id
stringlengths 3
8
| url
stringlengths 31
219
| title
stringlengths 1
139
| text
stringlengths 4
215k
|
|---|---|---|---|
1548456 | https://en.wikipedia.org/wiki/Spartacus%20%28The%20Farm%20album%29 | Spartacus (The Farm album) | Spartacus is the debut studio album by British rock band the Farm, released on 4 March 1991 through Produce Records. Following a variety of member changes and single releases, the band solidified their line-up in 1987; after a record deal fell through, they opted to start their own label, Produce Records. They recorded the bulk of their debut album in London with former Madness frontman Graham "Suggs" McPherson as producer, while one track from 1987 was produced by the Housemartins members Paul Heaton and Stan Cullimore. Spartacus is a baggy and dance-rock album that takes influence from the work of Buzzcocks, the Clash and the Jam.
Spartacus received generally positive reviews from music critics, though some of them were split on the album's songwriting quality, while others praised it in the context of the baggy scene. The album topped the charts in the United Kingdom. "Groovy Train" was released as its lead single in August 1990, followed by the second single "All Together Now" in November 1990. "Don't Let Me Down" appeared in April 1991, and was promoted with a supporting slot for Happy Mondays in June 1991 at the Elland Road football stadium in Leeds. They then toured the United States with Big Audio Dynamite and Downtown Science. NME and Vox included the album on their lists of the year's best 50 releases.
Background
Influenced by the likes of punk rock acts such as the Clash and the Jam, Peter Hooton decided to become a musician, initially picking up bass briefly before focusing on singing instead. He joined his friend's brother's band after their frontman failed to show up to a rehearsal. The death of John Lennon, coupled with anger towards the Tory party following a speech by leader Margaret Thatcher, inspired Hooton to become a writer. He started the fanzine The End, which chronicled his poems as well as football news, music and politics. The zine helped Hooton grow his confidence as a wordsmith, which he had shied away from after being ridiculed by his school's English teacher. Hooton's band soon became directionless and he was looking for to form another band; through a mutual friend, he met Steve Grimes, guitarist for local punk rock act the Excitements. After an audition, Hooton joined the Excitements, replacing Martin Dunbar. The rest of the band consisted of bassist Phil Stephenson, drummer Neil Campbell and dancer Thomas. While this was occurring, Phil Jones of zine Time for Action and Mick Potter started contributing to The End as it started becoming popular throughout Liverpool. Hooton played his debut show with the Excitements in 1982 at a friend's party. Despite him wanting to keep The End and the Excitements as separate entities, readers of the zine started attending the band's shows.
Several more local gigs ensued, with them changing their name to the Farm as they rehearsed on a farm plot in Lydiate. As they continued performing their punk rock sound, the band appeared out of place from the post-punk scene in Liverpool, featuring the likes of Echo & the Bunnymen, the Teardrop Explodes and Wah!. Andy McVann, who had seen Hooton's first show, joined the Farm as their drummer. Positive reviews from the music press earned the band their first John Peel session in April 1983, where they performed "Information Man", "No Man's Land" and "Memories". In February 1984, they did another session Peel, playing "Hearts & Minds", "Too Late", "Same Old Story" and "Somewhere". In between these sessions, the band went through multiple bassists until they ended up with Carl Hunter. They then appeared on Oxford Road Show, where they met Graham "Suggs" McPherson and Chas Smash, both formerly of Madness. Around this time, the Farm had little money, surviving off residuals from the Peel sessions. A friend of the Farm's was manning the doors at a Madness show and said the Farm were in need of help. Suggs, who had heard one of the Farm's Peel sessions, let them record some demos at Madness' studio on Caledonian Road, London for free. Suggs would subsequently produce their debut single, "Hearts & Minds", later in the year. Simon Moran, who would later found promoter SJM Concerts, became one of the band's early supporters, helping to organise shows for them.
Sometime later, a brass section consisting of Anthony Evans, Steve Levy, George Maher and John Melvin was brought into the band's line-up, shifting their sound towards Northern soul. McVann was involved in a fatal car crash in October 1986; the Farm almost broke up when the brass section left after this incident. In 1987, Roy Bulter filled in McVann's role, and second guitarist Keith Mullen and keyboardist Benjamin Leach were added to the line-up. Bill Drummond, one half of the KLF, who was well versed in the Liverpool scene and the Farm's actives, wanted to become their manager after meeting Hooton in a bar, but ultimately did not. After seeing one of the Farm's performances, Happy Mondays supported them in Liverpool in May 1987. The Farm then went on tour with the Housemartins; they almost signed to the Housemartins' Stan Cullimore's label Fair Play Committee, but the deal fell through when Cullimore decided to write children's books instead. During the discussion state of the deal, Moran wanted 20% of the proposed £25,000 signing bonus, claiming that as their manager he should be paid more; Hooton remarked that they considered him an equal, not a superior. Moran subsequently parted ways with the band at the same time the deal collapsed. "Body and Soul", their next single, was released in 1988 and saw a shift to synth-pop. In an attempt to draw more attention to the band, Hooton concocted a music scene under the name Urchin Rock that would include them and fellow Liverpools bands Rain and the Real People. Hooton then convinced popular journalists to cover the faux movement; it received a lot of press coverage, but did not further the careers of any of the acts grouped under it.
Label and recording
Around the Christmas period in 1989, Paul McKenna, who had been the Farm's merchandise aid, and Hooton had a meeting at the former's flat. McKenna introduced Hooton to Barney Moores, a fan of theirs and son of Littlewoods Pools owner John Moores. Barney Moores had spare money to invest in a business and was interested in helping the band, to which Hooton told him, £25,000 to cover the cost of an album and two singles. Hooton then contacted Kevin Sampson, who had connections around London and was hanging out with Suggs. After a few days, Sampson became the band's manager and travelled from London to Liverpool to set up a meeting. The outcome of it saw the formation of the record label Produce Records with Ian Croft, Wayne Chad, Moors and McKenna as business partners, with Best in Press and Anglo Plugging becoming their press agency and radio plugger, respectively. The label's releases would be distributed by Kent-based company Pinnacle. Part of the money the band received was used to purchase a sampler, in order for them to expand their musical style. Sampson drafted up a eight-page plan that Hooton referred to as "how to get the Farm into the Top 40", which would utilize Anglo Plugging, Madness' studio, booking agent Martin Horn of International Talent Booking, press officier John Best of Savage & Best Management. Hooton admitted that they "didn't know anything" and trusted Sampson's judgement.
Shortly afterwards, the band began working on a cover of "Stepping Stone" (1966) by Paul Revere & the Raiders as their next single. At the suggestion of mixing engineer Terry Farley, who was growing in popularity as a DJ in the acid house movement, the band slowed the track down and incorporated samples from "The Power" (1990) by Snap!. Though the song stalled at number 59 in the UK Singles Chart, the band received a lot of press coverage for it. The Farm tried to record "Higher & Higher" soon after, but were not satisfied with the sound, and decided to work on "Groovy Train" with engineer Mark Saunders instead as the next single. They had played a psychedelic version of "Groovy Train" for a Peel session; for the released version, Farley moved Mullen's guitar from the middle eight to the intro section and added a loop from "The Gas Face" (1989) by 3rd Bass.
Suggs produced nearly every track that would feature on Spartacus, save for "Tell the Story", which had been recorded in 1987 and was produced by Cullimore and Housemartins bandmate Paul Heaton produced. "Hearts & Minds", "How Long", "Sweet Inspiration", "Higher & Higher", "Don't Let Me Down", "Very Emotional" and "All Together Now" were recorded at Mayfair Studios in London in October and November 1990, while "Groovy Train" and "Family of Man" were recorded at Liquidator Studios, and "Tell the Story" was recorded at Fairview Recording Studio in Hull. Kevin Petri engineered the majority of the tracks, except for "Groovy Train" (done by Gary Wilkinson) and "All Together Now" (done by Noel Rafferty). Saunders mixed "Groovy Train" at the Konk studio in London; the majority of the songs were mixed at Westside Studios in London, while "All Together Now" was done at Mayfair and "Family of Man" and "Tell the Story" were remixed at E-Zee, also based in London. Paula David, who was a session vocalist that Suggs knew, and Pete Wylie contributed backing vocals throughout the recordings.
Composition and lyrics
Musically, the sound of Spartacus has been described as baggy and dance-rock, taking influence from the work of Buzzcocks, the Clash and the Jam. AllMusic reviewer Stephen Thomas Erlewine said it had all of the hallmarks of baggy, from "its rolling, neo-psychedelic grooves" to the "blissfully colorful pop hooks". The album's title was taken from the 1960 film of the same name; Grimes in relation to the plot of the film, the name worked as a "very tongue-in-cheek analogy between the Farm, who, like, for years didn't have a record label and then decided to do it ourselves... Basically, in spite of all the major record companies". He said McVann's death influenced some of the tracks on the album, such as "Don't Let Me Down".
The album's opening track, "Hearts & Minds", was slowed down from its original form, which had an offbeat reggae atmosphere to it. Its title alluded to a rally cry spoken by celebrities and politicians of the time; two years before including it on the album, Hooton said that some lyrics were added to "incorporate the plastic gangster fraternity". Though NME reported that the band had used samples from Taxi Driver (1978), Hooton was adamant that they used impersonators for the audio clips. "How Long" recalled the work of U2, while part of its lyrics referred to Hooton and drummer Boulter visiting the Berlin Wall in East Berlin. Hooton explained that the song talked about politicians rooting for change as long as it served their own ambitions. "Sweet Inspiration" was written around the release of Nelson Mandela and is about political prisoners that stand up for their beliefs even when confronted by authority figures. Discussing "Groovy Train", Grimes said it was an interpretation of people that Hooton knew during school that used to be political, but after acid house, "they've just forgotten about all their politics and just though, 'Sod this! Let's just have a good time.... Hooton wrote the lyrics in the weeks following an encounter with a girl at a nightclub in Liverpool. Journalist Paul Lester wrote that the song consisted of an "iridescent African hi-life [atmosphere], quintessentially baggy 'Funky Drummer' shufflebeat and slashing" Steve Jones-aping guitarwork.
"Higher & Higher" talks about a person facing rejection, which Hooton compared to "Should I Stay or Should I Go" (1982) by the Clash. "Don't Let Me Down" targeted Britain's underclass, anchored by as gospel-like backing vocals. The first verse of it grew out of an older, abandoned song titled "That's the Way We Were", with some lines specifically referring to McVann. Hootson said "Family of Man" asks the question of "why don't the police join the family of man, instead of punishing people at every opportunity?" "Tell the Story", which was an update on "Same Old Story", evoked the sound of fellow Liverpool act the Pale Fountains with its acoustic production. Journalist Bob Stanley wrote that the song's lyrics propose that the "derelict buildings and waste-ground tell a truer story about the band's hometown than thousand Jimmy Tarbuck-fuelled platitudes". It initially had six verses, which were then edited down to two for the final version"; Hooton said it referred to the slade trade and the planned redevelopment of Liverpool's Royal Albert Dock. "Very Emotion" evolved out of their 1985 song "Steps of Emotion", and was dedicated to their technician Ray Toohey. He had been involved in a peaceful protest in regards to Risley Remand Centre, but was arrested and imprisoned for 30 months. The band changed the song's lyrics to reflect Toohey's situation, with influence from "Stay Free" (1978) by the Clash.
"All Together Now" began as "No Man's Land", which Hooton had written after the reaction from right-wing press towards Michael Foot wearing a coat that resembled donkey jacket in November 1981. Alongside this, Hooton had read newspaper articles about the Christmas truce during the First World War, which he learned about from training as a history teacher. "No Man's Land" consisted of six verses sections and lacked a defined chorus. For a few years, Grimes wanted to pair the words with the music of a TV advert, which featured a version of Pachelbel's Canon in D. The band did not attempt to match them until after they had bought the aforementioned sampler; while it worked, the song still was void of a chorus section. They refined the song while in the studio, where they came up with an appropriate chorus. At Suggs' recommendation, the six verses were cut down to three, and half of the music for the chorus was similarly dropped. He then included a sample of Sid Vicious' rendition of the 1969 song "My Way" during the middle eight. At Farley's suggestion, the band wanted to include a beat they knew from a hip hop record. As they were unable to recreating it in a London studio, a member of their entourage was tasked with going to Hooton's house in Liverpool to retrieve it. When they sampled the drum loop, they found that it was partially out of synch with the music they had recorded.
Release
By mid-1990, the Farm were being slotted into the baggy scene, much to the chagrin of Hooton. After some persuading from Sampson, the band travelled to Ibiza, where they would shoot A Short Film About Chilling... Ibiza '90. The location was rising in popularity amongst the British youth and dance cultures. The film coincided with the "Groovy Train", helping to grow the band's stature. "Groovy Train" was released as the lead single from Spartacus on 20 August 1990. The CD and 12-inch vinyl versions included different remixes of "Groovy Train"; the CD version also featured a remix of "Stepping Stone". The music video for it featured Bill Dean singing into a piece of rock at a Southport fun fair, cut with some footage of their trip to Ibiza. The success of the track allowed the band to appear on Top of the Pops twice. Produce Records had received offers from various labels to buy them out, including from Sony Music Entertainment, but all of these were declined. While this was occurring, Produce Records were receiving orders to license out the "Groovy Train". One such request was from Sire Records, which was operated by Seymour Stein. He had been to several of the band's performances, which led to them being signed to the label. Up to that point, the song had some success at Modern Rock stations in the United States as an import release.
"All Together Now" was released as the second single from Spartacus on 26 November 1990. The CD edition featured remixes of the song by Farley & Pete Heller and Rocky & Diesel. The music video for "All Together Now", directed by Angus Cameron, sees the band and members of their families drinking in a pub. It was shot in a locale next to Shepherd's Bush Empire in London; they were concerned that if they tried to do it in Liverpool, too many people would try to gain entry. In January 1991, the Farm supported Happy Mondays at the Great British Music Weekend festival, which featured a line-up of Madchester-related acts. Following this, they embarked on a UK tour in February and March 1991. A launch show was scheduled for 7 February 1991, but was cancelled because of a dispute between the band and Flying Records, where the latter had not paid the band for an earlier show. Ahead of the album's release, promotional remixes of "Very Emotional" and "Higher & Higher" done by Farley and Heller were released as a white label 12-inch vinyl record.
After initially being planned for release on 25 February 1991, Spartacus was released on 4 March 1991 through Produce Records in the UK. The album's artwork was created by Hunter, who had experience from attending a graphic art school. Grimes explained that the band were being referred to in the British music press as a "very unglamorous band. We should be, like, working in a building profession, or we should be electricians, that type of thing". He decided that since the press thought that they looked like ordinary people, they would make the artwork "as something you'd see in a supermarket, that you wouldn't look twice at". It featured the Farley and Heller remixes of "Very Emotional" and "Higher & Higher" as additional tracks; the vinyl version limited the remixes to 30,000 copies. To promote the album, the band appeared on the Nicky Campbell show for BBC Radio 1, where they performed "Don't Let Me Down" and "How Long". Around this time, they released their first video album, Groovy Times; it consisted of a live performance of the entire album shot at the London Astoria in December 1990. It also included interviews and the music videos to "Stepping Stone" and "Groovy Train".
Hooton, while appreciative of the attention the band was receiving, felt burnt out from interviews, causing him to lose his voice. The other members of the band similarly suffered from restlessness; Hooton recounted how they were performing in Brighton the same night that the album went to number one "and I don't think we celebrated. We all became blasé even when everywhere on the tour was sold out". "Don't Let Me Down" was released as the album's third single on 22 April 1991; remixes of by Farley and Rocky & Diesel were included as its B-sides. Sampson was insistent on reissuing "Stepping Stone" instead of releasing "Don't Let Me Down", while everyone else at Produce Records were in favour of "Don't Let Me Down". The band were concerned they would be seen as sell outs if they went with Sampson's proposal; though they later admitted that his idea would have been a better choice. The music video for "Don't Let Me Down" was filmed in London and starred Frankie Howerd as the band liked his performance in Up Pompeii! (1969). They had to change one of the lyrics, from "stand up and fight" to "stand up, stand up", as the song would not receive airplay or TV airings due to the Gulf War.
Sire Records released Spartacus in the US on 30 April 1991. Warner Bros. Records product management vice president Steven Baker said Reprise Records was drafted in to help the band at alternative radio in the hopes of having them crossover to top 40 stations. Initially support came from the "Groovy Train" video being on active rotation at MTV. On 1 June 1991, they supported Happy Mondays at the Elland Road football stadium in Leeds. On 3 September 1991, "Groovy Train" was released as a single in the US; it featured remixes of "Groovy Train", "All Together Now" and "Stepping Stone", alongside the non-album single "Mind". As Sire did not like the original music video for "Groovy Train", another one was shot with the band travelling around Manhattan on a London-themed bus. Shortly afterwards, they went on a US tour alongside Big Audio Dynamite and Downtown Science.
Later in the year, the band failed to sell-out a show in Newcastle; Moran told them that Nirvana was playing a show in the city that same night and affected the attendance as a result. Unbeknownst to the Farm, the success of Nirvana's Nevermind (1991) some months earlier allowed for the success of grunge acts such as Alice in Chains, Pearl Jam and Soundgarden. Hooton explained that they were "reading about it [in the press] and we saw the Melody Maker attacking us and we realised they wanted to get rid" of Madchester and baggy and "replace it with something that they were more comfortable with". Around this time, the band's second video album, Spartacus Live, was released, featuring footage from a show at the Royal Court Theatre in Liverpool in March 1991. "All Together Now" was released as a single in the US on 6 February 1992, featuring remixes of "All Together Now" and a live demo of "Over Again".
Related releases and events
In 1991, a box set of Spartacus three singles, plus "Stepping Stone" and "Mind" was released on 12-inch vinyl under the name Boxsetacus; a CD version followed in 1993. In January 1999, NME reported that Produce Records initiated a legal dispute again BMG Entertainment, claiming that "Macarena" (1993) by Los del Río had ripped off "Higher & Higher". The World Intellectual Property Organization later reported that BMG settled out of court on the matter. In May 2004, Edsel Records released Spartacus as double-CD edition, under the moniker Spartacus... Plus, which included B-sides and remixes. The Farm were originally scheduled to the band performed the album in its entirety on a UK tour in April and May 2012, but this was posponed to September and October 2012. Spartacus was then included in the The Complete Studio Recordings 1983–2004 (2015) box set, which included all of the band's studio albums plus bonus discs of B-sides, remixes and radio sessions. BMG Rights Management released an EP of "All Together Now" remixes to celebrate the song's 30th anniversary. In March 2021, BMG released a digital expanded edition of the album to celebrate its 30th anniversary.
"Groovy Train", "Don't Let Me Down" and "All Together Now" were included on the Farm's second compilation album, Best of the Farm (1998). All of the songs from Sparatacus were included, albeit in a different running order, on their third compilation album, The Very Best of the Farm (2001). This feat was nearly duplicated, sans "Very Emotional", for their four compilation album, All Together Now: The Very Best of the Farm (2001). For their fifth compilation album, Alltogethernow – The Very Best of the Farm (2004), "Very Emotional" was reinstated and "How Long" was not included; the accompanying DVD featured the music videos for "Groovy Train", "Don't Let Me Down" and "All Together Now". The whole album was again included on their sixth and seventh compilation albums, All Together Now: The Very Best of the Farm (2009) and Groovy Train: The Very Best of the Farm (2017).
Reception and legacy
Opinion was split on the quality of Spartacus songwriting. While noting that a few of the songs had been previously released, Andrew Collins of NME wrote that it was "as solid as a rock record, yet roomy enough to accommodate" experimentation on tracks such as "Hearts & Minds" and "Tell the Story". Stanley, in a review for Melody Maker praised the band for having "the most astute lyrics" out of their contemporaries, however, "it's that much sadder that this LP is worthy but dull". Doug Iverson of Toledo Blade felt that aside from the first two singles, "it's doubly disappointing that Spartacus [...] is so lame". In a review for Select, writer Graham Linehan countered this by stating that it "keeps you alert and live. There's very little filler, very few signs of exhaustion". He went on to praise the songwriting quality and mention that their "honey appreciation of what a song danceable and memorable guarantees them a longer shelf-life than most".
Some reviewers viewed the Farm as being superior than the baggy tag let on. Erlewine wrote that the album was "one of the more ridiculous by-products of baggy, [...] yet very little of its charm, character, or substance". He added that since the genre was "never about substance, this is particularly damning". Gary Crossing of Record Mirror echoed a similar statement, praising the band's creativity, remarking that Spartacus was "conclusive proof that the Farm are more than just another baggy band". Journalist John Harris, writing in Sounds, said that when compared to their contemporaries, the Farm were "older, wiser, and in far greater command of a killer commercial sensibility" as Spartacus conveys "final confirmation of their sharp musical suss".
Spartacus topped the UK Albums Chart after its first week of release. It was Album of the Month in Select Magazine, and included in Vox magazine's 50 Albums of 1991 list. The NME placed the album at number 32 in their list of the Top 50 Albums of 1991. In 1998, Melody Maker considered it the 20th worst album of all time. In 2014, journalist John Robb wrote that "All Together Now" was "not only a great anthemic and uniting pop record, it also came out" during "one of those rare periods when people felt optimistic and [the song] soundtracked this, add[ing] a poignant working class memory".
Track listing
All songs written by Peter Hooton and Steve Grimes.
