DOMAIN
stringclasses 3
values | FIELD
stringlengths 6
92
| PQ_FORMAT
stringclasses 3
values | TITLE
stringlengths 39
204
| URL
stringlengths 28
214
| PUBLISHING_DATE
stringlengths 11
18
| EXPERIMENTAL_SETUP
stringlengths 373
8.04k
| MEASUREMENT_TAKEN
stringlengths 43
1.32k
| OUTCOME_PREDICTION_QUESTION
stringlengths 174
4.41k
| GTA
stringlengths 4
544
| BACKGROUND_KNOWLEDGE
stringlengths 84
1.67k
| RELATED_PAPERS_DATA
stringlengths 2
4.47k
⌀ |
|---|---|---|---|---|---|---|---|---|---|---|---|
Chemistry
|
Flow Chemistry, Catalysis
|
Numerical Values
|
CO-Degassing in a Segmented Slug Flow Reactor Enables Continuous Linear Alcohol Formation from Alkenes using a single, non-assisted Rh-catalyst by Switching Between Hydroformylation and Aldehyde Reduction
|
https://chemrxiv.org/engage/chemrxiv/article-details/67efd8066dde43c9086929eb
|
April 8, 2025
|
The experiment investigated a continuous tandem reductive hydroformylation of 1-octene to 1-nonanol using Rh(acac)(CO)₂ as precatalyst and Xantphos as ligand in a segmented slug-flow capillary reactor. The main intervention was the introduction of an in-line CO degassing step between the hydroformylation and reduction stages, achieved via a tube-in-tube AF2400 membrane operated under 5 mbar vacuum. This enabled selective removal of dissolved CO before the hydrogenation step, preventing CO inhibition of the reduction catalyst. The model system consisted of four serially connected FEP capillary modules (total length 75 m), with the first 15 m dedicated to hydroformylation, followed by the AF2400 degassing segment, and the remaining three modules used for aldehyde reduction. Critical parameters include the system being maintained at 150 °C under 10 bar (pPIC1) during hydroformylation and 11.5 bar (pPI2) post-degassing for reduction. The gas feed to the first section comprised syngas (CO/H₂) at 2.00 mL min⁻¹, while H₂ was introduced after degassing at 1.00 mL min⁻¹. The liquid feed consisted of a catalyst solution (0.94 mL min⁻¹) containing Rh(acac)(CO)₂ and Xantphos with a Rh/S ratio of 1/200 (0.5 mol %) and a Rh/P ratio of 1/7, alongside a 1-octene substrate feed (0.06 mL min⁻¹) in toluene. The total nominal residence time across the 75 m reactor path was 27.6 minutes, and reaction progress (l-nonanol yield %) was monitored via GC-FID at different reactor outlet points.
|
- l-nonanol yield (%) at reactor outlet (75m) [T = 150 °C, pPIC1 = 10.0 bar, pPI2 = 11.5 bar; Rh(acac)(CO)₂/Xantphos; Rh/S = 1:200, Rh/P = 1:7; syngas 2.00 mL min⁻¹ for the first 15 m (hydroformylation) → AF2400 CO-degassing at 5 mbar → H₂ 1.00 mL min⁻¹ for the remaining 60 m (reduction); total residence time = 27.6 min]. The results were determined via GC-FID
|
Under continuous-flow conditions at 150 °C and 10 bar (pPIC1), using Rh(acac)(CO)₂ as precatalyst and Xantphos as ligand (Rh/S = 1/200 mol/mol; Rh/P = 1/7 mol/mol) in toluene, 1-octene undergoes hydroformylation over the first 15 m of a segmented slug-flow capillary reactor, followed by continuous CO degassing through a tube-in-tube AF2400 membrane operated under 5 mbar vacuum. After degassing, hydrogen (1.00 mL min⁻¹) is introduced for the reduction step over the remaining reactor length (total = 75 m; residence time = 27.6 min). The gas feed to the first section consists of syngas (CO/H₂) = 2.00 mL min⁻¹, while the liquid feed comprises a catalyst phase (0.94 mL min⁻¹) and a 1-octene feed (0.06 mL min⁻¹). The pressure after degassing is 11.5 bar (pPI2). What is the yield (%) of l-nonanol measured at the reactor outlet?
|
l-nonanol yield = (62.1–72.1)% at reactor outlet (75m) [T = 150 °C, pPIC1 = 10.0 bar, pPI2 = 11.5 bar; Rh(acac)(CO)₂/Xantphos; Rh/S = 1:200, Rh/P = 1:7; syngas 2.00 mL min⁻¹ for the first 15 m (hydroformylation) → AF2400 CO-degassing at 5 mbar → H₂ 1.00 mL min⁻¹ for the remaining 60 m (reduction); total residence time = 27.6 min]. Reported point= 67.1 %. Note: No CI/SE/SD reported → fallback ±5 pp applied.
|
- Hydroformylation: is a catalytic reaction that adds a formyl group and a hydrogen atom across an alkene’s double bond to produce an aldehyde using synthesis gas (CO/H₂).
- Reductive hydroformylation: is a tandem process in which the aldehyde intermediate from hydroformylation is further hydrogenated to the corresponding alcohol.
- Rh(acac)(CO)₂: precatalyst combined with the bidentate ligand Xantphos to generate the active rhodium species responsible for catalyzing both the hydroformylation of 1-octene and the subsequent aldehyde reduction under continuous-flow conditions.
- Xantphos: Bidentate ligand coordinated to the rhodium precatalyst Rh(acac)(CO)₂ to form the active catalytic species that enables both the hydroformylation of 1-octene and the subsequent aldehyde reduction under continuous-flow conditions.
- CO inhibition: excess carbon monoxide binds strongly to the rhodium catalyst, suppressing the hydrogenation step and limiting alcohol formation.
- The AF2400: amorphous copolymer of tetrafluoroethylene and perfluorodimethyldioxolane, that allows most gases to permeate while
nearly impermeable to liquids membrane. it Allows selective removal of dissolved gases (CO) from liquid flow under vacuum, facilitating in-line degassing.
- FEP capillary modules: Fluorinated ethylene propylene (FEP) tubing segments connected in series to form the continuous-flow reactor, providing chemically inert channels for the segmented slug-flow reactions, including hydroformylation, CO degassing, and aldehyde reduction.
|
[{"label":"RBK Item","value":"FEP capillary modules: Fluorinated ethylene propylene (FEP) tubing segments connected in series to form the continuous-flow reactor, providing chemically inert channels for the segmented slug-flow reactions, including hydroformylation, CO degassing, and aldehyde reduction. "},{"label":"Title","value":"Gas Introduction by Permeation into Long Fluorinated Ethylene Propylene Capillaries with Slug Flow"},{"label":"URL","value":"https://onlinelibrary.wiley.com/doi/full/10.1002/ceat.202200557"},{"label":"Date","value":"January 16, 2023"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Physics
|
Physics/Optics
|
Numerical Values
|
Generation of UV-Vis correlated photon pairs using PP-LaBGeO₅
|
https://www.arxiv.org/abs/2509.09887
|
September 11, 2025
|
Researchers conducted second harmonic generation (SHG) measurements of periodically poled LaBGeO5 (PP-LBGO) with 2.1 µm gratins. The device was 0.3 mm thick and 10 mm long, and the gratings were 1 mm wide. The chip was mounted to a temperature-controlled block on a three-axis translation stage and heated from room temperature to 80 °C, with a stability of 0.1 °C. The SHG performance was characterized by pumping a single-frequency, diode-pumped solid state laser source at 532 nm that operated at a maximum power of 0.28 W. The laser was directed through a bandpass filter, a half-wave plate and a 10 cm focal length lens that focused the beam through the grating. The output was then collimated and passed through a stack of 4 short-pass filters (total optical density of 20) to filter the second harmonic, 266 nm signal. The filtered signal was coupled into a multimode fiber to use as an input for a spectrometer and a UV-sensitive photodiode.
|
- SHG spectrum obtained with a spectrometer for different temperatures
- SHG power (in µW) as a function of temperature, from room temperature to 80 °C.
|
Researchers conducted second harmonic generation (SHG) measurements of periodically poled LaBGeO5 (PP-LBGO) with 2.1 µm gratins. A 532 nm diode-pumped laser was directed into the sample and the output was filtered with a stack of short pass filters to obtain a 266 nm signal. The intensity of this signal was measured with an UV-sensitive photodiode to measure the generated power for temperatures ranging from room temperature up to 80 °C. Based these measurements, at which temperature (in °C) did the power reach its peak value?
|
[64.2-66.2] °C
Note: No CI/SE/SD provided -> a ±1.0 °C fallback was applied to the 65.2°C value reported by the authors.
|
- Periodically poled LaBGeO5 (PP-LBGO) is an interesting alternative for QPM devices, with a transparency extending to 195 nm and non-hygroscopicity.
|
[{"label":"RBK Item","value":"Periodically poled LaBGeO5 (PP-LBGO) is an interesting alternative for QPM devices, with a transparency extending to 195 nm and non-hygroscopicity."},{"label":"Title","value":"PP-LBGO device with 2nd-order QPM structure for 266nm generation"},{"label":"URL","value":"https://doi.org/10.1364/CLEO_SI.2015.STh3H.5"},{"label":"Date","value":"May 10, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but cited in the main article as reference 16."}]
|
Physics
|
Optics
|
Free-Format Question
|
Degeneracy-Locked Optical Parametric Oscillator
|
https://arxiv.org/abs/2505.00936
|
May 02, 2025
|
Researchers fabricated a degeneracy-locked counter-propagating optical parametric oscillator (CT-OPO) on a thin-film lithium niobate (LN) microresonator. The starting material consisted of a 50 nm-thick NbN layer on top of a silicon substrate, followed by a 2 µm PECVD SiO2 layer. A 600 nm z-cut
LN layer was bonded to this substrate and poling electrodes were patterned using e-beam lithography, followed by nickel deposition and a liftoff process. A voltage of 650 V was applied for 10 ms to the electrodes for poling. During the fabrication process, domains with opposite polarization were etched at slightly different rates. Post-fabrication annealing was conducted at 200◦C for 12 hours.
The device was pumped by a custom 775 nm pulsed laser (15 ns duration, 5 kHz repetition rate), created by frequency-doubling an amplified 1550 nm seed laser. The pump light was injected via a wavelength-division multiplexer (WDM), and the resulting counter-propagating signal and idler waves were collected from opposite sides of the chip using separate WDMs. A suite of characterization tools was employed: optical spectrum analyzers (OSA) and infrared photon detectors recorded the output power spectra; an electrical spectrum analyzer (ESA) measured the RF beat note from the mixed output to confirm frequency degeneracy; an acousto-optic modulator (AOM) shifted the seed laser to provide a reference for phase measurements, confirming the OPO's characteristic 0 or $\pi$ phase-flip; and a heater controlled the chip temperature across a 3-dB temperature bandwidth of ~0.37 $^\circ$C to tune the device's resonance mismatch ($\Delta$).
|
- The output power spectra of the signal and idler waves as a function of pump detuning at different temperatures.
- The operational state of the OPO (e.g., symmetric degenerate, asymmetric degenerate, or non-degenerate) as the temperature is varied.
|
A degeneracy-locked counter-propagating optical parametric oscillator (OPO) is fabricated using submicron periodically poled thin film lithium niobate and its operational stability is tested. The device's temperature is varied across a 3-dB temperature bandwidth of ~0.37 $^\circ$C. What is the expected effect of these temperature variations on the operational state of the optical parametric oscillator?
|
The system remains in a degenerate state despite the temperature variations, demonstrating its robust operation.
|
- An optical parametric oscillator, which can be built in a microresonator, converts a high-frequency pump photon into two lower-frequency photons, known as the signal and idler.
- Degenerate OPOs are challenging to operate in on-chip implementations due to temperature sensitivity and constraints such as phase matching and simultaneous resonance of of the pump and half-harmonic modes.
- The initial resonance mismatch ($\Delta$) quantifies how well the pump resonance aligns with the signal/idler resonance. An ideal mismatch is often near zero.
- Degenerate OPOs can operate in two different states, a symmetric degenerate state or an asymmetric degenerate state, depending on the pump detuning and resonance mismatch.
- The system can switch between the symmetric and asymmetric degenerate states at a specific phase transition point.
|
[{"label":"RBK Item","value":"An optical parametric oscillator, which can be built in a microresonator, converts a high-frequency pump photon into two lower-frequency photons, known as the signal and idler."},{"label":"Title","value":"Parametric generation of tunable light from continuous-wave to femtosecond pulses"},{"label":"URL","value":"https://doi.org/10.1126/science.286.5444.1513"},{"label":"Date","value":"November 19, 1999"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 1 in the article."},{"label":"RBK Item","value":"Degenerate OPOs are challenging to operate in on-chip implementations due to temperature sensitivity and constraints such as phase matching and simultaneous resonance of of the pump and half-harmonic modes."},{"label":"Title","value":"Coherence properties of a doubly resonant monolithic optical parametric oscillator"},{"label":"URL","value":"https://opg.optica.org/josab/abstract.cfm?uri=josab-7-5-815"},{"label":"Date","value":"May 1, 1990"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 27 in the paper."},{"label":"RBK Item","value":"The system can switch between the symmetric and asymmetric degenerate states at a specific phase transition point."},{"label":"Title","value":"Parity-time-symmetric coupled asymmetric dimers"},{"label":"URL","value":"https://doi.org/10.1103/PhysRevA.97.012121"},{"label":"Date","value":"January 19, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA. Phase transition between symmetric and asymmetric degenerate OPO states is asserted in the paper with no external reference."}]
|
Physics
|
Atomic Physics
|
MCQ
|
Single-frequency inverted Doppler-free resonance as a platform for chip-scale optical clock
|
https://arxiv.org/abs/2505.02219
|
May 04, 2025
|
An experiment compares two methods for generating a Doppler-free resonance in a vapor of isotopically enriched $^{87}\mathrm{Rb}$ atoms contained in a glass cell at $60^{\circ}\mathrm{C}$. In the first method, the dual-frequency technique, the atoms are interrogated using complex, counter-propagating bichromatic laser fields generated with an external modulator. In the second method, the single-frequency technique, the atoms are interrogated using a simplified setup with a single monochromatic laser beam with an intensity of approximately $0.8 \,\mathrm{mW/cm^{2}}$ that is reflected back through the cell with an orthogonally-oriented linear polarization. For both methods, the resulting spectroscopic resonance at the $F_{g}=2 \;-\; F_{e}=1$ transition is recorded.
|
- The transmission spectrum of the Fg=2 - Fe=1 transition for the dual-frequency technique.
- The transmission spectrum of the Fg=2 - Fe=1 transition for the single-frequency technique.
- The contrast of the resonance for both techniques.
- The full-width at half-maximum (linewidth) of the resonance for both techniques.
- The ratio of the contrast to the linewidth for both techniques.
|
An experiment compares two methods for generating a Doppler-free resonance in $^{87}\mathrm{Rb}$ atoms: an established dual-frequency technique using bichromatic fields and a new, simplified single-frequency technique using a monochromatic field with orthogonal polarizations. The quality of the resonance from each method is quantified by its contrast-to-width ratio. What is the most likely experimental result when comparing the simplified single-frequency method to the established dual-frequency method?
A) The single-frequency method yields a resonance with a contrast-to-width ratio that is practically the same as the dual-frequency method.
B) The single-frequency method yields a resonance with a significantly lower contrast-to-width ratio, representing the expected performance trade-off for its simplicity.
C) The single-frequency method yields a resonance with a much higher contrast but also a proportionally larger linewidth, resulting in a similar ratio but different spectral characteristics.
D) The single-frequency method yields a resonance with a significantly higher contrast-to-width ratio, proving it to be a superior technique.
|
A) The single-frequency method yields a resonance with a contrast-to-width ratio that is practically the same as the dual-frequency method.
|
1. In atomic vapors, the thermal motion of atoms causes Doppler broadening, which obscures narrow spectroscopic features. Counter-propagating laser beams are used to perform Doppler-free spectroscopy on the stationary, zero-velocity group of atoms.
2. Alkali atoms like rubidium have a complex hyperfine structure. When probed with a single, fixed-polarization laser, atoms can be optically pumped into non-absorbing dark states, which degrades or eliminates the resonance signal. The dual-frequency technique was developed to overcome this.
3. Using counter-propagating laser beams with mutually orthogonal linear polarizations is a technique that can prevent optical pumping for the zero-velocity atoms. This creates a transparency effect at the exact resonance, resulting in a sharp, inverted spectroscopic peak.
|
[{"label":"RBK Item","value":"In atomic vapors, the thermal motion of atoms causes Doppler broadening, which obscures narrow spectroscopic features. Counter-propagating laser beams are used to perform Doppler-free spectroscopy on the stationary, zero-velocity group of atoms."},{"label":"Title","value":"Spectroscopy in a New Light"},{"label":"URL","value":"https://doi.org/10.1103/RevModPhys.54.697"},{"label":"Date","value":"July 01, 1982"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [2] in the report."},{"label":"RBK Item","value":"Alkali atoms like rubidium have a complex hyperfine structure. When probed with a single, fixed-polarization laser, atoms can be optically pumped into non-absorbing dark states, which degrades or eliminates the resonance signal. The dual-frequency technique was developed to overcome this."},{"label":"Title","value":"Doppler-free spectroscopy on the Cs D1 line with a dual-frequency laser"},{"label":"URL","value":"https://opg.optica.org/ol/abstract.cfm?uri=ol-41-13-2982"},{"label":"Date","value":"June 23, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [3] in the report."},{"label":"RBK Item","value":"Using counter-propagating laser beams with mutually orthogonal linear polarizations is a technique that can prevent optical pumping for the zero-velocity atoms. This creates a transparency effect at the exact resonance, resulting in a sharp, inverted spectroscopic peak."},{"label":"Title","value":"Coherent Population Trapping in Laser Spectroscopy"},{"label":"URL","value":"https://osiris.df.unipi.it/gruppi/arimondo/documents/EA157.pdf"},{"label":"Date","value":"1996"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Physics
|
Mesoscale and Nanoscale Physics
|
Free-Format Question
|
Weak localization as probe of spin-orbit-induced spin-split bands in bilayer graphene proximity coupled to WSe₂
|
https://arxiv.org/abs/2505.24632
|
May 30, 2025
|
Researchers tested whether bilayer graphene proximitized by tungsten diselenide shows proximity induced spin split bands that can be read out by weak localization. The device was a dual gate heterostructure where bilayer graphene and tungsten diselenide were encapsulated between hexagonal boron nitride crystals. A graphite bottom gate and a narrow gold top gate provided independent control of Fermi level and band gap. Electrostatic control created lateral p-n-p cavities, and the devices operated in a quasi ballistic regime at a temperature of 60 mK. Low field magnetoconductance was measured to observe quantum interference effects.
|
- Two terminal resistance and differential conductance versus top and bottom gate voltages (Vtg, Vbg) in the range of -2 V to 2 V.
- Low field magnetoconductance versus magnetic field (approx. -10 mT to 10 mT) to observe quantum interference effects and their transition under gate control.
- The effects of varying displacement field intensity (D/ε₀) from -0.2 V/nm to -0.4 V/nm.
|
Researchers constructed a dual gate bilayer graphene device proximitized by tungsten diselenide and recorded its low field magnetoconductance at 60 mK. What is the primary quantum interference effect observed as the Fermi level is tuned from the p-n-p cavity regime to a low hole density near the valence band edge?
|
A gate-tunable transition from weak anti-localization (WAL) to weak localization (WL) is observed.
|
- Bilayer graphene is a two dimensional material whose band structure can be tuned by an electric displacement field.
- Tungsten diselenide is a transition metal dichalcogenide with strong spin orbit coupling.
- Proximity to tungsten diselenide can induce spin splitting in bilayer graphene.
- Weak localization and weak anti localization are quantum interference effects observed in magnetotransport.
|
[{"label":"RBK Item","value":"Bilayer graphene is a two dimensional material whose band structure can be tuned by an electric displacement field"},{"label":"Title","value":"The electronic properties of bilayer graphene"},{"label":"URL","value":"https://doi.org/10.1088/0034-4885/76/5/056503"},{"label":"Date","value":"April 19, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled but cited as reference 21."},{"label":"RBK Item","value":"Proximity to tungsten diselenide can induce spin splitting in bilayer graphene\n"},{"label":"Title","value":"Graphene on transition-metal dichalcogenides: A platform for proximity spin-orbit physics and optospintronics"},{"label":"URL","value":"https://doi.org/10.1103/PhysRevB.92.155403"},{"label":"Date","value":"October 5, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, cited as reference 1."},{"label":"RBK Item","value":"Weak localization and weak anti localization are quantum interference effects observed in magnetotransport."},{"label":"Title","value":"Weak Localization in Graphene Flakes"},{"label":"URL","value":"https://doi.org/10.1103/PhysRevLett.98.176805"},{"label":"Date","value":"April 26, 2007"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, cited as reference 27."}]
|
Biology
|
Microbiology / Plant Pathology
|
MCQ
|
Fair-weather friends: Unequal partnerships between Parastagonospora nodorum and Pyrenophora tritici-repentis define disease dynamics in wheat
|
https://www.biorxiv.org/content/10.1101/2025.10.09.681059v2
|
October 10, 2025
|
Researchers conducted sequential co-infection assays on wheat cultivar Scepter, which has moderate resistance to both pathogens, to investigate the role of temporal dynamics. Parastagonospora nodorum SN15 and Pyrenophora tritici-repentis M4 isolates were maintained on 90 mm V8 PDA plates at ambient temperature under a 12 h light and 12 h dark photoperiod, and mycelial tissue was harvested. Wheat seedlings were grown under white light on a 12-hour photoperiod until 12 days old. Attached leaves were inoculated with 15 µl of either 1x10^7 spores per millilitre of P. nodorum SN15, 1x10^5 spores per millilitre of P. tritici-repentis M4 suspended in 0.02% Tween 20, or a mixture maintaining the same final concentrations.
Following inoculation, the spore suspension was spread with a paintbrush, the leaves were allowed to dry, then sealed inside humidity chambers. The chambers were maintained at 22°C ± 1°C, at or above 95% humidity under a 12 hr light photoperiod. The treatments included single-pathogen infections, simultaneous co-infection, repeated single-pathogen infections after 72 h, and staggered co-infections where P. nodorum preceded P. tritici-repentis by 72 h or vice versa. Seven days after secondary infection, leaves were photographed, and 50mm sections were excised. Different hue value masks were generated to distinguish between healthy, chlorotic, and necrotic tissue, with cutoffs at 90, 43, and 30, respectively, utilizing the opencv library for Python. All fungal and plant tissues were snap frozen in liquid nitrogen, homogenized using a Tissue Lyser II, and DNA was purified. DNA concentrations were determined by fluorometric analysis.
Digital PCR reactions were carried out in 22-µl volumes, where each well contained 11µl ddPCR Supermix for Probes (No dUTP), 5μlDNA template, and 0.25µM of primer/probe mix at equimolar concentration. Primers used: aT_F and aT_R (designed to simultaneously amplify a 187-bp region in P. nodorum and a 185-bp region in P. tritici-repentis). Species-specific fluorescent probes: Pn_FAM and Ptr_HEX for species discrimination. A digital PCR-based model targeting conserved regions of the alpha-tubulin gene was used to quantify pathogen biomass during infection. The integrated biomass model was calculated from the number of alpha-tubulin gene copies per microlitre detected by digital PCR, divided by α (gene copies per nanogram of DNA), and multiplied by β (micrograms of DNA per milligram of tissue).
|
- Infection necrosis in Scepter wheat across co-infection treatments (single-pathogen, simultaneous, P. nodorum followed by P. tritici-repentis and P. tritici-repentis followed by P. nodorum at 72 h).
- Pathogen biomass (µg) for P. nodorum and P. tritici-repentis via biomass model of dPCR quantification across co-infection treatments (single-pathogen, simultaneous, P. nodorum followed by P. tritici-repentis and P. tritici-repentis followed by P. nodorum at 72 h).
|
Sequential co-infection assays were conducted on 12-day-old wheat seedlings (cv. Scepter). Attached leaves were inoculated with 15 µl of either 1x10^7 spores per ml of P. nodorum SN15 spores or 1x10^5 per ml of P. tritici-repentis M4 spores, suspended in 0.02% Tween 20. Staggered co-infection treatments involved one pathogen applied 72 hours after the other (P. nodorum first, or P. tritici-repentis first). Seedlings were incubated at 22°C ± 1°C, ≥ 95% humidity, and leaves were assessed seven days after the secondary infection for infection levels and fungal biomass. Which of the following outcomes is most likely?
A. When P. tritici-repentis establishes first, it compromises subsequent resistance responses to P. nodorum.
B. When P. nodorum establishes first, it compromises subsequent resistance responses to P. tritici-repentis.
C. When P. tritici-repentis establishes first, it enhances subsequent resistance responses to P. nodorum.
D. When P. nodorum establishes first, it enhances subsequent resistance responses to P. tritici-repentis.
|
A. When P. tritici-repentis establishes first, it compromises subsequent resistance responses to P. nodorum.
|
- Parastagonospora nodorum and Pyrenophora tritici-repentis are the causal agents of septoria nodorum blotch and tan spot of wheat, respectively.
- In the colonisation of plant tissues, early arriving species modify environmental conditions and resource availability, altering biotic conditions that determine the trajectory of community development.
- There are priority effects in plant-associated microbial communities, with pathogen arrival order determining infection outcomes and host responses.
- Digital PCR (dPCR) provides absolute quantification of target nucleic acids without standard curves, offering greater precision and reproducibility than RT-PCR for fungal biomass estimations.
|
[{"label":"RBK Item","value":"In the colonisation of plant tissues, early arriving species modify environmental conditions and resource availability, altering biotic conditions that determine the trajectory of community development."},{"label":"Title","value":"The Phyllosphere: Microbial Jungle at the Plant–Climate Interface"},{"label":"URL","value":"https://www.annualreviews.org/content/journals/10.1146/annurev-ecolsys-121415-032238"},{"label":"Date","value":"July 14, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"There are priority effects in plant-associated microbial communities, with pathogen arrival order determining infection outcomes and host responses."},{"label":"Title","value":"Facilitative priority effects drive parasite assembly under coinfection"},{"label":"URL","value":"https://www.nature.com/articles/s41559-020-01289-9"},{"label":"Date","value":"August 31, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Digital PCR (dPCR) provides absolute quantification of target nucleic acids without standard curves, offering greater precision and reproducibility than RT-PCR for fungal biomass estimations."},{"label":"Title","value":"The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments"},{"label":"URL","value":"https://academic.oup.com/clinchem/article-abstract/59/6/892/5621919"},{"label":"Date","value":"June 1, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Parastagonospora nodorum and Pyrenophora tritici-repentis are the causal agents of septoria nodorum blotch and tan spot of wheat, respectively."},{"label":"Title","value":"The pangenome of the wheat pathogen Pyrenophora tritici-repentis reveals novel transposons associated with necrotrophic effectors ToxA and ToxB"},{"label":"URL","value":"https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-022-01433-w"},{"label":"Date","value":"October 24, 2022"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Physics
|
Atomic Physics
|
Numerical Values
|
Single-atom imaging of 173Yb in optical tweezers loaded by a five-beam magneto-optical trap
|
https://arxiv.org/abs/2505.07371
|
May 12, 2025
|
Researchers evaluated whether a five beam magneto optical trap (MOT) in an orthogonal configuration could efficiently load and image single ¹⁷³Yb atoms in optical tweezers. A collimated thermal beam of neutral ytterbium atoms was generated by an oven kept at 380 °C, producing a flux of 1.5x10^12 atoms/s. A Zeeman slower reduced the longitudinal atomic beam velocity by 40m/s. A 2D MOT stage cooled atoms in the transverse direction and deflected the beam to an octagonal glass cell where the experiment took place. The trap operated on the 399 nm cooling transition with a beam waist of approximately 8 mm and intensity equal to 0.3 times the saturation intensity of 60 mW per cm². The atoms were confined for 200 ms in the trap during the MOT stage before undergoing a 250 ms compression MOT stage (pre-cMOT and cMOT). The first stage (pre-cMOT) slowly compressed the atom cloud whilst the field gradient increased to ~10 G/ cm and the power and global detuning of horizontal and vertical MOT beams were reduced. In the cMOT stage, the magnetic field gradient was ramped to ~30G/ cm over a linear increase of 100ms, whilst beam power and detuning were adjusted to yield lowest temperatures. In the last 50 ms of cMOT, the individual atoms were subsequently transferred into a tweezer array generated by 532 nm light focused to a waist of about 580 nm with a trap depth near 2 mK and spacing of 8.7 μm. After cMOT, the magnetic field was turned off and 50 ms of light-assisted collision was applied to isolate single atoms in the tweezers. Fluorescence imaging of the trapped atoms was performed for another 50 ms using 399 nm light at one hundredth of the saturation intensity, and scattered photons were collected by a 0.6 numerical aperture objective.
|
- Fluorescence photon counts collected during 50 ms imaging of trapped atoms
- Single-atom imaging/detection fidelity
- Survival probability of atoms after the imaging sequence
|
Single ¹⁷³Yb atoms were loaded into 532 nm optical tweezers from a five beam magneto optical trap and illuminated with 399 nm light at approximately one hundredth of the saturation intensity for 50 ms. Fluorescence photons were collected with a high numerical aperture objective during the imaging interval. What is the expected number of detected fluorescence photons per atom over the 50 ms imaging period?
|
N_detected = [33.12-40.48] photons/atom
at I_399 = ~ [1.3 x 10^-2] I_s, over 50 ms (Fig. 5a, p. 8).
Note: no CI/SE/SD reported → fallback ± 3.68 applied.
|
- Ytterbium-173 (¹⁷³Yb) is a fermionic isotope of ytterbium used in atomic physics because of its nuclear spin and optical transitions.
- Contrary to six-beam MOTs, a five-beam configuration omits the down-propagating vertical beam and counteracts the push from the bottom beam by gravity alone.
|
[{"label":"RBK Item","value":"Ytterbium-173 (¹⁷³Yb) is a fermionic isotope of ytterbium used in atomic physics because of its nuclear spin and optical transitions."},{"label":"Title","value":"Two-orbital S U(N) magnetism with ultracold alkaline-earth atoms"},{"label":"URL","value":"https://www.nature.com/articles/nphys1535"},{"label":"Date","value":"February 28, 2010"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but cited as reference 16."}]
|
Physics
|
Condensed Matter Physics
|
Numerical Values
|
Stoichiometry control and epitaxial growth of AgCrSe2
thin films by pulsed-laser deposition
|
https://arxiv.org/abs/2505.21867
|
May 28, 2025
|
Researchers used pulsed laser deposition to epitaxially grow AgCrSe$_2$. The stoichiometry of the resulting thin films were studied by using stoichiometric and Ag-rich targets for laser ablation. Stoichiometric AgCrSe$_2$ targets were prepared using a solid-state reaction of stoichiometric amounts of starting materials Ag, Cr, and Se. Meanwhile, Ag-rich pellet targets were prepared by grinding previously made AgCrSe$_2$ pellets and combining them with Ag$_2$Se powder with a 2:1 molar ratio. The 100-nm-thick films were grown on YSZ(111) substrates which were heated from 300 to 500 $^\circ$C. The Ag/Cr composition ratio of the deposited films as a function of target composition and substrate temperature were characterized by energy dispersive X-ray spectroscopy using a scanning electron microscope equipped with an energy dispersive spectrometer.
|
- Ag/Cr ratio of the thin films deposited at substrate temperatures of 450, 500 K using the stoichiometric target.
