartacus conveys "final confirmation of their sharp musical suss".
Spartacus topped the UK Albums Chart after its first week of release. It was Album of the Month in Select Magazine, and included in Vox magazine's 50 Albums of 1991 list. The NME placed the album at number 32 in their list of the Top 50 Albums of 1991. In 1998, Melody Maker considered it the 20th worst album of all time. In 2014, journalist John Robb wrote that "All Together Now" was "not only a great anthemic and uniting pop record, it also came out" during "one of those rare periods when people felt optimistic and [the song] soundtracked this, add[ing] a poignant working class memory".
Track listing
All songs written by Peter Hooton and Steve Grimes.
"Hearts & Minds" – 4:24
"How Long" – 3:38
"Sweet Inspiration" – 5:29
"Groovy Train" – 4:10
"Higher & Higher" – 4:38
"Don't Let Me Down" – 4:37
"Family of Man" – 4:44
"Tell the Story" – 3:39
"Very Emotional" – 4:41
"All Together Now" – 5:41
"Higher & Higher" (remixed by Pete Heller and Terry Farley) – 6:09
"Very Emotional" (remixed by Heller and Farley) – 6:22
Personnel
Personnel per sleeve.
The Farm
Peter Hooton – lead vocals
Keith Mullin – guitar
Steve Grimes – guitar
Carl Hunter – bass
Ben Leach – synthesizers
Roy Boulter – drums
Additional musicians
Paula David – backing vocals
Pete Wylie – additional backing vocals
Production and design
Graham "Suggs" McPherson – producer (all except track 8), remixing (track 8)
Kevin Petri – engineer (tracks 1–3, 5–7 and 9), remixing (track 8)
Gary Wilkinson – engineer (track 4)
Mark Saunders – mixing (track 4)
Paul Heaton – producer (track 8)
Stan Cullimore – producer (track 8)
Noel Rafferty – engineer (track 10)
Terry Farley – remixing (tracks 11 and 12)
Pete Heller – remixing (tracks 11 and 12)
Charts
References
Citations
Sources
External links
Interview with Pete Hooton with the Xs Noize Podcast – via YouTube
1991 debut albums
The Farm (British band) albums
Spartacus music |
38322291 | https://en.wikipedia.org/wiki/Trishna%20Wildlife%20Sanctuary | Trishna Wildlife Sanctuary | Trishna Wildlife Sanctuary is a wildlife sanctuary in Tripura, India. It was founded in 1988.
The sanctuary is situated in South Tripura District. It is from the sub divisional town of Belonia and is connected with Agartala by state highway. It can be approached either from Belonia in the south or Sonamura in the north. The sanctuary covers an area of 163 square kilometers. It has a number of perennial water rivulets, water bodies and grass land. There are patches of virgin forests which are rich in rare vegetation. Indian gaur (bison) is an attraction of the sanctuary. There are also varieties of birds, deer, hoolock gibbon, golden langur, capped langur, pheasant and many other animals and reptiles.
References
External links
Tripura.nic.in
Wildlife sanctuaries in Tripura
South Tripura district
Lower Gangetic Plains moist deciduous forests
Protected areas with year of establishment missing |
3628845 | https://en.wikipedia.org/wiki/TREMEC%20Corporation | TREMEC Corporation | TREMEC (Transmisiones y Equipos Mecánicos SA de CV, formerly Transmission Technology Corporation, TTC) is a manufacturer of automobile transmissions and drivetrain components based in Querétaro, Mexico.
Company
Torque transfer solutions from TREMEC are found in products ranging from supercars and high-performance sports cars to severe duty, vocational and commercial vehicles worldwide. The portfolio of products includes manual transmissions, dual-clutch transmissions, hybrid and electric vehicle (EV) solutions, gears, driveshafts, clutches, mechatronic systems, transmission control units, and control software.
The company has its US operations based in Novi, Michigan. This deals with sales, marketing and engineering office (and was, until 2018, based in Wixom, Michigan). Production facilities are located in Pedro Escobedo and Santiago de Querétaro, in Mexico, and Zedelgem (Bruges area) in Belgium. TREMEC is a wholly owned subsidiary of KUO Group, which is based in Mexico City.
Some of the first TREMEC products were originally designed by Borg-Warner, including the widely used T-56.
History
TREMEC was founded on April 12, 1964. The genesis was to manufacture transmissions in Mexico for Ford, GM and Chrysler. At that time, the Mexican government enacted a protectionist policy that mandated all vehicles assembled in Mexico have engines and transmissions 100-percent manufactured in Mexico. A joint venture was formed which included one of Ford's large transmissions suppliers – Clark Transmissions – and two entrepreneurial companies based in Mexico. TREMEC's first transmissions would be produced later that same year.
Products
Aftermarket transmissions
Tremec T-5 transmission
Tremec T-45 transmission
Tremec TKO transmission
Tremec T-56 transmission
TREMEC Magnum 6-speed transmission
TREMEC Magnum XL 6-speed transmission
OEM transmissions
Tremec TR-2450 transmission
Tremec TR-3160 transmission
Tremec TR-3450 transmission
Tremec TR-3650 transmission
TR-3655 transmission
Tremec TR-4050 transmission
Tremec TR-6060 transmission
Tremec TR-6070 transmission
Tremec TR-9070 DCT 7-speed dual clutch transmission
Tremec TR-9080 DCT 8-speed dual clutch transmission
Medium & Heavy Duty Truck Transmissions
EASY-SHIFT 5-speed
EASY-SHIFT 7-speed
PRO-SHIFT 6-Speed
PRO-SHIFT 7-Speed
PRO-SHIFT 9-Speed
PRO-SHIFT 10-Speed
PRO-SHIFT 18-Speed
References
External links
Transmission Technologies corporation website
Automotive companies of Belgium
Auto parts suppliers of the United States
Auto parts suppliers of Mexico
Manufacturing companies based in Michigan
Automotive transmission makers |
45211546 | https://en.wikipedia.org/wiki/Mike%20Gore%20%28physicist%29 | Mike Gore (physicist) | Michael Miles Gore (5 September 1934 – 8 January 2022) was a British-born Australian engineer, physicist, and science explainer, who worked at the Australian National University in Canberra. He was noted for being the founder of Questacon, the first interactive science centre in Australia.
Early life
Gore was born in Bolton, Lancashire, on 5 September 1934. He was the only child of May Robinson and Ernest Gore, who worked as an electrical engineer. Gore attended Worsley Technical School for two years, before completing his secondary education at Bolton Senior Tech. He first graduated with a Bachelor of Science in electrical engineering. He subsequently undertook postgraduate studies in that field at Leeds University, obtaining a Doctor of Philosophy in the 1950s.
Professional career
At the conclusion of his studies, Gore was offered a post-doctoral position at Brown University for nine months, as well as the position of lecturer in physics at the Australian National University (ANU) in Canberra. He accepted both positions after arranging a deferral of the starting date of the latter, and consequently immigrated to Australia in 1962. He later became a Professor, and in 1987 left the ANU and was later styled Professor Emeritus. As at early 2015, Gore was a Sessional Lecturer at the ANU, based at the Centre for the Public Awareness of Science.
Explaining science
Gore established Questacon, the national science centre, in Canberra in 1980. It was the first interactive science centre in the country. It was originally based in the recently shuttered, historic Ainslie Public School (built 1927). He was inspired to set up the centre after visiting the Exploratorium in San Francisco in 1976. Questacon moved to the permanent building on Lake Burley Griffin in 1988, after Gore left academia the year before to become the foundation director of Questacon – The National Science and Technology Centre. He retired back to academia in 1999, working as an adjunct professor in science communication.
Gore was a scientific advisor to the ABC television series "Towards 2000". He established the ANU's Centre for the Public Awareness of Science (CPAS) in 1995. In 2010, Gore was a founding member of The Faraday Club, established by Dr Howie Firth, , of the Orkney International Science Festival, to recognise science communicators of international standing and named after Michael Faraday, leading English scientist of the nineteenth century.
Personal life
Gore was married to Joyce Klaber. They met during his time in the United States as a post-doctoral research fellow at Brown University, where she was studying US History. They had three children.
Gore died on 8 January 2022, in Canberra. He was 87 years old.
Honours
1982
'Canberran of the Year'
Churchill Fellowship
1986
Member of the Order of Australia (AM) in recognition of service to scientific education.
1992
Eureka Prize – Gore and Questacon
2001
Award for Outstanding Service to Physics in Australia (Australian Institute of Physics)
2006
Academy Medal, Australian Academy of Science
2015
Officer of the Order of Australia (AO) for distinguished service to science through a range of public outreach, communication and education initiatives on a national and international level, and as a mentor and role model for young scientists.
Publications
Gore, Michael Miles, Interactive science centres: a world wide study (1983)
Gore, MM. Interactive Science and Technology Centres. In: National Engineering Conference (1990 : Canberra, A.C.T.). 1990 National Engineering Conference of the Institution of Engineers, Australia: Government, Engineering and the Nation; Barton, ACT: Institution of Engineers, Australia, 1990: 92-96. National conference publication (Institution of Engineers, Australia); no. 90/1
Sue Stocklmayer, Michael M. Gore, C.R. Bryant (editors), Science Communication in Theory and Practice. Springer Science & Business Media, 31 December 2001, 284 pages.
References
1934 births
2022 deaths
People from Bolton
Alumni of the University of Leeds
Australian National University faculty
Australian physicists
Officers of the Order of Australia
English emigrants to Australia
Brown University faculty |
16093892 | https://en.wikipedia.org/wiki/List%20of%20railway%20stations%20in%20Barcelona | List of railway stations in Barcelona | This is a complete list of Renfe and Ferrocarrils de la Generalitat de Catalunya-operated railway stations in Barcelona, sorted alphabetically, excluding Barcelona Metro stations. It only includes stations strictly located within the municipality of Barcelona proper (as opposed to the metropolitan area of Barcelona).
Stations
Future stations
Former stations
See also
Transport in Barcelona
List of Rodalies Barcelona railway stations
List of Barcelona Metro stations
List of tram stations in Barcelona
Barcelona
Railway stations |
8646987 | https://en.wikipedia.org/wiki/Royal%20Moroccan%20Army | Royal Moroccan Army | The Royal Moroccan Army ( Al-Quwwat al-Bariyah al-Malakiyah al-Maghribiyah, tasrdast tagldant) is the branch of the Royal Moroccan Armed Forces responsible for land-based military operations.
The Royal Moroccan Army is about 215,000 troops strong and consists of 195,000 professional soldiers and 20,000 conscripts. In case of war or state of siege, an additional force of 150,000 Reservists and paramilitary forces, including 24,000 regulars of the Royal Moroccan Gendarmerie and 30,000 Auxiliary Forces come under the Ministry of Defense command.
Army forces from Morocco have taken part in different wars and battles during the twentieth century, from World War I, to the recent Central African Republic conflict.
History
The Moroccan army has existed continuously since the rising of Almoravid Empire in the 11th-century. During the protectorate period (1912–1955), large numbers of Moroccans were recruited for service in the Spahi and Tirailleur regiments of the French Army of Africa (French: Armée d'Afrique). Many served during World War I. During World War II more than 300,000 Moroccan troops (including goumier auxiliaries) served with the Free French forces in North Africa, Italy, France and Austria. The two world conflicts saw Moroccan units earning the nickname of "Todesschwalben" (death swallows) by German soldiers as they showed particular toughness on the battlefield. After the end of World War II, Moroccan troops formed part of the French Far East Expeditionary Corps engaged in the First Indochina War from 1946 to 1954.
The Spanish Army also made extensive use of Moroccan troops recruited in the Spanish Protectorate, during both the Rif War of 1921–26 and the Spanish Civil War of 1936–39. Moroccan Regulares, together with the Spanish Legion, made up Spain's elite Spanish Army of Africa. A para-military gendarmerie, known as the "Mehal-la Jalifianas" and modelled on the French goumieres, was employed within the Spanish Zone.
The Royal Armed Forces were created on 14 May 1956, after French Morocco, a French Protectorate, was dissolved. Fourteen thousand Moroccan personnel from the French Army and ten thousand from the Spanish Armed Forces transferred into the newly formed armed forces. This number was augmented by approximately 5,000 former guerrillas from the "Army of Liberation". About 2,000 French officers and NCOs remained in Morocco on short term contracts, until crash training programmes at the military academies of Saint-Cyr, Toledo and Dar al Bayda produced sufficient numbers of Moroccan commissioned officers.
The first wars that Moroccan troops have taken part in the 20th century as an independent country were the Ifni War and Sand War.
In the early 1960s, Moroccan troops were sent to the Congo as part of the first multifunctional UN peacekeeping operation, ONUC. But the Moroccan Armed Forces were most notable in fighting a 25-year asymmetric war (Western Sahara War) against the POLISARIO, an Algerian backed rebel national liberation movement seeking the independence of Western Sahara from Morocco.
The Royal Moroccan Army fought during the Six-Day War and on the Golan front during the Yom Kippur War of 1973 (mostly in the battle for Quneitra) and intervened decisively in the 1977 conflict known as Shaba I to save Zaire's regime. After Shaba II, Morocco was part of the Inter-African Force deployed on the Zaire border, contributing about 1,500 troops. The Armed Forces also took part in the Gulf War with a Mechanized Battalion and an infantry battalion in the Omar and Tariq Task Forces.
In the 1990s, Moroccan troops went to Angola with the three UN Angola Versification Missions, UNAVEM I, UNAVEM II, and UNAVEM III. They were also in Somalia, with UNOSOM I, the U.S.-led Unified Task Force (UNITAF), sometimes known by its U.S. codename of 'Restore Hope,' and the follow-on UNOSOM II. They saw fighting during the 3–4 October 1993 confrontation in Mogadishu to rescue a U.S. anti-militia assault force. Other peace support involvement during the 1990s included United Nations Transitional Authority in Cambodia (UNTAC) in Cambodia, and the missions in the former Yugoslavia: IFOR, SFOR, and KFOR.
Recent United Nations deployment in Africa and elsewhere have included the United Nations Organization Stabilization Mission in the Democratic Republic of the Congo (MONUSCO), the UNOCI, BINUCA and MISCA (2014)
Other missions have included:
Perejil Island crisis
International Security Assistance Force Joint Command
Operation Scorched Earth
MINUSTAH
United Nations Supervision Mission in Syria (UNSMIS)
Algeria, Morocco, and other Maghreb states affected by the GSPC insurgency have been assisted in fighting Islamist militants by the United States and the United Kingdom since 2007, when Operation Enduring Freedom – Trans Sahara began.
Army of Liberation
The Army of Liberation (, ) was a force fighting for the independence of Morocco. In 1956, units of the Army began infiltrating Ifni and other enclaves of Spanish Morocco, as well as the Spanish Sahara. Initially, they received important backing from the Moroccan government. In the Spanish Sahara, the Army rallied Sahrawi tribes along the way, and triggered a large-scale rebellion. In early 1958, the Moroccan king reorganized the Army of Liberation units fighting in the Spanish Sahara as the "Saharan Liberation Army" .
The revolt in the Spanish Sahara was put down in 1958 by a joint French and Spanish offensive. The king of Morocco then signed an agreement with the Spanish, as he asserted control over the rebellious southern border areas, and parts of the Army of Liberation was absorbed back into the Moroccan armed forces.
Nationalistic Moroccans tend to see the Army of Liberation battles in Western Sahara as a proof of Western Sahara's loyalty to the Moroccan crown, whereas sympathizers to the Polisario Front view it only as an anti-colonial war directed against Spain. Sahrawi veterans of the Army of Liberation today exist on both sides of the Western Sahara conflict, and both the Kingdom of Morocco and the Sahrawi Arab Democratic Republic celebrate it as part of their political history.
Forces today
Situation and equipment
From the beginning of 21st-century, the Moroccan army began a modernisation program that included the purchase of modern equipment and the transformation into a more professional army performing multiple exercises with allied's armies, and as a Major non-NATO ally of the US, and member of the initiative 5+5 and other cooperation agreements. The army's modernisation program took shape with the acquisitions of weapons such as the Chinese VT-1A and MRLS AR2, American M1A1 Abrams, the HAWK air defense system or the M109A5 Self-Propelled Howitzer.
The organisation and structure of command remained the same:
General Command HQ (Rabat)
Northern operational Sector.
eastern Command HQ (Errachidia)
Eastern operational sector
Tafilalt operational sector
Saghro operational sector
Southern Command (Agadir)
Oued draa operational sector.
Sakia El Hamra operational sector.
Oued eddahab operational sector.
Formations are as follows:
2 Airborne infantry brigades.
15 Motorised infantry brigades/Regiments.
3 Royal Armored brigades.
13 Royal tanks regiments.
6 mechanised infantry brigades.
24 Royal Artillery groups(4 Ground to air Groups/2 Rocket artillery groups/18 field artillery groups)
1 light security brigade.
1 mechanised intervention brigade.
1 mountain infantry battalion.
2 Royal cavalry regiments.
12 Borders surveillance battalions.
17 intervention light infantfy battalions.
International projection
The Kingdom of Morocco is part of multiple international organisations, is a Major non-NATO ally, part of the Arab League, and has established military cooperation with different countries such as USA, Russia, Portugal, Tunisia, China, Qatar, Italy, France, Spain, UAE or Turkey. As part of the UN, Moroccan Army participated in different Peacekeeping missions. Moroccan troops were sent as part of SFOR, KFOR, MINUSTAH or the more recent UNSMIS in Syria. It has also responded the call of its allies, taking part of conflicts such as Shaba I, Battle of Mogadishu (1993), the Gulf War or the Operation Scorched Earth, among others. Morocco has dispatched several field hospitals to conflict zones and areas affected by natural disasters, the latest contributions were at Libyan Civil War, the Syrian civil war. and in the Gaza strip after Operation Pillar of Defense.
The Royal Moroccan Army also performs annual training exercise called "African Lion" with the United States Marine Corps. The exercise is a regularly scheduled, combined U.S. - Moroccan military exercise designed to promote improved interoperability and mutual understanding of each nation's tactics, techniques, procedures, unit readiness and enhancing foreign relations.
Morocco has also been the venue for Exercise "Jebel Sahara" since September 2000, taken 10 times since, and gathering elements from 33 Squadron, 230 Squadron, 18 Squadron, 27 Squadron, Joint Helicopter Force HQ from RAF Benson, 1st Battalion Royal Gibraltar Regiment and 2nd Brigade d’Infanterie Parachutiste of the Royal Moroccan Army. The aim of the Exercise was to increase the Support Helicopter warfighting capability in desert 'hot and high' conditions and foster good relations between the UK and Morocco. To achieve this, the scenario consisted of a joint counter insurgency operation in the desert and mountain foothills to re-establish control and authority within a troubled region of North Africa. Another exercises were the "Jebel Tarik", with the Moroccan contribution of service personnel to an annual bilateral deployment of two companies (up to 180 personnel) of the Royal Gibraltar Regiment (RG) to the UK, on seven occasions since 2003. "Desert Vortex", a one-off bilateral helicopter exercise which is run between 16 May and 30 June 2009. This was a UK training exercise with objectives set by Joint Helicopter Command (JHC) and run concurrently with Moroccan Air Force annual helicopter crew training.
The Royal Gibraltar Regiment ran an exercise with the Moroccan 2e Brigade d'Infanterie Parachutiste (2e BIP) in late 2008.
The Royal Armed Forces also take part of different international exercises as Leapfest, Flintlock, Blue Sand, and occasional military operations exercises with Belgium, U.A.E., Spain, France and others.
Ranks and structure
Officers
Général de l'armé et commandant en chef: Retained by His Majesty the King of Morocco.
Enlisted
In 2009, the Moroccan army had:
Equipment
Uniform
The most common service uniform of the Royal Moroccan Army is olive drab, but you can also see Moroccan troops with other types of uniforms such as the Desert lizard, Red Lizard and Camouflage Central-Europe uniforms.The uniform has been changed into a newer and modern one :
See also
Royal Moroccan Armed Forces
Royal Moroccan Navy
Royal Moroccan Air Force
Moroccan Royal Guard
Royal Moroccan Gendarmerie
Auxiliary Forces
References
Further reading
Anthony Cordesman, 'A Tragedy of Arms'
John Keegan "World Armies"
R. Hure "L'Armee d' Afrique 1830-1962"
Military of Morocco
Military units and formations established in 1956 |
550961 | https://en.wikipedia.org/wiki/Pied%20thrush | Pied thrush | The pied thrush (Geokichla wardii) is a member of the thrush family found in India and Sri Lanka. The males are conspicuously patterned in black and white while the females are olive brown and speckled. They breed in the central Himalayan forests and winter in the hill forests of southern India and Sri Lanka. Like many other thrushes, they forage on leaf litter below forest undergrowth and fly into trees when disturbed and sit still making them difficult to locate.
Description
Males of this thrush are conspicuously black and white. Mostly black on the upper parts it has a long white supercilium, and white tips to the wing coverts, tertials, rump and tail. The underparts are white with black flank spots the bill and legs are yellow. Females and young birds have the same basic pattern, but the black is replaced by dark brown, and the white by light brown. The markings on the underside are scalier. The third primary is the longest followed by the fourth with the second and fifth being nearly equal in length. The first primary is reduced.
The bill is not as strongly curved as that of the dark-sided thrush or the long-billed thrush and the female lacks the prominent pale cheek spot of the similar looking female Siberian thrush.
The binomial commemorates Samuel Neville Ward (1813–1897), a British colonial administrator in India from 1832 to 1863. Jerdon and Charles Darwin corresponded with S.N. Ward who worked in the Madras Civil Service, posted for sometime at Sirsi and was known for his natural history studies and artistic talent.
Thomas C. Jerdon who first obtained a specimen of the species from Ward notes:
The species was variously placed in the past and for a long time in the genus Zoothera along with many other thrushes but molecular phylogenetic studies in 2008 clarified the phylogeny and the requirements for monophyly of the genera led to the older genus Geokichla being resurrected. The genus Zoothera now contains species that are not strongly sexually dimorphic unlike Geokichla. The pied thrush's closest relative is the Siberian thrush Geokichla sibirica.
Distribution
The summer breeding range is from western Himachal Pradesh in the Himalayas east at least until central Nepal. Records from further east such as Sikkim have been questioned by Rasmussen and Anderton (2005). The pied thrush is migratory, wintering mainly in Sri Lanka, with smaller numbers in the hills of south India. During passage, they may be preyed on by crows.
Although rare, they are locally and seasonally seen regularly at certain locations in winter such as at Victoria Park in Nuwara Eliya, Sri Lanka, where a number of birds gather by the stream early in the morning or in some hills stations in southern India such as Nandi Hills and Yercaud.
Behaviour and ecology
They forage alone or in pairs, often seen on the ground but flying into the trees and perching still when disturbed. The pied thrush, like many Zoothera thrushes, can be quite secretive. Pied thrushes are omnivorous, but eat more insects than fruit. They form loose flocks in winter.
The breeding season is May to July and the nest is a deep cup lined with grass and cemented with mud and placed in a low tree fork. The clutch consists of 3–4 white or bluish eggs. This uncommon species breeds in the Himalayas between in thick woodland. The wintering areas are similar but include less well-wooded areas, and are generally at altitude.
Their song is not considered as musical as those of many others thrushes and consists of a series of squeaky notes followed by short trills.
References
External links
pied thrush
Birds of the Himalayas
Birds of India
Birds of Nepal
pied thrush |
36061015 | https://en.wikipedia.org/wiki/Paratomoxia%20maynei | Paratomoxia maynei | Paratomoxia maynei is a species of beetle in the genus Paratomoxia of the family Mordellidae. It was described by Píc in 1931.
References
External links
Coleoptera. BugGuide.
Beetles described in 1931
Mordellidae |
39869304 | https://en.wikipedia.org/wiki/Fevzi%20T%C3%BCrkeri | Fevzi Türkeri | Fevzi Türkeri (born 1941, Elazığ) is a former Turkish general. He graduated from the Turkish Military Academy in 1962 and the Kara Harp Akademisi in 1975. During the 1980s and 1990s he was twice Chief of the Special Forces of the Turkish Army. He was General Commander of the Gendarmerie of Turkey from 26 August 2004 to 24 August 2006.
References
1941 births
Living people
Turkish Army generals
General Commanders of the Gendarmerie of Turkey
Special Warfare Department personnel
Turkish Military Academy alumni
Commanders of the Second Army of Turkey
People from Elazığ |
28095958 | https://en.wikipedia.org/wiki/Bamba%20Bakary | Bamba Bakary | Bamba Bakary is an Ivorian actor, comedian and television presenter from the Ivory Coast.
Formerly an air steward for Air Afrique, Bakary became an ambassador for the prevention of AIDS for Africans, including in his role as Moussa, in Moussa le taximan. He is also the presenter of three shows on La Première (RTI) : Tonnerre which is shown regularly, Le bon vieux temps and Bonne cuisine.
Filmography
1988 : Dancing in the Dust, by Henri Duparc
1990 : Le Sixième Doigt, by Henri Duparc
2008- : Coup de force
2008- : Dr Boris
References
20th-century Ivorian male actors
Male comedians
Living people
Year of birth missing (living people)
21st-century Ivorian male actors |
7326713 | https://en.wikipedia.org/wiki/Ron%20Barrier | Ron Barrier | Ron Barrier is the former national spokesperson and media coordinator of American Atheists, and he frequently appears in U.S. media to present arguments from an atheist perspective. He has debated Christian apologist William Lane Craig over the existence of God.
Barrier produces the cable TV program "The Atheist Viewpoint" in Staten Island, New York.
References
Year of birth missing (living people)
Living people
American atheism activists
Television producers from New York City
American television talk show hosts
21st-century atheists |
57142395 | https://en.wikipedia.org/wiki/Percy%20Kelly%20%28artist%29 | Percy Kelly (artist) | Percy Kelly (1918–1993) was a Cumbrian artist, footballer, post office worker and transvestite. He is most famous for his drawings and paintings which he hoarded during his lifetime – "They are so important to me I could never sell them".
References
Citations
Sources
Further reading
Joint winner of Lakeland Book of the Year 2012; letters to Mary Burkett, director of Abbot Hall Art Gallery
External links
Percy Kelly website
1918 births
1993 deaths
Cross-dressers
English artists
British postmen
British postmasters
Workington A.F.C. players
Association footballers not categorized by position
Transgender sportspeople
LGBT association football players
LGBT sportspeople from England
English footballers
20th-century LGBT people |
38777568 | https://en.wikipedia.org/wiki/N-acetylglucosaminyldiphosphodolichol%20N-acetylglucosaminyltransferase | N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase | N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase (, UDP-GlcNAc:dolichyl-pyrophosphoryl-GlcNAc GlcNAc transferase, uridine diphosphoacetylglucosamine-dolichylacetylglucosamine pyrophosphate acetylglucosaminyltransferase, N,N'-diacetylchitobiosylpyrophosphoryldolichol synthase) is an enzyme with systematic name UDP-N-acetyl-D-glucosamine:N-acetyl-D-glucosaminyl-diphosphodolichol N-acetyl-D-glucosaminyltransferase. This enzyme catalyses the following chemical reaction
UDP-N-acetyl-D-glucosamine + N-acetyl-D-glucosaminyl-diphosphodolichol UDP + N,N'-diacetylchitobiosyl-diphosphodolichol
References
External links
EC 2.4.1 |
43026130 | https://en.wikipedia.org/wiki/Time%20Doesn%27t%20Heal | Time Doesn't Heal | Time Doesn't Heal () is the sixth Mandarin studio album by Taiwan-born Malaysian Mandopop artist Freya Lim (). It was released on 2 May 2014 by Rock Records.
Track listing
Notes
"歲月這把刀 (Time Doesn't Heal)" is the closing theme song of the television series Fabulous 30 (女人30情定水舞間).
"我們的故事只講了一半 (Unfinished Story)" is featured in the television series Just You.
"明明愛你 (Hidden Love)" is the closing theme song of the television series In a Good Way.
Music videos
References
External links
Rock Records Taiwan - 歲月這把刀
2014 albums
Freya Lim albums
Rock Records albums
Mandopop albums |
53794893 | https://en.wikipedia.org/wiki/Jane%20Waldfogel | Jane Waldfogel | Jane Waldfogel FBA is an American social economist and the Compton Foundation Centennial Professor of Social Work for the Prevention of Children's and Youth Problems at Columbia University. Her research focuses on work-family policies, improving the measurement of poverty, and understanding social mobility across countries and child welfare. She has published studies about the impact of public policies on child and family well-being.
Education and career
Waldfogel received her B.A. from Radcliffe College in 1976, her M.Ed. from the Harvard Graduate School of Education in 1979, and her Ph.D. in public policy from the Kennedy School of Government at Harvard University in 1994.
She was elected as a Corresponding Fellow of the British Academy in 2015.
References
External links
Faculty page at the Columbia University School of Social Work
Faculty page at the Columbia Population Research Center
Columbia University faculty
American sociologists
American women sociologists
Living people
American women economists
21st-century American economists
Radcliffe College alumni
Harvard Graduate School of Education alumni
Harvard Kennedy School alumni
Corresponding Fellows of the British Academy
Social work scholars
Year of birth missing (living people)
21st-century American women |
60469076 | https://en.wikipedia.org/wiki/Kundasang%20%28state%20constituency%29 | Kundasang (state constituency) | Kundasang is a state constituency in Sabah, Malaysia, that is represented in the Sabah State Legislative Assembly.
History
Election results
References
Sabah state constituencies |
1497773 | https://en.wikipedia.org/wiki/CNS%2011643 | CNS 11643 | The CNS 11643 character set (Chinese National Standard 11643), also officially known as the Chinese Standard Interchange Code or CSIC (), is officially the standard character set of Taiwan (Republic of China). In practice, variants of the related Big5 character set are de facto standard.
CNS 11643 is designed to conform to ISO 2022. It contains 16 planes, so the maximum possible number of encodable characters is 16×94×94 = 141376. Planes 1 through 7 are defined by the standard; since 2007, planes 10 through 15 have also been defined by the standard. Prior to this, planes 12 to 15 (35344 code points) were specifically designated for user-defined characters. Unlike CCCII, the encoding of variant characters in CNS 11643 is not related.
EUC-TW is an encoded representation of CNS 11643 and ASCII in Extended Unix Code (EUC) form. Other encodings capable of representing certain CSIC planes include ISO-2022-CN (planes 1 and 2) and ISO-2022-CN-EXT (planes 1 through 7).
History
The first edition of the standard was published in 1986, and included planes 1 and 2, deriving from levels 1 and 2 of Big5, with some re-ordering due to corrected stroke counts, two duplicate characters being omitted, and the addition of 213 classical radicals. Extensions to the standard were subsequently published in 1988 (6319 characters, occupying plane 14) and 1990 (7169 characters, occupying plane 15).
Unicode 1.0.0, although it did not yet include hanzi, included characters for compatibility with CNS 11643: the CJK Compatibility Forms block was titled "CNS 11643 Compatibility" in Unicode 1.0.0. When the Unicode CJK Unified Ideographs set was being compiled for Unicode 1.0.1, the national bodies submitted character sets to the CJK Joint Research Group for inclusion. The version of CNS 11643 submitted included the plane 14 extension, in addition to further desired characters appended to plane 14 (after 68-21, the last used code point in the standard version of the extension).
In the second edition of the standard, published in 1992, a much larger collection of hanzi was defined across seven planes. A subset of the 1988 plane 14 extension, including the 6148 code points 01-01 through 66-38, became plane 3 (with the remaining 171 characters, code points 66-39 through 68-21, being instead distributed amongst plane 4). The plane 15 extension was not included, although 338 of its characters were included amongst planes 4 through 7.
The third edition of the standard, published in 2007, added the Euro sign, ideographic zero, kana and extensions to the existing bopomofo and Roman alphabet support to plane 1. It introduced planes 10 through 14, containing additional hanzi, and incorporated the existing plane 15 extension into the standard itself (with gaps left where the characters already existed in planes 4 through 7). It also added 128 further hanzi to plane 3, starting at code point 68-40.
, there are several thousand CNS 11643 characters with no corresponding Unicode character, mostly in planes 10 through 14; these are mapped to the Unicode Supplementary Private Use Area.
Relationship to Big5
Levels 1 and 2 of the Big5 encoding correspond mostly to CNS 11643 planes 1 and 2, respectively, with occasional differences in order, and with two duplicate hanzi existing in Big5 but not in CNS 11643. They can be mapped using a list of ranges. However, the 213 classical radicals in CNS 11643 plane 1 are additional to the characters available in Big5, and further additional characters were added to CNS 11643 plane 1 in 2007. The Big5-2003 variant of Big5 is defined as a partial encoding of CNS 11643.
Within the Big5 hanzi repertoire, only one character is conventionally mapped to Unicode differently from the corresponding character from the first two CNS 11643 planes: to U+5F5D (彝), whereas its CNS plane 1 counterpart is mapped to a related variant at U+5F5E (彞). However, some variant mappings for Big5, such as some defined by IBM, include U+5F5E rather than U+5F5D.
References
This page is based on the information on the CNS official web site.
External links
CNS 11643 official web site
Current CNS 11643 open data, including mapping data
Unicode Consortium mappings for CNS 11643-1986: planes 1 and 2, plus the 1988 plane 14 (not the 2007 plane 14) with extensions. Uses a single prefixed hex digit to indicate plane.
CNS 11643 mappings from International Components for Unicode (ICU):
"CNS-11643-1992": original version, current version. The original version of the mapping includes standard planes 1–7 but includes the plane 15 layout as plane 9; the current version includes only planes 1 and 2. Uses prefixed 0x81 through 0x89 to indicate plane.
"EUC-TW-2014": standard assignments for planes 1 through 7 and 15, and IBM corporate assignments in planes 12 and 13. CNS codes in EUC format with two-byte plane 1.
ISO-IR registered CNS-11643 code charts: plane 1, plane 2, plane 3, plane 4, plane 5, plane 6, plane 7
Character sets
Chinese-language computing |
58019182 | https://en.wikipedia.org/wiki/Catherine%20Adifaka | Catherine Adifaka | Catherine Adifaka is a senior government official in the Solomon Islands. She was the first woman to be appointed as the Solomon Islands' Public Service Commissioner.
Life
Adifaka was appointed to the Constitutional Congress of the Solomon Islands in 2007.
References
Solomon Islands women in politics
Living people
Year of birth missing (living people) |
12426 | https://en.wikipedia.org/wiki/Groucho%20Marx | Groucho Marx | Julius Henry "Groucho" Marx (; October 2, 1890 – August 19, 1977) was an American comedian, actor, writer, stage, film, radio, singer, television star and vaudeville performer. He is generally considered to have been a master of quick wit and one of America's greatest comedians.
He made 13 feature films as a team with his siblings the Marx Brothers; he was the third-born of the brothers. He also had a successful solo career primarily on radio and television, most notably as the host of the game show You Bet Your Life.
His distinctive appearance, carried over from his days in vaudeville, included quirks such as an exaggerated stooped posture, spectacles, cigar, and a thick greasepaint mustache and eyebrows. These exaggerated features resulted in the creation of one of the most recognizable and ubiquitous novelty disguises, known as Groucho glasses: a one-piece mask consisting of horn-rimmed glasses, a large plastic nose, bushy eyebrows and mustache.
Early life
Julius Henry Marx was born on October 2, 1890, in Manhattan, New York. Marx stated that he was born in a room above a butcher's shop on East 78th Street, "Between Lexington & 3rd", as he told Dick Cavett in a 1969 television interview. The Marx children grew up in a turn-of-the-century building on East 93rd Street off Lexington Avenue in a neighborhood now known as Carnegie Hill on the Upper East Side of the borough of Manhattan. His older brother Harpo, in his memoir Harpo Speaks, called the building "the first real home they ever knew". It was populated with European immigrants, mostly artisans. Just across the street were the oldest brownstones in the area, owned by people including the well-connected Loew Brothers and William Orth. The Marx family lived there "for about 14 years," Groucho also told Cavett.
Marx's family was Jewish. His mother was Miene "Minnie" Schoenberg, whose family came from Dornum in northern Germany when she was 16 years old. His father was Simon "Sam" Marx, who changed his name from Marrix, and was called "Frenchie" by his sons throughout his life, because he and his family came from Alsace in France. Minnie's brother was Al Schoenberg, who shortened his name to Al Shean when he went into show business as half of Gallagher and Shean, a noted vaudeville act of the early 20th century. According to Marx, when Shean visited, he would throw the local waifs a few coins so that when he knocked at the door he would be surrounded by adoring fans. Marx and his brothers respected his opinions and asked him on several occasions to write some material for them.
Minnie Marx did not have an entertainment industry career but had intense ambition for her sons to go on the stage like their uncle. While pushing her second son Leonard (Chico Marx) in piano lessons, she found that Julius had a pleasant soprano voice and the ability to remain on key. Julius's early career goal was to become a doctor, but the family's need for income forced him out of school at the age of twelve. By that time young Julius had become a voracious reader, particularly fond of Horatio Alger. Marx would continue to overcome his lack of formal education by becoming very well-read.
After a few stabs at entry-level office work and jobs suitable for adolescents, Julius took to the stage as a boy singer with the Gene Leroy Trio, debuting at the Ramona Theatre in Grand Rapids, Michigan, on July 16, 1905. Marx reputedly claimed that he was "hopelessly average" as a vaudevillian, but this was typical Marx, wisecracking in his true form. By 1909, Minnie Marx had assembled her sons into an undistinguished vaudeville singing group billed as "The Four Nightingales". The brothers Julius, Milton (Gummo Marx) and Arthur (originally Adolph, but Harpo Marx from 1911) and another boy singer, Lou Levy, traveled the U.S. vaudeville circuits to little fanfare. After exhausting their prospects in the East, the family moved to La Grange, Illinois, to play the Midwest.
After a particularly dispiriting performance in Nacogdoches, Texas Julius, Milton, and Arthur began cracking jokes onstage for their own amusement. Much to their surprise, the audience liked them better as comedians than as singers. They modified the then-popular Gus Edwards comedy skit "School Days" and renamed it "Fun In Hi Skule". The Marx Brothers would perform variations on this routine for the next seven years.