"Hearts & Minds" – 4:24
"How Long" – 3:38
"Sweet Inspiration" – 5:29
"Groovy Train" – 4:10
"Higher & Higher" – 4:38
"Don't Let Me Down" – 4:37
"Family of Man" – 4:44
"Tell the Story" – 3:39
"Very Emotional" – 4:41
"All Together Now" – 5:41
"Higher & Higher" (remixed by Pete Heller and Terry Farley) – 6:09
"Very Emotional" (remixed by Heller and Farley) – 6:22
Personnel
Personnel per sleeve.
The Farm
Peter Hooton – lead vocals
Keith Mullin – guitar
Steve Grimes – guitar
Carl Hunter – bass
Ben Leach – synthesizers
Roy Boulter – drums
Additional musicians
Paula David – backing vocals
Pete Wylie – additional backing vocals
Production and design
Graham "Suggs" McPherson – producer (all except track 8), remixing (track 8)
Kevin Petri – engineer (tracks 1–3, 5–7 and 9), remixing (track 8)
Gary Wilkinson – engineer (track 4)
Mark Saunders – mixing (track 4)
Paul Heaton – producer (track 8)
Stan Cullimore – producer (track 8)
Noel Rafferty – engineer (track 10)
Terry Farley – remixing (tracks 11 and 12)
Pete Heller – remixing (tracks 11 and 12)
Charts
References
Citations
Sources
External links
Interview with Pete Hooton with the Xs Noize Podcast – via YouTube
1991 debut albums
The Farm (British band) albums
Spartacus music |
38322291 | https://en.wikipedia.org/wiki/Trishna%20Wildlife%20Sanctuary | Trishna Wildlife Sanctuary | Trishna Wildlife Sanctuary is a wildlife sanctuary in Tripura, India. It was founded in 1988.
The sanctuary is situated in South Tripura District. It is from the sub divisional town of Belonia and is connected with Agartala by state highway. It can be approached either from Belonia in the south or Sonamura in the north. The sanctuary covers an area of 163 square kilometers. It has a number of perennial water rivulets, water bodies and grass land. There are patches of virgin forests which are rich in rare vegetation. Indian gaur (bison) is an attraction of the sanctuary. There are also varieties of birds, deer, hoolock gibbon, golden langur, capped langur, pheasant and many other animals and reptiles.
References
External links
Tripura.nic.in
Wildlife sanctuaries in Tripura
South Tripura district
Lower Gangetic Plains moist deciduous forests
Protected areas with year of establishment missing |
3628845 | https://en.wikipedia.org/wiki/TREMEC%20Corporation | TREMEC Corporation | TREMEC (Transmisiones y Equipos Mecánicos SA de CV, formerly Transmission Technology Corporation, TTC) is a manufacturer of automobile transmissions and drivetrain components based in Querétaro, Mexico.
Company
Torque transfer solutions from TREMEC are found in products ranging from supercars and high-performance sports cars to severe duty, vocational and commercial vehicles worldwide. The portfolio of products includes manual transmissions, dual-clutch transmissions, hybrid and electric vehicle (EV) solutions, gears, driveshafts, clutches, mechatronic systems, transmission control units, and control software.
The company has its US operations based in Novi, Michigan. This deals with sales, marketing and engineering office (and was, until 2018, based in Wixom, Michigan). Production facilities are located in Pedro Escobedo and Santiago de Querétaro, in Mexico, and Zedelgem (Bruges area) in Belgium. TREMEC is a wholly owned subsidiary of KUO Group, which is based in Mexico City.
Some of the first TREMEC products were originally designed by Borg-Warner, including the widely used T-56.
History
TREMEC was founded on April 12, 1964. The genesis was to manufacture transmissions in Mexico for Ford, GM and Chrysler. At that time, the Mexican government enacted a protectionist policy that mandated all vehicles assembled in Mexico have engines and transmissions 100-percent manufactured in Mexico. A joint venture was formed which included one of Ford's large transmissions suppliers – Clark Transmissions – and two entrepreneurial companies based in Mexico. TREMEC's first transmissions would be produced later that same year.
Products
Aftermarket transmissions
Tremec T-5 transmission
Tremec T-45 transmission
Tremec TKO transmission
Tremec T-56 transmission
TREMEC Magnum 6-speed transmission
TREMEC Magnum XL 6-speed transmission
OEM transmissions
Tremec TR-2450 transmission
Tremec TR-3160 transmission
Tremec TR-3450 transmission
Tremec TR-3650 transmission
TR-3655 transmission
Tremec TR-4050 transmission
Tremec TR-6060 transmission
Tremec TR-6070 transmission
Tremec TR-9070 DCT 7-speed dual clutch transmission
Tremec TR-9080 DCT 8-speed dual clutch transmission
Medium & Heavy Duty Truck Transmissions
EASY-SHIFT 5-speed
EASY-SHIFT 7-speed
PRO-SHIFT 6-Speed
PRO-SHIFT 7-Speed
PRO-SHIFT 9-Speed
PRO-SHIFT 10-Speed
PRO-SHIFT 18-Speed
References
External links
Transmission Technologies corporation website
Automotive companies of Belgium
Auto parts suppliers of the United States
Auto parts suppliers of Mexico
Manufacturing companies based in Michigan
Automotive transmission makers |
45211546 | https://en.wikipedia.org/wiki/Mike%20Gore%20%28physicist%29 | Mike Gore (physicist) | Michael Miles Gore (5 September 1934 – 8 January 2022) was a British-born Australian engineer, physicist, and science explainer, who worked at the Australian National University in Canberra. He was noted for being the founder of Questacon, the first interactive science centre in Australia.
Early life
Gore was born in Bolton, Lancashire, on 5 September 1934. He was the only child of May Robinson and Ernest Gore, who worked as an electrical engineer. Gore attended Worsley Technical School for two years, before completing his secondary education at Bolton Senior Tech. He first graduated with a Bachelor of Science in electrical engineering. He subsequently undertook postgraduate studies in that field at Leeds University, obtaining a Doctor of Philosophy in the 1950s.
Professional career
At the conclusion of his studies, Gore was offered a post-doctoral position at Brown University for nine months, as well as the position of lecturer in physics at the Australian National University (ANU) in Canberra. He accepted both positions after arranging a deferral of the starting date of the latter, and consequently immigrated to Australia in 1962. He later became a Professor, and in 1987 left the ANU and was later styled Professor Emeritus. As at early 2015, Gore was a Sessional Lecturer at the ANU, based at the Centre for the Public Awareness of Science.
Explaining science
Gore established Questacon, the national science centre, in Canberra in 1980. It was the first interactive science centre in the country. It was originally based in the recently shuttered, historic Ainslie Public School (built 1927). He was inspired to set up the centre after visiting the Exploratorium in San Francisco in 1976. Questacon moved to the permanent building on Lake Burley Griffin in 1988, after Gore left academia the year before to become the foundation director of Questacon – The National Science and Technology Centre. He retired back to academia in 1999, working as an adjunct professor in science communication.
Gore was a scientific advisor to the ABC television series "Towards 2000". He established the ANU's Centre for the Public Awareness of Science (CPAS) in 1995. In 2010, Gore was a founding member of The Faraday Club, established by Dr Howie Firth, , of the Orkney International Science Festival, to recognise science communicators of international standing and named after Michael Faraday, leading English scientist of the nineteenth century.
Personal life
Gore was married to Joyce Klaber. They met during his time in the United States as a post-doctoral research fellow at Brown University, where she was studying US History. They had three children.
Gore died on 8 January 2022, in Canberra. He was 87 years old.
Honours
1982
'Canberran of the Year'
Churchill Fellowship
1986
Member of the Order of Australia (AM) in recognition of service to scientific education.
1992
Eureka Prize – Gore and Questacon
2001
Award for Outstanding Service to Physics in Australia (Australian Institute of Physics)
2006
Academy Medal, Australian Academy of Science
2015
Officer of the Order of Australia (AO) for distinguished service to science through a range of public outreach, communication and education initiatives on a national and international level, and as a mentor and role model for young scientists.
Publications
Gore, Michael Miles, Interactive science centres: a world wide study (1983)
Gore, MM. Interactive Science and Technology Centres. In: National Engineering Conference (1990 : Canberra, A.C.T.). 1990 National Engineering Conference of the Institution of Engineers, Australia: Government, Engineering and the Nation; Barton, ACT: Institution of Engineers, Australia, 1990: 92-96. National conference publication (Institution of Engineers, Australia); no. 90/1
Sue Stocklmayer, Michael M. Gore, C.R. Bryant (editors), Science Communication in Theory and Practice. Springer Science & Business Media, 31 December 2001, 284 pages.
References
1934 births
2022 deaths
People from Bolton
Alumni of the University of Leeds
Australian National University faculty
Australian physicists
Officers of the Order of Australia
English emigrants to Australia
Brown University faculty |
16093892 | https://en.wikipedia.org/wiki/List%20of%20railway%20stations%20in%20Barcelona | List of railway stations in Barcelona | This is a complete list of Renfe and Ferrocarrils de la Generalitat de Catalunya-operated railway stations in Barcelona, sorted alphabetically, excluding Barcelona Metro stations. It only includes stations strictly located within the municipality of Barcelona proper (as opposed to the metropolitan area of Barcelona).
Stations
Future stations
Former stations
See also
Transport in Barcelona
List of Rodalies Barcelona railway stations
List of Barcelona Metro stations
List of tram stations in Barcelona
Barcelona
Railway stations |
8646987 | https://en.wikipedia.org/wiki/Royal%20Moroccan%20Army | Royal Moroccan Army | The Royal Moroccan Army ( Al-Quwwat al-Bariyah al-Malakiyah al-Maghribiyah, tasrdast tagldant) is the branch of the Royal Moroccan Armed Forces responsible for land-based military operations.
The Royal Moroccan Army is about 215,000 troops strong and consists of 195,000 professional soldiers and 20,000 conscripts. In case of war or state of siege, an additional force of 150,000 Reservists and paramilitary forces, including 24,000 regulars of the Royal Moroccan Gendarmerie and 30,000 Auxiliary Forces come under the Ministry of Defense command.
Army forces from Morocco have taken part in different wars and battles during the twentieth century, from World War I, to the recent Central African Republic conflict.
History
The Moroccan army has existed continuously since the rising of Almoravid Empire in the 11th-century. During the protectorate period (1912–1955), large numbers of Moroccans were recruited for service in the Spahi and Tirailleur regiments of the French Army of Africa (French: Armée d'Afrique). Many served during World War I. During World War II more than 300,000 Moroccan troops (including goumier auxiliaries) served with the Free French forces in North Africa, Italy, France and Austria. The two world conflicts saw Moroccan units earning the nickname of "Todesschwalben" (death swallows) by German soldiers as they showed particular toughness on the battlefield. After the end of World War II, Moroccan troops formed part of the French Far East Expeditionary Corps engaged in the First Indochina War from 1946 to 1954.
The Spanish Army also made extensive use of Moroccan troops recruited in the Spanish Protectorate, during both the Rif War of 1921–26 and the Spanish Civil War of 1936–39. Moroccan Regulares, together with the Spanish Legion, made up Spain's elite Spanish Army of Africa. A para-military gendarmerie, known as the "Mehal-la Jalifianas" and modelled on the French goumieres, was employed within the Spanish Zone.
The Royal Armed Forces were created on 14 May 1956, after French Morocco, a French Protectorate, was dissolved. Fourteen thousand Moroccan personnel from the French Army and ten thousand from the Spanish Armed Forces transferred into the newly formed armed forces. This number was augmented by approximately 5,000 former guerrillas from the "Army of Liberation". About 2,000 French officers and NCOs remained in Morocco on short term contracts, until crash training programmes at the military academies of Saint-Cyr, Toledo and Dar al Bayda produced sufficient numbers of Moroccan commissioned officers.
The first wars that Moroccan troops have taken part in the 20th century as an independent country were the Ifni War and Sand War.
In the early 1960s, Moroccan troops were sent to the Congo as part of the first multifunctional UN peacekeeping operation, ONUC. But the Moroccan Armed Forces were most notable in fighting a 25-year asymmetric war (Western Sahara War) against the POLISARIO, an Algerian backed rebel national liberation movement seeking the independence of Western Sahara from Morocco.
The Royal Moroccan Army fought during the Six-Day War and on the Golan front during the Yom Kippur War of 1973 (mostly in the battle for Quneitra) and intervened decisively in the 1977 conflict known as Shaba I to save Zaire's regime. After Shaba II, Morocco was part of the Inter-African Force deployed on the Zaire border, contributing about 1,500 troops. The Armed Forces also took part in the Gulf War with a Mechanized Battalion and an infantry battalion in the Omar and Tariq Task Forces.
In the 1990s, Moroccan troops went to Angola with the three UN Angola Versification Missions, UNAVEM I, UNAVEM II, and UNAVEM III. They were also in Somalia, with UNOSOM I, the U.S.-led Unified Task Force (UNITAF), sometimes known by its U.S. codename of 'Restore Hope,' and the follow-on UNOSOM II. They saw fighting during the 3–4 October 1993 confrontation in Mogadishu to rescue a U.S. anti-militia assault force. Other peace support involvement during the 1990s included United Nations Transitional Authority in Cambodia (UNTAC) in Cambodia, and the missions in the former Yugoslavia: IFOR, SFOR, and KFOR.
Recent United Nations deployment in Africa and elsewhere have included the United Nations Organization Stabilization Mission in the Democratic Republic of the Congo (MONUSCO), the UNOCI, BINUCA and MISCA (2014)
Other missions have included:
Perejil Island crisis
International Security Assistance Force Joint Command
Operation Scorched Earth
MINUSTAH
United Nations Supervision Mission in Syria (UNSMIS)
Algeria, Morocco, and other Maghreb states affected by the GSPC insurgency have been assisted in fighting Islamist militants by the United States and the United Kingdom since 2007, when Operation Enduring Freedom – Trans Sahara began.
Army of Liberation
The Army of Liberation (, ) was a force fighting for the independence of Morocco. In 1956, units of the Army began infiltrating Ifni and other enclaves of Spanish Morocco, as well as the Spanish Sahara. Initially, they received important backing from the Moroccan government. In the Spanish Sahara, the Army rallied Sahrawi tribes along the way, and triggered a large-scale rebellion. In early 1958, the Moroccan king reorganized the Army of Liberation units fighting in the Spanish Sahara as the "Saharan Liberation Army" .
The revolt in the Spanish Sahara was put down in 1958 by a joint French and Spanish offensive. The king of Morocco then signed an agreement with the Spanish, as he asserted control over the rebellious southern border areas, and parts of the Army of Liberation was absorbed back into the Moroccan armed forces.
Nationalistic Moroccans tend to see the Army of Liberation battles in Western Sahara as a proof of Western Sahara's loyalty to the Moroccan crown, whereas sympathizers to the Polisario Front view it only as an anti-colonial war directed against Spain. Sahrawi veterans of the Army of Liberation today exist on both sides of the Western Sahara conflict, and both the Kingdom of Morocco and the Sahrawi Arab Democratic Republic celebrate it as part of their political history.
Forces today
Situation and equipment
From the beginning of 21st-century, the Moroccan army began a modernisation program that included the purchase of modern equipment and the transformation into a more professional army performing multiple exercises with allied's armies, and as a Major non-NATO ally of the US, and member of the initiative 5+5 and other cooperation agreements. The army's modernisation program took shape with the acquisitions of weapons such as the Chinese VT-1A and MRLS AR2, American M1A1 Abrams, the HAWK air defense system or the M109A5 Self-Propelled Howitzer.
The organisation and structure of command remained the same:
General Command HQ (Rabat)
Northern operational Sector.
eastern Command HQ (Errachidia)
Eastern operational sector
Tafilalt operational sector
Saghro operational sector
Southern Command (Agadir)
Oued draa operational sector.
Sakia El Hamra operational sector.
Oued eddahab operational sector.
Formations are as follows:
2 Airborne infantry brigades.
15 Motorised infantry brigades/Regiments.
3 Royal Armored brigades.
13 Royal tanks regiments.
6 mechanised infantry brigades.
24 Royal Artillery groups(4 Ground to air Groups/2 Rocket artillery groups/18 field artillery groups)
1 light security brigade.
1 mechanised intervention brigade.
1 mountain infantry battalion.
2 Royal cavalry regiments.
12 Borders surveillance battalions.
17 intervention light infantfy battalions.
International projection
The Kingdom of Morocco is part of multiple international organisations, is a Major non-NATO ally, part of the Arab League, and has established military cooperation with different countries such as USA, Russia, Portugal, Tunisia, China, Qatar, Italy, France, Spain, UAE or Turkey. As part of the UN, Moroccan Army participated in different Peacekeeping missions. Moroccan troops were sent as part of SFOR, KFOR, MINUSTAH or the more recent UNSMIS in Syria. It has also responded the call of its allies, taking part of conflicts such as Shaba I, Battle of Mogadishu (1993), the Gulf War or the Operation Scorched Earth, among others. Morocco has dispatched several field hospitals to conflict zones and areas affected by natural disasters, the latest contributions were at Libyan Civil War, the Syrian civil war. and in the Gaza strip after Operation Pillar of Defense.
The Royal Moroccan Army also performs annual training exercise called "African Lion" with the United States Marine Corps. The exercise is a regularly scheduled, combined U.S. - Moroccan military exercise designed to promote improved interoperability and mutual understanding of each nation's tactics, techniques, procedures, unit readiness and enhancing foreign relations.
Morocco has also been the venue for Exercise "Jebel Sahara" since September 2000, taken 10 times since, and gathering elements from 33 Squadron, 230 Squadron, 18 Squadron, 27 Squadron, Joint Helicopter Force HQ from RAF Benson, 1st Battalion Royal Gibraltar Regiment and 2nd Brigade d’Infanterie Parachutiste of the Royal Moroccan Army. The aim of the Exercise was to increase the Support Helicopter warfighting capability in desert 'hot and high' conditions and foster good relations between the UK and Morocco. To achieve this, the scenario consisted of a joint counter insurgency operation in the desert and mountain foothills to re-establish control and authority within a troubled region of North Africa. Another exercises were the "Jebel Tarik", with the Moroccan contribution of service personnel to an annual bilateral deployment of two companies (up to 180 personnel) of the Royal Gibraltar Regiment (RG) to the UK, on seven occasions since 2003. "Desert Vortex", a one-off bilateral helicopter exercise which is run between 16 May and 30 June 2009. This was a UK training exercise with objectives set by Joint Helicopter Command (JHC) and run concurrently with Moroccan Air Force annual helicopter crew training.
The Royal Gibraltar Regiment ran an exercise with the Moroccan 2e Brigade d'Infanterie Parachutiste (2e BIP) in late 2008.
The Royal Armed Forces also take part of different international exercises as Leapfest, Flintlock, Blue Sand, and occasional military operations exercises with Belgium, U.A.E., Spain, France and others.
Ranks and structure
Officers
Général de l'armé et commandant en chef: Retained by His Majesty the King of Morocco.
Enlisted
In 2009, the Moroccan army had:
Equipment
Uniform
The most common service uniform of the Royal Moroccan Army is olive drab, but you can also see Moroccan troops with other types of uniforms such as the Desert lizard, Red Lizard and Camouflage Central-Europe uniforms.The uniform has been changed into a newer and modern one :
See also
Royal Moroccan Armed Forces
Royal Moroccan Navy
Royal Moroccan Air Force
Moroccan Royal Guard
Royal Moroccan Gendarmerie
Auxiliary Forces
References
Further reading
Anthony Cordesman, 'A Tragedy of Arms'
John Keegan "World Armies"
R. Hure "L'Armee d' Afrique 1830-1962"
Military of Morocco
Military units and formations established in 1956 |
550961 | https://en.wikipedia.org/wiki/Pied%20thrush | Pied thrush | The pied thrush (Geokichla wardii) is a member of the thrush family found in India and Sri Lanka. The males are conspicuously patterned in black and white while the females are olive brown and speckled. They breed in the central Himalayan forests and winter in the hill forests of southern India and Sri Lanka. Like many other thrushes, they forage on leaf litter below forest undergrowth and fly into trees when disturbed and sit still making them difficult to locate.
Description
Males of this thrush are conspicuously black and white. Mostly black on the upper parts it has a long white supercilium, and white tips to the wing coverts, tertials, rump and tail. The underparts are white with black flank spots the bill and legs are yellow. Females and young birds have the same basic pattern, but the black is replaced by dark brown, and the white by light brown. The markings on the underside are scalier. The third primary is the longest followed by the fourth with the second and fifth being nearly equal in length. The first primary is reduced.
The bill is not as strongly curved as that of the dark-sided thrush or the long-billed thrush and the female lacks the prominent pale cheek spot of the similar looking female Siberian thrush.
The binomial commemorates Samuel Neville Ward (1813–1897), a British colonial administrator in India from 1832 to 1863. Jerdon and Charles Darwin corresponded with S.N. Ward who worked in the Madras Civil Service, posted for sometime at Sirsi and was known for his natural history studies and artistic talent.
Thomas C. Jerdon who first obtained a specimen of the species from Ward notes:
The species was variously placed in the past and for a long time in the genus Zoothera along with many other thrushes but molecular phylogenetic studies in 2008 clarified the phylogeny and the requirements for monophyly of the genera led to the older genus Geokichla being resurrected. The genus Zoothera now contains species that are not strongly sexually dimorphic unlike Geokichla. The pied thrush's closest relative is the Siberian thrush Geokichla sibirica.
Distribution
The summer breeding range is from western Himachal Pradesh in the Himalayas east at least until central Nepal. Records from further east such as Sikkim have been questioned by Rasmussen and Anderton (2005). The pied thrush is migratory, wintering mainly in Sri Lanka, with smaller numbers in the hills of south India. During passage, they may be preyed on by crows.