- Ag/Cr ratio of the thin films deposited at substrate temperatures of 400, 425, 450, 475 and 500 K using the Ag-rich target.
|
Stoichiometric and Ag-rich AgCrSe$_2$ targets were ablated to grow thin films via pulsed laser deposition. The Ag-rich target has a Ag/Cr ratio of 2. What is the Ag/Cr ratio of the thin film grown at 450 $^\circ$C using the Ag-rich target?
|
ΔAg/Cr ratio = [0.94-0.98] at 450 $^\circ$C derived from estimating the error bar lengths, which represent the standard deviation of Ag/Cr ratio values. Note: No CI/SE/SD values reported in the study → fallback ±0.02 applied.
|
- AgCrSe$_2$ is a p-type and polar magnetic semiconductor
- Stoichiometric AgCrSe$_2$ thin films are difficult to fabricate due to the volatility of Ag
- The Ag-deficient phase is a common impurity in AgCrSe$_2$ thin films
- Structural characterization of AgCrSe$_2$ is similar to that of a similar compound PdCoO$_2$ fabricated using pulsed laser deposition
|
[{"label":"RBK Item","value":"AgCrSe$_2$ is a p-type and polar magnetic semiconductor"},{"label":"Title","value":"Ionic and electronic processes in AgCrSe2"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/0167273883901510"},{"label":"Date","value":"December, 1983"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but referenced in the main paper (item [1])."},{"label":"RBK Item","value":"Stoichiometric AgCrSe$_2$ thin films are difficult to fabricate due to the volatility of Ag"},{"label":"Title","value":"Epitaxial growth of AgCrSe2 thin films by molecular beam epitaxy"},{"label":"URL","value":"https://pubs.aip.org/aip/jap/article/135/4/045303/3131064"},{"label":"Date","value":"January 25, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"The Ag-deficient phase is a common impurity in AgCrSe$_2$ thin films"},{"label":"Title","value":"Thermoelectric modulation by intrinsic defects in superionic conductor AgxCrSe2"},{"label":"URL","value":"https://pubs.aip.org/aip/apl/article-abstract/116/16/163901/38414/Thermoelectric-modulation-by-intrinsic-defects-in?redirectedFrom=fulltext"},{"label":"Date","value":"April 22, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but referenced in the main paper (item [23])."},{"label":"RBK Item","value":"Structural characterization of AgCrSe$_2$ is similar to that of a similar compound PdCoO$_2$ fabricated using pulsed laser deposition"},{"label":"Title","value":"Highly conductive PdCoO2 ultrathin films for transparent electrodes"},{"label":"URL","value":"https://pubs.aip.org/aip/apm/article/6/4/046107/121773"},{"label":"Date","value":"April 20, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Plant Biology
|
MCQ
|
Antifungal activity and mechanism of limonene against Fusarium oxysporum, a pathogen of potato dry rot
|
https://www.biorxiv.org/content/10.1101/2025.10.06.675995v1
|
October 6, 2025
|
A group of post-harvest scientists wants to test the effectiveness of limonene in controlling the growth of hyphae of a potato pathogen, Fusarium oxysporum. To do this, they developed an in vitro assay in a Petri dish with a final volume of 30 mL with a mix of PDA medium (200 g of potato, 20 g of glucose, and 15 g of agar) and decreasing concentrations of limonene emulsified with 0.3 DMSO (40.0, 20.0, 10.0, 5.0, 2.5, and 0 μL/mL). A 6-mm-diameter circular agar plug with mycelium, harvested from the periphery of a 5-day-old Fusarium oxysporum PDA plate, was placed at the centre of a plate containing 10ml of the limonene-diluted PDA medium. The 0 μL/mL limonene + DMSO group was considered as CK, and each group (limonene-treated and CK) included three biological replicates. The final prepared PDA plates were incubated at 28°C for 5 days and then observed. Colony diameters were measured using the cross-measurement method. The inhibition rate (%) was calculated using the following formula: Inhibition rate (%) = [(Control colony diameter (C) − Treated colony diameter (T)] / (Control colony diameter (C) − Disc diameter (D)) × 100%. The IC50 was also calculated.
|
- Colony diameter (in cm) of Fusarium oxysporum from control group and limonene-treated groups (2.5, 5.0, 10.0, 20.0 and 40.0 μL/mL) after 5 days of growth.
- Inhibition rate (%) of Fusarium oxysporum from control group and limonene-treated groups (2.5, 5.0, 10.0, 20.0 and 40.0 μL/mL) after 5 days of growth.
- Disc diameter of Fusarium oxysporum from control group and limonene-treated groups (2.5, 5.0, 10.0, 20.0 and 40.0 μL/mL) after 5 days of growth.
- IC50 value of Fusarium oxysporum from the control group and limonene-treated groups (2.5, 5.0, 10.0, 20.0 and 40.0 μL/mL) after 5 days of growth.
|
A group of post-harvest scientists wants to test the effectiveness of limonene in controlling the growth of hyphae of a potato pathogen, Fusarium oxysporum. To do this, they developed an in vitro assay in a Petri dish with a final volume of 30 mL with a mix of PDA medium (200 g of potato, 20 g of glucose, and 15 g of agar) and decreasing concentrations of limonene emulsified with 0.3 DMSO (40.0, 20.0, 10.0, 5.0, 2.5, and 0 μL/mL). A 6-mm-diameter circular agar plug with mycelium, harvested from the periphery of a 5-day-old Fusarium oxysporum PDA plate, was placed at the centre of a plate containing 10ml of the limonene-diluted PDA medium. The 0 μL/mL limonene + DMSO group was considered as CK, and each group (limonene-treated and CK) included three biological replicates. The final prepared PDA plates were incubated at 28°C for 5 days and then observed. Colony diameters were measured using the cross-measurement method. The inhibition rate (%) was calculated using the following formula: Inhibition rate (%) = [(Control colony diameter (C) − Treated colony diameter (T)] / (Control colony diameter (C) − Disc diameter (D)) × 100%. At what limonene concentrations is the inhibition rate most likely to fall between 20 and 40%?
A. Only at 5 μL/mL
B. Only at 10 μL/mL
C. At 5 and 10 μL/mL
D. At 2.5, 5 and 10 μL/mL
|
A. Only at 5 μL/mL
|
- Fusarium oxysporum is one of the most prevalent and virulent pathogens causing potato dry rot.
- Limonene, a bioactive compound, is a monoterpene widely distributed in plants and a key component of plant essential oils that is characterized by its lemon-like aroma.
- Limonene inhibits Fusarium species, specifically, lemon essential oil (48.3% limonene content) at concentrations of 0.5–2.0% completely inhibited the growth of Fusarium graminearum.
|
[{"label":"RBK Item","value":"Fusarium oxysporum is one of the most prevalent and virulent pathogens causing potato dry rot."},{"label":"Title","value":"Survey for potato wilt in Pennsylvania and Southern New York"},{"label":"URL","value":"https://link.springer.com/article/10.1007/BF02911740"},{"label":"Date","value":"September, 1924"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":" Limonene, a bioactive compound, is a monoterpene widely distributed in plants and a key component of plant essential oils that is characterized by its lemon-like aroma."},{"label":"Title","value":"Potential and application of plant volatile organic compounds in agricultural disease control"},{"label":"URL","value":"http://www.nyxxb.cn/en/article/doi/10.16801/j.issn.1008-7303.2022.0043"},{"label":"Date","value":"July 19, 2022"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Limonene inhibits Fusarium species, specifically, lemon essential oil (48.3% limonene content) at concentrations of 0.5–2.0% completely inhibited the growth of Fusarium graminearum. "},{"label":"Title","value":"Comparison of the Fungistatic Activity of Selected Essential Oils Relative to Fusarium graminearum Isolates"},{"label":"URL","value":"https://www.mdpi.com/1420-3049/24/2/311"},{"label":"Date","value":"January 16, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Microbiomics
|
MCQ
|
Gut Microbiota Modulates and Predicts Disease Severity in Experimental Pemphigoid Disease
|
https://www.biorxiv.org/content/10.1101/2025.10.01.679837v1
|
October 1, 2025
|
To verify the influence of the microbiota composition on the severity and progression of Pemphigoid Disease, researchers, using a passive model of bullous pemphigoid-like epidermolysis bullosa acquisita (BP-like EBA), compared C57BL/6J mice from two sources that differed in their baseline microbiota. A total of 90 female C57BL/6J mice (8-14 weeks old) were sourced from two breeding sources: University of Lübeck (UL, n = 46) and Charles River Laboratories (CR; Sulzfeld, Germany, n = 44). Among those mice, 16 from UL and 14 CR were randomly chosen and co-housed (Mix_UL, Mix_CR) for 28 days, with 5 in each cage, with a darklight cycle of 12h:12h and under a constant temperature and humidity. All mice were maintained under specific pathogen-free (SPF) conditions with ad libitum access to standard water and chow. The passive BP-like EBA mouse model was induced in mice by injection of anti-COL7 IgG (every 2 days for 12 days), with age-matched controls receiving normal rabbit IgG. Disease severity was assessed based on the extent of clinical manifestations, including crusts, erythema, lesions, and/or alopecia on individual body parts on day 4, 8, and 12, according to a 0-4 score system, which relies on the percentage of the body surface area affected.
Prior to disease induction, DNA was extracted from fecal samples (fresh pellets aseptically collected and immediately frozen at -80 °C). To identify the presence and abundance of different operational taxonomic units (OTU) composing each microbiome, researchers performed 16S rRNA gene amplicon-based sequence analysis (V1–V2 region amplified with 27F/338R primers, dual-barcoded, sequenced on Illumina MiSeq, processed in QIIME2/DADA2, clustered at 99 % OTU similarity, taxonomy assigned via SILVA 138). LEfSe analysis (|LDA| ≥ 2, adjusted p < 0.05) was performed in R (microeco v1.4.0) to identify differential gut OTUs. Spearman correlations between OTU abundance and disease severity were calculated across 45 mice, adjusted for source (CR, UL, Mix_CR, Mix_UL), including only taxa with ≥20% prevalence and applying Benjamini–Hochberg correction for multiple testing.
|
- Relative abundance (%) of each operational taxonomic unit (OTU) across mice with differing disease severity scores (0–4 scale) under a passive model of bullous pemphigoid-like epidermolysis bullosa acquisita (BP-like EBA) following 16S rRNA gene sequencing of fecal DNA prior to disease induction.
|
To verify the influence of the microbiota composition on the severity and progression of Pemphigoid Disease, researchers, using a passive model of bullous pemphigoid-like epidermolysis bullosa acquisita (BP-like EBA), compared C57BL/6J mice from two sources that differed in their baseline microbiota. A total of 90 female C57BL/6J mice (8-14 weeks old) were sourced from two breeding sources: University of Lübeck (UL, n = 46) and Charles River Laboratories (CR; Sulzfeld, Germany, n = 44). Among those mice, 16 from UL and 14 CR were randomly chosen and co-housed (Mix_UL, Mix_CR) for 28 days, with 5 in each cage, with a darklight cycle of 12h:12h and under a constant temperature and humidity. Disease was induced in mice by injection of anti-COL7 IgG (every 2 days for 12 days), with age-matched controls receiving normal rabbit IgG. Disease severity was assessed based on the extent of clinical manifestations, including crusts, erythema, lesions, and/or alopecia on individual body parts on day 4, 8, and 12, according to a 0-4 score system, which relies on the percentage of the body surface area affected.
Baseline fecal DNA was analyzed by 16S rRNA sequencing to identify gut OTUs; LEfSe (|LDA| ≥ 2, adj. p < 0.05) and Spearman correlations (adjusted for source, ≥20% prevalence, Benjamini–Hochberg correction) were used to relate OTU abundance to disease severity.
Which outcome best describes the expected relationship between baseline gut microbiota and disease severity?
A. Researchers only found one OTU significantly associated with disease severity.
B. Researchers did not find a single OTU significantly associated with disease severity.
C. Researchers found multiple OTUs significantly associated with disease severity.
|
A. Researchers only found one OTU significantly associated with disease severity.
|
- Pemphigoid diseases can be induced in mice either by repeated injections of rabbit IgG against Col 17/ Col7 (passive models), or immunization of mice with recombinant fragments of murine Col 17/ Col7 (active models)
- Mice that did not develop clinical disease, although serum anti-Col7 IgG and tissue-bound IgG and C3 were present, revealed a significantly higher richness and distinctly clustered diversity of their skin microbiota compared to diseased animals
- Gut dysbiosis can influence skin health by e.g. triggering immunological responses through microbial metabolites such as SCFA and GABA
|
[{"label":"RBK Item","value":"Pemphigoid diseases can be induced in mice either by repeated injections of rabbit IgG against Col 17/ Col7 (passive models), or immunization of mice with recombinant fragments of murine Col 17/ Col7 (active models)"},{"label":"Title","value":"A passive transfer model of the organ-specific autoimmune disease, bullous pemphigoid, using antibodies generated against the hemidesmosomal antigen, BP180"},{"label":"URL","value":"https://www.jci.org/articles/view/116856"},{"label":"Date","value":"November 1, 1993"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Mice that did not develop clinical disease, although serum anti-Col7 IgG and tissue-bound IgG and C3 were present, revealed a significantly higher richness and distinctly clustered diversity of their skin microbiota compared to diseased animals"},{"label":"Title","value":"Skin microbiota-associated inflammation precedes autoantibody induced tissue damage in experimental epidermolysis bullosa acquisita"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S0896841115300251"},{"label":"Date","value":"April 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Gut dysbiosis can influence skin health by e.g. triggering immunological responses through microbial metabolites such as SCFA and GABA"},{"label":"Title","value":"Impact of gut microbiome on skin health: gut-skin axis observed through the lenses of therapeutics and skin diseases"},{"label":"URL","value":"https://www.tandfonline.com/doi/full/10.1080/19490976.2022.2096995"},{"label":"Date","value":"July 22, 2022"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Microbiology
|
MCQ
|
Potent antimicrobial activity of hydrogel loaded with the antimicrobial peptide, D-Bac8c2,5 Leu, against monospecies and polymicrobial biofilms of Staphylococcus aureus and Pseudomonas aeruginosa
|
https://www.frontiersin.org/journals/microbiology/articles/10.3389/fmicb.2025.1571649/full
|
April 24, 2025
|
Researchers studied the effectiveness of five antimicrobial peptides (AMPs) against strains of Staphylococcus aureus and Pseudomonas aeruginosa. AMPs D-Bac8c2,5 Leu (RLWVLWRR, 1183.47 g/mol, +4), DRGN-1 (PSKKTKPVKPKKVA, 1535.95 g/mol, +7), 1037 (KRFRIRVRV, 1228.54 g/mol, +7), IDR-1018 (VRLIVAVRIWRR, 1535.93 g/mol, +5), RP557 (RFCWKVCYKGICFKKCK, 2139.73 g/mol, +7) were tested on methicillin-resistant S. aureus (MRSA): USA300 LAC and BH1CC; methicillin-sensitive S. aureus (MSSA): SH1000 and BH48; and Pseudomonas aeruginosa PAO1 (ATCC 156920) with fusidic acid, gentamicin, and mupirocin as antibiotic comparators. AMPs were synthesized by solid-phase 9-fluorenylmethoxycarbonyl (Fmoc) chemistry, purified to 95-99% by reverse-phase high-performance liquid chromatography (RP-HPLC), and mass confirmed by matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF MS). Minimum inhibitory concentration (MIC) was determined aerobically using a broth microdilution assay. 2-fold serial dilutions of the AMPs and antibiotics were prepared in Mueller-Hinton broth (MHB) in a 96-well round-bottom polypropylene plate. Bacterial suspensions were diluted in sterile phosphate-buffered saline (PBS) and then added to the wells, resulting in a final cell density of 10⁵ colony-forming units (CFU)/mL. Plates were incubated statically (18h at 37 °C). Each assay included inoculated medium without antimicrobials (growth) and uninoculated medium (sterility) as controls. The MIC value was determined as the lowest antimicrobial concentration that showed no visible growth relative to the controls. Each assay was conducted in triplicate and repeated three independent times.
|
- Minimum inhibitory concentration (MIC) values across different antimicrobial peptide treatments (D-Bac8c2,5 Leu, DRGN-1, 1037, IDR-1018, RP557) and comparator antibiotics (fusidic acid, gentamicin, mupirocin) against bacterial strains (SH1000, BH48, USA300 LAC, BH1CC, PAO1).
|
In a MIC (minimum inhibitory concetration) assay, five antimicrobial peptides (AMPs): D-Bac8c2,5 Leu (RLWVLWRR, 1183.47 g/mol, +4), DRGN-1 (PSKKTKPVKPKKVA, 1535.95 g/mol, +7), 1037 (KRFRIRVRV, 1228.54 g/mol, +7), IDR-1018 (VRLIVAVRIWRR, 1535.93 g/mol, +5), RP557 (RFCWKVCYKGICFKKCK, 2139.73 g/mol, +7) were tested against methicillin-resistant S. aureus: USA300 LAC and BH1CC; methicillin-sensitive S. aureus: SH1000 and BH48; and Pseudomonas aeruginosa PAO1 (ATCC 156920) with fusidic acid, gentamicin, and mupirocin as antibiotic comparators. MIC was determined by broth microdilution using 2-fold serial dilutions of AMPs and antibiotics in Mueller-Hinton broth, inoculated with ~10⁵ CFU/mL from PBS-diluted suspensions in 96-well plates, and incubated statically for 18 h at 37 °C. MIC was defined as the lowest concentration at which no visible growth was observed. Which answer option correctly summarizes the result?
A. IDR-1018 consistently showed the lowest MIC across all strains
B. D-Bac8c2,5 Leu requires a higher MIC against P. aeruginosa compared to S. aureus
C. RP557 exhibited lower MIC values in S. aureus strains compared to P. aeruginosa
D. IDR-1018 MIC matched the MIC of fusidic acid against methicillin-resistant S. aureus
|
B. D-Bac8c2,5 Leu requires a higher MIC against P. aeruginosa compared to S. aureus
|
- AMPs (antimicrobial peptides) are emerging as treatment alternatives to antibiotic-resistant strains due to antimicrobial properties, immunomodulatory effects, and low toxicity.
|
[{"label":"RBK Item","value":"AMPs (antimicrobial peptides) are emerging as treatment alternatives to antibiotic-resistant strains due to antimicrobial properties, immunomodulatory effects, and low toxicity."},{"label":"Title","value":"AMPs as anti-biofilm agents for human therapy and prophylaxis"},{"label":"URL","value":"https://link.springer.com/chapter/10.1007/978-981-13-3588-4_14"},{"label":"Date","value":"April 13, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Cancer Biology/Cell Biology
|
Free-Format Question
|
Loss of tumor suppressor p53 upregulates stem cell factor SOX9 via Notch signaling
|
https://www.biorxiv.org/content/10.1101/2025.05.27.656408v1
|
May 31, 2025
|
Researchers evaluated whether p53 controls Notch signalling and thereby SOX9 expression. Experimentally, they analyzed the level of Notch signalling proteins between p53-WT and p53-KO MaSC organoids derived from mouse breast tissue. p53-WT and p53-KO organoids were treated with DMSO (dimethyl sulfoxide) control and 10 μM Nut-3 (nutlin-3) for 48 hours in organoid culture conditions. Briefly, organoids were trypsinized, and live cells were counted using trypan blue. 400,000 live MaSCs were mixed with 2 mL of organoid media containing a final concentration of 10 μM Nut-3 and 5% Matrigel and seeded in one well of poly-HEMA-coated 6-well plates. After 48 hours of treatment, organoids were collected, and Matrigel was broken/diluted using ice-cold PBS and centrifuged at 500g for 5 min. The obtained organoid pellets were directly lysed in RIPA lysis buffer with the help of a syringe. Organoid lysates were centrifuged at 14,000 rpm for 15 min, and the collected proteins were run on precast Bis-Tris protein gels (4-12%). Resolved proteins were transferred to PVDF membrane, blocked with 5% non-fat milk for 1 hour, washed with 1xPBST three times, 10 minutes each, and incubated with primary antibodies against NOTCH, NICD1, and SOX9, overnight in the cold room. The next day, the blots were taken out from the primary antibodies and washed thrice with 1xPBST for 10 minutes each and incubated with secondary antibodies for 1 hour at RT, washed thrice with 1xPBST for 10 minutes each, and developed using ECL reagent in the darkroom.
|
- Protein expression levels of NOTCH, NICD1 and SOX9 (WT and p53-KO organoids in DMSO vs Nutlin)
|
Researchers grew mouse-derived mammary organoids in culture. Conditions included WT and p53 knockout organoids as well as control and Nutlin-3 treated. They were used to identify whether loss of P53 activates NOTCH signalling in these cultures. Would you expect there to be a significant change if NICD1 protein upon loss of P53?
|
In organoid culture, we could only see a modest increase in NICD1 levels upon p53 loss.
|
- In BLBC, TP53 is mutated in nearly 90% of the cases
- SOX9, a key developmental transcription factor of the luminal progenitor cells in mouse and human breast
- SOX9 expression has also been linked to cancer progression for various cancer types such as breast cancer 26,42-46
- NICD1 can regulate SOX9 by binding to its promoter 81, 82, 89
|
[{"label":"RBK Item","value":"In BLBC, TP53 is mutated in nearly 90% of the cases "},{"label":"Title","value":"Comprehensive molecular portraits of human breast tumors"},{"label":"URL","value":"https://www.nature.com/articles/nature11412"},{"label":"Date","value":"September 23, 2012"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"SOX9, a key developmental transcription factor of the luminal progenitor cells in mouse and human breast "},{"label":"Title","value":"Lineage-Biased Stem Cells Maintain Estrogen-Receptor-Positive and -Negative Mouse Mammary Luminal Lineages"},{"label":"URL","value":"https://www.cell.com/cell-reports/fulltext/S2211-1247(17)30289-9?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS2211124717302899%3Fshowall%3Dtrue"},{"label":"Date","value":"March 21, 2017"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"SOX9 expression has also been linked to cancer progression for various cancer types such as breast cancer "},{"label":"Title","value":"A Sox2–Sox9 signalling axis maintains human breast luminal progenitor and breast cancer stem cells"},{"label":"URL","value":"https://www.nature.com/articles/s41388-018-0656-7"},{"label":"Date","value":"Jan 08, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"NICD1 can regulate SOX9 by binding to its promoter "},{"label":"Title","value":"Genome-wide analysis of N1ICD/RBPJ targets in vivo reveals direct transcriptional regulation of Wnt, SHH, and Hippo pathway effectors by Notch1"},{"label":"URL","value":"https://academic.oup.com/stmcls/article-abstract/30/4/741/6415703?redirectedFrom=fulltext"},{"label":"Date","value":"April 2012"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Cryobiology / Cancer Biology
|
MCQ
|
Enhancing cryopreservation of ex vivo 3D tumor models using vitrification strategies
|
https://www.biorxiv.org/content/10.1101/2025.10.01.679784v1
|
October 3, 2025
|
Researchers determined the efficiency of the cryopreservation protocols, warm vitrification versus slow-freeze, by observing post-cryopreservation tissue viability in comparison with the results from fresh samples. The 2 cancer cell lines in the study are the human-derived ovarian (TOV112D) and prostate (49F). Each cancer cell line was cultured in petri dishes at 80% confluency in complete OSE media. A cell pellet (approximately 2 million cells) was prepared and injected into the lower left or right quadrant of a NOD-SCID (immunodeficient) mouse. The pellet was allowed to grow into a tumor of approximately 1000 mm³. Then, the tumor was harvested and microdissected into 500 ovaloids (microdissected tissue explants - MDTs), each approximately 350 µm in diameter. Then, fresh MDTs were cryopreserved using either slow-freeze method or warm vitrification. For slow-freezing, MDTs were suspended in freezing solution (fetal bovine serum (FBS) mixed with DMSO as a cryoprotective agent (CPA)), and gradually cooled from 25 °C to -80 °C in >90 mins, using a Mr. Frosty container to control the freezing rate. The samples were stored at -80 °C for one week. For warm vitrification, MDTs were pooled into groups of 80 and transferred into cryotubes. The freezing solution is DMETC199 mixed with FBS. Two successive baths of increasing CPAs (DMSO, EG, Sucrose) concentrations were applied inside the tubes (7.5% (v/v) → 15% (v/v)). As much liquid as possible was removed before freezing to maximize direct contact with liquid nitrogen, ensuring sub-second freezing time (37 to -196 °C in less than 1 sec). The cryotubes were stored in a liquid nitrogen tank for one week. The cryopreserved samples were then thawed to measure post-cryopreservation proliferation levels, cell density, and apoptosis levels. Warm vitrification samples were thawed by reversing the initial CPA baths, followed by a final wash in standard culture media. Slow-freeze samples were thawed by simply washing with culture media to remove cryoprotectants. The samples were loaded onto microfluidic platforms purchased from MISO chip (Montreal, Quebec, Canada). The culture medium was the complete OSE medium with antibiotics and FBS. The chips were kept in a humidified chamber inside an incubator at 37 °C and 5% CO2 for 4 days. The proliferation and apoptosis levels were measured through immunofluorescence (IF) staining for Ki-67, and cleaved caspase 3 (CC3) markers, using DAPI as counterstain. Image analysis was performed using VisionmorphTM (Visiopharm, Hørsholm, Denmark), applying a threshold-based method to quantify the area and count of positively stained pixels relative to negative background pixels. All quantitative data obtained from immunohistochemical and immunofluorescent assays were analyzed using One-way ANOVA to assess statistical significance across experimental groups in GraphPad Prism (GraphPad Software, San Diego, CA, USA).
|
- Quantitative data of the area and count of Ki-67 (proliferation) positively stained pixels relative to negative background pixels (%) of each preservation method (fresh sample, warm vitrification, and slow-freeze), of each cell line (49F and TOV112D).
- Quantitative data of the area and count of CC3 (apoptosis) positively stained pixels relative to negative background pixels (%) of each cryopreservation method (fresh sample, warm vitrification, and slow-freeze), of each cell line (49F and TOV112D).
|
The efficiency of two cryopreservation methods, slow-freeze and warm vitrification, was evaluated by measuring post-cryopreservation proliferation levels and apoptosis levels of microdissected tissue explants (MDTs) derived from 2 cell lines, 49F (ovarian tumor) and TOV112D (prostate tumor), in comparison with the results from the fresh sample cultures. The fresh MDTs of each cell line were cryopreserved by either slow-freeze or warm vitrification for 7 days before being thawed, cultured for 4 days, and subjected to IF staining for Ki-67 (proliferation) and CC3 (apoptosis) markers. Then, image analysis was performed to quantify the area of positively stained pixels relative to negative background pixels, and determine the proliferation level and apoptosis level. Which of the following outcomes is most likely? Note: “A > B” denotes for A significantly (p < 0.05) higher than B; “A = B” denotes for no significant (p > 0.05) differences between A and B.
A) Proliferation level of 49F: Fresh sample > Warm Vitrification > Slow-Freeze; Apoptosis level of 49F: Fresh sample > Warm Vitrification > Slow-Freeze; Proliferation level of TOV112D: Fresh sample > Warm Vitrification > Slow-Freeze; Apoptosis level of TOV112D: Fresh sample > Warm Vitrification > Slow-Freeze
B) Proliferation level of 49F: Fresh sample > Warm Vitrification > Slow-Freeze; Apoptosis level of 49F: Slow-Freeze > Warm Vitrification > Fresh sample; Proliferation level of TOV112D: Fresh sample > Warm Vitrification > Slow-Freeze; Apoptosis level of TOV112D: Slow-Freeze > Warm Vitrification > Fresh sample
C) Proliferation level of 49F: Fresh sample > Slow-Freeze = Warm Vitrification; Apoptosis level of 49F: Fresh sample = Slow-Freeze > Warm Vitrification; Proliferation level of TOV112D: Fresh sample > Warm Vitrification = Slow-Freeze; Apoptosis level of TOV112D: Fresh sample > Warm Vitrification = Slow-Freeze
D) Proliferation level of 49F: Fresh sample > Slow-Freeze = Warm Vitrification; Apoptosis level of 49F: Warm Vitrification = Slow-Freeze > Fresh sample; Proliferation level of TOV112D: Fresh sample > Warm Vitrification = Slow-Freeze; Apoptosis level of TOV112D: Warm Vitrification = Slow-Freeze > Fresh sample
|
C) Proliferation level of 49F: Fresh sample > Slow-Freeze = Warm Vitrification; Apoptosis level of 49F: Fresh sample = Slow-Freeze > Warm Vitrification; Proliferation level of TOV112D: Fresh sample > Warm Vitrification = Slow-Freeze; Apoptosis level of TOV112D: Fresh sample > Warm Vitrification = Slow-Freeze
|
- Given the limited availability of tumor material from surgical or biopsy specimens, microdissected tissue explants (MDTs) from a single tumor sample maintained under microfluidic platforms would enable the study of multiple tailored treatment modalities on representative patient-derived tumor models.
- Slow freezing cryopreservation involves a gradual reduction in temperature (typically 1 °C per minute) in the presence of a low concentration of cryoprotectants (CPAs) such as DMSO.
- While effective for cell suspensions, slow-freezing is poorly suited to 3D explants due to the incomplete diffusion of cryoprotectant into the core of the 3D tissue explants, leading to ice crystal formation and tissue damage.
- Vitrification is the process of inducing a transition from a liquid to an amorphous solid state, preventing crystalline ice formation. It is achieved by a combination of high concentrations of CPAs, which elevate solution viscosity, and ultra-rapid cooling, often via liquid nitrogen immersion.
|
[{"label":"RBK Item","value":"- Given the limited availability of tumor material from surgical or biopsy specimens, microdissected tissue explants (MDTs) from a single tumor sample maintained under microfluidic platforms would enable the study of multiple tailored treatment modalities on representative patient-derived tumor models."},{"label":"Title","value":"Microdissected Tissue vs Tissue Slices—A Comparative Study of Tumor Explant Models Cultured On-Chip and Off-Chip"},{"label":"URL","value":"https://www.mdpi.com/2072-6694/13/16/4208"},{"label":"Date","value":"August 21, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- While effective for cell suspension, slow-freezing is poorly suited to 3D explants due to the incomplete diffusion of cryoprotectant into the core of the 3D tissue explants, leading to ice crystal formation and tissue damage."},{"label":"Title","value":"Biobanking of patient and patient-derived xenograft ovarian tumour tissue: efficient preservation with low and high fetal calf serum based methods"},{"label":"URL","value":"https://www.nature.com/articles/srep14495"},{"label":"Date","value":"October 6, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Vitrification is the process of inducing a transition from a liquid to an amorphous solid state, preventing crystalline ice formation. It is achieved by a combination of high concentrations of CPAs, which elevate solution viscosity, and ultra-rapid cooling, often via liquid nitrogen immersion. "},{"label":"Title","value":"Principles of Cryopreservation by Vitrification"},{"label":"URL","value":"https://link.springer.com/protocol/10.1007/978-1-4939-2193-5_2"},{"label":"Date","value":"November 14, 2014"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the RBK item cited by this paper"}]
|
Biology
|
Cancer Biology
|
MCQ
|
Comparative Analysis of the Effects of PSPH and PHGDH Inhibitors on Tumor Cell Proliferation
|
https://www.biorxiv.org/content/10.1101/2025.04.28.650903v1
|
Apr 30, 2025
|
Researchers assessed the correlation between inhibition of serine metabolism and tumour growth. Cell proliferation was assessed using the CCK-8 assay. HCC-70 and BT-20 cells were grown in DMEM (Dulbecco's Modified Eagle's Medium). All media were supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin. The cells were seeded into 96-well plates at a density of 5,000 cells per well. After cell attachment, the culture medium was replaced with serine/glycine-free DMEM containing either PSPH or PHGDH inhibitors at final concentrations of 40 or 20, 10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625, or 0.07812 μM. After 4 days of treatment, 10 μL of CCK-8 solution was added to each well and incubated at 37 °C for 2 hours. Absorbance was then measured at 452 nm. All experiments were performed in triplicate.
|
- Cell proliferation was assessed on cell lines (HHC-70 and BT-20) treated with PSPH or PHGDH in DMEM medium lacking serine and glycine using CCK-8 assay.
|
Researchers cultured HCC-70 and BT-20 cells in serine and glycine-free DMEM media containing either PSPH or PHGDH inhibitors at final concentrations of 40 or 20, 10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625, or 0.07812 μM. After 4 days of treatment, 10 μL of CCK-8 solution was added to each well and incubated at 37°C for 2 hours. The absorbance was then measured at 452 nm. Which of the following outcomes is most likely?