For a time in vaudeville, all the brothers performed using ethnic accents. Leonard, the oldest, developed the Italian accent he used as Chico Marx to convince some roving bullies that he was Italian, not Jewish. Arthur, the next oldest, donned a curly red wig and became "Patsy Brannigan", a stereotypical Irish character. His discomfort when speaking on stage led to his uncle Al Shean's suggestion that he stop speaking altogether and play the role in mime. Julius Marx's character from "Fun In Hi Skule" was an ethnic German, so Julius played him with a German accent. After the sinking of the in 1915, public anti-German sentiment was widespread, and Marx's German character was booed, so he quickly dropped the accent and developed the fast-talking wise-guy character that became his trademark.
The Marx Brothers became the biggest comedic stars of the Palace Theatre in New York, which billed itself as the "Valhalla of Vaudeville". Brother Chico's deal-making skills resulted in three hit plays on Broadway. No other comedy routine had ever so infected the Broadway circuit. All of this stage work predated their Hollywood career. By the time the Marxes made their first movie, they were already major stars with sharply honed skills; and by the time Groucho was relaunched to stardom in television on You Bet Your Life, he had been performing successfully for half a century.
Career
Vaudeville
Marx started his career in vaudeville in 1905 when he joined up with an act called The Leroy Trio. He answered a newspaper want ad by a man named Robin Leroy who was looking for a boy to join his group as a singer. Marx was hired along with fellow vaudeville actor Johnny Morris. Through this act, Marx got his first taste of life as a vaudeville performer. In 1909, Marx and his brothers had become a group act, at first called The Three Nightingales and later The Four Nightingales. The brothers' mother, Minnie Marx, was the group's manager, putting them together and booking their shows. The group had a rocky start, performing in less than adequate venues and rarely, if ever, being paid for their performances. Eventually brother Milton (Gummo) would leave the act to serve in World War I and was replaced by Herbert (Zeppo), and the group became known as the Marx Brothers. Their first successful show was Fun In Hi Skule (1910).
Hollywood
Marx made 26 movies, 13 of them include his brothers Chico and Harpo. Marx developed a routine as a wisecracking hustler with a distinctive chicken-walking lope, an exaggerated greasepaint mustache and eyebrows and an ever-present cigar, improvising insults to stuffy dowagers (frequently played by his old friend Margaret Dumont) and anyone else who stood in his way. As the Marx Brothers, he and his brothers starred in a series of popular stage shows and movies.
Their first movie was a silent film made in 1921 that was never released, and is believed to have been destroyed at the time. A decade later, the team made two of their Broadway hits—The Cocoanuts and Animal Crackers—into movies. Other successful films were Monkey Business, Horse Feathers, Duck Soup and A Night at the Opera. One quip from Marx concerned his response to Sam Wood, the director of A Night at the Opera. Furious with the Marx Brothers' ad-libs and antics on the set, Wood yelled in disgust: "You can't make an actor out of clay." Marx responded, "Nor a director out of Wood."
Marx also worked as a radio comedian and show host. One of his earliest stints was a short-lived series in 1932, Flywheel, Shyster and Flywheel, costarring Chico. Though most of the scripts and discs were thought to have been destroyed, all but one of the scripts were found in 1988 in the Library of Congress.
In 1947, Marx was asked to host a radio quiz program You Bet Your Life. It was broadcast by ABC and then CBS before moving to NBC. It moved from radio to television on October 5, 1950, and ran for eleven years. Filmed before an audience, the show consisted of Marx bantering with the contestants and ad-libbing jokes before briefly quizzing them. The show was responsible for popularizing the phrases "Say the secret word and the duck will come down and give you fifty dollars," "Who's buried in Grant's Tomb?" and "What color is the White House?" (asked to reward a losing contestant a consolation prize).
Throughout his career Marx introduced a number of memorable songs in films, including "Hooray for Captain Spaulding" and "Hello, I Must Be Going", in Animal Crackers, "Whatever It Is, I'm Against It", "Everyone Says I Love You" and "Lydia the Tattooed Lady". Frank Sinatra, who once quipped that the only thing he could do better than Marx was sing, made a film with Marx and Jane Russell in 1951 entitled Double Dynamite.
Mustache, eyebrows, and walk
In public and off-camera, Harpo and Chico were hard to recognize without their wigs and costumes, and it was almost impossible for fans to recognize Groucho without his trademark eyeglasses, fake eyebrows, and mustache.
The greasepaint mustache and eyebrows originated spontaneously prior to a vaudeville performance in the early 1920s when he did not have time to apply the pasted-on mustache he had been using (or, according to his autobiography, simply did not enjoy the removal of the mustache because of the effects of tearing an adhesive bandage off the same patch of skin every night). After applying the greasepaint mustache, a quick glance in the mirror revealed his natural hair eyebrows were too undertoned and did not match the rest of his face, so Marx added the greasepaint to his eyebrows and headed for the stage. The absurdity of the greasepaint was never discussed on-screen, but in a famous scene in Duck Soup, where both Chicolini (Chico) and Pinky (Harpo) disguise themselves as Groucho, they are briefly seen applying the greasepaint, implicitly answering any question a viewer might have had about where he got his mustache and eyebrows.
Marx was asked to apply the greasepaint mustache once more for You Bet Your Life when it came to television, but he refused, opting instead to grow a real one, which he wore for the rest of his life. By this time, his eyesight had weakened enough for him to actually need corrective lenses; before then, his eyeglasses had merely been a stage prop. He debuted this new, and now much-older, appearance in Love Happy, the Marx Brothers's last film as a comedy team.
Marx did paint the old character mustache over his real one on a few rare occasions, including a TV sketch with Jackie Gleason on the latter's variety show in the 1960s (in which they performed a variation on the song "Mister Gallagher and Mister Shean," co-written by Marx's uncle Al Shean) and the 1968 Otto Preminger film Skidoo. In his late 70s at the time, Marx remarked on his appearance: "I looked like I was embalmed." He played a mob boss called "God" and, according to Marx, "both my performance and the film were God-awful!"
The exaggerated walk, with one hand on the small of his back and his torso bent almost 90 degrees at the waist, was a parody of a fad from the 1880s and 1890s. Fashionable young men of the upper classes would affect a walk with their right hand held fast to the base of their spines, and with a slight lean forward at the waist and a very slight twist toward the right with the left shoulder, allowing the left hand to swing free with the gait. Edmund Morris, in his biography The Rise of Theodore Roosevelt, describes a young Roosevelt, newly elected to the State Assembly, walking into the House Chamber for the first time in this trendy, affected gait, somewhat to the amusement of the older and more rural members. Marx exaggerated this fad to a marked degree, and the comedic effect was enhanced by how out of date the fashion was by the 1940s and 1950s.
Personal life
Marx's three marriages ended in divorce. His first wife was chorus girl Ruth Johnson (m. 1920–1942). He was 29 and she was 19 at the time of their wedding. The couple had two children, Arthur Marx and Miriam Marx. His second wife was Kay Marvis (m. 1945–1951), Catherine Dittig, former wife of Leo Gorcey. Marx was 54 and Kay was 21 at the time of their marriage. They had a daughter, Melinda Marx. His third wife was actress Eden Hartford (m. 1954–1969). He was 64 and she was 24 at the time of their wedding.
During the early 1950s, Marx described his perfect woman: "Someone who looks like Marilyn Monroe and talks like George S. Kaufman."
Marx was denied membership in an informal symphonietta of friends (including Harpo) organized by Ben Hecht, because he could play only the mandolin. When the group began its first rehearsal at Hecht's home, Marx rushed in and demanded silence from the "lousy amateurs". The musicians discovered him conducting the Los Angeles Symphony Orchestra in a performance of the overture to Tannhäuser in Hecht's living room. Marx was allowed to join the symphonietta.
Later in life, Marx would sometimes note to talk show hosts, not entirely jokingly, that he was unable to actually insult anyone, because the target of his comment would assume that it was a Groucho-esque joke, and would laugh.
Despite his lack of formal education, he wrote many books, including his autobiography, Groucho and Me (1959) and Memoirs of a Mangy Lover (1963). He was a friend of such literary figures as Booth Tarkington, T. S. Eliot and Carl Sandburg. Much of his personal correspondence with those and other figures is featured in the book The Groucho Letters (1967) with an introduction and commentary on the letters written by Marx, who donated his letters to the Library of Congress. His daughter Miriam published a collection of his letters to her in 1992 titled Love, Groucho.
In My Life with Groucho: A Son's Eye View, Arthur Marx relates that in his latter years Groucho increasingly referred to himself by the name Hackenbush, referring to the character of that name he played in A Day at the Races (film).
Marx made serious efforts to learn to play the guitar. In the 1932 film Horse Feathers, he performs the film's love theme "Everyone Says I Love You" for costar Thelma Todd on a Gibson L-5.
In July 1937, an America vs England pro-celebrity tennis doubles match was organized, featuring Marx and Ellsworth Vines playing against Charlie Chaplin and Fred Perry, to open the new clubhouse at the Beverly Hills Tennis Club. Marx appeared on court with 12 rackets and a suitcase, leaving Chaplin – who took tennis seriously – bemused, before he asked what was in it. Marx asked Chaplin what was in his, with Chaplin responding he didn't have one. Marx replied, "What kind of tennis player are you?" After playing only a few games, Marx sat on the court and unpacked an elaborate picnic lunch from his suitcase.
Irving Berlin quipped, "The world would not be in such a snarl, had Marx been Groucho instead of Karl". In his book The Groucho Phile, Marx says "I've been a liberal Democrat all my life", and "I frankly find Democrats a better, more sympathetic crowd.... I'll continue to believe that Democrats have a greater regard for the common man than Republicans do". However, during an episode of Firing Line on July 7, 1967, Marx admitted to voting for Wendell Willkie, the Republican candidate for president in 1940 over Franklin D. Roosevelt, stating that he did not believe that any man should run for more than two terms. Marx also said in a television interview that he disliked the women's liberation movement.
Later years
You Bet Your Life
Marx's radio career was not as successful as his work on stage and in film, though historians such as Gerald Nachman and Michael Barson suggest that, in the case of the single-season Flywheel, Shyster, and Flywheel (1932), the failure may have been a combination of a poor time slot and the Marx Brothers' returning to Hollywood to make another film.
In the mid-1940s, he weathered a depressing lull in his career. His radio show Blue Ribbon Town had failed, and he was unable to sell his proposed sitcom The Flotsam Family only to see it become a huge hit as The Life of Riley with William Bendix in the title role. By that time, the Marx Brothers as film performers had officially retired.
Marx was scheduled to appear on a radio show with Bob Hope. Annoyed that he was made to wait in the green room for 40 minutes, he went on the air in a foul mood. Hope started by saying "Why, Groucho Marx! Groucho, what are you doing out here in the desert?" Marx retorted, "Huh, desert, I've been sitting in the dressing room for forty minutes! Some desert alright ...". Marx continued to ignore the script, ad-libbing at length, and took it well beyond its allotted time slot.
Listening in on the show was producer John Guedel, who had a brainstorm. He approached Marx about doing a quiz show, to which Marx derisively retorted, "A quiz show? Only actors who are completely washed up resort to a quiz show!" Undeterred, Guedel proposed that the quiz would be only a backdrop for Marx's interviews of people, and the storm of ad-libbing that they would elicit. Marx replied, "Well, I've had no success in radio, and I can't hold on to a sponsor. At this point, I'll try anything!"
You Bet Your Life debuted in October 1947 on ABC radio (which aired it from 1947 to 1949), sponsored by costume jewelry manufacturer Allen Gellman; and then on CBS (1949–50), and finally NBC. The show was on radio only from 1947 to 1950; on both radio and television from 1950 to 1960; and on television only, from 1960 to 1961. The show proved a huge hit, being one of the most popular on television by the mid-1950s. With George Fenneman as his announcer and straight man, Marx entertained his audiences with improvised conversation with his guests. Since You Bet Your Life was mostly ad-libbed and unscripted — although writers did pre-interview the guests and feed Marx ready-made lines in advance — the producers insisted that the network prerecord it instead of it being broadcast live. There were three reasons for this: prerecording provided Marx with time to fish around for funny exchanges, any intervening dead spots could be edited out; and most importantly to protect the network, since Marx was a notorious loose cannon and known to say almost anything. The television show ran for 11 seasons until it was canceled in 1961. Automobile marque DeSoto was a longtime major sponsor. For the DeSoto ads, Marx would sometimes say: "Tell 'em Groucho sent you", or "Try a DeSoto before you decide." In the mid-1970s, episodes of the show were syndicated and rebroadcast as The Best of Groucho.
The program's theme music was an instrumental version of "Hooray for Captain Spaulding," which became increasingly identified as Marx's personal theme song. A recording of the song with Marx and the Ken Lane singers with an orchestra directed by Victor Young was released in 1952. Another recording made by Marx during this period was "The Funniest Song in the World," released on the Young People's Records label in 1949. It was a series of five original children's songs with a connecting narrative about a monkey and his fellow zoo creatures.
One of Marx's most oft-quoted remarks may have occurred during a 1947 radio episode. Marx was interviewing Charlotte Story, who had borne 20 children. When Marx asked why she had chosen to raise such a large family, Mrs. Story is said to have replied, "I love my husband," to which Marx responded, "I love my cigar, but I take it out of my mouth once in a while." The remark was judged too risqué to be aired, according to the anecdote, and was edited out before broadcast. Charlotte Story and her husband Marion, indeed parents of 20 children, were real people who appeared on the program. Audio recordings of the interview exist, and a reference to cigars is made ("With each new kid, do you go around passing out cigars?"), but there is no evidence of the claimed remark. "I get credit all the time for things I never said," Marx told Roger Ebert in 1972. "You know that line in You Bet Your Life? The guy says he has seventeen kids and I say, 'I smoke a cigar, but I take it out of my mouth occasionally'? I never said that." Marx's 1976 memoir recounts the episode as fact, but co-writer Hector Arce relied mostly on sources other than Marx himself—who was by then in his mid eighties, in ill health and mentally compromised—and was probably unaware that Marx had specifically denied making the observation. Head writer Bernie Smith recalled in a 1996 interview that the remark was indeed made—but again, well after the fact.
Another anecdote that may or may not be apocryphal recounts how Warner Brothers threatened to sue Groucho when they learned that the next Marx Brothers film was to be called A Night in Casablanca, contending that that title was too similar to their own film Casablanca. Groucho is reported to have replied, "What about 'Warner Brothers'? Do you own that too? Professionally, we were 'Brothers' long before you were 'Brothers'. We forbid you ever to use the word 'Brothers' again."
Other work
By the time You Bet Your Life debuted on TV on October 5, 1950, Marx had grown a real mustache (which he had already sported earlier in the films Copacabana and Love Happy).
During a tour of Germany in 1958, accompanied by then-wife Eden, daughter Melinda, Robert Dwan and Dwan's daughter Judith, he climbed a pile of rubble that marked the site of Adolf Hitler's bunker, the site of Hitler's death, and performed a two-minute Charleston. He later remarked to Richard J. Anobile in The Marx Brothers Scrapbook, "Not much satisfaction after he killed six million Jews!"
In 1960, Marx, a lifelong devotee of the comic operas of Gilbert and Sullivan, appeared as Ko-Ko, the Lord High Executioner, in a televised production of The Mikado on NBC's Bell Telephone Hour. A clip of this is in rotation on Classic Arts Showcase.
Another TV show, Tell It to Groucho, premiered January 11, 1962, on CBS, but only lasted five months. On October 1, 1962, Marx, after acting as occasional guest host of The Tonight Show during the six-month interval between Jack Paar and Johnny Carson, introduced Carson as the new host.
In 1964, Marx starred in the "Time for Elizabeth" episode of Bob Hope Presents the Chrysler Theatre, a truncated version of a play that he and Norman Krasna wrote in 1948.
In 1965, Marx starred in a weekly show for British TV titled Groucho, broadcast on ITV. The program was along similar lines to You Bet Your Life, with Keith Fordyce taking on the Fenneman role. However, it was poorly received and lasted only 11 weeks.
Marx appeared as a gangster named God in the comedy movie Skidoo (1968), directed by Otto Preminger, and starring Jackie Gleason and Carol Channing. It was released by the studio where the Marx Brothers began their film career, Paramount Pictures. The film received almost universally negative reviews. Writer Paul Krassner published a story in the February 1981 issue of High Times, relating how Marx prepared for the LSD-themed movie by taking a dose of the drug in Krassner's company, and had a moving, largely pleasant experience.
Marx developed friendships with rock star Alice Cooper—the two were photographed together for Rolling Stone magazine—and television host Dick Cavett, becoming a frequent guest on Cavett's late-night talk show, even appearing in a one-man, 90-minute interview. He befriended Elton John when the British singer was staying in California in 1972, insisting on calling him "John Elton". According to writer Philip Norman, when Marx jokingly pointed his index fingers as if holding a pair of six-shooters, Elton John put up his hands and said, "Don't shoot me, I'm only the piano player," thereby naming the album he had just completed. A film poster for the Marx Bros. movie Go West is visible on the album cover photograph as an homage to Marx. Elton John accompanied Marx to a performance of Jesus Christ Superstar. As the lights went down, Marx called out, "Does it have a happy ending?" And during the Crucifixion scene, he declared, "This is sure to offend the Jews."
Marx's previous work regained popularity; new books of transcribed conversations were published by Richard J. Anobile and Charlotte Chandler. In a BBC interview in 1975, Marx called his greatest achievement having a book selected for cultural preservation in the Library of Congress. In a Cavett interview in 1971, Marx said being published in The New Yorker under his own name, Julius Henry Marx, meant more than all the plays he appeared in. As a man who never had formal schooling, to have his writings declared culturally important was a point of great satisfaction.
As he passed his 81st birthday in 1971, Marx became increasingly frail, physically and mentally, as a result of a succession of minor strokes and other health issues. In 1972, largely at the behest of his companion Erin Fleming, Marx staged a live one-man show at Carnegie Hall that was later released as a double album, An Evening with Groucho, on A&M Records. He also made an appearance in 1973 on a short-lived variety show hosted by Bill Cosby. Fleming's influence on Marx was controversial. Some close to Marx believed that she did much to revive his popularity, and the relationship with a younger woman boosted his ego and vitality. Others described her as a Svengali, exploiting an increasingly senile Marx in pursuit of her own stardom. Marx's children, particularly Arthur, felt strongly that Fleming was pushing their weak father beyond his physical and mental limits. Writer Mark Evanier concurred.
On the 1974 Academy Awards telecast which was Groucho Marx's final major public appearance, Jack Lemmon presented him with an honorary Academy Award to a standing ovation. The award honored Harpo, Chico, and Zeppo as well: "in recognition of his brilliant creativity and for the unequalled achievements of the Marx Brothers in the art of motion picture comedy". Noticeably frail, Marx took a bow for his deceased brothers. "I wish that Harpo and Chico could be here to share with me this great honor," he said, naming his two deceased brothers (Zeppo, still alive, was in the audience). He also praised the late Margaret Dumont as a great straight woman who never understood any of his jokes. Marx's final appearance was a brief sketch with George Burns in the Bob Hope television special Joys (a parody of the 1975 movie Jaws) in March 1976. His health continued to decline the following year; when his younger brother Gummo died at age 83 on April 21, 1977, Marx was never told for fear of eliciting still further deterioration of his health.
Marx maintained his irrepressible sense of humor to the very end, however. George Fenneman, his radio and TV announcer, good-natured foil, and lifelong friend, often related a story of one of his final visits to Marx's home: When the time came to end the visit, Fenneman lifted Marx from his wheelchair, put his arms around his torso, and began to "walk" the frail comedian backwards across the room towards his bed. As he did, he heard a weak voice in his ear: "Fenneman," whispered Marx, "you always were a lousy dancer." When a nurse approached him with a thermometer during his final hospitalization, explaining that she wanted to see if he had a temperature, he responded, "Don't be silly—everybody has a temperature." Actor Elliott Gould recalled a similar incident: "I recall the last time I saw Groucho, he was in the hospital, and he had tubes in his nose and what have you," he said. "And when he saw me, he was weak, but he was there; and he put his fingers on the tubes and played them like it was a clarinet. Groucho played the tubes for me, which brings me to tears."
Death
Marx was hospitalized at Cedars-Sinai Medical Center with pneumonia on June 22, 1977, and died there nearly two months later at the age of 86 on August 19, four months after Gummo's death. Media coverage of Groucho's death and legacy was overshadowed by the sudden death of Elvis Presley three days previously.
His body was cremated and the ashes are interred in the Eden Memorial Park Cemetery in Los Angeles. He was survived by his three children and younger brother Zeppo, who outlived him by two years. His gravestone bears no epitaph, but in one of his last interviews he suggested one: "Excuse me, I can't stand up."
Litigation over his estate lasted into the 1980s. Eventually, his three children were awarded the bulk of the estate, and Erin Fleming, his companion during his final years, was ordered to repay $472,000.
Legacy
Groucho Marx was considered the most recognizable of the Marx Brothers. Groucho-like characters and references have appeared in popular culture both during and after his life, some aimed at audiences who may never have seen a Marx Brothers movie. Marx's trademark eyeglasses, nose, mustache, and cigar have become icons of comedy—glasses with fake noses and mustaches (referred to as "Groucho glasses", "nose-glasses," and other names) are sold by novelty and costume shops around the world.
The cover of The Firesign Theatre's 1969 album, How Can You Be in Two Places at Once When You're Not Anywhere at All, subtitled All Hail Marx and Lennon, features images of Groucho Marx and John Lennon.
Nat Perrin, close friend of Groucho Marx and writer of several Marx Brothers films, inspired John Astin's portrayal of Gomez Addams on the 1960s TV series The Addams Family with similarly thick mustache, eyebrows, sardonic remarks, backward logic, and ever-present cigar (pulled from his breast pocket already lit).
Minnie's Boys, a 1970 Broadway musical, focused on the younger years of Marx (played by Lewis J. Stadlen), his brothers, and his mother (played by Shelley Winters). Marx received credit as the show's advisor and appeared on The Dick Cavett Show to promote the production.
In 1972, at Cannes, Marx was made a Commander in the French Ordre des Arts et des Lettres, an honour he was very proud of. In a TV episode of MASH titled: "Yankee Doodle Doctor" Hawkeye Pierce (Alan Alda) portrays Marx in a parody movie along with Trapper John (Wayne Rogers) portraying Harpo Marx.
A meeting with Elton John led to a press photo of Marx pointing both of his index fingers and thumbs at Elton like revolvers. John's spontaneous response of holding up his hands and replying, "Don't shoot me! I'm only the piano player!" was so amusing that Elton John reused it as the title of a 1973 album. An added Marx homage was that a poster for the Marx Brothers' movie Go West was included on the cover art.
Marx was also known to influence the Warner Bros. cartoon character Bugs Bunny, who would recite his famous line "Of course you realize this means war!" in two of his cartoons in the Looney Tunes series, Long Haired Hare and Bully for Bugs, when his antagonist has offended him.
Two albums by British rock band Queen, A Night at the Opera (1975) and A Day at the Races (1976), are named after Marx Brothers films. In March 1977, Marx invited Queen to visit him in his Los Angeles home; there they performed "'39" a cappella.
A long-running ad campaign for Vlasic Pickles features an animated stork that imitates Marx's mannerisms and voice. On the famous Hollywood Sign in California, one of the "O"s is dedicated to Marx. Alice Cooper contributed over $27,000 to remodel the sign, in memory of his friend.
Actor Frank Ferrante has performed as Groucho Marx on stage since 1986. He continues to tour under rights granted by the Marx family in a show entitled An Evening with Groucho in theaters throughout the United States and Canada with supporting actors and piano accompanist Jim Furmston. In the late 1980s, Ferrante starred as Marx in the off-Broadway and London show Groucho: A Life in Revue penned by Marx's son Arthur. Ferrante portrayed the comedian from age 15 to 85. The show was later filmed for PBS in 2001. In 1982, Gabe Kaplan filmed a version of the same show, entitled Groucho.
In the Hungarian dubbed version of Woody Allen's film Annie Hall, a famous quotation told by Alvy Singer (Allen) at the beginning of the film is not attributed to Groucho Marx as in the original, but to Buster Keaton. The reason was that in communist Hungary, the name 'Marx' was associated with Karl Marx and it was not allowed to use it in such a light, humorous context.
Woody Allen's 1996 musical Everyone Says I Love You, in addition to being named for one of Marx's signature songs, ends with a Groucho-themed New Year's Eve party in Paris, which some of the stars, including Allen and Goldie Hawn, attend in full Groucho costume. The highlight of the scene is an ensemble song-and-dance performance of "Hooray for Captain Spaulding"—done entirely in French.
In 2008, Minnie's Boys was remounted Off-Broadway with Erik Liberman as Groucho and Pamela Myers as Minnie Marx. Liberman later played Marx in a musical based on Flywheel, Shyster, and Flywheel called The Most Ridiculous Thing You Ever Hoid (2010) and at the Obama White House.
Groucho, a supporting character in the Italian horror comics series Dylan Dog, is a Groucho Marx impersonator whose character became his permanent personality, and he works with Dylan Dog as his professional sidekick. In the English-language version, to avoid legal complications regarding Groucho Marx's estate, the art was altered so that Groucho no longer sports the Marx brother's signature moustache, and was renamed Felix.
In the M*A*S*H television series several Groucho homage traits are mirrored in Alan Alda’s portrayal of Hawkeye, including in one episode a Groucho impression complete with nose, moustache and glasses.
Filmography
Features
Short subjects
Hollywood on Parade No. 11 (1933)
Screen Snapshots Series 16, No. 3 (1936)
Sunday Night at the Trocadero (1937)
Screen Snapshots: The Great Al Jolson (1955)
Showdown at Ulcer Gulch (1956) (voice)
Screen Snapshots: Playtime in Hollywood (1956)
Bibliography
Books by Groucho Marx
Beds (Farrar & Rinehart, 1930)
Beds: revised & updated edition (Bobbs-Merrill, 1976 )
Many Happy Returns: An Unofficial Guide to Your Income-Tax Problems Illustrated by Otto Soglow (Simon & Schuster, 1942)
Groucho and Me (B. Geis Associates, 1959)
Memoirs of a Mangy Lover (B. Geis Associates, 1963)
The Groucho Letters: Letters From and To Groucho Marx (Simon & Schuster, 1967, )
The Marx Bros, Scrapbook with Richard Anobile (Darien House/W W Norton, 1973, )
The Secret Word Is Groucho with Hector Arce (Putnam, 1976)
The Groucho Phile: An Illustrated Life by Groucho Marx with Hector Arce (Galahad, 1976, )
Essays and reporting
References
Further reading
Miriam Marx Allen, Love, Groucho: Letters From Groucho Marx to His Daughter Miriam (1992, )
Charlotte Chandler, Hello, I Must Be Going! (1979, )
Stefan Kanfer, Groucho: The Life and Times of Julius Henry Marx (2000, )
Simon Louvish, Monkey Business: The Lives and Legends of the Marx Brothers (2001, )
Arthur Marx, Life With Groucho (1954, revised as My Life with Groucho: A Son's Eye View 1988, ))
Arthur Marx, Son of Groucho (1972, )
Harpo Marx, Harpo Speaks (1961, revised as Harpo Speaks! 1985, )
Glenn Mitchell, The Marx Brothers Encyclopedia (1996, )
Steve Stoliar, Raised Eyebrows: My Years Inside Groucho's House (1996, )
Julius H. (Groucho) Marx v. Commissioner of Internal Revenue, 29 T.C. 88 (1957)
External links
Marx, Groucho, 1890–1977 (Library of Congress Name Authority File)
Groucho Marx papers, 1930–1967 (Library of Congress)
Groucho Marx - Old Time Radio - Archive.org
Groucho's letter to Warner Brothers when they threatened to sue him
Groucho Marx Interview – Press Conference London June 1965
FBI Records: The Vault - Groucho Marx at vault.fbi.gov
The Marx Brothers Museum
1890 births
1977 deaths
20th-century American comedians
20th-century American male actors
Academy Honorary Award recipients
American game show hosts
American male comedians
American male film actors
American male musical theatre actors
American male stage actors
American male television actors
American male comedy actors
American people of German-Jewish descent
American radio personalities
Male actors from New York City
Burials at Eden Memorial Park Cemetery
California Democrats
Deaths from pneumonia in California
Jewish American male actors
Comedians from New York City
Marx Brothers
People from the Upper East Side
Vaudeville performers
Jewish American comedians
20th-century American male singers
20th-century American singers |
4876545 | https://en.wikipedia.org/wiki/Archibald%20McLean | Archibald McLean | Archibald McLean may refer to:
Archibald McLean (d. 1830), New Brunswick political figure
Archibald McLean (Baptist) (1733–1812), Scottish minister
Archibald McLean (judge) (1791–1865), judge and political figure in Upper Canada
Archibald J. McLean (1860–1933), cattleman and politician from Alberta, Canada
Archibald Lang McLean (1885–1922), Australian doctor
Archie McLean (footballer) (1894–1971), football player
Archie McLean (ice hockey) (1889–1960), Canadian professional ice hockey player
See also
Archibald MacLean (1883–1970), officer in the Royal Scots, Royal Flying Corps and Royal Air Force |
58440820 | https://en.wikipedia.org/wiki/Kiran%20C%20Patel | Kiran C Patel | Kiran C. Patel is a Zambian-Indian-American philanthropist, serial entrepreneur, hotelier and cardiologist.
Early life and education
Patel was born in Zambia in 1949 to a Hindu Gujarati Indian family. He got his primary education under the British educational system in Zambia and earned diplomas from Cambridge University and the University of London. Patel attended medical school in India at Gujarat University and completed his internship in Africa. In 1976, he moved to the United States. Patel did his residency in internal medicine in New Jersey in 1980 and completed a fellowship in the cardiology program affiliated with Columbia University of New York in 1982.
Career
After moving to Tampa, Florida in 1982, Patel began his practice as a cardiologist. In 1985 he started a physicians practice ownership and management company, which quickly expanded to 14 practices including family medicine, internal medicine, pediatrics and cardiology. In 1992 Patel became chairman of the board of Well Care HMO, INC. which under his leadership became this 5th largest Medicaid HMO in the United States. In 1999, he acquired 55% of Kingston N.Y.-based WellCare Management Group Inc, which managed two HMO's in Connecticut and New York. In 2002, he sold majority share in the WellCare Management Group, at which point WellCare Management was providing services to over 400,000 members. In 2007, Patel started a new insurance holding company called America's 1st Choice Holdings of Florida and acquired two Tampa Bay based Medicare Advantage Health Plans, Freedom Health and Optimum Health. He grew these companies to over 115,000 members and over $1 billion in revenue, at which point he sold to Anthem in April 2019.
In 2018, Patel invested $60 million in the medical device company Concept Medical. He committed to gift $50 million and an additional $150 million towards real estate and facility expansion in the medical education complex that will be part of NSU’s Tampa Bay Regional Campus, in Clearwater.
Medical insurance
In 1992, Patel bought Well Care HMO, Inc. (Well Care) for approximately $5 million. He sold the company a decade later in 2002 for $200 million.
In 2007 he purchased Freedom Health and Optimum Healthcare Inc.
In 2017, he sold his second insurance company – America’s 1st Choice (including Freedom Health and Optimum Healthcare) to Anthem Inc. for an undisclosed amount.
Freedom Health lawsuit
On 17 August 2009, a whistleblower filed a complaint with the district court in Tampa, alleging that Freedom was manipulating enrollment rolls. Patel and his brother Rupesh Shah were among the named defendants. The complaint also alleged that Freedom was engaging in service-area-expansion fraud—misrepresenting the number of health-care providers in its network in certain counties so that it could expand the areas in which it offered Medicare Advantage. Once the investigation was announced, Patel told employees "not to destroy documents or other evidence" in an emergency meeting.
New Yorker article further reports, "In 2016, seven years after Darren Sewell filed his case, the Justice Department informed Inman that it would join the suit. In May 2017, after months of difficult negotiations, Freedom settled charges that it had violated the False Claims Act and agreed to pay $31.7 million. Freedom's former chief operating officer, Sidd Pagidipati, paid seven hundred and fifty thousand dollars to settle charges related to his role in the alleged service-area-expansion fraud. Neither admitted liability.
Awards and recognition
In 2019, Patel was given the Pravasi Bharatiya Samman by the government of India. In January 2019, the Clearwater City Council issued a resolution to rename Damascus Road as Dr. Kiran C. Patel Boulevard in recognition of Patel's contribution to Nova Southeastern University's Tampa Bay Regional Campus.
Charity history
Patel has supported multiple groups through charitable donations:
Patel foundation committed for $225 Million to Nova Southeastern University's colleges of osteopathic and allopathic medicine.
$30.5 Million to the University of South Florida for the Patel Center for Global Solutions and College of Global Sustainability.
$171,500 to build homes for poor people to Habitat for Humanity.
Patel pledged $7.5 million donation to Florida Hospital Carrollwood from 2017-2018.
$5 million for a conservatory at the David A. Straz Jr. Center for the Performing Arts.
$3 million for a research institute at Florida Hospital Tampa.
$20 million committed to Patel High School for tuition-free education.
Namesake institutes
Kiran C. Patel College of Osteopathic Medicine (D.O)
Kiran C. Patel College of Allopathic Medicine (M.D)
Drs. Kiran and Pallavi Patel Allied Health Building
Dr. Kiran C. Patel Center for Global Solutions
Kiran C. Patel High School
Kiran C. Patel Research Institute
Patel Conservatory – Straz Center for the Performing Arts
Dr. Kiran C Patel Centre for Sustainable Development, IIT Gandhinagar, Gujarat
Personal life
Patel is married to pediatrician Pallavi Patel. They have two daughters and one son.
Patel developed vitiligo in 2002. He is not seeking treatment for the condition.
References
Living people
Zambian emigrants to the United States
American people of Indian descent in health professions
American people of Gujarati descent
American cardiologists
American people of Indian descent
American businesspeople
Recipients of Pravasi Bharatiya Samman
1949 births
People with vitiligo |
32053864 | https://en.wikipedia.org/wiki/Eddy%20Antoine | Eddy Antoine | Eddy Antoine (born 27 August 1949) is a Haitian former footballer who played at both professional and international levels as a midfielder.
Club career
After playing for Racing CH and New Jersey Brewers, Antoine spent time in the North American Soccer League with the Chicago Sting.
International career
Antoine also represented the Haitian national team at international level, and participated at the 1974 FIFA World Cup.
References
1949 births
Living people
Haitian footballers
Haitian expatriate footballers
Haiti international footballers
Racing CH players
American Soccer League (1933–1983) players
New Jersey Brewers players
North American Soccer League (1968–1984) players
Chicago Sting (NASL) players
Expatriate soccer players in the United States
Haitian expatriate sportspeople in the United States
1974 FIFA World Cup players
CONCACAF Championship-winning players
Association football midfielders |
24663898 | https://en.wikipedia.org/wiki/Luisa%20%C3%81lvarez | Luisa Álvarez | Luisa María Álvarez Iglesias (born October 3, 1962 in Candás) is a Spanish sprint canoer who competed in the early 1990s. She was eliminated in the semifinals of the K-4 500 m event at the 1992 Summer Olympics in Barcelona.
References
Sports-Reference.com profile
1962 births
Canoeists at the 1992 Summer Olympics
Living people
Olympic canoeists of Spain
Spanish female canoeists |
54453149 | https://en.wikipedia.org/wiki/Cumbria%20Cup | Cumbria Cup | The Cumbria Cup is an annual rugby union knock-out club competition organized by the Cumbria Rugby Union. It was first introduced during the 1882-83 season, when it was known as the Cumberland Challenge Cup, and the inaugural winners were Aspatria. Originally it was open only to club sides in Cumberland, but in 1974, as a result of the 1972 Local Government Act, Cumberland, Westmorland and Furness merged to form what we now know as Cumbria, and the competition was renamed as the Cumbria Cup, although the Westmorland & Furness Cup continued intermittently up until 2008. It is the most important cup competition in the county ahead of the Cumbria League Cup and Cumbria Shield.
The Cumbria Cup is currently open to the top club sides based in Cumbria, typically playing in tier 5 (National League 3 North), tier 6 (North 1 West) and tier 7 (North Lancashire/Cumbria), of the English rugby union league system. The format is a knockout cup with a first round, quarter-finals, semi-finals and a final to be held at a neutral venue between April–May. Between 2006-14 there was also a Cumbria Plate competition for sides knocked out of the first round of the main cup competition but this has been discontinued in recent years.
Winners
Cumbria Plate winners
Number of wins
Cup
Aspatria (32)
Wigton (13)
Workington (12)
Egremont (8)
Penrith (8)
Keswick (7)
Cockermouth (6)
Carlisle (5)
Kendal (5)
Whitehaven (4)
Millom (3)
Seaton (3)
Maryport (2)
Netherhall (2)
Silloth (2)
St Benedict's (2)
Blennerhasset (1)
St Bees (1)
Plate
St Benedict's (2)
Keswick (1)
Millon (1)
Upper Eden (1)
Whitehaven (1)
Workington (1)
Notes
See also
Cumbria Rugby Union
Cumbria League Cup
Cumbria Shield
Westmorland & Furness Cup
References
External links
Cumbria RU
Recurring sporting events established in 1882
1882 establishments in England
Rugby union cup competitions in England
Rugby union in Cumbria |
21356401 | https://en.wikipedia.org/wiki/168th%20meridian%20east | 168th meridian east | The meridian 168° east of Greenwich is a line of longitude that extends from the North Pole across the Arctic Ocean, Asia, the Pacific Ocean, New Zealand, the Southern Ocean, and Antarctica to the South Pole.
The 168th meridian east forms a great circle with the 12th meridian west.