Although rare, they are locally and seasonally seen regularly at certain locations in winter such as at Victoria Park in Nuwara Eliya, Sri Lanka, where a number of birds gather by the stream early in the morning or in some hills stations in southern India such as Nandi Hills and Yercaud.
Behaviour and ecology
They forage alone or in pairs, often seen on the ground but flying into the trees and perching still when disturbed. The pied thrush, like many Zoothera thrushes, can be quite secretive. Pied thrushes are omnivorous, but eat more insects than fruit. They form loose flocks in winter.
The breeding season is May to July and the nest is a deep cup lined with grass and cemented with mud and placed in a low tree fork. The clutch consists of 3–4 white or bluish eggs. This uncommon species breeds in the Himalayas between in thick woodland. The wintering areas are similar but include less well-wooded areas, and are generally at altitude.
Their song is not considered as musical as those of many others thrushes and consists of a series of squeaky notes followed by short trills.
References
External links
pied thrush
Birds of the Himalayas
Birds of India
Birds of Nepal
pied thrush |
36061015 | https://en.wikipedia.org/wiki/Paratomoxia%20maynei | Paratomoxia maynei | Paratomoxia maynei is a species of beetle in the genus Paratomoxia of the family Mordellidae. It was described by Píc in 1931.
References
External links
Coleoptera. BugGuide.
Beetles described in 1931
Mordellidae |
39869304 | https://en.wikipedia.org/wiki/Fevzi%20T%C3%BCrkeri | Fevzi Türkeri | Fevzi Türkeri (born 1941, Elazığ) is a former Turkish general. He graduated from the Turkish Military Academy in 1962 and the Kara Harp Akademisi in 1975. During the 1980s and 1990s he was twice Chief of the Special Forces of the Turkish Army. He was General Commander of the Gendarmerie of Turkey from 26 August 2004 to 24 August 2006.
References
1941 births
Living people
Turkish Army generals
General Commanders of the Gendarmerie of Turkey
Special Warfare Department personnel
Turkish Military Academy alumni
Commanders of the Second Army of Turkey
People from Elazığ |
28095958 | https://en.wikipedia.org/wiki/Bamba%20Bakary | Bamba Bakary | Bamba Bakary is an Ivorian actor, comedian and television presenter from the Ivory Coast.
Formerly an air steward for Air Afrique, Bakary became an ambassador for the prevention of AIDS for Africans, including in his role as Moussa, in Moussa le taximan. He is also the presenter of three shows on La Première (RTI) : Tonnerre which is shown regularly, Le bon vieux temps and Bonne cuisine.
Filmography
1988 : Dancing in the Dust, by Henri Duparc
1990 : Le Sixième Doigt, by Henri Duparc
2008- : Coup de force
2008- : Dr Boris
References
20th-century Ivorian male actors
Male comedians
Living people
Year of birth missing (living people)
21st-century Ivorian male actors |
7326713 | https://en.wikipedia.org/wiki/Ron%20Barrier | Ron Barrier | Ron Barrier is the former national spokesperson and media coordinator of American Atheists, and he frequently appears in U.S. media to present arguments from an atheist perspective. He has debated Christian apologist William Lane Craig over the existence of God.
Barrier produces the cable TV program "The Atheist Viewpoint" in Staten Island, New York.
References
Year of birth missing (living people)
Living people
American atheism activists
Television producers from New York City
American television talk show hosts
21st-century atheists |
57142395 | https://en.wikipedia.org/wiki/Percy%20Kelly%20%28artist%29 | Percy Kelly (artist) | Percy Kelly (1918–1993) was a Cumbrian artist, footballer, post office worker and transvestite. He is most famous for his drawings and paintings which he hoarded during his lifetime – "They are so important to me I could never sell them".
References
Citations
Sources
Further reading
Joint winner of Lakeland Book of the Year 2012; letters to Mary Burkett, director of Abbot Hall Art Gallery
External links
Percy Kelly website
1918 births
1993 deaths
Cross-dressers
English artists
British postmen
British postmasters
Workington A.F.C. players
Association footballers not categorized by position
Transgender sportspeople
LGBT association football players
LGBT sportspeople from England
English footballers
20th-century LGBT people |
38777568 | https://en.wikipedia.org/wiki/N-acetylglucosaminyldiphosphodolichol%20N-acetylglucosaminyltransferase | N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase | N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase (, UDP-GlcNAc:dolichyl-pyrophosphoryl-GlcNAc GlcNAc transferase, uridine diphosphoacetylglucosamine-dolichylacetylglucosamine pyrophosphate acetylglucosaminyltransferase, N,N'-diacetylchitobiosylpyrophosphoryldolichol synthase) is an enzyme with systematic name UDP-N-acetyl-D-glucosamine:N-acetyl-D-glucosaminyl-diphosphodolichol N-acetyl-D-glucosaminyltransferase. This enzyme catalyses the following chemical reaction
UDP-N-acetyl-D-glucosamine + N-acetyl-D-glucosaminyl-diphosphodolichol UDP + N,N'-diacetylchitobiosyl-diphosphodolichol
References
External links
EC 2.4.1 |
43026130 | https://en.wikipedia.org/wiki/Time%20Doesn%27t%20Heal | Time Doesn't Heal | Time Doesn't Heal () is the sixth Mandarin studio album by Taiwan-born Malaysian Mandopop artist Freya Lim (). It was released on 2 May 2014 by Rock Records.
Track listing
Notes
"歲月這把刀 (Time Doesn't Heal)" is the closing theme song of the television series Fabulous 30 (女人30情定水舞間).
"我們的故事只講了一半 (Unfinished Story)" is featured in the television series Just You.
"明明愛你 (Hidden Love)" is the closing theme song of the television series In a Good Way.
Music videos
References
External links
Rock Records Taiwan - 歲月這把刀
2014 albums
Freya Lim albums
Rock Records albums
Mandopop albums |
53794893 | https://en.wikipedia.org/wiki/Jane%20Waldfogel | Jane Waldfogel | Jane Waldfogel FBA is an American social economist and the Compton Foundation Centennial Professor of Social Work for the Prevention of Children's and Youth Problems at Columbia University. Her research focuses on work-family policies, improving the measurement of poverty, and understanding social mobility across countries and child welfare. She has published studies about the impact of public policies on child and family well-being.
Education and career
Waldfogel received her B.A. from Radcliffe College in 1976, her M.Ed. from the Harvard Graduate School of Education in 1979, and her Ph.D. in public policy from the Kennedy School of Government at Harvard University in 1994.
She was elected as a Corresponding Fellow of the British Academy in 2015.
References
External links
Faculty page at the Columbia University School of Social Work
Faculty page at the Columbia Population Research Center
Columbia University faculty
American sociologists
American women sociologists
Living people
American women economists
21st-century American economists
Radcliffe College alumni
Harvard Graduate School of Education alumni
Harvard Kennedy School alumni
Corresponding Fellows of the British Academy
Social work scholars
Year of birth missing (living people)
21st-century American women |
60469076 | https://en.wikipedia.org/wiki/Kundasang%20%28state%20constituency%29 | Kundasang (state constituency) | Kundasang is a state constituency in Sabah, Malaysia, that is represented in the Sabah State Legislative Assembly.
History
Election results
References
Sabah state constituencies |
1497773 | https://en.wikipedia.org/wiki/CNS%2011643 | CNS 11643 | The CNS 11643 character set (Chinese National Standard 11643), also officially known as the Chinese Standard Interchange Code or CSIC (), is officially the standard character set of Taiwan (Republic of China). In practice, variants of the related Big5 character set are de facto standard.
CNS 11643 is designed to conform to ISO 2022. It contains 16 planes, so the maximum possible number of encodable characters is 16×94×94 = 141376. Planes 1 through 7 are defined by the standard; since 2007, planes 10 through 15 have also been defined by the standard. Prior to this, planes 12 to 15 (35344 code points) were specifically designated for user-defined characters. Unlike CCCII, the encoding of variant characters in CNS 11643 is not related.
EUC-TW is an encoded representation of CNS 11643 and ASCII in Extended Unix Code (EUC) form. Other encodings capable of representing certain CSIC planes include ISO-2022-CN (planes 1 and 2) and ISO-2022-CN-EXT (planes 1 through 7).
History
The first edition of the standard was published in 1986, and included planes 1 and 2, deriving from levels 1 and 2 of Big5, with some re-ordering due to corrected stroke counts, two duplicate characters being omitted, and the addition of 213 classical radicals. Extensions to the standard were subsequently published in 1988 (6319 characters, occupying plane 14) and 1990 (7169 characters, occupying plane 15).
Unicode 1.0.0, although it did not yet include hanzi, included characters for compatibility with CNS 11643: the CJK Compatibility Forms block was titled "CNS 11643 Compatibility" in Unicode 1.0.0. When the Unicode CJK Unified Ideographs set was being compiled for Unicode 1.0.1, the national bodies submitted character sets to the CJK Joint Research Group for inclusion. The version of CNS 11643 submitted included the plane 14 extension, in addition to further desired characters appended to plane 14 (after 68-21, the last used code point in the standard version of the extension).
In the second edition of the standard, published in 1992, a much larger collection of hanzi was defined across seven planes. A subset of the 1988 plane 14 extension, including the 6148 code points 01-01 through 66-38, became plane 3 (with the remaining 171 characters, code points 66-39 through 68-21, being instead distributed amongst plane 4). The plane 15 extension was not included, although 338 of its characters were included amongst planes 4 through 7.
The third edition of the standard, published in 2007, added the Euro sign, ideographic zero, kana and extensions to the existing bopomofo and Roman alphabet support to plane 1. It introduced planes 10 through 14, containing additional hanzi, and incorporated the existing plane 15 extension into the standard itself (with gaps left where the characters already existed in planes 4 through 7). It also added 128 further hanzi to plane 3, starting at code point 68-40.
, there are several thousand CNS 11643 characters with no corresponding Unicode character, mostly in planes 10 through 14; these are mapped to the Unicode Supplementary Private Use Area.
Relationship to Big5
Levels 1 and 2 of the Big5 encoding correspond mostly to CNS 11643 planes 1 and 2, respectively, with occasional differences in order, and with two duplicate hanzi existing in Big5 but not in CNS 11643. They can be mapped using a list of ranges. However, the 213 classical radicals in CNS 11643 plane 1 are additional to the characters available in Big5, and further additional characters were added to CNS 11643 plane 1 in 2007. The Big5-2003 variant of Big5 is defined as a partial encoding of CNS 11643.
Within the Big5 hanzi repertoire, only one character is conventionally mapped to Unicode differently from the corresponding character from the first two CNS 11643 planes: to U+5F5D (彝), whereas its CNS plane 1 counterpart is mapped to a related variant at U+5F5E (彞). However, some variant mappings for Big5, such as some defined by IBM, include U+5F5E rather than U+5F5D.
References
This page is based on the information on the CNS official web site.
External links
CNS 11643 official web site
Current CNS 11643 open data, including mapping data
Unicode Consortium mappings for CNS 11643-1986: planes 1 and 2, plus the 1988 plane 14 (not the 2007 plane 14) with extensions. Uses a single prefixed hex digit to indicate plane.
CNS 11643 mappings from International Components for Unicode (ICU):
"CNS-11643-1992": original version, current version. The original version of the mapping includes standard planes 1–7 but includes the plane 15 layout as plane 9; the current version includes only planes 1 and 2. Uses prefixed 0x81 through 0x89 to indicate plane.
"EUC-TW-2014": standard assignments for planes 1 through 7 and 15, and IBM corporate assignments in planes 12 and 13. CNS codes in EUC format with two-byte plane 1.
ISO-IR registered CNS-11643 code charts: plane 1, plane 2, plane 3, plane 4, plane 5, plane 6, plane 7
Character sets
Chinese-language computing |
58019182 | https://en.wikipedia.org/wiki/Catherine%20Adifaka | Catherine Adifaka | Catherine Adifaka is a senior government official in the Solomon Islands. She was the first woman to be appointed as the Solomon Islands' Public Service Commissioner.
Life
Adifaka was appointed to the Constitutional Congress of the Solomon Islands in 2007.
References
Solomon Islands women in politics
Living people
Year of birth missing (living people) |
12426 | https://en.wikipedia.org/wiki/Groucho%20Marx | Groucho Marx | Julius Henry "Groucho" Marx (; October 2, 1890 – August 19, 1977) was an American comedian, actor, writer, stage, film, radio, singer, television star and vaudeville performer. He is generally considered to have been a master of quick wit and one of America's greatest comedians.
He made 13 feature films as a team with his siblings the Marx Brothers; he was the third-born of the brothers. He also had a successful solo career primarily on radio and television, most notably as the host of the game show You Bet Your Life.
His distinctive appearance, carried over from his days in vaudeville, included quirks such as an exaggerated stooped posture, spectacles, cigar, and a thick greasepaint mustache and eyebrows. These exaggerated features resulted in the creation of one of the most recognizable and ubiquitous novelty disguises, known as Groucho glasses: a one-piece mask consisting of horn-rimmed glasses, a large plastic nose, bushy eyebrows and mustache.
Early life
Julius Henry Marx was born on October 2, 1890, in Manhattan, New York. Marx stated that he was born in a room above a butcher's shop on East 78th Street, "Between Lexington & 3rd", as he told Dick Cavett in a 1969 television interview. The Marx children grew up in a turn-of-the-century building on East 93rd Street off Lexington Avenue in a neighborhood now known as Carnegie Hill on the Upper East Side of the borough of Manhattan. His older brother Harpo, in his memoir Harpo Speaks, called the building "the first real home they ever knew". It was populated with European immigrants, mostly artisans. Just across the street were the oldest brownstones in the area, owned by people including the well-connected Loew Brothers and William Orth. The Marx family lived there "for about 14 years," Groucho also told Cavett.
Marx's family was Jewish. His mother was Miene "Minnie" Schoenberg, whose family came from Dornum in northern Germany when she was 16 years old. His father was Simon "Sam" Marx, who changed his name from Marrix, and was called "Frenchie" by his sons throughout his life, because he and his family came from Alsace in France. Minnie's brother was Al Schoenberg, who shortened his name to Al Shean when he went into show business as half of Gallagher and Shean, a noted vaudeville act of the early 20th century. According to Marx, when Shean visited, he would throw the local waifs a few coins so that when he knocked at the door he would be surrounded by adoring fans. Marx and his brothers respected his opinions and asked him on several occasions to write some material for them.
Minnie Marx did not have an entertainment industry career but had intense ambition for her sons to go on the stage like their uncle. While pushing her second son Leonard (Chico Marx) in piano lessons, she found that Julius had a pleasant soprano voice and the ability to remain on key. Julius's early career goal was to become a doctor, but the family's need for income forced him out of school at the age of twelve. By that time young Julius had become a voracious reader, particularly fond of Horatio Alger. Marx would continue to overcome his lack of formal education by becoming very well-read.
After a few stabs at entry-level office work and jobs suitable for adolescents, Julius took to the stage as a boy singer with the Gene Leroy Trio, debuting at the Ramona Theatre in Grand Rapids, Michigan, on July 16, 1905. Marx reputedly claimed that he was "hopelessly average" as a vaudevillian, but this was typical Marx, wisecracking in his true form. By 1909, Minnie Marx had assembled her sons into an undistinguished vaudeville singing group billed as "The Four Nightingales". The brothers Julius, Milton (Gummo Marx) and Arthur (originally Adolph, but Harpo Marx from 1911) and another boy singer, Lou Levy, traveled the U.S. vaudeville circuits to little fanfare. After exhausting their prospects in the East, the family moved to La Grange, Illinois, to play the Midwest.
After a particularly dispiriting performance in Nacogdoches, Texas Julius, Milton, and Arthur began cracking jokes onstage for their own amusement. Much to their surprise, the audience liked them better as comedians than as singers. They modified the then-popular Gus Edwards comedy skit "School Days" and renamed it "Fun In Hi Skule". The Marx Brothers would perform variations on this routine for the next seven years.
For a time in vaudeville, all the brothers performed using ethnic accents. Leonard, the oldest, developed the Italian accent he used as Chico Marx to convince some roving bullies that he was Italian, not Jewish. Arthur, the next oldest, donned a curly red wig and became "Patsy Brannigan", a stereotypical Irish character. His discomfort when speaking on stage led to his uncle Al Shean's suggestion that he stop speaking altogether and play the role in mime. Julius Marx's character from "Fun In Hi Skule" was an ethnic German, so Julius played him with a German accent. After the sinking of the in 1915, public anti-German sentiment was widespread, and Marx's German character was booed, so he quickly dropped the accent and developed the fast-talking wise-guy character that became his trademark.
The Marx Brothers became the biggest comedic stars of the Palace Theatre in New York, which billed itself as the "Valhalla of Vaudeville". Brother Chico's deal-making skills resulted in three hit plays on Broadway. No other comedy routine had ever so infected the Broadway circuit. All of this stage work predated their Hollywood career. By the time the Marxes made their first movie, they were already major stars with sharply honed skills; and by the time Groucho was relaunched to stardom in television on You Bet Your Life, he had been performing successfully for half a century.
Career
Vaudeville
Marx started his career in vaudeville in 1905 when he joined up with an act called The Leroy Trio. He answered a newspaper want ad by a man named Robin Leroy who was looking for a boy to join his group as a singer. Marx was hired along with fellow vaudeville actor Johnny Morris. Through this act, Marx got his first taste of life as a vaudeville performer. In 1909, Marx and his brothers had become a group act, at first called The Three Nightingales and later The Four Nightingales. The brothers' mother, Minnie Marx, was the group's manager, putting them together and booking their shows. The group had a rocky start, performing in less than adequate venues and rarely, if ever, being paid for their performances. Eventually brother Milton (Gummo) would leave the act to serve in World War I and was replaced by Herbert (Zeppo), and the group became known as the Marx Brothers. Their first successful show was Fun In Hi Skule (1910).
Hollywood
Marx made 26 movies, 13 of them include his brothers Chico and Harpo. Marx developed a routine as a wisecracking hustler with a distinctive chicken-walking lope, an exaggerated greasepaint mustache and eyebrows and an ever-present cigar, improvising insults to stuffy dowagers (frequently played by his old friend Margaret Dumont) and anyone else who stood in his way. As the Marx Brothers, he and his brothers starred in a series of popular stage shows and movies.
Their first movie was a silent film made in 1921 that was never released, and is believed to have been destroyed at the time. A decade later, the team made two of their Broadway hits—The Cocoanuts and Animal Crackers—into movies. Other successful films were Monkey Business, Horse Feathers, Duck Soup and A Night at the Opera. One quip from Marx concerned his response to Sam Wood, the director of A Night at the Opera. Furious with the Marx Brothers' ad-libs and antics on the set, Wood yelled in disgust: "You can't make an actor out of clay." Marx responded, "Nor a director out of Wood."
Marx also worked as a radio comedian and show host. One of his earliest stints was a short-lived series in 1932, Flywheel, Shyster and Flywheel, costarring Chico. Though most of the scripts and discs were thought to have been destroyed, all but one of the scripts were found in 1988 in the Library of Congress.
In 1947, Marx was asked to host a radio quiz program You Bet Your Life. It was broadcast by ABC and then CBS before moving to NBC. It moved from radio to television on October 5, 1950, and ran for eleven years. Filmed before an audience, the show consisted of Marx bantering with the contestants and ad-libbing jokes before briefly quizzing them. The show was responsible for popularizing the phrases "Say the secret word and the duck will come down and give you fifty dollars," "Who's buried in Grant's Tomb?" and "What color is the White House?" (asked to reward a losing contestant a consolation prize).
Throughout his career Marx introduced a number of memorable songs in films, including "Hooray for Captain Spaulding" and "Hello, I Must Be Going", in Animal Crackers, "Whatever It Is, I'm Against It", "Everyone Says I Love You" and "Lydia the Tattooed Lady". Frank Sinatra, who once quipped that the only thing he could do better than Marx was sing, made a film with Marx and Jane Russell in 1951 entitled Double Dynamite.
Mustache, eyebrows, and walk
In public and off-camera, Harpo and Chico were hard to recognize without their wigs and costumes, and it was almost impossible for fans to recognize Groucho without his trademark eyeglasses, fake eyebrows, and mustache.
The greasepaint mustache and eyebrows originated spontaneously prior to a vaudeville performance in the early 1920s when he did not have time to apply the pasted-on mustache he had been using (or, according to his autobiography, simply did not enjoy the removal of the mustache because of the effects of tearing an adhesive bandage off the same patch of skin every night). After applying the greasepaint mustache, a quick glance in the mirror revealed his natural hair eyebrows were too undertoned and did not match the rest of his face, so Marx added the greasepaint to his eyebrows and headed for the stage. The absurdity of the greasepaint was never discussed on-screen, but in a famous scene in Duck Soup, where both Chicolini (Chico) and Pinky (Harpo) disguise themselves as Groucho, they are briefly seen applying the greasepaint, implicitly answering any question a viewer might have had about where he got his mustache and eyebrows.
Marx was asked to apply the greasepaint mustache once more for You Bet Your Life when it came to television, but he refused, opting instead to grow a real one, which he wore for the rest of his life. By this time, his eyesight had weakened enough for him to actually need corrective lenses; before then, his eyeglasses had merely been a stage prop. He debuted this new, and now much-older, appearance in Love Happy, the Marx Brothers's last film as a comedy team.