A. Both PSPH and PHGDH had significant anti-proliferative effects
B. PSPH was better at inhibiting cellular proliferation than PHGDH
C. The PSPH inhibitors failed to significantly inhibit cell proliferation
D. The PHGDH inhibitors had minimal anti-proliferative effects
|
C. The PSPH inhibitors failed to significantly inhibit cell proliferation
|
- Phosphoglycerate dehydrogenase (PHGDH) converts 3-phosphoglycerate (3PG) to 3-phosphohydroxypyruvate (3PHP).
- PHGDH is also involved in several other critical metabolic processes, including one-carbon metabolism, redox homeostasis via NAD⁺/NADH balance, α-KG production, and nucleotide biosynthesis.
- PHGDH inhibition has been shown to markedly reduce tumor cell growth in some contexts.
- Phosphoserine phosphatase (PSPH) catalyzes the dephosphorylation of p-Ser to produce serine.
|
[{"label":"RBK Item","value":"Phosphoglycerate dehydrogenase (PHGDH) converts 3-phosphoglycerate (3PG) to 3-phosphohydroxypyruvate (3PHP). "},{"label":"Title","value":"Serine Metabolic Reprogramming in Tumorigenesis, Tumor Immunity, and Clinical Treatment"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/pii/S2161831323003125?via%3Dihub"},{"label":"Date","value":"September 2023"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"PHGDH is also involved in several other critical metabolic processes, including one-carbon metabolism, redox homeostasis via NAD⁺/NADH balance, α-KG production, and nucleotide biosynthesis."},{"label":"Title","value":"PHGDH: a novel therapeutic target in cancer"},{"label":"URL","value":"https://www.nature.com/articles/s12276-024-01268-1"},{"label":"Date","value":"July 01, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"PHGDH inhibition has been shown to markedly reduce tumor cell growth in some contexts."},{"label":"Title","value":"The PHGDH enigma: Do cancer cells only need serine or also a redox modulator?"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S0304383520300501#preview-section-introduction"},{"label":"Date","value":"Feb 04, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Phosphoserine phosphatase (PSPH) catalyzes the dephosphorylation of p-Ser to produce serine."},{"label":"Title","value":"Serine Metabolic Reprogramming in Tumorigenesis, Tumor Immunity, and Clinical Treatment"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC10509429/"},{"label":"Date","value":"May 13, 2023"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA; the primary site cannot be reached."}]
|
Biology
|
Plant Developmental Biology, Crop Science
|
MCQ
|
The lag phase of seed development plays an important role in determining the maximum potential final seed weight in soybean (Glycine max L.)
|
https://www.biorxiv.org/content/10.1101/2025.10.07.679780v1
|
October 7, 2025
|
An experiment was conducted to investigate how genetic background and resource availability influence early soybean seed development. Researchers selected four maturity group-0 cultivars representing contrasting seed sizes (two small-seeded: C1 and C2; two large-seeded: C3 and C4). Plants were grown under either control conditions (normal multi-pod development) or depodding treatment, where at anthesis all flowers except one marked flower per node on the main stem were removed, along with all flowers on secondary branches. Following this, emerging flowers were continuously eliminated. Lag phase duration was measured as days from open flower until seeds reached 3 mm in length, determined by tracking marked pods every three days and periodically sampling pods to measure seed size. Each cultivar-treatment combination included five replicate plants, and the experiment was performed over three consecutive growing seasons.
|
- Lag phase duration (days): temporal tracking from anthesis (open flower marking) until pods contained 3 mm seeds (measured via pod dissection and seed measurement); recorded for all four cultivars under both control and depodding conditions
|
An experiment was conducted to investigate how genetic background and resource availability influence early soybean seed development. Researchers selected four maturity group-0 cultivars representing contrasting seed sizes (two small-seeded: C1 and C2; two large-seeded: C3 and C4) under two conditions: control (normal multi-pod development) or depodding (all flowers except one per node on the main stem removed at anthesis to eliminate resource competition). The lag phase duration, defined as days from open flower until pods contained 3 mm seeds, was measured for each cultivar under both conditions. Which of the following statements describes the observed results? Select all options that apply.
A) Large-seeded cultivars exhibited significantly longer lag phase durations than small-seeded cultivars, regardless of treatment condition.
B) Lag phase duration showed a strong positive correlation with final seed weight across all cultivars and treatments.
C) Depodding treatment significantly extended lag phase duration compared to control conditions, demonstrating that resource availability modulates early developmental timing.
D) The interaction between cultivar and treatment was significant, indicating that small-seeded and large-seeded cultivars responded differently to increased resource availability.
|
A) Large-seeded cultivars exhibited significantly longer lag phase durations than small-seeded cultivars, regardless of treatment condition.
B) Lag phase duration showed a strong positive correlation with final seed weight across all cultivars and treatments.
|
- The lag phase is a plant developmental stage where embryo cells undergo continuous cell division to form preglobular, globular, and heart shapes, and reach the maximum number of cotyledon.
- Since the number of cotyledon cells generated during the lag phase is positively associated with seed weight, the length of the lag phase is hypothesized to show a corresponding positive association with seed weight.
- Pod development is a key factor influencing seed growth by encapsulating, protecting and supplying assimilates in developing seeds.
|
[{"label":"RBK Item","value":"The lag phase is a plant developmental stage where embryo cells undergo continuous cell division to form preglobular, globular, and heart shapes, and reach the maximum number of cotyledon."},{"label":"Title","value":"Control of Seed Growth in Soya Beans [Glycine max (L.) Merrill]"},{"label":"URL","value":"https://doi.org/10.1093/oxfordjournals.aob.a086110"},{"label":"Date","value":"August, 1981"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Pod development is a key factor influencing seed growth by encapsulating, protecting and supplying assimilates in developing seeds. "},{"label":"Title","value":"The role of the pod in seed development: strategies for manipulating yield"},{"label":"URL","value":"https://nph.onlinelibrary.wiley.com/doi/10.1111/j.1469-8137.2011.03714.x"},{"label":"Date","value":"April 20, 2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Since the number of cotyledon cells generated during the lag phase is positively associated with seed weight, the length of the lag phase is hypothesized to show a corresponding positive association with seed weight."},{"label":"Title","value":"Relationship of Cotyledon Cell Number and Seed Respiration to Soybean Seed Growth"},{"label":"URL","value":"https://acsess.onlinelibrary.wiley.com/doi/abs/10.2135/cropsci1985.0011183X002500050021x"},{"label":"Date","value":"September 1, 1985"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Plant Biology
|
Free-Format Question
|
Jasmonate primes plant responses to extracellular ATP
|
https://doi.org/10.1111/tpj.70514
|
October 6, 2025
|
Researchers analyzed how various plant stress hormones influence extracellular ATP (eATP) signaling differently. eATP-induced cytosolic Ca²⁺ levels after hormonal treatment (50 µM methyl jasmonate [MeJA], 300 µM salicylic acid [SA], 50 µM aminocyclopropane-carboxylic acid [ACC], or 50 µM abscisic acid [ABA]) were measured in transgenic Arabidopsis thaliana seedlings expressing the cytosolic calcium reporter apoaequorin, and the Ca²⁺-induced luminescence was recorded. Surface-sterilized and cold-stratified seeds were sown on square plates containing ½-strength Murashige and Skoog (MS) medium (pH 5.8) supplemented with 0.8% (w/v) sucrose, 0.8% (w/v) agar, and 0.5 g L⁻¹ MES. After sowing, the plates were transferred to a 22°C growth chamber with a 12-h light cycle (100–120 µmol photons m⁻² s⁻¹) and grown vertically for 7 days. On the morning of the 8th day, individual seedlings were transferred to single wells of 96-well plates containing the apoaequorin substrate coelenterazine, 2 mM MES buffer (pH 5.7), 10 mM CaCl₂, and the plant stress hormones and incubated overnight in darkness. 100 µM ATP was delivered the next day, and luminescence was monitored. 100 µl of discharge solution (20% ethanol [v/v] and 2 M CaCl₂·7H₂O) was added to each well, and luminescence was recorded for an additional 30 seconds before converting the data to Ca²⁺concentration values.
|
- Summed cytosolic Ca²⁺-induced luminescence (nM) in Arabidopsis thaliana seedlings expressing apoaequorin across treatments with plant stress hormones (50 µM MeJA, 300 µM SA, 50 µM ACC, 50 µM ABA) and a mock control, followed by ATP-induced bioluminescence.
|
Transgenic Arabidopsis thaliana seedlings expressing the calcium reporter apoaequorin were used to measure eATP-induced cytosolic Ca²⁺ responses. On the 8th day after germination, individual seedlings were transferred to single wells of 96-well plates containing the apoaequorin substrate coelenterazine, 2 mM MES buffer (pH 5.7), 10 mM CaCl₂, and one of the plant stress hormones (50 µM methyl jasmonate [MeJA], 300 µM salicylic acid [SA], 50 µM aminocyclopropane-carboxylic acid [ACC], or 50 µM abscisic acid [ABA]) or a mock solution and incubated overnight in darkness. The following day, 100 µM ATP was added, and the induced luminescence was recorded. 100 µl of discharge solution (20% ethanol [v/v] and 2 M CaCl₂·7H₂O) was then added to each well, and luminescence was recorded for an additional 30 seconds before converting the data to Ca²⁺concentration values. How would you expect each hormonal treatment to influence the plants’ cytosolic Ca²⁺ response to eATP, as measured by the summed calcium values calculated from the recorded luminescence?
|
MeJA treatment enhanced the eATP-induced cytosolic Ca²⁺ response, SA suppressed it, and ABA and ACC showed no significant effect compared to the mock treatment.
|
- Extracellular ATP (eATP) is a biologically active molecule that is normally maintained at low concentrations outside the cell, where it functions as a signaling molecule mediating processes such as cytosolic Ca²⁺ responses.
- Plant hormones like MeJa, SA, ABA and ACC mediate plant responses to environmental queues and influence the plant responses.
- Apoaequorin is a photoprotein from _Aequorea victoria_ that requires binding of the coelenterazine substrate to emits light when Ca²⁺ binds. It allows measurement of cytosolic Ca²⁺ changes via luminescence.
|
[{"label":"RBK Item","value":"Extracellular ATP (eATP) is a biologically active molecule that is normally maintained at low concentrations outside the cell, where it functions as a signaling molecule mediating processes such as cytosolic Ca²⁺ responses."},{"label":"Title","value":"Identification of a Plant Receptor for Extracellular ATP"},{"label":"URL","value":"https://doi.org/10.1126/science.343.6168.290"},{"label":"Date","value":"January 17, 2014"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Plant hormones such as methyl jasmonate (MeJa), salicylic acid (SA), abscisic acid (ABA), and 1-aminocyclopropane-1-carboxylic acid (ACC) regulate plant responses to environmental stimuli and stress conditions."},{"label":"Title","value":"Extracellular Nucleotides Elicit Cytosolic Free Calcium Oscillations in Arabidopsis"},{"label":"URL","value":"https://doi.org/10.1104/pp.110.162503"},{"label":"Date","value":"July 29, 2010"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Apoaequorin is a photoprotein from _Aequorea victoria_ that requires binding of the coelenterazine substrate to emits light when Ca²⁺ binds. It allows measurement of cytosolic Ca²⁺ changes via luminescence."},{"label":"Title","value":"Monitoring of intracellular calcium in Saccharomyces cerevisiae with an apoaequorin cDNA expression system"},{"label":"URL","value":"https://doi.org/10.1073/pnas.88.15.6878"},{"label":"Date","value":"August 1, 1999"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Neuroscience
|
Free-Format Question
|
Minor Cannabinoids CBD, CBG, CBN and CBC differentially modulate sensory neuron activation
|
https://www.biorxiv.org/content/10.1101/2025.10.02.680148v1
|
October 3, 2025
|
Researchers prepared primary cultures of adult mouse dorsal root ganglion (DRG) neurons from 8-12 week C57BL/6 (wild type), total TRPV1 knockout (TRPV1-/-), and conditional CB1R knockdown lines (CB1R flox Advillin-Cre or Nav1.8-Cre). Laboratory diet was freely available to mice ad libitum. Lumbar DRGs were dissociated and neurons plated as described previously. Minor cannabinoid stocks cannabidiol (CBD), cannabigerol (CBG), cannabinol (CBN), and cannabichromene (CBC) were prepared at a final target concentration of 2 mg/ml (CBD in 1:1 ethanol:water; CBG/CBN/CBC in ethanol; CBC first freed from methanol), stored in glass vials at -20ºC. Stock identity, purity, and concentration were verified by HPLC (agilent 1100; Eclipse Plus C18 4.6x150 mm, 3.5 μm; 210 nm UV; specified isocratic programs; gradient used to assess purity). Immediately before imaging, cannabinoids were diluted into Hank’s buffered salt solution (HBSS) (with Ca²+/Mg²+, 20 mM HEPES, pH 7.4) in glass, loaded into a glass Luer-lock syringe on a syringe pump, and delivered directly to the imaging bath via PEEK tubing to avoid plastic adsorption and time-depending loss; freshly prepared aqueous aliquots and lines were exchanged frequently. Aqueous dosing via this glass-syringe/PEEK were the ones administered to cultured DRG neurons during recordings. For calcium imaging, neurons were loaded with 5 μM Fluo-4AM + pluronic F-127 for 45 min at 37 ºC/5% CO2. Imaging used a Zeiss Axiovert (10x) with Axiocam and Zen Pro software. Cells were perfused with HBSS+HEPES (plus 1% penicilin-streptomycin) at ~2 mL/min at room temperature (~22 ºC). Responders were defined as ΔF/F% ≥ 10%; non-responders to terminal KCl were excluded. Dose-response experiments applied cannabinoids over 0.1-100 μM (log series) during live imaging to quantify ΔF/F% vs concentration.
|
- ΔF/F% (Intracellular Ca²+ response) for cannabinoid (cannabidiol (CBD), cannabigerol (CBG), cannabinol (CBN), and cannabichromene (CBC)) in cultured mouse DRG neurons (log dose-response curves).
- ΔF/F% (Intracellular Ca²+ response) of neurons classified as responders for each mouse line (C57BL/6 and TRPV1-/-)
- Soma area (μm²) distribution of responding neurons by cannabinoid (cannabidiol (CBD), cannabigerol (CBG), cannabinol (CBN), and cannabichromene (CBC))
- HPLC-verified cannabinoid (cannabidiol (CBD), cannabigerol (CBG), cannabinol (CBN), and cannabichromene (CBC)) purity and achieved aqueous-phase concentration.
|
Harvested adult mouse dorsal root ganglion (DRG) neurons from 8-12 week C57BL/6 were administered doses of 0.1-100 μM of differents cannabinoids: cannabidiol (CBD), cannabigerol (CBG), cannabinol (CBN), and cannabichromene (CBC). Cannabinoids stock (2 mg/ml) was previously prepared (CBD in 1:1 ethanol:water; CBG/CBN/CBC in ethanol; CBC first freed from methanol), and stored in glass vials at -20°C. Stock identity, purity, and concentration were verified by HPLC. Administration of cannabinoids was done through dilution into Hank’s buffered salt solution (HBSS) (with Ca²+/Mg²+, 20 mM HEPES, pH 7.4) in glass, loaded into a glass Luer-lock syringe on a syringe pump, and delivered directly to the imaging bath via PEEK tubing. For calcium imaging, neurons were loaded with 5 μM Fluo-4AM + pluronic F-127 for 45 min at 37 ºC/5% CO2, perfused with HBSS+HEPES (plus 1% penicilin-streptomycin) at ~2 mL/min at room temperature (~22 ºC), and recorded through Zeiss Axiovert (10x) with Axiocam and Zen Pro software. Responders were defined as ΔF/F% ≥ 10%; non-responders to terminal KCl were excluded. Predict how the ΔF/F% dose-response curve behavior differs between cannabidiol (CBD) and cannabinol (CBN).
|
CBD shows an approximately linear increase in ΔF/F% across 0.1-100 μM, whereas CBN exhibits an inverted U-shaped relationship.
|
- Minor cannabinoids are a diverse set of diterpene-related molecules derived from the plant Cannabis sativa that have anti-inflammatory and analgesic properties.
- Sensory neurons are functionally distinguished by their unique properties of activation, typically requiring noxious thermal, chemical and/or mechanical stimuli of sufficient magnitude to activate high threshold receptor / channels expressed on nociceptor terminal.
|
[{"label":"RBK Item","value":"Minor cannabinoids are a diverse set of diterpene-related molecules derived from the plant Cannabis sativa that have anti-inflammatory and analgesic properties."},{"label":"Title","value":"Systematic review and meta-analysis of cannabinoids, cannabis-based medicines, and endocannabinoid system modulators tested for antinociceptive effects in animal models of injury-related or pathological persistent pain"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC8216112/"},{"label":"Date","value":"Mar 15, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Sensory neurons are functionally distinguished by their unique properties of activation, typically requiring noxious thermal, chemical and/or mechanical stimuli of sufficient magnitude to activate high threshold receptor / channels expressed on nociceptor terminal."},{"label":"Title","value":"The fundamental unit of pain is the cell"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC3858489/"},{"label":"Date","value":"May 24, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Cancer Biology/Immunology
|
Numerical Values
|
Reduced CSF1R expression in myeloid cells has limited impact on chronic lymphocytic leukemia progression
|
https://www.biorxiv.org/content/10.1101/2025.10.07.680920v1
|
Oct 7, 2025
|
Researchers investigated whether Csf1r (colony-stimulating factor 1 receptor) expression impacts the growth of CLL (chronic lymphocytic leukemia) in a mouse model. Csf1r+/- C57BL6J x C3Heb/FeJ mice were crossed with Eu-TCL1 C57BL/6J mice to create TCL1tg/wt Csf1r+/- (Csf1r haploinsufficient) and control TCL1tg/wt Csf1r+/+ mice. Spleen samples were taken from euthanized mice at 8-10 months old and analyzed via flow cytometry to calculate the percentage of CLL cells. Cells were stained with fluorochrome-conjugated antibodies against CD45+, CD19+, and CD5+ cells. The percentage of CLL cells was calculated relative to total CD45+ leukocytes.
|
- Percentage of CLL cells (%) in the spleen (CD45+, CD19+, and CD5+ cells relative to total CD45+ leukocytes) in WT vs. Csf1r-haploinsuffient mice.
|
Researchers investigated whether Csf1r (colony-stimulating factor 1 receptor) expression impacts the growth of CLL (chronic lymphocytic leukemia) in a mouse model. Csf1r+/+ C57BL6J x C3Heb/FeJ mice were crossed with Eu-TCL1 C57BL6J mice to create TCL1tg/wt Csf1r+/- (Csf1r haploinsufficient) and control TCL1tg/wt Csf1r+/+ mice. Spleen samples were taken at 8-10 months from euthanized mice, and the percentage of CLL cells (CD45+, CD19+, and CD5+ cells relative to total CD45+ leukocytes) was determined using flow cytometry. Predict the average percentage of CLL cells expected to be found in the spleen in the Csf1r-haploinsufficient mice.
|
42% +/- 5
|
- The tumor microenvironment is critical in supporting CLL cell survival.
- Colony-stimulating factor 1 (CSF1) is critical for the survival, proliferation, and differentiation of mononuclear phagocytes and acts exclusively through the CSF1 receptor (CSF1R).
- Preclinical studies have shown that blocking CSF1R can disrupt macrophage support and trigger apoptosis in CLL cells.
|
[{"label":"RBK Item","value":"The tumour microenvironment is critical in supporting CLL cell survival"},{"label":"Title","value":"Role of the tumor microenvironment in CLL pathogenesis"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/pii/S0037196323000987?via%3Dihub"},{"label":"Date","value":"June, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Colony-stimulating factor 1 (CSF1) is critical for the survival, proliferation and differentiation of mononuclear phagocytes and acts exclusively through the CSF1 receptor (CSF1R)."},{"label":"Title","value":"CSF-1--a mononuclear phagocyte lineage-specific hemopoietic growth factor"},{"label":"URL","value":"https://onlinelibrary.wiley.com/doi/10.1002/jcb.240210206"},{"label":"Date","value":"1983"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Preclinical studies have shown that blocking CSF1R can disrupt macrophage support and trigger apoptosis in CLL cells."},{"label":"Title","value":"Targeting Macrophages Sensitizes Chronic Lymphocytic Leukemia to Apoptosis and Inhibits Disease Progression"},{"label":"URL","value":"https://www.cell.com/cell-reports/fulltext/S2211-1247(16)30020-1?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS2211124716300201%3Fshowall%3Dtrue"},{"label":"Date","value":"Febuary 23, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Neurobiology / Stem Cell Biology
|
Numerical Values
|
The Staufen2 modulates the temporal dynamics of human neurogenesis in vitro
|
https://www.biorxiv.org/content/10.1101/2025.10.02.679988v1.full.pdf
|
October 2, 2025
|
Human induced pluripotent stem cell (hiPSC) lines were used to generate STAU2 knockout (KO) and isogenic wild-type (WT) control lines. Functional STAU2 KO lines were produced by deleting exons 7 and 8 of the STAU2 gene using CRISPR/Cas9 genome editing. Following genome editing, cells were plated in mTeSR1 medium supplemented with 10 µM Y-27632 (ROCK inhibitor) and clonally expanded. WT and STAU2 KO hiPSC lines were maintained and subjected to neural induction under identical culture conditions. Cells were maintained in neural induction medium with daily media changes until Day 11 of differentiation. On Day 11, cultures were processed for immunocytochemistry to evaluate neuronal differentiation. Cells were fixed using paraformaldehyde (PFA) and permeabilized with Triton X-100. After blocking in serum-containing buffer, cells were incubated with a primary antibody against the neuronal marker βIII-tubulin (TUBB3), followed by a fluorescent secondary antibody. Nuclei were counterstained with DAPI. Fluorescence imaging was performed using a Carl Zeiss LSM 880 spectral confocal laser scanning microscope (Carl Zeiss Microscopy GmbH, Jena, Germany). Image analysis was performed using Fiji/Image J (Wayne Rasband, NIH, USA). Quantification was performed for both WT and STAU2 KO cultures under matched conditions to enable comparison of neuronal differentiation at Day 11.
|
- Percentage of TUBB3-positive cells quantified by immunocytochemistry in STAU2 knockout (KO) and isogenic wild-type (WT) cells.
- Total cell count per image using DAPI nuclear staining in STAU2 knockout (KO) and isogenic wild-type (WT) cells.
|
Researchers generated functional STAU2 knockout (KO) human induced pluripotent stem cells (iPSCs) using CRISPR/Cas9 to delete exons 7 and 8 of the STAU2 gene. These STAU2 KO lines and their isogenic wild-type (WT) controls were differentiated under identical neural induction conditions. On Day 11 of differentiation, cultures were stained for the neuronal marker TUBB3, and the total cell count and percentage of TUBB3-positive cells was quantified by immunofluorescence. What is the predicted difference (in percentage points) in the proportion of TUBB3-positive cells between STAU2 knockout cultures and wild-type cultures at Day 11?
|
Δ TUBB3⁺ neurons = [1.7 – 2.1] percentage points, derived from WT = [3.8 %], STAU2 KO = [5.7 %] at Day 11 of neural differentiation. Note: No CI/SE/SD reported → fallback ± 0.2 pp applied (per Numeric Tolerance Policy).
|
- The Staufen (Stau) family of double-stranded RBPs is essential for neurogenesis and neuronal function across species
- Loss of STAU2 in the developing mouse cortex triggers premature cortical radial glial cells (RGCs) differentiation and mislocalization of key mRNAs such as Prox1 and Trim32
- Induced pluripotent stem cells (iPSCs) can differentiate into a wide variety of cortical neuron subtypes in vitro, recapitulating critical stages of human corticogenesis, such as neuroepithelial formation, RGC specification, and neuronal maturation.
|
[{"label":"RBK Item","value":"The Staufen (Stau) family of double-stranded RBPs is essential for neurogenesis and neuronal function across species\n"},{"label":"Title","value":"Staufen2 regulates neuronal target RNAs"},{"label":"URL","value":"https://pubmed.ncbi.nlm.nih.gov/24360961/"},{"label":"Date","value":"Dec 26, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Loss of STAU2 in the developing mouse cortex triggers premature cortical radial glial cells (RGCs) differentiation and mislocalization of key mRNAs such as Prox1 and Trim32."},{"label":"Title","value":"An asymmetrically localized Staufen2-dependent RNA complex regulates maintenance of mammalian neural stem cells"},{"label":"URL","value":"https://pubmed.ncbi.nlm.nih.gov/22902294/"},{"label":"Date","value":"Oct 5, 2012"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Induced pluripotent stem cells (iPSCs) can differentiate into a wide variety of cortical neuron subtypes in vitro, recapitulating critical stages of human corticogenesis, such as neuroepithelial formation, RGC specification, and neuronal maturation."},{"label":"Title","value":"Cortical neurogenesis from pluripotent stem cells: complexity emerging from simplicity"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC4386058/"},{"label":"Date","value":"Apr 18, 2014"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Biology/Animal Behavior
|
Free-Format Question
|
Sleep-wake cycle and behavioral disturbance in a mouse model of frustrative nonreward
|
https://www.biorxiv.org/content/10.1101/2025.08.22.671819v2
|
September 29, 2025
|
Researchers studied how an unexpected reduction in reward value (sucrose) affects mice behavior. Mice were housed in a controlled environment with a 12-h light/dark cycle, at a temperature of 23 ±1 °C, and had ad libitum access to food, water, and nesting material. 16 mice were used for the consummatory reward downshift task. The 16 mice were randomly assigned to the downshift condition and the unshifted control condition, and were connected to dummy boxes of similar shape and weight to the minilogger recording device. They were allowed to habituate to the dummy minilogger a week before experiments started with real miniloggers. Briefly, a sucrose solution (16% concentration for downshifted mice and 2% for unshifted mice) was presented in each animal’s home cage for 1 h by the end of the dark phase. On session 11 (first post-shift session) the 16% sucrose solution was downshifted to 2% sucrose for downshifted animals, to match that of unshifted controls that were always exposed to 2% sucrose. There were 5 post-shift sessions (sessions 11-15) during which both groups had access to 2% sucrose. Continuous video recordings were used to quantify the time spent in the reward zone (third of the cage nearest the sucrose bottle).
|
- Video tracking of time spent in the reward zone (1/3 of the cage area closest to the sucrose bottle nozzle) for 1 hr per session (10 pre-shift sessions during which downshifted mice received 16% sucrose and unshifted controls received 2% sucrose, followed by 5 post-shift sessions during which both groups received 2% sucrose).
|
Behavior of 16 mice were evaluated based on a reduction of rewards, in this case a sucrose solution for 15 days of a consistent light/dark cycle. Eight of these mice were administered 2% sucrose solution for the 15-day duration of the experiment, while the other 8 were administered 16% sucrose solution for 10 days, and then downshifted to 2% for the remaining 5 days. What would you expect to be the difference in time spent in the rewarded zone (if any) among downshifted mice after the third downshift day relative to pre-shift levels?
|
By the third downshift day, time in the reward zone should be back to roughly pre-shift levels.
|
- Predictability of a reward can work as a cue to organize activity patterns.
- Craving an expected reward can elicit strong anticipatory behavior that can persist after the reward is removed.
- Unexpected onmission of a reward can trigger a negative emotional state (frustration).
|
[{"label":"RBK Item","value":"- Predictability of a reward can work as a cue to organize activity patterns."},{"label":"Title","value":"Random access to palatable food stimulates similar addiction-like responses as a fixed schedule, but only a fixed schedule elicits anticipatory activation"},{"label":"URL","value":"https://www.nature.com/articles/s41598-019-54540-0"},{"label":"Date","value":"December 3, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Craving an expected reward can elicit strong anticipatory behavior that can persist after the reward is removed."},{"label":"Title","value":"Expectancy for food or expectancy for chocolate reveals timing systems for metabolism and reward."},{"label":"URL","value":"https://www.ibroneuroscience.org/article/S0306-4522(08)00874-9/abstract"},{"label":"Date","value":"July 31, 2008"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"- Unexpected onmission of a reward can trigger a negative emotional state (frustration)."},{"label":"Title","value":"Frustrative Nonreward: Behavior, Circuits, Neurochemistry, and Disorders"},{"label":"URL","value":"https://www.jneurosci.org/content/44/40/e1021242024"},{"label":"Date","value":"October 2, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Cancer Biology / Cell Biology
|
Numerical Values
|
Collagen-Based Tumor Spheroid Model for Investigating Tumor Macrophage Interactions through Extracellular Matrix Remodeling
|
https://www.biorxiv.org/content/10.1101/2025.10.01.679587v1
|
October 03, 2025
|
Researchers developed a 3D collagen-based tumor spheroid model to investigate the impact of peripheral blood mononuclear cell (PBMC)-derived macrophages on cancer cell-extracellular matrix (ECM) and cancer cell-macrophage interactions within the tumor microenvironment (TME).
MDA-MB-231 GFP breast cancer cells were maintained in Dulbecco's modified eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin-glutamine. In order to generate tumor spheroids (TS) the MDA-MB-231 cells were harvested around 70% confluence and resuspended at a density of 1x10^5 cells/mL in culture media with 2.5% Matrigel. 100 µL cell solution was plated into each well of an ultra-low attachment U-bottom 96-well plate, followed by 5 min of centrifugation at 1000 rpm. Tumor spheroids were cultured at 37°C and harvested on Day 5 for experimentation.
Human monocytes from healthy donors were purified from peripheral blood mononuclear cells (PBMCs) via a monocyte enrichment negative magnetic selection kit and verified by flow cytometry. The monocytes were cultured in ultra-low attachment plates at a density of 5x10^5 cells/mL RPMI media supplemented with 10% FBS, 1% penicillin-streptomycin, and 60 ng/mL human macrophage colony-stimulating factor (M-CSF). On Day 5, without removing the culture media, an equal volume of fresh media supplemented with 120 ng/mL M-CSF was added into each well. Cells were harvested on day 7 by washing with Dulbecco's phosphate-buffered saline (DPBS) then incubated with 5 mM ethylenediaminetetraacetic acid (EDTA) for 30 minutes at 37 ºC. Once detached, PBMC-derived macrophages were washed with DPBS and centrifuged at 400 xg for 10 min for further experimentation.