From Pole to Pole
Starting at the North Pole and heading south to the South Pole, the 168th meridian east passes through:
{| class="wikitable plainrowheaders"
! scope="col" width="130" | Co-ordinates
! scope="col" | Country, territory or sea
! scope="col" | Notes
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Arctic Ocean
| style="background:#b0e0e6;" |
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | East Siberian Sea
| style="background:#b0e0e6;" |
|-valign="top"
|
! scope="row" |
| Chukotka Autonomous Okrug — Ayon Island and the mainland Kamchatka Krai — from
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Bering Sea
| style="background:#b0e0e6;" |
|-
|
! scope="row" |
| Kamchatka Krai — Medny Island
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Pacific Ocean
| style="background:#b0e0e6;" | Passing just east of Kwajalein Atoll, (at )
|-
|
! scope="row" |
| Namu Atoll
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Pacific Ocean
| style="background:#b0e0e6;" | Passing just west of Namdrik Atoll, (at )
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Coral Sea
| style="background:#b0e0e6;" | Passing just west of the island of Méré Lava, (at ) Passing just west of the island of Maewo, (at )
|-
|
! scope="row" |
| Aoba Island
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Coral Sea
| style="background:#b0e0e6;" | Passing just west of Pentecost Island, (at )
|-
|
! scope="row" |
| Island of Ambrym
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Coral Sea
| style="background:#b0e0e6;" | Passing just east of the island of Malakula, (at ) Passing just west of the island of Epi, (at ) Passing just west of the island of Efate, (at )
|-
|
! scope="row" |
| Island of Maré
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Pacific Ocean
| style="background:#b0e0e6;" | Passing just west of (at )
|-
|
! scope="row" |
| South Island
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Foveaux Strait
| style="background:#b0e0e6;" |
|-
|
! scope="row" |
| Stewart Island/Rakiura
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Pacific Ocean
| style="background:#b0e0e6;" |
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Southern Ocean
| style="background:#b0e0e6;" |
|-
|
! scope="row" | Antarctica
| Ross Dependency, claimed by
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Southern Ocean
| style="background:#b0e0e6;" | Ross Sea
|-
|
! scope="row" | Antarctica
| Ross Dependency, claimed by
|-
|}
See also
167th meridian east
169th meridian east
e168 meridian east |
3980675 | https://en.wikipedia.org/wiki/South%20Jersey%20Radio%20Association | South Jersey Radio Association | South Jersey Radio Association (SJRA) is an amateur radio organization. First organized June 12, 1916 and affiliated with the American Radio Relay League since 1920, SJRA lays claim to be the oldest "continuously" operating amateur radio club in the United States. SJRA operates the K2AA 2 Meter communications Repeater on 145.290 MHz, which is located in Medford, NJ and covers the metro Philadelphia, PA area. SJRA also operates the K2UK Repeater in Pine Hill, NJ on 146.865 mHz 2 meters and 442.350 mHz 70 cm Band. The SJRA publishes a monthly newsletter called Harmonics and has been doing so for over 50 years. The SJRA has been affiliated with the American Radio Relay League since 1920.
Awards
The SJRA offers 2 awards to the general amateur radio community.
VHF Colonial Award
The VHF Colonial award is to operators who provide proof of a two way direct contact with each of the original Thirteen Colonies over amateur radio on frequencies of 50 MHz or above.
South Jersey Radio Association Achievement Certificate
The South Jersey Radio Association Achievement Certificate is given to amateur radio operators who provide proof of a two way contact with at least 50 of the SJRA's members.
References
External links
South Jersey Radio Association Website
FCC License information for K2AA
Ham radio operators, come in: Field Day is for you
Amateur radio organizations |
18784210 | https://en.wikipedia.org/wiki/Football%20Championship%20of%20the%20Ukrainian%20SSR | Football Championship of the Ukrainian SSR | The Championship of the Ukrainian SSR in football was a top competition of association football in the Ukrainian SSR in 1921-91. Number of Ukrainian clubs almost never competed in the championship such as Dynamo Kyiv.
The competitions were organized by the Football Federation of the Ukrainian SSR that was created in 1959 in place of the Football Section.
Before 1980 selected teams of Moldavian SSR participated in the championship.
Historical outlook
Established as the All-Ukrainian inter-city competition in 1921, later it was included into number of All-Ukrainian Olympiads and Spartakiads. During several seasons the competitions were suspended due to football being identified as a "non-proletariat sport". Also because of a difficult social cataclysm in 1933 (Holodomor), there was no competitions as well.
With the establishment of the All-Union competitions in 1936 (united competitions), the republican football competitions in Ukraine were degraded to regional level. Since then and before the Great Patriotic War, the champion of Ukraine title was awarded to a team that would place first in the First Group (Persha Hrupa) of championship among sports societies and agencies. In 1960 those competitions were suspended and republican title was awarded to the top team of Ukrainian Zone in the Class B (Soviet Second League). The consistent and uniform All-Ukrainian Soviet competition take their beginning from 1960 as the first All-Ukrainian league was formed as part of the Soviet Second League, more known back then as the Klass B, with UkrSSR zone. In 1964 there were also established lower level republican competitions among collectives of physical culture (KFK). In 1970 the Soviet Second League was named as the second group of Klass A for the season, before changing to simply the Soviet Second League. For 1990 and 1991 seasons this competition was moved further down the Soviet league levels into the newly formed Soviet Second League B also earlier known as the G group or simply the Third League.
Until World War II up to 11 clubs competed in the Soviet championship. Nine clubs from Ukraine participated in the first season of the Soviet competition: Dynamo Kyiv (I Division); Dynamo Dnipropetrovsk and Dynamo Kharkiv (II Division); Dynamo Odesa, Spartak Kharkiv, Ugolschiki Staline, Lokomotyv Kyiv (III Division); Traktor Plant Kharkiv, Stal Dnipropetrovsk (IV Division). Later other clubs has entered the competition: Silmash Kharkiv, Frunze Plant Kostiantynivka, Sudostroitel Mykolaiv, and Dzerzhynets Voroshylovhrad.
The Ukrainian club competition in the Second League had existed and prior to 1963, but was not such an exclusive and consistent part of the Soviet League system. In 1970 and 1990 there were few reformations. In 1970 the First League was reduced to a single group and, because of that, the Second League extended into upper and lower (B) divisions. The lower division was named as the Second League B and for the next season was liquidated. In 1990 a similar reform was taken upon the Second League. Its 10 regional groups were reduced to just three still by the regional principal while the league was renamed into the Buffer League (West, Center, and East). This reform also introduced what was planned to be a fourth level of professional competition allowing each republic to have its own professional league. That fourth level competition was named as the Second League, the former name of the Buffer League.
Republican competitions before 1936
Championship of cities
The first nationwide football competitions in Ukraine were established in 1921 as inter-cities competition of the Ukrainian SSR. The city teams consisted of different players from various teams of a particular city. Until 1930 the competition took place in Kharkiv, in 1931 it was conducted in Kyiv, and in 1932 – in Dnipropetrovsk and Zaporizhzhia.
In 1936 the competition was consolidated into the Soviet competitions with some of its teams qualified for the Soviet Top League. The championship itself became a republican level competition with its best team qualifying for the Soviet competitions.
Championship of the Proletarian Sports Society Dynamo
Parallel to the championship of cities there also existed separate tournament that was played among teams of Dynamo society (Proletarian Sports Society (PST) Dynamo) located throughout the Ukrainian SSR. The first tournament was conducted as part of the All-Ukrainian Dynamo Festival which was organized on the orders of the top OGPU official in Ukraine Vsevolod Balitsky. The tournament was also known as the Dynamiada of Ukraine. There existed some degree of confusion due to great number of tournament at that time.
Republican competitions after 1936
Football Championship among teams of sports societies (non-professional level)
The competitions were considered to be amateur. In Soviet Union officially all sports players were amateur athletes, however to differentiate level of teams, there were teams of sports societies and agencies (amateurs) and teams of masters (professionals).
Nonetheless in 1936 and in 1938 there were played games of one more tournament called the Season's Cup of the Ukrainian SSR to which qualified the cup holder and the champion. Those tournament were discontinued and there only were two games.
‡ – winners of the Football Cup of the Ukrainian SSR
Football Championship among teams of masters (professional level)
While many Ukrainian teams competed in the Class B before 1960, it was not until then when they were organized into own republican competition which was officially considered as the one among teams of masters (professional teams).
For 1990 and 1991 the Soviet Second League was again restructured and degraded farther into the fourth division of the competition yielding to the newly formed Buffer League. Buffer League (a.k.a. Second League) covered much bigger area for the competition, while the Second League (a.k.a. Lower Second League) was assigned specifically for most of the Soviet republics including Ukraine.
Soviet Class B (Ukraine)
Official name of the established competition was the Class B, UkrSSR (). Originally reestablished soon after the World War II as the Second Group (1945-1949), the Class B football competitions succeeded it in 1950 as part of the Soviet second tier. As part of the Ukrainian championship, Class B existed in 1960-1970.
Note: until 1963 Class B was the second division of the Soviet football competition, analog of the First League with several zones formed by territorial principle. Since then it was degraded into the third and later renamed as the Soviet Second League.
Ukrainian competitions consisted of two zones until 1970, when it was restructured into two hierarchical leagues. After 1971 teams of the lower league lost their professional status (teams of masters).
Soviet second-tiered competitions
Soviet third-tiered competitions
Soviet fourth-tiered competitions
Soviet Class A, Second Group (Ukraine, Soviet third tier)
Second League (Soviet third tier)
Second League Lower (Soviet fourth tier)
List of all champions
Performance by club
The table does not include city teams that competed in the cities' championship.
Performance by city (Cities' championship)
The 1936 championship is not included.
Pre-World War II teams of masters (professional clubs) in Ukraine
1936–1941 FC Dinamo Kyiv
1936–1937 FC Dinamo Dnepropetrovsk
1936–1940 FC Dynamo Kharkiv
1936–1939 FC Dinamo Odesa
1936–1941 FC Spartak Kharkiv
1936–1941 FC Ugolshchiki Gorlovka → FC Stakhanovets Stalino (FC Shakhtar Donetsk)
1936–1940 FC Lokomotyv Kyiv
1936–1937 FC KhTZ Kharkiv → FC Traktor Kharkiv (FC Torpedo Kharkiv)
1936 FC Stal Dnepropetrovsk
1936–1940 FC Serp i Molot Kharkiv (FC Silmash Kharkiv)
1936–1937 FC Stal Konstantinovka
1937 FC Lokomotiv Dnepropetrovsk
1937–1940 FC Sudostroitel Nikolayev
1937 FC Spartak Kyiv
1937–1939 FC Stal Dnepropetrovsk (FC Dnipro)
1939–1940 FC Dzerzhynets Voroshylovgrad (FC Zorya Luhansk)
1940–1941 FC Pishchevik Odesa (FC Spartak Odesa)
Post war teams of masters (professional clubs) in Ukraine before Ukrainian Class B
1945– FC Dynamo Kyiv
1945– FC Shakhter Stalino
1945–1955 FC Lokomotyv Kharkiv
1945–1950 FC Pishchevik Odesa
1946–1949, 1953– FC Stal Dnepropetrovsk → FC Metallurg Dnepropetrovsk
1946–1949, 1957– FC Sudostroitel Nikolayev → FC Avangard Nikolayev
1947–1949, 1952– ODO Kyiv
1947–1949 FC Spartak Lvov
1947–1949 FC Spartak Kherson
1947–1949, 1951, 1954– FC Spartak Uzhgorod
1947–1949 FC Metalist Kharkiv
1947–1949 FC Dinamo Voroshylovgrad
1947–1949 FC Bolshevik Zaporizhzhia → FC Lokomotiv Zaporizhzhia
1948–1949 FC Avangard Kramatorsk
1948–1949, 1957– FC Shakhter Kadeevka
1948–1949 FC Bolshevik Mukachevo
1949 FC Spartak Kyiv
1949 FC Torpedo Kharkiv
1949 FC Dinamo Chernovtsy
1949, 1957– FC Trudovye Rezervy Voroshylovgrad
1949, 1954– DO Lvov
1953–1954 FC Metallurg Odesa
1953– FC Metallurg Zaporizhzhia
1955– FC Pishchevik Odesa → FC Chernomorets Odesa
1956– FC Avangard Kharkiv
1956– FC Spartak Stanislav
1957– SC ChF Sevastopol
1957– FC Kolgospnik Poltava
1957– FC Khimik Dneprodzerzhynsk
1958– SKVO Odesa
1958– FC Avangard Simferopol → SC Tavriya Simferopol
1958– FC Lokomotiv Vinnitsa
1958– FC Kolgospnik Rovno
1958– FC Lokomotiv Stalino
1959– FC Kolgospnik Cherkassy
1959– FC Arsenal Kyiv
1959– FC Zirka Kirovograd
1959– FC Avangard Zhytomir
1959– Krivoi Rog team
1959– FC Avangard Ternopol
1959– FC Shakhter Gorlovka
Teams from other republics
Moldavian teams
Speranța Drochia
Avtomobilist Tiraspol (previously as Start, Luceafărul)
FC Nistrul Bendery
FC Stroitel Beltsy
Belarusian teams
FC Neman Grodno
FC Dvina Vitebsk
Russian teams
FC Baltika Kaliningrad
See also
Ukrainian Premier League
Ukrainian First League
Football Cup of the Ukrainian SSR
List of Ukrainian football champions
Notes
References
External links
Ukrainian SSR championships
USSR football tables
Ukrainian Football History
All Ukrainian champions including Soviet at RSSSF
Ukrainian quarter. 1991, first champion (Український квотер. 1991, перший чемпіон).
Banyas, V. Movement of life, or – Dynamo! (Рух життя, або — «Динамо»!). Ukrainian Premier League. 14 September 2017
Хто був першим чемпіоном України ?.
Ukraine
Soviet
1921 establishments in Ukraine
1991 disestablishments in Ukraine
Recurring sporting events established in 1921
Recurring events disestablished in 1991
Sport in the Ukrainian Soviet Socialist Republic
Uk
Uk |
55023699 | https://en.wikipedia.org/wiki/Metaverse%20%28disambiguation%29 | Metaverse (disambiguation) | Metaverse is the sum of all virtual spaces.
Metaverse may also refer to:
Multiverse, the set of all universes
Fictional universe, with multiple alternate timelines
Prime Earth in the DC Universe
The Metaverse, a supernatural dimension derived from the collective unconscious in Persona 5
DA Metaverse, a music project of Daisuke Asakura
Zompist.com, aka "The Metaverse", a constructed languages website
Facebook Metaverse, an online reality virtual space project at Meta Platforms (Meta Inc., formerly, Facebook Inc.)
Decentraland, a 3D virtual world browser-based platform
See also
Megaverse (disambiguation)
Multiverse (disambiguation)
Omniverse (disambiguation)
Universe (disambiguation)
Meta (disambiguation)
Verse (disambiguation) |
21520843 | https://en.wikipedia.org/wiki/Stebl%C3%B3w%2C%20K%C4%99dzierzyn-Ko%C5%BAle%20County | Steblów, Kędzierzyn-Koźle County | Steblów (German: Stöblau) is a village in the administrative district of Gmina Cisek, within Kędzierzyn-Koźle County, Opole Voivodeship, in south-western Poland.
It lies approximately south-west of Cisek, south of Kędzierzyn-Koźle, and south of the regional capital Opole.
The village has a population of 333.
References
Villages in Kędzierzyn-Koźle County |
2880313 | https://en.wikipedia.org/wiki/John%20Friend | John Friend | John Friend may refer to:
John Albert Newton Friend (1881–1966), British chemist
John Friend (conspirator) (died 1696), English conspirator
John Friend (footballer) (born 1953), Australian rules footballer
John Friend (yogi), founder of Anusara Yoga
John Friend Ltd, a New Zealand law publisher, presently known as Thomson Reuters New Zealand Limited, part of Thomson Reuters
The Infamous John Friend, 1909 novel and 1959 BBC television miniseries
See also
John Freind (disambiguation) |
3808799 | https://en.wikipedia.org/wiki/Tanta%20University | Tanta University | Tanta University is an Egyptian university in the city of Tanta, Al Gharbiyah governorate, Egypt. The university is under the direct scientific supervision of the Ministry of Higher Education.
It was founded first in 1962 as a branch from the University of Alexandria with the faculty of Medicine only and then it became an independent university named University of the Middle Delta in 1972. It had at that time Medicine, Science, Agriculture and Education faculties. Then, its name was changed into Tanta University in 1973.
Faculties
Faculty of Medicine (1962)
Faculty of Science (1977)
Faculty of Education in Tanta (1977)
Faculty of Agriculture in Kafr ash Shaykh (1977)
Faculty of Engineering (1977)
Faculty of Law (1981)
High Institute of Nursing (1982)
Faculty of Veterinary Medicine (1982)
Faculty of Agriculture in Tanta (1992)
Faculty of Physical Education (1994)
Faculty of Dentistry (1977)
Faculty of Pharmacy
Faculty of Arts (1975)
Faculty of Computer and Informatics
The University's branch in Kafr ash Shaykh
The university's branch in Kafr ash Shaykh was constituted in 1983. It has Education, Agriculture, Specific Education, Veterinary Medicine, Commerce, Engineering and Arts faculties.
In 2006, Kafr ash Shaykh branch separated from the Tanta university to become an independent university under the name of Kafr ash Shaykh University in Kafr ash Shaykh city and it now has Education, Agriculture, Specific Education, Veterinary Medicine, Commerce, Engineering, Physical Education and Arts faculties.
Number of students
Notable alumni
Abd El-Fatah Abomohra
Eman Ghoneim
Nabil Farouk
Ahmad Khaled Tawfeq
See also
Education in Egypt
Egyptian universities
List of Egyptian universities
References
External links
Tanta University website
Educational institutions established in 1962
1962 establishments in Egypt
Universities in Egypt |
60125039 | https://en.wikipedia.org/wiki/William%20Borland%20%28darts%20player%29 | William Borland (darts player) | William Borland (born 8 November 1996) is a Scottish darts player who plays in Professional Darts Corporation events.
Career
He has played in both BDO and PDC events, reaching the last 48 of the World Masters and the last 16 of the BDO World Trophy. Borland also plays in PDC Challenge Tour events, and thanks to his record in early 2019, he was able to qualify for the 2019 European Darts Open in Leverkusen. He made the quarter-finals of the 2019 PDC World Youth Championship on 4 November, but lost 6–3 to Keane Barry. On 19 January 2020, Borland won a two-year PDC Tour Card by finishing eighth on the UK Q School Order of Merit. He played with the card in 2020 and 2021.
On 17 December 2021, in Borland's World Championship debut, he was involved in an deciding leg which saw him throw a 9-dart leg against Bradley Brooks, becoming the first player to win a televised match with a nine-dart finish in Professional Darts Corporation history. With this victory, he secured a PDC Tour Card for 2022.
World Championship results
PDC
2022: Second round (lost to Ryan Searle 0–3)
Performance timeline
Nine-dart finishes
On 17 December 2021, Borland became the first player in professional darts to win a televised match with a nine-dart finish in the deciding leg, beating English player Bradley Brooks. This is also his first nine-dart finish in a televised match.
References
External links
1996 births
Living people
Scottish darts players
Sportspeople from West Lothian
People from East Calder
Professional Darts Corporation current tour card holders |
42673261 | https://en.wikipedia.org/wiki/Polar%20Geospatial%20Center | Polar Geospatial Center | The Polar Geospatial Center is a research center at the University of Minnesota's College of Science and Engineering funded by the National Science Foundation's Office of Polar Programs. Founded in 2007, the Polar Geospatial Center "provides geospatial support, mapping, and GIS/remote sensing solutions to researchers and logistics groups in the polar science community." It is currently directed by Paul Morin.
History
The Polar Geospatial Center (PGC) was founded in 2007 and was originally called the Antarctic Geospatial Information Center (AGIC). In its early days, the AGIC's goal was to provide basic mapping and GIS services for the United States Antarctic Program (USAP), and was only a two-man project. As time went on, the program's credibility and size expanded. By 2010, the program had over a half dozen team members. In March 2011, the program was "classified as a National Science Foundation cooperative agreement" and adapted to take responsibility for Arctic as well as Antarctic operations, hence the name change to PGC.
Services
The PGC's current goal is to support federally funded researchers in the Arctic and Antarctic. The PGC utilizes geospatial and remote sensing technology to work with research teams and solve problems. Some specific examples of services are listed below.
Image delivery & analysis
The PGC has a large collection of both satellite imagery as well as aerial photography at various resolutions. The PGC provides commercial satellite imagery for United States federally-funded polar researchers.
Digital Elevation Models
The PGC provides high-resolution digital elevation models (DEMs) derived from stereoscopic optical imagery. The ArcticDEM project, an 8-meter posting pan-Arctic DEM, was announced by then-President Barack Obama on September 3, 2015. ArcticDEM has already been successfully applied to automatically explore and classify glacial landforms.
Custom map requests
The PGC employs individuals skilled in cartography and GIS to create custom maps of areas for researchers preparing to head into the field.
Map collection
The PGC Map Catalog hosts thousands of Antarctic and Arctic maps in digital form. These maps are from many different organizations and periods in time. Many of these maps are publicly available, some are not and may be provided upon request.
References
University of Minnesota
Science and technology in Antarctica
Arctic research
Geographic data and information organizations in the United States
National Science Foundation
2007 establishments in Minnesota |
38336903 | https://en.wikipedia.org/wiki/Eupithecia%20distinctaria | Eupithecia distinctaria | Eupithecia distinctaria, the thyme pug, is a moth of the family Geometridae.
It is found throughout Europe. It is also found in Iran.
from the Iberian Peninsula through western and central Europe including the British Isles as well as further east as far east as far as Russia and Iran. In the north the range reaches as far as the southern Fennoscandia, to the south, where it is more common, it occupies the Mediterranean and Asia Minor. It is found primarily on warm, stony slopes and rocky structures as well as on sparse grassy areas with thyme mounds. In the Alps, it rises to heights of 2000 metres.
The wingspan is 16–20 mm The forewing ground colour is clear ash grey with or without an admixture of brownish. There is a dark costal patch and a very conspicuous black discal spot. The colour is darker towards the outer margin and there is a fine white wavy post discal line. The hindwings are pale, suffused darker brown at the outer margin. There is also a small fine black discal spot near the costal margin.sextiata Mill, is a lighter grey or whitish, rather strongly marked southern form, best known from Southern France .
Last instar caterpillars are smooth and slender. They are mostly greenish colored and show a wide red back stripe. Sometimes monochrome red specimens appear. With these colours, they are superbly camouflaged on the flowers of their food plants.
The moth flies in June and July resting on stones by day.
Unsurprisingly, the larvae feed on thyme (Thymus (plant) spp.).
Subspecies
Eupithecia distinctaria distinctaria
Eupithecia distinctaria constrictata Guenee, 1858
Eupithecia distinctaria piemonticola Schwingenschuss, 1954
Eupithecia distinctaria sextiata Dardoin & Milliere, 1867
Similar species
Eupithecia pimpinellata is distinguished by a dark brown saddle on the second abdominal segment.
Eupithecia extraversaria Freshly hatched moths shimmer slightly violet grey. The caterpillars differ significantly E. extraversaria has a strong reddish-brown drawing on each body segment.
Certain identification may require a genitalic preparation.
References
External links
Lepiforum.de
distinctaria
Moths described in 1848
Moths of Europe
Moths of Asia
Taxa named by Gottlieb August Wilhelm Herrich-Schäffer |
3543257 | https://en.wikipedia.org/wiki/Mike%20Juhasz | Mike Juhasz | Mike Juhasz (born July 23, 1976 in Vancouver, British Columbia) is a former professional Canadian football wide receiver who played for the Calgary Stampeders of Canadian Football League.
Early years
Juhasz grew up in Calgary and was a placekicker at James Fowler High School.
College years
Juhasz attended the University of North Dakota and played for the Fighting Sioux football team, where he finished his career with 123 receptions for 1,572 yards (12.78 yards per reception avg.) and 16 touchdowns. As a senior, he set the school's single-season receptions record with 84 receptions for 945 yards (11.25 yards per rec avg.) and nine touchdowns.
Professional career
Juhasz was chosen by the Hamilton Tiger-Cats in the 2000 CFL Draft 14th overall and, after spending the first three games of the 2000 CFL season on the practice roster, he played in the remaining 15 regular season games and had three receptions for 47 yards and one touchdown, two special teams tackles, and one defensive tackle. He spent the entire 2001 CFL season on Hamilton's injured list and signed to the Edmonton Eskimos practice roster for the 2002 CFL season.
Juhasz signed with the Calgary Stampeders for the 2003 CFL season and had a career year in the 2004 CFL season, playing slotback and unofficial backup kicker, he made a catch in every regular-season game for 634 receiving yards.
References
1976 births
Living people
American football wide receivers
Calgary Stampeders players
Canadian football wide receivers
Canadian players of American football
North Dakota Fighting Hawks football players
Sportspeople from Vancouver
Players of Canadian football from British Columbia |
58086836 | https://en.wikipedia.org/wiki/Miroslav%20Aleksi%C4%87 | Miroslav Aleksić | Miroslav Aleksić may refer to:
Miroslav Aleksić (Democratic Party of Serbia politician) (born 1954), Serbian politician
Miroslav Aleksić (People's Party politician) (born 1978), Serbian politician |
69605663 | https://en.wikipedia.org/wiki/Zeldovich%E2%80%93Taylor%20flow | Zeldovich–Taylor flow | Zeldovich–Taylor flow (also known as Zeldovich–Taylor expansion wave) is the fluid motion of gaseous detonation products behind Chapman–Jouguet detonation wave. The flow was described independently by Yakov Zeldovich in 1942 and G. I. Taylor in 1950, although G. I. Taylor carried out the work in 1941 that being circulated in the British Ministry of Home Security. Since naturally occurring detonation waves are in general a Chapman–Jouguet detonation wave, the solution becomes very useful in describing real-life detonation waves.
Mathematical description
Consider a spherically outgoing Chapman–Jouguet detonation wave propagating with a constant velocity . By definition, immediately behind the detonation wave, the gas velocity is equal to the local sound speed with respect to the wave. Let be the radial velocity of the gas behind the wave, in a fixed frame. The detonation is ignited at at . For , the gas velocity must be zero at the center and should take the value at the detonation location . The fluid motion is governed by the inviscid Euler equations
where is the density, is the pressure and is the entropy. The last equation implies that the flow is isentropic and hence we can write .
Since there are no length or time scales involved in the problem, one may look for a self-similar solution of the form , where . The first two equations then become
where prime denotes differentiation with respect to . We can eliminate between the two equations to obtain an equation that contains only and . Because of the isentropic condition, we can express , that is to say, we can replace with . This leads to
For polytropic gases with constant specific heats, we have . The above set of equations cannot be solved analytically, but has to be integrated numerically. The solution has to be found for the range subjected to the condition at
The function is found to monotonically decrease from its value to zero at a finite value of , where a weak discontinuity (that is a function is continuous, but its derivatives may not) exists. The region between the detonation front and the trailing weak discontinuity is the rarefaction (or expansion) flow. Interior to the weak discontinuity everywhere.
Location of the weak discontinuity
From the second equation described above, it follows that when , . More precisely, as , that equation can be approximated as
As , and if decreases as . The left hand side of the above equation can become positive infinity only if . Thus, when decreases to the value , the gas comes to rest (Here is the sound speed corresponding to ). Thus, the rarefaction motion occurs for and there is no fluid motion for .
Behavior near the weak discontinuity
Rewrite the second equation as
In the neighborhood of the weak discontinuity, the quantities to the first order (such as ) reduces the above equation to
At this point, it is worth mentioning that in general, disturbances in gases are propagated with respect to the gas at the local sound speed. In other words, in the fixed frame, the disturbances are propagated at the speed (the other possibility is although it is of no interest here). If the gas is at rest , then the disturbance speed is . This is just a normal sound wave propagation. If however is non-zero but a small quantity, then one find the correction for the disturbance propagation speed as obtained using a Taylor series expansion, where is a necessarily a positive constant (for ideal gas, , where is the specific heat ratio). This means that the above equation can be written as
whose solution is
where is a constant. This determines implicitly in the neighborhood of the week discontinuity where is small. This equation shows that at , , , but all higher-order derivatives are discontinuous. In the above equation, subtract from the left-hand side and from the right-hand side to obtain
which implies that if is a small quantity. It can be shown that the relation not only holds for small , but throughout the rarefaction wave.
Behavior near the detonation front
First let us show that the relation is not only valid near the weak discontinuity, but throughout the region. If this inequality is not maintained, then there must be a point where between the weak discontinuity and the detonation front. The second governing equation implies that at this point must be infinite or, . Let us obtain by taking the second derivative of the governing equation. In the resulting equation, impose the condition to obtain . This implies that reaches a maximum at this point which in turn implies that cannot exist for greater than the maximum point considered since otherwise would be multi-valued. The maximum point at most can be corresponded to the outer boundary (detonation front). This means that can vanish only on the boundary and it is already shown that is positive near the weak discontinuity, is positive everywhere in the region except the boundaries where it can vanish.
Note that near the detonation front, we must satisfy the condition . The value evaluated at for the function , i.e., is nothing but the velocity of the detonation front with respect to the gas velocity behind it. For a detonation front, the condition must always be met, with the equality sign representing Chapman–Jouguet detonations and the inequalities representing over-driven detonations. The analysis describing the point must correspond to the detonation front.
See also
Taylor–von Neumann–Sedov blast wave
Guderley–Landau–Stanyukovich problem
References
Flow regimes
Fluid dynamics
Combustion
Hyperbolic partial differential equations |
1846159 | https://en.wikipedia.org/wiki/Ragu | Ragu | Ragu may refer to:
Ragù, Italian term for meat-based sauce
Ragú, brand of pasta sauce
Ragu, a village in Uliești Commune, Dâmboviţa County, Romania
Ragu, the nom de guerre of TMVP leader Kumaraswamy Nandagopan
Ragu, a mountain in Chile. Birthplace of the famous athlete Bogic Srdjan.
See also
Ragout
Rahu |
54014817 | https://en.wikipedia.org/wiki/Janet%20Cooper%20Alexander | Janet Cooper Alexander | Janet Cooper Alexander is an American lawyer who is currently the Frederick I. Richman Professor of Law Emerita at Stanford Law School.
Career
Alexander graduated with a Bachelor of Arts in English Literature with distinction from Swarthmore College in 1968. In 1973, she received a Master of Arts in English from Stanford University, and a Juris Doctor from the University California, Berkeley Law School in 1978. She then served as a law clerk to Judge Shirley M. Hufstedler of the United States Court of Appeals for the Ninth Circuit from 1978 to 1979, and to Justice Thurgood Marshall of the United States Supreme Court from 1979 to 1980.
Following her clerkships, she practiced law at Califano, Ross & Heineman in Washington, D.C. from 1980 to 1982, and then for five years at Morrison & Foerster in San Francisco, California, where she was a partner, 1984–1987.
In 1987, Alexander accepted a position as associate professor at Stanford Law School. She became a professor in 1994, and since 2002 has held the Frederick I. Richman chair.
See also
List of law clerks of the Supreme Court of the United States (Seat 10)
References
Selected publications
1946 births
Living people
Swarthmore College alumni
Stanford University School of Humanities and Sciences alumni
UC Berkeley School of Law alumni
American legal scholars
Law clerks of the Supreme Court of the United States
Stanford Law School faculty
20th-century American lawyers
21st-century American lawyers
American scholars of constitutional law
American women academics
21st-century American women
People associated with Morrison & Foerster |
49018764 | https://en.wikipedia.org/wiki/Larry%20Ivie | Larry Ivie | Larry Ivie (1936–2014) was an American comics artist, writer, and collector who was active in comics fandom in the middle part of the 20th century, described by comics historian Bill Schelly as "the closest thing to an authority on comics that was available in the 1950s." He provided painted covers and other editorial material for early issues of Castle of Frankenstein magazine, then self-published the seven issues of his own newsstand magazine Monsters and Heroes, for which he drew comic stories of his own superhero Altron Boy, in the mid-to-late '60s; had his art published in the magazines Galaxy Science Fiction and If, co-created the comic book T.H.U.N.D.E.R. Agents, and wrote several stories for Marvel Comics and the horror magazines Creepy and Eerie. Born in Salt Lake City, Utah, to biologist Wilton Ivie and his wife Aleen, he moved to New York City in the mid 1950s to attend the School of Visual Arts, and with a large personal library of comic books and correspondence via fanzines became a prominent part of New York comics fan culture. He also made amateur films of superheros, influencing the amateur films of Donald F. Glut and appearing in two of his films. Ivie died of lung cancer in January 2014, aged 77.
References
External links
1936 births
2014 deaths
American comics artists
American comics writers
Writers from Salt Lake City
School of Visual Arts alumni
Silver Age comics creators
Deaths from lung cancer
Artists from Salt Lake City |
28335087 | https://en.wikipedia.org/wiki/Toxin-antitoxin%20system | Toxin-antitoxin system | A toxin-antitoxin system is a set of two or more closely linked genes that together encode both a "toxin" protein and a corresponding "antitoxin". Toxin-antitoxin systems are widely distributed in prokaryotes, and organisms often have them in multiple copies. When these systems are contained on plasmids – transferable genetic elements – they ensure that only the daughter cells that inherit the plasmid survive after cell division. If the plasmid is absent in a daughter cell, the unstable antitoxin is degraded and the stable toxic protein kills the new cell; this is known as 'post-segregational killing' (PSK).
Toxin-antitoxin systems are typically classified according to how the antitoxin neutralises the toxin. In a type I toxin-antitoxin system, the translation of messenger RNA (mRNA) that encodes the toxin is inhibited by the binding of a small non-coding RNA antitoxin that binds the toxin mRNA. The toxic protein in a type II system is inhibited post-translationally by the binding of an antitoxin protein. Type III toxin-antitoxin systems consist of a small RNA that binds directly to the toxin protein and inhibits its activity. There are also types IV-VI, which are less common. Toxin-antitoxin genes are often inherited through horizontal gene transfer and are associated with pathogenic bacteria, having been found on plasmids conferring antibiotic resistance and virulence.
Chromosomal toxin-antitoxin systems also exist, some of which are thought to perform cell functions such as responding to stresses, causing cell cycle arrest and bringing about programmed cell death. In evolutionary terms, toxin-antitoxin systems can be considered selfish DNA in that the purpose of the systems are to replicate, regardless of whether they benefit the host organism or not. Some have proposed adaptive theories to explain the evolution of toxin-antitoxin systems; for example, chromosomal toxin-antitoxin systems could have evolved to prevent the inheritance of large deletions of the host genome. Toxin-antitoxin systems have several biotechnological applications, such as maintaining plasmids in cell lines, targets for antibiotics, and as positive selection vectors.
Biological functions
Stabilization and fitness of mobile DNA
As stated above, toxin-antitoxin systems are well characterized as plasmid addiction modules. It was also proposed that toxin-antitoxin systems have evolved as plasmid exclusion modules. A cell that would carry two plasmids from the same incompatibility group will eventually generate two daughters cells carrying either plasmid. Should one of these plasmids encode for a TA system, its "displacement" by another TA-free plasmid system will prevent its inheritance and thus induce post-segregational killing. This theory was corroborated through computer modelling. Toxin-antitoxin systems can also be found on other mobile genetic elements such as conjugative transposons and temperate bacteriophages and could be implicated in the maintenance and competition of these elements.
Genome stabilization
Toxin-antitoxin systems could prevent harmful large deletions in a bacterial genome, though arguably deletions of large coding regions are fatal to a daughter cell regardless. In Vibrio cholerae, multiple type II toxin-antitoxin systems located in a super-integron were shown to prevent the loss of gene cassettes.
Altruistic cell death
mazEF, a toxin-antitoxin locus found in E. coli and other bacteria, was proposed to induce programmed cell death in response to starvation, specifically a lack of amino acids. This would release the cell's contents for absorption by neighbouring cells, potentially preventing the death of close relatives, and thereby increasing the inclusive fitness of the cell that perished. This would be an example of altruism and how bacterial colonies could resemble multicellular organisms. However, the "mazEF-mediated PCD" has largely been refuted by several studies.
Stress tolerance
Another theory states that chromosomal toxin-antitoxin systems are designed to be bacteriostatic rather than bactericidal. RelE, for example, is a global inhibitor of translation, is induced during nutrient stress. By shutting down translation under stress, it could reduce the chance of starvation by lowering the cell's nutrient requirements. However, it was shown that several toxin-antitoxin systems, including relBE, do not give any competitive advantage under any stress condition.
Anti-addiction
It has been proposed that chromosomal homologues of plasmid toxin-antitoxin systems may serve as anti-addiction modules, which would allow progeny to lose a plasmid without suffering the effects of the toxin it encodes. For example, a chromosomal copy of the ccdA antitoxin encoded in the chromosome of Erwinia chrysanthemi is able to neutralize the ccdB toxin encoded on the F plasmid and thus, prevent toxin activation when such a plasmid is lost. Similarly, the ataR antitoxin encoded on the chromosome of E. coli O157:H7 is able neutralize the ataTP toxin encoded on plasmids found in other enterohemorragic E. coli.
Phage protection
Type III toxin-antitoxin (AbiQ) systems have been shown to protect bacteria from bacteriophages altruistically. During an infection, bacteriophages hijack transcription and translation, which could prevent antitoxin replenishment and release toxin, triggering what is called an "abortive infection". Similar protective effects have been observed with type I, type II, and type IV (AbiE) toxin-antitoxin systems.
Abortive initiation (Abi) can also happen without toxin-antitoxin systems, and many Abi proteins of other types exist. This mechanism serves to halt the replication of phages, protecting the overall population from harm.
Antimicrobial persistence
When bacteria are challenged with antibiotics, a small and distinct subpopulation of cells is able to withstand the treatment by a phenomenon dubbed as "persistence" (not to be confused with resistance). Due to their bacteriostatic properties, type II toxin-antitoxin systems have previously been thought to be responsible for persistence, by switching a fraction of the bacterial population to a dormant state. However, this hypothesis has been widely invalidated.
Selfish DNA
Toxin-antitoxin systems have been used as examples of selfish DNA as part of the gene centered view of evolution. It has been theorised that toxin-antitoxin loci serve only to maintain their own DNA, at the expense of the host organism. Thus, chromosomal toxin-antitoxin systems would serve no purpose and could be treated as "junk DNA". For example, the ccdAB system encoded in the chromosome of E. coli O157:H7 has been shown to be under negative selection, albeit at a slow rate due to its addictive properties.