Marx did paint the old character mustache over his real one on a few rare occasions, including a TV sketch with Jackie Gleason on the latter's variety show in the 1960s (in which they performed a variation on the song "Mister Gallagher and Mister Shean," co-written by Marx's uncle Al Shean) and the 1968 Otto Preminger film Skidoo. In his late 70s at the time, Marx remarked on his appearance: "I looked like I was embalmed." He played a mob boss called "God" and, according to Marx, "both my performance and the film were God-awful!"
The exaggerated walk, with one hand on the small of his back and his torso bent almost 90 degrees at the waist, was a parody of a fad from the 1880s and 1890s. Fashionable young men of the upper classes would affect a walk with their right hand held fast to the base of their spines, and with a slight lean forward at the waist and a very slight twist toward the right with the left shoulder, allowing the left hand to swing free with the gait. Edmund Morris, in his biography The Rise of Theodore Roosevelt, describes a young Roosevelt, newly elected to the State Assembly, walking into the House Chamber for the first time in this trendy, affected gait, somewhat to the amusement of the older and more rural members. Marx exaggerated this fad to a marked degree, and the comedic effect was enhanced by how out of date the fashion was by the 1940s and 1950s.
Personal life
Marx's three marriages ended in divorce. His first wife was chorus girl Ruth Johnson (m. 1920–1942). He was 29 and she was 19 at the time of their wedding. The couple had two children, Arthur Marx and Miriam Marx. His second wife was Kay Marvis (m. 1945–1951), Catherine Dittig, former wife of Leo Gorcey. Marx was 54 and Kay was 21 at the time of their marriage. They had a daughter, Melinda Marx. His third wife was actress Eden Hartford (m. 1954–1969). He was 64 and she was 24 at the time of their wedding.
During the early 1950s, Marx described his perfect woman: "Someone who looks like Marilyn Monroe and talks like George S. Kaufman."
Marx was denied membership in an informal symphonietta of friends (including Harpo) organized by Ben Hecht, because he could play only the mandolin. When the group began its first rehearsal at Hecht's home, Marx rushed in and demanded silence from the "lousy amateurs". The musicians discovered him conducting the Los Angeles Symphony Orchestra in a performance of the overture to Tannhäuser in Hecht's living room. Marx was allowed to join the symphonietta.
Later in life, Marx would sometimes note to talk show hosts, not entirely jokingly, that he was unable to actually insult anyone, because the target of his comment would assume that it was a Groucho-esque joke, and would laugh.
Despite his lack of formal education, he wrote many books, including his autobiography, Groucho and Me (1959) and Memoirs of a Mangy Lover (1963). He was a friend of such literary figures as Booth Tarkington, T. S. Eliot and Carl Sandburg. Much of his personal correspondence with those and other figures is featured in the book The Groucho Letters (1967) with an introduction and commentary on the letters written by Marx, who donated his letters to the Library of Congress. His daughter Miriam published a collection of his letters to her in 1992 titled Love, Groucho.
In My Life with Groucho: A Son's Eye View, Arthur Marx relates that in his latter years Groucho increasingly referred to himself by the name Hackenbush, referring to the character of that name he played in A Day at the Races (film).
Marx made serious efforts to learn to play the guitar. In the 1932 film Horse Feathers, he performs the film's love theme "Everyone Says I Love You" for costar Thelma Todd on a Gibson L-5.
In July 1937, an America vs England pro-celebrity tennis doubles match was organized, featuring Marx and Ellsworth Vines playing against Charlie Chaplin and Fred Perry, to open the new clubhouse at the Beverly Hills Tennis Club. Marx appeared on court with 12 rackets and a suitcase, leaving Chaplin – who took tennis seriously – bemused, before he asked what was in it. Marx asked Chaplin what was in his, with Chaplin responding he didn't have one. Marx replied, "What kind of tennis player are you?" After playing only a few games, Marx sat on the court and unpacked an elaborate picnic lunch from his suitcase.
Irving Berlin quipped, "The world would not be in such a snarl, had Marx been Groucho instead of Karl". In his book The Groucho Phile, Marx says "I've been a liberal Democrat all my life", and "I frankly find Democrats a better, more sympathetic crowd.... I'll continue to believe that Democrats have a greater regard for the common man than Republicans do". However, during an episode of Firing Line on July 7, 1967, Marx admitted to voting for Wendell Willkie, the Republican candidate for president in 1940 over Franklin D. Roosevelt, stating that he did not believe that any man should run for more than two terms. Marx also said in a television interview that he disliked the women's liberation movement.
Later years
You Bet Your Life
Marx's radio career was not as successful as his work on stage and in film, though historians such as Gerald Nachman and Michael Barson suggest that, in the case of the single-season Flywheel, Shyster, and Flywheel (1932), the failure may have been a combination of a poor time slot and the Marx Brothers' returning to Hollywood to make another film.
In the mid-1940s, he weathered a depressing lull in his career. His radio show Blue Ribbon Town had failed, and he was unable to sell his proposed sitcom The Flotsam Family only to see it become a huge hit as The Life of Riley with William Bendix in the title role. By that time, the Marx Brothers as film performers had officially retired.
Marx was scheduled to appear on a radio show with Bob Hope. Annoyed that he was made to wait in the green room for 40 minutes, he went on the air in a foul mood. Hope started by saying "Why, Groucho Marx! Groucho, what are you doing out here in the desert?" Marx retorted, "Huh, desert, I've been sitting in the dressing room for forty minutes! Some desert alright ...". Marx continued to ignore the script, ad-libbing at length, and took it well beyond its allotted time slot.
Listening in on the show was producer John Guedel, who had a brainstorm. He approached Marx about doing a quiz show, to which Marx derisively retorted, "A quiz show? Only actors who are completely washed up resort to a quiz show!" Undeterred, Guedel proposed that the quiz would be only a backdrop for Marx's interviews of people, and the storm of ad-libbing that they would elicit. Marx replied, "Well, I've had no success in radio, and I can't hold on to a sponsor. At this point, I'll try anything!"
You Bet Your Life debuted in October 1947 on ABC radio (which aired it from 1947 to 1949), sponsored by costume jewelry manufacturer Allen Gellman; and then on CBS (1949–50), and finally NBC. The show was on radio only from 1947 to 1950; on both radio and television from 1950 to 1960; and on television only, from 1960 to 1961. The show proved a huge hit, being one of the most popular on television by the mid-1950s. With George Fenneman as his announcer and straight man, Marx entertained his audiences with improvised conversation with his guests. Since You Bet Your Life was mostly ad-libbed and unscripted — although writers did pre-interview the guests and feed Marx ready-made lines in advance — the producers insisted that the network prerecord it instead of it being broadcast live. There were three reasons for this: prerecording provided Marx with time to fish around for funny exchanges, any intervening dead spots could be edited out; and most importantly to protect the network, since Marx was a notorious loose cannon and known to say almost anything. The television show ran for 11 seasons until it was canceled in 1961. Automobile marque DeSoto was a longtime major sponsor. For the DeSoto ads, Marx would sometimes say: "Tell 'em Groucho sent you", or "Try a DeSoto before you decide." In the mid-1970s, episodes of the show were syndicated and rebroadcast as The Best of Groucho.
The program's theme music was an instrumental version of "Hooray for Captain Spaulding," which became increasingly identified as Marx's personal theme song. A recording of the song with Marx and the Ken Lane singers with an orchestra directed by Victor Young was released in 1952. Another recording made by Marx during this period was "The Funniest Song in the World," released on the Young People's Records label in 1949. It was a series of five original children's songs with a connecting narrative about a monkey and his fellow zoo creatures.
One of Marx's most oft-quoted remarks may have occurred during a 1947 radio episode. Marx was interviewing Charlotte Story, who had borne 20 children. When Marx asked why she had chosen to raise such a large family, Mrs. Story is said to have replied, "I love my husband," to which Marx responded, "I love my cigar, but I take it out of my mouth once in a while." The remark was judged too risqué to be aired, according to the anecdote, and was edited out before broadcast. Charlotte Story and her husband Marion, indeed parents of 20 children, were real people who appeared on the program. Audio recordings of the interview exist, and a reference to cigars is made ("With each new kid, do you go around passing out cigars?"), but there is no evidence of the claimed remark. "I get credit all the time for things I never said," Marx told Roger Ebert in 1972. "You know that line in You Bet Your Life? The guy says he has seventeen kids and I say, 'I smoke a cigar, but I take it out of my mouth occasionally'? I never said that." Marx's 1976 memoir recounts the episode as fact, but co-writer Hector Arce relied mostly on sources other than Marx himself—who was by then in his mid eighties, in ill health and mentally compromised—and was probably unaware that Marx had specifically denied making the observation. Head writer Bernie Smith recalled in a 1996 interview that the remark was indeed made—but again, well after the fact.
Another anecdote that may or may not be apocryphal recounts how Warner Brothers threatened to sue Groucho when they learned that the next Marx Brothers film was to be called A Night in Casablanca, contending that that title was too similar to their own film Casablanca. Groucho is reported to have replied, "What about 'Warner Brothers'? Do you own that too? Professionally, we were 'Brothers' long before you were 'Brothers'. We forbid you ever to use the word 'Brothers' again."
Other work
By the time You Bet Your Life debuted on TV on October 5, 1950, Marx had grown a real mustache (which he had already sported earlier in the films Copacabana and Love Happy).
During a tour of Germany in 1958, accompanied by then-wife Eden, daughter Melinda, Robert Dwan and Dwan's daughter Judith, he climbed a pile of rubble that marked the site of Adolf Hitler's bunker, the site of Hitler's death, and performed a two-minute Charleston. He later remarked to Richard J. Anobile in The Marx Brothers Scrapbook, "Not much satisfaction after he killed six million Jews!"
In 1960, Marx, a lifelong devotee of the comic operas of Gilbert and Sullivan, appeared as Ko-Ko, the Lord High Executioner, in a televised production of The Mikado on NBC's Bell Telephone Hour. A clip of this is in rotation on Classic Arts Showcase.
Another TV show, Tell It to Groucho, premiered January 11, 1962, on CBS, but only lasted five months. On October 1, 1962, Marx, after acting as occasional guest host of The Tonight Show during the six-month interval between Jack Paar and Johnny Carson, introduced Carson as the new host.
In 1964, Marx starred in the "Time for Elizabeth" episode of Bob Hope Presents the Chrysler Theatre, a truncated version of a play that he and Norman Krasna wrote in 1948.
In 1965, Marx starred in a weekly show for British TV titled Groucho, broadcast on ITV. The program was along similar lines to You Bet Your Life, with Keith Fordyce taking on the Fenneman role. However, it was poorly received and lasted only 11 weeks.
Marx appeared as a gangster named God in the comedy movie Skidoo (1968), directed by Otto Preminger, and starring Jackie Gleason and Carol Channing. It was released by the studio where the Marx Brothers began their film career, Paramount Pictures. The film received almost universally negative reviews. Writer Paul Krassner published a story in the February 1981 issue of High Times, relating how Marx prepared for the LSD-themed movie by taking a dose of the drug in Krassner's company, and had a moving, largely pleasant experience.
Marx developed friendships with rock star Alice Cooper—the two were photographed together for Rolling Stone magazine—and television host Dick Cavett, becoming a frequent guest on Cavett's late-night talk show, even appearing in a one-man, 90-minute interview. He befriended Elton John when the British singer was staying in California in 1972, insisting on calling him "John Elton". According to writer Philip Norman, when Marx jokingly pointed his index fingers as if holding a pair of six-shooters, Elton John put up his hands and said, "Don't shoot me, I'm only the piano player," thereby naming the album he had just completed. A film poster for the Marx Bros. movie Go West is visible on the album cover photograph as an homage to Marx. Elton John accompanied Marx to a performance of Jesus Christ Superstar. As the lights went down, Marx called out, "Does it have a happy ending?" And during the Crucifixion scene, he declared, "This is sure to offend the Jews."
Marx's previous work regained popularity; new books of transcribed conversations were published by Richard J. Anobile and Charlotte Chandler. In a BBC interview in 1975, Marx called his greatest achievement having a book selected for cultural preservation in the Library of Congress. In a Cavett interview in 1971, Marx said being published in The New Yorker under his own name, Julius Henry Marx, meant more than all the plays he appeared in. As a man who never had formal schooling, to have his writings declared culturally important was a point of great satisfaction.
As he passed his 81st birthday in 1971, Marx became increasingly frail, physically and mentally, as a result of a succession of minor strokes and other health issues. In 1972, largely at the behest of his companion Erin Fleming, Marx staged a live one-man show at Carnegie Hall that was later released as a double album, An Evening with Groucho, on A&M Records. He also made an appearance in 1973 on a short-lived variety show hosted by Bill Cosby. Fleming's influence on Marx was controversial. Some close to Marx believed that she did much to revive his popularity, and the relationship with a younger woman boosted his ego and vitality. Others described her as a Svengali, exploiting an increasingly senile Marx in pursuit of her own stardom. Marx's children, particularly Arthur, felt strongly that Fleming was pushing their weak father beyond his physical and mental limits. Writer Mark Evanier concurred.
On the 1974 Academy Awards telecast which was Groucho Marx's final major public appearance, Jack Lemmon presented him with an honorary Academy Award to a standing ovation. The award honored Harpo, Chico, and Zeppo as well: "in recognition of his brilliant creativity and for the unequalled achievements of the Marx Brothers in the art of motion picture comedy". Noticeably frail, Marx took a bow for his deceased brothers. "I wish that Harpo and Chico could be here to share with me this great honor," he said, naming his two deceased brothers (Zeppo, still alive, was in the audience). He also praised the late Margaret Dumont as a great straight woman who never understood any of his jokes. Marx's final appearance was a brief sketch with George Burns in the Bob Hope television special Joys (a parody of the 1975 movie Jaws) in March 1976. His health continued to decline the following year; when his younger brother Gummo died at age 83 on April 21, 1977, Marx was never told for fear of eliciting still further deterioration of his health.
Marx maintained his irrepressible sense of humor to the very end, however. George Fenneman, his radio and TV announcer, good-natured foil, and lifelong friend, often related a story of one of his final visits to Marx's home: When the time came to end the visit, Fenneman lifted Marx from his wheelchair, put his arms around his torso, and began to "walk" the frail comedian backwards across the room towards his bed. As he did, he heard a weak voice in his ear: "Fenneman," whispered Marx, "you always were a lousy dancer." When a nurse approached him with a thermometer during his final hospitalization, explaining that she wanted to see if he had a temperature, he responded, "Don't be silly—everybody has a temperature." Actor Elliott Gould recalled a similar incident: "I recall the last time I saw Groucho, he was in the hospital, and he had tubes in his nose and what have you," he said. "And when he saw me, he was weak, but he was there; and he put his fingers on the tubes and played them like it was a clarinet. Groucho played the tubes for me, which brings me to tears."
Death
Marx was hospitalized at Cedars-Sinai Medical Center with pneumonia on June 22, 1977, and died there nearly two months later at the age of 86 on August 19, four months after Gummo's death. Media coverage of Groucho's death and legacy was overshadowed by the sudden death of Elvis Presley three days previously.
His body was cremated and the ashes are interred in the Eden Memorial Park Cemetery in Los Angeles. He was survived by his three children and younger brother Zeppo, who outlived him by two years. His gravestone bears no epitaph, but in one of his last interviews he suggested one: "Excuse me, I can't stand up."
Litigation over his estate lasted into the 1980s. Eventually, his three children were awarded the bulk of the estate, and Erin Fleming, his companion during his final years, was ordered to repay $472,000.
Legacy
Groucho Marx was considered the most recognizable of the Marx Brothers. Groucho-like characters and references have appeared in popular culture both during and after his life, some aimed at audiences who may never have seen a Marx Brothers movie. Marx's trademark eyeglasses, nose, mustache, and cigar have become icons of comedy—glasses with fake noses and mustaches (referred to as "Groucho glasses", "nose-glasses," and other names) are sold by novelty and costume shops around the world.
The cover of The Firesign Theatre's 1969 album, How Can You Be in Two Places at Once When You're Not Anywhere at All, subtitled All Hail Marx and Lennon, features images of Groucho Marx and John Lennon.
Nat Perrin, close friend of Groucho Marx and writer of several Marx Brothers films, inspired John Astin's portrayal of Gomez Addams on the 1960s TV series The Addams Family with similarly thick mustache, eyebrows, sardonic remarks, backward logic, and ever-present cigar (pulled from his breast pocket already lit).
Minnie's Boys, a 1970 Broadway musical, focused on the younger years of Marx (played by Lewis J. Stadlen), his brothers, and his mother (played by Shelley Winters). Marx received credit as the show's advisor and appeared on The Dick Cavett Show to promote the production.
In 1972, at Cannes, Marx was made a Commander in the French Ordre des Arts et des Lettres, an honour he was very proud of. In a TV episode of MASH titled: "Yankee Doodle Doctor" Hawkeye Pierce (Alan Alda) portrays Marx in a parody movie along with Trapper John (Wayne Rogers) portraying Harpo Marx.
A meeting with Elton John led to a press photo of Marx pointing both of his index fingers and thumbs at Elton like revolvers. John's spontaneous response of holding up his hands and replying, "Don't shoot me! I'm only the piano player!" was so amusing that Elton John reused it as the title of a 1973 album. An added Marx homage was that a poster for the Marx Brothers' movie Go West was included on the cover art.
Marx was also known to influence the Warner Bros. cartoon character Bugs Bunny, who would recite his famous line "Of course you realize this means war!" in two of his cartoons in the Looney Tunes series, Long Haired Hare and Bully for Bugs, when his antagonist has offended him.
Two albums by British rock band Queen, A Night at the Opera (1975) and A Day at the Races (1976), are named after Marx Brothers films. In March 1977, Marx invited Queen to visit him in his Los Angeles home; there they performed "'39" a cappella.
A long-running ad campaign for Vlasic Pickles features an animated stork that imitates Marx's mannerisms and voice. On the famous Hollywood Sign in California, one of the "O"s is dedicated to Marx. Alice Cooper contributed over $27,000 to remodel the sign, in memory of his friend.
Actor Frank Ferrante has performed as Groucho Marx on stage since 1986. He continues to tour under rights granted by the Marx family in a show entitled An Evening with Groucho in theaters throughout the United States and Canada with supporting actors and piano accompanist Jim Furmston. In the late 1980s, Ferrante starred as Marx in the off-Broadway and London show Groucho: A Life in Revue penned by Marx's son Arthur. Ferrante portrayed the comedian from age 15 to 85. The show was later filmed for PBS in 2001. In 1982, Gabe Kaplan filmed a version of the same show, entitled Groucho.
In the Hungarian dubbed version of Woody Allen's film Annie Hall, a famous quotation told by Alvy Singer (Allen) at the beginning of the film is not attributed to Groucho Marx as in the original, but to Buster Keaton. The reason was that in communist Hungary, the name 'Marx' was associated with Karl Marx and it was not allowed to use it in such a light, humorous context.
Woody Allen's 1996 musical Everyone Says I Love You, in addition to being named for one of Marx's signature songs, ends with a Groucho-themed New Year's Eve party in Paris, which some of the stars, including Allen and Goldie Hawn, attend in full Groucho costume. The highlight of the scene is an ensemble song-and-dance performance of "Hooray for Captain Spaulding"—done entirely in French.
In 2008, Minnie's Boys was remounted Off-Broadway with Erik Liberman as Groucho and Pamela Myers as Minnie Marx. Liberman later played Marx in a musical based on Flywheel, Shyster, and Flywheel called The Most Ridiculous Thing You Ever Hoid (2010) and at the Obama White House.
Groucho, a supporting character in the Italian horror comics series Dylan Dog, is a Groucho Marx impersonator whose character became his permanent personality, and he works with Dylan Dog as his professional sidekick. In the English-language version, to avoid legal complications regarding Groucho Marx's estate, the art was altered so that Groucho no longer sports the Marx brother's signature moustache, and was renamed Felix.
In the M*A*S*H television series several Groucho homage traits are mirrored in Alan Alda’s portrayal of Hawkeye, including in one episode a Groucho impression complete with nose, moustache and glasses.