Tumour invasion was performed under the effect of tumor spheroid conditioned macrophages (TSCM). After harvesting on day 5, TS were transferred to a 3D hydrogel model containing rat tail collagen I, which was buffered with 10X DPBS, neutralized to a pH of 7.4, then diluted to a 2mg/mL concentration, on ice. PBMC-derived macrophages were incubated with CellTrace FarRed (Thermo Fisher, Cat. # C34564) for 20 minutes at room temperature, before being washed with DPBS and added (1x10^5 stained cells) into 130 uL of collagen mixture, per sample. To ensure the TS were suspended in the collagen solution, 50 uL of collagen solution was added to the wells of a 96-well plate and incubated for 5 minutes at 37 ºC then 1 minute at room temperature. Once settled, an additional 80uL of collagen solution was placed on top of the lower layer and a single TS was embedded into the middle of the collagen solution. The plate was incubated at 37 °C for 20 minutes with 180uL of 50% MDA-MB-231 media and 50% macrophage media supplemented with 60ng/mL M-CSF. The wells were fed with this mixture every day for 5 days.
The experimental design contained the following groups, prepared according to the previously defined methodology: 1) tumor spheroid without macrophages (TS+/Mφ-), 2) tumor spheroid with macrophages (TS+/ Mφ+), and 3) PBMC-derived macrophages encapsulated in collagen hydrogel (TS-/ Mφ+). To collect the soluble factors secreted by tumor spheroid and macrophages from the collagen hydrogel solution, at day 5, the supernatant was collected and spun at 400xg for 10 minutes at 4 °C to remove cell debris. This supernatant was used with the Proteome Profiler Human Oncology Array (R&D Systems, Cat. # ARY026), according to manufacturer’s instructions. Expression of soluble factors was analyzed by densitometry using ImageStudio Lite 2.2 (Licor). Protein expression was normalized by the total protein amount in the conditioned media, the latter being determined using the BCA protein assay. Fold-changes per protein are expressed using the normalized expression values of the (TS+/ Mφ-) group as the reference (e.g. (TS+/ Mφ-) = 1).
|
- Fold change of secreted proteins (MMP-9, Cathepsin B, Cathepsin D, Cathepsin S, CCL2, Osteopontin, Galectin-3, and Progranulin) in conditioned medium collected at day 5 from (TS+/Mφ-), (TS+/Mφ+), and (TS-/Mφ+) experimental conditions (Proteome Profiler Human Oncology Array).
|
Researchers developed a 3D collagen-based tumor spheroid model to investigate cancer cell-macrophage interactions. MDA-MB-231 GFP breast cancer cells embedded in Matrigel (1x10^5 cells/mL) were employed to generate tumour spheroids (TS). TS were transferred to a 3D hydrogel model derived from rat tail collagen I. Peripheral blood mononuclear cell (PBMC)-derived macrophages were incorporated in the collagen hydrogel (1x10^5 cells in 130 uL of collagen) and 3D models were incubated in 50% MDA-MB-231 media and 50% macrophage media supplemented with 60ng/mL M-CSF for 5 days. Experimental groups were: 1) tumor spheroid without macrophages (TS+/Mφ-), 2) tumor spheroid with macrophages (TS+/ Mφ+), and 3) PBMC-derived macrophages encapsulated in collagen hydrogel (TS-/ Mφ+). The conditioned media were analyzed at day 5 for soluble factors secretion (MMP-9, Cathepsin B, Cathepsin D, Cathepsin S, CCL2, Osteopontin, Galectin-3, and Progranulin) using the Proteome Profiler Human Oncology Array (R&D Systems). Protein expression was normalized by the total protein amount in the conditioned media, and fold-changes were calculated in reference to the (TS+/ Mφ-) group.
What is the expected fold-change value for Osteopontin (OPN) protein, between the tumor spheroid only (TS+/Mφ-) and the tumor spheroid-macrophage co-culture (TS+/Mφ+)?
|
Osteopontin (OPN) fold-change (FC) [(TS+/Mφ+)/(TS+/Mφ-)] = 36 - 44. Note, no CI/SE/SD reported → ±10 % fallback applied over the FC value of ~ 40.
|
- Tumor-associated macrophages (TAMs) are crucial players, comprising up to 50% of tumor mass and associated with poor clinical outcomes in breast cancer.
- The extracellular matrix (ECM) provides structural support, mediates biochemical signaling, and dynamically interacts with cancer cells to influence tumor growth, invasion, metastasis, and resistance to therapy.
- TAMs enhance cancer cell invasiveness by inducing epithelial-to-mesenchymal transition (EMT), a process characterized by the loss of cell adhesion and acquisition of migratory and invasive properties. This is mediated by TAM-secreted factors.
- Osteopontin, along with other factors, can promote collagen degradation to create a low-resistant ECM.
|
[{"label":"RBK Item","value":"- Tumor-associated macrophages (TAMs) are crucial players, comprising up to 50% of tumor mass and associated with poor clinical outcomes in breast cancer."},{"label":"Title","value":"Tumor-associated macrophages: unwitting accomplices in breast cancer malignancy"},{"label":"URL","value":"https://www.nature.com/articles/npjbcancer201525"},{"label":"Date","value":"Jan 20, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- The extracellular matrix (ECM) provides structural support, mediates biochemical signaling, and dynamically interacts with cancer cells to influence tumor growth, invasion, metastasis, and resistance to therapy."},{"label":"Title","value":"The evolving tumor microenvironment: From cancer initiation to metastatic outgrowth"},{"label":"URL","value":"https://linkinghub.elsevier.com/retrieve/pii/S1535-6108(23)00044-2"},{"label":"Date","value":"Mar 13, 2023"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- TAMs enhance cancer cell invasiveness by inducing epithelial-to-mesenchymal transition (EMT), a process characterized by the loss of cell adhesion and acquisition of migratory and invasive properties. This is mediated by TAM-secreted factors."},{"label":"Title","value":"Tumor-associated macrophages promote epithelial-mesenchymal transition and the cancer stem cell properties in triple-negative breast cancer through CCL2/AKT/β-catenin signaling"},{"label":"URL","value":"https://biosignaling.biomedcentral.com/articles/10.1186/s12964-022-00888-2"},{"label":"Date","value":"Jun 17, 2022"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Osteopontin, along with other factors, can promote collagen degradation to create a low-resistant ECM and may consequently facilitate cancer cell invasion."},{"label":"Title","value":"Osteopontin: role in cell signaling and cancer progression"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S0962892405003132"},{"label":"Date","value":"Jan 10, 2006"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the RBK item cited by this paper"}]
|
Biology
|
Cancer Biology/Cell Biology
|
Numerical Values
|
VH032 suppresses glioma proliferation by inhibiting the VHL/HIF-1α/VEGF pathway
|
https://pmc.ncbi.nlm.nih.gov/articles/PMC12477846/
|
Sep 18, 2025
|
Researchers investigated the effects of the drug VH032 on glioma cell migration by wound healing assay. Human U87MG and U251GBM cell lines were cultured at 5% CO2 atmosphere conditions in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10 % fetal bovine serum (FBS) and 1 % antibiotics (streptomycin/penicillin). For wound healing assay, U87MG and U251, at a 80% - 90% confluence of growth, were added onto 6-well plates. Wounds of a similar width were produced in the cell by vertically scratching the plate using a 200 μL tip of a sterile pipette gun. The previous medium was removed, and a fresh serum free medium with IC50 of VH032 was added for each cell (U87MG = 59.2 μM, U251 = 85.07 μM). A blank and dimethyl sulfoxide (DMSO) were used as controls. Scratched area images in each group were captured with an inverted microscope at 0 and 24 h and area quantification of the wounds healing was determined with the aid of ImageJ software.
|
- Relative migration rate (%) in glioma cell lines (U87MG and U251) at 0 and 24 hours after the addition of serum-free medium with different reagents (Blank, DMSO, VH032).
|
Researchers investigated the effects of the drug VH032 on wound healing by measuring the relative migration rate of human U87MG and U251 cell lines, following injury. Previously, cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% antibiotics (streptomycin/penicillin) under standard conditions (37 °C, 5% CO2), then at a 80% - 90% confluence they were seeded into 6-well plated, and wounds of similar width were produced in the cell by vertically scratching the plate with a 200 μL tip of a sterile pipette gun. Medium was removed, and a fresh serum free medium with the relative IC50 of VH032 was used (U87MG = 59.2uM, U251 = 85.07). A blank and dimethyl sulfoxide (DMSO) were used as controls. Area images were captured with an inverted microscope at 0 and 24 hours. Area quantification was determined with ImageJ Software. Following injury, what would you expect the difference in relative migration rate of U87MG cells, in %, before and following 24hrs treatment with VH032?
|
17.32%-21.16%
|
- Von Hippel-Lindau (VHL) is an E3 ligase that functions primarily as a tumor suppressor gene and plays a crucial role in cancer prevention
- VHL is efficacious in cancer treatment, with findings highlighting its anti-tumor activity in ovarian cancer.
- VH032 can recruit the VHL protein. The cornerstone of this regulatory effect lies in the ability of VH032 to interact with target protein ligands through linkers to form proteolysis-targeting chimeras (PROTACs), which can serve as multi-target inhibitors.
|
[{"label":"RBK Item","value":"Von Hippel-Lindau (VHL) is an E3 ligase that functions primarily as a tumor suppressor gene and plays a crucial role in cancer prevention"},{"label":"Title","value":"VHL, the story of a tumour suppressor gene"},{"label":"URL","value":"https://www.nature.com/articles/nrc3844"},{"label":"Date","value":"Dec 23, 2014"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"VHL is efficacious in cancer treatment, with findings highlighting its anti-tumor activity in ovarian cancer."},{"label":"Title","value":"Ultrasound Microbubble-Mediated VHL Regulates the Biological Behavior of Ovarian Cancer Cells"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S0301562920304890"},{"label":"Date","value":"March, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"VH032 can recruit the VHL protein. The cornerstone of this regulatory effect lies in the ability of VH032 to interact with target protein ligands through linkers to form proteolysis-targeting chimeras (PROTACs), which can serve as multi-target inhibitors."},{"label":"Title","value":"Understanding and Improving the Membrane Permeability of VH032-Based PROTACs"},{"label":"URL","value":"https://pubs.acs.org/doi/10.1021/acsmedchemlett.0c00265"},{"label":"Date","value":"Jul 30, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Microbiology / Molecular Biology
|
Numerical Values
|
The Ubiquitination of Mycobacterium tuberculosis Rv3717 Promotes Proteasomal Degradation of Interleukin Enhancer-Binding Factor
|
https://doi.org/10.3390/biology14101414
|
October 14, 2025
|
Researchers aimed to investigate the role of Rv3717 in Mycobacterium spp. pathogenicity. For this purpose, the recombinant strains rM.smeg (control) and rM.smeg/Rv3717 (Tg+ Rv3717) were constructed using electroporation of wild-type Mycobacterium smegmatis with pSUM_EGFP and pSUM_Rv3717-EGFP plasmids, respectively. The bacterial suspension was adjusted to an appropriate concentration based on colony-forming units (CFU). The suspension was repeatedly aspirated using a 26G needle syringe and dispersed for 20 min in an ultrasonic cleaner. THP-1 cells were inoculated into 96-well plates with three replicates and differentiated into macrophages (dTHP-1) using 20 ng/mL phorbol 12-myristate 13-acetate (PMA). Bacterial suspension was added to each well at a multiplicity of infection (MOI) of 1:100. The cells were incubated for 3 h with mycobacteria and treated using amikacin at a final concentration of 50 μg/mL for 1 h to eliminate extracellular bacteria, and then incubated for 0, 1, 3, and 6 h. The dTHP-1 cells were broken using ddH2O at 37 ºC for 20 min, and the released mycobacterial suspension was calculated in CFU/mL after culture on LB agar. The bacterial clearance rate in dTHP-1 cells during 1, 3, or 6 h was calculated according to (CFU (0 h–1/3/6 h) / CFU 0 h) x 100%.
|
- Bacterial clearance rate (%): in dHTP-1 cells at 0, 1, 3, and 6h post-infection with rM.smeg and rM.smeg/Rv3717
|
Researchers aimed to investigate the role of Rv3717 in Mycobacterium spp. pathogenicity. The recombinant strains rM.smeg (control) and rM.smeg/Rv3717 (Tg+ Rv3717) were constructed through transfection of wild-type Mycobacterium smegmatis with pSUM_EGFP and pSUM_Rv3717-EGFP plasmids, respectively. THP-1 cells differentiated into dTHP-1 cells were infected with the recombinant strains at a multiplicity of infection (MOI) of 1:100, incubated for 3 h, treated with amikacin to eliminate extracellular bacteria, and then incubated for 0, 1, 3, and 6 h. After the incubation period, dTHP-1 cells were lysed in water and the bacterial clearance rate was calculated from the released mycobacterial suspension. What is the expected bacterial clearance rate (%) for the rM.smeg/Rv3717 treatment group, after 3h of incubation?
|
Ground Truth Answer (GTA): Bacterial clearance rate (rM.smeg/Rv3717; 3h) = 22.5 - 32.5 %. Note: No CI/SE/SD reported → ±5 % fallback applied over 27.5 %.
|
- Rv3717 has been identified as a peptidoglycan (PG) amidase, playing a crucial role in maintaining the integrity of the mycobacterial cell wall
- Rv3717 has been implicated in facilitating bacillary dissemination to the spleen and promoting intracellular survival in murine infection models
|
[{"label":"RBK Item","value":"- Rv3717 has been identified as a peptidoglycan (PG) amidase, playing a crucial role in maintaining the integrity of the mycobacterial cell wall"},{"label":"Title","value":"Effect of Mycobacterium tuberculosis Rv3717 on cell division and cell adhesion"},{"label":"URL","value":"https://doi.org/10.1016/j.micpath.2018.02.034"},{"label":"Date","value":"February 17, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the RBK item cited by this paper"},{"label":"RBK Item","value":"- Rv3717 has been implicated in facilitating bacillary dissemination to the spleen and promoting intracellular survival in murine infection models"},{"label":"Title","value":"Mycobacterium tuberculosis Rv3717 enhances the survival of Mycolicibacterium smegmatis by inhibiting host innate immune and caspase-dependent apoptosis"},{"label":"URL","value":"https://doi.org/10.1016/j.meegid.2020.104412"},{"label":"Date","value":"June 9, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the RBK item cited by this paper"}]
|
Chemistry
|
Polymer Science
|
Free-Format Question
|
Ethylene and Alkyl Acrylate Copolymers Made-to-Order Using Dynamic Cation Switching Polymerization and Evidence for Improved Polymer Degradability with Low Polar Group Density
|
https://chemrxiv.org/engage/chemrxiv/article-details/68c714a13e708a76490f3069
|
September 18, 2025
|
Given these polymers with the average molecular weight of ~20 kg/mol:
- polyethylene (PE-1)
- ethylene-methyl acrylate copolymers (EMA-1), containing 0.8 mol% methyl acrylate
- ethylene-methyl acrylate copolymers (EMA-2), containing 1.1 mol% methyl acrylate
- ethylene-methyl acrylate copolymers (EMA-3), containing 1.4mol% methyl acrylate
With the proposal of studying their mechanical properties, tensile tests were performed on an Instron Model 5567 equipped with a 1000 N load cell. The tensile bars were held in two clamps and extended at a rate of 10 mm/min at RT until failure. The T-bone tensile specimen (ASTM D638, type V) was made by compression molding using a hydraulic press. Two steel plates in the press were first pre-heated to 200 ℃. The mold was then filled with solid polymer powder and compressed at RT first. The filled mold was then sandwiched between two steel plates and placed between the two pre-heated steel plates. The compression force was ramped up from 5 to 20 tons in three steps. In each step, the force was held for 2 min before the pressure was released. The molds were then cooled to RT using an in-built water-cooling system, taken out, and kept at RT for 30 min. Tensile testing was then performed on the T-shaped molds to determine the strain and stress at break
|
-Tensile tests, performed on an Instron Model 5567 equipped with a 1000 N load cell.
The T-bone tensile specimen (ASTM D638, type V) was made by compression molding using a hydraulic press.
|
The following polymers with an average molecular weight of ~20 kg/mol were subjected to tensile tests:
- polyethylene (PE-1)
- ethylene-methyl acrylate copolymers (EMA-1), containing 0.8 mol% methyl acrylate
- ethylene-methyl acrylate copolymers (EMA-2), containing 1.1 mol% methyl acrylate
- ethylene-methyl acrylate copolymers (EMA-3), containing 1.4mol% methyl acrylate
Order from lowest to highest the % elongation at break that these polymers will have.
|
% elongation at break: EMA-3<PE-1<EMA-1<EMA-2
|
-Development of cation-tunable polymerization catalysts (using Li⁺, Na⁺, K⁺, Cs⁺), where changing the cation type or ratio modulates polymer properties.
|
[{"label":"RBK Item","value":"Development of cation-tunable polymerization catalysts (using Li⁺, Na⁺, K⁺, Cs⁺), where changing the cation type or ratio modulates polymer properties."},{"label":"Title","value":"Fine-Tuning Nickel Phenoxyimine Olefin Polymerization Catalysts: Performance Boosting by Alkali Cations"},{"label":"URL","value":"https://pubs.acs.org/doi/10.1021/jacs.5b10351"},{"label":"Date","value":"November 12, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Chemistry
|
Organic chemistry
|
Numerical Values
|
Direct conversion of methane to value-added hydrocarbons using alkali metal-promoted cobalt catalysts
|
https://pubs.rsc.org/en/content/articlelanding/2025/ra/d5ra02408k
|
July 7, 2025
|
All catalysts were prepared using incipient wetness impregnation. The base catalyst consisted of 20 wt% Co supported on γ-Al₂O₃ (surface area: 75.32 m²/g), promoted with alkali metals Li, Na, K, or Rb at loadings ranging from 0.1-10 wt%. Metal nitrates served as precursors: LiNO₃, NaNO₃, KNO₃, RbNO₃, and Co(NO₃)₂·6H₂O. After impregnation, samples were dried at 90°C and calcined at 400°C for 1 hour with a 10°C/min heating rate.
Catalytic tests were performed in a plug flow reactor using a quartz tube (0.5 cm diameter) with 40 mg of catalyst packed between quartz wool. The feed consisted of CH₄ and O₂ at a 2:1 ratio with a total flow rate of 40 mL/min. Reactions were conducted at atmospheric pressure over a temperature range of 440-740°C.
Effluent gases were analyzed using an online GC-14A equipped with FID for hydrocarbons (C₂H₄, C₂H₆, C₃H₆, C₃H₈, C₄H₈, C₄H₁₀) and TCD for CO, CO₂, and CH₄. Catalytic performance was evaluated based on CH₄ conversion, C₂+ selectivity, and C₂+ yield.
Each experiment was repeated at least three times with reproducibility within 10%. Carbon balance errors were maintained below 5%, and data were reported as average values except for stability tests.
|
Gas chromatography analysis of effluent gases
Flame ionization detector for hydrocarbons
Thermal conductivity detector for CO, CO₂, CH₄
Standard calibration curves (R² > 0.995)
%CH₄ conversion calculation
%C₂⁺ selectivity calculation
%C₂⁺ yield calculation
Repeatability testing (3+ runs)
Carbon balance verification
|
Predict the C₂⁺ yield (%) achieved when using the 4.6K–Co/Al₂O₃ catalyst under optimal reaction conditions (640°C, atmospheric pressure, CH₄:O₂ = 2:1, 40 mg catalyst, 40 mL min⁻¹ total flow rate) for the oxidative coupling of methane reaction.
|
8.1%. Note: The fallback applied is +/-5% so any energy value inside the following range is also acceptable: [7.7%, 8.5%].
|
-Despite its environmental impact, methane is also a valuable raw material for producing more complex and economically essential compounds. Efficient conversion of methane into higher-value chemicals can provide a dual benefit of mitigating climate impact and creating valuable products.
-Methane conversion can proceed through two primary pathways: indirect and direct.
-Oxidative Coupling of Methane (OCM) has attracted substantial attention as a feasible pathway for directly converting methane to C2+. In the OCM process, methane reacts with molecular oxygen at high temperatures (above 700 °C) to produce these valuable compounds and byproducts, including water, hydrogen, carbon monoxide, and carbon dioxide.
-Early research on OCM explored a range of catalysts, including pure oxides of rare earth, alkaline earth, and transition metals.
|
[{"label":"RBK Item","value":"Despite its environmental impact, methane is also a valuable raw material for producing more complex and economically essential compounds. Efficient conversion of methane into higher-value chemicals can provide a dual benefit of mitigating climate impact and creating valuable products."},{"label":"Title","value":"Direct conversion of methane to value-added hydrocarbons using alkali metal-promoted cobalt catalysts"},{"label":"URL","value":"https://pubs.rsc.org/en/content/articlelanding/2025/ra/d5ra02408k"},{"label":"Date","value":"July 7, 2025"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Methane conversion can proceed through two primary pathways: indirect and direct."},{"label":"Title","value":"Non-oxidative coupling of methane over Mo-doped CeO2\ncatalysts"},{"label":"URL","value":"https://pure.tue.nl/ws/portalfiles/portal/303912005/1-s2.0-S1872206723644407-main.pdf"},{"label":"Date","value":"June 5, 2023"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Oxidative Coupling of Methane (OCM) has attracted substantial attention as a feasible pathway for directly converting methane to C2+. In the OCM process, methane reacts with molecular oxygen at high temperatures (above 700 °C) to produce these valuable compounds and byproducts, including water, hydrogen, carbon monoxide, and carbon dioxide."},{"label":"Title","value":"High-Pressure oxidative coupling of methane on alkali metal catalyst – Microkinetic analysis and operando thermal visualization"},{"label":"URL","value":"https://research.tudelft.nl/en/publications/high-pressure-oxidative-coupling-of-methane-on-alkali-metal-catal"},{"label":"Date","value":"March 11, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Early research on OCM explored a range of catalysts, including pure oxides of rare earth, alkaline earth, and transition metals."},{"label":"Title","value":"Materials Enabling Methane and Toluene Gas Treatment"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC10820036/"},{"label":"Date","value":"January 7, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Chemistry
|
Materials Chemistry
|
Free-Format Question
|
Nonaqueous formation mechanism of zirconium and hafnium oxo clusters
|
https://chemrxiv.org/engage/chemrxiv/article-details/68c7d21e3e708a76493253b0
|
Sep 23, 2025
|
In order to follow the ester formation over time, a metal block was designed which can hold 20 mL vials. An additional plastic cover was used to minimize temperature fluctuations.
The metal block (with cover) was put onto a stirring plate inside a fridge (4◦C) and heated to 15◦C. In a standard Zr12-acetate synthesis, a 20 mL vial was equipped with a septum and cycled three times between argon and vacuum. Zirconium propoxide (2.25 mL, 5 mmol, 1 eq.) was added to the vial, together with dry DCM (5.463 mL). Under stirring, distilled acetic acid (2.287 mL, 40 mmol, 8 eq.) was injected, reaching a total reaction volume of 10 mL and thus a zirconium concentration of 0.5 M. Aliquots were taken during the reaction. For each aliquot, 20 µL was added to 500 µL CDCl3 cooled in brine. Afterwards, the NMR was measured immediately. By integrating the α-CH2 resonance of propoxide and of propyl acetate ester, and considering the known total amount of propyl chains in the reaction mixture, the concentration of ester is calculated.
|
- Concentration of ester, measured via solution NMR spectroscopy, in M.
|
To monitor ester formation over time, a special metal block was designed to hold 20 mL vials, with an additional plastic cover to minimize temperature fluctuations. During the reaction, aliquots were taken and mixed with CDCl3 cooled in brine for immediate NMR measurement. The ester concentration was calculated by integrating the α-CH2 resonance of propoxide and propyl acetate ester, using the known total of propyl chains.
What would you expect regarding the ester concentration in the reaction between Zr(OPr)4 and acetic acid? what would you estimate would be the maximum concentration of esters? and what would this imply about the role of esters in cluster formation?
|
The ester concentration does not exceed 0.67 M (= 1.33 equivalents). The ester is thus exclusively a byproduct of the cluster formation.
|
RBK 1 - Understanding how to use EXAFS and PDF data profiling. As EXAFS measures atomic environment, while PDF profiling is for short to medium range information, both track cluster formation in non-aqueous metal systems.
RBK 2 - Observing and identification of Trinuclear intermediates in Zr or Hf clusters. Trinuclear intermediates are made out of three metal atom species formulated during cluster assembly.
RBK 3 - Fundamental knowledge of how clusters are structured within Metal Alkoxides. These clusters are put together by OH and directed by ligands.
|
[{"label":"RBK Item","value":" Understanding how to use EXAFS and PDF data profiling."},{"label":"Title","value":"Beyond crystallography: the study of disorder, nano crystallinity and crystallographically challenged materials with pair distribution functions"},{"label":"URL","value":"https://pubs.rsc.org/en/content/articlelanding/2004/cc/b309577k"},{"label":"Date","value":"July, 2004"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, part of a journal that requires a purchase or signing up for a subscription. "},{"label":"RBK Item","value":"Observing and identification of Trinuclear intermediates in Zr or Hf clusters."},{"label":"Title","value":"Binding and Reactivity of Copper to R1 and R3 Fragments of tau Protein"},{"label":"URL","value":"https://pubs.acs.org/doi/10.1021/acs.inorgchem.9b02266"},{"label":"Date","value":"December 10, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, part of a journal that requires a subscription-based payment. "},{"label":"RBK Item","value":"Fundamental knowledge of how clusters are structured within Metal Alkoxides. \n"},{"label":"Title","value":"Crystal Nucleation in Liquids: Open Questions and Future Challenges in Molecular Dynamics Simulations"},{"label":"URL","value":"https://pubs.acs.org/doi/10.1021/acs.chemrev.5b00744"},{"label":"Date","value":"May 26, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA, accessible to all. "}]
|
Chemistry
|
Environmental Chemistry / Materials Science
|
Numerical Values
|
Tuning the surface charge of cellulose super-bridging agents for improved performance during wastewater treatment
|
https://chemrxiv.org/engage/chemrxiv/article-details/68c8727e9008f1a467b917e2
|
September 19, 2025
|
Recycled cardboard was used as a starting material to prepare a suspension of cellulose fibers. Cardboard was torn into 5 cm pieces and soaked in warm tap water for 5 min before blending for 7 s in a Ninja blender at 40 g/L. The resulting suspension was poured over a 160 μm sieve and rinsed in Milli-Q water for 60 s before excess water was pressed out of the fibers. Cellulose fibers modified with quaternary ammonium groups were obtained by oxidation with (meta)periodate followed by quaternary ammonium functionalization with 2-hydrazinyl-2-oxoethyl)-trimethylazanium chloride (i.e., Girard’s reagent T). First, 5.33 g sodium (meta)periodate (NaIO4) and 15.6 g sodium chloride (NaCl, Thermo Fisher Scientific) were dissolved in 179 mL of deionized (DI) water in a 500 mL flask covered in aluminum foil. Then, 91 g of a blended cardboard slurry (12 g/260 mL DI water, 46 g/L) was added and stirred for 60 min. The reaction was quenched with 3 mL of ethylene glycol (C2H6O), and the resulting oxidized fibers were poured over a 160 μm sieve and rinsed for 10 min in DI water (Pristine fibers). To induce the quaternary ammonium functionalization of cellulose, oxidized fibers underwent a Schiff base reaction with Girard’s reagent T (GT, Thermo Fisher Scientific). Fibers were stirred for 24 h at a ratio of 1 g dry fibers : 4.8 g NaCl : 2 g GT : 320 g DI water with the pH of the suspension adjusted to 4.5 with 1 M HCl. The resulting modified fibers were again washed over a 160 μm sieve and rinsed for 5 min using DI water (Modified fibers).
For Jar tests, 10-fold concentrated synthetic wastewater (SWW) was prepared according to OECD guidelines by combining 10 mg of magnesium sulfate heptahydrate (MgSO4 + 7H2O), 20 mg of calcium chloride dihydrate (CaCl2 + 2H2O), 35 mg of sodium chloride (NaCl), 0.15 g of urea (Alpha Chemicals), 0.14 g of dipotassium phosphate (K2HPO4), 0.55 g of meat extract, 0.8 g of peptone, and 500 mL of DI water. The concentrated SWW was stirred for 60 min before use and was stored at 4ºC. In jar tests, 25 mL of concentrated SWW was diluted in 225 mL of tap water at room temperature (21ºC), followed by the addition of 350 μL of a silicon dioxide suspension (40 mg SiO2/L, 1-5 μm in size) to raise the initial turbidity to 62 ± 1 NTU. By default, the pH of the SWW was 7.7. Jar tests were conducted in 500 mL glass beakers agitated with a magnetic stir bar at 200 rpm. To start coagulation, aluminum sulfate (alum) (ALS, Kemira Water Solutions Canada, Inc.) was added and mixed for 2 min. Then, anionic polyacrylamide (aPAM, molecular weight > 106 g/mol, anionic charge density < 5%) (Hydrex 3511, Veolia) was added in two equivalent doses one minute apart to prevent floc breakage for a total treatment time of 4 min. For treatment involving fibers, the fibers are added in a single dose, 15 s before the first addition of aPAM. For jar tests meant to elucidate the removal of metals, metal stocks were added to each jar to reach a concentration of 0.5x mg/L of Ni, Fe, and Zn, and 0.05 mg/L of Cr, Pb, and Mn. A 10 mL sample was collected after 30 s and 180 s of settling for metal analysis. Samples were acidified using nitric acid (ThermoFisher Scientific, 67 %) and subsequently digested at 95 °C for 1 h in a DigiPREP (SCP Science). Then, samples were subject to vacuum filtration through hydrophilic Teflon filters (pore size 0.45 μm, Fisherbrand) before injection in an iCAP 6000 series ICP Spectrometer (ThermoFisher Scientific) to determine the concentration of each metal in the sample.
|
- Metal analysis: for processed samples collected from jar tests (after 30s and 180s of settling) meant to elucidate the removal of metals from all tested groups (Conventional: no fibers; Pristine: 150 mg/L unmodified fibers; Modified: 50 or 150 mg/L modified fibers) (iCAP 6000 series ICP Spectrometer, ThermoFisher Scientific).
|
Cellulose fibers modified with quaternary ammonium groups were obtained by oxidation with (meta)periodate followed by quaternary ammonium functionalization with 2-hydrazinyl-2-oxoethyl)-trimethylazanium chloride (i.e., Girard’s reagent T). A jar test using synthetic wastewater (SWW) was employed to determine the performance of different treatments (Conventional: no fibers; Pristine: 150 mg/L unmodified fibers; Modified: 50 or 150 mg/L modified fibers) in metal removal from wastewater. Metal stocks were added to each jar to reach a concentration of 0.5x mg/L of Ni, Fe, and Zn, and 0.05 mg/L of Cr, Pb, and Mn. A 10 mL sample was collected after 30 s and 180 s of settling, and analysis of processed samples was performed in an iCAP 6000 series ICP Spectrometer. What is the expected average value (in %) of total metal removal for modified fibers (150 mg/L) after 30 s of settling?
|
53 - 63%. Note: no CI reported → fallback ±5 pp applied.
|
- The coagulation-flocculation process is the most commonly used physicochemical method in wastewater treatment plants. In this process, a hydrolyzing metal coagulant is used in conjunction with a polymeric flocculant to destabilize suspended particles and facilitate floc formation and subsequent settling.