System types
Type I
Type I toxin-antitoxin systems rely on the base-pairing of complementary antitoxin RNA with the toxin mRNA. Translation of the mRNA is then inhibited either by degradation via RNase III or by occluding the Shine-Dalgarno sequence or ribosome binding site of the toxin mRNA. Often the toxin and antitoxin are encoded on opposite strands of DNA. The 5' or 3' overlapping region between the two genes is the area involved in complementary base-pairing, usually with between 19–23 contiguous base pairs.
Toxins of type I systems are small, hydrophobic proteins that confer toxicity by damaging cell membranes. Few intracellular targets of type I toxins have been identified, possibly due to the difficult nature of analysing proteins that are poisonous to their bacterial hosts. Also, the detection of small proteins has been challenging due to technical issues, a problem that remains to be solved with large-scale analysis.
Type I systems sometimes include a third component. In the case of the well-characterised hok/sok system, in addition to the hok toxin and sok antitoxin, there is a third gene, called mok. This open reading frame almost entirely overlaps that of the toxin, and the translation of the toxin is dependent on the translation of this third component. Thus the binding of antitoxin to toxin is sometimes a simplification, and the antitoxin in fact binds a third RNA, which then affects toxin translation.
Example systems
Type II
Type II toxin-antitoxin systems are generally better-understood than type I. In this system a labile proteic antitoxin tightly binds and inhibits the activity of a stable toxin. The largest family of type II toxin-antitoxin systems is vapBC, which has been found through bioinformatics searches to represent between 37 and 42% of all predicted type II loci. Type II systems are organised in operons with the antitoxin protein typically being located upstream of the toxin, which helps to prevent expression of the toxin without the antitoxin. The proteins are typically around 100 amino acids in length, and exhibit toxicity in a number of ways: CcdB, for example, affects DNA replication by poisoning DNA gyrase whereas toxins from the MazF family are endoribonucleases that cleave cellular mRNAs, tRNAs or rRNAs at specific sequence motifs. The most common toxic activity is the protein acting as an endonuclease, also known as an interferase.
One of the key features of the TAs is the autoregulation. The antitoxin and toxin protein complex bind to the operator that is present upstream of the TA genes. This results in repression of the TA operon. The key to the regulation are (i) the differential translation of the TA proteins and (ii) differential proteolysis of the TA proteins. As explained by the "Translation-reponsive model", the degree of expression is inversely proportional to the concentration of the repressive TA complex. The TA complex concentration is directly proportional to the global translation rate. The higher the rate of translation more TA complex and less transcription of TA mRNA. Lower the rate of translation, lesser the TA complex and higher the expression. Hence, the transcriptional expression of TA operon is inversely proportional to translation rate.
A third protein can sometimes be involved in type II toxin-antitoxin systems. in the case of the ω-ε-ζ (omega-epsilon-zeta) system, the omega protein is a DNA binding protein that negatively regulates the transcription of the whole system. Similarly, the paaR2 protein regulates the expression of the paaR2-paaA2-parE2 toxin-antitoxin system. Other toxin-antitoxin systems can be found with a chaperone as a third component. This chaperone is essential for proper folding of the antitoxin, thus making the antitoxin addicted to its cognate chaperone.
Example systems
Type III
Type III toxin-antitoxin systems rely on direct interaction between a toxic protein and an RNA antitoxin. The toxic effects of the protein are neutralised by the RNA gene. One example is the ToxIN system from the bacterial plant pathogen Erwinia carotovora. The toxic ToxN protein is approximately 170 amino acids long and has been shown to be toxic to E. coli. The toxic activity of ToxN is inhibited by ToxI RNA, an RNA with 5.5 direct repeats of a 36 nucleotide motif (AGGTGATTTGCTACCTTTAAGTGCAGCTAGAAATTC). Crystallographic analysis of ToxIN has found that ToxN inhibition requires the formation of a trimeric ToxIN complex, whereby three ToxI monomers bind three ToxN monomers; the complex is held together by extensive protein-RNA interactions.
Type IV
Type IV toxin-antitoxin systems are similar to type II systems, because they consist of two proteins. Unlike type II systems, the antitoxin in type IV toxin-antitoxin systems counteracts the activity of the toxin, and the two proteins do not necessarily interact directly. DarTG is a type IV toxin-antitoxin system where the toxin, DarT, modifies DNA by adding ADP-ribose to thymidine bases, and the antitoxin, DarG, removes the toxic modification.
Type V
ghoST is a type V toxin-antitoxin system, in which the antitoxin (GhoS) cleaves the ghoT mRNA. This system is regulated by a type II system, mqsRA.
Type VI
socAB is a type VI toxin-antitoxin system that was discovered in Caulobacter crescentus. The antitoxin, SocA, promotes degradation of the toxin, SocB, by the protease ClpXP.
Type VII
Type VII has been proposed to include systems hha/tomB, tglT/takA and hepT/mntA, all of which neutralise toxin activity by post-translational chemical modification of amino acid residues.
Biotechnological applications
The biotechnological applications of toxin-antitoxin systems have begun to be realised by several biotechnology organisations. A primary usage is in maintaining plasmids in a large bacterial cell culture. In an experiment examining the effectiveness of the hok/sok locus, it was found that segregational stability of an inserted plasmid expressing beta-galactosidase was increased by between 8 and 22 times compared to a control culture lacking a toxin-antitoxin system. In large-scale microorganism processes such as fermentation, progeny cells lacking the plasmid insert often have a higher fitness than those who inherit the plasmid and can outcompete the desirable microorganisms. A toxin-antitoxin system maintains the plasmid thereby maintaining the efficiency of the industrial process.
Additionally, toxin-antitoxin systems may be a future target for antibiotics. Inducing suicide modules against pathogens could help combat the growing problem of multi-drug resistance.
Ensuring a plasmid accepts an insert is a common problem of DNA cloning. Toxin-antitoxin systems can be used to positively select for only those cells that have taken up a plasmid containing the inserted gene of interest, screening out those that lack the inserted gene. An example of this application comes from the ccdB-encoded toxin, which has been incorporated into plasmid vectors. The gene of interest is then targeted to recombine into the ccdB locus, inactivating the transcription of the toxic protein. Thus, cells containing the plasmid but not the insert perish due to the toxic effects of CcdB protein, and only those that incorporate the insert survive.
Another example application involves both the CcdB toxin and CcdA antitoxin. CcdB is found in recombinant bacterial genomes and an inactivated version of CcdA is inserted into a linearised plasmid vector. A short extra sequence is added to the gene of interest that activates the antitoxin when the insertion occurs. This method ensures orientation-specific gene insertion.
Genetically modified organisms must be contained in a pre-defined area during research. Toxin-antitoxin systems can cause cell suicide in certain conditions, such as a lack of a lab-specific growth medium they would not encounter outside of the controlled laboratory set-up.
See also
Toxin-antitoxin database
References
External links
RASTA – Rapid Automated Scan for Toxins and Antitoxins in Bacteria
Plasmids
Non-coding RNA
Toxins
RNA-binding proteins |
71329995 | https://en.wikipedia.org/wiki/Montana%20Levi%20Blanco | Montana Levi Blanco | Montana Levi Blanco (born April 25, 1984) is an American costume designer. He won a Tony Award in the category Best Costume Design in a Play for the play The Skin of Our Teeth.
References
External links
1984 births
Living people
People from Albuquerque, New Mexico
American costume designers
Tony Award winners
American theatre people
Oberlin Conservatory of Music alumni
Brown University alumni
Yale School of Drama alumni |
171196 | https://en.wikipedia.org/wiki/Vestfold | Vestfold | Vestfold is a traditional region, a former county and a current electoral district in Eastern Norway. In 2020 the county became part of the much larger county of Vestfold og Telemark. Located on the western shore of the Oslofjord, it bordered the previous Buskerud and Telemark counties. The county administration was located in Tønsberg, Norway's oldest city, and the largest city is Sandefjord. With the exception of the city-county of Oslo, Vestfold was the smallest county in Norway by area. Vestfold was the only county in which all municipalities had declared Bokmål to be their sole official written form of the Norwegian language.
Vestfold is located west of the Oslofjord, as the name indicates. It includes many smaller, but well-known towns in Norway, such as Larvik, Sandefjord, Tønsberg and Horten; these towns run from Oslo in an almost constant belt of urban areas along the coast, ending in Grenland in neighbouring region Telemark. The river Numedalslågen runs through the county. Many islands are located at the coast. Vestfold is mostly dominated by lowland and is among the best agricultural areas of Norway. Winters last about three months, while pleasant summer temperatures last from May to September, with a July average high of 17 °C (63 °F).
Vestfold is traditionally known for shipping and sailing. Sandefjord was formerly a headquarters for the Norwegian whaling fleet, and Horten used to be Norway's main naval port. The coastal towns of Vestfold now engage in fishing and shipbuilding. Some lumbering is carried on in the interior. The area also includes some of the best farmland in Norway.
Vestfold merged with neighboring Telemark County on 1 January 2020 as part of a nationwide municipal reform. The new county name is Vestfold og Telemark. Vestfold as a county is expected to be re-established by 1 January 2024, following a vote of the county council of Vestfold og Telemark on 15 February 2022 to split the newly established county into its respective counties that existed before the merger took place; Telemark and Vestfold.
Etymology
Vestfold is the old name of the region which was revived in modern times. Fold was the old name of the Oslofjord, and the meaning of the name Vestfold is the region west of the Fold (see also Østfold). Before 1919, the county was called Jarlsberg og Larvik Amt. The amt was created in 1821, consisting of the two old counties of Jarlsberg and Larvik. In the Viking Age, Vestfold also referred to Eiker, Drammen, Kongsberg, Lier, now in Buskerud.
Vestfold Hills on Antarctica's Sørsdal Glacier is named after the county.
History
Viking history
Vestfold is mentioned for the first time in a written source in 813, when Danish kings were in Vestfold to quell an uprising amongst the Fürsts . There may have been as many as six political centers in Vestfold. At that time Kaupang, which was located in Tjølling near Larvik, had been functioning for decades and had a chieftain. Kaupang, which dates from the Viking Era, is believed to be the first town in Norway, although Tønsberg (which dates from ca. 900) is the oldest town in Norway still in existence. At Borre, there was a site for another chieftain. That site held chieftains for more than one hundred years prior to 813.
The stone mounds at Mølen have been dated to the Viking Age. The mounds at Haugar in present-day Tønsberg's town centre have been dated to the Viking period. At Farmannshaugen in Sem there seems to have been activity at the time, while activity at Oseberghaugen and Gokstadhaugen dates from a few decades later.
An English source from around 890 retells the voyage of Ottar (Ottar fra Hålogaland) "from the farthest North, along Norvegr via Kaupang and Hedeby to England", where Ottar places Kaupang in the land of the Dane - danenes land. Bjørn Brandlien says that "To the degree that Harald Hårfagre gathered a kingdom after the Battle of Hafrsfjord at the end of the 9th century - that especially is connected to Avaldsnes - it does not seem to have made such a great impression on Ottar".
Kaupang is mentioned under the name of Skiringssal (Kaupangen i Skiringssal) in Ottar's tales.
By the 10th century, the local kings had established themselves. The king or his ombudsman resided in the old Royal Court at Sæheim i Sem, today the Jarlsberg Estate (Jarlsberg Hovedgård) in Tønsberg. The farm Haugar (from Old Norse haugr meaning hill or mound) became the seat for Haugating, the Thing for Vestfold and one of Norway's most important place for the proclamation of kings.
The family of Harald Fairhair, who was most likely the first king of Norway, is said to have come from this area.
The Danish kings seem to have been weak in Vestfold from around the middle of the 9th century until the middle of the 10th century, but their rule was strengthened there at the end of the 10th century. The Danish kings seem to have tried to control the region until the 13th century.
Kings ruling some or all of Vestfold
Erik Agnarsson
Halfdan Hvitbeinn (part of Vestfold)
Eystein Halfdansson
Halfdan the Mild
Gudrød the Hunter
Halfdan the Black, together with his brother, Olaf Gudrødsson
Ragnvald the Mountain-High, Cousin of Harold Fairhair
Harald Fairhair
Bjørn Farmann
Olaf Haraldsson Geirstadalf, brother of Bjørn
Harald Gudrødsson Grenske, 976–987
Whaling
Whaling was an important 19th century industry in coastal cities such as Larvik, Tønsberg, and Sandefjord, which was the world centre for the world's modern whaling industry. Not only did men from Vestfold County make up practically all the crew on the Norwegian whaling fleet, but many were also involved in the whaling industry in other nations. As an example, the first phase of modern Australian whaling was almost entirely based on workers from Larvik. While the first whaling station in the Faroe Islands was established by Sandefjordians, Larvik played a similar role for the Shetland Islands. Tønsberg initiated much of the whaling industry in Iceland and the Hebrides.
The largest settlement in South Georgia and the South Sandwich Islands, Grytviken, was established by Carl Anton Larsen of Sandefjord on 16 November 1904. Sandefjordian Nils Larsen's expeditions to Antarctica in the early 20th century led to the Norwegian annexation of Bouvet Island (1927) and Peter I Island (1929). A cove on Peter I Island is named Sandefjord Cove in honor of Nils Larsen's hometown.
Sandefjord Harbor is now home to Southern Actor, the only whale-catcher from the Modern Whaling Epoch still to be in its original order. The museum ship is owned by Sandefjord Whaling Museum, Europe's only museum dedicated to whaling. Sandefjord has been named the centre of the Modern Whaling Epoch, and has been nicknamed "the whaling capital of the world."
Geography
Vestfold was Norway's smallest county, with the exception of the city-county of Oslo. It lies on the western shore of the Oslofjord. Vestfold borders with Buskerud County in the north and with Telemark County in the west. It is bordered by Skagerrak in the North Sea to both the south and east. The county has a total area of and has a coastline. Vestfjellet at is the tallest peak in the county. It is also home to 1,407 islands. Nøtterøy () is the largest island in Vestfold, while Tjøme () is the second-largest island.
There is a total of 634 freshwater lakes in Vestfold, with a total area of 79 square kilometers. Large lakes include Farris, Eikeren, Goksjø, Hallevannet, Akersvannet, and others. Vestfold makes up 0.7 percent of Norway's total land area. Ten Norwegian municipalities are larger in size than Vestfold County. As an example, Kautokeino municipality in Finnmark County is over four times larger than Vestfold County. The county of Finnmark is 22 times larger than Vestfold.
Geology
The county's soft soil is composed of varieties of moraine and sedimentary soils. The Ice Age left large parts of Vestfold below sea level, and the most cultivated soil can be found on the marine terraces. Marine clay and sand cover most of the lower lying country in the south-west and north. The Vestfold moraine, a continuation of the Østfold moraine at Moss, is an ice-formed formation which stretches as a cohesive gravel ridge through the county, from Horten in the east to Mølen in the south.
Preserved areas
Færder National Park was the county's first national park when the decision was formalized by King Harald V on 23 August 2013. The visitor center is at World's End, and was officially opened by Queen Sonja on 26 June 2015. The national park lies in Nøtterøy- and Tjøme municipalities, and is made up of of ocean and of land. It stretches from Ormøy in the north to Færder Lighthouse in the south. It is one of two marine national parks in Norway, and is made up of coast, skerries, islands and sea bed.
Mølen in Larvik is home to Norway's largest stone beach and is an ancient burial site consisting of 230 cairns, some exceeding in diameter. Excavations have dated the rock piles to about 250 A.D. It was the first UNESCO Global Geopark in the Nordics when established in 2008. Mølen is one of Larvik's most popular tourist attractions. It is home to over a hundred species of rock, including Norway's national stone, Larvikite, which is named from the area. It is a crucially important seabird habitat, where over 316 species of bird have been recorded.
Municipalities
Vestfold County has experienced a large reduction in number of municipalities. As of 1949, the county was home to 19 rural municipalities and seven city municipalities. There were 14 municipalities as of 2016, but the number will decrease to 8 by 1 January 2020.
As of 1 January 2017 the number of municipalities in Vestfold County was reduced from 14 to 12.
As of 1 January 2018 the number of municipalities in Vestfold County was reduced from 12 to 9.
Andebu (merged into Sandefjord on 1 January 2017)
Hof (merged into Holmestrand on 1 January 2018)
Holmestrand (added Hof on 1 January 2018)
Horten
Lardal (merged into Larvik on 1 January 2018)
Larvik (added Lardal on 1 January 2018)
Nøtterøy (merged with Tjøme on 1 January 2018 to form the new municipality of Færder)
Re (merged into Tønsberg on 1 January 2020)
Sande (merged into Holmestrand on 1 January 2020)
Sandefjord (added Andebu and Stokke on 1 January 2017)
Stokke (merged into Sandefjord on 1 January 2017)
Svelvik (merged into Drammen on 1 January 2020)
Tjøme (merged with Nøtterøy on 1 January 2018 to form the new municipality of Færder)
Tønsberg (added Re on 1 January 2020)
Cities
Holmestrand
Horten
Larvik
Sandefjord
Stavern
Tønsberg
Parishes
Andebu
Arnadal (Arendal)
Berg
Borre
Botne
Brunlanes
Fon
Fredricksværn, see Stavern
Hedrum
Hem
Hillestad
Hof
Holmestrand
Horten
Hvarnes
Høyjord
Kjose
Kodal
Konnerud
Kvelde
Langestrand
Lardal
Larvik
Nykirke
Nøtterøy
Ramnes
Sandar
Sande
Sandefjord
Sandeherred, see Sandar
Sankt Laurentii
Sem
Skjee
Skoger
Slagen
Stavern
Stokke
Strømm (Strømmen)
Strømsgodset
Styrvoll
Svarstad
Svelvik
Tanum
Tjølling
Tjøme
Tønsberg
Undrumsdal
Valløy
Vassås
Vivestad
Vor Frue (Maria)
Våle
Åsgårdstrand
Larvik Branch (LDS, early-1927)
Tønsberg Branch (LDS, early-1951)
Larvik (Katolske Apostoliske, 1888–1963)
Villages
Andebu
Barkåker
Berger
Bergsåsen
Bjerkøya
Bjørnevåg
Borgheim
Borre
Brekkeåsen
Buerstad
Duken
Eidsfoss
Eik
Eikeberg
Fevang
Fokserød
Fon
Freberg
Føynland
Gjone
Glomstein
Gretteåsen
Grimestad
Gullhaug
Hafallen
Helgeroa
Hem
Hof
Hulebakk
Husvik
Husøy
Hvasser
Høyjord
Hårkollen
Kaupang
Kjose
Kjøpmannskjær
Klever
Kodal
Kvelde
Lahelle
Linnestad
Melsomvik
Nesbrygga
Nesbygda
Nykirke
Ormelet
Oterbekk
Ramnes
Revetal
Rånerudåsen
Råstad
Sande
Selvik
Sem
Skallestad
Skinmo
Skjerve
Skoppum
Solløkka
Solvang
Stavern
Stokke
Storevar
Strand
Strengsdal
Sundbyfoss
Sundene
Svarstad
Svelvik
Svinevoll
Teie
Tenvik
Torød
Ula
Unneberg
Valberg
Vassås
Vear
Veierland
Verdens Ende
Verningen
Vestskogen
Vollen
Årøysund
Åsgårdstrand
Former Municipalities
Andebu
Borre
Botne
Brunlanes
Hedrum
Hof
Lardal
Nøtterøy
Ramnes
Sandar
Sem
Skoger
Stavern
Stokke
Strømm
Tjølling
Tjøme
Våle
Åsgårdstrand
Political strength
Results from parliamentary elections in Vestfold County since 1973:
Bold letters represent the alliances (Leftwing Ap+SV. Centre KrF+V+Sp. Rightwing H+Frp). M = Number of elected parliamentarians.
Demographics
According to Statistics Norway, Vestfold County was home to 244,967 residents as of 1 January 2016. Immigrants made up 11.9 percent of the population in 2017. Most immigrants were from Poland (4,287 people), followed by Lithuania (2,794) and Iraq (1,549). Despite its small size, Vestfold had the third-highest population density in Norway. However, the population density may still have been considered low; as an example, the population density of the Netherlands was four times higher than that of Vestfold County in 1998.
Sandefjord was the most populous city of Vestfold County; one in four people from Vestfold were from Sandefjord, or 25.2 percent of the county population.
Economy
Traditional industries in Vestfold have included whaling and ship building. For over 50 years in the 19th century, Sandefjord and partially Tønsberg functioned as the world centre for the whaling industry. However, whaling ended in the 1960s and the ship building industry has gradually reduced since the 1980s. Information technology is currently a growing industry, and the county is home to large web shops such as Komplett, MPX.no and netshop.no. 18.9 percent of the county's total area is used for agriculture, the highest percentage of any county in Norway. 70% of agricultural lands are used for the cultivation of grains. Vestfold's farming area makes up five percent of Norway's cultivated areas. However, by area, Vestfold only makes up 0.7 percent of Norway's land area.
Vestfold has Norway's most expensive vacation homes. Sandefjord had Norway's most expensive vacation homes in 2012, while Tjøme had the most expensive homes as of 2010. General property values appreciated 28.3 percent between 2010 and 2015.
Tourism
Summer tourism is an important industry in Vestfold, particularly in coastal communities such as Sandefjord, Tjøme and Stavern. Coastal cities also have large numbers of vacation homes. There were 534,724 hotel stays in 2015, where the purpose was vacationing for 236,895. Most international tourists were from the United Kingdom, Sweden, and Denmark. There were 781,459 stays at rental cabins or campgrounds in 2015. Consequentially, the population increases drastically during summer months in municipalities such as Sandefjord, Tjøme, and elsewhere. The population at Tjøme goes from 4,500 to around 50,000 each summer. The population of islands such as Tjøme often quadruple during summer, while summer communities as Stavern often sees a doubling or tripling. Tjøme Island is home to nearly as many vacation homes as residential homes.
While Tjøme has the nickname Sommerøya ("the Summer Island"), Sandefjord is nicknamed Badebyen ("the Bathing City") due to its many beaches and former spas. Sandefjord is known for its many great beaches, and it is primarily known as a summer resort community. It first became a bathing destination when sulphur was discovered in 1837. The city gained further recognition when Sandefjord Sulfur Spa and Resort (Kurbadet) was established in 1837. The bath was one of the most visited in Europe during the late 19th century.
Vestfold's most visited tourist attractions include Borre mound cemetery, the largest burial site in Northern Europe, as well as numerous sites along the coast. Architectural sites include the villages of Åsgårdstrand, Karljohansvern in Horten, and Fredriksvern in Stavern. Other important attractions are Sandefjord Whaling Museum, Mølen Geopark in Larvik, as well as Tønsberg Fortress (Slottsfjellet) in Tønsberg.
Largest companies
Largest companies in Vestfold County based on operating income in 2015:
Culture
Vestfold is the county in Norway with the most traces from the Viking Age. Examples include the Oseberg- and Gokstad Burial Mounds. While the Oseberg Ship was discovered in Tønsberg, the Gokstad Ship was discovered in Sandefjord. The Gokstad Ship is Norway's largest preserved Viking ship. Both ships are now located at the Viking Ship Museum in Oslo. Additional burial mounds are found at Borre mound cemetery and Mølen, an UNESCO Global Geopark. Borre mound cemetery is home to Northern Europe's largest burial mound site from Viking Age.
Vestfold is home to 21 churches dating to medieval times. It is also home to one stave church, Høyjord Stave Church in Andebu (Sandefjord). Nearby Andebu Church also has Norway's oldest parish register, dating to 1623. The city of Sandefjord proper is home to Europe's only museum dedicated to whaling, Sandefjord Museum in the city centre. This museum also owns Southern Actor, a whale-catcher turned museum ship. Southern Actor is the only whale-catcher from the Modern Whaling Epoch still to be in its original working order. Also at Sandefjord Harbor is the Harbour Chapel (Bryggekapellet), which is the only floating church in Norway and most likely Europe, perhaps the only floating church in the world.
The city of Tønsberg is Norway's oldest city, most likely founded in year 871. Tønsberg is home to Tønsberg Fortress, which is Scandinavia's largest ruin site. It includes ruins from Castrum Tunsbergis, Norway's largest castle in the 13th century. An outdoor music festival is held at Tønsberg Fortress every July. Ruins of a German fortress can be seen at Folehavna Fort on West Island, Sandefjord.
Transportation
The Vestfold Line is a railway line that runs from Drammen, through a number of towns in Vestfold and ending in the town of Skien in Telemark. European route E18 runs through the county roughly parallel to the railway.
There are two international ferry connections, both operated by Color Line. Larvik is connected to the Danish town Hirtshals, the other route is between Sandefjord and Strømstad in Sweden. Fjord Line is also a ferry operator between Sandefjord and Strømstad. In addition there is a domestic route connecting Horten and Moss.
Sandefjord Airport Torp is one of Norway's largest airports. Only Bergen- and Oslo Airports have more international flights than Torp Airport. Despite being located 74 miles south of Oslo, Torp is sometimes called Oslo Airport Torp. It is reached with a free shuttle bus from Sandefjord Airport Station on Vestfoldbanen. Torp is regional hub for low-cost carrier Norwegian, as well as low-cost carriers Ryanair and WizzAir also operate from the airport. Torp offers direct routes to over 30 international and domestic destinations, including daily flights to European cities such as London and Amsterdam.
Points of interest
Larvik
Bøkeskogen, world's northernmost beech tree forest.
Kaupang, home to remains for the oldest Nordic town yet discovered. The remains are from one of Scandinavia's earliest urban sites, established in year 800 A.D.
Mølen, Scandinavia's first UNESCO Global Geopark.
Nevlunghavn and Helgeroa, adjacent coastal villages.
Larvik Museum
Fritzøehus, largest privately owned estate in Norway.
Stavern, small coastal town, home of Citadell Island
Fredriksvern, Norway's main naval base from the mid-1750s until 1864.
Minnehallen (Hall of Remembrance), largest monument in Vestfold.
Horten
Borre National Park, largest burial mound site in Northern Europe.
Løvøy Chapel
Royal Norwegian Navy Museum
Preus Museum
Borre Church, romanesque medieval church constructed in the 1100s.
Tordenskioldeika
Åsgårdstrand, oceanside resort town.
Borre Golfbane
Tønsberg and Færder
Tønsberg Fortress, largest ruin park in the Nordic countries.
Oseberg Mound, site of the discovery of the Oseberg Ship
Haugar
Tønsberg Cathedral
Sem Church
Slottsfjellmuseet
Nordbyen
World's End, southernmost point at Tjøme.
Herkelås
Tjøme Church
Færder National Park, first National Park in Vestfold.
Sandefjord
Sandefjord Museum (the Whaling Museum), Europe's only museum dedicated to whaling.
Southern Actor, only whale-catcher from the Modern Whaling Epoch still to be in its original working order.
Gokstad Mound, site of the discovery of the 9th-century Gokstad Ship.
Gaia ship, replica of the Gokstad Ship docked at Museum's Wharf.
Sandar Church, built on ruins of a 13th-century medieval stone church. Present church was erected in 1792.
Whaler's Monument, rotating bronze monument erected in honor of pioneering whalers.
Sandefjord Church
Istrehågan, ancient burial ground which dates to the Roman Iron Age around 1500-500 BCE.
Kurbadet, former resort spa and one of Europe's most visited baths in the late 19th century.
Folehavna Fort, ruins from a German fortress erected in 1941 during the German occupation of Norway.
Høyjord Stave Church, the only stave church left in Vestfold County.
Langeby, popular bathing beach at West Island.
Goksjø, third-largest lake in Vestfold County.
Archaeological sites
Istrehågan
Istrehågan is an ancient burial ground which dates to the Roman Iron Age around 1500-500 BCE. It is located at Jåberg in Tjølling, on the border between Sandefjord and Larvik. The rock settings at Istrehågan resemble a ship. It is long, and meters broad. Archaeological excavations made in 1959-61 uncovered
remains of bones, bear claws, pottery shards, a brooch, and more. At Haugen farm on the Sandefjord side is Vestfold County's largest collection of petroglyphs.
Borre National Park
At Borrehaugene near Borrre there are 9 large mounds and around 30 smaller ones. It is the largest burial mound site in Northern Europe.
Borre mound cemetery most likely contains graves belonging to kings of the Yngling dynasty. It is mentioned in the poem Ynglingatal as the burial site of one of two kings belonging to the royal dynasty of the Ynglingas.
Kaupang
Kaupang in Skiringssal (Larvik) is home to remains from the oldest Nordic town yet discovered. It was a trade centre established around year 800, making it one of Scandinavia's earliest urban sites. The settlement was abandoned in the mid-10th century. It is located in Kaupang Bay in Viksfjord, Larvik. Archeological finds include melting pots, jewelry parts, casting moulds and casting models. Most of Kaupang remains not excavated. There are replicas of Viking homes at Kaupang today, giving insight to how homes were constructed during the Viking Age.
Oseberg Burial Mound
Oseberg Mound is located in Tønsberg and is where the Oseberg Ship was discovered. The ship, which dates to 834 A.D., had a length of . Two female skeletons were found in the ship's burial chamber.
Viking burial site at Gulli
Gulli, outside Tønsberg, was the site of an archaeological excavation during the period from 2003 to 2004, prior to asphalt being laid for constructing the new E18 (road). There were 60 graves - 20 of those were preserved to a degree that [authorities decided] permitted examinations. "Perhaps the most spectacular [item] was a høvre" - used with a horse's harness. "There are few of those in Norway - one in Trøndelag and a gilded one found in Borre".
The artifacts are on display at the Midgard Historical Centre in Borre.
Fevang
19th century archeologists were struck by the many burial mounds and artifacts discovered at Fevang near Torp Airport in Sandefjord. Local farmers had discovered various artifacts in the 19th- and early 20th centuries. Archeologist Nicolay Nicolaysen traveled to Fevang and concluded that Fevang was home to an array of ancient burial mounds. Nicolaysen further discovered that Fevang had been an active graveyard for over 1,000 years - since year 0 A.D. until the first Christian cemeteries were established. Among the artifacts discovered were a gold jewel named Berlokk, which was retrieved in a woman's grave along with two gold beads, two blue glass beads, a hairpin, ceramic, burnt bones, and two clips of bronze. Her tomb is dated to the Old Iron Age, around 0-400 A.D.
Gokstad Mound
Gokstad Mound in Sandefjord was where the Gokstad Ship was excavated by Nicolay Nicolaysen in 1880. The skeleton of a man was found in the ship, long believed to be Olaf Geirstad-Alf, former king of Vestfold and half-brother of Halfdan the Black, the father of Harald Fairhair, Norway's first king. However, recent discoveries have increased uncertainty and it therefore remains unknown what chieftain was buried at Gokstad.
The ship, which is the largest found in Norway, is currently located at the Viking Ship Museum in Oslo. The ship was buried along with numerous gifts, including weapons, jewels, a gaming board, fish-hooks, 64 shields, six beds, three smaller boats and kitchen utensils. Twelve horses, eight dogs, two goshawks and two peacocks were also discovered in the grave.
Interpretive signs have been put up at the mound and Gaia, an exact replica of the Gokstad Ship, can be seen on Museum's Wharf at Sandefjord Harbor.
Mølen
The Old Norse word Mol translates to cairns, a site often used by ancient peoples to mark a burial site. Mølen, which is Norway's largest stone beach, is home to 230 cairns, which have been built over ages. Some cairns have been dated to 250 A.D. The isthmus of Mølen is home to stone piles, grave mounds, and stone settings, which are all part of a protected historic site. The last Ice Age pushed large amounts of gravel and stones ahead of it, and deposited it as a moraine through all of Vestfold, known as Vestfoldraet. Raet meets the ocean at Mølen, where the moraine sinks into the sea. Its encounter with the Skagerrak ocean waves has uncovered and polished the huge round stone floor for centuries.
Bøkeskogen
Besides being the largest beech tree forest in Norway, and the most northernmost beech tree forest in the world, Bøkeskogen is also an important archeological area. 83-90 burial mounds have been discovered in the forest. Some of these include the largest burial grounds from the Pre-Roman Iron Age in Vestfold County.
Recreation
At least 238 kilometers of coastal hiking trails can be found in Vestfold County, from Larvik in the south to Svelvik in the north. Hiking trails are found throughout the county, including at World's End in Færder National Park. Furthermore, there is a 35 km (22 mi.) marked trail between the towns of Stavern and Helgeroa. Mølen, Kjærrafossen and Bøkeskogen are also home to various trails. Tønsberg Barrel, an old beacon dated to Sverris saga in the Middle Ages, sits at Yxnøy on Sandefjord's East Island. West Island is home to Folehavna Fort and additional trails. Combined, the trails on Sandefjord's East- and West Islands are 45 km (28 mi.), and a part of the international North Sea Trail. Bøkeskogen in Larvik is home to various trails, varying from 2.6 km (1.6 mi.) to 10 km (6.2 mi.) in length.
Fauna
Vestfold's fauna includes species such as the White-tailed eagle, Roe deer, Moose, European hedgehog, Eurasian eagle-owl, Mountain hare, European badger, European pine marten, and Norway lemming. Rare observations of Gray wolf, European lynx, and Brown bear do occur. A wolf shot in Lardal in 2013 was the first wolf killed in the county in over 100 years. Between 700 and 800 moose are annually hunted in Vestfold. Larvik has one of the highest numbers of moose in Norway.
The Harbor seal is the most commonly observed species of seal in Vestfold, and it was estimated to be at minimum 183 seals in Vestfold as of August 2014. Dolphins are uncommon, however, a Common bottlenose dolphin was observed by Nøtterøy in 2014, and a Striped dolphin was observed the same summer at Helgeroa in Larvik.
Common European Viper is the only venomous snake found in Norway. There are two non-venomous snake species in Vestfold County: European grass snake and European smooth snake.
Vestfold has a rich avifauna: over 130 bird species have been observed in Svelvik, while Mølen in Larvik has the national record of 320 species.
Wildlife refuge
Saltstein is part of a protected habitat for birds. From 2014 surfing was permitted off Saltstein.
Besides being an UNESCO Global Geopark, Mølen in Larvik is a habitat for a variety of rare bird species. Mølen became a protected sanctuary for birds in 1970. 320 species of birds have been recorded at Mølen, more species than at any other site in Norway.
Wildlife preserves include Melsom- and Hemskilen Wildlife Preserves. Hemskilen Wildlife Preserve lies on the Larvik-Sandefjord border and is an important habitat for shorebirds, geese, and Passerines. Melsom Plant- and Wildlife Preserve in Sandefjord is home to various older oaks, some of them home to as many as 1,500 different species of insects. Marøyskjæra Bird Preserve consists of two skerries west of Natholmen Island, which have been important nesting areas for Common tern and Common gull since the 1980s. Over 500 seagulls hatched on the islets in the 1990s.
In popular culture
Although not filmed in Vestfold, the City of Tønsberg appears in the films Thor (2011) and also in Captain America: The First Avenger (2011), and in Avengers: Endgame
Some films shot in Vestfold include:
Norway (2018), movie based on the 2011 Norway attacks, filmed in Tønsberg and Nøtterøy.
Olsenbanden tar gull (1972), filmed in Stavern (Larvik) and Sande in Vestfold.
Baadshah (1999), Tønsberg
Christmas Blood ("Juleblod") (2017), Tønsberg and Sandefjord.
Wisting (2018– ), Larvik and Sandefjord.
Nonni and Manni (1988–89), Horten.
Head Above Water (1993), filmed at East Island in Sandefjord.
Deadline Torp (2005), movie based on the 1994 Torp hostage crisis, filmed in Sandefjord and Larvik.
Valfångare (1939), Sandefjord.
Den starkaste (1929), Sandefjord.
Gallery
References
External links
Vestfold photo gallery
Former counties of Norway
2020 disestablishments in Norway
Petty kingdoms of Norway
States and territories disestablished in 2020 |
18826434 | https://en.wikipedia.org/wiki/1994%20Chinese%20Taipei%20National%20Football%20League | 1994 Chinese Taipei National Football League | Statistics of the Chinese Taipei National Football League for the 1994 season.
Overview
It was contested by 8 teams, and Tatung won the championship.
League standings
References
Chinese Taipei - List of final tables (RSSSF)
Chinese Taipei National Football League seasons
1
Taipei
Taipei |
21261860 | https://en.wikipedia.org/wiki/Rybno%2C%20Silesian%20Voivodeship | Rybno, Silesian Voivodeship | Rybno is a village in the administrative district of Gmina Kłobuck, within Kłobuck County, Silesian Voivodeship, in southern Poland. It lies approximately south-west of Kłobuck and north of the regional capital Katowice.
The village has a population of 177.
References
Rybno |
8347382 | https://en.wikipedia.org/wiki/Luther%20H.%20Story | Luther H. Story | Luther H. Story (July 20, 1931 – September 1, 1950) was a soldier in the United States Army during the Korean War. Story joined the US Army in October 1948. He posthumously received the Medal of Honor for his actions on September 1, 1950 during the Battle of Yongsan.
Posthumously named for Story is the Luther Story Bridge over the Flint River in his native state of Georgia.
Medal of Honor citation
Rank and organization Private First Class, U.S. Army, Company A, 9th Infantry Regiment, 2nd Infantry Division
Place and date: Near Agok, Korea, September 1, 1950
Entered service at: Georgia. Born: July 20, 1931, Buena Vista, Georgia
G.O. No.: 70, August 2, 1951
Citation:
Pfc. Story, distinguished himself by conspicuous gallantry and intrepidity above and beyond the call of duty in action. A savage daylight attack by elements of 3 enemy divisions penetrated the thinly held lines of the 9th Infantry. Company A beat off several banzai attacks but was bypassed and in danger of being cut off and surrounded. Pfc. Story, a weapons squad leader, was heavily engaged in stopping the early attacks and had just moved his squad to a position overlooking the Naktong River when he observed a large group of the enemy crossing the river to attack Company A. Seizing a machine gun from his wounded gunner he placed deadly fire on the hostile column killing or wounding an estimated 100 enemy soldiers. Facing certain encirclement the company commander ordered a withdrawal. During the move Pfc. Story noticed the approach of an enemy truck loaded with troops and towing an ammunition trailer. Alerting his comrades to take cover he fearlessly stood in the middle of the road, throwing grenades into the truck. Out of grenades he crawled to his squad, gathered up additional grenades and again attacked the vehicle. During the withdrawal the company was attacked by such superior numbers that it was forced to deploy in a rice field. Pfc. Story was wounded in this action, but, disregarding his wounds, rallied the men about him and repelled the attack. Realizing that his wounds would hamper his comrades he refused to retire to the next position but remained to cover the company's withdrawal. When last seen he was firing every weapon available and fighting off another hostile assault. Private Story's extraordinary heroism, aggressive leadership, and supreme devotion to duty reflect the highest credit upon himself and were in keeping with the esteemed traditions of the military service.