Filmography
Features
Short subjects
Hollywood on Parade No. 11 (1933)
Screen Snapshots Series 16, No. 3 (1936)
Sunday Night at the Trocadero (1937)
Screen Snapshots: The Great Al Jolson (1955)
Showdown at Ulcer Gulch (1956) (voice)
Screen Snapshots: Playtime in Hollywood (1956)
Bibliography
Books by Groucho Marx
Beds (Farrar & Rinehart, 1930)
Beds: revised & updated edition (Bobbs-Merrill, 1976 )
Many Happy Returns: An Unofficial Guide to Your Income-Tax Problems Illustrated by Otto Soglow (Simon & Schuster, 1942)
Groucho and Me (B. Geis Associates, 1959)
Memoirs of a Mangy Lover (B. Geis Associates, 1963)
The Groucho Letters: Letters From and To Groucho Marx (Simon & Schuster, 1967, )
The Marx Bros, Scrapbook with Richard Anobile (Darien House/W W Norton, 1973, )
The Secret Word Is Groucho with Hector Arce (Putnam, 1976)
The Groucho Phile: An Illustrated Life by Groucho Marx with Hector Arce (Galahad, 1976, )
Essays and reporting
References
Further reading
Miriam Marx Allen, Love, Groucho: Letters From Groucho Marx to His Daughter Miriam (1992, )
Charlotte Chandler, Hello, I Must Be Going! (1979, )
Stefan Kanfer, Groucho: The Life and Times of Julius Henry Marx (2000, )
Simon Louvish, Monkey Business: The Lives and Legends of the Marx Brothers (2001, )
Arthur Marx, Life With Groucho (1954, revised as My Life with Groucho: A Son's Eye View 1988, ))
Arthur Marx, Son of Groucho (1972, )
Harpo Marx, Harpo Speaks (1961, revised as Harpo Speaks! 1985, )
Glenn Mitchell, The Marx Brothers Encyclopedia (1996, )
Steve Stoliar, Raised Eyebrows: My Years Inside Groucho's House (1996, )
Julius H. (Groucho) Marx v. Commissioner of Internal Revenue, 29 T.C. 88 (1957)
External links
Marx, Groucho, 1890–1977 (Library of Congress Name Authority File)
Groucho Marx papers, 1930–1967 (Library of Congress)
Groucho Marx - Old Time Radio - Archive.org
Groucho's letter to Warner Brothers when they threatened to sue him
Groucho Marx Interview – Press Conference London June 1965
FBI Records: The Vault - Groucho Marx at vault.fbi.gov
The Marx Brothers Museum
1890 births
1977 deaths
20th-century American comedians
20th-century American male actors
Academy Honorary Award recipients
American game show hosts
American male comedians
American male film actors
American male musical theatre actors
American male stage actors
American male television actors
American male comedy actors
American people of German-Jewish descent
American radio personalities
Male actors from New York City
Burials at Eden Memorial Park Cemetery
California Democrats
Deaths from pneumonia in California
Jewish American male actors
Comedians from New York City
Marx Brothers
People from the Upper East Side
Vaudeville performers
Jewish American comedians
20th-century American male singers
20th-century American singers |
4876545 | https://en.wikipedia.org/wiki/Archibald%20McLean | Archibald McLean | Archibald McLean may refer to:
Archibald McLean (d. 1830), New Brunswick political figure
Archibald McLean (Baptist) (1733–1812), Scottish minister
Archibald McLean (judge) (1791–1865), judge and political figure in Upper Canada
Archibald J. McLean (1860–1933), cattleman and politician from Alberta, Canada
Archibald Lang McLean (1885–1922), Australian doctor
Archie McLean (footballer) (1894–1971), football player
Archie McLean (ice hockey) (1889–1960), Canadian professional ice hockey player
See also
Archibald MacLean (1883–1970), officer in the Royal Scots, Royal Flying Corps and Royal Air Force |
58440820 | https://en.wikipedia.org/wiki/Kiran%20C%20Patel | Kiran C Patel | Kiran C. Patel is a Zambian-Indian-American philanthropist, serial entrepreneur, hotelier and cardiologist.
Early life and education
Patel was born in Zambia in 1949 to a Hindu Gujarati Indian family. He got his primary education under the British educational system in Zambia and earned diplomas from Cambridge University and the University of London. Patel attended medical school in India at Gujarat University and completed his internship in Africa. In 1976, he moved to the United States. Patel did his residency in internal medicine in New Jersey in 1980 and completed a fellowship in the cardiology program affiliated with Columbia University of New York in 1982.
Career
After moving to Tampa, Florida in 1982, Patel began his practice as a cardiologist. In 1985 he started a physicians practice ownership and management company, which quickly expanded to 14 practices including family medicine, internal medicine, pediatrics and cardiology. In 1992 Patel became chairman of the board of Well Care HMO, INC. which under his leadership became this 5th largest Medicaid HMO in the United States. In 1999, he acquired 55% of Kingston N.Y.-based WellCare Management Group Inc, which managed two HMO's in Connecticut and New York. In 2002, he sold majority share in the WellCare Management Group, at which point WellCare Management was providing services to over 400,000 members. In 2007, Patel started a new insurance holding company called America's 1st Choice Holdings of Florida and acquired two Tampa Bay based Medicare Advantage Health Plans, Freedom Health and Optimum Health. He grew these companies to over 115,000 members and over $1 billion in revenue, at which point he sold to Anthem in April 2019.
In 2018, Patel invested $60 million in the medical device company Concept Medical. He committed to gift $50 million and an additional $150 million towards real estate and facility expansion in the medical education complex that will be part of NSU’s Tampa Bay Regional Campus, in Clearwater.
Medical insurance
In 1992, Patel bought Well Care HMO, Inc. (Well Care) for approximately $5 million. He sold the company a decade later in 2002 for $200 million.
In 2007 he purchased Freedom Health and Optimum Healthcare Inc.
In 2017, he sold his second insurance company – America’s 1st Choice (including Freedom Health and Optimum Healthcare) to Anthem Inc. for an undisclosed amount.
Freedom Health lawsuit
On 17 August 2009, a whistleblower filed a complaint with the district court in Tampa, alleging that Freedom was manipulating enrollment rolls. Patel and his brother Rupesh Shah were among the named defendants. The complaint also alleged that Freedom was engaging in service-area-expansion fraud—misrepresenting the number of health-care providers in its network in certain counties so that it could expand the areas in which it offered Medicare Advantage. Once the investigation was announced, Patel told employees "not to destroy documents or other evidence" in an emergency meeting.
New Yorker article further reports, "In 2016, seven years after Darren Sewell filed his case, the Justice Department informed Inman that it would join the suit. In May 2017, after months of difficult negotiations, Freedom settled charges that it had violated the False Claims Act and agreed to pay $31.7 million. Freedom's former chief operating officer, Sidd Pagidipati, paid seven hundred and fifty thousand dollars to settle charges related to his role in the alleged service-area-expansion fraud. Neither admitted liability.
Awards and recognition
In 2019, Patel was given the Pravasi Bharatiya Samman by the government of India. In January 2019, the Clearwater City Council issued a resolution to rename Damascus Road as Dr. Kiran C. Patel Boulevard in recognition of Patel's contribution to Nova Southeastern University's Tampa Bay Regional Campus.
Charity history
Patel has supported multiple groups through charitable donations:
Patel foundation committed for $225 Million to Nova Southeastern University's colleges of osteopathic and allopathic medicine.
$30.5 Million to the University of South Florida for the Patel Center for Global Solutions and College of Global Sustainability.
$171,500 to build homes for poor people to Habitat for Humanity.
Patel pledged $7.5 million donation to Florida Hospital Carrollwood from 2017-2018.
$5 million for a conservatory at the David A. Straz Jr. Center for the Performing Arts.
$3 million for a research institute at Florida Hospital Tampa.
$20 million committed to Patel High School for tuition-free education.
Namesake institutes
Kiran C. Patel College of Osteopathic Medicine (D.O)
Kiran C. Patel College of Allopathic Medicine (M.D)
Drs. Kiran and Pallavi Patel Allied Health Building
Dr. Kiran C. Patel Center for Global Solutions
Kiran C. Patel High School
Kiran C. Patel Research Institute
Patel Conservatory – Straz Center for the Performing Arts
Dr. Kiran C Patel Centre for Sustainable Development, IIT Gandhinagar, Gujarat
Personal life
Patel is married to pediatrician Pallavi Patel. They have two daughters and one son.
Patel developed vitiligo in 2002. He is not seeking treatment for the condition.
References
Living people
Zambian emigrants to the United States
American people of Indian descent in health professions
American people of Gujarati descent
American cardiologists
American people of Indian descent
American businesspeople
Recipients of Pravasi Bharatiya Samman
1949 births
People with vitiligo |
32053864 | https://en.wikipedia.org/wiki/Eddy%20Antoine | Eddy Antoine | Eddy Antoine (born 27 August 1949) is a Haitian former footballer who played at both professional and international levels as a midfielder.
Club career
After playing for Racing CH and New Jersey Brewers, Antoine spent time in the North American Soccer League with the Chicago Sting.
International career
Antoine also represented the Haitian national team at international level, and participated at the 1974 FIFA World Cup.
References
1949 births
Living people
Haitian footballers
Haitian expatriate footballers
Haiti international footballers
Racing CH players
American Soccer League (1933–1983) players
New Jersey Brewers players
North American Soccer League (1968–1984) players
Chicago Sting (NASL) players
Expatriate soccer players in the United States
Haitian expatriate sportspeople in the United States
1974 FIFA World Cup players
CONCACAF Championship-winning players
Association football midfielders |
24663898 | https://en.wikipedia.org/wiki/Luisa%20%C3%81lvarez | Luisa Álvarez | Luisa María Álvarez Iglesias (born October 3, 1962 in Candás) is a Spanish sprint canoer who competed in the early 1990s. She was eliminated in the semifinals of the K-4 500 m event at the 1992 Summer Olympics in Barcelona.
References
Sports-Reference.com profile
1962 births
Canoeists at the 1992 Summer Olympics
Living people
Olympic canoeists of Spain
Spanish female canoeists |
54453149 | https://en.wikipedia.org/wiki/Cumbria%20Cup | Cumbria Cup | The Cumbria Cup is an annual rugby union knock-out club competition organized by the Cumbria Rugby Union. It was first introduced during the 1882-83 season, when it was known as the Cumberland Challenge Cup, and the inaugural winners were Aspatria. Originally it was open only to club sides in Cumberland, but in 1974, as a result of the 1972 Local Government Act, Cumberland, Westmorland and Furness merged to form what we now know as Cumbria, and the competition was renamed as the Cumbria Cup, although the Westmorland & Furness Cup continued intermittently up until 2008. It is the most important cup competition in the county ahead of the Cumbria League Cup and Cumbria Shield.
The Cumbria Cup is currently open to the top club sides based in Cumbria, typically playing in tier 5 (National League 3 North), tier 6 (North 1 West) and tier 7 (North Lancashire/Cumbria), of the English rugby union league system. The format is a knockout cup with a first round, quarter-finals, semi-finals and a final to be held at a neutral venue between April–May. Between 2006-14 there was also a Cumbria Plate competition for sides knocked out of the first round of the main cup competition but this has been discontinued in recent years.
Winners
Cumbria Plate winners
Number of wins
Cup
Aspatria (32)
Wigton (13)
Workington (12)
Egremont (8)
Penrith (8)
Keswick (7)
Cockermouth (6)
Carlisle (5)
Kendal (5)
Whitehaven (4)
Millom (3)
Seaton (3)
Maryport (2)
Netherhall (2)
Silloth (2)
St Benedict's (2)
Blennerhasset (1)
St Bees (1)
Plate
St Benedict's (2)
Keswick (1)
Millon (1)
Upper Eden (1)
Whitehaven (1)
Workington (1)
Notes
See also
Cumbria Rugby Union
Cumbria League Cup
Cumbria Shield
Westmorland & Furness Cup
References
External links
Cumbria RU
Recurring sporting events established in 1882
1882 establishments in England
Rugby union cup competitions in England
Rugby union in Cumbria |
21356401 | https://en.wikipedia.org/wiki/168th%20meridian%20east | 168th meridian east | The meridian 168° east of Greenwich is a line of longitude that extends from the North Pole across the Arctic Ocean, Asia, the Pacific Ocean, New Zealand, the Southern Ocean, and Antarctica to the South Pole.
The 168th meridian east forms a great circle with the 12th meridian west.
From Pole to Pole
Starting at the North Pole and heading south to the South Pole, the 168th meridian east passes through:
{| class="wikitable plainrowheaders"
! scope="col" width="130" | Co-ordinates
! scope="col" | Country, territory or sea
! scope="col" | Notes
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Arctic Ocean
| style="background:#b0e0e6;" |
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | East Siberian Sea
| style="background:#b0e0e6;" |
|-valign="top"
|
! scope="row" |
| Chukotka Autonomous Okrug — Ayon Island and the mainland Kamchatka Krai — from
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Bering Sea
| style="background:#b0e0e6;" |
|-
|
! scope="row" |
| Kamchatka Krai — Medny Island
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Pacific Ocean
| style="background:#b0e0e6;" | Passing just east of Kwajalein Atoll, (at )
|-
|
! scope="row" |
| Namu Atoll
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Pacific Ocean
| style="background:#b0e0e6;" | Passing just west of Namdrik Atoll, (at )
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Coral Sea
| style="background:#b0e0e6;" | Passing just west of the island of Méré Lava, (at ) Passing just west of the island of Maewo, (at )
|-
|
! scope="row" |
| Aoba Island
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Coral Sea
| style="background:#b0e0e6;" | Passing just west of Pentecost Island, (at )
|-
|
! scope="row" |
| Island of Ambrym
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Coral Sea
| style="background:#b0e0e6;" | Passing just east of the island of Malakula, (at ) Passing just west of the island of Epi, (at ) Passing just west of the island of Efate, (at )
|-
|
! scope="row" |
| Island of Maré
|-valign="top"
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Pacific Ocean
| style="background:#b0e0e6;" | Passing just west of (at )
|-
|
! scope="row" |
| South Island
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Foveaux Strait
| style="background:#b0e0e6;" |
|-
|
! scope="row" |
| Stewart Island/Rakiura
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Pacific Ocean
| style="background:#b0e0e6;" |
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Southern Ocean
| style="background:#b0e0e6;" |
|-
|
! scope="row" | Antarctica
| Ross Dependency, claimed by
|-
| style="background:#b0e0e6;" |
! scope="row" style="background:#b0e0e6;" | Southern Ocean
| style="background:#b0e0e6;" | Ross Sea
|-
|
! scope="row" | Antarctica
| Ross Dependency, claimed by
|-
|}
See also
167th meridian east
169th meridian east
e168 meridian east |
3980675 | https://en.wikipedia.org/wiki/South%20Jersey%20Radio%20Association | South Jersey Radio Association | South Jersey Radio Association (SJRA) is an amateur radio organization. First organized June 12, 1916 and affiliated with the American Radio Relay League since 1920, SJRA lays claim to be the oldest "continuously" operating amateur radio club in the United States. SJRA operates the K2AA 2 Meter communications Repeater on 145.290 MHz, which is located in Medford, NJ and covers the metro Philadelphia, PA area. SJRA also operates the K2UK Repeater in Pine Hill, NJ on 146.865 mHz 2 meters and 442.350 mHz 70 cm Band. The SJRA publishes a monthly newsletter called Harmonics and has been doing so for over 50 years. The SJRA has been affiliated with the American Radio Relay League since 1920.
Awards
The SJRA offers 2 awards to the general amateur radio community.
VHF Colonial Award
The VHF Colonial award is to operators who provide proof of a two way direct contact with each of the original Thirteen Colonies over amateur radio on frequencies of 50 MHz or above.
South Jersey Radio Association Achievement Certificate
The South Jersey Radio Association Achievement Certificate is given to amateur radio operators who provide proof of a two way contact with at least 50 of the SJRA's members.
References
External links
South Jersey Radio Association Website
FCC License information for K2AA
Ham radio operators, come in: Field Day is for you
Amateur radio organizations |
18784210 | https://en.wikipedia.org/wiki/Football%20Championship%20of%20the%20Ukrainian%20SSR | Football Championship of the Ukrainian SSR | The Championship of the Ukrainian SSR in football was a top competition of association football in the Ukrainian SSR in 1921-91. Number of Ukrainian clubs almost never competed in the championship such as Dynamo Kyiv.
The competitions were organized by the Football Federation of the Ukrainian SSR that was created in 1959 in place of the Football Section.
Before 1980 selected teams of Moldavian SSR participated in the championship.
Historical outlook
Established as the All-Ukrainian inter-city competition in 1921, later it was included into number of All-Ukrainian Olympiads and Spartakiads. During several seasons the competitions were suspended due to football being identified as a "non-proletariat sport". Also because of a difficult social cataclysm in 1933 (Holodomor), there was no competitions as well.
With the establishment of the All-Union competitions in 1936 (united competitions), the republican football competitions in Ukraine were degraded to regional level. Since then and before the Great Patriotic War, the champion of Ukraine title was awarded to a team that would place first in the First Group (Persha Hrupa) of championship among sports societies and agencies. In 1960 those competitions were suspended and republican title was awarded to the top team of Ukrainian Zone in the Class B (Soviet Second League). The consistent and uniform All-Ukrainian Soviet competition take their beginning from 1960 as the first All-Ukrainian league was formed as part of the Soviet Second League, more known back then as the Klass B, with UkrSSR zone. In 1964 there were also established lower level republican competitions among collectives of physical culture (KFK). In 1970 the Soviet Second League was named as the second group of Klass A for the season, before changing to simply the Soviet Second League. For 1990 and 1991 seasons this competition was moved further down the Soviet league levels into the newly formed Soviet Second League B also earlier known as the G group or simply the Third League.
Until World War II up to 11 clubs competed in the Soviet championship. Nine clubs from Ukraine participated in the first season of the Soviet competition: Dynamo Kyiv (I Division); Dynamo Dnipropetrovsk and Dynamo Kharkiv (II Division); Dynamo Odesa, Spartak Kharkiv, Ugolschiki Staline, Lokomotyv Kyiv (III Division); Traktor Plant Kharkiv, Stal Dnipropetrovsk (IV Division). Later other clubs has entered the competition: Silmash Kharkiv, Frunze Plant Kostiantynivka, Sudostroitel Mykolaiv, and Dzerzhynets Voroshylovhrad.
The Ukrainian club competition in the Second League had existed and prior to 1963, but was not such an exclusive and consistent part of the Soviet League system. In 1970 and 1990 there were few reformations. In 1970 the First League was reduced to a single group and, because of that, the Second League extended into upper and lower (B) divisions. The lower division was named as the Second League B and for the next season was liquidated. In 1990 a similar reform was taken upon the Second League. Its 10 regional groups were reduced to just three still by the regional principal while the league was renamed into the Buffer League (West, Center, and East). This reform also introduced what was planned to be a fourth level of professional competition allowing each republic to have its own professional league. That fourth level competition was named as the Second League, the former name of the Buffer League.
Republican competitions before 1936
Championship of cities
The first nationwide football competitions in Ukraine were established in 1921 as inter-cities competition of the Ukrainian SSR. The city teams consisted of different players from various teams of a particular city. Until 1930 the competition took place in Kharkiv, in 1931 it was conducted in Kyiv, and in 1932 – in Dnipropetrovsk and Zaporizhzhia.
In 1936 the competition was consolidated into the Soviet competitions with some of its teams qualified for the Soviet Top League. The championship itself became a republican level competition with its best team qualifying for the Soviet competitions.
Championship of the Proletarian Sports Society Dynamo
Parallel to the championship of cities there also existed separate tournament that was played among teams of Dynamo society (Proletarian Sports Society (PST) Dynamo) located throughout the Ukrainian SSR. The first tournament was conducted as part of the All-Ukrainian Dynamo Festival which was organized on the orders of the top OGPU official in Ukraine Vsevolod Balitsky. The tournament was also known as the Dynamiada of Ukraine. There existed some degree of confusion due to great number of tournament at that time.
Republican competitions after 1936
Football Championship among teams of sports societies (non-professional level)
The competitions were considered to be amateur. In Soviet Union officially all sports players were amateur athletes, however to differentiate level of teams, there were teams of sports societies and agencies (amateurs) and teams of masters (professionals).
Nonetheless in 1936 and in 1938 there were played games of one more tournament called the Season's Cup of the Ukrainian SSR to which qualified the cup holder and the champion. Those tournament were discontinued and there only were two games.
‡ – winners of the Football Cup of the Ukrainian SSR
Football Championship among teams of masters (professional level)
While many Ukrainian teams competed in the Class B before 1960, it was not until then when they were organized into own republican competition which was officially considered as the one among teams of masters (professional teams).
For 1990 and 1991 the Soviet Second League was again restructured and degraded farther into the fourth division of the competition yielding to the newly formed Buffer League. Buffer League (a.k.a. Second League) covered much bigger area for the competition, while the Second League (a.k.a. Lower Second League) was assigned specifically for most of the Soviet republics including Ukraine.
Soviet Class B (Ukraine)
Official name of the established competition was the Class B, UkrSSR (). Originally reestablished soon after the World War II as the Second Group (1945-1949), the Class B football competitions succeeded it in 1950 as part of the Soviet second tier. As part of the Ukrainian championship, Class B existed in 1960-1970.
Note: until 1963 Class B was the second division of the Soviet football competition, analog of the First League with several zones formed by territorial principle. Since then it was degraded into the third and later renamed as the Soviet Second League.
Ukrainian competitions consisted of two zones until 1970, when it was restructured into two hierarchical leagues. After 1971 teams of the lower league lost their professional status (teams of masters).
Soviet second-tiered competitions
Soviet third-tiered competitions
Soviet fourth-tiered competitions
Soviet Class A, Second Group (Ukraine, Soviet third tier)
Second League (Soviet third tier)
Second League Lower (Soviet fourth tier)
List of all champions
Performance by club
The table does not include city teams that competed in the cities' championship.
Performance by city (Cities' championship)
The 1936 championship is not included.