- As jar tests are conducted at pH 7.7, most metals in solution form hydroxide precipitates which are removed through enmeshment with growing coagula during coagulation and flocculation in a process known as sweep flocculation.
|
[{"label":"RBK Item","value":"- The coagulation-flocculation process is the most commonly used physicochemical method in wastewater treatment plants. In this process, a hydrolyzing metal coagulant is used in conjunction with a polymeric flocculant to destabilize suspended particles and facilitate floc formation and subsequent settling."},{"label":"Title","value":"Super-bridging fibrous materials for water treatment"},{"label":"URL","value":"https://www.nature.com/articles/s41545-022-00155-4"},{"label":"Date","value":"April 11, 2022"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- As jar tests are conducted at pH 7.7, most metals in solution form hydroxide precipitates which are removed through enmeshment with growing coagula during coagulation and flocculation in a process known as sweep flocculation"},{"label":"Title","value":"Coagulation–flocculation process with metal salts, synthetic polymers and biopolymers for the removal of trace metals (Cu, Pb, Ni, Zn) from municipal wastewater"},{"label":"URL","value":"https://link.springer.com/article/10.1007/s10098-017-1481-3"},{"label":"Date","value":"February 7, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the RBK item cited by the manuscript."}]
|
Physics
|
Physics, non-linear optics, nanotechnology
|
MCQ
|
Efficient and tunable frequency conversion using periodically poled thin-film lithium tantalate nanowaveguides
|
https://arxiv.org/abs/2505.03162
|
May 06, 2025
|
An experiment is conducted to characterize the thermal properties of a periodically poled thin-film lithium tantalate (PPLT) waveguide. The LT waveguide has a fixed width of 1µm and a thickness of 600nm with a 100nm thick unetched layer. The estimated poling period is 2.75µm at a pump wavelength of 1550nm. The device fabrication commences with the patterning of waveguides, followed by the poling process. A commercial lithium niobate on insulator (LTOI) wafer (supplied by NANOLN) is utilized, consisting of a 600nm-thick z-cut LT thin film on a 2.0µm-thick silicon dioxide (SiO2) layer over a silicon substrate. The bus waveguide pattern is defined using electron beam lithography (EBL) with hydrogen silsesquioxane resist and developed in 25% TMAH for high contrast. An optimized inductively coupled plasma reactive ion etching (ICP RIE) with Ar+ plasma transfers the pattern onto the LT layer. The chip is subsequently immersed in a 3:1 KOH (40%): H2O2 (30%) solution for 3 hours at 40 °C to remove redeposition generated by dry etching. For the poling process, nickel (Ni) finger electrodes are first deposited on the LT waveguides through EBL and liftoff processes. The chip is heated to 250 °C on a copper plate and then subjected to three 400V, 120ms pulses via a probe. The bus waveguide is ultimately tapered to a width of 3µm at both facets to improve the fiber-to-chip coupling efficiency. For second-harmonic generation (SHG), a tunable telecom laser (Santec TSL570) serves as the pump source, with a fiber polarization controller (FPC) ensuring that the on-chip pump light is aligned to the TM polarization. The telecom (IR) and near-visible (Nvis) outputs are separated using a wavelength division multiplexer (WDM) and subsequently measured by the corresponding photodetectors (PD). The device is placed on a thermoelectric cooler, and its temperature is precisely controlled and varied over a range from $30^{\circ}\mathrm{C}$ to $100^{\circ}\mathrm{C}$, with the measured temperature-dependent cavity resonant wavelength.
|
- The peak wavelength of the second-harmonic generation (SHG) spectrum as a function of the waveguide's temperature.
- The absolute conversion efficiency of the SHG process as a function of on-chip pump power.
- The temperature-dependent resonant wavelength shift of a separate microring resonator device.
|
An experiment is conducted to characterize the thermal properties of a periodically poled thin-film lithium tantalate (PPLT) waveguide. The LT waveguide has a fixed width of 1µm and a thickness of 600nm with a 100nm thick unetched layer. The estimated poling period is 2.75µm at a pump wavelength of 1550nm. The bus waveguide is ultimately tapered to a width of 3µm at both facets to improve the fiber-to-chip coupling efficiency. For second-harmonic generation (SHG), a tunable telecom laser serves as the pump source, with a fiber polarization controller (FPC) ensuring that the on-chip pump light is aligned to the TM polarization. The device is placed on a thermoelectric cooler, and its temperature is precisely controlled and varied over a range from $30^{\circ}\mathrm{C}$ to $100^{\circ}\mathrm{C}$, with the measured temperature-dependent cavity resonant wavelength. From the experiment, predict which of the following outcomes most accurately describes the observed phenomenon of the peak wavelength for efficient second-harmonic generation (SHG)?
a) The peak wavelength shows a nonlinear temperature dependence, exhibiting a red shift.
b) The peak wavelength is mainly independent of temperature, with no observable shift over the 30–100°C range.
c) The peak wavelength exhibits a strong linear dependence on temperature, with a blue shift.
d) The peak wavelength demonstrates a strong linear dependence on temperature, resulting in a broad red shift.
|
c) The peak wavelength exhibits a strong linear dependence on temperature, with a blue shift.
|
- TFLN has certain limitations, like a low optical damage threshold and a strong photorefractive effect, restricting its performance under high power.
- TFLT demonstrates an enhanced optical damage threshold, a broader transparent window, and a lower birefringence, further enhancing its potential for devices such as electro-optic modulators, frequency converters, and optical switches.
- SHG devices based on intermodal phase-matching and periodically poled lithium tantalate on x-cut have already been developed, showcasing its promise for nonlinear photonic applications.
|
[{"label":"RBK Item","value":"TFLN has certain limitations like low optical damage threshold and strong photorefract effect, restricting its performance under high power."},{"label":"Title","value":"Erbium doping of lithium niobate on insulator using low-temperature ion exchange"},{"label":"URL","value":"https://opg.optica.org/ome/fulltext.cfm?uri=ome-14-1-157"},{"label":"Date","value":"Dec 15, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Open-access, this is cited as reference 28 in the paper"},{"label":"RBK Item","value":"TFLT demonstrates an enhanced optical damage threshold, a broader transparent window, and a lower birefringence, further enhancing its potential for devices such as electro-optic modulators, frequency converters, and optical switches. "},{"label":"Title","value":"Lithium tantalate photonic integrated circuits for volume manufacturing"},{"label":"URL","value":"https://www.nature.com/articles/s41586-024-07369-1"},{"label":"Date","value":"May 8, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Open-access, this is cited as reference 29 in the paper"},{"label":"RBK Item","value":"SHG devices based on intermodal phase-matching and periodically poled lithium tantalate on x-cut have already been developed, showcasing its promise for nonlinear photonic applications."},{"label":"Title","value":"Continuous-wave second-harmonic generation of green light in periodically poled thin-film lithium tantalate"},{"label":"URL","value":"https://opg.optica.org/ol/abstract.cfm?uri=ol-50-4-1125"},{"label":"Date","value":"Feb 3, 2025"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 33 in the paper"}]
|
Chemistry
|
Nanoscience / Photoelectrochemistry
|
Numerical Values
|
A feasible, low temperature production of germanium nanowires: a photoelectrochemical study
|
https://chemrxiv.org/engage/chemrxiv/article-details/68ca71d43e708a7649a87938
|
September 22, 2025
|
Germanium nanowires (GeNWs) were prepared using thermal CVD of GeH₄ (Union Carbide, 98%) on copper substrates (Provetro, 99.99%). Substrates were first cleaned with No. 1200 abrasive paper, followed by ultrasonic cleaning in acetone (Lachner, 99.98%), dried with a heat gun, and placed into a glass tube with an inner diameter of 14 mm that was evacuated with a rotary pump to 5–10 Pa. The furnace was heated at a ramp rate of 10 °C/min until reaching 180, 220, 280, or 330 °C, at which point germane was allowed to pressurize the tube to 30 kPa, and pyrolysis lasted 60 minutes, after which the tube was removed and cooled naturally to room temperature. Photoelectrochemical characterization was conducted using cyclic voltammetry in a two-electrode system, where the GeNW sample served as the working electrode, high-purity nickel (>99.99%) as the counter electrode, and 0.1 M aqueous K₂HPO₄ (pH ≈ 8.1) as the electrolyte. Measurements were performed at 22 °C using a Biologic SP-150e potentiostat, scanning from –2.0 to –0.6 V at 10 mV/s, recording 20 cycles and averaging the last 7 cycles. Illumination was provided by a solar light simulator Oriel LCS-100 positioned 5 ± 0.1 cm from the sample with an intensity of ~5 Sun.
|
- Cyclic voltammetry (CV) (I [mA] vs E [V]) measured with a Biologic SP-150e potentiostat for Ge/Cu samples grown at 180–330 °C, scanned from –2.0 to –0.6 V under dark and illuminated (~5 Sun) conditions, using a two-electrode setup in 0.1 M K₂HPO₄ (pH ≈ 8.1) at 22 °C.
- Photocurrent (I [mA]) measured with a Biologic SP-150e potentiostat for Ge/Cu samples grown at 180–330 °C, scanned from –2.0 to –0.6 V under dark and illuminated (~5 Sun) conditions, using a two-electrode setup in 0.1 M K₂HPO₄ (pH ≈ 8.1) at 22 °C.
|
Germanium nanowires (GeNWs) were synthesized via thermal CVD on copper substrates (99.99% purity) at 180, 220, 280, and 330 °C using germane (GeH₄, 98%) at 30 kPa for 60 min under 5–10 Pa pressure. Cyclic voltammetry (I [mA] vs E [V]) was measured with a Biologic SP-150e potentiostat in a two-electrode setup (GeNW/Cu working, Ni counter) using 0.1 M K₂HPO₄ electrolyte (pH ≈ 8.1) at 22 °C, scanned from –2.0 to –0.6 V under dark and illuminated (~5 Sun) conditions. Under illumination, what is the predicted photocurrent (in mA) at –1.2 V for the GeNWs grown at 220 °C?
|
Photocurrent (I)= 0.25 ± 0.2 mA, for 220 ºC and -1.2V at illuminated conditions Note: confidence/standard error not reported → fallback uncertainty ± 0.2 mA applied.
|
- GeNW: Germanium nanostructures, most commonly germanium nanowires, synthesized by a variety of deposition techniques
- CVD method: GeNWs are grown on molten metal nanodroplets; the process is simple but causes unwanted metal doping that cannot be fully removed.
- Cyclic voltammetry (CV): is the electrochemical method used to record current–potential (I–E) curves of GeNW samples under dark and illuminated (~5 Sun) conditions using a two-electrode setup.
- Photocurrent (I): measurable current generated upon illumination, arising from electron–hole pairs created in germanium by photons with energy above its bandgap; these carriers are separated at the semiconductor electrolyte interface and drive redox reactions, making photocurrent a key performance metric.
|
[{"label":"RBK Item","value":"- CVD method: GeNWs are grown on molten metal nanodroplets; the process is simple but causes unwanted metal doping that cannot be fully removed."},{"label":"Title","value":"Growth, Thermodynamics, and Electrical Properties of Silicon Nanowires†"},{"label":"URL","value":"https://pubs.acs.org/doi/full/10.1021/cr900141g"},{"label":"Date","value":"January 13, 2010"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Chemistry
|
Polymer Chemistry (ring-opening polymerization, organocatalysis & kinetics)
|
Numerical Values
|
Ureate anion-catalyzed ring-opening polymerization (ROP) of CO2-derived lactones: rapid catalysis through pKa matching
|
https://chemrxiv.org/engage/chemrxiv/article-details/6887985423be8e43d66ebd05
|
July 30, 2025
|
Researchers investigated ureate-anion–catalyzed ROP of DEtP under neat conditions at 25 °C using U2 urea (1 mol %), KHMDS (1 mol %), and 1,4-benzenedimethanol (BDM, 1 mol %). To quantify impurity effects, rigorously purified DEtP was doped with defined 2-ethylheptanoic acid (EHA) loadings of 0.00, 0.10, 0.50, 0.75, and 1.00 mol % while other components and temperature were held constant.
|
-Monomer conversion vs time tracked by ¹H NMR for DEtP under fixed catalyst/base/initiator loadings at 25 °C.
-Pseudo–first-order rate constant k_obs (min⁻¹) obtained from the slope of ln([DEtP]ₜ/[DEtP]₀) vs time.
-Focus condition for the prediction task: EHA = 0.10 mol % (others 1 mol %).
|
Under neat conditions at 25 °C with U2 (1 mol%), KHMDS (1 mol%), and 1,4-benzenedimethanol initiator (BDM, 1 mol%) for DEtP ring-opening polymerization, the monomer was deliberately doped with 0.10 mol % 2-ethylheptanoic acid (EHA). What single value did the authors report for the pseudo-first-order rate constant k_{obs} (in min⁻¹) under this 0.10 mol % EHA condition?
|
k_{obs} for DEtP ROP at 0.10 mol % EHA (U2 1 mol %, KHMDS 1 mol %, BDM 1 mol %, 25 °C, neat) = 0.11 min⁻¹, accept 0.10–0.12 min⁻¹.
|
-ROP monitoring by ¹H NMR: Conversion is calculated from relative integrals of monomer vs polymer resonances in the ¹H NMR spectrum.
-Definition of k_obs: The pseudo–first-order rate constant is obtained from the slope of ln([DEtP]ₜ/[DEtP]₀) vs time (units reported per table: h⁻¹ in Table 1; min⁻¹ in Table 2).
-pKₐ matching concept (urea/base): Rates increase as urea pKₐ approaches the base’s pKₐ-H; this mirrors prior Waymouth reports on (thio)urea-catalyzed ROP cited in the paper.
-Referenced acidity/basicity values used by authors: Urea pKₐ range (13.8–26.9 in DMSO) and base pKₐ-H values (KHMDS 25.8; KOtBu 32.2; KO(CF₃)tBu 21.9; KBHT 16.8) are explicitly listed.
-Initiation & role of BDM under standard conditions: Standard kinetic studies use 1 mol % each of urea, base, and BDM initiator; MALDI-TOF evidences BDM initiation under U2/KHMDS.
-Acid impurity (EHA) inhibition & provenance: Trace EHA from EVP→DEtP hydrogenation inhibits anionic ROP; the manuscript cites Behr et al. for EHA formation and shows that 0.75 mol % drastically slows, and ≥1.00 mol % suppresses, polymerization.
|
[{"label":"RBK Item","value":"-pKₐ matching concept (urea/base): Rates increase as urea pKₐ approaches the base’s pKₐ-H; this mirrors prior Waymouth reports on (thio)urea-catalyzed ROP cited in the paper."},{"label":"Title","value":"Organic Ring-Opening Polymerization Catalysts: Reactivity Control by Balancing Acidity"},{"label":"URL","value":"https://pubs.acs.org/doi/abs/10.1021/acs.macromol.8b00540"},{"label":"Date","value":"April 4, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"-Referenced acidity/basicity values used by authors: Urea pKₐ range (13.8–26.9 in DMSO) and base pKₐ-H values (KHMDS 25.8; KOtBu 32.2; KO(CF₃)tBu 21.9; KBHT 16.8) are explicitly listed."},{"label":"Title","value":"Acidity measurements on pyridines in tetrahydrofuran using lithiated silylamines"},{"label":"URL","value":"https://pubs.acs.org/doi/pdf/10.1021/jo00217a050"},{"label":"Date","value":"Agust 1, 1985"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"-Acid impurity (EHA) inhibition & provenance: Trace EHA from EVP→DEtP hydrogenation inhibits anionic ROP; the manuscript cites Behr et al. for EHA formation and shows that 0.75 mol % drastically slows, and ≥1.00 mol % suppresses, polymerization."},{"label":"Title","value":"Homogeneous and heterogeneous catalyzed three-step synthesis of 2-ethylheptanoic acid from carbon dioxide, butadiene and hydrogen"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S1381116902001905"},{"label":"Date","value":"Sep 9, 2002"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalld"}]
|
Physics
|
Physics/Nuclear Physics
|
Numerical Values
|
Measurement of 3,4He(K−,π0)3,4 Λ Hreaction cross section and evaluation of hypertriton binding energy
|
https://arxiv.org/abs/2509.16967
|
September 21, 2025
|
Researchers investigated the production of light hypernuclei (³ΛH and ⁴ΛH) via the in-flight (K⁻, π⁰) reaction on liquid ³He and ⁴He targets to determine the hypertriton binding energy.
A 1.0 GeV/cK⁻ beam was directed onto cryogenic ³He and ⁴He targets at J-PARC's K1.8BR beam line. The setup included a timing counter (To), a beam profile chamber (BPC), a liquid-helium cryostat, a forward PbF₂ Cerenkov calorimeter for γ-ray detection from π⁰ decay, and a cylindrical detector system composed of a solenoidal magnet, drift chamber, and detector hodoscope to detect π⁻ from hypernuclear weak decay.
The (K⁻, π⁰) events were identified using a K⁻ beam and γ-forward trigger, requiring a γ-ray signal in the calorimeter and no veto signal. The ⁴He and ³He data were extracted under identical conditions, with a target temperature of 2.6 - 2.9 K.
This configuration enabled simultaneous detection of neutral and charged decay products, allowing precise determination of the (K⁻, π⁰) reaction cross sections and hypertrition binding energy.
|
- γ-ray energy recorded by the PbF₂ Cerenkov calorimeter to identify π⁰ decays from the (K⁻, π⁰) reaction.
- π⁻ momentum measured by the cylindrical drift chamber within the CDS to reconstruct mesonic weak decay of ³ΛH and ⁴ΛH.
- Beam particle timing obtained from the timing counter to synchronize the incident K⁻ beam with detector response.
- Energy deposition in the calorimeter and veto counters used to discriminate γ-ray events and suppress background signals.
- Target temperature and pressure are continuously monitored to maintain stable liquid ³He and ⁴He densities during data collection.
- Decay vertex position reconstructed from the intersection of K⁻ and π⁻ tracks in the CDC to identify hypernuclear decay events.
|
Researchers aimed to study the decay of hypernuclei ⁴ΛH; decay points (π⁻) are detected using a tracking system combined with a time-of-flight detector. To minimize contamination from muons, events are selected with mass-squared M² ≥ 0.015 (GeV/c²)², where M² is determined from the momentum and TOF measurements. Based on the above setup and selection criteria, what is the estimated efficiency percentage for π⁻?
|
94.5%-95.1%
|
- Hypernuclei are produced via the in-flight (K$^-$, $\pi^0$) reaction at a forward angle. A u-quark in the target proton is replaced by an s-quark, thereby converting the participant proton into a Λ hyperon.
- The production of $^{3,4}_\Lambda$ hypernuclei can be identified effectively by also considering the subsequent mono-energetic pions from $^{3,4}_\Lambda$H → $^{3,4}$He + $\pi^-$ two-body mesonic weak decay.
- After event selection, the $\pi^-$ momentum spectra can be fundamentally described by two major components: the quasifree production of hyperons (Λ, Σ) and the events of MWD of hypernuclei.
|
[{"label":"RBK Item","value":"The production of $^{3,4}_\\Lambda$ hypernuclei can be identified effectively by also considering the subsequent mono-energetic pions from $^{3,4}_\\Lambda$H → $^{3,4}$He + $\\pi^-$ two-body mesonic weak decay."},{"label":"Title","value":"Precise lifetime measurement of H hypernucleus using in-flight 4He H reaction"},{"label":"URL","value":"https://doi.org/10.1016/j.physletb.2023.138128"},{"label":"Date","value":"October 10, 2023"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA, cited as reference 8 (prior work from the authors)."}]
|
Physics
|
Nuclear Physics / Particle Physics
|
MCQ
|
Features of the EAR2 neutron beam following the spallation target upgrade at the n_TOF facility at CERN
|
https://arxiv.org/abs/2505.00042
|
April 29, 2025
|
Researchers characterized the EAR2 neutron beamline at CERN's n_TOF facility after installing a new spallation target. The previous target consisted of a monolithic solid lead cylinder, which limited cooling efficiency and neutron yield uniformity. The current design consists of a segmented solid lead spallation target, featuring a dedicated flat lead wedge to improve proton beam impact distribution and neutron moderation. This configuration, with a water moderator, a vacuum line window, collimators (small: 21.8 mm inner diameter, big: 60 mm inner diameter), and a beam dump was intended to enhance neutron flux. Neutron flux was measured using SiMon2 (with 6Li), MGAS (with 10B and 235U), and PPACMon (with 235U and 238U) detectors. Using PPACMon, the spatial beam profile was measured at a flight path of 19.95 meters. Resonance capture measurements with C6D6 scintillator detectors for 197Au(n,γ) and 56Fe(n,γ) were used to verify energy resolution and validate flux characterization.
|
- Neutron flux measured with SiMon2
- Resonance structures in 197Au(n,γ) and 56Fe(n,γ) reactions
- Beam interception factor for samples of different diameters
- Beam profile recorded by PPACMon at 19.95 m with 1.5 mm resolution.
- γ-flash timing is used to define neutron TOF and energy calibration.
- Target temperature, vacuum, and alignment kept stable during data collection.
|
After installation of a segmented lead spallation target with a flat wedge at CERN’s n_TOF EAR2 beamline, researchers conducted a complete characterization of the neutron beamline using SiMon2 (6Li), MGAS (10B and 235U), and PPACMon (235U and 238U) detectors.
The setup included a water moderator, vacuum window, and two collimators (21.8 mm and 60 mm inner diameters) along a 19.95 m flight path.
Resonance capture studies in 197Au(n,γ) and 56Fe(n,γ) were used to validate energy-dependent flux and time-of-flight resolution.
Based solely on these measurements and the described configuration, which of the following interpretations is most consistent with the observed neutron beam behavior?
A. The segmentation and wedge likely improved proton impact uniformity and moderated neutrons more efficiently in water, resulting in some increase in low-energy flux below ~10 keV and a slightly smoother energy-dependent flux profile across detectors, with resonance sharpness in 197Au and 56Fe largely preserved.
B. The segmentation and wedge likely improved proton impact uniformity and moderated neutrons more efficiently in water, resulting in some increase in low-energy flux below ~10 keV and a slightly smoother energy-dependent flux profile across detectors, but low-energy flux may actually be slightly overestimated due to detector sensitivity biases.
C. The segmented target combined with the wedge slightly increased neutron flux in the sub-10 keV region and maintained time-of-flight resolution; resonance spectra in 197Au and 56Fe appear consistent with improved moderation, with only minor deviations in flux homogeneity across the beam profile.
D. The segmented target and wedge slightly increased low-energy flux in the sub-10 keV region and generally maintained time-of-flight resolution; resonance peaks in 197Au and 56Fe appear largely consistent with improved moderation, although minor variations in flux across the beam profile may have slightly affected some low-energy resonance intensities.
|
A. The segmentation and wedge likely improved proton impact uniformity and moderation efficiency in water, resulting in generally enhanced low-energy flux below ~10 keV and a smoother energy-dependent flux profile across detectors, with resonance sharpness in 197Au and 56Fe largely preserved.
|
- Neutron flux is the number of neutrons per proton pulse integrated over the spatial profile of the neutron beam arriving at the experimental area.
- A spallation target is a heavy metal target where high-energy protons collide with nuclei to produce neutrons through spallation reactions.
- The n_TOF facility is a neutron time-of-flight facility at CERN used for measuring neutron-induced cross sections.
- EAR2 is the second experimental area at n_TOF, located 20 m above the spallation target.
- By absorbing neutrons outside of a predetermined path, collimators help to shape the neutron beam.
- Peaks at particular energies that aid in characterizing the neutron beam are known as resonance structures in neutron capture reactions.
- The Facility's capacity to discriminate between neutrons with varying energies is referred to as energy resolution.
| null |
Physics
|
Optics
|
MCQ
|
Observation of resonant doublet and variable finesse in a tabletop meter-scale linear three-mirror cavity
|
https://arxiv.org/abs/2505.03416
|
May 06, 2025
|
The experiment used a linear three-mirror Fabry–Perot cavity of 1.00 m total length, divided symmetrically into two 0.50 m sub-cavities. Mirrors M₁–M₃ were dielectric Laseroptiks mirrors with reflectivity R=90±2 and outer-mirror radii of curvature of 1 m. The central mirror (M₂) was fixed; M₁ and M₃ were mounted on Piezoconcept HS1 piezo stages providing 10 µm travel (1 µm V⁻¹ calibration). A Coherent Mephisto S laser at 1064 nm illuminated the cavity, mode-matched by a two-lens telescope. Transmitted light was detected with a silicon photodiode and digitized on a Teledyne LeCroy HDO6401 oscilloscope. The cavity operated in air on an actively damped optical table. Lengths were scanned by driving the two piezos in opposite directions using identical and simultaneous displacement ramps, causing simultaneous expansion/contraction of the sub-cavities. Transmission peaks were recorded to determine resonance splitting and finesse variation.
|
- The transmission spectrum of the symmetric three-mirror cavity as a function of the sub-cavity length scan.
- The relative amplitudes of the two peaks within the observed resonant doublets.
- The spectral widths of the two peaks within the observed resonant doublets.
|
In order to study resonance frequency splitting, researchers devised a linear three-mirror Fabry-Perot cavity of 1.00 m total length, divided symmetrically into two 0.5 m sub-cavities. The position of the non-central mirrors at each end was adjusted by piezo stages providing 10 µm travel. A coherent 1064 nm source illuminated the cavity, and was recorded by a photodiode and digitalized on an oscilloscope. The length of the sub-cavities was changed simultaneously by equal amounts in opposite directions. Based on this setup, what pattern was observed in the splitting of the resonance?
A) The two peaks within a doublet were virtually symmetrical.
B) The two peaks within a doublet exhibited a random and fluctuating asymmetry in their amplitudes.
C) The two peaks within a doublet consistently exhibited a systematic asymmetry in their amplitudes, with the first peak always being higher than the second.
D) The two peaks within a doublet consistently exhibited a systematic asymmetry in their amplitudes, with the second peak always being higher than the first.
|
B) The two peaks within a doublet exhibited a random and fluctuating asymmetry in their amplitudes.
|
- The first sub-cavity in the three-mirror system can be interpreted as a virtual mirror, whose effective reflection and transmission coefficients vary with its tuning.
- The reflectivity and transmissivity of the virtual mirror M′1 correspond to those of the Fabry-Perot cavity formed by M1 and M2.
- The symmetry is reflected in terms of peak width, amplitude, and spacing with respect to the central resonance condition.
- The linear three-mirror cavity configuration exhibits two key features of interest: the splitting of its resonant peak into a doublet and its functional equivalence to a two-mirror cavity with variable finesse.
|
[{"label":"RBK Item","value":"The first sub-cavity in the three-mirror system can be interpreted as a virtual mirror, whose effective reflection and transmission coefficients vary with its tuning."},{"label":"Title","value":"Recent advances toward mesoscopic quantum optomechanics"},{"label":"URL","value":"https://pubs.aip.org/avs/aqs/article-abstract/5/1/014403/2879040/Recent-advances-toward-mesoscopic-quantum?redirectedFrom=fulltext"},{"label":"Date","value":"Feb 3, 2023"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 14 in the paper"},{"label":"RBK Item","value":"The linear three-mirror cavity configuration exhibits two key features of interest: the splitting of its resonant peak into a doublet and its functional equivalence to a two-mirror cavity with variable finesse."},{"label":"Title","value":"Experimental demonstration of the use of a Fabry–Perot cavity as a mirror of variable reflectivity"},{"label":"URL","value":"https://pubs.aip.org/aip/rsi/article-abstract/65/4/799/359752/Experimental-demonstration-of-the-use-of-a-Fabry?redirectedFrom=fulltext"},{"label":"Date","value":"April 1, 1994"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 13 in the paper"}]
|
Physics
|
Physics/Non-linear dynamics
|
MCQ
|
Parametric resonance and nonlinear dynamics in a coupled double-pendulum system
|
https://arxiv.org/abs/2509.08509
|
September 10, 2025
|
Researchers investigated the nonlinear dynamics and parametric resonance phenomena in a collision-coupled double pendulum system (Lato Lato 2.0) to experimentally validate theoretical predictions derived from Lagrangian mechanics.
A reciprocating motor with adjustable frequency and amplitude was employed to provide vertical sinusoidal driving to the common pivot of two pendulums through a connecting rod and square piston guide that constrained motion to a single vertical plane. Each pendulum consisted of a rigid light rod (length 0.245 m, ~1/10 of total mass) made with bicycle spokes sheathed with hollow thin steel tubes, and a steel ball (mass 0.10644 kg) connected by low-friction hinges at the pivot to allow smooth oscillation and collision.
The driving frequency (ω) and amplitude (A₀) were varied to explore resonance behavior across different frequency ratios (ω/ω₀ = 1.5–3.0). A high-speed video acquisition system recorded the angular motion of the pendulum balls, and image analysis software was used to extract time-resolved displacement and damping data. The damping coefficient was determined from free-decay measurements by fitting the upper envelope of the oscillation curve.
|
- Time series of each pendulum angle recorded by high-speed video analysis
|
Researchers studied the maximum stabilized angle of a Lato Lato 2.0 coupled double pendulum. This pendulum comprised two 0.10644 kg steel balls connected through 0.245 m rigid rods to an axle indirectly attached to the base of a square piston. The piston was driven by a reciprocating motor of adjustable amplitude and frequency and provided near-perfect vertical sinusoidal motion.
The maximum steady-state angular displacement (in degrees) (y-axis) vs the ratio of driving frequency vs natural frequency (ω/ω_0) (x-axis) was plotted for four different driving amplitudes A_0 = 0.0172m, A_0 = 0.0280m, A_0 = 0.0367m and A_0 = 0.0415m for ω/ω_0 spanning ~1.0 to ~3.0. Which of the following outcomes is most likely observed?
A. All four driving amplitudes display one resonance peak in the ω/ω_0 = 1.9-2.1 range.
B. The two smaller driving amplitudes display two distinct peaks in the ω/ω_0 = 2.4-2.9 range
C. The peaks shift to higher ratios as the driving amplitude increases.
D. No discernible peaks are observed in the ω/ω_0 = 1.0-2.0 range.
|
D. No discernible peaks are observed in the ω/ω_0 = 1.0-2.0 range.
|
- The solution to the equation of motion of the damped, rigid pendulum shows oscillatory amplitude growth that eventually saturates due to the transition to a non-linear regime.
- In other systems, such as discrete time crystals, parametric resonance occurs at driving frequencies that are integer multiples of the natural frequency.
|
[{"label":"RBK Item","value":"The solution to the equation of motion of the damped, rigid pendulum shows oscillatory amplitude growth that eventually saturates due to the transition to a non-linear regime."},{"label":"Title","value":"A magnetic pendulum for demonstrating Mathieu-type parametric resonance"},{"label":"URL","value":"https://doi.org/10.1088/1361-6404/ad91fb"},{"label":"Date","value":"Dec 9, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but cited as reference 28 in the main article."},{"label":"RBK Item","value":"In other systems, such as discrete time crystals, parametric resonance occurs at driving frequencies that are integer multiples of the natural frequency."},{"label":"Title","value":"Discrete Time Crystals: Rigidity, Criticality, and Realizations"},{"label":"URL","value":"https://doi.org/10.1103/PhysRevLett.118.030401"},{"label":"Date","value":"Jan 18, 2017"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but cited in the main article as reference 6."}]
|
Physics
|
High energy particle physics
|
Free-Format Question
|
Measurement of muon neutrino induced charged current interactions without charged pions in the final state using a new T2K off-axis near detector WAGASCI-BabyMIND.
|
https://arxiv.org/abs/2509.07814
|
September 09, 2025
|
The experiment was carried out using the T2K muon-neutrino beam produced at J-PARC. Protons of 30 GeV struck a graphite target, and the resulting secondary particles, mainly pions, were focused by magnetic horns before decaying in a 96 m decay pipe to produce a muon-neutrino flux. The WAGASCI-BabyMIND detector was positioned at an off-axis angle of 1.5°, where the neutrino flux peaked at approximately 0.7 GeV. The integrated detector system combined several modules: WAter Grid And SCIntillator (WAGASCI) modules serving as water targets, a Proton Module made of hydrocarbon, two Wall Muon Range Detectors for angular coverage, and the BabyMIND magnetized iron spectrometer for muon charge and momentum measurements. The fiducial mass of the targets was 229 kg of H₂O and 62 kg of CH in WAGASCI, and 313 kg of CH in the Proton Module. Each sub-detector was constructed from plastic scintillator bars with wavelength-shifting fibers coupled to multi-pixel photon counters. The BabyMIND detector incorporated alternating magnetized iron planes and scintillator planes to track muons and determine their charge sign. The full dataset analyzed corresponded to 2.96 × 10²⁰ protons on target accumulated since 2018.
|
- Flux-integrated total cross section per nucleon for νμ CC0π interactions on hydrocarbon (CH).