See also
List of Medal of Honor recipients
List of Korean War Medal of Honor recipients
Notes
References
External links
Luther Story Bridge historical marker
1931 births
1950 deaths
United States Army Medal of Honor recipients
American military personnel killed in the Korean War
People from Buena Vista, Georgia
Korean War recipients of the Medal of Honor
Military personnel from Georgia (U.S. state)
Military personnel missing in action
United States Army personnel of the Korean War |
318178 | https://en.wikipedia.org/wiki/Philip%20Noel-Baker | Philip Noel-Baker | Philip John Noel-Baker, Baron Noel-Baker, (1 November 1889 – 8 October 1982), born Philip John Baker, was a British politician, diplomat, academic, athlete, and renowned campaigner for disarmament. He carried the British team flag and won a silver medal for the 1500m at the 1920 Summer Olympics in Antwerp, and received the Nobel Peace Prize in 1959.
Noel-Baker is the only person to have won an Olympic medal and received a Nobel Prize. He was a Labour member of parliament from 1929 to 1931 and from 1936 to 1970, serving in several ministerial offices and the cabinet. He became a life peer in 1977.
Early life and athletic career
Baker was born in Brondesbury Park, London, the sixth of seven children of the Canadian-born Quaker, Joseph Allen Baker and the Scottish-born Elizabeth Balmer Moscrip. His father had moved to England in 1876 to establish a manufacturing business and served as a Progressive member of the London County Council from 1895 to 1906 and as a Liberal member of the House of Commons for East Finsbury from 1905 to 1918.
Baker was educated at Ackworth School, Bootham School, and then in the US at the Quaker-associated Haverford College in Pennsylvania. He studied at King's College, Cambridge, from 1908 to 1912. As well as being an excellent student, obtaining a second in Part I history and a first in Part II economics, he was President of the Cambridge Union Society in 1912 and President of the Cambridge University Athletic Club from 1910 to 1912.
He was a competitor in the Olympic Games as a middle-distance runner, both before and after the First World War, representing Great Britain in the 800 metres and 1500 metres at the 1912 Olympic Games in Stockholm. He reached the final of the 1500 metres, won by his fellow countryman Arnold Jackson. At the 1920 Summer Olympics in Antwerp Baker was captain of the British track team and carried the team's flag. He won his first race in the 800 metres, but then concentrated on the 1500 metres, taking the silver medal behind his teammate Albert Hill. He was captain again at the 1924 Summer Olympics in Paris, but did not compete.
Baker's early career was as an academic. In 1914 he was appointed as vice-principal of Ruskin College, Oxford, and in 1915 was elected a fellow at King's College, Cambridge. During World War I, he organised and led the Friends' Ambulance Unit attached to the fighting front in France (1914–1915), and was then, as a conscientious objector from 1916, adjutant of the First British Ambulance Unit for Italy, in association with the British Red Cross (1915–1918), for which he received military medals from the UK, France and Italy.
Political career
After World War I, Noel-Baker was closely involved in the formation of the League of Nations, serving as assistant to Lord Robert Cecil, then assistant to Sir Eric Drummond, the league's first secretary-general. According to historian Susan Pedersen "Baker was far to the left of Drummond politically, but he had the kind of formation, connections, and intimate understanding of British officialdom’s rules of the game that made for easy collaboration between the two." Noel-Baker did much of the League's early work on the mandates system.
He became the first Sir Ernest Cassel Professor of International Relations at the University of London from 1924 to 1929 and a lecturer at Yale University from 1933 to 1934. His political career with the Labour Party began in 1924 when he stood, unsuccessfully, for Parliament in the Conservative safe seat of Birmingham Handsworth. He was elected as the member for Coventry in 1929, and served as parliamentary private secretary to the Foreign Secretary Arthur Henderson.
Noel-Baker lost his seat in 1931, but remained Henderson's assistant while Henderson was president of the World Disarmament Conference in Geneva in 1932 to 1933. He stood for Parliament again in Coventry in 1935, unsuccessfully, but won the Derby by-election in July 1936 after the sitting Derby Member of Parliament J. H. Thomas resigned. When that constituency was split in 1950, he transferred to Derby South.
Noel-Baker became a member of the Labour Party's National Executive Committee in 1937. On 21 June 1938, Noel-Baker, as M.P. for Derby, in the run up to World War II, spoke at the House of Commons against aerial bombing of German cities based on moral grounds. "The only way to prevent atrocities from the air is to abolish air warfare and national air forces altogether."
In the coalition government during the World War II he was a parliamentary secretary at the Ministry of War Transport from February 1942, and served as Minister of State for Foreign Affairs after Labour gained power following the 1945 general election, but had a poor relationship with the Foreign Secretary, Ernest Bevin. Noel-Baker moved to become Secretary of State for Air in October 1946, and then became Secretary of State for Commonwealth Relations in 1947 and joined the cabinet.
Noel-Baker was the minister responsible for organising the 1948 Olympic Games in London. He moved to the Ministry of Fuel and Power in 1950. In the mid-1940s, Noel-Baker served on the British delegation to what became the United Nations, helping to draft its charter and other rules for operation as a British delegate. He served as Chairman of the Labour Party in 1946–47, but lost his place on the National Executive Committee in 1948, his place being taken by Michael Foot. An opponent of left-wing Bevanite policies in the 1950s, and an advocate of multilateral nuclear disarmament, rather than a policy of unilateral disarmament, he received the Nobel Peace Prize in 1959. In 1979, with Fenner Brockway, he co-founded the World Disarmament Campaign, serving as co-Chair until he died, and was an active supporter of disarmament into the 1980s.
Noel-Baker stood down as the MP for Derby South at the 1970 general election, at which he was succeeded by Walter Johnson. His life peerage was announced in the 1977 Silver Jubilee and Birthday Honours and he was raised to the peerage 22 July 1977, as Baron Noel-Baker, of the City of Derby, having declined an appointment as a Companion of Honour in the 1965 New Year Honours. He was president of the International Council of Sport Science and Physical Education from 1960 to 1976.
A memorial garden, the Philip Noel-Baker Peace Garden, exists within Elthorne Park, a small park in the London Borough of Islington.
Personal life
In June 1915, Philip John Baker married Irene Noel, a field hospital nurse in East Grinstead, subsequently adopting the hyphenated name Noel-Baker in 1921 by deed poll. His wife was a friend of Virginia Woolf. Their only son, Francis, also became a Labour MP and served together with his father in the Commons. Their marriage, however was not a success and Noel-Baker's mistress from 1936 was Megan Lloyd George, daughter of the former Liberal Party leader David Lloyd George, herself a Liberal and later Labour MP. The relationship ended when Irene died in 1956.
He died at home in Westminster on 8 October 1982.
Works
Writings
(Reprint 1970, New York: Kennicat Press)
(Reprint 1972, New York: Dover Publications)
By Philip Noel-Baker with other authors
See also
Fridtjof Nansen
List of peace activists
References
Bibliography
Primary and Secondary Sources
Lloyd, Lorna: Philip Noel-Baker and the Peace Through Law in
External links
(timeline of Noel-Baker's life, and index to his papers held at Churchill Archives Centre, Churchill College, Cambridge)
1889 births
1982 deaths
People from Hendon
Athletes from London
English Quakers
Labour Party (UK) MPs for English constituencies
Labour Party (UK) life peers
British sportsperson-politicians
English male middle-distance runners
Olympic athletes of Great Britain
Olympic silver medallists for Great Britain
Athletes (track and field) at the 1912 Summer Olympics
Athletes (track and field) at the 1920 Summer Olympics
Athletes (track and field) at the 1924 Summer Olympics
Members of the Parliament of the United Kingdom for constituencies in Derbyshire
UK MPs 1929–1931
UK MPs 1935–1945
UK MPs 1945–1950
UK MPs 1950–1951
UK MPs 1951–1955
UK MPs 1955–1959
UK MPs 1959–1964
UK MPs 1964–1966
UK MPs 1966–1970
UK MPs who were granted peerages
British anti-war activists
British conscientious objectors
British Secretaries of State
Chairs of the Labour Party (UK)
English Christian pacifists
Nobel Peace Prize laureates
British Nobel laureates
English Nobel laureates
Members of the Privy Council of the United Kingdom
Presidents of the Cambridge Union
People educated at Bootham School
Alumni of King's College, Cambridge
Fellows of King's College, Cambridge
Academics of the London School of Economics
Haverford College alumni
People associated with the Friends' Ambulance Unit
Sportspeople from Yorkshire
Medalists at the 1920 Summer Olympics
Olympic silver medalists in athletics (track and field)
Ministers in the Attlee governments, 1945–1951
Life peers created by Elizabeth II |
49328352 | https://en.wikipedia.org/wiki/With%20You%20%28South%20Korean%20TV%20series%29 | With You (South Korean TV series) | With You () was a 2014 South Korean television program that shows the perspective of couples in late marriages. It aired on JTBC on Tuesdays at 21:30 (KST). Starting from the second season the show changed its name to With You Season 2: The Greatest Love ().
Season 1
Couples
Lee Young-ha & Park Chan-sook (episodes 1–15)
Ji Sang-ryeol & Park Jun-keum (episodes 16–47)
Im Hyun-sik & Park Won-sook (episodes 1–24)
Lee Sang-min & Sayuri Fujita (episodes 27–47)
Kim Bum-soo & Ahn Moon-sook (episodes 32–47)
Season 2
Couples
Kim Bum-soo & Ahn Moon-sook (episodes 1–23)
Jang Seo-hee & Yoon Gun (episodes 1–23)
Guillaume Patry & Song Min-seo (episodes 24–36)
Yoon Jung-soo & Kim Sook (episode 24–120)
Heo Kyung-hwan & Oh Na-mi (episodes 37–77)
Seo In-young & Crown J (Episode 78–90)
Yoo Min-sang & Lee Su-ji (Episode 91–103)
Kim Young-chul & Song Eun-i (episode 102–120)
Guests
Ratings
In the ratings below, the highest rating for the show will be in red, and the lowest rating for the show will be in blue each year.
References
External links
Season 1
Season 2
2014 South Korean television series debuts
2014 South Korean television series endings
2015 South Korean television series debuts
2017 South Korean television series endings
Korean-language television shows
JTBC original programming
South Korean variety television shows
South Korean dating and relationship reality television series |
41251373 | https://en.wikipedia.org/wiki/ESAE%20FC | ESAE FC | ESAE FC is a Beninese football club based in Sakété in the Plateau Department. They currently play in the Benin Premier League.
The club was previously known as Adjobi FC until 2015.
Stadium
The team plays at the 12,000 capacity Stade René Pleven d'Akpakpa.
Current squad
''Squad for the 2021–22 CAF Confederation Cup
Staff
References
External links
Soccerway
Sportsopera
Football clubs in Benin |
15720162 | https://en.wikipedia.org/wiki/Royal%20Bend%20of%20Castile | Royal Bend of Castile | The Royal Bend of Castile (Banda Real de Castilla) was the heraldic flag of the monarchs of the Crown of Castile, a personal banner of military use, distinctive indicating to the troops the presence of the monarch and allowed them to have identified his position in the battles. This insignia, who joined in the symbolism of the king of Castile to heraldic flag with the Castile and Leonese arms, was created in 1332 by the king Alfonso XI of Castile, although its origin probably would go back to one of the primitive symbols of the Counts of Castile, which had consisted of a gold bend on gules (red). The dragantes appeared on the handpiece or baton when Scipio brought the Roman legions to Hispania.
Alfonso XI founded the Order of the Royal Band of Castile to reward the best services to the sovereign.
The Bend of Castile was used by all the monarchs that had Castile until Charles V, Holy Roman Empire. It consisted, from the reign of Henry IV of Castile, on a reddish flag, probably purple scarlet, with a golden bend of throaty dragantes heads of the same color.
The dragantes are the heraldic representation of dragons.
Prior to the reign of Henry IV, the colors were something changing and have been preserved representations of the Royal Bend of Castile in the reign of Peter of Castile with dragantes of white and black color bend.
The Bend of Castile description from Henry I reign was: Gules, a bend or engouled into dragantes (dragon or wolf's heads). Before, the bend and the dragon's heads were different colours.
The Castilian Bend origin was the old Count of Castile's coat of arms Gules a bend Or -, after "Gules, a three towered castle Or"
The Catholic Monarchs used the Castilian Bend between a yoke with ribbons Or (on obverse side) and a sheaf of arrows with ribbons Or (on reverse side) and their motto: Tanto Monta, Monta Tanto ("cutting as untying") an explanation of the equality of the monarchs.
Charles I used the Bend between the Pillars of Hercules, External Oraments of the King-Emperor's heraldry.
Later use of the Royal Bend of Castile
Francisco Franco, General and Head of State of Spain, used from 1940 to 1975 the Castilian Bend (like the version of Charles I) as Head of State’s Standard and Guidon: The Bend between the Pillars of Hercules, crowned with an imperial crown and open (old) royal crown. The Bend between the Pillars of Hercules also were depicting in the personal coat of arms used by Franco as Head of Spanish State
See also
Heraldry of Castile
Knights of the Band
Female order of the Band
References
Band of Castile
14th-century establishments in Castile
Heraldic charges
Castille |
1596409 | https://en.wikipedia.org/wiki/Armstrong%20Whitworth%20Aircraft | Armstrong Whitworth Aircraft | Sir W. G. Armstrong Whitworth Aircraft Company, or Armstrong Whitworth Aircraft, was a British aircraft manufacturer.
History
Armstrong Whitworth Aircraft was established as the Aerial Department of the Sir W. G. Armstrong Whitworth & Company engineering group in Newcastle-upon-Tyne in 1912, and from c. 1914 to 1917 employed the Dutch aircraft designer Frederick Koolhoven (hence the "F.K." models).
In 1920, Armstrong Whitworth acquired the engine and automobile manufacturer Siddeley-Deasy. The engine and automotive businesses of both companies were spun off as Armstrong Siddeley and the aircraft interests as the Sir W. G. Armstrong Whitworth Aircraft Company. When Vickers and Armstrong Whitworth merged in 1927 to form Vickers-Armstrongs, Armstrong Whitworth Aircraft and Armstrong Siddeley were bought out by J. D. Siddeley and did not join the new grouping. This left two aircraft companies with Armstrong in the name – Vickers-Armstrongs (usually known as just "Vickers") and "Armstrong-Whitworth".
The most successful aircraft made by Armstrong-Whitworth in the inter-war period was the Siskin which first flew in 1919 and remained in RAF service until 1932, with 485 produced.
In 1935, J. D. Siddeley retired and Armstrong Whitworth Aircraft was purchased by Hawker Aircraft, the new group becoming Hawker Siddeley Aircraft. The component companies of Hawker Siddeley co-operated, but operated as individual entities.
In March 1936, the first Armstrong Whitworth Whitley bomber aircraft made its maiden flight and a total of 1,814 were produced for the RAF, ending in July 1943. During the war, Armstrong Whitworth also produced 1,328 Avro Lancasters and designed the Armstrong Whitworth Albemarle reconnaissance bomber which was then made by A. W. Hawksley Ltd, part of the Hawker Siddeley group.
Armstrong Whitworth built 281 Avro Lincolns at Baginton from 1945 to 1951. Then, during the 1950s Armstrong Whitworth Aircraft built many Gloster Meteor, Hawker Seahawk, Hawker Hunter and Gloster Javelin jet fighters at their Bitteswell and Baginton factories for delivery to the Royal Air Force, the Royal Navy and the Royal Belgian Air Force.
The Armstrong Whitworth Apollo airliner was unsuccessful and the company was eventually merged with another Hawker Siddeley company, Gloster Aircraft Company, to form Whitworth Gloster Aircraft in 1961. In 1963 Hawker Siddeley dropped the names of the component companies from its products, the last Armstrong Whitworth product, the Argosy, becoming the Hawker Siddeley Argosy.
Products
Aircraft
Date of first flight in parenthesis.
Armstrong Whitworth Aerial Department
Armstrong Whitworth F.K.1 (1914) – "Sissit"
Armstrong Whitworth F.K.3 (1915)
Armstrong Whitworth F.K.4 (1915) – gondola for SS class airship
Armstrong Whitworth F.K.6 (1916) – Escort fighter triplane
Armstrong Whitworth F.K.8 (1916) – "Big Ack" (1,200 built)
Armstrong Whitworth F.K.9 (1916)
Armstrong Whitworth F.K.10 (1917) – "Quadriplane" (8 built)
Armstrong Whitworth Armadillo (1918) (One built)
Armstrong Whitworth Ara (1919)
Armstrong Whitworth Tadpole
Armstrong Whitworth Siskin (1919) (485 built)
Armstrong-Siddeley Aircraft
Armstrong-Siddeley Siniai (1921) – Bomber (1 built)
Armstrong-Whitworth Aircraft
Armstrong Whitworth Awana (1923)
Armstrong Whitworth Wolf (1923)
Armstrong Whitworth Atlas (1925)
Armstrong Whitworth Ajax (1925)
Armstrong Whitworth A.W.14 Starling
Armstrong Whitworth Ape (1926)
Armstrong Whitworth Argosy (1926)
Armstrong Whitworth A.W.15 Atalanta (1932)
Armstrong Whitworth A.W.16 (1930)
Armstrong Whitworth A.W.17 Aries (1930)
Armstrong Whitworth A.W.18 – heavy bomber project
Armstrong Whitworth A.W.19 (1934)
Armstrong Whitworth A.W.20 – monoplane day bomber project
Armstrong Whitworth A.W.21 – monoplane fighter project
Armstrong Whitworth A.W.22 – monoplane project
Armstrong Whitworth A.W.23 (1935)
Armstrong Whitworth A.W.24 – monoplane day bomber project
Armstrong Whitworth A.W.27 Ensign (1938)
Armstrong Whitworth A.W.28 – single-seat biplane fighter project
Armstrong Whitworth A.W.29 (1936) – competing design for Specification P.27/32 for a day bomber
Armstrong Whitworth A.W.30 – twin-engined monoplane bomber project
Armstrong Whitworth A.W.31 – single-seat biplane fighter project
Armstrong Whitworth A.W.32 – braced two-seat monoplane project
Armstrong Whitworth A.W.33 – twin-engined two-seat monoplane turret fighter project
Armstrong Whitworth A.W.34 – twin-engined fighter project
Armstrong Whitworth A.W.35 Scimitar (1935)
Armstrong Whitworth A.W.36 – two-seat Army co-op biplane project
Armstrong Whitworth A.W.37 – two-seat general purpose biplane project
Armstrong Whitworth A.W.38 Whitley (1936)
Armstrong Whitworth A.W.39 – heavy bomber project
Armstrong Whitworth A.W.40 – monoplane mail carrier project
Armstrong Whitworth A.W.41 Albemarle (1940)
Armstrong Whitworth A.W.43 – monoplane airliner project
Armstrong Whitworth A.W.44 – four-engine bomber project
Armstrong Whitworth A.W.45 – monoplane medium bomber (and/or recce?) project
Armstrong Whitworth A.W.48 – medium (heavy?) bomber project
Armstrong Whitworth A.W.49 – twin-boom, laminar wing bomber (low level attack) project
Armstrong Whitworth A.W.50 – tailless monoplane project
Armstrong Whitworth A.W.51 – two-seat tailless glider project
Armstrong Whitworth A.W.52 (1947) – flying wing, prototypes only
Armstrong Whitworth A.W.53 – twin-engined fast torpedo scout (bomber?) project
Armstrong Whitworth A.W.54 – naval reconnaissance aircraft project
Armstrong Whitworth A.W.55 Apollo (1949)
Armstrong Whitworth A.W.56 – flying wing medium bomber project
Armstrong Whitworth A.W.57 – medium-range 4-engine passenger transport project
Armstrong Whitworth A.W.58 – advanced 59° swept wing Mach 1.2 research aircraft project
Armstrong Whitworth A.W.59 – variable wing-sweep research aircraft proposal
Armstrong Whitworth Argosy (AW.650 / 660) (1959)
Armstrong Whitworth AW.681 – proposed STOL military transport aircraft design
Armstrong Whitworth A.W.690 – proposed VTOL version of Nord Noratlas transport
Armstrong Whitworth A.W.168 – proposed tactical bomber design
Armstrong Whitworth AW.169 – proposed design for Operational Requirement F.155 high altitude supersonic interceptor
Armstrong Whitworth AW.171 – supersonic VTOL flying wing
Hawker Sea Hawk – produced as part of Hawker Siddeley Aircraft
Armstrong Whitworth Meteor NF.11 – redesign of the Gloster Meteor produced as part of Hawker Siddeley Aircraft
Airships
R25r airship
R29 – airship
R33 – airship
Missiles
Seaslug (missile)
See also
Aerospace industry in the United Kingdom
References
Notes
Bibliography
Tapper, Oliver. Armstrong Whitworth Aircraft since 1913. London:Putnam, 1988. .
External links
The History of Sir W. G. Armstrong Whitworth Aircraft Limited
Armstrong Whitworth
Companies based in Warwickshire
Defunct aircraft manufacturers of the United Kingdom
Guided missile manufacturers
Hawker Siddeley
History of Warwickshire
Manufacturing companies established in 1912
Science and technology in Warwickshire
1912 establishments in England
Manufacturing companies disestablished in 1961
1961 establishments in England |
43270182 | https://en.wikipedia.org/wiki/Lepturges%20gratiosus | Lepturges gratiosus | Lepturges gratiosus is a species of beetle in the family Cerambycidae. It was described by Henry Walter Bates in 1874.
References
Lepturges
Beetles described in 1874 |
70363148 | https://en.wikipedia.org/wiki/Davidson%20Ishmael | Davidson Ishmael | Davidson Ishmael is a Barbadian politician. He is a member of parliament in the House of Assembly of Barbados. He was first elected member of parliament in January 2018. He also serves as the Minister of Industry, Innovation, Science and Technology in the cabinet of Mia Mottley.
References
Living people
Barbadian politicians
Government ministers of Barbados
Barbados Labour Party politicians
Year of birth missing (living people) |
46773300 | https://en.wikipedia.org/wiki/Navy%20Day%20%28Israel%29 | Navy Day (Israel) | In Israel, Navy Day (יום חיל הים) is celebrated on June 30. At this time in 1948 the Port of Haifa was captured by Israel during the 1947–1949 Palestine war. Traditionally, Navy Day is preceded by Memorial Evening.
In 1993 Admiral Ami Ayalon decided to hold the Israel Navy day in the last week of October, commemorating victories in several wars:
The sinking of the Egyptian Navy flagship El Amir Farouq on 22 October 1948.
Capture of the Egyptian frigate Ibrahim el Awal on 31 October 1956.
The overwhelming successful actions of the Yom Kippur War, 6–24 October 1973.
Memorial Evening was rescheduled as well, marking the loss of destroyer INS Eilat on 21/10/1967. As of 2009 the celebrations have been elongated for a week, which for practical reasons, are held each year in August.
See also
List of Gregorian Jewish-related and Israeli holidays
References
National holidays
Public holidays in Israel
June observances
Summer events in Israel |
57901195 | https://en.wikipedia.org/wiki/Narayanganj-4 | Narayanganj-4 | Narayanganj-4 is a constituency represented in the Jatiya Sangsad (National Parliament) of Bangladesh since 2014 by Shamim Osman of the Awami League.
Boundaries
The constituency encompasses Fatulla and Siddhirganj thanas.
History
The constituency was created in 1984 from the Dhaka-31 constituency when the former Dhaka District was split into six districts: Manikganj, Munshiganj, Dhaka, Gazipur, Narsingdi, and Narayanganj.
Ahead of the 2008 general election, the Election Commission redrew constituency boundaries to reflect population changes revealed by the 2001 Bangladesh census. The 2008 redistricting altered the boundaries of the constituency.
Ahead of the 2014 general election, the Election Commission reduced the boundaries of the constituency. Previously it had included five union parishads of Narayanganj Sadar Upazila: Baktaballi, Enayetnagar, Fatullah, Kashipur, and Kutubpur.
Members of Parliament
Elections
Elections in the 2010s
Shamim Osman was elected unopposed in the 2014 general election after opposition parties withdrew their candidacies in a boycott of the election.
Elections in the 2000s
Elections in the 1990s
References
External links
Parliamentary constituencies in Bangladesh
Narayanganj District |
52665683 | https://en.wikipedia.org/wiki/Dodge%20Creek | Dodge Creek | Dodge Creek is a stream in Ste. Genevieve County in the U.S. state of Missouri.
Dodge Creek has the name of Israel Dodge, a pioneer citizen.
See also
List of rivers of Missouri
References
Rivers of Ste. Genevieve County, Missouri
Rivers of Missouri |
275302 | https://en.wikipedia.org/wiki/James%20Thomson%20%28poet%2C%20born%201700%29 | James Thomson (poet, born 1700) | James Thomson (c. 11 September 1700 – 27 August 1748) was a Scottish poet and playwright, known for his poems The Seasons and The Castle of Indolence, and for the lyrics of "Rule, Britannia!"
Scotland, 1700–1725
James Thomson was born in Ednam in Roxburghshire around 11 September 1700 and baptised on 15 September. He was the fourth of nine children of Thomas Thomson and Beatrix Thomson (née Trotter). Beatrix Thomson was born in Fogo, Berwickshire and was a distant relation of the house of Hume. Thomas Thomson was the Presbyterian minister of Ednam until eight weeks after Thomson's birth, when he was admitted as minister of Southdean, where Thomson spent most of his early years.
Thomson may have attended the parish school of Southdean before going to the grammar school in Jedburgh in 1712. He failed to distinguish himself there. Shiels, his earliest biographer, writes: 'far from appearing to possess a sprightly genius, [Thomson] was considered by his schoolmaster, and those which directed his education, as being really without a common share of parts'. He was, however, encouraged to write poetry by Robert Riccaltoun (1691–1769), a farmer, poet and Presbyterian minister; and Sir William Bennet (d. 1729), a whig laird who was a patron of Allan Ramsay. While some early poems by Thomson survive, he burned most of them on New Year's Day each year.
Thomson entered the College of Edinburgh in autumn 1715, destined for the Presbyterian ministry. At Edinburgh he studied metaphysics, Logic, Ethics, Greek, Latin and Natural Philosophy. He completed his arts course in 1719 but chose not to graduate, instead entering Divinity Hall to become a minister. In 1716 Thomas Thomson died, with local legend saying that he was killed whilst performing an exorcism. At Edinburgh Thomson became a member of the Grotesque Club, a literary group, and he met his lifelong friend David Mallet. After the successful publication of some of his poems in the "Edinburgh Miscellany" Thomson followed Mallet to London in February 1725 in an effort to publish his verse.
London, 1725–1727
In London, Thomson became a tutor to the son of Charles Hamilton, Lord Binning, through connections on his mother's side of the family. Through David Mallet, by 1724 a published poet, Thomson met the great English poets of the day including Richard Savage, Aaron Hill and Alexander Pope. Thomson's mother died on 12 May 1725, around the time of his writing ‘Winter’, the first poem of The Seasons. "Winter" was first published in 1726 by John Millian, with a second edition being released (with revisions, additions and a preface) later the same year.
By 1727, Thomson was working on "Summer", published in February, and was working at Watt's Academy, a school for young gentlemen and a bastion of Newtonian science. In the same year Millian published a poem by Thomson titled "A Poem to the Memory of Sir Isaac Newton" (who had died in March). Leaving Watt's Academy, Thomson hoped to earn a living through his poetry, helped by his acquiring several wealthy patrons including Thomas Rundle, the countess of Hertford and Charles Talbot, 1st Baron Talbot.
Later life, 1728–1748
He wrote "Spring" in 1728 and finally "Autumn" in 1730, when the set of four was published together as The Seasons. During this period he also wrote other poems, such as "To the Memory of Sir Isaac Newton", and his first play, Sophonisba (1730). The latter is best known today for its mention in Samuel Johnson's Lives of the English Poets, where Johnson records that one 'feeble' line of the poem – "O, Sophonisba, Sophonisba, O!" was parodied by the wags of the theatre as, "O, Jemmy Thomson, Jemmy Thomson, O!"
In 1730, he became tutor to the son of Sir Charles Talbot, then Solicitor-General, and spent nearly two years in the company of the young man on a tour of Europe.
On his return Talbot arranged for him to become a secretary in chancery, which gave him financial security until Talbot's death in 1737. Meanwhile, there appeared his next major work, Liberty (1734). This is a lengthy monologue by the "Goddess of Liberty", describing her travels through the ancient world, and then English and British history, before the resolution of the Glorious Revolution of 1688. In 1738 his tragedy Agamemnon was played at Drury Lane and the following year he wrote a prologue when Mallet's Mustapha was performed there.
In 1740, he collaborated with Mallet on the masque Alfred which was first performed at Cliveden, the country home of Frederick, Prince of Wales. Thomson's words for "Rule, Britannia!", written as part of that masque and set to music by Thomas Arne, became one of the best-known British patriotic songs – quite distinct from the masque which is now virtually forgotten. The Prince gave him a pension of £100 per annum. He had also introduced him to George Lyttelton, who became his friend and patron.
In later years, Thomson lived in Richmond upon Thames, and it was there that he wrote his final work The Castle of Indolence, which was published just before his untimely death on 27 August 1748. Johnson writes about Thomson's death, "by taking cold on the water between London and Kew, he caught a disorder, which, with some careless exasperation, ended in a fever that put end to his life". He is buried in St. Mary Magdalene church in Richmond.
A dispute over the publishing rights to one of his works, The Seasons, gave rise to two important legal decisions (Millar v. Taylor; Donaldson v. Beckett) in the history of copyright.
Thomson's The Seasons was translated into German by Barthold Heinrich Brockes (1745). This translation formed the basis for a work with the same title by Gottfried van Swieten, which became the libretto for Haydn's oratorio The Seasons. Some recordings of Haydn’s oratorio use Thomson’s original lyrics as well.
Memorials
Thomson is one of the sixteen Scottish poets and writers appearing on the Scott Monument on Princes Street in Edinburgh. He appears on the right side of the east face.
Thomson has a large memorial in Westminster Abbey's Poets' Corner, next to William Shakespeare and underneath Thomson's countryman, Robert Burns.
Thomson is the poet memorialised at Poets' Corner in Richmond Park's Pembroke Lodge Gardens. A bench sculpted by Richard Farrington, and known as "Poet's seat", is inscribed with lines by Thomson, who was living in Richmond at the time of his death. A wooden memorial plaque with an ode to Thomson by the writer and historian John Heneage Jesse was installed in 1851. The plaque was replaced by the Selborne Society in 1895 and by a re-gilded board in 2014.
King Henry's Mound, which is also in Richmond Park, has a seat inscribed with a few lines from The Seasons.
Editions
The four seasons, and other poems. By James Thomson. London: printed for J. Millan, near Scotland-Yard, White-Hall; and A. Millar, in the Strand, M.DCC.XXXV., 1735. [2];77,[3];64;72;79,[1]p., plates; 8⁰. (ESTC T83; Foxon T242; OTA K019862.000)
Patrick Murdoch (ed.), The Works of James Thomson, with his last corrections and improvements, prefixed by an account of his life and writings (Royal Quarto edition, A. Millar, London 1762); Dublin printing by John Exshaw, 1767; Murdoch's revised 4-volume edition of (A. Millar and T. Cadell, London 1768), with Lord Lyttelton's annotations, and 1772-3 edition (R. Clarke, Edinburgh 1772), (W. Bowyer, etc., London 1773) and subsequent versions.
Thomson, James & Bloomfield, Robert, The Seasons & Castles of Indolence / The Farmer's Boy, Rural Tales, Banks of the Wye, &c. &c., (London: Scott, Webster & Geary, 1842).
Gilfillan, Rev. George, Thomson's Poetical Works, with Life, Critical Dissertation, and Explanatory Notes, Library Edition of the British Poets (1854).
Thomson, James. The Seasons (A. Donaldson, Edinburgh 1774; J. Donaldson, London 1776).
Thomson, James. The Seasons, by ... A New Edition. Adorned with A Set of Engravings, from Original Paintings. Together with an Original Life of the Author, and a Critical Essay on the Seasons. by Robert Heron, (Perth: R. Morison, 1793).
Thomson, James The Seasons and Castle of Indolence Printed for J. and F.C. Rivington and the other proprietors, James Marsh, 1820
Thomson, James. Poems, edited by William Bayne, London : Walter Scott Publishing Co., [1900], (Series: The Canterbury poets).
Thomson, James. The Seasons, edited with introduction and commentary by James Sambrook, (Oxford: Clarendon Press, 1981) .
Thomson, James. Liberty, The Castle of Indolence and other poems, edited with introduction and commentary by James Sambrook, (Oxford: Clarendon Press, 1986) .
Bayne, William, Life of James Thomson, Edinburgh: Oliphant, Anderson and Ferrier, 1898, ("Famous Scots Series").
See also
List of abolitionist forerunners
References
Sources
External links
James Thomson at the Eighteenth-Century Poetry Archive (ECPA)
Selected Poetry of James Thomson (1700–1748), Representative Poetry On-line
Local History Notes: James Thomson (1700–1748), London Borough of Richmond upon Thames
1700 births
1748 deaths
Alumni of the University of Edinburgh
People of the Scottish Enlightenment
Scottish male poets
18th-century Scottish writers
18th-century Scottish poets
18th-century British male writers |
59233125 | https://en.wikipedia.org/wiki/R%C3%A4is%C3%A4nen | Räisänen | Räisänen is an eastern Finnish surname. Notable people with the surname include:
Yrjö Räisänen (1888–1948), Finnish politician
Tapio Räisänen (born 1949), Finnish ski jumper
Antti Räisänen (born 1950), Finnish scientist
Tomi Räisänen (born 1976), Finnish composer
Timo Räisänen (born 1979), Swedish musician
Meeri Räisänen (born 1989), Finnish ice hockey goaltender
Otso Räisänen (born 1994), Finnish freestyle skier
Finnish-language surnames |
27195160 | https://en.wikipedia.org/wiki/Varian%20Johnson | Varian Johnson | Varian Johnson (born in 1977) is an American writer, who writes contemporary young adult literature. He is the author of multiple novels including My Life as a Rhombus.
Biography
Johnson is a twin and the father of two daughters. He is also a member of The Brown Bookshelf, an organization that "is designed to push awareness of the myriad of African American voices writing for young authors".
Published works
A Red Polka Dot in a World Full of Plaid (2005)
Essence best seller list, March 2005
My Life as a Rhombus (2008)
Saving Maddie (2010)
Bank Street Best Children's Book, 2011
Open Mic: Riffs on Life Between Cultures in Ten Voices (2013), contributor
Things I'll Never Say: Stories About Our Secret Selves (2015), contributor
Been There, Done That: School Dazed (2016), contributor
The Great Greene Heist (2014)
Kirkus Reviews Best Book, 2014
ALA ALSC Notable Children's Books List, 2015
Bank Street Best Children's Book, 2015
To Catch a Cheat (A Jackson Greene Novel) (2016)
The Return (2016), Spirit Animals: Fall of the Beasts book 3
The Wildcat's Claw (2017), Spirit Animals: Fall of the Beasts book 6
Gabriela: Time for Change (2017), American Girl: Girl of the Year 2017 book 3
The Parker Inheritance (2018)
What Were The Negro Leagues? (2019) a Who HQ series book, Penguin Workshop
Twins (2020)
Playing the Cards You’re Dealt (2021)
Mister Miracle: The Great Escape (2022)
References
External links
Living people
1977 births
American male writers |
6749088 | https://en.wikipedia.org/wiki/The%20%241%2C000%2C000%20Reward | The $1,000,000 Reward | The $1,000,000 Reward is a 1920 American drama film serial directed by George Lessey and produced by Harry Grossman. This is now considered to be a lost film, as there are no available copies of it.
Cast
Lillian Walker as Betty Thorndyke
Coit Albertson as Morgan Spencer
Charles B. Middleton as William Russell
George Lessey as James Bradley (credited as George A. Lessey)
Joe Smith Marba as Kenwah (credited as Joseph Marba)
Leora Spellman as Valerie Kernan
Bernard Randall as Kip Van Hoan
William Pike as James Forsythe
Buck Connors (credited as George Connors)
Louise Hotaling
Ray Allen
Herbert Rawlinson as Man in suit
F.W. Stewart
See also
List of American films of 1920
List of film serials
List of film serials by studio
List of lost films
References
External links
1920 films
1920 drama films
American silent serial films
American black-and-white films
Lost American films
Films directed by George Lessey
Silent American drama films
1920 lost films
Lost drama films
1920s American films |
50247816 | https://en.wikipedia.org/wiki/Saka%20%E2%80%93%20The%20Martyrs%20of%20Nankana%20Sahib | Saka – The Martyrs of Nankana Sahib | Saka – The Martyrs of Nankana Sahib is a Punjabi historical film about 1921 Nankana Sahib massacre directed and written by Jagmeet Singh Samundri, starring Mukul Dev, Aman Dhaliwal, Oshin Brar.
Plot
The film is about a massacre (Saka) that happened during Sikh protests of 1920-21 in peaceful efforts to liberate Gurdwara Janam Asthan at Nankana Sahib.
Cast
Mukul Dev as Lachhman Singh Dharowali
Aman Dhaliwal
Oshin Brar
Dev Kharoud as Kehar Singh
Hardeep Gill
Stass Klassen as British governor of Lahore (Edward Douglas MacLagan)
Mahabir Bhullar as Mahant Narain Dass
Planning and Shooting
The set of Gurudwara Sahib was raised at cost of spreading over 2.5 acres at village Ucha Pind, Phagwara by a team from Mumbai. Shooting was completed within 45 days as it rained incessantly during April 2015.
Release
It was released worldwide on 8 April 2016. Shiromani Gurdwara Parbandhak Committee and team of film were angered at Central Board of Film Certification of India for giving 'A' certification to the film and at British Censors for '15 rating' to the film.