Pre-World War II teams of masters (professional clubs) in Ukraine
1936–1941 FC Dinamo Kyiv
1936–1937 FC Dinamo Dnepropetrovsk
1936–1940 FC Dynamo Kharkiv
1936–1939 FC Dinamo Odesa
1936–1941 FC Spartak Kharkiv
1936–1941 FC Ugolshchiki Gorlovka → FC Stakhanovets Stalino (FC Shakhtar Donetsk)
1936–1940 FC Lokomotyv Kyiv
1936–1937 FC KhTZ Kharkiv → FC Traktor Kharkiv (FC Torpedo Kharkiv)
1936 FC Stal Dnepropetrovsk
1936–1940 FC Serp i Molot Kharkiv (FC Silmash Kharkiv)
1936–1937 FC Stal Konstantinovka
1937 FC Lokomotiv Dnepropetrovsk
1937–1940 FC Sudostroitel Nikolayev
1937 FC Spartak Kyiv
1937–1939 FC Stal Dnepropetrovsk (FC Dnipro)
1939–1940 FC Dzerzhynets Voroshylovgrad (FC Zorya Luhansk)
1940–1941 FC Pishchevik Odesa (FC Spartak Odesa)
Post war teams of masters (professional clubs) in Ukraine before Ukrainian Class B
1945– FC Dynamo Kyiv
1945– FC Shakhter Stalino
1945–1955 FC Lokomotyv Kharkiv
1945–1950 FC Pishchevik Odesa
1946–1949, 1953– FC Stal Dnepropetrovsk → FC Metallurg Dnepropetrovsk
1946–1949, 1957– FC Sudostroitel Nikolayev → FC Avangard Nikolayev
1947–1949, 1952– ODO Kyiv
1947–1949 FC Spartak Lvov
1947–1949 FC Spartak Kherson
1947–1949, 1951, 1954– FC Spartak Uzhgorod
1947–1949 FC Metalist Kharkiv
1947–1949 FC Dinamo Voroshylovgrad
1947–1949 FC Bolshevik Zaporizhzhia → FC Lokomotiv Zaporizhzhia
1948–1949 FC Avangard Kramatorsk
1948–1949, 1957– FC Shakhter Kadeevka
1948–1949 FC Bolshevik Mukachevo
1949 FC Spartak Kyiv
1949 FC Torpedo Kharkiv
1949 FC Dinamo Chernovtsy
1949, 1957– FC Trudovye Rezervy Voroshylovgrad
1949, 1954– DO Lvov
1953–1954 FC Metallurg Odesa
1953– FC Metallurg Zaporizhzhia
1955– FC Pishchevik Odesa → FC Chernomorets Odesa
1956– FC Avangard Kharkiv
1956– FC Spartak Stanislav
1957– SC ChF Sevastopol
1957– FC Kolgospnik Poltava
1957– FC Khimik Dneprodzerzhynsk
1958– SKVO Odesa
1958– FC Avangard Simferopol → SC Tavriya Simferopol
1958– FC Lokomotiv Vinnitsa
1958– FC Kolgospnik Rovno
1958– FC Lokomotiv Stalino
1959– FC Kolgospnik Cherkassy
1959– FC Arsenal Kyiv
1959– FC Zirka Kirovograd
1959– FC Avangard Zhytomir
1959– Krivoi Rog team
1959– FC Avangard Ternopol
1959– FC Shakhter Gorlovka
Teams from other republics
Moldavian teams
Speranța Drochia
Avtomobilist Tiraspol (previously as Start, Luceafărul)
FC Nistrul Bendery
FC Stroitel Beltsy
Belarusian teams
FC Neman Grodno
FC Dvina Vitebsk
Russian teams
FC Baltika Kaliningrad
See also
Ukrainian Premier League
Ukrainian First League
Football Cup of the Ukrainian SSR
List of Ukrainian football champions
Notes
References
External links
Ukrainian SSR championships
USSR football tables
Ukrainian Football History
All Ukrainian champions including Soviet at RSSSF
Ukrainian quarter. 1991, first champion (Український квотер. 1991, перший чемпіон).
Banyas, V. Movement of life, or – Dynamo! (Рух життя, або — «Динамо»!). Ukrainian Premier League. 14 September 2017
Хто був першим чемпіоном України ?.
Ukraine
Soviet
1921 establishments in Ukraine
1991 disestablishments in Ukraine
Recurring sporting events established in 1921
Recurring events disestablished in 1991
Sport in the Ukrainian Soviet Socialist Republic
Uk
Uk |
55023699 | https://en.wikipedia.org/wiki/Metaverse%20%28disambiguation%29 | Metaverse (disambiguation) | Metaverse is the sum of all virtual spaces.
Metaverse may also refer to:
Multiverse, the set of all universes
Fictional universe, with multiple alternate timelines
Prime Earth in the DC Universe
The Metaverse, a supernatural dimension derived from the collective unconscious in Persona 5
DA Metaverse, a music project of Daisuke Asakura
Zompist.com, aka "The Metaverse", a constructed languages website
Facebook Metaverse, an online reality virtual space project at Meta Platforms (Meta Inc., formerly, Facebook Inc.)
Decentraland, a 3D virtual world browser-based platform
See also
Megaverse (disambiguation)
Multiverse (disambiguation)
Omniverse (disambiguation)
Universe (disambiguation)
Meta (disambiguation)
Verse (disambiguation) |
21520843 | https://en.wikipedia.org/wiki/Stebl%C3%B3w%2C%20K%C4%99dzierzyn-Ko%C5%BAle%20County | Steblów, Kędzierzyn-Koźle County | Steblów (German: Stöblau) is a village in the administrative district of Gmina Cisek, within Kędzierzyn-Koźle County, Opole Voivodeship, in south-western Poland.
It lies approximately south-west of Cisek, south of Kędzierzyn-Koźle, and south of the regional capital Opole.
The village has a population of 333.
References
Villages in Kędzierzyn-Koźle County |
2880313 | https://en.wikipedia.org/wiki/John%20Friend | John Friend | John Friend may refer to:
John Albert Newton Friend (1881–1966), British chemist
John Friend (conspirator) (died 1696), English conspirator
John Friend (footballer) (born 1953), Australian rules footballer
John Friend (yogi), founder of Anusara Yoga
John Friend Ltd, a New Zealand law publisher, presently known as Thomson Reuters New Zealand Limited, part of Thomson Reuters
The Infamous John Friend, 1909 novel and 1959 BBC television miniseries
See also
John Freind (disambiguation) |
3808799 | https://en.wikipedia.org/wiki/Tanta%20University | Tanta University | Tanta University is an Egyptian university in the city of Tanta, Al Gharbiyah governorate, Egypt. The university is under the direct scientific supervision of the Ministry of Higher Education.
It was founded first in 1962 as a branch from the University of Alexandria with the faculty of Medicine only and then it became an independent university named University of the Middle Delta in 1972. It had at that time Medicine, Science, Agriculture and Education faculties. Then, its name was changed into Tanta University in 1973.
Faculties
Faculty of Medicine (1962)
Faculty of Science (1977)
Faculty of Education in Tanta (1977)
Faculty of Agriculture in Kafr ash Shaykh (1977)
Faculty of Engineering (1977)
Faculty of Law (1981)
High Institute of Nursing (1982)
Faculty of Veterinary Medicine (1982)
Faculty of Agriculture in Tanta (1992)
Faculty of Physical Education (1994)
Faculty of Dentistry (1977)
Faculty of Pharmacy
Faculty of Arts (1975)
Faculty of Computer and Informatics
The University's branch in Kafr ash Shaykh
The university's branch in Kafr ash Shaykh was constituted in 1983. It has Education, Agriculture, Specific Education, Veterinary Medicine, Commerce, Engineering and Arts faculties.
In 2006, Kafr ash Shaykh branch separated from the Tanta university to become an independent university under the name of Kafr ash Shaykh University in Kafr ash Shaykh city and it now has Education, Agriculture, Specific Education, Veterinary Medicine, Commerce, Engineering, Physical Education and Arts faculties.
Number of students
Notable alumni
Abd El-Fatah Abomohra
Eman Ghoneim
Nabil Farouk
Ahmad Khaled Tawfeq
See also
Education in Egypt
Egyptian universities
List of Egyptian universities
References
External links
Tanta University website
Educational institutions established in 1962
1962 establishments in Egypt
Universities in Egypt |
60125039 | https://en.wikipedia.org/wiki/William%20Borland%20%28darts%20player%29 | William Borland (darts player) | William Borland (born 8 November 1996) is a Scottish darts player who plays in Professional Darts Corporation events.
Career
He has played in both BDO and PDC events, reaching the last 48 of the World Masters and the last 16 of the BDO World Trophy. Borland also plays in PDC Challenge Tour events, and thanks to his record in early 2019, he was able to qualify for the 2019 European Darts Open in Leverkusen. He made the quarter-finals of the 2019 PDC World Youth Championship on 4 November, but lost 6–3 to Keane Barry. On 19 January 2020, Borland won a two-year PDC Tour Card by finishing eighth on the UK Q School Order of Merit. He played with the card in 2020 and 2021.
On 17 December 2021, in Borland's World Championship debut, he was involved in an deciding leg which saw him throw a 9-dart leg against Bradley Brooks, becoming the first player to win a televised match with a nine-dart finish in Professional Darts Corporation history. With this victory, he secured a PDC Tour Card for 2022.
World Championship results
PDC
2022: Second round (lost to Ryan Searle 0–3)
Performance timeline
Nine-dart finishes
On 17 December 2021, Borland became the first player in professional darts to win a televised match with a nine-dart finish in the deciding leg, beating English player Bradley Brooks. This is also his first nine-dart finish in a televised match.
References
External links
1996 births
Living people
Scottish darts players
Sportspeople from West Lothian
People from East Calder
Professional Darts Corporation current tour card holders |
42673261 | https://en.wikipedia.org/wiki/Polar%20Geospatial%20Center | Polar Geospatial Center | The Polar Geospatial Center is a research center at the University of Minnesota's College of Science and Engineering funded by the National Science Foundation's Office of Polar Programs. Founded in 2007, the Polar Geospatial Center "provides geospatial support, mapping, and GIS/remote sensing solutions to researchers and logistics groups in the polar science community." It is currently directed by Paul Morin.
History
The Polar Geospatial Center (PGC) was founded in 2007 and was originally called the Antarctic Geospatial Information Center (AGIC). In its early days, the AGIC's goal was to provide basic mapping and GIS services for the United States Antarctic Program (USAP), and was only a two-man project. As time went on, the program's credibility and size expanded. By 2010, the program had over a half dozen team members. In March 2011, the program was "classified as a National Science Foundation cooperative agreement" and adapted to take responsibility for Arctic as well as Antarctic operations, hence the name change to PGC.
Services
The PGC's current goal is to support federally funded researchers in the Arctic and Antarctic. The PGC utilizes geospatial and remote sensing technology to work with research teams and solve problems. Some specific examples of services are listed below.
Image delivery & analysis
The PGC has a large collection of both satellite imagery as well as aerial photography at various resolutions. The PGC provides commercial satellite imagery for United States federally-funded polar researchers.
Digital Elevation Models
The PGC provides high-resolution digital elevation models (DEMs) derived from stereoscopic optical imagery. The ArcticDEM project, an 8-meter posting pan-Arctic DEM, was announced by then-President Barack Obama on September 3, 2015. ArcticDEM has already been successfully applied to automatically explore and classify glacial landforms.
Custom map requests
The PGC employs individuals skilled in cartography and GIS to create custom maps of areas for researchers preparing to head into the field.
Map collection
The PGC Map Catalog hosts thousands of Antarctic and Arctic maps in digital form. These maps are from many different organizations and periods in time. Many of these maps are publicly available, some are not and may be provided upon request.
References
University of Minnesota
Science and technology in Antarctica
Arctic research
Geographic data and information organizations in the United States
National Science Foundation
2007 establishments in Minnesota |
38336903 | https://en.wikipedia.org/wiki/Eupithecia%20distinctaria | Eupithecia distinctaria | Eupithecia distinctaria, the thyme pug, is a moth of the family Geometridae.
It is found throughout Europe. It is also found in Iran.
from the Iberian Peninsula through western and central Europe including the British Isles as well as further east as far east as far as Russia and Iran. In the north the range reaches as far as the southern Fennoscandia, to the south, where it is more common, it occupies the Mediterranean and Asia Minor. It is found primarily on warm, stony slopes and rocky structures as well as on sparse grassy areas with thyme mounds. In the Alps, it rises to heights of 2000 metres.
The wingspan is 16–20 mm The forewing ground colour is clear ash grey with or without an admixture of brownish. There is a dark costal patch and a very conspicuous black discal spot. The colour is darker towards the outer margin and there is a fine white wavy post discal line. The hindwings are pale, suffused darker brown at the outer margin. There is also a small fine black discal spot near the costal margin.sextiata Mill, is a lighter grey or whitish, rather strongly marked southern form, best known from Southern France .
Last instar caterpillars are smooth and slender. They are mostly greenish colored and show a wide red back stripe. Sometimes monochrome red specimens appear. With these colours, they are superbly camouflaged on the flowers of their food plants.
The moth flies in June and July resting on stones by day.
Unsurprisingly, the larvae feed on thyme (Thymus (plant) spp.).
Subspecies
Eupithecia distinctaria distinctaria
Eupithecia distinctaria constrictata Guenee, 1858
Eupithecia distinctaria piemonticola Schwingenschuss, 1954
Eupithecia distinctaria sextiata Dardoin & Milliere, 1867
Similar species
Eupithecia pimpinellata is distinguished by a dark brown saddle on the second abdominal segment.
Eupithecia extraversaria Freshly hatched moths shimmer slightly violet grey. The caterpillars differ significantly E. extraversaria has a strong reddish-brown drawing on each body segment.
Certain identification may require a genitalic preparation.
References
External links
Lepiforum.de
distinctaria
Moths described in 1848
Moths of Europe
Moths of Asia
Taxa named by Gottlieb August Wilhelm Herrich-Schäffer |
3543257 | https://en.wikipedia.org/wiki/Mike%20Juhasz | Mike Juhasz | Mike Juhasz (born July 23, 1976 in Vancouver, British Columbia) is a former professional Canadian football wide receiver who played for the Calgary Stampeders of Canadian Football League.
Early years
Juhasz grew up in Calgary and was a placekicker at James Fowler High School.
College years
Juhasz attended the University of North Dakota and played for the Fighting Sioux football team, where he finished his career with 123 receptions for 1,572 yards (12.78 yards per reception avg.) and 16 touchdowns. As a senior, he set the school's single-season receptions record with 84 receptions for 945 yards (11.25 yards per rec avg.) and nine touchdowns.
Professional career
Juhasz was chosen by the Hamilton Tiger-Cats in the 2000 CFL Draft 14th overall and, after spending the first three games of the 2000 CFL season on the practice roster, he played in the remaining 15 regular season games and had three receptions for 47 yards and one touchdown, two special teams tackles, and one defensive tackle. He spent the entire 2001 CFL season on Hamilton's injured list and signed to the Edmonton Eskimos practice roster for the 2002 CFL season.
Juhasz signed with the Calgary Stampeders for the 2003 CFL season and had a career year in the 2004 CFL season, playing slotback and unofficial backup kicker, he made a catch in every regular-season game for 634 receiving yards.
References
1976 births
Living people
American football wide receivers
Calgary Stampeders players
Canadian football wide receivers
Canadian players of American football
North Dakota Fighting Hawks football players
Sportspeople from Vancouver
Players of Canadian football from British Columbia |
58086836 | https://en.wikipedia.org/wiki/Miroslav%20Aleksi%C4%87 | Miroslav Aleksić | Miroslav Aleksić may refer to:
Miroslav Aleksić (Democratic Party of Serbia politician) (born 1954), Serbian politician
Miroslav Aleksić (People's Party politician) (born 1978), Serbian politician |
69605663 | https://en.wikipedia.org/wiki/Zeldovich%E2%80%93Taylor%20flow | Zeldovich–Taylor flow | Zeldovich–Taylor flow (also known as Zeldovich–Taylor expansion wave) is the fluid motion of gaseous detonation products behind Chapman–Jouguet detonation wave. The flow was described independently by Yakov Zeldovich in 1942 and G. I. Taylor in 1950, although G. I. Taylor carried out the work in 1941 that being circulated in the British Ministry of Home Security. Since naturally occurring detonation waves are in general a Chapman–Jouguet detonation wave, the solution becomes very useful in describing real-life detonation waves.
Mathematical description
Consider a spherically outgoing Chapman–Jouguet detonation wave propagating with a constant velocity . By definition, immediately behind the detonation wave, the gas velocity is equal to the local sound speed with respect to the wave. Let be the radial velocity of the gas behind the wave, in a fixed frame. The detonation is ignited at at . For , the gas velocity must be zero at the center and should take the value at the detonation location . The fluid motion is governed by the inviscid Euler equations
where is the density, is the pressure and is the entropy. The last equation implies that the flow is isentropic and hence we can write .
Since there are no length or time scales involved in the problem, one may look for a self-similar solution of the form , where . The first two equations then become
where prime denotes differentiation with respect to . We can eliminate between the two equations to obtain an equation that contains only and . Because of the isentropic condition, we can express , that is to say, we can replace with . This leads to
For polytropic gases with constant specific heats, we have . The above set of equations cannot be solved analytically, but has to be integrated numerically. The solution has to be found for the range subjected to the condition at
The function is found to monotonically decrease from its value to zero at a finite value of , where a weak discontinuity (that is a function is continuous, but its derivatives may not) exists. The region between the detonation front and the trailing weak discontinuity is the rarefaction (or expansion) flow. Interior to the weak discontinuity everywhere.
Location of the weak discontinuity
From the second equation described above, it follows that when , . More precisely, as , that equation can be approximated as
As , and if decreases as . The left hand side of the above equation can become positive infinity only if . Thus, when decreases to the value , the gas comes to rest (Here is the sound speed corresponding to ). Thus, the rarefaction motion occurs for and there is no fluid motion for .
Behavior near the weak discontinuity
Rewrite the second equation as
In the neighborhood of the weak discontinuity, the quantities to the first order (such as ) reduces the above equation to
At this point, it is worth mentioning that in general, disturbances in gases are propagated with respect to the gas at the local sound speed. In other words, in the fixed frame, the disturbances are propagated at the speed (the other possibility is although it is of no interest here). If the gas is at rest , then the disturbance speed is . This is just a normal sound wave propagation. If however is non-zero but a small quantity, then one find the correction for the disturbance propagation speed as obtained using a Taylor series expansion, where is a necessarily a positive constant (for ideal gas, , where is the specific heat ratio). This means that the above equation can be written as
whose solution is
where is a constant. This determines implicitly in the neighborhood of the week discontinuity where is small. This equation shows that at , , , but all higher-order derivatives are discontinuous. In the above equation, subtract from the left-hand side and from the right-hand side to obtain
which implies that if is a small quantity. It can be shown that the relation not only holds for small , but throughout the rarefaction wave.
Behavior near the detonation front
First let us show that the relation is not only valid near the weak discontinuity, but throughout the region. If this inequality is not maintained, then there must be a point where between the weak discontinuity and the detonation front. The second governing equation implies that at this point must be infinite or, . Let us obtain by taking the second derivative of the governing equation. In the resulting equation, impose the condition to obtain . This implies that reaches a maximum at this point which in turn implies that cannot exist for greater than the maximum point considered since otherwise would be multi-valued. The maximum point at most can be corresponded to the outer boundary (detonation front). This means that can vanish only on the boundary and it is already shown that is positive near the weak discontinuity, is positive everywhere in the region except the boundaries where it can vanish.
Note that near the detonation front, we must satisfy the condition . The value evaluated at for the function , i.e., is nothing but the velocity of the detonation front with respect to the gas velocity behind it. For a detonation front, the condition must always be met, with the equality sign representing Chapman–Jouguet detonations and the inequalities representing over-driven detonations. The analysis describing the point must correspond to the detonation front.
See also
Taylor–von Neumann–Sedov blast wave
Guderley–Landau–Stanyukovich problem
References
Flow regimes
Fluid dynamics
Combustion
Hyperbolic partial differential equations |
1846159 | https://en.wikipedia.org/wiki/Ragu | Ragu | Ragu may refer to:
Ragù, Italian term for meat-based sauce
Ragú, brand of pasta sauce
Ragu, a village in Uliești Commune, Dâmboviţa County, Romania
Ragu, the nom de guerre of TMVP leader Kumaraswamy Nandagopan
Ragu, a mountain in Chile. Birthplace of the famous athlete Bogic Srdjan.
See also
Ragout
Rahu |
54014817 | https://en.wikipedia.org/wiki/Janet%20Cooper%20Alexander | Janet Cooper Alexander | Janet Cooper Alexander is an American lawyer who is currently the Frederick I. Richman Professor of Law Emerita at Stanford Law School.
Career
Alexander graduated with a Bachelor of Arts in English Literature with distinction from Swarthmore College in 1968. In 1973, she received a Master of Arts in English from Stanford University, and a Juris Doctor from the University California, Berkeley Law School in 1978. She then served as a law clerk to Judge Shirley M. Hufstedler of the United States Court of Appeals for the Ninth Circuit from 1978 to 1979, and to Justice Thurgood Marshall of the United States Supreme Court from 1979 to 1980.
Following her clerkships, she practiced law at Califano, Ross & Heineman in Washington, D.C. from 1980 to 1982, and then for five years at Morrison & Foerster in San Francisco, California, where she was a partner, 1984–1987.
In 1987, Alexander accepted a position as associate professor at Stanford Law School. She became a professor in 1994, and since 2002 has held the Frederick I. Richman chair.
See also
List of law clerks of the Supreme Court of the United States (Seat 10)
References
Selected publications
1946 births
Living people
Swarthmore College alumni
Stanford University School of Humanities and Sciences alumni
UC Berkeley School of Law alumni
American legal scholars
Law clerks of the Supreme Court of the United States
Stanford Law School faculty
20th-century American lawyers
21st-century American lawyers
American scholars of constitutional law
American women academics
21st-century American women
People associated with Morrison & Foerster |
49018764 | https://en.wikipedia.org/wiki/Larry%20Ivie | Larry Ivie | Larry Ivie (1936–2014) was an American comics artist, writer, and collector who was active in comics fandom in the middle part of the 20th century, described by comics historian Bill Schelly as "the closest thing to an authority on comics that was available in the 1950s." He provided painted covers and other editorial material for early issues of Castle of Frankenstein magazine, then self-published the seven issues of his own newsstand magazine Monsters and Heroes, for which he drew comic stories of his own superhero Altron Boy, in the mid-to-late '60s; had his art published in the magazines Galaxy Science Fiction and If, co-created the comic book T.H.U.N.D.E.R. Agents, and wrote several stories for Marvel Comics and the horror magazines Creepy and Eerie. Born in Salt Lake City, Utah, to biologist Wilton Ivie and his wife Aleen, he moved to New York City in the mid 1950s to attend the School of Visual Arts, and with a large personal library of comic books and correspondence via fanzines became a prominent part of New York comics fan culture. He also made amateur films of superheros, influencing the amateur films of Donald F. Glut and appearing in two of his films. Ivie died of lung cancer in January 2014, aged 77.