- Flux-integrated total cross section per nucleon for νμ CC0π interactions on water (H₂O).
- Differential cross section as a function of muon momentum (pμ).
- Differential cross section as a function of muon angle (cosθμ).
|
Using the off-axis (1.5°) T2K νμ beam (flux peak ≈0.7 GeV) and the WAGASCI–BabyMIND detector on H₂O and CH targets, and noting that at these energies CC0π interactions are dominated by quasi-elastic νμ + n → μ⁻ + p on neutrons (so free hydrogen protons in CH do not contribute to νμ CC0π per nucleon), state in one short phrase whether the flux-integrated total CC0π cross section per nucleon is expected to be higher on H₂O than on CH, lower, or comparable within typical experimental uncertainties.
|
Comparable within typical experimental uncertainties
|
- Muon-neutrino charged-current interactions (νμ CC): Muon neutrinos interact via the weak force, producing muons in CC events. This is fundamental to oscillation physics.
- CC0π event definition: CC0π refers to charged-current interactions where no charged pion is observed in the final state, a key category in neutrino cross-section measurements.
- Detector technology (WAGASCI-BabyMIND): The detector system uses water and hydrocarbon modules with plastic scintillators, MPPC readouts, and a magnetized spectrometer to measure muon kinematics.
- Systematic modeling with event generators (NEUT): NEUT is a neutrino–nucleus interaction generator used in T2K to estimate efficiencies and systematics.
|
[{"label":"RBK Item","value":"Muon-neutrino charged-current interactions (νμ CC): Muon neutrinos interact via the weak force, producing muons in CC events. This is fundamental to oscillation physics."},{"label":"Title","value":"The T2K Experiment"},{"label":"URL","value":"https://arxiv.org/abs/1106.1238"},{"label":"Date","value":"June 7, 2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"CC0π event definition: CC0π refers to charged-current interactions where no charged pion is observed in the final state, a key category in neutrino cross-section measurements."},{"label":"Title","value":"First measurement of the ν_μ charged-current cross section without pions in the final state on a water target"},{"label":"URL","value":"https://arxiv.org/abs/1708.06771"},{"label":"Date","value":"August 22, 2017"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Detector technology (WAGASCI-BabyMIND): The detector system uses water and hydrocarbon modules with plastic scintillators, MPPC readouts, and a magnetized spectrometer to measure muon kinematics."},{"label":"Title","value":"Baby MIND: A magnetised spectrometer for the WAGASCI experiment"},{"label":"URL","value":"https://arxiv.org/abs/1704.08079"},{"label":"Date","value":"April 26, 2017"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Systematic modeling with event generators (NEUT): NEUT is a neutrino–nucleus interaction generator used in T2K to estimate efficiencies and systematics."},{"label":"Title","value":"The NEUT Neutrino Interaction Simulation"},{"label":"URL","value":"https://arxiv.org/abs/0905.3740"},{"label":"Date","value":"June 30, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Physics
|
Experimental Condensed Matter Physics
|
Free-Format Question
|
Effects of thermal treatment on micro-Cu(In,Ga)Se2 solar cells prepared by one-stage selenization of sputter Cu–In–Ga precursor
|
https://iopscience.iop.org/article/10.1088/2515-7655/ae020e
|
September 19, 2025
|
Researchers investigated the effects of microstructuring and thermal treatment on the properties of CIG absorbers and device performance. A 100 nm thick SiOxNyNa barrier was first deposited on soda-lime glass by RF magnetron sputtering, followed by a 500 nm Mo black contact bilayer. The SLG/SiOxNy/Mo substrates were cleaned ultrasonically. PECVD deposited a 2 μm SiOx layer, and a 2200 nm thick positive photoresist was spin-coated, patterned by direct laser writing, and developed. Micro holes were etched through the SiOx layer by RF until the Mo back contact was exposed. CIG precursor films were deposited by DC magnetron sputtering from a ternary CIG target (Cu:In:Ga = 50:35:15 at%) at a power density of 1.5 W cm⁻² and working pressure of 5.6 × 10⁻³ mbar. The samples were thermally treated in a vacuum pot at 450°C for 30 min after three nitrogen purge-pump cycles. Selenization was performed in a tube furnace inside a graphite box containing 50 mg of Se under Ar flow at 480°C for 30 min. The furnace was cooled to below 130°C at a rate of 20°C min⁻¹. The selenized films were etched in a 5 wt% KCN solution for 30 seconds to remove Cu-Se₂ phases, followed by the deposition of a CdS buffer layer at 60°C via chemical bath deposition. I-ZnO and ZnO:Al window layers were deposited by RF magnetron sputtering. Electrical characterization of the micro-devices was performed using current density–voltage (J–V) characteristics under AM1.5 standard one-sun illumination. For the solar simulator measurement, the probes were placed on the window layer near the micro solar cell and Raman spectroscopy of the micro-CIGSe was conducted using a Witec Alpha 300 R confocal Raman system with a laser power of 3 mW at 532 nm and a 1800-line grating.
|
- Current density-voltage (J-V) of the micro solar cell was measured under AM 1.5G illumination.
- Raman spectroscopy of the micro-CIGSe was measured with a laser power of 3 mW at 532 nm.
|
The effects of microstructuring and thermal treatment on the properties of CIG absorbers and device performance were studied. SLG/SiOxNy/Mo substrates were made and cleaned ultrasonically. PECVD deposited a SiOx layer, and a positive photoresist was spin-coated, patterned by direct laser writing, and developed. CIG precursor films were deposited by DC magnetron sputtering. The samples were thermally treated in a vacuum pot at 450°C for 30 min. Selenization was performed in a tube furnace under Ar flow at 480°C. The furnace was cooled to below 130°C. The selenized films were etched, followed by the deposition of a CdS buffer layer. I-ZnO and ZnO:Al window layers were deposited. Electrical characterization of the micro-devices was performed using current density–voltage (J–V) characteristics under AM1.5 standard one-sun illumination Based on the results from Raman Spectroscopy, predict the behavior of the dominant mode, if any, relative to the typical position of the dominant mode for CIGSe, 177 cm⁻¹.
|
The main dominant mode, A1, is red-shifted relative to the typical A1 position for CIGSe.
|
- CPV has achieved remarkably high efficiencies, with current records of 30.8% at 61× for flexible single-junction GaAs, 47.6% at 665× and four-junction GaAs concentrator solar cells, and 23.3% at 14.7× for thin-film CIGSe.
- In the top–down fabrication, co-evaporation is employed, yielding high-quality CIGSe micro-absorbers with reported PCEs ranging from 11% to 16% under 1 sun, and up to 21% under concentrated illumination.
- In bottom–up techniques, such as thermal evaporation of In precursors, has typically been significantly lower, typically below 6% under both standard and concentrated illumination conditions.
|
[{"label":"RBK Item","value":"CPV has achieved remarkably high efficiencies, with current records of 30.8% at 61× for flexible single-junction GaAs, 47.6% at 665× and four-junction GaAs concentrator solar cells, and 23.3% at 14.7× for thin-film CIGSe. "},{"label":"Title","value":"Flexible Thin-Film Tandem Solar Cells With >30% Efficiency"},{"label":"URL","value":"https://ieeexplore.ieee.org/document/6729050"},{"label":"Date","value":"Mar, 2014"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 15 in the paper"},{"label":"RBK Item","value":"In the top–down fabrication, co-evaporation is typically employed, yielding high-quality CIGSe micro-absorbers with reported PCEs ranging from 11% to 16% under 1 sun, and up to 21%under concentrated illumination."},{"label":"Title","value":"Cu(In, Ga)Se2 microcells: High efficiency and low material consumption"},{"label":"URL","value":"https://pubs.aip.org/aip/jrse/article-abstract/5/1/011202/819061/Cu-In-Ga-Se2-microcells-High-efficiency-and-low?redirectedFrom=fulltext"},{"label":"Date","value":"Febr 27, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 20 in the paper"},{"label":"RBK Item","value":"In bottom–up techniques, such as electrodeposition, thermal evaporation of In precursors, and laser-induced forward transfer, efficiencies have typically been significantly lower, typically below 6% under both standard and concentrated illumination conditions."},{"label":"Title","value":"Femtosecond laser-assisted fabrication of chalcopyrite micro-concentrator photovoltaics"},{"label":"URL","value":"https://www.beilstein-journals.org/bjnano/articles/9/281"},{"label":"Date","value":"Dec 12, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Open-access, this is cited as reference 27 in the paper"}]
|
Biology
|
Immunology
|
MCQ
|
Hemoglobin alpha regulates T-lymphocyte activation and mitochondrial function
|
https://www.biorxiv.org/content/10.1101/2025.08.01.668160v2
|
Aug 2, 2025
|
Researchers investigated the role of T-lymphocyte-specific hemoglobin alpha-a1 (Hba-a1) in the severity of experimental autoimmune encephalomyelitis (EAE). They used Wild-type C57BL/6J (shorthand WT) and B6.Cg-Tg(Cd4-cre)1Cwi/BfluJ (shorthand CD4-cre) mice. Conditional Hba-a1 knock-out mice were crossed with CD4-Cre mice to generate pan-T-lymphocyte-specific modified progeny (HbKO). All mice were bred in-house to eliminate shipping stress and microbiome shifts, as well as co-housed with their littermates. Mice were housed with standard pine chip bedding, paper nesting material, and given access to standard chow and water ad libitum. Male and female experimental mice between the ages of 8-14 weeks were utilized in all experiments. EAE was induced using the MOG35-55/CFA Emulsion kit. 9-14 week old mice were anesthetized and injected with 100 µl of myelin oligodendrocyte glycoprotein (MOG) emulsion in two separate subcutaneous locations. Two hours later, mice were anesthetized again and injected intraperitoneally with 100 µL of 100 ng/µL pertussis toxin in PBS, followed by a second dose after 24 hours. Beginning seven days later, mice were weighed and scored every day to assess disease progression. Disease scores (0–5) were based on a standardized clinical signs and symptom rubric. Separate cohorts of mice were sacrificed at either peak disease (day 14) or after disease relapse (day 28).
|
- Daily clinical EAE disease severity scores (scale 0–5), tracked for each mouse up to 14 or 28 days.
- Daily body weight measurements for each mouse, up to 14 or 28 days.
- Circulating plasma cytokine levels at 14 and 28 days post-immunization.
- Percentage of CD4+ and CD8+ T-lymphocytes in the spleen and inguinal lymph nodes at day 14 and day 28.
- Percentage of splenic CD4+ polarized T-lymphocyte subtypes (e.g., $T_{H}1$, $T_{H}2$, $T_{H}17$, $T_{reg}$).
- Splenocyte proliferation and cytokine production upon ex-vivo restimulation with $MOG_{35-55}$ antigen.
- Plasma immunoglobulin concentrations (e.g., IgM, lambda) in EAE animals.
- Expression of CD40L on CD4+ T-lymphocytes.
|
Researchers tested whether T-lymphocyte-specific hemoglobin alpha-a1 knockout alters the severity of experimental autoimmune encephalomyelitis (EAE). They used Wild-type C57BL/6J and B6.Cg-Tg(Cd4-cre)1Cwi/BfluJ (shorthand CD4-cre) mice. Conditional Hbα-a1 knock-out mice were crossed with CD4-Cre mice to generate pan-T-lymphocyte-specific modified progeny (HbKO). Mice were housed with standard pine chip bedding, paper nesting material, and given access to standard chow and water ad libitum. Mice between the ages of 8-14 weeks were utilized in all experiments. EAE was induced using the MOG35-55/CFA Emulsion kit. 9-14 week old mice were anesthetized and injected with 100 µl of myelin oligodendrocyte glycoprotein (MOG) emulsion in two separate subcutaneous locations. Two hours later, mice were anesthetized again and injected intraperitoneally with 100 µL of 100 ng/µL pertussis toxin in PBS, followed by a second dose after 24 hours. Beginning seven days later, mice were weighed and scored every day to assess disease progression. Which of the following outcomes is most likely?
A. Mice lacking Hbα in T-lymphocytes exhibited accelerated progression of experimental autoimmune encephalomyelitis (EAE) compared to wild-type control animals
B. Mice lacking Hbα in T-lymphocytes exhibited delayed progression of experimental autoimmune encephalomyelitis (EAE) compared to wild-type control animals
C. Mice lacking Hbα in T-lymphocytes exhibited equivalent progression of experimental autoimmune encephalomyelitis (EAE) compared to wild-type control animals
|
B. Mice lacking Hbα in T-lymphocytes exhibited delayed progression of experimental autoimmune encephalomyelitis (EAE) compared to wild-type control animals
|
- Hemoglobin: A protein traditionally known for oxygen transport in erythrocytes, which is now recognized to be expressed in non-erythroid cells where it possesses diverse redox functions.
- Hbα (Hemoglobin alpha): A specific subunit of the hemoglobin protein that is expressed in T-lymphocytes, where its expression is sensitive to redox perturbations and appears crucial for maintaining mitochondrial bioenergetics.
- Hemoglobinopathies: A class of inherited genetic disorders affecting 7% of the global population, where one or more hemoglobin subunits are impacted, leading to conditions like sickle cell disease or thalassemia.
- Low O2 (Hypoxia): A condition of low oxygen availability which has been shown to decrease T-lymphocyte responses, complicating the understanding of how hemoglobinopathies might influence immune-mediated diseases.
|
[{"label":"RBK Item","value":"Hemoglobin has been shown to possess varying redox functions and regulatory mechanisms throughout its diverse cellular potency"},{"label":"Title","value":"Hemoglobin Expression in Nonerythroid Cells: Novel or Ubiquitous?"},{"label":"URL","value":"https://onlinelibrary.wiley.com/doi/10.1155/2014/803237"},{"label":"Date","value":"Nov 5, 2014"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Hbα is expressed in T-lymphocytes, and its expression is malleable to redox perturbations"},{"label":"Title","value":"Hemoglobin alpha is a redox-sensitive mitochondrial-related protein in T-lymphocytes"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/pii/S0891584924010785"},{"label":"Date","value":"Feb 1, 2025"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Hemoglobinopathies are a class of genetic diseases in which one or more subunits of hemoglobin are impacted"},{"label":"Title","value":"World Distribution, Population Genetics, and Health Burden of the Hemoglobinopathies"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC3426822/"},{"label":"Date","value":"Sep 1, 2012"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Low O2 has been shown to decrease T-lymphocyte responses"},{"label":"Title","value":"Importance of culturing primary lymphocytes at physiological oxygen levels"},{"label":"URL","value":"https://www.pnas.org/doi/full/10.1073/pnas.0611732104"},{"label":"Date","value":"Mar 13, 2007"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Microbiology
|
MCQ
|
Pseudomonas aeruginosa clinical isolates can encode plastic-degrading enzymes that allow survival on plastic and augment biofilm formation
|
https://www.cell.com/cell-reports/fulltext/S2211-1247(25)00421-8?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS2211124725004218%3Fshowall%3Dtrue
|
May 27, 2025
|
Researchers investigated how a clinical isolate of Pseudomonas aeruginosa (PA-W23), which produces a novel polycaprolactone (PCL)- degrading enzyme, forms biofilms in the presence of PCL. PA-W23 was shown to include a PCL-degrading enzyme (pap1). The biofilm assay tested Pseudomonas aeruginosa clinical isolate WT PA-W23 (PCL-degrading, pap1+), a pap1 mutant with the pap1 gene deleted (Δpap1), a complemented mutant with the pap1 reintroduced (cΔpap1), and a control strain that does not degrade PCL (PA14). Strains were cultured overnight in Luria-Bertani (LB) broth at 37 °C, and diluted to an OD600 of 0.1 in 1 mL fresh LB. 150 μL was then added to six 96-well flat-bottomed plates. Three of the wells included a sterile PCL or glass bead, and three did not include PCL beads. The plate was incubated with agitation (37 °C, 24h), then cultures and PCL beads were removed, and the plate was washed 3 times with distilled water. 200 μL 0.1% crystal violet was added to each well (12 min), then removed, and the plate was washed 5 times with distilled water. Plates were dried at room temperature, then 200 μL 99% ethanol was added to each well to dissolve the crystal violet (4 h). The plate was then read at 570 nm.
|
- Absorbance at 570 nm of biofilms formed by Pseudomonas aeruginosa strains (PA-W23, Δpap1, cΔpap1, PA14) grown with and without PCL beads.
- Biofilm formation (%) by Pseudomonas aeruginosa strains (PA-W23, Δpap1, cΔpap1, PA14) grown with and without PCL beads.
|
Scientists performed a biofilm assay to investigate how a clinical isolate of Pseudomonas aeruginosa (WT PA-W23), which produces a novel polycaprolactone (PCL)-degrading enzyme, forms biofilms in the presence of PCL. They tested the clinical isolate PA-W23, Δpap1 (pap1 deletion mutant), cΔpap1 (Δpap1 complemented with pap1), and PA14 (non-PCL-degrading control) in the presence of PCL beads. They were also tested with glass beads as a comparison. Overnight Luria-Bertani (LB) cultures at 37 °C were adjusted to OD600 = 0.1; 150 µL was dispensed per well of a 96-well plate. Plates were incubated 24 h at 37 °C with agitation, washed, stained with 0.1% crystal violet, and destained in 99% ethanol. Biofilm biomass was quantified by absorbance at 570 nm. What would be the expected outcome of this experiment?
A. When cultured without PCL beads, Δpap1 displayed roughly half the biofilm biomass of WT.
B. When cultured without PCL beads, Δpap1 produced biofilm biomass statistically indistinguishable from WT.
C. When cultured with PCL beads, Δpap1 displayed roughly half the biofilm biomass of WT.
D. When cultured with PCL beads, Δpap1 produced biofilm biomass statistically indistinguishable from WT.
|
B. When cultured without PCL beads, Δpap1 produced biofilm biomass statistically indistinguishable from WT.
|
- Polycaprolactone (PCL) is a synthetic polyester that is biodegradable, biocompatible, and bioresorbable with a variety of medical uses, such as in sutures, as a composite for dental fillings, and as a collagen-stimulator dermal filler.
|
[{"label":"RBK Item","value":"PCL is a biodegradable polycaprolactone commonly used as surgical mesh and sutures."},{"label":"Title","value":"Monocryl® suture, a new ultra-pliable absorbable monofilament suture"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/014296129593577Z"},{"label":"Date","value":"October, 1995"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Toxicology / Natural products
|
MCQ
|
Oral Exposure to Chlorella sorokiniana Detoxifies Deoxynivalenol, Ochratoxin A, and Fumonisin B1 In Vitro and In Vivo
|
https://www.mdpi.com/2072-6651/17/7/318
|
June 23, 2025
|
Researchers examined the capacity of Chlorella sorokiniana (CS) powder to adsorb and diminish the intestinal absorption of the mycotoxins deoxynivalenol (DON) and fumonisin B1 (FB1) in vivo. The heated-air-dried CS powder utilized for in vivo mice administration was obtained from commercially sourced dried biomass of Chlorella sorokiniana (Euglena Co., Ltd., Tokyo, Japan). The CS powder contained 4.3 g of water, 69.58 g of protein, 5.1 g of ash, 98 mg of sodium, 27.3 mg of iron, and 2.91 g of total chlorophyll per 100 g of product. DON and FB1 standards were obtained from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan).
For in vivo assessment, male ICR mice (7 weeks old; n = 5 per group) were subjected to a 3-hour fasting period and thereafter administered 5 mg/kg of DON (in deionized water) or FB1 (in corn oil), with or without 500 mg/kg of CS (in deionized water), via oral gavage. Blood samples were obtained at 30 minutes, 2 hours, and 24 hours, and plasma was isolated using centrifugation. DON was quantified via LC–MS/MS employing a ZORBAX Eclipse XDB C18 column (150 mm × 2.1 mm, 1.9 µm) under electrospray ionization in negative mode, while FB1 was assessed using an enzyme-linked immunosorbent assay (ELISA) according to the supplier’s instructions (Elabscience Bionovation Inc., Houston, TX, USA). Analysis of variance (ANOVA) was conducted (Bartlett’s test and the Brown–Forsythe test), followed by Sidak’s multiple comparison test or an unpaired t-test with Welch’s correction to determine significant differences between the values of multiple or two groups. Statistical significance was set at 5%.
|
- Plasma levels of deoxynivalenol (DON) after 30 min, 2 h, and 24 h of oral co-administration of 5 mg/kg of DON and either 500 mg/kg of CS powder or vehicle control (LC–MS/MS).
- Plasma levels of DON after 30 min, 2 h, and 24 h of oral co-administration of 5 mg/kg of FB1 and either 500 mg/kg of CS powder or vehicle control (ELISA).
|
The detoxification efficacy of Chlorella sorokiniana (CS) dry powder against various mycotoxins was assessed through an in vivo experiment. Male ICR mice (7 weeks old; n = 5 per group) were orally fed either 5 mg/kg deoxynivalenol (DON) or 5 mg/kg fumonisin B1 (FB1), with or without 500 mg/kg CS, following a 3-hour fasting period. Mice blood samples were obtained 30 minutes, 2 hours, and 24 hours post-treatment. DON plasma concentrations were measured using LC–MS/MS, while FB1 plasma levels were assessed by ELISA. The toxin-only group (without CS) acted as the vehicle control.
Which of the following outcomes reflect the most likely effects of CS co-administration on the plasma concentrations of DON and FB1, in comparison to vehicle control?
A) Both DON and FB1 plasma levels decreased significantly at all time points.
B) DON plasma levels decreased significantly only after 30 minutes.
C) Both DON and FB1 plasma levels decreased significantly only after 30 minutes and 2 hours.
D) FB1 plasma levels decreased significantly at all time points.
|
B) DON plasma levels decreased significantly only after 30 minutes.
|
- Most deoxynivalenol (DON) and its metabolites rapidly eliminated via urinary excretion in rodents.
- Chlorella spp. exhibits detoxifying activities against various environmental pollutants such as dioxin.
- Chlorella spp. possess thick and highly resilient cell walls composed of complex polysaccharides which contribute to their selective binding capabilities and limited bioavailability, being key determinants of their adsorptive interactions with environmental toxins.
|
[{"label":"RBK Item","value":"- Most deoxynivalenol (DON) and its metabolites rapidly eliminated via urinary excretion in rodents."},{"label":"Title","value":"Sex Is a Determinant for Deoxynivalenol Metabolism and Elimination in the Mouse"},{"label":"URL","value":"https://www.mdpi.com/2072-6651/9/8/240"},{"label":"Date","value":"August 4, 2017"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Chlorella spp. exhibits detoxifying activities against various environmental pollutants such as dioxin."},{"label":"Title","value":"Maternal-fetal distribution and transfer of dioxins in pregnant women in Japan, and attempts to reduce maternal transfer with Chlorella (Chlorella pyrenoidosa) supplements"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S0045653505004959"},{"label":"Date","value":"June 27, 2005"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the RBK item cited by the paper"},{"label":"RBK Item","value":"- Chlorella spp. possess thick and highly resilient cell walls composed of complex polysaccharides which contribute to their selective binding capabilities and limited bioavailability, being key determinants of their adsorptive interactions with environmental toxins."},{"label":"Title","value":"Insights into cell wall disintegration of Chlorella vulgaris"},{"label":"URL","value":"https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0262500"},{"label":"Date","value":"January 14, 2022"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Animal behaviour and cognition
|
MCQ
|
Environmental enrichment accelerates cortical memory consolidation
|
https://www.biorxiv.org/content/10.1101/2025.07.28.667332v1
|
July 31, 2025
|
Researchers compared the functional characteristics of cortical ensembles after 9 weeks between environmentally enriched and exercise-matched control mice learning a virtual spatial foraging task. Ten male transgenic Thy1-GCaMP6s mice were randomly split into enriched (N=5) and control groups (N=5) and housed in standard rodent cages in pairs (one enriched and one control per cage) with food and water available ad libitum until the beginning of treadmill running sessions. The housing room was kept at 24ºC under a 12h light/dark cycle, with lights on at 7:30 AM. All experiments were carried out during the light cycle. Mice started the enrichment training at the age of 28 days, for 5 days a week for 9 weeks. The enriched group training was for one hour, in which the mice ran a custom-made square-shaped track having 12 obstacles spread across the track, which became more complex over the course of the training sessions, while the control group ran for the same time amount on an identical track filled with 12 ramps. The experiment was started by placing animals from both groups at the starting point. Once the mice reached the goal, they were allowed to consume the reward, chocolate milk, at the goal location. For the duration of the training period, during the session for the enrichment group, a new obstacle (such as a seesaw, stairs, or tunnel) or track manipulation was added every ten minutes with increasing level difficulty. At the end of the training period (9 weeks), the enrichment mice had faced 84 different obstacles. Following nine weeks of training, all animals received a cranial window implant over the dorsal cortex (AP: 2 mm anterior to −3 mm posterior from bregma; ML: -2.5 mm to +2.5 mm). After implantation, mice were given a week to recover from surgery before being water-restricted. Mice's weight was consistently measured to ensure it remains 85% above their baseline. Animals were gradually accustomed to being head-fixed and to rest over a clamped treadmill consisting of a 150 cm long belt with tactile cues placed at different locations. The belt was guided by two 10-cm-diameter, polyamide wheels located at each end of the treadmill, and an optical encoder was mounted to the wheel shaft to track the movement of the animal. At the end of each lap (detected by a photoelectric sensor), a solenoid pinch valve released a drop of sucrose water to the animal (10%, 2.5 µL). Before and after the running period (~10 min), mice were allowed to rest for 20 min with the belt clamped. The anticipatory response to the reward was measured by evaluating changes in speed across different positions of the treadmill.
|
- Running performance on the treadmill (laps/minute) between environmentally enriched mice and exercise-matched control mice for each session after 9 weeks of training.
- Anticipatory response to the reward site (changes in running speed near the reward site) between environmentally enriched mice and exercise-matched control mice for each session after 9 weeks of training.
- Speed on the treadmill of environmentally enriched mice and exercise-matched control mice for each session after 9 weeks of training.
|
Researchers compared the functional characteristics of cortical ensembles between environmentally enriched and exercise-matched control mice learning a virtual spatial foraging task. Ten male transgenic Thy1-GCaMP6s mice were randomly split into enriched and control groups. Following nine weeks of training, all animals received a cranial window implant over the dorsal cortex. Animals were gradually accustomed to being head-fixed and to rest over a clamped treadmill consisting of a 150 cm long belt with tactile cues placed at different locations. At the end of each lap, a solenoid pinch valve released a drop of sucrose water to the animal (10%, 2.5 µL). Which of the following outcomes is most likely?
A. Only after two days of performing on the treadmill, the enriched group exhibited substantially stronger anticipatory responses than the control group.
B. Only after four days of performing on the treadmill, the enriched group exhibited substantially stronger anticipatory responses than the control group.
C. Only after six days of performing on the treadmill, the enriched group exhibited substantially stronger anticipatory responses than the control group.
D. Only after eight days of performing on the treadmill, the enriched group exhibited substantially stronger anticipatory responses than the control group.
|
C. Only after six days of performing on the treadmill, the enriched group exhibited substantially stronger anticipatory responses than the control group.
|
- Environmental enrichment improves spatial learning and the ability to predict reward locations.
- Learning performance can be effectively quantified through anticipatory behaviors, such as licking or decelerating before reward delivery
- Rodents that have been exposed to complex environments with more opportunities for physical and/or social engagements have demonstrated faster learning.
|
[{"label":"RBK Item","value":"Environmental enrichment improves spatial learning and the ability to predict reward locations"},{"label":"Title","value":"Exposure to Enriched Environment Improves Spatial Learning Performances and Enhances Cell Density but Not Choline Acetyltransferase Activity in the Hippocampus of Ventral Subicular–Lesioned Rats"},{"label":"URL","value":"https://doi.org/10.1037/0735-7044.121.3.491."},{"label":"Date","value":"March 1, 2007"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Learning performance can be effectively quantified through anticipatory behaviors, such as licking or decelerating before reward delivery"},{"label":"Title","value":"Differential Encoding of Behavior and Spatial Context in Deep and Superficial Layers of the Neocortex"},{"label":"URL","value":"https://doi.org/10.1016/j.neuron.2005.01.042"},{"label":"Date","value":"March 2, 2005."},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Rodents that have been exposed to complex environments with more opportunities for physical and/or social engagements have demonstrated faster learning "},{"label":"Title","value":"Environmental Enrichment Modifies the PKA-Dependence of Hippocampal LTP and Improves Hippocampus-Dependent Memory"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC311356/"},{"label":"Date","value":"October 13, 2000"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Evolutionary Biology
|
Free-Format Question
|
Population Consequences of Single-Cell Damage Dynamics: Theory and Experiment under Glucose Limitation in E. coli
|
https://www.biorxiv.org/content/10.1101/2025.09.25.678661v1.full.pdf
|
Sep 27, 2025
|
Researchers investigated the effects of glucose limitation on Escherichia coli MG1655, which carries a chromosomal PrpoS-GFP reporter. Cells were cultured in M9 minimal medium containing $0.2\%$ Casamino Acids, $0.075\%$ Tween-20, and $1~\mu\text{g}/\text{ml}$ propidium iodide (PI), at 37°C. Two conditions were tested: (1) glucose-rich ($0.4\%$ glucose) and (2) glucose-limited ($0.0\%$ glucose). Single-cell dynamics were tracked for up to 72 hours using a microfluidic "mother machine" device that traps mother cells inheriting the old pole, under continuous medium flow ($200~\mu\text{l}/\text{h}$). Time-lapse imaging was performed every 4 minutes using phase-contrast, GFP (RpoS activity), and RFP (PI fluorescence) microscopy. Parallel population-level dynamics were conducted in a 96-well plate reader under identical medium conditions, measuring Optical Density at $600~\text{nm}$ (OD600), GFP, and RFP fluorescence every 4 minutes.
|
- Division rate (in divisions per hour) estimated from active single-cell lineages ($r > 0.25$) across glucose-rich and glucose-limited conditions.
- Single-cell mortality rate (estimated via growth arrest criterion and PI fluorescence) over time.
- RpoS promoter activity (GFP fluorescence normalized to cell area) over time in single cells.
- Population growth dynamics ($N(t)/N_{0}$) measured via optical density in batch culture.
- Per-cell PI fluorescence (as a proxy for lysis/mortality) in plate reader assays.