Reception
Box office
References
External links
2016 films
Films about massacres of Sikhs
Punjabi-language Indian films
2010s Punjabi-language films
Films set in 1921
Films set in Punjab, Pakistan
Films set in the British Raj |
12893472 | https://en.wikipedia.org/wiki/Alternanthera%20subscaposa | Alternanthera subscaposa | Alternanthera subscaposa, synonym Lithophila subscaposa, is a species of plant in the family Amaranthaceae. It is endemic to the Galápagos Islands.
References
subscaposa
Flora of the Galápagos Islands
Vulnerable plants
Taxonomy articles created by Polbot |
24820407 | https://en.wikipedia.org/wiki/Lansdown%20Guilding | Lansdown Guilding | Lansdown Guilding (9 May 1797 – 22 October 1831) was a theologian and naturalist. He is best known for his works on the flora and fauna of St Vincent in particular and on the Caribbean in general. He wrote numerous illustrated papers for journals of scholarly societies in England including the first descriptions of velvet worms and scale insects in the ground pearl family.
Guilding was born on 9 May 1797 in Kingstown, Saint Vincent and the Grenadines. He was one of six siblings, son of the Reverend John Guilding and his wife Sarah. In 1802, at the age of 5, he was sent to England, where he studied at Oxford University. In 1817, after receiving a B.A. degree, he returned to his home country. His father died in 1818, and he took up work as garrison chaplain and left for England in 1819. In 1821, Guilding travelled to England to marry Mary Hunt, daughter of the Rev. S. Hunt, rector of Wakerly and St. George's Church, Stamford. From 1824 to 1826 he disputed with Robert Herries for the right to payment for paupers' funerals. Herries claimed that Guilding had expunged the minutes of some meetings to change the vote of a vestry election, causing Herries to lose his position. Guilding stated that it was "just a misunderstanding”.
In 1818, Guilding was accepted as Fellow of the Linnean Society, and by 1820 he was corresponding with Joseph Dalton Hooker, Aylmer Bourke Lambert and other established scientists. Hooker wrote that Guilding was "an arrogant, demanding, ambitious, and often conceited individual, all too ready to ask for unusual favors". His first zoological paper was read at the Linnean Society and published in 1822. Guilding was a capable artist of plant and animal drawings. He prided himself on the accuracy of his work and his use of color. When his work was redrawn he criticized both the artist and the engraver. His book “An Account of the Botanic Gardens of the Island of St. Vincent” was published in Glasgow in 1825. Guilding was an excellent artist and engraver and he produced a "Table of Colours Arranged for Naturalists" in 1825 which may have been the first biological colour chart. This production was submitted to the Wernerian Natural History Society, where it was presented by the president, Professor Robert Jameson. He corresponded with Charles Darwin, providing him with notes on the natural history of the Caribbean region.
In 1826, Guilding published the first description of a member of the phylum Onychophora. He found what he thought was an unusual type of slug, and included it along with his Caribbean mollusks. He named this genus Peripatus (1826). He included an excellent watercolor painting of the specimen, and a mention to the defensive mechanism of sticky liquid squirts. A translation into English from Guilding's description, originally written in Latin, shows how he first classified the specimen in the Class Moluska, and how astonished he was for discovering a new species.
He was also among the first to describe scale insects of the ground pearl family, Margarodidae. Guilding's announced "Fauna" and "Pomona occidentalis" were never completed. The manuscripts were lost, together with his table of colors.
Guilding's first wife died "in childbed” on 15 November 1827, leaving five children behind. A year later he married Charlotte Lydia Melville, of St. George's, Grenada. In 1831 he went on vacation to Bermuda, where he died on 22 October. The cause of death was not recorded.
Bibliography
Guilding L. (1825). An Account of the Botanic Garden in the Island of St. Vincent.
Guilding L. (1825). "The natural history of Xylocopa teredo and Horia maculata". Transactions of the Linnean Society of London 14: 313-317. Table VIII.
Guilding L. (1825). "Description of a new species of Oncidium". [Read 4 November 1823.] Transactions of the Linnean Society of London 14: 322-324, table IX.
References
External links
Darwin correspondence database
Brief biography
Saint Vincent and the Grenadines people of British descent
English naturalists
1797 births
1831 deaths
English theologians
19th-century English Anglican priests
English engravers |
52110785 | https://en.wikipedia.org/wiki/Aquatics%20at%20the%201969%20Southeast%20Asian%20Peninsular%20Games | Aquatics at the 1969 Southeast Asian Peninsular Games | Aquatics at the 1969 Southeast Asian Peninsular Games included swimming, diving, and waterpolo events. The sports of aquatics were held in Rangoon, Burma. Aquatics events was held between 10 December to 13 December.
Swimming
Men's events
Women's events
Diving
Waterpolo
References
1969
1969 Southeast Asian Peninsular Games |
20435588 | https://en.wikipedia.org/wiki/Art%20Herchenratter | Art Herchenratter | Arthur Jacob Herchenratter (November 24, 1917 — August 1, 1989) was a Canadian ice hockey player who played 10 games in the National Hockey League with the Detroit Red Wings during the 1940–41 season. The rest of his career, which lasted from 1938 to 1950, was spent in various minor leagues.
Career statistics
Regular season and playoffs
External links
1917 births
1989 deaths
Canadian ice hockey right wingers
Detroit Red Wings players
Houston Huskies players
Ice hockey people from Ontario
Indianapolis Capitals players
Kitchener Greenshirts players
New Haven Eagles players
Omaha Knights (AHA) players
Ontario Hockey Association Senior A League (1890–1979) players
Sportspeople from Kitchener, Ontario
Springfield Indians players |
63447010 | https://en.wikipedia.org/wiki/Morgan%20Phillips%20%28sport%20shooter%29 | Morgan Phillips (sport shooter) | Morgan Phillips (born 27 March 1998) is the University of Memphis head rifle coach (circa 2021). She was an American NCAA sports shooter. She competed in the 50 meter rifle prone and 50 meter rifle three positions events at junior level at the 2018 ISSF World Shooting Championships, where she won four medals, and the 2018 ISSF Junior World Cup, where she won three.
She also won the NCAA Smallbore Championship at the 2017 and 2018 NCAA Rifle Championships, while studying at West Virginia University.
References
External links
1998 births
Living people
American female sport shooters
West Virginia Mountaineers rifle shooters
People from Salisbury, Maryland
21st-century American women
20th-century American women |
72203695 | https://en.wikipedia.org/wiki/Ruslan%20Panteleymonov | Ruslan Panteleymonov | Ruslan Panteleymonov (2 August 1983 – 2 September 2022) was a Ukrainian-born artistic gymnast representing Great Britain and England internationally, and an international diving coach after retirement. He was part of the Great Britain team to win gold at the 2012 European Championships, and was reserve for the bronze medal-winning Great Britain team at the 2012 Summer Olympics.
Personal life
Born in Kharkiv, Ukraine, Panteleymonov spent a childhood in Ukrainian gymnastics. With his coach Alex Shyryayev he was part of the Ukrainian squad. He moved to England in 2001 to join his coach who was by then coaching at Hinckley Gymnastics Club in England. Ruslan also worked part time as a coach and gained UK citizenship some years later which allowed him to transfer allegiance and compete for Great Britain.
He excelled in the Great Britain team that won the nation's first ever team gold at the 2012 European Championships in Montpellier. Panteleymonov’s 16.1 vault score, in particular, moved Britain into first place ahead of Russia, in what turned out to be a crucial turning point in the competition. Ruslan was travelling reserve for the London Olympic Games.
After retirement, Panteleymonov joined British Swimming as a gymnastics coach for the diving team. He worked with British divers in the build-up to their record-breaking performances at the 2016 Olympic Games in Rio de Janeiro and the 2020 Olympic Games in Tokyo, as well as World Championship and European Championship campaigns.
Death
British Gymnastics and British Swimming reported Ruslan's death in September 2022. He was 39 years old, survived by a wife and a son.
References
1983 births
2022 deaths
Sportspeople from Kharkiv
Sportspeople from Gravesend, Kent
British male artistic gymnasts
Ukrainian male artistic gymnasts
Gymnasts at the 2012 Summer Olympics
Ukrainian emigrants to the United Kingdom
European champions in gymnastics
21st-century British people
21st-century Ukrainian people |
6157958 | https://en.wikipedia.org/wiki/Committee%20of%20Interns%20and%20Residents | Committee of Interns and Residents | The Committee of Interns and Residents (CIR) is the largest housestaff union in the United States, representing more than 22,000 interns, residents, and fellows in California, Florida, Illinois, Massachusetts, New Jersey, New York, New Mexico, and Washington, D.C. CIR contracts seek to improve housestaff salaries and working conditions as well as enhance the quality of patient care. CIR was founded in 1957.
History
CIR was founded by interns and residents in New York City's public hospitals. In 1958, CIR achieved the first collective bargaining agreement for housestaff anywhere in the U.S. By the mid-1960s, CIR had established the only housestaff-administered benefit plan. By 1969-70, members in the private, or voluntary, sector started organizing and joining CIR.
In a landmark achievement in 1975, CIR won contractual limits for on-call schedules of one night in three. In the late 1980s and early 1990s, CIR successfully negotiated innovative maternity leave clauses, won provisions for pay for housestaff covering for absent colleagues, and in 1989 helped shape New York State's regulations that set maximum work hour limits for housestaff. Since then, CIR members have negotiated hours limitations and program security clauses in Miami, Los Angeles, and Boston.
In May 1997, CIR affiliated with the 1.6 million-member Service Employees International Union (SEIU), which represents over 1 million healthcare workers nationwide. Its affiliation with SEIU has increased its strength wherever CIR represents housestaff.
Mission
According to its website, CIR's mission is to be "the national voice for physicians-in-training, uniting and empowering them to create a better and more just healthcare system for patients and healthcare workers and to improve training and quality of life for resident physicians, fellows, and their families."
References
Further reading
Ludmerer, Kenneth M. Time to heal: American medical education from the turn of the century to the era of managed care. Oxford University Press, 1999.
Mullan, Fitzhugh. White Coat, Clenched Fist: The Political Education of an American Physician. University of Michigan Press, 2006.
Peterkin, Allen. Staying human during residency training: how to survive and thrive after medical school. University of Toronto Press, 2008.
Institute of Medicine (U.S.). Committee on Optimizing Graduate Medical Trainee (Resident) Hours and Work Schedules to Improve Patient Safety. Resident duty hours: enhancing sleep, supervision, and safety (Google eBook).
Healthcare trade unions in the United States
Medical and health student organizations
Service Employees International Union
Medical and health organizations based in New York (state)
Trade unions established in 1957 |
53883188 | https://en.wikipedia.org/wiki/Trevor%20Richards%20%28musician%29 | Trevor Richards (musician) | Trevor Hamilton Edward Richards (born 29 August 1945, Bexhill-on-Sea) is an English jazz drummer.
Richards played in Germany from 1963–1966, then went to New York City, where he studied briefly with Zutty Singleton. He went to New Orleans and played in jazz clubs until 1968, when he returned to England. Later that year, he drummed for the Olympia Brass Band on a European tour. He would spend much of the 1970s touring Europe, playing with Louis Nelson, Alton Purnell, Freddie Kohlman, Albert Nicholas, and Benny Waters. In the 1980s he worked extensively with Art Hodes as well as with Ralph Sutton and Jacques Gauthé. He returned to New Orleans in 1982 and played with Clive Wilson; Richards eventually led Wilson's ensemble for recordings and a tour of Asia. He has recorded for the labels Stomp Off and L+R among others.
References
"Trevor Richards". The New Grove Dictionary of Jazz. 2nd edition, ed. Barry Kernfeld.
English jazz drummers
1945 births
Living people
Olympia Brass Band members |
20240511 | https://en.wikipedia.org/wiki/Chris%20Terrill | Chris Terrill | Chris Terrill is a British anthropologist, adventurer, broadcaster, author and filmmaker.
Biography
Born in Brighton, Sussex, in 1952, Terrill attended Brighton College 1965–1970, and then went to Durham University, where he gained a joint-honours degree in Geography and Anthropology. Between 1976 and 1977 he lived with the remote Acholi Tribe of Southern Sudan where he carried out doctoral research on the impact of civil war on the tribal society before taking up the post of head of geography at Rendcomb College in Gloucestershire. In 1983, he left teaching to become a full-time professional anthropologist working for the International Disaster Institute and the UN in Geneva and throughout the famine-gripped and war-ravaged areas of Africa. Later he moved into broadcasting, after being offered a job immediately following a feature interview to the BBC African Service. He changed careers and became a producer for the BBC World Service specialising in African affairs. After five years in radio, in which he engaged in current affairs, documentaries and drama, Terrill joined BBC television as a documentary producer, making investigative documentaries and observational films and series about communities all over the world.
As a programme maker, Terrill has always favoured anthropological methodology, particularly participant observation, rather than more conventional documentary making techniques. As a Fellow of the Royal Anthropological Institute and the Royal Geographical Society, Terrill is regarded as a practising anthropologist/geographer who uses film as his primary research tool and recording medium in the field.
He won an Emmy for outstanding investigative journalism for a film called Ape Trade. This Inside Story Special (BBC1) exposed the major gangs smuggling endangered orangutans to illegal markets in Taiwan, the US and Russia. Other notable films/series he made for the BBC were Subway, Yellow Line, Race Game, Miami Wild, HMS Brilliant, Alison's Last Mountain, Beloved Country, Soho Stories (see below), The Cruise, Jailbirds, Tito's Story, Through the Eyes of the Old and The Ship. After 20 years at the BBC, and with over 100 prime time films and numerous awards to his name, he left the corporation in 2003 after being headhunted by Elisabeth Murdoch for her newly set up Shine company. For Shine Terrill made several prime time music and arts films and a major series about the Royal Navy (Shipmates BBC1). Two years later Terrill set up his own company, Uppercut Films, and began to specialise in military and high adventure documentaries—though always concentrating on communities/groups and their internal dynamics. In 2007, he documented and participated in the rigorous eight months training with the Royal Marine Commandos after which he followed the newly qualified recruits to the front line in Afghanistan for their first taste of real war. Terrill is the only civilian (and, at 55, the oldest person) to complete and pass all four commando tests for which he was awarded the iconic green beret.
Terrill produces his own camerawork and sound recording without a film crew. This "lone wolf" technique is a hallmark of his work. Using the new digital technology, he was the first mainstream filmmaker to experiment as a self-shooting/self-recording director in the mid 1990s when he made Soho Stories for the BBC; a seminal series that won him the Royal Television Society Award for Innovation. This series which explored London's famous and flamboyant Soho district, was one of the first to be dubbed docu-soap in its style of filmmaking. Terrill then went on to refine his techniques on prime time series such as The Cruise (BBC1), Jailbirds (BBC1), Through the Eyes of the Old (BBC1), The Ship (BBC2), Shipmates (BBC 1) and two feature documentary specials on Charlotte Church—Spreading Her Wings (BBC1) and Confessions of a Teen-angel (ITV1). Commando: On the Front Line (ITV1)—an account of Royal Marine Commandos fighting in Afghanistan was followed by Nature's Fury (ITV1) a trilogy on the world's greatest storms and their impact on communities.
In 2009 Terrill made a series on the Theatre Royal, Haymarket, London, called Theatreland for Sky Arts. This was an intimate portrait of theatre people at work and featured Ian McKellen, Patrick Stewart, Simon Callow, Ronald Pickup and Anna Friel. In the same year he made a two-part film series about Royal Marines, badly injured in Afghanistan, attempting to climb in the high Himalayas (Wartorn Warriors—Sky1). In 2010 he spent six months on in the Caribbean filming counter narcotics operations as well as humanitarian disaster relief during the hurricane season (Royal Navy: Caribbean Patrol for Channel Five and National Geographic). In 2011 Terrill returned to working with the Royal Marines when he joined 42 Commando in the dangerous Nad e Ali (north) district of Helmand Province. This was for a 6-part series commissioned by Channel Five entitled "Royal Marines: Mission Afghanistan" transmitted in January/February 2012.
In late 2011 Terrill embarked on a project that brought together the military and the theatre. The Theatre Royal, Haymarket (where Terrill had filmed Theatreland in 2009) put on a play using injured soldiers and marines as the actors, singers, and dancers. The play, written by the poet Owen Sheers and based on the experiences of the soldiers mostly in Afghanistan, was called The Two Worlds of Charlie F and was performed on 22 January 2012. Terrill's feature-length film entitled Theatre of War, documenting the preparation of the play, was shown on BBC1's Imagine strand and was nominated for a prestigious Grierson Award in the best arts documentary category.
In 2014 Terrill's current affairs film for the BBC: Marine A: Criminal or Casualty of War? won the Evcom Clarion Award for ethics in journalism.
In 2015 Terrill became a Fellow of the Maritime Foundation and was presented with a Lifetime Achievement Award.
Throughout 2016 and 2017 Terrill was embedded in the ship's company of to make a major series for the BBC about the largest warship ever built for the Royal Navy, "Britain's Biggest Warship". He returned to HMS Queen Elizabeth in 2018 and spent four months at sea to make a second series, "Britain's Biggest Warship: Goes to Sea". This focuses on the marrying of the ship with the F35 Lightning Stealth Fighter off the eastern seaboard of the US.
In January 2018 Terrill was conferred Doctor of Science at the Winter Congregation of Durham University "for pioneering work in anthropology and filmmaking"
For seven months in 2021 Terrill was back on HMS Queen Elizabeth for her first operational deployment to the South China Sea. This was to film for a new six part series for the BBC called Strike Carrier (working title) - currently in post production
Terrill lectures widely on film making techniques – especially on working solo in the field. He holds regular workshops at the London Film School.
Personal life
In 1999 Terrill was engaged for a brief period to former glamour model Heather Mills. He proposed to her on a fishing boat whilst sailing up the Mekong River in Cambodia, where they were making a film about landmines.
In 2009 Terrill married the BAFTA award-winning filmmaker Christine Hall.
On 9 February 2013 Terrill received a full apology in open court from News UK for repeatedly hacking his phone in 2005/06. They also paid undisclosed but substantial damages plus costs.
Terrill, who describes himself as a 'devout Atheist', is a dedicated animal advocate and activist. He is also an accomplished amateur athlete, specialising in ultra running and boxing.
Books published
Filmography
Honours, awards and nominations
Honours
Awards
Nominations
Public Service Interests
Notes
References
External links
Commando: On The Front Line
Jon Stratford—PTI during filming of Commando: On The Front Line
http://www.uppercutfilms.co.uk
English film producers
English film directors
English cinematographers
English television producers
English television directors
English writers
British investigative journalists
People educated at Brighton College
Alumni of Collingwood College, Durham
British war correspondents
1952 births
Living people |
19807669 | https://en.wikipedia.org/wiki/Lingyuan%20%28disambiguation%29 | Lingyuan (disambiguation) | Lingyuan may refer to:
Lingyuan, Liaoning, city in Liaoning, China
Lingyuan Subdistrict, in Jinjiang, Fujiang, China
Chu Lingyuan (褚靈媛) (384–436), last empress of Jin Dynasty in China
Lingyuan, Wenquan, Yingshan County, Huanggang, Hubei |
60690595 | https://en.wikipedia.org/wiki/Noemi%20Ryhner | Noemi Ryhner | Noemi Ryhner (born 24 April 2000) is a Swiss ice hockey player and member of the Swiss national team, currently playing in the Swedish Women's Hockey League (SDHL) with Leksands IF Dam.
Playing career
Ryhner made her Swiss Women's Hockey League A (SWHL A) debut with the ZSC Lions Frauen in 2015. After winning the 2016 and 2017 SWHL A championships with the team, she transferred to SC Reinach Damen in 2017. After scoring 41 points in 38 games with Reinach over three years with the club, she transferred to the Ladies Team Lugano for the 2020–21 season.
International
She represented Switzerland in four IIHF U18 Women's World Championships, from 2015 to 2018, before making her senior national team debut at the 2019 IIHF Women's World Championship. She was due to play for Switzerland at the 2020 IIHF Women's World Championship, before it was cancelled because of the COVID-19 pandemic. In August 2020, it was announced she was one of twelve players selected by the Swiss Ice Hockey Federation to take part in the new national team Swiss Women's Hockey Academy.
References
External links
2000 births
Living people
Ice hockey players at the 2016 Winter Youth Olympics
Ice hockey players at the 2022 Winter Olympics
Leksands IF Dam players
HC Lugano players
Luleå HF/MSSK players
Olympic ice hockey players of Switzerland
People from Zug
Sportspeople from the canton of Zug
Swiss women's ice hockey forwards |
44251501 | https://en.wikipedia.org/wiki/Monster%20Strike | Monster Strike | is a mobile Japanese role-playing physics game with elements of puzzle, strategy and cooperative multiplayer. It is developed by XFLAG for iOS and Android platforms. The game was created by former Capcom game designer Yoshiki Okamoto. In Japan, its name is often shortened to . The game can be summed up as a cross between Nintendo's Pokémon and Capcom's Metal Walker; the former in that it centers around monster collecting and the latter in that battles take place using catapult mechanics.
By October 2018, the game grossed over worldwide, surpassing Puzzle & Dragons to become the highest-grossing mobile app of all time. The game has grossed a total revenue at least .
A more traditional role-playing game of Monster Strike was released for the Nintendo 3DS in December 2015. The game was adapted into an anime series in 2015. An anime film adaptation titled Monster Strike The Movie was released on December 10, 2016. A second anime film, titled Monster Strike the Movie: Sora no Kanata, was released on October 5, 2018, in Japan. A third anime film titled Monster Strike The Movie: Lucifer Zetsubō no Yoake was slated to be released in June 2020 but it has since been delayed due to the COVID-19 pandemic.
Gameplay
Monster Strike has been compared to competitor Puzzle & Dragons and other freemium puzzle games in that the player battles waves of monsters to collect them, fuse them, and evolve them and earn gold and other items through gameplay to get stronger monsters, and build a list of friends with monsters to use as well. What sets it apart is that rather than being a tile-matching video game, the player aims and flicks their monsters around on a field, similar to billiards/pool, bumping off of walls and enemies to perform damage. Colliding the currently in play monster with any of the allied monsters activates that set off explosions, energy beams, or projectiles to perform damage on opponent monsters. Every turn, numerous counters on enemy monsters count down to launch various attacks that deal damage or add hazards to the field. Player monsters often have other unique passive abilities to counter these hazards, or may have passive abilities that cause greater damage to particular kinds of enemy monsters. Some monsters also have gauges that when it is launched at the right time, it activates a secondary gauge ability as well as slightly increases their attack strength. Each of the player's monsters also has its own counter, which allows the player to activate the monster's attack to perform more damage. The final battle of each Quest Mission features a Boss monster that has a moving critical hit point. Monster Strike also offers co-operative play for up to 4 players.
Quests in the game are divided into Solo and Co-Op and then Normal and Event. Event Quests are only available for limited periods of time and often feature rare monsters that are powerful or that can be used in the Ascension of other monsters. Completing the levels of a quest awards the player monsters, catalysts, and coins. In Normal Quests, for completing the penultimate level in the quest, players are awarded a rare catalyst and for completing the final level, they are awarded an Orb as well as unlocking a Bonus Level featuring the experience-increasing or high-selling turtle monsters. A Mission Log is also given to players to reach certain goals in Quests to win other Catalysts, Orbs, or experience-increasing monsters. A third set of Quests are available in the Temple of Heroes. Clearing any of these awards the player that gives one of the player's monsters an additional stat bonus. Initially, only certain Hatcher monsters could have an Ableberry. Later, the ability for rare Event Quest monsters to have Ableberries was added, but only if the player has Max Luck on two copies of the same monster. A Tower of Champions event is also occasionally run in Japan, providing an increased challenge for players to win rare monsters and prizes. A similar event was held in the North American version of the game for Christmas 2015.
Each monster has its own HP, Attack, and Speed statistics. The player's three monsters' HP and their friend or helper's monsters' HP are combined for a total HP. Attack determines how much damage the player's monster does to enemy monsters and Speed determines how fast (how much distance) the monster travels in a single turn. These values are increased by fusing monsters together to gain experience, or using special stat-only increasing monsters. There is also a value, symbolized by a four-leaf clover, that determines the possibility of obtaining bonus prizes at the end of a Mission. Luck can only be increased by fusing two of the same monsters together, or monsters in the same evolutionary line; fusing two Red Smydras or a Red Drake and a Red Smydra will both cause Luck to increase. An additional Luck Skill was added to the game, allowing certain monsters to either have a critical hit or a shield to prevent damage on one turn.
After raising a monster to its maximum level, the player can them through the use of . Players can also their monsters into even more powerful forms through the use of other monsters with specific Luck levels. is a combination of the two evolutions, giving the monster a second tier to their Strike Shot and a second slot for an Ableberry.
The game also features that the player spends either Friend Points (earned through choosing another player's monster to complete a level) for fairly common monsters or Orbs for rarer monsters. The main Hatcher cycles through a series of different sets of monsters that have an increased availability, with the rarest found during the events. The Friend Hatcher is sometimes used for giving out rare Event monsters for collaborations, such as with Line Corporation and Weekly Shōnen Jump in Japan. The Japanese edition of the game has also featured a special Hatcher to commemorate the release of Godzilla requiring special Godzilla Sharls to use it. Collaborations have also been made with Lawson's convenience store chain, Monster Hunter Big Game Hunting Quest, Bakusō Kyōdai Let's & Go!!, Game Walker, Parasyte, Teenage Mutant Ninja Turtles, Rebuild of Evangelion, Love Live! Sunshine!! and Ultraman.
The game has an in-game store to purchase Orbs that are used to continue lost Missions, expand the number of the player's available saved monsters, restore Stamina used to play Missions, or use them in the game's Hatcher to earn powerful and rare monsters.
Development
The game was created by former Capcom game designer Yoshiki Okamoto. Monster Strike was originally released in Japan in September 2013, and by November 2013 it was credited with saving Mixi, originally a social media network, under the XFLAG brand, after the app became popular in the iOS App Store. In September 2014, it was announced that a North American version and a South Korean version would be released. South Korean support ended on November 30, 2016, while North American support ended on August 1, 2017.
Music
A theme song for Monster Strike titled was written by Nagae Kuwabara (lyrics) and Riichiro Kuwabara (composition) and performed by Hironobu Kageyama. Kageyama performed it live for the first time at the Monster Strike first anniversary event at the Nico Nico Douga live house nicofarre on October 25, 2014, and the song was later released for sale on October 29.
Reception
Critical reception
With the English language version's release, a reviewer for Android Authority said that the game was fun, but similar to other games on the market, and had concerns about the length of the game's tutorial levels. On Pocket Gamer, the reviewer found the game not challenging, as there did not seem to be any strategy, and as it is easy to earn Orbs (the premium currency), he could easily use the Hatcher to get better monsters, resulting in just a wait for the Stamina to refill and fuse monsters, until you run out of gold to fuse and space in the Monster Box.
Commercial performance
During JulySeptember 2014, the game grossed () in content revenue, about 90% of Mixi's total income for the quarter. The game's revenue increased to () in the next quarter, OctoberDecember 2014. It overtook Puzzle & Dragons as Japan's highest-grossing mobile app in late 2014, and its revenues exceeded () per quarter during JanuaryMarch 2015. By March 2015, Monster Strike had been downloaded more than 30 million times and had daily revenues of $3.8 million. During AprilJune 2015, the game's revenue increased to () per quarter. By June 30, 2015, daily revenues reached $4.2 million. During AprilDecember 2015, the game grossed approximately (), roughly 90% of Mixi's sales during the period.
It was the highest-grossing mobile game of 2016, earning a revenue of $1.3 billion for the year, more than Pokémon Go and Clash Royale. Monster Strike earned another in 2017, when it was the year's third highest-grossing mobile game, behind Arena of Valor and Fantasy Westward Journey. In Japan, the game grossed () between January 2017 and October 3, 2017. By May 2018, the game had over 45million players worldwide.
The game's popularity has led to a partnership with Sumitomo Mitsui Banking Corporation to issue VISA credit cards in Japan in 2015.
By October 2018, the game grossed over worldwide, surpassing Puzzle & Dragons to become the highest-grossing mobile app of all time. The game grossed a further () in Japan during 2019, bringing the game's total revenue to at least . It was the world's second top-grossing mobile game during the 2020 New Year period, behind only fellow JRPG title Fate/Grand Order.
Nintendo 3DS game
An RPG version of Monster Strike for the Nintendo 3DS was released in Japan on December 17, 2015. It features characters and stories introduced in the anime. Characters based on Japanese YouTubers Tomotake "Max" Murai, former CEO of Japanese iPhone news and reviews site AppBank, and beatboxer Hikakin, who both do Let's Play videos of Monster Strike, are featured in the game as NPCs.
Before the launch of the game, XFLAG announced that they have shipped over one million copies of the game. The game debuted in Japan at the No.1 spot in the weekly sales chart based on figures by Media Create, selling a total of 437,903 copies, and dethroning Monster Hunter Generations after a three-week streak in the top spot.
Anime
A web anime adaptation of Monster Strike premiered on October 10, 2015, on YouTube. The series' ending theme is a cover of Queen's "We Will Rock You" performed by Japanese vocalist Gloria.
A second season of Monster Strike has been announced and premiered on April 1, 2017. On YouTube, the anime series had been watched 100million times by August 2016, and over 200million times as of June 2017.
The Monster Strike anime got its first spin-off on May 3, 2017, with the A Rhapsody Called Lucy -The Very First Song- OVA episode. This leads into the MSonic! D'Artagnyan's Rise to Fame special mini-series that premiered on June 14, 2017. Both A Rhapsody Called Lucy and MSonic! are set in a separate continuity from the main Monster Strike anime.
Localization
Mixi released an English version of Monster Strike for North American and Australian markets in 2014. It was marketed on online websites such as on Facebook. However, Mixi ceased marketing in August 2016, with English eventually being shut down in August 2017 due to both competition in those markets.
See also
Puzzle & Dragons
Puzzle & Dragons X
Monster Strike (anime)
Monster Strike The Movie
References
External links
Action-adventure games
Action video games
Android (operating system) games
Esports games
Fantasy anime and manga
Fantasy video games
Free-to-play video games
Fiction about monsters
Gacha games
IOS games
Video games about mecha
Mass media franchises
Multiplayer video games
Video games about robots
Science fantasy video games
Science fiction video games
Spy video games
Superhero video games
Ubisoft games
Video games adapted into television shows
Video games adapted into films
Video games developed in Japan
Video game franchises
Video game franchises introduced in 2013
Video games scored by Hideki Sakamoto
Video games set in Asia
Video games set in Europe
Video games set in the future
Video games set in Japan
Video games set in London
Video games set in Tokyo
Video games set in the United Kingdom
Works about legendary creatures |
151848 | https://en.wikipedia.org/wiki/Human%20intelligence%20%28intelligence%20gathering%29 | Human intelligence (intelligence gathering) | Human intelligence (abbreviated HUMINT and pronounced as hyoo-mint) is intelligence gathered by means of interpersonal contact, as opposed to the more technical intelligence gathering disciplines such as signals intelligence (SIGINT), imagery intelligence (IMINT) and measurement and signature intelligence (MASINT).
NATO defines HUMINT as "a category of intelligence derived from information collected and provided by human sources." HUMINT, as the name suggests, is mostly done by people rather than any technical means, and is commonly provided by covert agents and spies. For instance, Oleg Penkovsky was a Soviet military intelligence (GRU) colonel who served as a source to the UK and the United States by informing them of the precise knowledge necessary to address rapidly developing military tensions with the Soviet Union. A typical HUMINT activity consists of interrogations and conversations with persons having access to information.
The manner in which HUMINT operations are conducted is dictated by both official protocol and the nature of the source of the information. Within the context of the U.S. military, HUMINT activity may involve clandestine activities, however these operations are more closely associated with CIA projects. Both counterintelligence and HUMINT include clandestine HUMINT and clandestine HUMINT operational techniques.
See also
97E, (ninety seven echo) the Military Occupational Specialty code designating a human intelligence collector in the US Army
Document Exploitation
Intelligence collection management
References
Intelligence gathering disciplines |
36618731 | https://en.wikipedia.org/wiki/1956%20Chim%20earthquake | 1956 Chim earthquake | The 1956 Chim earthquake was a destructive multiple-shock event that occurred on March 16 in Lebanon along a strand of the Dead Sea Transform (DST) fault system. The epicenter was located in the south of Lebanon in the Chouf District. Six thousand homes were destroyed and another 17,000 were damaged. The number of persons killed was 136.
Tectonic setting
The DST is a long transform fault that runs in a mostly north-south direction from the northern end of the Red Sea along the Jordan Rift Valley to the Taurus Mountains complex in southern Turkey. The left-lateral fault zone marks the boundary of the Arabian Plate and the Sinai-Levantine block and consists of multiple parallel faults. As the fault moves through Lebanon and Syria the fault trace follows a restraining bend and splits into several strands that include the Serghaya, Rachaya, and Roum faults, as well as the prominent Yammouneh fault.
Earthquake
The Roum fault runs for a length of between the Hula basin the Awali river and is the westernmost strand of the fault system in that area. A paleoseismic trench investigation revealed that it may have been the source of the twin-shock event.
The twin shocks were separated by less than fifteen minutes with the first event occurring at 19:32 and the second event at 19:43 hours. The initial shock was estimated to measure ( = 5.3) and the second event was rated ( = 5.5).
See also
List of earthquakes in 1956
List of earthquakes in the Levant
References
1956 in Lebanon
1956 Chim
1956 earthquakes |
15886771 | https://en.wikipedia.org/wiki/Saint-Martin%2C%20Meurthe-et-Moselle | Saint-Martin, Meurthe-et-Moselle | Saint-Martin () is a commune in the Meurthe-et-Moselle department in north-eastern France.
See also
Communes of the Meurthe-et-Moselle department
References
Saintmartin |
2027941 | https://en.wikipedia.org/wiki/Steve%20Larmer | Steve Larmer | Steven Donald Larmer (born June 16, 1961) is a Canadian former professional ice hockey forward. He is the brother of Jeff Larmer.
Career
As a youth, Larmer played in the 1974 Quebec International Pee-Wee Hockey Tournament with a minor ice hockey team from Peterborough, Ontario.
Steve Larmer played in the NHL for the Chicago Blackhawks and New York Rangers and was known as one of the NHL's best power forwards of that era. He won the 1983 Calder Memorial Trophy as well as being named to the NHL All-Rookie Team that year. From 1982 to 1993, Larmer played in 884 consecutive games for the Blackhawks, an NHL record for most consecutive games played with the same team, and the third longest consecutive-games streak in league history at that time. He had a chance at breaking Doug Jarvis' record for consecutive games played but a contract dispute at the beginning of the 1993–94 officially ended his streak. The impasse was resolved by Larmer being traded to the New York Rangers, who would go on to win the Stanley Cup that same year. Larmer was selected to play in Pittsburgh in the 1990 All-Star Game, and in Chicago's 1991 All-Star Game as well. In the 1990-91 season he finished 5th in the voting for NHL league MVP. Larmer was great at both ends of the ice as he received Frank J. Selke Trophy votes on five occasions (1989-17th, 1991-3rd, 1992-8th, 1993-10th, 1994-13th) as best defensive forward in the league. He received votes for the Lady Byng Memorial Trophy on five occasions. He won a Stanley Cup with the Rangers in 1994, where he served as alternate captain, and scored his 1,000th point and played in his 1,000th game in 1994–95, his final season.
Larmer was a member of the 1991 Canada Cup team for Canada and played on team's top line with Wayne Gretzky where Larmer led the entire competition in goals (6) and ranked second in points (11) behind only Gretzky.
Career statistics
Regular season and playoffs
International
Awards and achievements
Individual awards
Calder Memorial Trophy – 1983
NHL All-Rookie Team - 1983
1990 NHL All-Star
1991 NHL All-Star
Team awards
1982 Calder Cup Champion with New Brunswick Hawks
1991 Canada Cup Gold Medalist with Team Canada
1991 Silver Medalist with Team Canada
1994 Stanley Cup Champion with New York Rangers
NHL accolades
Led NHL in Games Played for 11 Consecutive Seasons (1982-83 - 1992-1993)
Led NHL in Shooting % with 31.3% (1990–91)
Top 10 in Goals (1984–85)
Top 10 in Assists (1986–87)
Top 10 in Points (1990–91)
3 time Top 10 in Shorthanded Goals (1987–88) (1992–93) (1993–94)
4 time Top 10 in Power-Play Goals (1984–85) (1987–88) (1988–89) (1990–91)
2 time Top 10 on Plus/Minus (1982–83) (1990–91)
2 time Top 10 in Game Winning Goals (1982–83) (1990–91)
3 time Top 10 in Hat Tricks (1982–83) (1991–92) (1992–93)
Top 10 in Shooting % (1984–85)
5 times (+20 Plus/Minus)
9 times (30+ Goals)
5 times (40+ Goals)
10 times (40+ Assists)
3 times (55+ Assists)
11 times (70+ Points)
9 times (75+ Points)
7 times (80+ Points)
3 times (90+ Points)
(100+ Points)
9 Hat Tricks (Regular Season)
NHL records
Most Game Winning Goals by a Rookie in a Single Season (9)
Most Consecutive Games Played by a Right Winger in Regular Season History (884)
See also
List of NHL players with 100-point seasons
References
Kreiser, John and Friedman, Lou (1996), "The New York Rangers", Sports Publishing LLC, ,
External links
1961 births
Living people
Calder Trophy winners
Canadian ice hockey right wingers
Chicago Blackhawks draft picks
Chicago Blackhawks players
Ice hockey people from Ontario
National Hockey League All-Stars
New Brunswick Hawks players
New York Rangers players
Niagara Falls Flyers players
Peterborough Petes (ice hockey) players
Sportspeople from Peterborough, Ontario
Stanley Cup champions |
10785372 | https://en.wikipedia.org/wiki/Rod%20Buskas | Rod Buskas | Rod Dale Buskas (born January 7, 1961) is a Canadian former professional ice hockey defenceman who spent 11 seasons in the National Hockey League. A hard-nosed physical defender, Buskas is best known for his time with the Pittsburgh Penguins, where he was the club's all-time leader in penalty minutes at the time of his departure in 1990.