References
External links
1936 births
2014 deaths
American comics artists
American comics writers
Writers from Salt Lake City
School of Visual Arts alumni
Silver Age comics creators
Deaths from lung cancer
Artists from Salt Lake City |
28335087 | https://en.wikipedia.org/wiki/Toxin-antitoxin%20system | Toxin-antitoxin system | A toxin-antitoxin system is a set of two or more closely linked genes that together encode both a "toxin" protein and a corresponding "antitoxin". Toxin-antitoxin systems are widely distributed in prokaryotes, and organisms often have them in multiple copies. When these systems are contained on plasmids – transferable genetic elements – they ensure that only the daughter cells that inherit the plasmid survive after cell division. If the plasmid is absent in a daughter cell, the unstable antitoxin is degraded and the stable toxic protein kills the new cell; this is known as 'post-segregational killing' (PSK).
Toxin-antitoxin systems are typically classified according to how the antitoxin neutralises the toxin. In a type I toxin-antitoxin system, the translation of messenger RNA (mRNA) that encodes the toxin is inhibited by the binding of a small non-coding RNA antitoxin that binds the toxin mRNA. The toxic protein in a type II system is inhibited post-translationally by the binding of an antitoxin protein. Type III toxin-antitoxin systems consist of a small RNA that binds directly to the toxin protein and inhibits its activity. There are also types IV-VI, which are less common. Toxin-antitoxin genes are often inherited through horizontal gene transfer and are associated with pathogenic bacteria, having been found on plasmids conferring antibiotic resistance and virulence.
Chromosomal toxin-antitoxin systems also exist, some of which are thought to perform cell functions such as responding to stresses, causing cell cycle arrest and bringing about programmed cell death. In evolutionary terms, toxin-antitoxin systems can be considered selfish DNA in that the purpose of the systems are to replicate, regardless of whether they benefit the host organism or not. Some have proposed adaptive theories to explain the evolution of toxin-antitoxin systems; for example, chromosomal toxin-antitoxin systems could have evolved to prevent the inheritance of large deletions of the host genome. Toxin-antitoxin systems have several biotechnological applications, such as maintaining plasmids in cell lines, targets for antibiotics, and as positive selection vectors.
Biological functions
Stabilization and fitness of mobile DNA
As stated above, toxin-antitoxin systems are well characterized as plasmid addiction modules. It was also proposed that toxin-antitoxin systems have evolved as plasmid exclusion modules. A cell that would carry two plasmids from the same incompatibility group will eventually generate two daughters cells carrying either plasmid. Should one of these plasmids encode for a TA system, its "displacement" by another TA-free plasmid system will prevent its inheritance and thus induce post-segregational killing. This theory was corroborated through computer modelling. Toxin-antitoxin systems can also be found on other mobile genetic elements such as conjugative transposons and temperate bacteriophages and could be implicated in the maintenance and competition of these elements.
Genome stabilization
Toxin-antitoxin systems could prevent harmful large deletions in a bacterial genome, though arguably deletions of large coding regions are fatal to a daughter cell regardless. In Vibrio cholerae, multiple type II toxin-antitoxin systems located in a super-integron were shown to prevent the loss of gene cassettes.
Altruistic cell death
mazEF, a toxin-antitoxin locus found in E. coli and other bacteria, was proposed to induce programmed cell death in response to starvation, specifically a lack of amino acids. This would release the cell's contents for absorption by neighbouring cells, potentially preventing the death of close relatives, and thereby increasing the inclusive fitness of the cell that perished. This would be an example of altruism and how bacterial colonies could resemble multicellular organisms. However, the "mazEF-mediated PCD" has largely been refuted by several studies.
Stress tolerance
Another theory states that chromosomal toxin-antitoxin systems are designed to be bacteriostatic rather than bactericidal. RelE, for example, is a global inhibitor of translation, is induced during nutrient stress. By shutting down translation under stress, it could reduce the chance of starvation by lowering the cell's nutrient requirements. However, it was shown that several toxin-antitoxin systems, including relBE, do not give any competitive advantage under any stress condition.
Anti-addiction
It has been proposed that chromosomal homologues of plasmid toxin-antitoxin systems may serve as anti-addiction modules, which would allow progeny to lose a plasmid without suffering the effects of the toxin it encodes. For example, a chromosomal copy of the ccdA antitoxin encoded in the chromosome of Erwinia chrysanthemi is able to neutralize the ccdB toxin encoded on the F plasmid and thus, prevent toxin activation when such a plasmid is lost. Similarly, the ataR antitoxin encoded on the chromosome of E. coli O157:H7 is able neutralize the ataTP toxin encoded on plasmids found in other enterohemorragic E. coli.
Phage protection
Type III toxin-antitoxin (AbiQ) systems have been shown to protect bacteria from bacteriophages altruistically. During an infection, bacteriophages hijack transcription and translation, which could prevent antitoxin replenishment and release toxin, triggering what is called an "abortive infection". Similar protective effects have been observed with type I, type II, and type IV (AbiE) toxin-antitoxin systems.
Abortive initiation (Abi) can also happen without toxin-antitoxin systems, and many Abi proteins of other types exist. This mechanism serves to halt the replication of phages, protecting the overall population from harm.
Antimicrobial persistence
When bacteria are challenged with antibiotics, a small and distinct subpopulation of cells is able to withstand the treatment by a phenomenon dubbed as "persistence" (not to be confused with resistance). Due to their bacteriostatic properties, type II toxin-antitoxin systems have previously been thought to be responsible for persistence, by switching a fraction of the bacterial population to a dormant state. However, this hypothesis has been widely invalidated.
Selfish DNA
Toxin-antitoxin systems have been used as examples of selfish DNA as part of the gene centered view of evolution. It has been theorised that toxin-antitoxin loci serve only to maintain their own DNA, at the expense of the host organism. Thus, chromosomal toxin-antitoxin systems would serve no purpose and could be treated as "junk DNA". For example, the ccdAB system encoded in the chromosome of E. coli O157:H7 has been shown to be under negative selection, albeit at a slow rate due to its addictive properties.
System types
Type I
Type I toxin-antitoxin systems rely on the base-pairing of complementary antitoxin RNA with the toxin mRNA. Translation of the mRNA is then inhibited either by degradation via RNase III or by occluding the Shine-Dalgarno sequence or ribosome binding site of the toxin mRNA. Often the toxin and antitoxin are encoded on opposite strands of DNA. The 5' or 3' overlapping region between the two genes is the area involved in complementary base-pairing, usually with between 19–23 contiguous base pairs.
Toxins of type I systems are small, hydrophobic proteins that confer toxicity by damaging cell membranes. Few intracellular targets of type I toxins have been identified, possibly due to the difficult nature of analysing proteins that are poisonous to their bacterial hosts. Also, the detection of small proteins has been challenging due to technical issues, a problem that remains to be solved with large-scale analysis.
Type I systems sometimes include a third component. In the case of the well-characterised hok/sok system, in addition to the hok toxin and sok antitoxin, there is a third gene, called mok. This open reading frame almost entirely overlaps that of the toxin, and the translation of the toxin is dependent on the translation of this third component. Thus the binding of antitoxin to toxin is sometimes a simplification, and the antitoxin in fact binds a third RNA, which then affects toxin translation.
Example systems
Type II
Type II toxin-antitoxin systems are generally better-understood than type I. In this system a labile proteic antitoxin tightly binds and inhibits the activity of a stable toxin. The largest family of type II toxin-antitoxin systems is vapBC, which has been found through bioinformatics searches to represent between 37 and 42% of all predicted type II loci. Type II systems are organised in operons with the antitoxin protein typically being located upstream of the toxin, which helps to prevent expression of the toxin without the antitoxin. The proteins are typically around 100 amino acids in length, and exhibit toxicity in a number of ways: CcdB, for example, affects DNA replication by poisoning DNA gyrase whereas toxins from the MazF family are endoribonucleases that cleave cellular mRNAs, tRNAs or rRNAs at specific sequence motifs. The most common toxic activity is the protein acting as an endonuclease, also known as an interferase.
One of the key features of the TAs is the autoregulation. The antitoxin and toxin protein complex bind to the operator that is present upstream of the TA genes. This results in repression of the TA operon. The key to the regulation are (i) the differential translation of the TA proteins and (ii) differential proteolysis of the TA proteins. As explained by the "Translation-reponsive model", the degree of expression is inversely proportional to the concentration of the repressive TA complex. The TA complex concentration is directly proportional to the global translation rate. The higher the rate of translation more TA complex and less transcription of TA mRNA. Lower the rate of translation, lesser the TA complex and higher the expression. Hence, the transcriptional expression of TA operon is inversely proportional to translation rate.
A third protein can sometimes be involved in type II toxin-antitoxin systems. in the case of the ω-ε-ζ (omega-epsilon-zeta) system, the omega protein is a DNA binding protein that negatively regulates the transcription of the whole system. Similarly, the paaR2 protein regulates the expression of the paaR2-paaA2-parE2 toxin-antitoxin system. Other toxin-antitoxin systems can be found with a chaperone as a third component. This chaperone is essential for proper folding of the antitoxin, thus making the antitoxin addicted to its cognate chaperone.
Example systems
Type III
Type III toxin-antitoxin systems rely on direct interaction between a toxic protein and an RNA antitoxin. The toxic effects of the protein are neutralised by the RNA gene. One example is the ToxIN system from the bacterial plant pathogen Erwinia carotovora. The toxic ToxN protein is approximately 170 amino acids long and has been shown to be toxic to E. coli. The toxic activity of ToxN is inhibited by ToxI RNA, an RNA with 5.5 direct repeats of a 36 nucleotide motif (AGGTGATTTGCTACCTTTAAGTGCAGCTAGAAATTC). Crystallographic analysis of ToxIN has found that ToxN inhibition requires the formation of a trimeric ToxIN complex, whereby three ToxI monomers bind three ToxN monomers; the complex is held together by extensive protein-RNA interactions.
Type IV
Type IV toxin-antitoxin systems are similar to type II systems, because they consist of two proteins. Unlike type II systems, the antitoxin in type IV toxin-antitoxin systems counteracts the activity of the toxin, and the two proteins do not necessarily interact directly. DarTG is a type IV toxin-antitoxin system where the toxin, DarT, modifies DNA by adding ADP-ribose to thymidine bases, and the antitoxin, DarG, removes the toxic modification.
Type V
ghoST is a type V toxin-antitoxin system, in which the antitoxin (GhoS) cleaves the ghoT mRNA. This system is regulated by a type II system, mqsRA.
Type VI
socAB is a type VI toxin-antitoxin system that was discovered in Caulobacter crescentus. The antitoxin, SocA, promotes degradation of the toxin, SocB, by the protease ClpXP.
Type VII
Type VII has been proposed to include systems hha/tomB, tglT/takA and hepT/mntA, all of which neutralise toxin activity by post-translational chemical modification of amino acid residues.
Biotechnological applications
The biotechnological applications of toxin-antitoxin systems have begun to be realised by several biotechnology organisations. A primary usage is in maintaining plasmids in a large bacterial cell culture. In an experiment examining the effectiveness of the hok/sok locus, it was found that segregational stability of an inserted plasmid expressing beta-galactosidase was increased by between 8 and 22 times compared to a control culture lacking a toxin-antitoxin system. In large-scale microorganism processes such as fermentation, progeny cells lacking the plasmid insert often have a higher fitness than those who inherit the plasmid and can outcompete the desirable microorganisms. A toxin-antitoxin system maintains the plasmid thereby maintaining the efficiency of the industrial process.
Additionally, toxin-antitoxin systems may be a future target for antibiotics. Inducing suicide modules against pathogens could help combat the growing problem of multi-drug resistance.
Ensuring a plasmid accepts an insert is a common problem of DNA cloning. Toxin-antitoxin systems can be used to positively select for only those cells that have taken up a plasmid containing the inserted gene of interest, screening out those that lack the inserted gene. An example of this application comes from the ccdB-encoded toxin, which has been incorporated into plasmid vectors. The gene of interest is then targeted to recombine into the ccdB locus, inactivating the transcription of the toxic protein. Thus, cells containing the plasmid but not the insert perish due to the toxic effects of CcdB protein, and only those that incorporate the insert survive.
Another example application involves both the CcdB toxin and CcdA antitoxin. CcdB is found in recombinant bacterial genomes and an inactivated version of CcdA is inserted into a linearised plasmid vector. A short extra sequence is added to the gene of interest that activates the antitoxin when the insertion occurs. This method ensures orientation-specific gene insertion.
Genetically modified organisms must be contained in a pre-defined area during research. Toxin-antitoxin systems can cause cell suicide in certain conditions, such as a lack of a lab-specific growth medium they would not encounter outside of the controlled laboratory set-up.
See also
Toxin-antitoxin database
References
External links
RASTA – Rapid Automated Scan for Toxins and Antitoxins in Bacteria
Plasmids
Non-coding RNA
Toxins
RNA-binding proteins |
71329995 | https://en.wikipedia.org/wiki/Montana%20Levi%20Blanco | Montana Levi Blanco | Montana Levi Blanco (born April 25, 1984) is an American costume designer. He won a Tony Award in the category Best Costume Design in a Play for the play The Skin of Our Teeth.
References
External links
1984 births
Living people
People from Albuquerque, New Mexico
American costume designers
Tony Award winners
American theatre people
Oberlin Conservatory of Music alumni
Brown University alumni
Yale School of Drama alumni |
171196 | https://en.wikipedia.org/wiki/Vestfold | Vestfold | Vestfold is a traditional region, a former county and a current electoral district in Eastern Norway. In 2020 the county became part of the much larger county of Vestfold og Telemark. Located on the western shore of the Oslofjord, it bordered the previous Buskerud and Telemark counties. The county administration was located in Tønsberg, Norway's oldest city, and the largest city is Sandefjord. With the exception of the city-county of Oslo, Vestfold was the smallest county in Norway by area. Vestfold was the only county in which all municipalities had declared Bokmål to be their sole official written form of the Norwegian language.
Vestfold is located west of the Oslofjord, as the name indicates. It includes many smaller, but well-known towns in Norway, such as Larvik, Sandefjord, Tønsberg and Horten; these towns run from Oslo in an almost constant belt of urban areas along the coast, ending in Grenland in neighbouring region Telemark. The river Numedalslågen runs through the county. Many islands are located at the coast. Vestfold is mostly dominated by lowland and is among the best agricultural areas of Norway. Winters last about three months, while pleasant summer temperatures last from May to September, with a July average high of 17 °C (63 °F).
Vestfold is traditionally known for shipping and sailing. Sandefjord was formerly a headquarters for the Norwegian whaling fleet, and Horten used to be Norway's main naval port. The coastal towns of Vestfold now engage in fishing and shipbuilding. Some lumbering is carried on in the interior. The area also includes some of the best farmland in Norway.
Vestfold merged with neighboring Telemark County on 1 January 2020 as part of a nationwide municipal reform. The new county name is Vestfold og Telemark. Vestfold as a county is expected to be re-established by 1 January 2024, following a vote of the county council of Vestfold og Telemark on 15 February 2022 to split the newly established county into its respective counties that existed before the merger took place; Telemark and Vestfold.
Etymology
Vestfold is the old name of the region which was revived in modern times. Fold was the old name of the Oslofjord, and the meaning of the name Vestfold is the region west of the Fold (see also Østfold). Before 1919, the county was called Jarlsberg og Larvik Amt. The amt was created in 1821, consisting of the two old counties of Jarlsberg and Larvik. In the Viking Age, Vestfold also referred to Eiker, Drammen, Kongsberg, Lier, now in Buskerud.
Vestfold Hills on Antarctica's Sørsdal Glacier is named after the county.
History
Viking history
Vestfold is mentioned for the first time in a written source in 813, when Danish kings were in Vestfold to quell an uprising amongst the Fürsts . There may have been as many as six political centers in Vestfold. At that time Kaupang, which was located in Tjølling near Larvik, had been functioning for decades and had a chieftain. Kaupang, which dates from the Viking Era, is believed to be the first town in Norway, although Tønsberg (which dates from ca. 900) is the oldest town in Norway still in existence. At Borre, there was a site for another chieftain. That site held chieftains for more than one hundred years prior to 813.
The stone mounds at Mølen have been dated to the Viking Age. The mounds at Haugar in present-day Tønsberg's town centre have been dated to the Viking period. At Farmannshaugen in Sem there seems to have been activity at the time, while activity at Oseberghaugen and Gokstadhaugen dates from a few decades later.
An English source from around 890 retells the voyage of Ottar (Ottar fra Hålogaland) "from the farthest North, along Norvegr via Kaupang and Hedeby to England", where Ottar places Kaupang in the land of the Dane - danenes land. Bjørn Brandlien says that "To the degree that Harald Hårfagre gathered a kingdom after the Battle of Hafrsfjord at the end of the 9th century - that especially is connected to Avaldsnes - it does not seem to have made such a great impression on Ottar".
Kaupang is mentioned under the name of Skiringssal (Kaupangen i Skiringssal) in Ottar's tales.
By the 10th century, the local kings had established themselves. The king or his ombudsman resided in the old Royal Court at Sæheim i Sem, today the Jarlsberg Estate (Jarlsberg Hovedgård) in Tønsberg. The farm Haugar (from Old Norse haugr meaning hill or mound) became the seat for Haugating, the Thing for Vestfold and one of Norway's most important place for the proclamation of kings.
The family of Harald Fairhair, who was most likely the first king of Norway, is said to have come from this area.
The Danish kings seem to have been weak in Vestfold from around the middle of the 9th century until the middle of the 10th century, but their rule was strengthened there at the end of the 10th century. The Danish kings seem to have tried to control the region until the 13th century.
Kings ruling some or all of Vestfold
Erik Agnarsson
Halfdan Hvitbeinn (part of Vestfold)
Eystein Halfdansson
Halfdan the Mild
Gudrød the Hunter
Halfdan the Black, together with his brother, Olaf Gudrødsson
Ragnvald the Mountain-High, Cousin of Harold Fairhair
Harald Fairhair
Bjørn Farmann
Olaf Haraldsson Geirstadalf, brother of Bjørn
Harald Gudrødsson Grenske, 976–987
Whaling
Whaling was an important 19th century industry in coastal cities such as Larvik, Tønsberg, and Sandefjord, which was the world centre for the world's modern whaling industry. Not only did men from Vestfold County make up practically all the crew on the Norwegian whaling fleet, but many were also involved in the whaling industry in other nations. As an example, the first phase of modern Australian whaling was almost entirely based on workers from Larvik. While the first whaling station in the Faroe Islands was established by Sandefjordians, Larvik played a similar role for the Shetland Islands. Tønsberg initiated much of the whaling industry in Iceland and the Hebrides.
The largest settlement in South Georgia and the South Sandwich Islands, Grytviken, was established by Carl Anton Larsen of Sandefjord on 16 November 1904. Sandefjordian Nils Larsen's expeditions to Antarctica in the early 20th century led to the Norwegian annexation of Bouvet Island (1927) and Peter I Island (1929). A cove on Peter I Island is named Sandefjord Cove in honor of Nils Larsen's hometown.
Sandefjord Harbor is now home to Southern Actor, the only whale-catcher from the Modern Whaling Epoch still to be in its original order. The museum ship is owned by Sandefjord Whaling Museum, Europe's only museum dedicated to whaling. Sandefjord has been named the centre of the Modern Whaling Epoch, and has been nicknamed "the whaling capital of the world."
Geography
Vestfold was Norway's smallest county, with the exception of the city-county of Oslo. It lies on the western shore of the Oslofjord. Vestfold borders with Buskerud County in the north and with Telemark County in the west. It is bordered by Skagerrak in the North Sea to both the south and east. The county has a total area of and has a coastline. Vestfjellet at is the tallest peak in the county. It is also home to 1,407 islands. Nøtterøy () is the largest island in Vestfold, while Tjøme () is the second-largest island.
There is a total of 634 freshwater lakes in Vestfold, with a total area of 79 square kilometers. Large lakes include Farris, Eikeren, Goksjø, Hallevannet, Akersvannet, and others. Vestfold makes up 0.7 percent of Norway's total land area. Ten Norwegian municipalities are larger in size than Vestfold County. As an example, Kautokeino municipality in Finnmark County is over four times larger than Vestfold County. The county of Finnmark is 22 times larger than Vestfold.
Geology
The county's soft soil is composed of varieties of moraine and sedimentary soils. The Ice Age left large parts of Vestfold below sea level, and the most cultivated soil can be found on the marine terraces. Marine clay and sand cover most of the lower lying country in the south-west and north. The Vestfold moraine, a continuation of the Østfold moraine at Moss, is an ice-formed formation which stretches as a cohesive gravel ridge through the county, from Horten in the east to Mølen in the south.