- Per-cell RpoS activity (GFP signal normalized to estimated population size) in plate reader measurements.
|
Researchers cultured Escherichia coli MG1655 carrying a PrpoS-GFP reporter in M9 minimal medium supplemented with $0.2\%$ Casamino Acids, $0.075\%$ Tween-20, and $1~\mu\text{g}/\text{ml}$ propidium iodide at 37°C, under two conditions: (1) glucose-rich ($0.4\%$ glucose) and (2) glucose-limited ($0.0\%$ glucose). Using a microfluidic mother machine with 4-minute imaging intervals over 72 hours, they tracked single-cell division, mortality (via propidium iodide and growth arrest), and RpoS stress response. In parallel, population growth, per-cell RpoS activity, and per-cell propidium iodide fluorescence were measured in a plate reader. Predict the outcome of mortality dynamics in glucose-limited versus glucose-rich conditions during the first 24 hours of the experiment.
|
In glucose-limited conditions, mortality rises sharply within a few hours and plateaus around $0.01/\text{h}$, whereas in glucose-rich conditions, mortality remains low for approximately 24 hours before gradually increasing.
|
- RpoS (sigma factor S) is an overall stress-response regulator in Escherichia coli that governs the expression of genes that are related to survival in adverse environments, including nutrient starvation, oxidative stress, and the stationary phase.
- Propidium iodide (PI) is a fluorescent DNA-binding dye, which is unable to penetrate intact cell membranes; it is employed to measure membrane loss and cell lysis, which represent a surrogate of death in bacterial cells.
- The mother machine is a microfluidic cell that entraps bacterial cells in small side channels as it continually supplies fresh medium, allowing long-term single-cell tracking of lineages that inherit the old pole (mothers) and new pole (daughters).
- Carbon starvation impediment with glucose restriction in low medium (e.g. M9) causes global stress responses in E. coli and changes division processes and survival behaviors.
- Casamino Acids are products of acid hydrolysis of casein that supply both amino acids and peptides to enable E. coli to maintain basal metabolism and restricted growth even in the absence of glucose.
|
[{"label":"RBK Item","value":"- RpoS (sigma factor S) is an overall stress-response regulator in Escherichia coli that governs the expression of genes that are related to survival in adverse environments, including nutrient starvation, oxidative stress, and the stationary phase."},{"label":"Title","value":"Identification of a Central Regulator of Stationary-Phase Gene Expression in Escherichia coli"},{"label":"URL","value":"https://doi.org/10.1111/j.1365-2958.1991.tb01825.x"},{"label":"Date","value":"Jan 1, 1991"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Propidium iodide (PI) is a fluorescent DNA-binding dye, which is unable to penetrate intact cell membranes; it is employed to measure membrane loss and cell lysis, which represent a surrogate of death in bacterial cells."},{"label":"Title","value":"Tracking Bacterial Lineages in Complex and Dynamic Environments with Applications for Growth Control and Persistence"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC10277933/"},{"label":"Date","value":"May 20, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- The mother machine is a microfluidic cell that entraps bacterial cells in small side channels as it continually supplies fresh medium, allowing long-term single-cell tracking of lineages that inherit the old pole (mothers) and new pole (daughters)."},{"label":"Title","value":"Robust Growth of Escherichia coli"},{"label":"URL","value":"https://doi.org/10.1016/j.cub.2010.04.045"},{"label":"Date","value":"Jun 22, 2010"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Casamino Acids are products of acid hydrolysis of casein that supply both amino acids and peptides to enable E. coli to maintain basal metabolism and restricted growth even in the absence of glucose."},{"label":"Title","value":"E. coli Leverages Growth Arrest to Remodel Its Proteome upon Entry into Starvation"},{"label":"URL","value":"https://www.biorxiv.org/content/10.1101/2024.02.29.582700v1"},{"label":"Date","value":"Mar 1, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Neuroscience
|
Free-Format Question
|
Adolescent alcohol exposure disrupts extinction learning and retrosplenial cortex physiology in adult males
|
https://www.biorxiv.org/content/10.1101/2025.09.29.679287v1
|
October 1, 2025
|
To verify whether adolescent alcohol exposure would produce lasting alterations in extinction recall behavior, researchers exposed male and female C57Bl/6J mice (n = 72) to air or adolescent intermittent ethanol (AIE) vapor via air or ethanol vapor chamber on a 2 days-on, 2 days-off schedule, for 16 hrs/day beginning at P28 (post natal day 28), and ending at P60. Mice were group-housed 4/cage and maintained on a 12-hour reverse light-dark cycle in temperature- and humidity-controlled facilities, with ad libitum access to food and water. Vapor chambers were calibrated to produce average blood ethanol concentrations (BECs) (0.08%, or 0.08 grams of alcohol per deciliter or higher). Then, mice were subjected to trace fear conditioning, extinction, and extinction recall. On the first day, mice were given one 5-minute context pre-exposure session in Context A (grid floor, cleaned with a 20% ethanol + 1% vanilla solution), during which they were allowed to freely explore the context. On day 2 (conditioning), mice were placed into Context A; after a 2-min baseline, mice were subjected to 5 tone-shock pairings separated by a 20 s stimulus-free trace interval (tone: 20 s, 80 dB, 3KHz; trace: 20 s; shock: 0.6 mA, 2 s). Each tone-trace-shock presentation was separated by a 120 s inter-trial interval. On day 3 (extinction), mice were placed into a novel context B (curved walls, white plastic flooring, cleaned with 0.5% acetic acid). After a 2 min baseline, mice were presented with 20 tone presentations separated by a 60 s inter-trial interval. On day 4 (extinction recall), mice were again placed into context B and received tone/inter-trial interval presentation as in day 3. Fear box hardware (Med Associates) was controlled by EthoVision XT, which recorded freezing behavior as the percentage of time spent immobile.
|
- Freezing behavior duration (% of time immobile) in female mice exposed to adolescent intermittent ethanol (AIE) or air control under trace fear extinction recall.
|
To verify whether adolescent alcohol exposure would produce lasting alterations in extinction recall behavior, researchers exposed male and female C57Bl/6J mice (n = 72) to air or adolescent intermittent ethanol (AIE) vapor in air or ethanol vapor chambers on a 2 days-on, 2 days-off schedule for 16 h/day, from postnatal day 28 (P28) to P60. Mice were then subjected to trace fear conditioning, extinction, and extinction recall. On day 1, mice received a 5-min pre-exposure in Context A (grid floor cleaned with 20% ethanol + 1% vanilla). On day 2 (conditioning), mice were placed into Context A, given a 2-min baseline, and exposed to five tone-shock pairings (tone: 20 s, 80 dB, 3 kHz; trace: 20 s; shock: 0.6 mA, 2 s) separated by 120 s inter-trial intervals. On day 3 (extinction), mice were placed into a novel Context B (curved white floor cleaned with 0.5% acetic acid), given a 2-min baseline, and presented with 20 tone presentations separated by 60 s inter-trial intervals. On day 4 (extinction recall), mice were returned to Context B and received tone and inter-trial interval presentations identical to day 3. Fear box hardware (Med Associates) was controlled by EthoVision XT, which recorded freezing behavior as the percentage of time spent immobile.
Predict the relative change (increase, decrease, or no change) in extinction recall following adolescent intermittent ethanol exposure in female mice.
|
Extinction recall was not significantly changed in female mice following adolescent intermittent ethanol exposure.
|
- Initiation of binge drinking during adolescence is one of the single greatest predictors of comorbid affective disorders, such as post-traumatic stress disorder in adulthood
- Trace fear conditioning is ideally suited for the examination of complex memory formation and extinction
|
[{"label":"RBK Item","value":"Initiation of binge drinking during adolescence is one of the single greatest predictors of comorbid affective disorders, such as post-traumatic stress disorder in adulthood"},{"label":"Title","value":"Age at First Alcohol Use: A Risk Factor for the Development of Alcohol Disorders"},{"label":"URL","value":"https://psychiatryonline.org/doi/10.1176/appi.ajp.157.5.745"},{"label":"Date","value":"May 1, 2000"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Trace fear conditioning is ideally suited for the examination of complex memory formation and extinction"},{"label":"Title","value":"Demographic and social adjustment characteristics of patients with comorbid posttraumatic stress disorder and alcohol dependence: potential pitfalls to PTSD treatment"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S0306460303001618?via%3Dihub"},{"label":"Date","value":"December 2003"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
metabolic pathways, plant biology
|
Numerical Values
|
RETICULATA1 is a plastid-localized basic amino acid transporter
|
https://pmc.ncbi.nlm.nih.gov/articles/PMC12449267/
|
Aug 22, 2025
|
Mutant Arabidopsis thaliana (Col-0) seeds deficient in the gene 'RE1' via T-DNA insertion - Salk_084529, referred to as re-6 hereafter were obtained from the Nottingham Arabidopsis Stock Centre (NASC). The seeds were surface-sterilized with sodium hypochlorite and subjected to cold stratification for 2 days at 4°C before being grown on half-strength MS (Murashige and Skoog) medium at pH 5.7 without sucrose supplemented with 0.8% (w/v) agar for 14 days under a 12-h light/12-h
dark photoperiod under 100 micromole per square meter per second (μmol m⁻² s⁻¹) light intensity. Seedlings were then transferred to soil and grown under a 12-h light/12-h dark photoperiod under 130 μmol m⁻² s⁻¹ light intensity and 50% humidity, and samples were subsequently taken under the light period.
RER1 knockout mutants (rer1) were generated from these re-6 mutants using CRISPR/Cas9. Four gRNA constructs were used targeting exon 1 of RER1 and were introduced into a plasmid under control of the U6-26 promoter in one construct using the polycistronic tRNA–gRNA (PTG) strategy (using the Golden Gate cloning tool MoClo) with phosphinothricin resistance as the selection mechanism, Cas9 under the control of the egg-cell-specific EC1.2 promoter, and a GFP (Green Fluorescent Protein) under the control of the seed-specific At2S3 promoter to additionally aid in selection. The final vector was integrated into the Arabidopsis mutant background via Agrobacterium-mediated transformation using the floral dip method. Positive transformants were selected via both (1) media as before (MS) but supplemented with 7.5 μg ml⁻¹ glufosinate-ammonium solution and (2) fluorescence in seeds from GFP, before final validation of mutations by Sanger sequencing. Mutant seeds were grown as before.
Mature siliques were harvested from Col-0 (wildtype, n=94), re-6 (background mutant, n=88) and re–6 × rer1 (–/+) #22 and re–6 × rer1 (–/+) #23 (two hemizygous rer1 x re-6 mutants, as homozygous rer1 + re-6 is lethal, n=78 and n=87 respectively) and the length of the siliques was compared in mm (milimitres).
|
- Mature silique length (mm) across genotypes (Col-0, re-6, re–6 × rer1 (–/+) #22, and re–6 × rer1 (–/+) #23)
|
The RE1 transporter gene affects plant growth (causing reticulate leaf growth phenotype) and is though to be related to amino acid transport. A homologous gene, RER1 was identified and was hypothesised to have a similar function. To test this, a knockout line of both homozygous knockout RE1 (re-6) and hemizygous knockout RER1 (rer1) was created (re-6 x rer1 (–/+)) using CRISPR/Cas9. Two double knockout plants (re–6 × rer1 (–/+) #22, re–6 × rer1 (–/+) #23), the wild type (Col-0), and the single knockout RE1 (re-6) were grown to maturity first on MS media and then in soil, and the silique length of the siliques of each plant was measured and averaged. What is the predicted difference in milimiters in mean silique length in the double knockout plants (re–6 × rer1 (–/+) #23 vs the single knockout (re-6)?
|
ΔSilique = [8.1 - 9.9] mm, derived from re-6 = [~14 mm], re–6 × rer1 (–/+) #23 = [~5 mm]. Note: No CI/SE/SD reported -> fallback ±0.90 mm applied.
|
- RETICULATA1 (RE1) is a member of the RETICULATA (RE) protein family, which comprises eight plastid-localized membrane proteins in Arabidopsis.
|
[{"label":"RBK Item","value":"RETICULATA1 (RE1) is a member of the RETICULATA (RE) protein family, which comprises eight plastid-localized membrane proteins in Arabidopsis"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC3668055/"},{"label":"Title","value":"Functional Redundancy and Divergence within the Arabidopsis RETICULATA-RELATED Gene Family"},{"label":"Date","value":"Apr 17, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Neuroscience, Chronobiology
|
Free-Format Question
|
Caffeine induces age-dependent increases in brain complexity and criticality during sleep
|
https://www.nature.com/articles/s42003-025-08090-z
|
April 30, 2025
|
An experiment was carried out to investigate how caffeine changes brain dynamics during sleep by measuring electrophysiological features and their discriminative power. Forty healthy adults aged 20 to 58 years spent two non-consecutive nights in a sleep laboratory, receiving 200 mg caffeine in double-blind crossover fashion on one night, and placebo on the other. Night-long scalp electroencephalograms were acquired at 256 samples per second from electrodes positioned according to the international 10–20 system. Recordings were parsed into 20-second segments, visually classified into sleep stages using modified Rechtschaffen–Kales criteria, and consolidated into NREM and REM periods for analysis.
To characterize spectral power, investigators applied Welch's method with 4-second sliding windows and 2-second overlap to NREM epochs under both conditions, then used the FOOOF algorithm to model and remove the aperiodic 1/f component, retaining oscillatory peaks up to five per spectrum. Power was averaged across five canonical bands—delta (0.5–4 Hz), theta (4–8 Hz), alpha (8–12 Hz), sigma (12–16 Hz), and beta (16–32 Hz)—and expressed in µV²/Hz.
Entropy and complexity were quantified with dimensionless indices: spectral entropy and spectral sample entropy applied to the raw power spectrum, sample entropy computed with embedding dimension m=2 and tolerance r=0.2 standard deviations from the filtered time series, and Lempel–Ziv complexity after median-split binarization of the NREM epochs.
Criticality was assessed through two additional dimensionless metrics: the detrended fluctuation analysis scaling exponent, fitted to the fluctuation function across window sizes, and the aperiodic slope extracted via FOOOF fits between 3–32 Hz, both derived from NREM epochs under each treatment condition.
Finally, a random forest classifier distinguished caffeine from placebo using all three feature categories simultaneously. Feature importance was determined by normalized Gini importance, averaged across 1000 reinitializations with grouped seven-fold cross-validation and nested grid-search, and reported separately for spectral power, entropy/complexity measures, and criticality metrics during NREM sleep.
|
- Spectral power (five frequency bands): µV²/Hz, measured using Welch's method with FOOOF aperiodic removal applied to sleep-scored NREM epochs from 256 Hz EEG, caffeine vs placebo
- Entropy and complexity indices (spectral entropy, sample entropy, spectral sample entropy, and Lempel-Ziv complexity): dimensionless, computed on sleep-scored NREM epochs from 256 Hz EEG, caffeine vs placebo
- Criticality metrics (DFA scaling exponent and aperiodic slope): dimensionless, computed on sleep-scored NREM epochs from 256 Hz EEG, caffeine vs placebo
- Feature importance scores for each of three feature categories (spectral power, entropy/complexity, criticality): dimensionless (normalized Gini importance), calculated using a random forest classifier (1000 reinitializations, grouped 7-fold cross-validation) trained to discriminate caffeine vs placebo in NREM sleep
|
An experiment was carried out to investigate how caffeine alters brain dynamics during sleep. Forty healthy adults ingested 200 mg caffeine or placebo during an experimental sleep session, and whole-night EEG was recorded and scored into NREM and REM stages. A random forest classifier was trained on all extracted features (spectral power, entropy/complexity, and criticality metrics) to discriminate caffeine from placebo. During NREM sleep, what was the ranking of the three feature categories, from highest to lowest, in terms of their importance for classification performance?
|
Entropy/complexity measures ranked highest, followed by criticality metrics, then spectral power.
|
- While caffeine enhances alertness and cognitive performance, it disrupts sleep quality by increasing sleep latency (time to fall asleep), decreasing sleep efficiency, and reducing time spent in deep sleep.
- Caffeine works primarily as an adenosine antagonist, blocking the natural sleep-promoting effects of adenosine, which normally accumulates during wakefulness to create homeostatic sleep pressure.
- Prior sleep EEG research has demonstrated that caffeine reduces low-frequency delta and theta power while increasing sigma and beta oscillations (although spectral analyses do not capture the full complexity and information content of neural signals)
- Brain signal entropy measures the unpredictability of neural activity and correlates positively with cognitive functions including attention and memory, with wakefulness showing the highest entropy followed by REM sleep and then progressively deeper NREM stages
- According to criticality theory, maximal neural complexity emerges at an optimal balance between order and randomness—the “edge of chaos”, which enables maximal computational efficiency and can be assessed through Lempel‑Ziv complexity, aperiodic power spectrum slope, and long‑range temporal correlations.
|
[{"label":"RBK Item","value":"While caffeine enhances alertness and cognitive performance, it disrupts sleep quality by increasing sleep latency (time to fall asleep), decreasing sleep efficiency, and reducing time spent in deep sleep.\n"},{"label":"Title","value":"A review of caffeine’s effects on cognitive, physical and occupational performance"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/pii/S0149763416300690"},{"label":"Date","value":"April 14, 2010"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Brain signal complexities include entropy (how irregular/unpredictable) and Lempel-Ziv complexity (distinct patterns in a signal) as measured by EEGs.\n"},{"label":"Title","value":" Information measures, effective complexity, and total information"},{"label":"URL","value":"https://onlinelibrary.wiley.com/doi/epdf/10.1002/%28SICI%291099-0526%28199609/10%292%3A1%3C44%3A%3AAID-CPLX10%3E3.0.CO%3B2-X"},{"label":"Date","value":"6 September 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Caffeine works primarily as an adenosine antagonist, blocking the natural sleep-promoting effects of adenosine, which normally accumulates during wakefulness to create homeostatic sleep pressure."},{"label":"Title","value":"Caffeine and Adenosine"},{"label":"URL","value":"https://journals.sagepub.com/doi/abs/10.3233/JAD-2010-1379"},{"label":"Date","value":"April 14, 2010"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Prior sleep EEG research has demonstrated that caffeine reduces low-frequency delta and theta power while increasing sigma and beta oscillations (although spectral analyses do not capture the full complexity and information content of neural signals)."},{"label":"Title","value":"Caffeine reduces low-frequency delta activity in the human sleep EEG"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/0893133X9400079F"},{"label":"Date","value":"May, 1995"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Brain signal entropy measures the unpredictability of neural activity and correlates positively with cognitive functions including attention and memory, with wakefulness showing the highest entropy followed by REM sleep and then progressively deeper NREM stages"},{"label":"Title","value":"Electroencephalogram approximate entropy correctly classifies the occurrence of burst suppression pattern as increasing anesthetic drug effect"},{"label":"URL","value":"https://journals.lww.com/anesthesiology/fulltext/2000/10000/electroencephalogram_approximate_entropy_correctly.14.aspx"},{"label":"Date","value":"October, 2000"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"According to criticality theory, maximal neural complexity emerges at an optimal balance between order and randomness (the “edge of chaos”) which enables maximal computational efficiency and can be assessed through Lempel‑Ziv complexity, aperiodic power spectrum slope, and long‑range temporal correlations."},{"label":"Title","value":"Optimal dynamical range of excitable networks at criticality"},{"label":"URL","value":"https://www.nature.com/articles/nphys289"},{"label":"Date","value":"April 23, 2006"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Chemistry
|
Catalysis
|
MCQ
|
REVERSIBLE TEMPERATURE-INDUCED SHAPE TRANSITION OF PT NANOPARTICLES SUPPORTED ON AL2O3
|
https://chemrxiv.org/engage/chemrxiv/article-details/68d9f47e3e708a7649bab114
|
Oct 01, 2025
|
γ-Al₂O₃-supported Pt catalyst (5 wt % Pt; average nanoparticle diameter ~1.8 nm; denoted “Pt 1.8 nm/Al₂O₃”) pre-reduced in H₂. Room-temperature HAADF-STEM and 35 °C CO/H₂ chemisorption were used to characterize the sample prior to in-situ studies. In-situ Pt L₃-edge XAS (EXAFS/XANES) was collected between 35–400 °C in two gas environments: 50% v/v H₂ and He (He spectra acquired after removal of adsorbed H₂). Environmental TEM of the same catalyst was performed under ~10⁻⁷ mbar, with images acquired at 25 °C and 400 °C using ~10 °C min⁻¹ heating/cooling ramps, including thermal cycling.
|
- HAADF-STEM, RT): Recorded particle size distribution and morphology images of Pt/Al₂O₃ at room temperature.
- Volumetric chemisorption (35 °C): Measured CO and H₂ irreversible uptake on the catalyst.
- EXAFS (in-situ, Pt L₃-edge): Collected k²-weighted χ(k) and Fourier transforms over ∆k = 3–12 Å⁻¹ to extract first-shell Pt–Pt coordination number and Pt–Pt bond distance as a function of temperature (35–400 °C) in 50% v/v H₂ and in He.
- XANES (in-situ, Pt L₃-edge): Recorded spectra to track white-line intensity and edge energy at 35 °C and 400 °C in He and H₂.
- ETEM (high vacuum): Acquired images of particle projections/outlines at 25 °C and 400 °C under ~10⁻⁷ mbar, with ~10 °C min⁻¹ ramps and heating/cooling cycles.
|
Pt Nanoparticles Supported on Al2O3 have a significant effect on their shape at different temperatures. Please advise on the observations found on the shape of this cluster if the temperature were to increase? Which of the following outcomes is most likely?
A) Pt Nanoparticles Supported on Al2O3 transition from a flatter 2-2.5D raft to a hemispherical shape irrespective of the chemical environment of He or H2.
B) Pt Nanoparticles Supported on Al2O3 transition from a hemispherical shape to flatter 2-2.5D rafts irrespective of the chemical environment of He or H2.
C) Pt Nanoparticles Supported on Al2O3 transition from a spherical shape to flatter 2-2.5D rafts irrespective of the chemical environment of He or H2.
D) Pt Nanoparticles Supported on Al2O3 transition from a spherical shape to flatter 2-2.5D rafts within the chemical environment of H2.
|
B) Pt Nanoparticles Supported on Al2O3 transition from a hemispherical shape to flatter 2-2.5D rafts irrespective of the chemical environment of He or H2.
|
- Supported metal nanoparticles are fluxional. Small supported clusters can change shape and electronic structure as a function of temperature and the adsorbates present.
- Meaning of “2–2.5D rafts.”: “2–2.5D” refers to clusters that are one or a few atomic layers thick, i.e., fewer layers than a hemispherical nanoparticle.
- Temperature vs. coverage in spectral/structural changes: Temperature can itself drive structural/shape changes that affect spectroscopic features, so changes (e.g., in XANES white line) should not be attributed only to adsorbate coverage.
|
[{"label":"RBK Item","value":"- Supported metal nanoparticles are fluxional. Small supported clusters can change shape and electronic structure as a function of temperature and the adsorbates present."},{"label":"Title","value":"Shape Changes of Supported Rh Nanoparticles During Oxidation and Reduction Cycles"},{"label":"URL","value":"https://www.science.org/doi/abs/10.1126/science.1160845"},{"label":"Date","value":"Sep 19, 2008"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Immunology/Cell Biology
|
Numerical Values
|
Impaired IFNγ responsiveness of lung monocyte-derived cells limits immunity to Mycobacterium tuberculosis
|
https://www.biorxiv.org/content/10.1101/2025.10.06.680719v1
|
Oct 06, 2025
|
Researchers explored how distinct subsets of lung mononuclearphagocytes (MNPs) respond to interferon-γ (IFNγ) during chronic Mycobacterium tuberculosis (Mtb) infection. The MNP populations analysed included alveolar macrophages (AM), monocyte-derived CD11c low (MNC1), and monocyte-derived CD11c high (MNC2) cells, which were isolated from 8–12-week-old C57BL/6 mice at 28 days post-infection (dpi) with Mtb. To generate single-cell suspensions, lungs were perfused with 10 mL PBS containing 2 mM EDTA, homogenized using a gentleMACS dissociator, and digested in 4 mL RPMI-1640 supplemented with 5% heat-inactivated FBS, 1 mg/mL collagenase D, and 50 μg/mL DNase I for 30 minutes at 37°C. The digested tissue was processed again with the gentleMACS system, filtered through a 70-μm strainer, and red blood cells were lysed using 3 mL ACK buffer for 3 minutes before two washes in RPMI-1640 with 5% HI-FBS. From each lung, one million cells were stained with Zombie Aqua Fixable Viability Dye at 4°C for 15 minutes and washed once. The cell suspensions were then stimulated with or without 100 μL of 20 ng/mL IFNγ at 37°C for 15 minutes, followed by fixation with 100 μL of 4% PFA/PBS for 15 minutes at room temperature. Following fixation, samples were washed in PBS and permeabilized with 180 μL of cold methanol for 12 minutes at 4°C. After two washes, cells were blocked with 50 μL of 1:50 anti-CD16/32 in PBS for 5 minutes, then stained with AF647-conjugated anti-phospho-STAT1 (pSTAT1) diluted in 50 μL of Brilliant Stain Buffer and incubated for 30 minutes at room temperature. Finally, cells were washed twice with PBS, resuspended in 1% PFA/PBS, and analyzed by flow cytometry to assess IFNγ-induced signaling responses across MNP subsets.
|
- Mean fluorescence intensity of pSTAT1 in lung single cell samples (AM, MNC1 and MNC2) obtained from Mtb-infected mice (28 dpi), treated with or without IFNγ.
- Relative fold change in median fluorescence intensity of pSTAT1 in lung single cell samples (AM, MNC1 and MNC2) obtained from Mtb-infected mice (28 dpi), treated with or without IFNγ.
- relative fold change in median fluorescence intensity of pSTAT1 in lung single cell samples (AM, MNC1 and MNC2) obtained from Mtb-infected mice (28 dpi), treated with or without IFNγ
|
Researchers investigated whether different subsets of lung mononuclear phagocytes (MNP) respond differently to interferon-γ (IFNγ) during murine chronic Mycobacterium tuberculosis (Mtb) infection (28 days). The MNP subsets used were alveolar macrophage (AM), monocyte-derived CD11c low (MNC1) and monocyte-derived CD11c high (MNC2). 1 million lung cells of either AM, MNC1 or MNC2 were treated with or without 20ng/mL IFNγ, fixed, permeabilised and stained for pStat1. If we performed flow cytometry on these cells, what would be the relative fold-change in median fluorescent intensity (MFI) of pSTAT1 after treating AM cells with IFNγ?
|
Δ Relative fold change of pSTAT1 after treating AM cells with IFNγ = [4.9 - 5.3], derived from 5.1. No CI reported. Fallback of ±0.2 applied.
|
-Tuberculosis (TB), caused by the respiratory pathogen Mycobacterium tuberculosis (Mtb), is the leading cause of death from a single infectious disease worldwide.
- Mtb infects multiple subsets of lung mononuclear phagocytes (MNP), among them, monocyte-derived cells (MNC) serve as the major bacterial reservoir during chronic infection.
-Alveolar macrophages (AM) have a superior ability to restrict Mtb compared to MNC1 and MNC2 cells.
- Interferon-gamma (IFNγ) plays a critical role in host defense against Mycobacterium tuberculosis
- Individuals with mutations in genes responsible for IFNγ immunity, such as Stat1, are susceptible to mycobacterial infections, including non46
tuberculous mycobacteria and Mtb.
|
[{"label":"RBK Item","value":"- Mtb infects multiple subsets of lung mononuclear phagocytes (MNP), among them, monocyte-derived cells (MNC) serve as the major bacterial reservoir during chronic infection."},{"label":"Title","value":"Heterogeneity in lung macrophage control of Mycobacterium tuberculosis is modulated by T cells"},{"label":"URL","value":"https://doi.org/10.1038/s41467-024-48515-7"},{"label":"Date","value":"July 08, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Interferon-gamma (IFNγ) plays a critical role in host defense against mycobacterium tuberculosis"},{"label":"Title","value":"Interferon-γ and infectious diseases: Lessons and prospects"},{"label":"URL","value":"https://doi.org/10.1126/science.adl2016"},{"label":"Date","value":"Apr 19, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Stat1 is one of the genes responsible for IFNγ mediated immunity"},{"label":"Title","value":"Interferon-γ-Responsive Nonhematopoietic Cells Regulate the Immune Response to Mycobacterium tuberculosis"},{"label":"URL","value":"https://doi.org/10.1016/j.immuni.2009.10.007"},{"label":"Date","value":"Dec 18, 2009"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"-Alveolar macrophages (AM) have a superior ability to restrict Mtb compared to MNC1 and MNC2 cells."},{"label":"Title","value":"Mycobacterium tuberculosis resides in lysosome-poor monocyte-derived lung cells during chronic infection"},{"label":"URL","value":"https://doi.org/10.1371/journal.ppat.1012205"},{"label":"Date","value":"May 03, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Chemistry
|
Organometallic Chemistry / Analytical Chemistry
|
MCQ
|
A Novel Schiff Base Probe Based on Fluorescein for Fluorometric and Colorimetric Dual-Mode Rapid Detection of Cu2+
|
https://doi.org/10.3390/molecules30183824
|
September 20, 2025
|
Fluorescein (1.66 g, 5 mmol) was introduced into a three-necked flask containing 50 mL of ethanol. Excess hydrazine hydrate (2.5 mL) was then slowly added to the mixture. The reaction mixture was heated to 80 °C and refluxed while stirring for 6 h to obtain a dark red transparent solution. The dark red solution was subsequently subjected to rotary evaporation until a small amount of solid was formed. The resulting mixture was then poured into an appropriate volume of deionized water and allowed to stand until precipitation occurred. The precipitated solid was filtered, washed with deionized water until the filtrate became colorless, and then washed with anhydrous ethanol to obtain the crude product. The crude product was recrystallized from anhydrous ethanol and vacuum-dried. The dried light yellow solid was identified as compound 1, fluorescein hydrazide. Compound 1 (0.345 g, 1 mmol) and 8-hydroxyjulonidine-9-carboxaldehyde (0.2172 g, 1 mmol) were dissolved in 20 mL of ethanol. The reaction mixture was heated to 80 °C, and a few drops of glacial acetic acid were added as a catalyst. The solution was then refluxed and monitored using thin-layer chromatography (TLC) to track the progress of the reaction. Upon completion of the reaction, the mixture was allowed to cool to room temperature, resulting in the formation of a precipitate. The precipitate was filtered and thoroughly washed with cold ethanol. The resulting yellow solid was dried completely in an oven to obtain the final product, probe AH. In order to investigate the influence of solution pH on the luminescence performance of AH probe (10 µM), the changes in fluorescence intensity and absorbance of the probe during the detection process in an ethanol/HEPES (9:1, v/v, 20 mM HEPES) system with different pH values (2 - 12) after adding Cu2+ (12 µM) were examined after the mixture of ethanol and HEPES buffer solution.
|
- UV-Visible absorption spectra: before and after Cu2+ (12 µM) addition to probe AH (10 µM) in ethanol/HEPES (9:1, v/v, 20 mM HEPES) system with different pH values (2 - 12) (Cary 8454 UV-Vis spectrophotometer).
- Fluorescence spectra: before and after Cu2+ (12 µM) addition to probe AH (10 µM) in ethanol/HEPES (9:1, v/v, 20 mM HEPES) system with different pH values (2 - 12) (λEx: 400 nm, Ex & Em slit width: 5 nm; Cary Eclipse fluorescence spectrophotometer).
|
Researchers synthesized a novel compound (probe AH) using fluorescein hydrazide and 8-hydroxyjulonidine-9-carboxaldehyde as raw materials. In order to investigate the influence of solution pH on the luminescence performance of AH probe (10 µM), the changes in fluorescence intensity and absorbance of the probe during the detection process in an ethanol/HEPES (9:1, v/v, 20 mM HEPES) system with different pH values (2 - 12) after adding Cu2+ (12 µM) were examined after the mixture of ethanol and HEPES buffer solution. What of the following outcomes is most likley?
A) The probe blank solution exhibited stable behavior within the pH range of 2–12 for absorbance at 452 nm but not for fluorescence intesity (Em: 512 nm).