Early life
Buskas was born on January 7, 1961, in Wetaskiwin, Alberta, and was raised in Medicine Hat, Alberta.
Playing career
Buskas was selected in the 6th round (112th overall) of the 1981 NHL Entry Draft by the Penguins after a solid junior career with the Medicine Hat Tigers. After some seasoning in the minors, he made his NHL debut near the start of the 1982–83 season, and finished the year with 4 points and 102 penalty minutes in 41 games.
After another season split between Pittsburgh and the minors, Buskas established himself as a regular for the Penguins in 1984–85, and was a fixture on the club's blueline for the next five seasons. In 1986–87, he had his best offensive season, finishing the year with 3 goals and 15 assists for 18 points. In 1987–88, he led the Penguins with a career-high 206 penalty minutes, and midway through the 1988–89 season he broke Bryan Watson's club record of 872 penalty minutes. While the Penguins finished consistently near the bottom of the league for most of the 1980s, the maturing of superstar Mario Lemieux finally saw the team reach the playoffs in 1989, and Buskas appeared in the first 10 NHL playoff games of his career.
At the start of the 1989–90 campaign, Buskas was dealt to the Vancouver Canucks for a draft pick. However, he appeared in only 17 games for the Canucks before breaking his ankle, requiring surgery. While recovering, he was traded back to Pittsburgh, and he appeared in 6 more games for the Penguins late in the season. He would leave Pittsburgh for good at the start of the 1990–91 season, when he was selected by the Los Angeles Kings in the NHL Waiver Draft. At the time, he was Pittsburgh's all-time leader in penalty minutes with 959, although that record would later be broken by Troy Loney and is now held by Kevin Stevens.
Buskas spent a year in Los Angeles, recording 3 goals and 11 points along with 182 penalty minutes in 57 games, before being dealt to the Chicago Blackhawks early in the 1991–92 season. Now a sparingly-used depth defender, he finished the year with 4 assists in 47 games between Los Angeles and Chicago. That season's playoffs would prove to be one of the highlights of his career, as Chicago reached the Stanley Cup finals before losing to his former team, the Pittsburgh Penguins.
Buskas saw his NHL career come to a close in 1992–93, as he was assigned to the minors for the first time since 1984 and appeared in only 4 games for the Blackhawks. Released at the end of the season, he spent two more seasons in the IHL with the Las Vegas Thunder before retiring in 1995. Buskas finished his career with totals of 19 goals and 63 assists for 82 points in 556 career NHL games, along with 1294 penalty minutes.
Following his retirement Buskas, who has obtained a pilot's license during his playing career, remained in the Las Vegas area and ran a flight school in Henderson, Nevada. He would also later serve for a time as an assistant coach with the Las Vegas Thunder.
Buskas is currently a captain with Hawaiian Airlines. He currently lives in Las Vegas and has two children: Paulina and Blake.
Career statistics
Transactions
On June 10, 1981 the Pittsburgh Penguins drafted Rod Buskas in the sixth-round (#112 overall) of the 1981 NHL draft.
On October 24, 1989 the Pittsburgh Penguins traded Rod Buskas to the Vancouver Canucks in exchange for a 1990 sixth-round pick (#107-Ian Moran).
On January 8, 1990 the Vancouver Canucks traded Rod Buskas, Tony Tanti and Barry Pederson to the Pittsburgh Penguins in exchange for Dan Quinn, Andrew McBain and Dave Capuano.
On October 1, 1990 the Los Angeles Kings claimed Rod Buskas from the Pittsburgh Penguins in waiver draft.
On October 28, 1991 the Los Angeles Kings traded Rod Buskas to the Chicago Blackhawks in exchange for Chris Norton and future considerations.
References
External links
Profile at hockeydraftcentral.com
1961 births
Living people
Billings Bighorns players
Canadian ice hockey defencemen
Canadian people of Swedish descent
Chicago Blackhawks players
Ice hockey people from Alberta
Los Angeles Kings players
Medicine Hat Tigers players
People from Wetaskiwin
Pittsburgh Penguins draft picks
Pittsburgh Penguins players
Sportspeople from Medicine Hat
Vancouver Canucks players |
40907904 | https://en.wikipedia.org/wiki/South%20Essex%20Partnership%20University%20NHS%20Foundation%20Trust | South Essex Partnership University NHS Foundation Trust | South Essex Partnership University NHS Foundation Trust was an NHS foundation trust providing mental health, learning disability, social care and community services across Bedfordshire, Essex, Luton and Suffolk, England.
It was involved in running the Aldeburgh Cottage Hospital in Suffolk through a partnership or joint venture with Serco and others.
It was named by the Health Service Journal as one of the top hundred NHS trusts to work for in 2015. At that time it had 5,084 full-time equivalent staff and a sickness absence rate of 5.07%. 65% of staff recommend it as a place for treatment and 55% recommended it as a place to work.
It merged with North Essex Partnership University NHS Foundation Trust in April 2017 forming a new organisation Essex Partnership University NHS Foundation Trust. “Significant” service reconfiguration is expected to follow.
See also
Healthcare in Bedfordshire
Healthcare in Essex
List of NHS trusts
References
Defunct NHS trusts |
2140462 | https://en.wikipedia.org/wiki/Everything%20Is%20Wrong%20%28album%29 | Everything Is Wrong (album) | Everything Is Wrong is the third studio album by American electronica musician Moby, released on March 14, 1995 by record labels Mute in the United Kingdom and Elektra in the United States. It was released with a limited-edition bonus disc of ambient music titled Underwater.
Background
Following the release of two albums, Moby and Ambient, on Instinct, Moby signed to Mute and Elektra and began work on what he felt was his first "legitimate" album, seeking to create a record that encompassed his various musical influences. Moby has described Everything Is Wrong as "a record that almost served as a lifeboat for the songs I cared the most about", noting that he attempted to cover as many musical styles as possible not "out of trying to be eclectic, but just because I was in love with all of these genres and I felt like this may be my only chance to make a record."
Moby recorded and mixed the album himself in his apartment on Mott Street in Manhattan, New York, using inexpensive recording equipment. Everything Is Wrong features guest vocal contributions from Rozz Morehead, whom Moby had met while performing on the British television program Top of the Pops, and Mimi Goese, whose work with the band Hugo Largo he admired, and who he later found out lived just a block away from him.
Content
Moby titled the album Everything Is Wrong and wrote its extensive accompanying liner notes as a means of expressing some ideas that he felt were important to him, later reflecting, "At the time, I was — and am still — a vegan and an animal rights activist, really militant in all my beliefs. So I would wake up really angry every day, and sleep angry every night because I thought the world was in terrible shape, and I thought, 'What small thing can I do to express my beliefs that the world is in such terrible shape?' And that’s where the title of the album came from." Inside the album's booklet, Moby provides two personal essays, quotes from notable figures (from Albert Einstein to St. Francis of Assisi), and facts that he has collected regarding subjects such as vegetarianism, environmentalism, and animal experiments.
Critical reception
Everything Is Wrong was released to positive reviews from music critics. Spins Barry Walters praised its diverse range of musical styles compared to most other "one-dimensional" electronic albums and dubbed it "a hugely passionate album held together by its intensity". Greg Kot of the Chicago Tribune felt that Moby "explodes the boundaries of the genre" with an album "as moving as it is adventurous", while Lorraine Ali of the Los Angeles Times wrote that Everything Is Wrong "swoops from agony to ecstasy, leaping from the glittery heights of disco divadom to the rampaging ugliness of speed-metal to the refined feel of classical—while always remaining consistently Moby." In The Village Voice, Robert Christgau remarked: "Where in concert he subsumes rockist guitar and classical pretensions in grand, joyous rhythmic release, on album his distant dreams remain tangents." Everything Is Wrong was voted the third best album of 1995 in The Village Voices year-end Pazz & Jop critics' poll. By 2002, the album had sold over 180,000 copies in the United States.
In popular culture
"God Moving Over the Face of the Waters" is featured in the closing moments of the 1995 film Heat.
"First Cool Hive" is featured in the final scene of the 1996 film Scream.
"When It's Cold I'd Like to Die" is featured in The Sopranos, at the end of the episode "Join the Club". Additionally, the song was featured in season 1 and 4 of Stranger Things.
An instrumental version features at the end of the 2006 documentary film Deliver Us From Evil.
Track listing
Personnel
Credits for Everything Is Wrong adapted from album liner notes.
Moby – engineering, production, programming, writing
Kochie Banton – vocals on "Feeling So Real" and "Everytime You Touch Me"
Mimi Goese – lyrics and vocals on "Into the Blue" and "When It's Cold I'd Like to Die"
Rozz Morehead – vocals on "Feeling So Real" and "Everytime You Touch Me"
Myim Rose – vocals on "Feeling So Real"
Saundra Williams – vocals on "Bring Back My Happiness"
Nicole Zaray – vocals on "Feeling So Real"
Artwork and design
Barbie – art direction
Jill Greenberg – photography
Slim Smith – layout
Charts
Certifications
Remix album
A two-disc remix album entitled Everything Is Wrong: Non-Stop DJ Mix by Evil Ninja Moby or Everything Is Wrong: Mixed! Remixed! was released in January 1996 by Mute. The album was mixed by Moby from various remixes that were commissioned by the label.
Track listing
Charts
Certifications
References
External links
Moby albums
1995 albums
Mute Records albums
Techno albums by American artists
Ambient albums by American artists
Elektra Records albums
Albums produced by Moby |
58473434 | https://en.wikipedia.org/wiki/Too%20Much%20%28Zayn%20song%29 | Too Much (Zayn song) | "Too Much" is a song by English singer and songwriter Zayn Malik featuring American producer Timbaland. The song was released as the fourth single from Zayn Malik's second studio album, Icarus Falls (2018), on 2 August 2018. The song is written by Zayn Malik, Angel Lopez, Timothy Mosley and Federico Vindver, with the production handled by Timbaland, Lopez and Vindver.
Background and release
On 7 April 2018, Timbaland teased the song when he posted on his Instagram account that he was working with Malik on a song. On 30 July, Malik posted on his Twitter a 15-second animated gif with a 1990s Grand Theft Auto style. Malik also revealed the title and cover, and confirmed that the song would be released on 2 August 2018.
The song was recorded in Los Angeles by Timbaland, Angel Lopez and Federico Vindver. The animated single cover shows half of Zayn's face on the right side and half of Timbaland's face on the left. Zayn also released an animated video on YouTube, which he previously teased on Twitter. In the video, an animated version of Zayn dances while Timbaland arrives driving a car.
Critical reception
John Blistein of Rolling Stone opined that Zayn finds himself caught in the desire and the song boasts Timbaland with quintessential beat that synths a thumping drum track, creating a sensual, futuristic atmosphere. Alex Zidel of HotNewHipHop said that Zayn flexes his connections and keeps the intrigue alive. He also thinks that Timbaland brings his vintage 90's vibes meanwhile Zayn flows smoothly in his falsetto. writing that in contrast to his previous work "Sour Diesel", Zayn explores new vibes and sounds.
Charts
Certifications
References
Zayn Malik songs
Timbaland songs
2018 singles
2018 songs
Songs written by Zayn Malik
Songs written by Timbaland
Songs written by Federico Vindver |
13705085 | https://en.wikipedia.org/wiki/Palayam%2C%20Thiruvananthapuram | Palayam, Thiruvananthapuram | Palayam or Cantonment, as it is locally known, one of the busiest localities in Thiruvananthapuram (also known as [Trivandrum), the capital of Kerala State in India. It is home to many of the administrative, cultural, and educational institutions in Kerala.
History
It gets its name from the fact that it used to be camp of the royal army and cavalry of the erstwhile kings of Travancore. It extended from the Cantonment House in the North up to A.K.G. Centre in the South, including areas now occupied by the University Stadium and Chandrasekharan Nair Stadium. The Army subsequently moved to Pangode. The cavalry, however, remained at Palayam.
The name "Cantonment" is not much in use for the area, though that name is still associated with the police station near the Secretariat, "Cantonment Police Station". At present, "Cantonment House" serves as the official residence of the Leader of the Opposition.
Religious confluence
The Palayam Juma Mosque, St. Joseph's Latin Cathedral or Palayam Palli and a temple dedicated to Lord Ganesh are situated close to each other. The mosque and a temple are side by side, touching each other. The co-existence of these three centres of worship of different religions is quite unique and is a standing example of the religious tolerance and harmony in the state. Today hundreds of devotees offered prayers at the temple. The Friday prayers at the mosque are attended by a fairly high number of people.
St. Joseph's Cathedral is under the Latin Archdiocese of Thiruvananthapuram .
It is a major shopping area of the city. Offices of the University of Kerala, Legislative Assembly, hostel of the Members of the Legislative Assembly, Jubilee Memorial Hospital, Connemara Market and Saphalyam Shopping Complex are at Palayam.
Restaurants serving Arabian cuisine like Shawarma and Kabsa and multi-cuisine ones are many in number.
Connemara Market
Also known as Palayam Market, Connemara Market was established by Lord Connemara, Governor of Madras. Saphalyam Shopping Complex and many other shops such as Shoe Wagon, Lee are situated here. Connemara Market is going to be renovated into a big shopping complex and 3-star hotel by next 4 or 5 years.
References
External links
Cantonments of British India
Suburbs of Thiruvananthapuram |
41698680 | https://en.wikipedia.org/wiki/Celebrity%20Come%20Dine%20With%20Me%20Australia | Celebrity Come Dine With Me Australia | Celebrity Come Dine With Me Australia is a celebrity version of the Australian television reality cooking series based on the Come Dine with Me format which premiered on 11 December 2012 on The LifeStyle Channel in Australia, as a spin-off to Come Dine with Me Australia. It is narrated by James Valentine.
Series Summary
History
In 2009, The Lifestyle Channel bought the rights to Come Dine with Me, commissioning Granada Media Australia to produce a version for the Australian market. The first season consists of 20 episodes. A second season was approved before the first season premiered and was broadcast in mid-2010. A fourth season was commissioned in 2012 with a celebrity Christmas special to screen prior to the fourth season. A second Christmas celebrity special was commissioned which aired in December 2013 along with a full celebrity season which aired in 2014.
Cancelled Revival
The series was set to be revived in 2016 by ITV Studios for the Nine Network. however on 14 April 2016, the series was shelved due to production issues and Nine implementing changes after a bad start to the ratings year.
Format
The unscripted show follows celebrity chefs competing against each other in hosting a dinner party for the other contestants. Each week over four nights, four celebrities take it in turns to cook up their idea of the perfect evening for the other four. Each believes they can cook up the perfect evening and hopes their unique style will clinch them the title of best host and the $2000 cash prize for charity.
Episodes
Xmas Special (2012)
Xmas Special (2013)
Season 1 (2014)
References
External links
Official website
See also
MasterChef
My Kitchen Rules
Come Dine with Me Australia
2010s Australian reality television series
Australian cooking television series
Cooking competitions in Australia
Food reality television series
2012 Australian television series debuts
2014 Australian television series endings
English-language television shows
Television series by ITV Studios |
34009302 | https://en.wikipedia.org/wiki/List%20of%20number-one%20club%20tracks%20of%202008%20%28Australia%29 | List of number-one club tracks of 2008 (Australia) | This is the list of ARIA Club Chart number-one hits in 2008, compiled by the Australian Recording Industry Association (ARIA) from weekly DJ reports.
2008
Number-one artists
See also
ARIA Charts
List of number-one singles of 2008 (Australia)
List of number-one albums of 2008 (Australia)
2008 in music
References
2008 Club
Australia Club Chart
2008 in Australian music |
10127982 | https://en.wikipedia.org/wiki/Lemko%20Republic | Lemko Republic | Lemko-Rusyn People's Republic (), often known also as the Lemko-Rusyn Republic, just the Lemko Republic, or the Florynka Republic was a short-lived state founded on 5 December 1918 in the aftermath of World War I and the dissolution of the Austro-Hungarian Empire. It was centered on Florynka, a village in the south-east of present-day Poland (on the border with Slovakia, south and south-east of Nowy Targ - Florynka, Krynica-Zdrój, Świetnica, Gładyszów, Sanok). Being Russophile, its intent was unification with a democratic Russia and was opposed to a union with the West Ukrainian People's Republic. A union with Russia proved impossible, so the Republic then attempted to join Subcarpathian Rus' as an autonomous province of Czechoslovakia. This, however, was opposed by the then governor of Subcarpathian Rus', Gregory Žatkovich.
The Republic was headed by Jaroslav Kacmarcyk as President of the Central National Council. It was ended by the Polish government in March 1920. Its fate was sealed by the September 1919 Treaty of Saint-Germain, which gave Galicia west of the San to Poland and by the Peace of Riga in March 1921 whereby the fait accompli was recognized by Moscow.
This state should not be confused with the Komancza Republic of eastern Lemko Region, another short-lived republic. This was a smaller pro-Ukrainian state that existed between November 1918 and 23 January 1919.
Background
In the middle of the 19th century, the question of Rusyn population in Galicia turned into a power struggle between Austria, Russia and Poland. A circle of Russophile pan-Slavists formed around Mikhail Pogodin who visited Galicia regularly, and conducted talks with anti-Polish clergy of Eastern Catholic and Eastern Orthodox denominations. The spread of pro-Russian sympathies proved successful as there already were cultural and social conflicts between the Poles and Rusyn peasants, resulting in an anti-Polish attitude. Antipathy towards Poland was also caused by the attitude of Polish nationalist groups, which spread the belief that Rusyns were a Polish tribe and that Rusyn culture was just a regional variation of the Polish one. Rusyns demanded that Eastern Catholic customs be freely respected in Galicia, and for the Rusyn language to be represented in administration and schools. Fears of Polonization and ignorance concerning the treatments of Rusyns and Ukrainians within the borders of the Russian Empire made the Russian campaign particularly successful, and already in 1849 the Lemkos sent a delegation to Tsar Nicholas I led by Mykhailo Hrynda of Szlachtowa, which asked the Tsar for his "protection".
Mykhailo Hrushevsky stresses that there was no nationalism nor a strong identity present in the Rusyn circles, the cultural and religious differences made it impossible to identify with both the Polish and Ukrainian population, and yet despite a common desire for independence or autonomy, there weren't any strong foundations for a Lemko nation. In other words, Lemkos were certain that they weren't Poles nor Ukrainians and sought sovereignity from them, and yet many didn't feel like they formed a nation on their own either. Russian agitation solved this problem, and many Rusyns proceeded to identify with the Russian nation and culture.
The Russophilia of Rusyn circles came to be combated by the Ukrainian nationalist movements, most importantly the Prosvita society, and by the dominant Polish element as well. This temporarily weakened the pro-Russian ambitions of the Rusyns, but it returned as a consequence of Russian defeat in the Russo-Japanese War. In 1907, the National Democrats came to represent Galicia in the Viennese parliament. National Democrats represented a Russophile current, believing that rebuilding the Polish state lies in collaboration with Russia in exchange of extensive autonomy and combating Ukrainian nationalism. This pro-Russian attitude of National Democrats greatly emporered the Russophile Rusyns and weakened the Ukrainian movement in Lemko region.
The First World War resulted in the Russian occupation of Galicia, which the Russian officials declared to be "eternally Russian lands". Russia made vigorous efforts to integrate Galicia into Russia, and conducted mass conversions from Greek Catholicism to Eastern Orthodoxy. Ukrainian national movement was repressed, with most Ukrainian politicians fleeing to Vienna. Andrey Sheptytsky, the Greek Catholic metropolitan, was arrested. The situation was quickly reversed when the Russian army was pushed back, with mass arrests and reprisals against pro-Russian circles by the Austrian army, including against the Rusyn movement. The war greatly polarised the Ukrainian and Russophile factions amongst Lemko activists, with the East being swayed towards supporting the Ukrainians and proclaiming a pro-Ukrainian Komancza Republic, while western Lemkos remained hostile to Ukrainian nationalism.
Proclamation
The western Lemkos were concerned that they would be incorporated into the Western Ukrainian People's Republic against their will. In November 1918, an anti-Ukrainian rally was held in Świątkowa Wielka, where Rusyn activists spoke against joining the Ukrainian state. A political conference of Lemko activists in Gładyszów proclaimed that the Lemko region could only belong to Russian state. Jarosław Moklak notes that the resolutions of Gładyszów received support from local Lemkos, as they considered the Ukrainian nation foreign to them and feared being dismissed as a mere regional variant of the Ukrainian culture. Further rallies took place in Grybów and Nowy Sącz.
On 5th of December 1918, over 500 Rusyn representatives of 130 villages and towns in the western Lemko Region held a national congress in Florynka, with the Slovak representatives from the Prešov Region also present as well. Additionally, a representative of the Polish government, Kazimierz Romult, was present as well. The congress proclaimed the creation of 'Nachalnyi Sovit', the executive council, and 'Russka Rada', the national council. Mykhal Iurchakevych led the former, while Jaroslav Kacmarcyk of Muszyna was elected as the head of the latter. The newly proclaimed government proceeded to establish its control over the region, forming a national guard and workers' cooperatives. Given that the Lemko Republic was opposed to the West Ukrainian People's Republic, the Polish government expected the Lemko state to support them and offered them the former town hall of Grybów for its government headquarters. However, the Lemkos were not interested in joining the Polish state and desired to join Russia instead. At the end of 1918, the council announced the incorporation of the Lemko region into Russia, although it wasn't specified whether the council meant Soviet Russia or White Russia. The Rusyn Council established its control on the region, prohibiting teachers and officials from submitting "pledges of loyalty" to the Polish government, and public documents referred to the Republic as "Russian National Republic".
The collapse of Russia put the pro-Russian republic in a difficult situation, and the republic started seeking alternatives. This made the Lemkos develop a pro-Czechoslovak policy as to avoid integration into Poland, and the pro-Czech attitude was already widespread amongst the Rusyns of Slovakia and Carpathian Ruthenia. In January 1919, Lemko council members met with Rusyns of Carpathia and under the leadership of Antonii Beskyd formed a united Carpatho-Rusyn National Council, announcing that the Lemkos of Galicia and Rusyns of Carpathia formed a single nation that would join Czechoslovakia. A delegation was sent to the Paris Peace Conference, which issued a formal memorandum in April 1919 of a united Rusyn state which would encompass the Lemko region in Galicia, the Prešov Region and Carpathian Ruthenia. Gregory Žatkovich, the first governor of Czechoslovak Carpathian Ruthenia, vehemently opposed the annexation of Lemko Region into Czechoslovakia, given that it would provoke a war in Poland and that the Entente powers have already allowed Poland to occupy all of Galicia until the resolution of the Russian Civil War. While the Polish government was passive towards the Lemko state and saw no need to suppress it thanks to its anti-Ukrainian attitude, the pro-Czech attitude concerned the Polish authorities, and unlike Russophilia, was seen as a threat to the Polish nation state. Following the proclamation of Lemko Council of joining Czechoslovakia as the part of Carpathian Ukraine, the Polish army quickly occupied the region in March 1920, effectively dissolving the Lemko Republic. A trial of the council members took place on 10 June 1921 in Nowy Sącz, but the Polish court was lenient towards the Lemko activists and acquitted every defendant.
Following the annexation of the Lemko-Rusyn Republic and the lenient trial, the newly established Polish state ignored Lemkos and didn't interfere in the local political affairs. The success of the Polish state and the downfall of Ukrainian one re-evaluated Rusyn politics, with the Russophile Lemkos becoming split between left-wing pro-Soviet and anti-Bolshevik right wing activists, known as the Old Rusyns. Old Rusyns remained loyal to the Russonphile cause, but also declared loyalty towards the Polish state and started advocating for autonomy within Poland, without abandoning their Rusyn national consciousness. Given the partition of Ukrainian lands between Poland and the Soviet Union, the pro-Ukrainian Lemkos merged with the pro-Russian groups, seeing either the Soviets or the Polish state as preferable. Jaroslav Kacmarcyk never gave up on his ambition to join Russia, and continued to support a union with Russia, even if under Bolshevik governance.
Territory
On 5 December 1918, the Republic's delegates issued the statement: "We, the Rusyn nation, living in a compact settlement in the southern parts of the Galician administrative units of Nowy Targ, Nowy Sącz, Grybów, Gorlice, Jasło, Krosno, and Sanok do not wish to be incorporated into the Polish state, and wish to share the fate of our Rusyn brothers [living] in Spiš, Šariš, and Zemplín counties as one indivisible geographic and ethnographic unit."
See also
Lemkos
Komancza Republic
Notes
External links
History of the Lemko-Rusyn Republic
Paul R. Magocsi article on the Lemko Republic
Lemko Region
Former countries in Europe
Former republics
States succeeding Austria-Hungary
History of Galicia (Eastern Europe)
History of Podkarpackie Voivodeship
History of Lesser Poland Voivodeship
1918 establishments in Poland
States and territories established in 1918
1920 disestablishments in Europe
1918-12-05 |
5296621 | https://en.wikipedia.org/wiki/Gettysburg%20%28game%29 | Gettysburg (game) | Gettysburg is a board wargame produced by Avalon Hill in 1958 that re-enacts the American Civil War battle of Gettysburg. The game rules were groundbreaking in several respects, and the game, revised several times, was a bestseller for Avalon Hill for several decades.
History
Gettysburg was originally published in 1958, and was the first board wargame based on a historical battle.
Gettysburg has game mechanics similar to Avalon Hill's ground-breaking Tactics II (1958). In particular, the combat results table favors attacking where one has a local superiority of numbers. Unlike Tactics II, Gettysburg gives each unit an orientation, and an attacker can improve his odds by attacking a defender from the side or from the rear. The defender, meanwhile, can improve his odds by entrenching himself atop a hill.
Charles S. Roberts, the founder of Avalon Hill, made the following comment about the game in 1983:
In its original form, Gettysburg played something like a miniatures game. The map was marked off in a square grid, but this was used for tracking hidden movement, not to regulate regular movement. Movement instead used range cards, which were also used to check firing ranges. The rectangular (not square) units were allowed to rotate on their centers before using the range card, and the system gave bonuses for firing on a flank.
In 1961, the game was re-released, redone to use a hex grid, which also appeared in other Avalon Hill games released that year. This proved a popular mechanism for regulating movement, with it being a staple of wargame design ever since, but Avalon Hill returned to a square grid (albeit with more normal movement rules) for the 1964 edition of the game.
The hex grid returned for the 1977 redesign of the game, which also introduced multiple counters for each unit and expanded rules of unit formation. The rules additions were an attempt to simulate unit movement in columns and the delay and difficulty of changing formation into a line of battle. Separate counters represented flanks, which could be turned to join adjacent units' flanks or turned back to defend against expected assault. Although the grid was retained for the 1988 redesign, the multiple counters per unit and overly complex unit formation rules were discarded, and this last iteration of the game bore a stronger resemblance to the 1961 version, save for the full color illustrated board of the 1977 edition. A new edition for the 125th anniversary of the battle was published in 1988.
A sister game, Chancellorsville, used the same game mechanics.
These works are in the public domain because they were published in the United States before 1978 and although there was a copyright notice, the copyright was not renewed.
Reception
In his 1977 book The Comprehensive Guide to Board Wargaming, Nicholas Palmer noted its relative unpopularity in the wargaming world at the time (it was rated 189th out of 205 games in a poll of wargamers conducted by SPI), saying, "it is too simple to appeal to the hard-core, there is a play-balance problem, and the attractive map is insufficiently used." However, he thought for newer players, "it is quite a reasonable game in its class, a brisk, easy classic, and quite a pleasant introduction to the hobby for anyone interested in the period. Experts will prefer Terrible Swift Sword."
In Issue 27 of Phoenix, Donald Mack liked the rule in the 1977 version of Gettysburg that prevents a unit from attacking that has a combat strength less than 1/6th of its opponent. Instead, that weak unit must retreat, preventing tactical but suicidal "soak-off" attacks. However, he pointed out problems with the road movement rule that resulted in "blue and grey columns whizzing across the map in a manner which would have astounded [General Robert E.] Lee and [General George] Meade."
R. B. McArthur for Washingtonian in 1980 said that "It is not hard to improve on Lee's actual tactics at Gettysburg – just don't charge uphill against massed, fortified, grapeshot-firing cannon. But winning the battle for the South is tough. Strong men have been known to weep when, once more, someone drives old Dixie down."
In The Guide to Simulations/Games for Education and Training, Martin Campion reviewed the 1977 edition and noted with approval the improvements that had been made to the original game mechanics. In terms of using this game in the classroom, Campion noted that "The combat rules are probably more intricate than most teachers will have time for, but they might appreciate that the game contains plenty of opportunities to use multipl,e commanders."
In the 1980 book The Complete Book of Wargames, game designer Jon Freeman also reviewed the 1977 edition, and had little good to say about it, commenting "It's one of the most splendid examples of wretched excess ever published. All that tremendous order-of-battle work [...] is straitjacketed by a playing board that makes no sense. The scale is totally wrong for regimental simulation, and the game map, which is pretty but hard to read, is virtually ignored in terms of terrain effects and movement." He concluded by giving the game an Overall Evaluation of only "Fair", saying, "In some respects it may be a better historical tool than SPI's vaunted Terrible Swift Sword, but no one in his right mind would want to play it."
Gettysburg was chosen for inclusion in the 2007 book Hobby Games: The 100 Best. Game designer Lou Zocchi commented, "With Gettysburg, [designer Charles S.] Roberts{{]}} created a game that evoked memories of brilliant commanders such as Lee and Jackson, even as players grew to understand the intricacies of their commands."
Awards
At the 1989 Origins Awards, the 125th Anniversary edition of Gettysburg won "Best Pre-20th Century Boardgame of 1988".
Legacy
Gary Gygax and Dave Arneson, co-designers of Dungeons & Dragons, reported that their first board wargame was Gettysburg. According to Gygax, "I’d purchased an AH game (GETTYSBURG) in ‘58 or ‘59 and avidly sought more."
References
External links
American board games
American Civil War board wargames
Avalon Hill games
Board games introduced in 1958
Charles S. Roberts games
Origins Award winners
Battle of Gettysburg |
42879512 | https://en.wikipedia.org/wiki/Blake%20Little | Blake Little | Blake Little is an entertainment, advertising, and fine art photographer based in Los Angeles since 1982. He has had assignments in advertising, film, television, book and magazine publishing. He has worked with personalities in entertainment, sports and politics.
His work has been exhibited in New York, Seattle, Indianapolis, Los Angeles and Japan.
Early life
Little was born and raised in Seattle, Washington. After studying for three years at the University of Washington, he transferred to Seattle Central College where he completed his photography degree in 1984. After college, he moved to Los Angeles. His portraits have included David Hockney, John Baldessari and Edward Ruscha, and he has had commercial assignments and work in the entertainment industry.
Photography
Little has photographed people in entertainment, sports and politics. His clients includes Tom Cruise, Jeff Bridges, Julianne Moore, Steve Carell, Samuel Jackson, Kevin Spacey, Gwyneth Paltrow, Aaron Eckhart, Johnny Knoxville, Marcia Cross, Colin Powell, kd Lang, 50 Cent, Glenn Close, Jane Fonda, Jack Black, Adrien Brody, Jane Lynch, and Brett Favre.
Little works for book and magazine publishers including Simon & Schuster, Random House, Penguin Books, Vanity Fair, Time, People, The Times of London and USA Weekend. He has worked with Henry Cavill and Greg Kinnear. He did covers for I, Rhoda by Valerie Harper, Prime Time by Jane Fonda, and New Rules by Bill Maher. His portrait of Marissa Mayer was featured in Vanity Fair for April 2014 issue.
Little's advertising work includes photography for Austin Powers, Borat and Get Smart.
Monographs
Little has published three monographs; his first book Dichotomy in 1997, his second publication The Company of Men released in September, 2011, and his third book Manifest in September, 2013.
Exhibitions
Little had his first museum exhibition; Blake Little: Photographs from the Gay Rodeo at the Eiteljorg Museum in Indianapolis, IN Jan. 18 – July 13, 2014.
September 2011 - "The Company of Men" Book Signing, Clamp Art Gallery, New York, NY
September 2011 - "The Company of Men" Exhibition and Book Signing, Western Project, Los Angeles, CA
September 2008 - "The Company of Men" Exhibition, Wessel O'Connor Fine Art, Brooklyn, NY
October 1996 - "Dichotomy" Exhibition, G. Ray Hawkins Gallery, Santa Monica, CA
March 1995 - "The Nude and The Contemporary Photograph" Group Exhibition Tokyo Galleria, Tokyo, Japan.
September 1993 - "Photographs, 1990–1994", Wessel O'Connor Fine Art, New York
November 1992 - "The Nude: Classic Beauty" Group Exhibition The Silver Image Gallery, Seattle, WA
July 1992 - "Bare Essentials " Group Exhibition Couturier Gallery, Los Angeles, CA
April 1988 - "Artist's Images of Artists" Group Exhibition Donna Beam Fine Art, Las Vegas, NV
April 1986 - "Light Sensitive VI" Group Exhibition, The Thomas Center Gallery, Gainesville, FL
September 1985 - "Pacific Light " Group Exhibition Jan Kesner Gallery
April 1984 - "New Photographs" Exhibition, James Turcotte Gallery, Los Angeles, CA
November 1983 - "Cities" Group Exhibition, San Francisco Arts Commission, San Francisco, CA
September 1983 - "Los Angeles Ballet" Group Exhibition Bernard Jacobson Gallery, Los Angeles, CA
June 1992 - "Industrial Architecture" Exhibition Cameravision, Los Angeles, CA
Awards
Little was awarded the American Photo 2014 AP29 and the IPA Lucie Foundation's Int'l Photography Competition in 2013.
References
External links
Photographers from California
Artists from Seattle
Artists from Los Angeles
Year of birth missing (living people)
Living people
University of Washington alumni
Fine art photographers |
7615274 | https://en.wikipedia.org/wiki/Peter%20Tudebode | Peter Tudebode | Peter Tudebode () was a Poitevin priest who was part of the First Crusade as part of the army of Raymond of Saint-Gilles. He wrote an account of the crusade, Historia de Hierosolymitano itinere, including an eye-witness account of the siege of Antioch of 1097–1098. The work is included in Patrologia Latina, Volume 155, pp. 758–823. The work appears in Recueil des historiens des croisades (RHC), with a translation and Præfatio by French historian Jean Besly (1572–1644).
The anonymous Gesta Francorum and Tudebode's account share similarities and there are disputes among scholars as to their relationship. Historian Jay Rubenstein suggests that both derive from a lost common source. This is disputed by Marcus Bull's recent examination of a little known manuscript related to these two chronicles, Peregrinatio Antiochie, which proposes that the Gesta is indeed the earliest surviving narrative from which the other two, the Historia and the Peregrinatio, as well as many others, descended.
External links
The Battle for Antioch (1097-98) according to Peter Tudebode
References
Crusade literature
Christians of the First Crusade
11th-century French historians
11th-century births
Year of death unknown
French male non-fiction writers
11th-century Latin writers |
47136748 | https://en.wikipedia.org/wiki/Apis%20Papyrus | Apis Papyrus | The Apis Papyrus is an ancient Egyptian artifact, the work of scribes upon papyrus, concerning the Apis bull.
Language
The text on the papyrus is written in hieratic-demotic script, and the inscriptions are the work of two scribes.
Dating
According to one source the papyrus was written during the middle of the 2nd century BC, another source dates the papyrus to a period falling within the 26th Dynasty, and a third considers the papyrus dates to the 1st century C.E.
Contents
The text shows details of the burial rites and ritual of performing an embalming of the Apis, particularly the last parts or stages of the embalming.
D.K. Sharpes states the ritual extended to seventy days. Priests performing the ritual were required to maintain hair at a long length, not bathe, to wear costumes made especially for the purposes of the fulfilment of the ritual, wail loudly, fast for four days and abstain from milk and meat for the remaining sixty-six days.
History of scholarship
The papyrus was purchased in 1821 by Dr Ernst August Burghart for the Münz und Antikencabinet at a cost of 200 Guilders Konventionschmünze.
Heinrich Brugsch was the first scholar to study the papyrus. In 1886, von Bergmann published a photolithograph of it, and in 1920 Wilhelm Spiegelberg published the first translation. The papyrus was contained within the Kunsthistoriches Museum at a time circa 1993.
See also
List of ancient Egyptian papyri
References
Egyptian papyri
Papyrus
Sacred bulls |
46598429 | https://en.wikipedia.org/wiki/I%27m%20Not%20the%20Only%20One%20%28book%29 | I'm Not the Only One (book) | I'm Not the Only One is a 2004 political autobiography by the British politician George Galloway. The book details his political beginnings in the Labour Party in Glasgow, his opposition to the invasion of Iraq, support for the Palestinian cause and the founding of the Respect Party.
Reception
Johann Hari in The Independent described the book as a "strange, repetitive little manifesto". The book was also criticised by Andrew Anthony in The Guardian who, apart from labelling Galloway an apologist for dictators, wrote that Galloway has an "enduring ability to believe in transparent fictions". Jim Horton in Socialism Today was more positive, but wrote that in I'm Not the Only One "there is hardly a scintilla of a socialist programme".
References
2004 non-fiction books
2004 in British politics
Books about politics of the United Kingdom
Books by George Galloway
British memoirs
English-language books
Iraq War books
Political memoirs |
38134506 | https://en.wikipedia.org/wiki/TradeCard | TradeCard | TradeCard, Inc. was an American software company. Its main product, also called TradeCard, was a SaaS collaboration product that was designed to allow companies to manage their extended supply chains including tracking movement of goods and payments. TradeCard software helped to improve visibility, cash flow and margins for over 10,000 retailers and brands, factories and suppliers, and service providers (financial institutions, logistics service providers, customs brokers and agents) operating in 78 countries.
On January 7, 2013, TradeCard and GT Nexus announced plans to undergo a merger of equals, creating a global supply-chain management company that would employ about 1,000 people and serve about 20,000 businesses in industries including manufacturing, retail and pharmaceuticals. The combined company rebranded itself as GT Nexus.
History
TradeCard was founded in 1999 by Kurt Cavano as a privately owned firm.
In 2003, Warburg Pincus led three funding rounds, with TradeCard closing $10 million.
In 2010, Deloitte cited TradeCard for its entrepreneurial and disruptive cloud technology enterprise resource planning solution that provides new IT architectures designed to address unmet needs of enterprises.