Preserved areas
Færder National Park was the county's first national park when the decision was formalized by King Harald V on 23 August 2013. The visitor center is at World's End, and was officially opened by Queen Sonja on 26 June 2015. The national park lies in Nøtterøy- and Tjøme municipalities, and is made up of of ocean and of land. It stretches from Ormøy in the north to Færder Lighthouse in the south. It is one of two marine national parks in Norway, and is made up of coast, skerries, islands and sea bed.
Mølen in Larvik is home to Norway's largest stone beach and is an ancient burial site consisting of 230 cairns, some exceeding in diameter. Excavations have dated the rock piles to about 250 A.D. It was the first UNESCO Global Geopark in the Nordics when established in 2008. Mølen is one of Larvik's most popular tourist attractions. It is home to over a hundred species of rock, including Norway's national stone, Larvikite, which is named from the area. It is a crucially important seabird habitat, where over 316 species of bird have been recorded.
Municipalities
Vestfold County has experienced a large reduction in number of municipalities. As of 1949, the county was home to 19 rural municipalities and seven city municipalities. There were 14 municipalities as of 2016, but the number will decrease to 8 by 1 January 2020.
As of 1 January 2017 the number of municipalities in Vestfold County was reduced from 14 to 12.
As of 1 January 2018 the number of municipalities in Vestfold County was reduced from 12 to 9.
Andebu (merged into Sandefjord on 1 January 2017)
Hof (merged into Holmestrand on 1 January 2018)
Holmestrand (added Hof on 1 January 2018)
Horten
Lardal (merged into Larvik on 1 January 2018)
Larvik (added Lardal on 1 January 2018)
Nøtterøy (merged with Tjøme on 1 January 2018 to form the new municipality of Færder)
Re (merged into Tønsberg on 1 January 2020)
Sande (merged into Holmestrand on 1 January 2020)
Sandefjord (added Andebu and Stokke on 1 January 2017)
Stokke (merged into Sandefjord on 1 January 2017)
Svelvik (merged into Drammen on 1 January 2020)
Tjøme (merged with Nøtterøy on 1 January 2018 to form the new municipality of Færder)
Tønsberg (added Re on 1 January 2020)
Cities
Holmestrand
Horten
Larvik
Sandefjord
Stavern
Tønsberg
Parishes
Andebu
Arnadal (Arendal)
Berg
Borre
Botne
Brunlanes
Fon
Fredricksværn, see Stavern
Hedrum
Hem
Hillestad
Hof
Holmestrand
Horten
Hvarnes
Høyjord
Kjose
Kodal
Konnerud
Kvelde
Langestrand
Lardal
Larvik
Nykirke
Nøtterøy
Ramnes
Sandar
Sande
Sandefjord
Sandeherred, see Sandar
Sankt Laurentii
Sem
Skjee
Skoger
Slagen
Stavern
Stokke
Strømm (Strømmen)
Strømsgodset
Styrvoll
Svarstad
Svelvik
Tanum
Tjølling
Tjøme
Tønsberg
Undrumsdal
Valløy
Vassås
Vivestad
Vor Frue (Maria)
Våle
Åsgårdstrand
Larvik Branch (LDS, early-1927)
Tønsberg Branch (LDS, early-1951)
Larvik (Katolske Apostoliske, 1888–1963)
Villages
Andebu
Barkåker
Berger
Bergsåsen
Bjerkøya
Bjørnevåg
Borgheim
Borre
Brekkeåsen
Buerstad
Duken
Eidsfoss
Eik
Eikeberg
Fevang
Fokserød
Fon
Freberg
Føynland
Gjone
Glomstein
Gretteåsen
Grimestad
Gullhaug
Hafallen
Helgeroa
Hem
Hof
Hulebakk
Husvik
Husøy
Hvasser
Høyjord
Hårkollen
Kaupang
Kjose
Kjøpmannskjær
Klever
Kodal
Kvelde
Lahelle
Linnestad
Melsomvik
Nesbrygga
Nesbygda
Nykirke
Ormelet
Oterbekk
Ramnes
Revetal
Rånerudåsen
Råstad
Sande
Selvik
Sem
Skallestad
Skinmo
Skjerve
Skoppum
Solløkka
Solvang
Stavern
Stokke
Storevar
Strand
Strengsdal
Sundbyfoss
Sundene
Svarstad
Svelvik
Svinevoll
Teie
Tenvik
Torød
Ula
Unneberg
Valberg
Vassås
Vear
Veierland
Verdens Ende
Verningen
Vestskogen
Vollen
Årøysund
Åsgårdstrand
Former Municipalities
Andebu
Borre
Botne
Brunlanes
Hedrum
Hof
Lardal
Nøtterøy
Ramnes
Sandar
Sem
Skoger
Stavern
Stokke
Strømm
Tjølling
Tjøme
Våle
Åsgårdstrand
Political strength
Results from parliamentary elections in Vestfold County since 1973:
Bold letters represent the alliances (Leftwing Ap+SV. Centre KrF+V+Sp. Rightwing H+Frp). M = Number of elected parliamentarians.
Demographics
According to Statistics Norway, Vestfold County was home to 244,967 residents as of 1 January 2016. Immigrants made up 11.9 percent of the population in 2017. Most immigrants were from Poland (4,287 people), followed by Lithuania (2,794) and Iraq (1,549). Despite its small size, Vestfold had the third-highest population density in Norway. However, the population density may still have been considered low; as an example, the population density of the Netherlands was four times higher than that of Vestfold County in 1998.
Sandefjord was the most populous city of Vestfold County; one in four people from Vestfold were from Sandefjord, or 25.2 percent of the county population.
Economy
Traditional industries in Vestfold have included whaling and ship building. For over 50 years in the 19th century, Sandefjord and partially Tønsberg functioned as the world centre for the whaling industry. However, whaling ended in the 1960s and the ship building industry has gradually reduced since the 1980s. Information technology is currently a growing industry, and the county is home to large web shops such as Komplett, MPX.no and netshop.no. 18.9 percent of the county's total area is used for agriculture, the highest percentage of any county in Norway. 70% of agricultural lands are used for the cultivation of grains. Vestfold's farming area makes up five percent of Norway's cultivated areas. However, by area, Vestfold only makes up 0.7 percent of Norway's land area.
Vestfold has Norway's most expensive vacation homes. Sandefjord had Norway's most expensive vacation homes in 2012, while Tjøme had the most expensive homes as of 2010. General property values appreciated 28.3 percent between 2010 and 2015.
Tourism
Summer tourism is an important industry in Vestfold, particularly in coastal communities such as Sandefjord, Tjøme and Stavern. Coastal cities also have large numbers of vacation homes. There were 534,724 hotel stays in 2015, where the purpose was vacationing for 236,895. Most international tourists were from the United Kingdom, Sweden, and Denmark. There were 781,459 stays at rental cabins or campgrounds in 2015. Consequentially, the population increases drastically during summer months in municipalities such as Sandefjord, Tjøme, and elsewhere. The population at Tjøme goes from 4,500 to around 50,000 each summer. The population of islands such as Tjøme often quadruple during summer, while summer communities as Stavern often sees a doubling or tripling. Tjøme Island is home to nearly as many vacation homes as residential homes.
While Tjøme has the nickname Sommerøya ("the Summer Island"), Sandefjord is nicknamed Badebyen ("the Bathing City") due to its many beaches and former spas. Sandefjord is known for its many great beaches, and it is primarily known as a summer resort community. It first became a bathing destination when sulphur was discovered in 1837. The city gained further recognition when Sandefjord Sulfur Spa and Resort (Kurbadet) was established in 1837. The bath was one of the most visited in Europe during the late 19th century.
Vestfold's most visited tourist attractions include Borre mound cemetery, the largest burial site in Northern Europe, as well as numerous sites along the coast. Architectural sites include the villages of Åsgårdstrand, Karljohansvern in Horten, and Fredriksvern in Stavern. Other important attractions are Sandefjord Whaling Museum, Mølen Geopark in Larvik, as well as Tønsberg Fortress (Slottsfjellet) in Tønsberg.
Largest companies
Largest companies in Vestfold County based on operating income in 2015:
Culture
Vestfold is the county in Norway with the most traces from the Viking Age. Examples include the Oseberg- and Gokstad Burial Mounds. While the Oseberg Ship was discovered in Tønsberg, the Gokstad Ship was discovered in Sandefjord. The Gokstad Ship is Norway's largest preserved Viking ship. Both ships are now located at the Viking Ship Museum in Oslo. Additional burial mounds are found at Borre mound cemetery and Mølen, an UNESCO Global Geopark. Borre mound cemetery is home to Northern Europe's largest burial mound site from Viking Age.
Vestfold is home to 21 churches dating to medieval times. It is also home to one stave church, Høyjord Stave Church in Andebu (Sandefjord). Nearby Andebu Church also has Norway's oldest parish register, dating to 1623. The city of Sandefjord proper is home to Europe's only museum dedicated to whaling, Sandefjord Museum in the city centre. This museum also owns Southern Actor, a whale-catcher turned museum ship. Southern Actor is the only whale-catcher from the Modern Whaling Epoch still to be in its original working order. Also at Sandefjord Harbor is the Harbour Chapel (Bryggekapellet), which is the only floating church in Norway and most likely Europe, perhaps the only floating church in the world.
The city of Tønsberg is Norway's oldest city, most likely founded in year 871. Tønsberg is home to Tønsberg Fortress, which is Scandinavia's largest ruin site. It includes ruins from Castrum Tunsbergis, Norway's largest castle in the 13th century. An outdoor music festival is held at Tønsberg Fortress every July. Ruins of a German fortress can be seen at Folehavna Fort on West Island, Sandefjord.
Transportation
The Vestfold Line is a railway line that runs from Drammen, through a number of towns in Vestfold and ending in the town of Skien in Telemark. European route E18 runs through the county roughly parallel to the railway.
There are two international ferry connections, both operated by Color Line. Larvik is connected to the Danish town Hirtshals, the other route is between Sandefjord and Strømstad in Sweden. Fjord Line is also a ferry operator between Sandefjord and Strømstad. In addition there is a domestic route connecting Horten and Moss.
Sandefjord Airport Torp is one of Norway's largest airports. Only Bergen- and Oslo Airports have more international flights than Torp Airport. Despite being located 74 miles south of Oslo, Torp is sometimes called Oslo Airport Torp. It is reached with a free shuttle bus from Sandefjord Airport Station on Vestfoldbanen. Torp is regional hub for low-cost carrier Norwegian, as well as low-cost carriers Ryanair and WizzAir also operate from the airport. Torp offers direct routes to over 30 international and domestic destinations, including daily flights to European cities such as London and Amsterdam.
Points of interest
Larvik
Bøkeskogen, world's northernmost beech tree forest.
Kaupang, home to remains for the oldest Nordic town yet discovered. The remains are from one of Scandinavia's earliest urban sites, established in year 800 A.D.
Mølen, Scandinavia's first UNESCO Global Geopark.
Nevlunghavn and Helgeroa, adjacent coastal villages.
Larvik Museum
Fritzøehus, largest privately owned estate in Norway.
Stavern, small coastal town, home of Citadell Island
Fredriksvern, Norway's main naval base from the mid-1750s until 1864.
Minnehallen (Hall of Remembrance), largest monument in Vestfold.
Horten
Borre National Park, largest burial mound site in Northern Europe.
Løvøy Chapel
Royal Norwegian Navy Museum
Preus Museum
Borre Church, romanesque medieval church constructed in the 1100s.
Tordenskioldeika
Åsgårdstrand, oceanside resort town.
Borre Golfbane
Tønsberg and Færder
Tønsberg Fortress, largest ruin park in the Nordic countries.
Oseberg Mound, site of the discovery of the Oseberg Ship
Haugar
Tønsberg Cathedral
Sem Church
Slottsfjellmuseet
Nordbyen
World's End, southernmost point at Tjøme.
Herkelås
Tjøme Church
Færder National Park, first National Park in Vestfold.
Sandefjord
Sandefjord Museum (the Whaling Museum), Europe's only museum dedicated to whaling.
Southern Actor, only whale-catcher from the Modern Whaling Epoch still to be in its original working order.
Gokstad Mound, site of the discovery of the 9th-century Gokstad Ship.
Gaia ship, replica of the Gokstad Ship docked at Museum's Wharf.
Sandar Church, built on ruins of a 13th-century medieval stone church. Present church was erected in 1792.
Whaler's Monument, rotating bronze monument erected in honor of pioneering whalers.
Sandefjord Church
Istrehågan, ancient burial ground which dates to the Roman Iron Age around 1500-500 BCE.
Kurbadet, former resort spa and one of Europe's most visited baths in the late 19th century.
Folehavna Fort, ruins from a German fortress erected in 1941 during the German occupation of Norway.
Høyjord Stave Church, the only stave church left in Vestfold County.
Langeby, popular bathing beach at West Island.
Goksjø, third-largest lake in Vestfold County.
Archaeological sites
Istrehågan
Istrehågan is an ancient burial ground which dates to the Roman Iron Age around 1500-500 BCE. It is located at Jåberg in Tjølling, on the border between Sandefjord and Larvik. The rock settings at Istrehågan resemble a ship. It is long, and meters broad. Archaeological excavations made in 1959-61 uncovered
remains of bones, bear claws, pottery shards, a brooch, and more. At Haugen farm on the Sandefjord side is Vestfold County's largest collection of petroglyphs.
Borre National Park
At Borrehaugene near Borrre there are 9 large mounds and around 30 smaller ones. It is the largest burial mound site in Northern Europe.
Borre mound cemetery most likely contains graves belonging to kings of the Yngling dynasty. It is mentioned in the poem Ynglingatal as the burial site of one of two kings belonging to the royal dynasty of the Ynglingas.
Kaupang
Kaupang in Skiringssal (Larvik) is home to remains from the oldest Nordic town yet discovered. It was a trade centre established around year 800, making it one of Scandinavia's earliest urban sites. The settlement was abandoned in the mid-10th century. It is located in Kaupang Bay in Viksfjord, Larvik. Archeological finds include melting pots, jewelry parts, casting moulds and casting models. Most of Kaupang remains not excavated. There are replicas of Viking homes at Kaupang today, giving insight to how homes were constructed during the Viking Age.
Oseberg Burial Mound
Oseberg Mound is located in Tønsberg and is where the Oseberg Ship was discovered. The ship, which dates to 834 A.D., had a length of . Two female skeletons were found in the ship's burial chamber.
Viking burial site at Gulli
Gulli, outside Tønsberg, was the site of an archaeological excavation during the period from 2003 to 2004, prior to asphalt being laid for constructing the new E18 (road). There were 60 graves - 20 of those were preserved to a degree that [authorities decided] permitted examinations. "Perhaps the most spectacular [item] was a høvre" - used with a horse's harness. "There are few of those in Norway - one in Trøndelag and a gilded one found in Borre".
The artifacts are on display at the Midgard Historical Centre in Borre.
Fevang
19th century archeologists were struck by the many burial mounds and artifacts discovered at Fevang near Torp Airport in Sandefjord. Local farmers had discovered various artifacts in the 19th- and early 20th centuries. Archeologist Nicolay Nicolaysen traveled to Fevang and concluded that Fevang was home to an array of ancient burial mounds. Nicolaysen further discovered that Fevang had been an active graveyard for over 1,000 years - since year 0 A.D. until the first Christian cemeteries were established. Among the artifacts discovered were a gold jewel named Berlokk, which was retrieved in a woman's grave along with two gold beads, two blue glass beads, a hairpin, ceramic, burnt bones, and two clips of bronze. Her tomb is dated to the Old Iron Age, around 0-400 A.D.
Gokstad Mound
Gokstad Mound in Sandefjord was where the Gokstad Ship was excavated by Nicolay Nicolaysen in 1880. The skeleton of a man was found in the ship, long believed to be Olaf Geirstad-Alf, former king of Vestfold and half-brother of Halfdan the Black, the father of Harald Fairhair, Norway's first king. However, recent discoveries have increased uncertainty and it therefore remains unknown what chieftain was buried at Gokstad.
The ship, which is the largest found in Norway, is currently located at the Viking Ship Museum in Oslo. The ship was buried along with numerous gifts, including weapons, jewels, a gaming board, fish-hooks, 64 shields, six beds, three smaller boats and kitchen utensils. Twelve horses, eight dogs, two goshawks and two peacocks were also discovered in the grave.
Interpretive signs have been put up at the mound and Gaia, an exact replica of the Gokstad Ship, can be seen on Museum's Wharf at Sandefjord Harbor.
Mølen
The Old Norse word Mol translates to cairns, a site often used by ancient peoples to mark a burial site. Mølen, which is Norway's largest stone beach, is home to 230 cairns, which have been built over ages. Some cairns have been dated to 250 A.D. The isthmus of Mølen is home to stone piles, grave mounds, and stone settings, which are all part of a protected historic site. The last Ice Age pushed large amounts of gravel and stones ahead of it, and deposited it as a moraine through all of Vestfold, known as Vestfoldraet. Raet meets the ocean at Mølen, where the moraine sinks into the sea. Its encounter with the Skagerrak ocean waves has uncovered and polished the huge round stone floor for centuries.
Bøkeskogen
Besides being the largest beech tree forest in Norway, and the most northernmost beech tree forest in the world, Bøkeskogen is also an important archeological area. 83-90 burial mounds have been discovered in the forest. Some of these include the largest burial grounds from the Pre-Roman Iron Age in Vestfold County.
Recreation
At least 238 kilometers of coastal hiking trails can be found in Vestfold County, from Larvik in the south to Svelvik in the north. Hiking trails are found throughout the county, including at World's End in Færder National Park. Furthermore, there is a 35 km (22 mi.) marked trail between the towns of Stavern and Helgeroa. Mølen, Kjærrafossen and Bøkeskogen are also home to various trails. Tønsberg Barrel, an old beacon dated to Sverris saga in the Middle Ages, sits at Yxnøy on Sandefjord's East Island. West Island is home to Folehavna Fort and additional trails. Combined, the trails on Sandefjord's East- and West Islands are 45 km (28 mi.), and a part of the international North Sea Trail. Bøkeskogen in Larvik is home to various trails, varying from 2.6 km (1.6 mi.) to 10 km (6.2 mi.) in length.
Fauna
Vestfold's fauna includes species such as the White-tailed eagle, Roe deer, Moose, European hedgehog, Eurasian eagle-owl, Mountain hare, European badger, European pine marten, and Norway lemming. Rare observations of Gray wolf, European lynx, and Brown bear do occur. A wolf shot in Lardal in 2013 was the first wolf killed in the county in over 100 years. Between 700 and 800 moose are annually hunted in Vestfold. Larvik has one of the highest numbers of moose in Norway.
The Harbor seal is the most commonly observed species of seal in Vestfold, and it was estimated to be at minimum 183 seals in Vestfold as of August 2014. Dolphins are uncommon, however, a Common bottlenose dolphin was observed by Nøtterøy in 2014, and a Striped dolphin was observed the same summer at Helgeroa in Larvik.
Common European Viper is the only venomous snake found in Norway. There are two non-venomous snake species in Vestfold County: European grass snake and European smooth snake.
Vestfold has a rich avifauna: over 130 bird species have been observed in Svelvik, while Mølen in Larvik has the national record of 320 species.
Wildlife refuge
Saltstein is part of a protected habitat for birds. From 2014 surfing was permitted off Saltstein.
Besides being an UNESCO Global Geopark, Mølen in Larvik is a habitat for a variety of rare bird species. Mølen became a protected sanctuary for birds in 1970. 320 species of birds have been recorded at Mølen, more species than at any other site in Norway.
Wildlife preserves include Melsom- and Hemskilen Wildlife Preserves. Hemskilen Wildlife Preserve lies on the Larvik-Sandefjord border and is an important habitat for shorebirds, geese, and Passerines. Melsom Plant- and Wildlife Preserve in Sandefjord is home to various older oaks, some of them home to as many as 1,500 different species of insects. Marøyskjæra Bird Preserve consists of two skerries west of Natholmen Island, which have been important nesting areas for Common tern and Common gull since the 1980s. Over 500 seagulls hatched on the islets in the 1990s.
In popular culture
Although not filmed in Vestfold, the City of Tønsberg appears in the films Thor (2011) and also in Captain America: The First Avenger (2011), and in Avengers: Endgame
Some films shot in Vestfold include:
Norway (2018), movie based on the 2011 Norway attacks, filmed in Tønsberg and Nøtterøy.
Olsenbanden tar gull (1972), filmed in Stavern (Larvik) and Sande in Vestfold.
Baadshah (1999), Tønsberg
Christmas Blood ("Juleblod") (2017), Tønsberg and Sandefjord.
Wisting (2018– ), Larvik and Sandefjord.
Nonni and Manni (1988–89), Horten.
Head Above Water (1993), filmed at East Island in Sandefjord.
Deadline Torp (2005), movie based on the 1994 Torp hostage crisis, filmed in Sandefjord and Larvik.
Valfångare (1939), Sandefjord.
Den starkaste (1929), Sandefjord.
Gallery
References
External links
Vestfold photo gallery
Former counties of Norway
2020 disestablishments in Norway
Petty kingdoms of Norway
States and territories disestablished in 2020 |
18826434 | https://en.wikipedia.org/wiki/1994%20Chinese%20Taipei%20National%20Football%20League | 1994 Chinese Taipei National Football League | Statistics of the Chinese Taipei National Football League for the 1994 season.
Overview
It was contested by 8 teams, and Tatung won the championship.
League standings
References
Chinese Taipei - List of final tables (RSSSF)
Chinese Taipei National Football League seasons
1
Taipei
Taipei |
End of preview. Expand
in Dataset Viewer.
- Downloads last month
- 2