In 2011, TradeCard's revenue grew by 36% over the previous year, and the company claimed on its website that it handled $25 billion in sourcing volume on its platform, by 10,000 organizations and 45,000 unique users. In 2012, founder and CEO Kurt Cavano transitioned to the Chairman role and Sean Feeney was appointed CEO.
TradeCard was headquartered in New York City, with offices in San Francisco, Amsterdam, Hong Kong, Shenzhen, Shanghai, Taipei, Seoul, Colombo and Ho Chi Minh City.
Clients
TradeCard provided global supply chain and financial supply chain products to retail companies, factories and suppliers, and service providers (financial institutions, logistics service providers, customs brokers and agents).
Clients include retailers and brands such as Coach, Inc. Levi Strauss & Co., Columbia Sportswear, Guess, Rite Aid, and Perry Ellis International.
Awards
2012 Best Platform Connecting Buyers, Suppliers and Financial Institutions by Global Finance
2012 Supply and Demand Chain 100
2012 Pros to Know by Supply and Demand Chain
2011 Top Innovator by Apparel Magazine
2011 Great Supply Chain Partner by SupplyChainBrain
References
External links
Supply chain software companies
American companies established in 1999
Companies based in New York City
ERP software companies
Software distribution
As a service
Software industry
Cloud platforms
ERP software
Private equity portfolio companies
Business software companies
Warburg Pincus companies |
61038661 | https://en.wikipedia.org/wiki/Ulster%20Literary%20Theatre | Ulster Literary Theatre | The Ulster Literary Theatre was a theatre company in Ulster (Ireland, now also Northern Ireland) from 1904 to 1934. It had a differently named precursor in 1902, and by 1915 it was named just the Ulster Theatre. It was founded by Bulmer Hobson and David Parkhill with patronage from Francis Joseph Bigger, who was also its first president.
History
Precursor: The Ulster Branch of the Irish Literary Theatre in 1902
Originally, Hobson and Parkhill envisaged an "Ulster branch" of W. B. Yeats' Irish Literary Theatre in Dublin, the pair having travelled to Dublin to see it in early 1902.
They put on two plays as the "Ulster branch" in 1902 in St Mary's Minor Hall in Ulster.
Yeats was not involved in these productions, nor (according to Hobson) gave them any encouragement; and the involvement of the Irish Literary Theatre was largely limited to two of its performers, Dudley Diggs and Maire T. Quinn, travelling from Dublin to perform in Yeats' Cathleen ni Houlihan and James Cousins' The Racing Lug.
Hobson and Parkhill actually put on Yeats' play without direct permission from Yeats, instead obtaining it from Maud Gonne who assured them that "He wrote that play for me and he gave it to me. It is mine and you can put it on whenever you want to."
The lack of encouragement from Yeats, according to anecdote, caused Hobson to remark upon the return journey from Dublin to Belfast after having visited him "Damn Yeats! We'll write our own plays!".
This first production did not translate well to Ulster audiences, and the original plan of an eventual federation across the country linked back to the Irish Literary Theatre, failed.
Gerald McNamara, later a playwright for the theatre, observed in particular about the central character of Yeats' play that "Ninety-nine percent of the population had never heard of the lady – and cared less.".
There were, moreover, complaints from the secretary of the Irish Literary Theatre, George Roberts, about the unauthorized use of its name, accompanied by requests for royalties to be paid on Yeats' play.
Foundation in 1904
So Hobson and Parkhill founded the Ulster Literary Theatre in 1904, with plays from others including several by Parkhill, who wrote under the pseudonym Lewis Purcell, and with the goal of having its own distinct identity rather than being an offshoot of the Irish Literary Theatre.
The Irish News described the goal of art that was "neither Dublin nor Munster nor English in its character and essentials, but Ulster in heart and soul".
Hobson was later to describe their goal as that of "writing and producing distinctively Ulster plays, which would be a commentary on the political and social conditions in the North of Ireland".
Their 1904 production included George Russell's Deirdre at first, and towards the end of the year Hobson's Brian of Banba and Parkhill's/Purcell's The Reformers.
The first issue of the theatre's journal Uladh (the word for Ulster in Irish, in the genitive), financed by Bigger, was published the same year.
Later
Later plays included Gerald McNamara's The Mist that Does Be on the Bog, first performed in 1909, and Rutherford Mayne's The Drone, first performed in 1908 and a staple of the company thereafter.
The Drone and McNamara's Thompson in Tir-na-nOg were to prove widely popular with audiences.
The latter resonated with Ulster audiences because of its use of language and cultural references that were specific to Ulster and current events of the time.
Parkhill's/Purcell' further plays included The Enthusiast (1905), The Pagan (1906), and Suzanne and the Sovereigns (1907 in collaboration with McNamara).
McNamara's further plays included The Throwbacks (1917), No Surrender (1928), and Who Fears to Speak (1929).
In all, over the course of its lifetime the Theatre produced 47 original plays.
Reflecting Hobson's originally stated goal, most of these were satirical in nature (some straight political satire, others satirical comedies), and only six were mythological.
By 1909 the company gained a permanent home in the Grand Opera House in Belfast, and by 1915 the company was simply named the Ulster Theatre.
Uladh did not last long.
Financial difficulties caused the closure of the whole Theatre in 1934.
References
Cross-reference
Reference bibliography
Further reading
External links
Theatre companies
1904 establishments
1934 disestablishments |
1472102 | https://en.wikipedia.org/wiki/Mass%20media%20in%20South%20Africa | Mass media in South Africa | The mass media in South Africa has a large mass media sector and is one of Africa's major media centres. While South Africa's many broadcasters and publications reflect the diversity of the population as a whole, the most commonly used language is English. However, all ten other official languages are represented to some extent or another. Afrikaans is the second most commonly used language, especially in the publishing sector.
Up until 1994, the country had a thriving Alternative press comprising community broadsheets, bilingual weeklies and even student "zines" and photocopied samizdats. After the elections, funding and support for such ventures dried up, but there has been a resurgence of interest in alternative forms of news gathering of late, particularly since the events of 11 September 2001.
Press freedom
Press freedom has a chequered history in South Africa. While some sectors of the South African media openly criticised the apartheid system and the National Party government, they were hampered by various amounts of government censorship during the years. For example, journalist Donald Woods became renowned after he fled to live in the United Kingdom in exile after helping to expose the truth behind the death of Steve Biko, the leader of the Black Consciousness Movement, along with renowned journalist and current South African politician, Helen Zille. After the end of apartheid in 1994 however, censorship ended and a new constitution was enacted which has a Bill of Rights that guarantees that every citizen has the right to freedom of expression, which includes freedom of the press and media, the freedom to receive or impart information or ideas, freedom of artistic creativity, academic freedom, and freedom of scientific research.
These freedoms are generally respected in practice and the press is considered relatively free. Laws concerning the media and political control over its content are generally considered to be moderate and there is little evidence of repressive measures against journalists. In consequence, South Africa is ranked 39th in Reporters Without Borders' worldwide index of press freedom 2015–2016.
However, there has also been criticism of certain aspects of the freedom of the press in South Africa. All the large daily newspapers are owned by the four largest media firms, which could lead to pro-corporate bias. In addition, the South African Broadcasting Corporation (SABC), the public broadcaster, is funded by the ANC-majority government.
Some media aspects of the Oilgate scandal have also been a cause for concern as was the banning of the publication of the cartoons of Muhammad in South Africa by Judge Mohammed Jajbhay on 3 February 2006.
According to media reports, the SABC blacklisted certain commentators and analysts which may be critical of the government.
Recently, the Protection of Information Bill and the proposed Media Appeals Tribunal has caused controversy both domestically and abroad with allegations that press freedom is under threat.
Newspapers
The history of newspapers in South Africa dates back to 1800, when the governor of the Cape Colony initiated the publishing of the government-controlled Cape Town Gazette and African Advertiser. The first privately owned newspaper, the SA Commercial Advertiser was published in 1824, with Thomas Pringle and John Fairbairn as editors. The first Dutch language newspaper, De Zuid-Afrikaan, was published in 1830, the first African language newspaper, Umshumayeli Wendaba, in 1837 and the first Afrikaans language newspaper, Die Afrikaanse Patriot, in 1876.
The current newspaper industry is in a fairly healthy state. According to a South African Audit Bureau of Circulation (ABC) survey in 1996, there were 36 daily and weekly urban newspapers in the country – 29 in English, four in Afrikaans, two in Zulu and one in Xhosa. The dichotomy between demographics and publishing languages can be explained by different literacy levels, the widespread popular use of the English language, as well as South Africa's history of censorship, which curbed the development of a culture of newspaper readership. There are also a large number of free (advertising-funded) local and community newspapers in several different languages. An estimated 1.3 million newspapers are sold in South Africa daily.
There are several independently owned newspapers, most notably Mail & Guardian, however the majority are owned by four large publishing groups: Avusa, Naspers, Independent News and Media (owned by Sekunjalo Investments), and CTP/Caxton.
Magazines
South Africa has a very robust magazine industry with an estimated 280 locally published titles available; imported magazines add to this number considerably. The industry's annual turnover in 1998 was estimated to be about R 1.7 billion.
While the mass consumer market sector is dominated by only a few publishers (Naspers, Perskor, CTP Holdings, TML), the specialist consumer and trade & technical sectors are very fragmented and contain a large number of small- and medium-sized publishers in addition to the aforementioned major players.
As could be expected from South Africa's recent history, its magazine market is (still) characterised by definite differences in the readership of magazines amongst the country's different race groups. A decline in traditional mass consumer magazine titles versus the growth of specialist titles also characterises the industry, as does the growth of magazines specifically aimed at black South Africans, such as Drum.
Naspers is the dominant player in the mass consumer magazine sector and sells about two-thirds of all the magazines read in South Africa, including imported magazines. The company publishes large national titles such as Fair Lady, Sarie, Insig, SA Sports Illustrated, Kickoff, Huisgenoot, You and Drum. The Afrikaans language family magazine Huisgenoot has the largest circulation of any South African magazine and is followed by You, its English language version; these two magazines have a combined circulation of almost one million copies a week. Fair Lady and Sarie are South Africa's largest selling English- and Afrikaans-language women's magazines, respectively.
Other large mass market publishers are Perskor (Republican Press), CTP Holdings and Times Media. Specialist consumer magazines are also published by the aforementioned publishers, as well as by Primedia Publishing, Kagiso Media and Ramsay Son & Parker. In the trade and technical sector Primedia is the largest publisher.
Books
The book publishing industry in South Africa is relatively small, but it is nevertheless a key factor in its economy. There are more than 120 publishers in the country, according to the Publishers' Association of South Africa (PASA). Among these are commercial publishers, university presses, non-governmental organisations and one-person privately owned publishers. Of the 120 publishers who are members of the PASA, about 12 are classified as large publishers, 7 as medium-sized publishers and the remaining 101 as small publishers.
Books are published in all eleven official languages of South Africa as well as in some non-official and foreign languages. Works published include fiction, non-fiction, children's books, reference works as well as school and university textbooks. Electronic publishing is also a growing segment of the publishing industry. While some publishers specialise in the type of books they produce (for example textbooks), the majority of the large and medium publishers publish in several categories.
There are also a number of book importers and distributors active in South Africa as the great majority of books sold in South Africa (especially fiction) are still imported, mostly from Britain and the United States. This has resulted in relatively high prices being charged for books in comparison with the income of the average South African.
The South African publishing industry employs about 3,000 people full-time, as well as many freelance workers. In addition, it is estimated that the South African publishing industry employs about 9,000 authors (full- and part-time), who together earn an estimated R 150 million in royalties annually. The book-printing and bookselling are also largely dependent on this industry.
Television
Television is the most tightly regulated media sector in South Africa and is (along with radio) regulated by the Independent Communications Authority of South Africa (ICASA). Broadcast rights, especially for television, are issued by invitation only and only two independent television broadcasters have been permitted to operate up to now. Broadcast licenses mandate percentages of local, community and educational content and broadcasters are required to include such content as a condition of their license.
As a result, there are only four free-to-air terrestrial television channels in South Africa, the South African Broadcasting Corporation's SABC 1, SABC 2 and SABC 3 as well as e.tv. The South African Broadcasting Corporation or SABC is South Africa's state-owned public broadcaster. All broadcasters are subject to the Broadcast Complaints Commission.
Multichoice is the oldest provider of pay TV and satellite broadcasting in the country, with one terrestrial pay TV channel, M-Net, and DStv, a digital satellite television network with over 55 local and international channels that broadcasts to over 2 million subscribers throughout Africa. In November 2008 four new licenses were granted, from a total of 18 applications, for the operation of pay-TV services. Walking on Water (a Christian broadcaster), On Digital Media and e-Sat (the satellite arm of e.tv) were all expected to start direct-to-home satellite broadcasts in mid-2008. This did not happen as only On succeeded in launching its Top TV service. Even Telkom Media which was supposed to operate satellite services as well as IPTV services such as video-on-demand, never took off and was subsequently sold to Shenzhen Media South Africa. On Digital Media is 68% black owned.
Radio stations
Radio has always been South Africa's biggest broadcast medium; From the 1960s, South Africa was a world leader in FM radio technology. In 1962, five FM radio stations broadcast, each to a particular language group. The content of the broadcasts ranged widely, over music, sports, religion, current affairs and drama. By the mid 1980s another five languages had their own stations and four music-only regional, commercial broadcasters had been added to the FM network. The sector's deregulation in 1996 led to an even bigger proliferation of radio stations. For example, there are about 4 radio stations available to Johannesburg listeners.
Broadcasts range from the country-wide and regional radio stations of the state-owned and funded SABC to fully commercial privately owned stations to community stations that target specific cities, towns, neighbourhoods or ethnic groups. Approximately eighty community radio licenses have been issued, although a quarter of these are inoperative.
The majority of radio stations broadcast in English, although the other official languages of South Africa are represented on the airwaves as well. The industry is regulated by ICASA.
Internet and telecommunications
In comparison with the rest of Africa, this sector is fairly big and robust. However, it is dominated by the fixed line monopoly Telkom, which has been criticised in recent years for hampering further growth. Telephone and internet access is also available via mobile network operators, such as Vodacom and MTN, but is an even more expensive option.
See also
Alternative media in South Africa
List of radio stations in South Africa
List of newspapers in South Africa
List of South African media
Cinema of South Africa
South African literature
South African comics
References
Bibliography
External links
South Africa
South Africa |
25157 | https://en.wikipedia.org/wiki/Paolo%20Fresu | Paolo Fresu | Paolo Fresu (; born 10 February 1961) is an Italian jazz trumpet and flugelhorn player, as well as a composer and arranger of music.
Career
Born in Berchidda, Sardinia, he picked up the trumpet at the age of 11, and played in the band Bernardo de Muro in his home town Berchidda. Fresu graduated from the Conservatory of Cagliari in 1984, in trumpet studies under Enzo Morandini, and attended the University of Bologna School of music and performing arts in Bologna. He made his debut in 1985, with the release of his first album Ostinato.
He has taught at the Siena Jazz National Seminars, as well as jazz university courses in Terni, and is the director of Nuoro Jazz Seminars in Nuoro, Italy.
Fresu composes music for theatre, poem, dance, radio, television, and film.
In 2007, he recorded and toured with Carla Bley's quartet, the Lost Chords.
In 2011, he released Mistico Mediterraneo, which featured him, Daniele di Bonaventura and five other members playing bandoneons in A Filetta style.
In 2012, his quintet performed at the Sirifort Auditorium, New Delhi, India, to celebrate 10 years of the Italian culture center there.
In 2015, Fresu was awarded an honorary doctorate of music from Berklee College of Music.
Partial discography
The complete official discography of Paolo Fresu can be found on his official website (more than 600 tracks).
1987 Mamut: Music for a Mime (Splasc(H), 1987)
1989 Opale with Francesco Tattara, Furio Di Castri (Clac, 1989)
1991 Umiliani Jazz Family with Piero Umiliani (Liuto Edizioni Musicali, 1991)
1993 Contos with Furio Di Castri, John Taylor (EGEA, 1993)
1995 Palatino with Aldo Romano, Michel Benita, Glenn Ferris (Label Bleu, 1995)
1995 Mythscapes with Furio Di Castri, Jon Balke, Pierre Favre (Soul Note, 1995)
1996 The Hands with Flavio Piras, Furio Di Castri, Antonello Salis (Amiata, 1996)
1997 Wanderlust (RCA Victor, 1997)
1998 Palatino Tempo with Aldo Romano, Michel Benita, Glenn Ferris (Label Bleu, 1998)
1998 Condaghes with Jacques Pellen, Erik Marchand (Silex)
1998 Things Left Behind with Iridescente Ensemble (Symphonia)
1999 Metamorfosi (RCA Victor)
1999 Shades of Chet with Enrico Rava (Via Veneto Jazz)
2001 Porgy and Bess with Orchestra Jazz Della Sardegna (Il Manifesto)
2001 Heartland with David Linx, Diederik Wissels (EmArcy)
2002 Kind of Porgy & Bess (RCA Victor)
2003 Scores (CAM Jazz)
2006 Homescape with Nguyen Le, Dhafer Youssef (ACT)
2007 Mare Nostrum with Richard Galliano, Jan Lundgren (ACT)
2008 Le Fresiadi (Time in Jazz)
2009 Jazzitaliano Live 2009 (Casa del Jazz)
2010 Chiaoscuro with Ralph Towner (ECM)
2011 Alma with Omar Sosa (Tuk)
2012 Birth of the Cool (Musica Jazz)
2013 Vinodentro (Tuk)
2014 Brass Bang! with Steven Bernstein, Gianluca Petrella, Marcus Rojas (Tuk)
2015 The Whistleblowers with David Linx, Diederik Wissels (Tuk)
2016 Mare Nostrum II with Richard Galliano, Jan Lundgren (ACT)
2016 Eros with Omar Sosa, Jaques Morelenbaum, Natacha Atlas (Tuk)
2016 Around Tuk (Casa del Jazz)
2017 Danse Memoire, Danse (Tuk)
2018 Tempo di Chet , with Dino Rubino and Marco Bardoscia (Tuk)
2019 Mare Nostrum III with Richard Galliano, Jan Lundgren (ACT)
As leader
Paolo Fresu 5et
P.A.R.T.E., (EMI, 2005)
Incantamento, (EMI, 2006)
Thinking, (EMI, 2006)
Kosmopolites, (EMI, 2005)
Rosso, Verde, Giallo E Blu, (EMI, 2007)
Paolo Fresu Devil Quartet
Stanley Music, (EMI, 2007)
Desertico, (Tuk Music, 2013)
Carpe Diem, (Tuk Music, 2018)
Paolo Fresu
P60LO FR3SU (Tuk Music, 2021)
As sideman
With Joe Barbieri
Origami, (Microcosmo Dischi, 2017)
With Carla Bley
The Lost Chords find Paolo Fresu (ECM/Watt, 2007)
With Daniele di Bonaventura
Mistico Mediterraneo, (ECM, 2011)
In maggiore, (ECM, 2015)
With Uri Caine
Things (Blue Note, 2006)
think. (Blue Note, 2009)
Two Minuettos (Tǔk Music, 2016)
With Lars Danielsson
Summerwind (ACT, 2018)
With Aldo Romano
Ritual (Owl, 1988)
With Ralph Towner
Chiaroscuro (ECM, 2008)
See also
List of jazz arrangers
References
External links
Official website
1961 births
Living people
People from the Province of Sassari
Flugelhorn players
Italian jazz trumpeters
Male trumpeters
Italian composers
Music in Sardinia
RCA Records artists
Columbia Records artists
Blue Note Records artists
Nastro d'Argento winners
Italian jazz musicians
20th-century Italian musicians
21st-century Italian musicians
20th-century trumpeters
21st-century trumpeters
20th-century Italian male musicians
21st-century Italian male musicians
Male jazz musicians
ACT Music artists
Label Bleu artists
Paolo Fresu. "Tempo e relazione" in Brooklyn Rail (September 2021), as part of section "How Long Is Now?" guest edited by Francesca Pietropaolo: https://brooklynrail.org/2021/09/criticspage |
61330113 | https://en.wikipedia.org/wiki/Ken%20Saxon | Ken Saxon | Kendall Reginald James von Tunzelmann Saxon (1 November 1894 – 1 June 1976) was a New Zealand soldier, first-class cricketer and educator.
Ken Saxon was born in Nelson, New Zealand, one of seven children of James and Clara Saxon. He was educated at Nelson College and returned to teach there in 1913.
Saxon served in the First World War as an officer in the New Zealand Rifle Brigade. While serving as a lieutenant in the 4th Battalion in 1916 he was awarded the Military Cross for "conspicuous gallantry in action". In 1918, as a captain in the 1st Battalion, he was awarded a bar to his MC for "conspicuous gallantry and devotion to duty". Each time he had shown courage and leadership under fire, the first time while wounded. His older brother Jack was killed at the Somme in 1916.
In October 1919 he began studying science at Emmanuel College, Cambridge. He represented Cambridge in the rugby match against Oxford in 1920, but a war wound to his knee prevented his taking part in 1921. He won the long jump at the Cambridge University sports in 1921 with a jump of 21 feet 9 inches, beating the future Olympian Harold Abrahams by one inch. He graduated in June 1922, married Frances Smyth of Monks Kirby, Warwickshire, in Farnham Royal, Buckinghamshire, on 29 June, and sailed for New Zealand on 20 July to take up a position at Nelson College.
Saxon captained Nelson when they won the Hawke Cup from Wanganui in January 1924, opening the batting and making the two highest scores of the match, 59 and 42 not out. A month later he was selected in the Canterbury team to play a first-class match against the touring New South Wales, again opening the batting, and making 43 and 0.
He returned to England in the mid-1920s, taking up a teaching position in Cambridgeshire. At the end of 1928 he began teaching at Merchant Taylors' School, Northwood.
He played regularly for the Cambridgeshire team in Minor Counties cricket from 1927 to 1934. His highest score in Minor Counties cricket was 160, opening the batting against Surrey Second XI in 1933.
He married for a second time in May 1931 to Elizabeth Francis of Cambridge. They lived in London.
References
External links
1894 births
1976 deaths
People from Nelson, New Zealand
New Zealand military personnel of World War I
New Zealand Army officers
New Zealand recipients of the Military Cross
Victoria University of Wellington alumni
New Zealand cricketers
Canterbury cricketers
Alumni of Emmanuel College, Cambridge
Cambridge University R.U.F.C. players
Cambridgeshire cricketers
New Zealand schoolteachers
New Zealand emigrants to the United Kingdom
People educated at Nelson College
Nelson College faculty |
65671209 | https://en.wikipedia.org/wiki/Rajee%20Samarasinghe | Rajee Samarasinghe | Rajee Samarasinghe (born January 12, 1988) is a Sri Lankan filmmaker and visual artist. His work explores a wide array of topics including the Sri Lankan Civil War, his family, and the deconstruction of documentary and narrative film.
Early life and education
Samarasinghe was born in Colombo, Sri Lanka, in 1988, during the Sri Lankan Civil War. He moved to the United States in 1998 where he is currently based. Initially interested in illustration, his focus later shifted to film. He received a Bachelor of Fine Arts in Visual Arts (Media) from the University of California San Diego and a Master of Fine Arts in Film and Video from the California Institute of the Arts.
Career
Samarasinghe's 2016 short film, If I Were Any Further Away I’d Be Closer to Home, premiered in the international competition at the 62nd International Short Film Festival Oberhausen. Genevieve Yue, writing for Film Comment, stated that "(Lav) Diaz’s visual lyricism was only topped by Rajee Samarasinghe’s If I Were Any Further Away I’d Be Closer to Home, a silent, black-and-white portrait of a Sri Lankan noodle-maker and his family. Shot in HD scope with a vintage anamorphic projector lens mounted to the digital camera, the film is as attentive to the rolling, cutting, and drying batches of long noodles as it is to the shifting patterns of natural light in and around their small workroom, in which a small girl stares up at the swirling dust around her." If I Were Any Further Away I’d Be Closer to Home won the Film House Award for Visionary Filmmaking at the 44th Athens International Film and Video Festival and screened at the 27th FIDMarseille as well as the 60th San Francisco International Film Festival where it was a Golden Gate Award nominee.
Samarasinghe's 2018 short film, Piṭuvahalayā (The Exile), which examines Sri Lanka's post-war era, premiered in the international competition at the 64th International Short Film Festival Oberhausen and subsequently screened at the 62nd BFI London Film Festival.
Samarasinghe's 2020 short film, The Eyes of Summer, which explores his mother's interactions with spirits during her childhood, premiered in the Tiger Short Competition at the 49th International Film Festival Rotterdam, and was included in the 49th New Directors/New Films presented by Film Society of Lincoln Center & MoMA, the 26th Slamdance Film Festival, and the 49th Festival du nouveau cinéma. The film also went on to win the Tíos Award for Best International Film at the 58th Ann Arbor Film Festival.
Samarasinghe's debut feature film, Your Touch Makes Others Invisible, a hybrid documentary investigating the history of enforced disappearances during the Sri Lankan Civil War, has received support from the Sundance Institute and Berlinale Talents.
In 2020, he was named one of Filmmaker Magazine’s 25 New Faces of Independent Film and in 2021 he had a solo exhibition at the Museum of Modern Art.
References
External links
Rajee Samarasinghe - Filmmaker Magazine’s 25 New Faces of Independent Film
1988 births
Sri Lankan filmmakers
Living people
California Institute of the Arts alumni
American people of Sri Lankan descent |
5738184 | https://en.wikipedia.org/wiki/The%20Cutting%20Edge%20%28novel%29 | The Cutting Edge (novel) | The Cutting Edge is a fantasy novel by Dave Duncan
Plot introduction
"The world of Pandemia seethes with tension as imperial troops wage war along its borderlands and omens predict disaster. When the Protocol which restricts the use of magic begins to break down, only a few handpicked people have a chance to preserve the balance of their crumbling society." (1)
Plot summary
The year 3000 is approaching, and life continues as normal for most people. A few, however, are aware that the Protocol (the rules that determine how magic may be used) of the past thousand years is breaking down.
Shandie is battling the Caliph in Zark, and gains himself a new Signifier when Ylo saves the banner from falling. While they follow Imperial decrees and take the war to the elves, King Rap in Krasnegar receives a warning from the gods that he must lose one of his children. After his son sees a vision of a legionary, he realizes that this has to do with the upcoming millennium, he sets out for Hub, the capital of the Impire, to speak with his friend the Imperor.
Thaïle, a Gifted pixie in mysterious Thume, stands Death Watch over a neighbor, and receives her first Word of power. This earns her interest from the College, and Jain arrives at her parents' house to talk to Thaïle. He informs her she will be going to the College next year, and there is nothing she can do about it.
After suffering defeat from summoned dragons at Nefer Moor, the Legion retreats back to Qoble. Shandie and his inner circle decide to head to Hub to speak with the Imperor. Instead of traveling conventionally, they race to Hub to beat the message of their coming. On the way, a cloaked Pixie visits them and tells them of a preflecting pool at Wold Hall (putting your left foot in the pool shows you what you should seek, your right foot shows you what you should avoid). They detour to visit it, and each person's vision guides their actions afterwards.
Thaïle, despondent over not being allowed to meet a man and have her own Place, meets Leéb. They fall in love and find a Place far from home. Thaïle hopes that the College won't find her or care about her, but the College catches up with her just as her child is born. They spirit Thaïle away to the College and the Keeper.
Shandie and company arrive in Hub, and find the Imperor a deranged, drooling husk of his former self. Shandie immediately seizes administrative control, and plans on how to meet with the young man he saw in the pool (who turns out to be Rap son). Ylo's vision was a lovely women naked amid daffodils, and the woman turns out to be Princess Eshiala. When the Imperor finally falls into a coma and dies, preparations are made for the upcoming coronation of Shandie.
During practice, the Warlock Raspnex appears and tells the procession to crown Shandie immediately. Ylo takes charge and completes the ceremony just as the four warlocks' thrones are destroyed by magic. The group meets for a council of war, and go to Dr. Sagorn's house (the vision seen by Sir Acopulo). Rap has just arrived and meets the group at the doctor's house. As they try to puzzle out what is going on, Raspnex shows up and tells them that the evil sorcerer Zinixo is taking over all of the sorcerers in the world, and plans to take over all of Pandemia. After a short discussion, the house is attacked, and Raspnex uses magic to whisk the group away to safety.
Characters in "The Cutting Edge"
Emshandar IV - Imperor
Ylo Yllipo - Signifier for Shandie and the XXth legion. Last of his line
Thaïle - Pixie in Thume
Shandie - Emshandar V. Heir apparent and Prince of the Impire
Sir Acopulo – Shandie's chief political advisor & tactician
Lord Umpily – Shandie's chief of protocol & spymaster
Hardgraa – Shandie's chief of bodyguard
Kadie (Kadolan)– Princess of Krasnegar. Twin of Gath
Inosolan – Queen of Krasnegar. Rap's wife. ex-sorceress
Gath (Gathmore) – Prince of Krasnegar. Twin of Kadie. Has the gift of Prescience (a single word, garnered from a death watch).
Rap – King of Krasnegar, ex-stableboy, ex-demigod, and sorcerer
Zinixo – Dwarven sorcerer imprisoned by Rap
Efflio – Captain of the Sea Beauty and Imperial trader
Eshiala – Princess and wife of Shandie
Jain – Recorder for the Thume College
Gaib - Thaïle's father
Leeb – Husband to Thaïle
Death Bird - Goblin King
Olybino – Warlock and Warden of the east
Raspnex – Warlock and Warden of the north
Lith'rian – Warlock and Warden of the south
Grunth – Witch and Warden of the west
Major themes
Allusions/references to other works
The history of Rap, Insolan, and a younger Shandie are recounted in the series A Man of His Word by Dave Duncan.
Allusions/references to actual history, geography and current science
There are allusions to the Roman Empire, in the military structure and names of the Impire.
The land of Zark, which features prominently in the first series and again briefly in this story, is based largely upon cultural and geographic elements from the Middle East.
Release details
1992, United States, Del Rey, , Pub date 1 September 1992, Hardcover
1993, United States, Del Rey, , Pub date 1 April 1993, Paperback
1994, United Kingdom, Constable & Robinson, , Pub date 1 November 1994, Paperback
Sources, references, external links, quotations
(1) Review by Library Journal at www.amazon.com
Sample chapter from the author's website
1992 Canadian novels
Canadian fantasy novels
Del Rey books |
5001861 | https://en.wikipedia.org/wiki/Jorge%20Enrique%20Abello | Jorge Enrique Abello | Jorge Enrique Abello (born 28 February 1968) is a Colombian actor.
Abello has performed roles in telenovelas, such as: the original version of La Viuda de Blanco (The Widow in white) 1996, as Dr. Dimas Pantoja, opposite Yolandita Monge as Haydée Blanco, Las Ejecutivas (The Executives) 1996, La Mujer en el Espejo (The Woman in the Mirror) 1997, Perro amor (Dog Love) 1998, and the leading man in the original version of Betty La Fea (Betty, the ugly) 1999, opposite leading lady Ana Maria Orozco, Julius 1999, Eco moda (Echo Fashion) 2001, La Costeña y el Cachaco (The coastal girl and the city guy) (2003), Anita no te Rajes (Anita don't screw up) 2004, opposite leading lady Ivonne Montero & Merlina, Mujer Divina" (2005–06)& En los tacones de Eva" (In Eva's heels) (2006), he worked as well in the telenovela "Aquí no hay quien viva" (no one could live here) in 2008 playing the role of Fernando; this has been his first foreign work. Later on in 2010 he worked in the Colombian version of Greys Anatomy A corazon abierto, as Mauricio Hernandez, the Colombian role for Mark Sloan. Finally in 2012 he played the role of Cristobal in the telenovela Donde está Elisa? (Where is Elisa?).
Filmography
References
External links
1968 births
Living people
Colombian male telenovela actors |
13684099 | https://en.wikipedia.org/wiki/Aquileo%20Parra | Aquileo Parra | José Bonifacio Aquileo Elias Parra y Gómez de la Vega was a Colombian soldier, businessman and political figure. He was the President of Colombia between 1876 and 1878.
Biographic data
Aquileo Parra was born in Barichara, Santander, on May 12, 1825. He died in Pacho, Cundinamarca, on December 4, 1900.
Early life
Parra began his early education in the public school of his home town of Barichara, but he was forced to drop out before graduating from high school because of economic hardship. He found a job making and selling hats, and he navigated the Magdalena River, calling on the ports of Magangué, Mompós and Puerto Berrío. He eventually saved enough money to change jobs and became a politician. He spent all his free time learning and studying, and he became an autodidact and highly educated.
Political career
Parra takes his first steps as a politician in the state of Santander as state senator and later, in 1875, elected as president of the same state. He is also elected MP assists to congress for several terms. Para was also elected as delegate to the Constitutional Assembly of Rionegro. He served as minister of the treasury of President Manuel Murillo Toro and later, reappointed to the same position by President Santiago Pérez de Manosalbas.
Parra also served in the military and participated in the civil wars against presidents José María Melo, Mariano Ospina Rodríguez and the Granadine Confederation ("Confederacion Granadina") in 1861.
The presidency
Parra was elected President of Colombia by congress. During the general election for president in 1876, none of the three candidates obtained enough votes to become president. Thus, Congress decide the election by giving Parra 48 votes, Rafael Nuñez 18 votes and Bartolomé Calvo 18 votes. becoming the first and only President of Colombia from Santander.
Parra was inaugurated as President of Colombia on April 1, 1876. Three months later he had deal with the events that lead to the bloodiest civil war of the 19th century. The liberal party was divided in two groups, the "Radicals", loyal to Parra and the "Independent", loyal to Rafel Núñez. The Conservatives, united in one group, launched the military offensive in the States of Antioquia and Cauca.
References
1825 births
1900 deaths
People from Barichara
Presidents of Colombia
Presidential Designates of Colombia
Colombian Liberal Party politicians |
1142909 | https://en.wikipedia.org/wiki/Goofer%20dust | Goofer dust | Goofer dust is a traditional hexing material and practice of the African American tradition of hoodoo from the South Eastern region of the United States of America.
Description
It can generally refer to any powder used to cast a spell, especially if harmful in nature, but specifically refers to a concoction of natural ingredients that can be used to cause harm, trouble or even kill an enemy. Some historical sources, such as some of the interviews conducted by Harry M. Hyatt indicate goofer dust can be synonymous with graveyard dirt.
Use
In practice, it was often used to create illness in victims, such as swelling of the legs or blindness. Recipes for making it vary, but primarily include graveyard dirt and snakeskin. Other ingredients may include ash, powdered sulfur, salt, powdered bones, powdered insect chitin, dried manure, herbs, spices and "anvil dust" — the fine black iron detritus found around a blacksmith's anvil. On page 162 of his autobiography Dr. John / Mac Rebennack wrote: "Goofer dust is a combination of dirt from a graveyard, gunpowder, and grease from them (St. Roch Cemetery, New Orleans) bells." The result usually varies in color from "a fine yellowish-grey" to deep "black dust" depending on the formula, and it may be mixed with local dirt to conceal its deployment.
In the modern day, formulations may be thought to include anything harmful that can come to hand. For example, insecticide powders might be mixed with expired medications, dried medical waste, etc. Regardless of any intended magical effects, synergies between the ingredients might cause real medical harm.
It is sometimes used in love spells of a coercive nature, the severity of which range from the goofer dust being used to provoke helpful spirits to coax the target into love, to the more extreme "love me or die" spells. Rarely, it has been used in gambling spells.
Goofer Dust has also been used as a protection spell. By using graveyard dirt from a loved one of the practitioner, along with salt and pepper and other ingredients, the normally offensive functions of Goofer Dust become protective functions.
Etymology
The word Goofer comes from the Kikongo word "Kufwa", which means "To die". Among older Hoodoo practitioners, this derivation is very clear, because "Goofer" is not only used as an adjective modifying "dust" but also a verb ("He goofered that man") and a noun ("She put a goofer on him"). As late as the 1930s, goofering was a regional synonym for hoodooing, and in North Carolina at least, the meaning of the term was broadened beyond spells of damage, illness, and death to include love spells cast with dominating intent.
A euphemistic word for goofering is "poisoning," which in this context does not refer to a physical poison but to a physical agent that, through magical means, brings about an "unnatural illness" or the death of the victim. Even more euphemistic is the special use of the verb "hurt," which is often defined as "to poison," with the tacit understanding that "to poison" really means "to goofer." The more general verbs "fix" (meaning to prepare a spell) and "trick" (meaning to cast a spell) are also applied to goofering.
In popular culture
In the 1954 Cold War classic Night People (film), Col. Steve Van Dyke (Gregory Peck) spiked a bottle of absinthe with a packet of goofer dust.
The X-Files, in Episode 14 of season 7 (Theef), referenced the use of goofer dust by the vengeful father of a woman who died due to poor hospital care.
Goofer dust was referenced to protect against hellhounds in the television show Supernatural (U.S. TV series), Season 2, episode 8 "Crossroad Blues" and in Season 8, episode 14 "Trial and Error".
In the song "Sarah's Night" on the Voodoo album, King Diamond sings that the character Salem uses graveyard dust (referred to as goofer dust) to send the spirits of dead people into Sarah's head.
Goofer dust is referenced in the more popular series of short films "Scary or Die" in which a grandfather with a family history of dabbling in voodoo and the occult blows "Golfer dust" or as she describes to the watcher, "The ash of her loved ones; in which she says that the grandfather told her that if she felt love in her heart it would "Never die" and therefore hexes her to come back as the undead".
Goofer dust is mentioned in the Willie Mabon blues song "I Don't Know". It was also used in the song "I Got My Mojo Workin".
In "Treemonisha" by Scott Joplin, Zodzetrick refers to himself as the goofer dus' man and 'King of Goofer Dus' Land'.
Lil Johnson recorded a song called "Goofer Dust Swing" in 1937.
Michael Ondaatje refers to goofer dust on page three of Coming Through Slaughter.
Colson Whitehead's 2016 novel The Underground Railroad speaks of a slaveowner hiring a witch to "goofer his property" to prevent anyone from escaping.
References
Hoodoo (spirituality)
Magic powders |