B) The best probe response for both absorbance (452nm) and fluorescence (Em: 512 nm) was obtained between pH 5 - 6.
C) At pH values > 9, absorbance (452 nm) gradually decreased while fluorescence intensity (512 nm) gradually increased.
D) The fluorescence intensity (512 nm) approaches zero within the pH range of 7–12, while absorbance (452 nm) stabilized within the pH range of 5–9.
|
D) The fluorescence intensity (512 nm) approaches zero within the pH range of 7–12, while absorbance (452 nm) stabilized within the pH range of 5–9.
|
- Schiff base substances exhibit remarkable advantages in the detection of heavy metal ions due to the presence of lone electron pairs on the nitrogen atom within the imine bond in their structure, and their robust coordination ability with metal ions.
- Fluorescein and its derivatives are frequently employed as key materials for fabricating metal ion detection probes, owing to their superior photochemical properties, including high fluorescence quantum yield, extended absorption and emission wavelengths, excellent photostability, favorable biocompatibility, and minimal toxicity.
- Fluorescein, a chromophore, and fluorophore with high quantum yield and photostability, can be used as a chemosensor for Cu2+ ions.
|
[{"label":"RBK Item","value":"- Fluorescein and its derivatives are frequently employed as key materials for fabricating metal ion detection probes, owing to their superior photochemical properties, including high fluorescence quantum yield, extended absorption and emission wavelengths, excellent photostability, favorable biocompatibility, and minimal toxicity."},{"label":"Title","value":"A fluorescein-based fluorescent probe for real-time monitoring hypochlorite"},{"label":"URL","value":"https://doi.org/10.1016/j.jphotochem.2022.114511"},{"label":"Date","value":"December 24, 2022"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the cited element in this paper"},{"label":"RBK Item","value":"Fluorescein, a chromophore, and fluorophore with high quantum yield and photostability, can be used as a chemosensor for Cu2+ ions"},{"label":"Title","value":"A fluorescein conjugate as colorimetric and red-emissive fluorescence chemosensor for selective recognition Cu2+ ions"},{"label":"URL","value":"https://doi.org/10.1016/j.optmat.2024.115580"},{"label":"Date","value":"May 27, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the cited element in this paper"}]
|
Chemistry
|
Physical Chemistry
|
MCQ
|
Raoult’s Law Comparison of Liquid Mixtures Using UV−vis Spectroscopy: A Physical Chemistry Laboratory Experiment
|
https://pubs.acs.org/doi/pdf/10.1021/acs.jchemed.4c01373?ref=article_openPD
|
April 17, 2025
|
Researchers investigated which binary liquid mixture, acetone/toluene or acetone/ethyl acetate, behaves more ideally according to Raoult’s law. Approximately 50 mL of each pure liquid (acetone, toluene, and ethyl acetate) were provided to prepare mixtures. Each binary system was prepared at six mole fractions of the second component (x = 0.0, 0.2, 0.4, 0.6, 0.8, and 1.0). About 2.0 g of each mixture were made using a balance with 1 mg precision to ensure accurate composition. For each composition, a small amount of the liquid mixture was carefully transferred to a 1 cm quartz cuvette forming a 2 mm liquid layer at the bottom, and the cuvette was sealed to prevent evaporation. After 10 seconds, a UV–vis spectrum of the vapor phase above the liquid was collected using a Shimadzu UV-1800 spectrophotometer. Between samples, the cuvette was emptied and flushed with nitrogen gas to remove residual solvent. The absorbance at 278 nm (acetone), 258 nm (toluene), and 209 nm (ethyl acetate) was recorded. For the acetone/toluene system, the acetone contribution at 258 nm was subtracted using reference absorbance values of pure acetone vapor. The total absorbance (proportional to vapor pressure) for each mixture was plotted against mole fraction, and the data were fitted to a second-order polynomial (y = ax² + bx + c). The quadratic coefficient (a) was used to quantify the degree of deviation from Raoult’s law.
|
- Absorbance of each mixture at characteristic wavelengths (278 nm for acetone, 258 nm for toluene, and 209 nm for ethyl acetate) was recorded using UV–vis spectroscopy (Shimadzu UV-1800 spectrophotometer).
|
Two binary liquid mixtures, acetone/toluene and acetone/ethyl acetate, were prepared with mole fractions of 0.0–1.0 for the second component. UV–vis spectra of the vapor phase were analyzed and fitted to second-order polynomials to evaluate deviations from Raoult’s law.
Based on the experimental results, which of the following statements are correct? (Mark all the correct options.)
A. The acetone/ethyl acetate mixture behaves more ideally.
B. The acetone/toluene mixture behaves more ideally.
C. Both mixtures show negative deviations from Raoult’s law.
D. Both mixtures show positive deviations from Raoult’s law.
|
A. The acetone/ethyl acetate mixture behaves more ideally.
C. Both mixtures show negative deviations from Raoult’s law.
|
- Raoult's Law: used to assess the behavior of an ideal liquid mixture, where for a binary system the total vapor pressure is given by p = xApA + xBpB.
- Ideal liquid mixture: An ideal liquid mixture is one in which A···B intermolecular forces are identical to those of A···A and B···B, and the vapor pressure of each component is directly proportional to its mole fraction in the liquid phase.
- Absorbance: absorbance can be used as a quantity which is proportional to vapor pressure.
|
[]
|
Chemistry
|
Photochemistry
|
Free-Format Question
|
Synthesis and Photophysics of 5-(1-Pyrenyl)-1,2-Azoles
|
https://www.mdpi.com/2624-8549/7/4/120
|
July 27, 2025
|
A 10 μM solution of 5-(pyren-1-yl)isoxazole (compound 3) is prepared in acetonitrile at ~20°C. The compound exhibits strong fluorescence with absorption at 351 nm and emission at 398 nm when excited at 300 nm. To investigate acid-base interactions, trifluoroacetic acid (TFA, 0.1 M) is added incrementally in varying quantities (0.1-300 μL) to the fluorescent solution while monitoring spectroscopic changes.
|
-Absorption spectra recorded from 300-480 nm after each TFA addition to compound 3
-Fluorescence emission spectra recorded from 325-550 nm (λexc = 300 nm) after each TFA addition to compound 3
-Limit of detection calculations using 3σ/slope relationship from linear calibration plots
|
TFA is added incrementally in varying quantities (0.1-300 μL) to a 5-(pyren-1-yl)isoxazole (compound 3) solution in acetonitrile. Predict the spectroscopic changes that will occur in the fluorescence emission spectrum, upon adding TFA to compund 3.
|
Upon TFA addition, the emission band at 398 nm dramatically decreases, accompanied by a new emission band emerging at 350 nm.
|
-Isoxazole ring basicity and protonation at the sp² nitrogen atom
-The N-heterocyclic core incorporation as an electron-donating group (EDG) and an electron withdrawing group (EWG) extends π-electron delocalization and promotes intramolecular charge transfer (ICT), aggregation-induced emission/quenching (AIE/AIQ), or energy transfer (ET) processes by facilitating spatial interactions in the excited state
-Pyrene excimers display distinct spectroscopic features compared to the monomeric species. The formation of these excited-state species is susceptible to environmental conditions, including temperature, viscosity, pressure, pH, solubility, and molecular confinement
|
[{"label":"RBK Item","value":"Isoxazole ring basicity and protonation at the sp² nitrogen atom"},{"label":"Title","value":"Access to Five-Membered N-Heteroaromatic Compounds: Current Approach Based on Microwave-Assisted Synthesis"},{"label":"URL","value":"http://dx.medra.org/10.17374/targets.2022.25.436\n"},{"label":"Date","value":"2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"The N-heterocyclic core incorporation as an electron-donating group (EDG) and an electron withdrawing group (EWG) not only extends π-electron delocalization but can also promote intramolecular charge transfer (ICT), aggregation-induced emission/quenching (AIE/AIQ), or energy transfer (ET) processes by facilitating spatial interactions in the excited state"},{"label":"Title","value":"Structural Changes Accompanying Intramolecular Electron Transfer"},{"label":"URL","value":"https://pubs.acs.org/doi/pdf/10.1021/cr940745l"},{"label":"Date","value":"September 17, 2003"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Pyrene excimers display distinct spectroscopic features compared to the monomeric species. The formation of these excited-state species is susceptible to environmental conditions, including temperature, viscosity, pressure, pH, solubility, and molecular confinement"},{"label":"Title","value":"The Nature of Excimer Formation in Crystalline Pyrene Nanoparticles"},{"label":"URL","value":"https://pubs.acs.org/doi/10.1021/acs.jpcc.8b03963"},{"label":"Date","value":"August 31, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Chemistry
|
Physical Chemistry / Electrochemistry / Materials Chemistry
|
Free-Format Question
|
Time-resolved photo-electrochemical measurements to study band bending of BiVO₄ photoanodes.
|
https://chemrxiv.org/engage/chemrxiv/article-details/68b1a2e2728bf9025e19a17e
|
September 05, 2025
|
Polycrystalline monoclinic BiVO₄ thin films (~100 nm) were deposited on single-side-polished Nb-doped SrTiO₃ substrates (⌀ 5 mm, 0.5 mm) by pulsed-laser deposition using a KrF excimer laser (248 nm, 1.5 J·cm⁻², 10 Hz) at room temperature and vacuum; ~5000 pulses were used, followed by ex-situ annealing in air at 450 °C for 2 h with 5 °C·min⁻¹ ramps.
The electrodes were mounted as the disk in a rotating ring–disk electrode (RRDE-3A) inside a custom Teflon cell with a quartz window, operated in a three-electrode configuration with a platinum counter electrode and a saturated calomel reference electrode (all potentials reported vs RHE). The electrolyte was neutral phosphate buffer (pH 7) prepared with ≥18.2 MΩ·cm water, purged with Ar for at least 30 min before and kept under continuous Ar purge during measurements; the assembly was rotated at 1600 rpm.
Illumination was provided by a WaveLabs Sinus 70 LED simulating AM 1.5G, used in continuous or chopped mode with 1 s on / 1 s off; the LED on/off transient was ~3 ms.
Cyclic voltammetry was run from 0–2.5 V vs RHE at 20 mV·s⁻¹ (and 60 mV·s⁻¹ when emphasizing capacitive currents). During chopped-CV, the acquisition resolution was ~0.83 ms in time and ~50 µV in potential. (If RRDE ring data were recorded, the ring was held at 0.4 V vs RHE with ~10 ms time and ~2 mV potential resolution.)
For analysis under chopped illumination, applied-potential windows were predefined as follows: Region I, E ≤ 0.50 V; Region II, 0.50 ≤ E ≤ 0.95 V; Region IIIa, 0.95 ≤ E ≤ 1.25 V; Region IIIb, E ≥ 1.25 V. (Only the boundaries are specified here; no outcome is stated.)
|
- Disk current transients under chopped AM 1.5G. During the CV sweep (0–2.5 V vs RHE; 20 mV s⁻¹; 1600 rpm), record time-resolved disk photocurrent with 1 s on / 1 s off chopping; acquisition resolution ≈ 0.83 ms (time) and 50 µV (potential); LED switching transient ~3 ms.
- Switching-induced capacitive features. At each potential, detect and classify (without assigning values here) the presence/absence and sign (positive/negative) of the capacitive peak at light switch-on and at light switch-off. Results are aggregated by the defined potential regions I, II, IIIa, IIIb.
|
When BiVO₄ photoanodes were subjected to chopped AM 1.5G illumination, how did the switching-induced capacitive peaks behave across the four potential regions (I, II, IIIa, IIIb), specifically in terms of their sign and presence at light switch-on and switch-off?
|
In Region I (≤0.5 V_RHE), the switch-on peak was negative and the switch-off peak was positive.
In Region II (0.5–0.95 V_RHE), the switch-on peak was negative and the switch-off peak was positive, with a magnitude about one order of magnitude smaller than Region I.
In Region IIIa (0.95–1.25 V_RHE), the switch-on peak was positive and the switch-off peak was a tiny positive feature.
In Region IIIb (≥1.25 V_RHE), the switch-on peak was positive, and no switch-off peak was observed.
|
- Flat-band potential (E_fb): the potential at which band bending vanishes in a semiconductor/electrolyte interface.
- Mott–Schottky pitfalls: Mott–Schottky analysis assumes depletion-layer capacitance dominates and that interface states and frequency dispersion are negligible. When surface states or parallel Helmholtz capacitance contribute appreciably, MS plots can misestimate 𝐸fb and carrier density.
- Band bending in n-type semiconductors: upward bending promotes hole transport and governs space-charge layer behavior.
|
[{"label":"RBK Item","value":"Flat-band potential (E_fb): the potential at which band bending vanishes in a semiconductor/electrolyte interface."},{"label":"Title","value":"Flat band potential determination: avoiding the pitfalls"},{"label":"URL","value":"https://pubs.rsc.org/en/content/articlehtml/2019/ta/c9ta09569a"},{"label":"Date","value":"November 8, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Mott–Schottky pitfalls: Mott–Schottky analysis assumes depletion-layer capacitance dominates and that interface states and frequency dispersion are negligible. When surface states or parallel Helmholtz capacitance contribute appreciably, MS plots can misestimate 𝐸fb and carrier density."},{"label":"Title","value":"Flat band potential determination: avoiding the pitfalls"},{"label":"URL","value":"https://pubs.rsc.org/en/content/articlehtml/2019/ta/c9ta09569a"},{"label":"Date","value":"November 8, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Physics
|
High-Energy Experimental Physics
|
MCQ
|
Testing perturbative QCD calculations with beauty-mesonproduction in proton–proton collisions with ALICE
|
https://arxiv.org/abs/2509.00458
|
August 30, 2025
|
Researchers measured the production cross section of B⁰ mesons to test perturbative QCD calculations. The model system used proton-proton (pp) collisions at a center-of-mass energy of √s=13.6 TeV, provided by the LHC and recorded by the ALICE experiment during Run 3. B⁰ mesons were fully reconstructed via their decay channel B⁰ → D⁻π⁺, with the subsequent decay D⁻ → π⁻K⁺π⁻. The analysis was performed in the transverse momentum (Pt) range of 1<Pt<23.5 GeV/c and the midrapidity region ∣y∣<0.5. The raw yields were extracted from a fit to the invariant mass distribution of candidate particles and were corrected for detector acceptance, efficiency, and the branching ratio BR = (2.35±0.08)×10^−6. The measurement was based on an integrated luminosity of L int = (43±4) pb⁻¹.
|
- The production cross section of B⁰ mesons, measured as a function of transverse momentum (Pt) in the range 1<Pt<23.5 GeV/c and at a midrapidity (∣y∣<0.5).
- The ratio of B⁰ meson production cross section at midrapidity (ALICE) to the B⁺ mesons production cross section at forward rapidity (LHCb), as a function of Pt.
- The total bb‾ production cross section per unit of rapidity at midrapidity (∣y∣<0.5), estimated from the measured B⁰ cross section.
|
The production cross section of B⁰ mesons was measured in proton-proton collisions at a center-of-mass energy of 13.6 TeV, down to a very low transverse momentum of 1 GeV/c at midrapidity. This low Pt region is challenging for perturbative QDC calculations. When compared to state-of-the-art theoretical predictions, which of the following outcomes is most likely?
a) The measured cross section is found to be same as with all considered theoretical predictions, within their respective uncertainties across the measured Pt range.
b) The measurement is consistent with calculations using a General-Mass Variable-Flavour-Number scheme but is significantly higher than predictions from the Kt-factorization approach.
c) The measured cross section is found to be different with all considered theoretical predictions, within their respective uncertainties across the measured Pt range
d) The data agrees with next-to-leading order (NLO) calculations that do not include resummation, indicating that resummation effects are negligible for beauty quark production.
|
a) The measured cross section is found to be same as with all considered theoretical predictions, within their respective uncertainties across the measured Pt range.
|
- The production cross section of B0 mesons is measured in the rapidity range |y| < 0.5 and the 1 < pT < 23.5 GeV/c interval, and is computed from the B0 raw yields, which include particles and antiparticles, extracted in each pT interval via a fit to the invariant mass distribution of selected candidates.
- The B0 production cross section can in turn be obtained by integrating the pT-differential production cross section measured in the 1 < pT < 23.5 GeV/c range and by applying an extrapolation factor obtained from FONLL predictions
|
[{"label":"RBK Item","value":"The production cross section of B0 mesons is measured in the rapidity range |y| < 0.5 and the 1 < pT < 23.5 GeV/c interval, and is computed from the B0 raw yields, which include particles and antiparticles, extracted in each pT interval via a fit to the invariant mass distribution of selected candidates."},{"label":"Title","value":"Preliminary Physics Summary: measurement of B^0 -meson production cross section in proton-proton collisions at √s=13.6 TeV"},{"label":"URL","value":"https://cds.cern.ch/record/2928766"},{"label":"Date","value":"Mar 28, 2025"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Open-access, this is cited as reference 4 in the paper"},{"label":"RBK Item","value":"The B0 production cross section can in turn be obtained by integrating the pT-differential production cross section measured in the 1 < pT < 23.5 GeV/c range and by applying an extrapolation factor obtained from FONLL predictions"},{"label":"Title","value":"Theoretical predictions for charm and bottom production at the LHC"},{"label":"URL","value":"https://link.springer.com/article/10.1007/JHEP10(2012)137"},{"label":"Date","value":"Oct 19, 2012"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Open-access, this is cited as reference 5 in the paper"}]
|
Physics
|
Physics/Condensed Matter Physics
|
MCQ
|
Assessment of transparent conductive oxides as back contacts for inline-fabricated Cu(In,Ga)Se2 solar cells
|
https://iopscience.iop.org/article/10.1088/2515-7655/adfd86
|
September 16, 2025
|
The researchers examined the use of transparent conductive oxides (TCOs) as transparent back contacts (TBCs) in Cu(In,Ga)Se₂ (CIGS) thin-film solar cells fabricated through an industrial inline co-evaporation process. Different TCO materials were deposited on glass substrates, followed by absorber growth, buffer and window layer deposition, and complete device fabrication.
• Cu(In,Ga)Se₂ (CIGS) absorbers were co-evaporated in an inline industrial coater designed for substrates up to 30 × 30 cm².
• Four transparent conductive oxides (TCOs) were tested as transparent back contacts (TBCs): ITO, FTO, IZO, and IZrO. A 550 nm Mo layer was used as reference, and some ITO samples included a 10 nm Mo interlayer for protection.
• The substrate temperature during deposition was varied, reaching a maximum of approximately 580 °C.
• All absorbers underwent an RbF post-deposition treatment to improve device performance.
• A ~50 nm CdS buffer layer was deposited by chemical bath deposition (CBD).
• The window stack consisted of RF-sputtered Zn₀.₈₅Mg₀.₁₅O (ZMO) and DC-sputtered Al-doped ZnO (AZO) layers.
• A Ni/Al/Ni front grid was deposited by electron-beam evaporation to ensure good electrical contact.
|
• Electrical performance (JV):
• Under one-sun AM1.5G illumination (WACOM solar simulator).
• Bifacial JV with dual LED simulators for front/back illumination.
• Efficiency (PCE), fill factor (FF), open-circuit voltage (VOC), short-circuit current density (JSC).
• Optical characterization:
• Transmittance & reflectance spectra before/after CIGS growth (350–1600 nm).
• External quantum efficiency (EQE) spectra (250–1250 nm, 5–10 nm steps).
• Material properties:
• Sheet resistance of TBCs (before & after growth).
• Thermodynamic stability (enthalpy of formation vs Ga₂O₃).
• Derived parameters:
• Band gap (Eg) ≈ 1.1 eV from EQE; bifaciality ratio (JSC,back/JSC,front).
|
Which transparent conductive oxide (TCO) back contact produced the best-performing Cu(In,Ga)Se₂ (CIGS) solar cell when fabricated in the industrial inline process?
A. Indium tin oxide (ITO)
B. Fluorine-doped tin oxide (FTO)
C. Indium–zinc oxide (IZO)
D. Zirconium-doped indium oxide (IZrO)
|
D. Zirconium-doped indium oxide (IZrO)
|
• Cu(In,Ga)Se₂ (CIGS) Thin-Film Solar Cells are Semiconductor absorber materials composed of copper, indium, gallium, and selenium used in high-efficiency thin-film photovoltaics.
• Transparent Back Contact (TBC) is a conductive and optically transparent layer that replaces the conventional opaque molybdenum (Mo) back electrode, enabling bifacial and tandem solar-cell configurations.
• Transparent Conductive Oxides (TCOs) are materials that combine high electrical conductivity with optical transparency, typically based on doped metal oxides (e.g., ITO, FTO, IZO, IZrO).
|
[{"label":"RBK Item","value":"Cu(In,Ga)Se₂ (CIGS) Thin-Film Solar Cells are Semiconductor absorber materials composed of copper, indium, gallium, and selenium used in high-efficiency thin-film photovoltaics."},{"label":"Title","value":"Efficiency boost of bifacial Cu(In,Ga)Se2 thin-film solar cells for flexible and tandem applications with silver-assisted low-temperature process"},{"label":"URL","value":"https://www.nature.com/articles/s41560-022-01157-9"},{"label":"Date","value":"Nov 21, 2022"},{"label":"RBK Item","value":"Transparent Back Contact (TBC) is a conductive and optically transparent layer that replaces the conventional opaque molybdenum (Mo) back electrode, enabling bifacial and tandem solar-cell configurations."},{"label":"Title","value":"Efficiency boost of bifacial Cu(In,Ga)Se2 thin-film solar cells for flexible and tandem applications with silver-assisted low-temperature process"},{"label":"URL","value":"https://www.nature.com/articles/s41560-022-01157-9"},{"label":"Date","value":"Nov 21, 2022"},{"label":"RBK Item","value":"Transparent Conductive Oxides (TCOs) are materials that combine high electrical conductivity with optical transparency, typically based on doped metal oxides (e.g., ITO, FTO, IZO, IZrO)."},{"label":"Title","value":"Microstructural and diffusion properties of CIGS thin film solar cells fabricated using transparent conducting oxide back contacts"},{"label":"URL","value":"https://doi.org/10.1016/j.tsf.2004.11.142"},{"label":"Date","value":"Jun 1, 2005"}]
|
Chemistry
|
Environmental Chemistry / Interfaces
|
Numerical Values
|
Size Dependent Uncatalyzed Sulfite Oxidation in Aqueous Microdroplets
|
https://doi.org/10.1021/acs.est.5c01509
|
September 11, 2025
|
Researchers investigated the uncatalyzed oxidation of sulfite to sulfate by O2 in aqueous microdroplets deposited on a superhydrophobic substrate, as a function of size, gas-phase composition, and temperature, utilizing in situ micro-Raman spectroscopy. The superhydrophobic substrate, with a contact angle of 160.1 ± 3.4º, was produced by dip-coating a quartz plate (Alfa Chemistry) into a solution of Cab-O-SIL TS-720 (Inoxia Ltd) suspended in acetone (20 mg/mL), followed by air drying at 200 °C on a hot plate. Milli-Q water (18.2 MΩ·cm–1, 4 ppb of Total-Organic-Carbon (TOC)) used for all experiments. Bulk solutions were prepared with oxygen-free Milli-Q water (Milli-Q water purged with nitrogen) in order to reduce the potential influence of water-soluble oxygen. The 1.2 mol/kg Na2SO3 solution was prepared with an initial pH of 9.5. This pH was not further adjusted. Microdroplets were generated from the bulk solutions by using a nebulizer and collected on the superhydrophobic quartz substrate. The hydrophobic substrate with aerosols was transferred to a sealed environmental cell (Linkam, THMS600 Stage) connected to a humidity control system. The relative humidity (RH) within the environment cell was set at ∼80 ± 3%. This was controlled by adjusting the ratio of dry and wet gases and monitored by a hygrometer (Buck, CR-4). The droplets were monitored in situ with micro-Raman spectroscopy (Horiba, LabRam HR Evolution). The spectrometer was equipped with an optical microscope (Olympus BX41), featuring 10× and 100× objectives, and a 532 nm laser. Spectra were collected at the droplet center, with kinetics largely independent of detection depth, using a 5 s acquisition time, 2 co-added accumulations, and a spectral resolution of ∼1 cm–1. To quantify the concentrations of sulfate ([SO4^2–]) and sulfite ([SO3^2–]) within the microdroplets during the oxidation reaction, calibration curves were established. The calibration curves of [SO4^2–] and [SO3^2–] were obtained from the peak area ratios of sulfate (vs(SO4^2–) at 980 cm–1) or sulfite (vs(SO3^2–) at 934 cm–1 and va(SO3^2–) at 966 cm–1) to water (v(OH)water at 3420 cm–1, a broad peak from 2700 to 3800 cm–1), respectively. These peak areas were derived from the Raman spectra of standard Na2SO4 and Na2SO3 solutions at various concentrations in units of molality (m, mol/kg). The sulfate concentration was determined as follows: [SO4^2-]= K_sulfate x [A(SO4^2-)/A(OH_water); where K_sulfate represents the slope of 46.7 m determined from the calibration curve. The Raman peak for H2O, v(OH)water, was applied as an internal standard. Raman spectra of standard Na2SO3 solutions were collected under nitrogen to prevent further oxidation by air. The time evolution of sulfite concentration, Csulfite, t, was described by EqA: (−dCsulfite/dt) = (1/τsulfate) x Csulfite = dCsulfate/dt; and EqB: ln(Csulfite/Csulfite,0) = (1/τsulfate) x t. The values of the inverse sulfate formation time scale (1/τsulfate, min–1) were determined by fitting ln(Csulfite,t /Csulfite,t=0) as a function of t, following EqB. 1/τsulfate was analyzed as a function of the experimental parameters (0, 9, 21% O2; 298 K) for different values of droplet radius (1.5 - 112), r (μm), which was measured with the optical microscope equipped on the micro-Raman spectrometer.
|
- Inverse sulfate formation time scale (1/τsulfate, min–1): for microdroplets of different radii (1.5 - 112 μm) at 0, 9, 21% O2 and 298 K (micro-Raman spectrometer).
|
Researchers investigated the uncatalyzed oxidation of sulfite to sulfate by O2 in aqueous microdroplets deposited on a superhydrophobic substrate, as a function of size, gas-phase composition, and temperature, utilizing in situ micro-Raman spectroscopy. Microdroplets (1.5 - 112 μm radii) were generated from the bulk solutions by using a nebulizer and collected on the superhydrophobic quartz substrate. The relative humidity (RH) within the environment cell was set at ∼80 ± 3%. The droplets were monitored in situ with micro-Raman spectroscopy (Horiba, LabRam HR Evolution). 1/τsulfate was analyzed as a function of the experimental parameters (0, 9, 21% O2; 298 K). Which is the expected value of 1/τsulfate (min–1) for a 8.3 μm microdroplet assessed at 21% O2 and 298K?
|
1/τsulfate (8.3 μm, 21% O2, 298K) = 2.56 - 3.12 x 10^-3 min^-1. Note: No CI/SE/SD reported -> fallback ±10% applied.
|
- Aqueous aerosol microdroplets are unique microreactors; compared to bulk phase solutions, the air−water interface in these systems enhances reaction rates and enables redox chemistry.
- S(IV) oxidation is accelerated in micron-sized aqueous aerosols compared to bulk solutions.
|
[{"label":"RBK Item","value":"- Aqueous aerosol microdroplets are unique microreactors; compared to bulk phase solutions, the air−water interface in these systems enhances reaction rates and enables redox chemistry."},{"label":"Title","value":"Organic Reactions in Microdroplets: Reaction Acceleration Revealed by Mass Spectrometry"},{"label":"URL","value":"https://onlinelibrary.wiley.com/doi/10.1002/anie.201602270"},{"label":"Date","value":"October 6, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the cited RBK item by this paper"},{"label":"RBK Item","value":"- S(IV) oxidation is accelerated in micron-sized aqueous aerosols compared to bulk solutions."},{"label":"Title","value":"Oxidation of sulfur dioxide by nitrogen dioxide accelerated at the interface of deliquesced aerosol particles"},{"label":"URL","value":"https://onlinelibrary.wiley.com/doi/10.1002/anie.201602270"},{"label":"Date","value":"September 30, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the cited RBK item by this paper"}]
|
Physics
|
Quantum Physics
|
Free-Format Question
|
Experimental observation of subabsorption
|
https://arxiv.org/abs/2506.09872
|
June 11, 2025
|
The experiment is performed inside an ultrahigh vacuum chamber which is kept at a base pressure of ~10⁻⁹ torr. The model system was ultracold rubidium-87 atoms prepared in a magneto-optical trap at low optical depth and a dilute density of about 0.01 atoms per cubic wavelength. The main intervention was exposing the ensemble to weak resonant laser pulses on the D2 line at 780 nanometers, each containing only tens of photons. Three counter-propagating beam pairs are used; each pair has an optical power of approximately 40 mW and a beam radius of 3 cm. The third beam pair is not orthogonal to the other two, and has a smaller size, with a beam radius of 5 mm, and an optical power of 5 mW. Pulses were generated with an acousto-optic modulator set to an 8-nanosecond rise time, faster than the atomic excited state lifetime. Transmission through the atoms was recorded using single-photon counting modules (SPCM). An oscilloscope was used to measure the output of the SPCM was measured on an oscilloscope, which gave approximately 4 ns time resolution for the intensity of the pulse, and continuous measurements of both I input and I output over ∼10⁵ experimental cycles.
|
- Time dependent absorption of resonant laser pulses
- Transmission with and without atoms (single photon counting module)
- Absorption rise time under varied conditions (optical depth, atomic temperature, laser detuning), obtained from exponential fits
|
Researchers prepared ultracold rubidium-87 atoms in a magneto-optical trap at a temperature of about 40 microkelvin and low optical depth. The atoms were illuminated with weak resonant laser pulses on the D2 line at 780 nanometers, each pulse generated by an acousto-optic modulator with an 8-nanosecond rise time and containing only tens of photons. Transmission of the pulses was recorded with a single photon counting module. Absorption rise time was then measured under varied conditions, including changes in optical depth, atomic temperature, and laser detuning. Based on the observations, what would you expect to happen to measured absorption rise time of the laser pulses when the optical depth of the ensemble is 0.1 and the atomic temperature is increased from 60 to 80 μK?
|
At an optical depth of 0.1, the measured absorption rise time will decrease when the atomic temperature is increased from 60 to 80 μK.
|
- By controlling the atomic positions in a cavity using a nano-patterned mask, they demonstrated that the atomic ensemble can absorb photons in the cavity mode at a rate faster than what is dictated by single-atom physics.
- An ensemble of atoms may interact with light in a way that is qualitatively different than how a single atom interacts.
- If we have many atoms per cubic wavelength of the emitted radiation, the ensemble can spontaneously decay at a rate that is much faster than the single-atom decay rate.
|
[{"label":"RBK Item","value":"By controlling the atomic positions in a cavity using a nano-patterned mask, they demonstrated that the atomic ensemble can absorb photons in the cavity mode at a rate faster than what is dictated by single-atom physics."},{"label":"Title","value":"Realization of superabsorption by time reversal of superradiance"},{"label":"URL","value":"https://www.nature.com/articles/s41566-021-00770-6"},{"label":"Date","value":"Mar 1, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 37 in the paper"},{"label":"RBK Item","value":"An ensemble of atoms may interact with light in a way that is qualitatively different than how a single atom interacts."},{"label":"Title","value":"Coherence in Spontaneous Radiation Processes"},{"label":"URL","value":"https://journals.aps.org/pr/abstract/10.1103/PhysRev.93.99"},{"label":"Date","value":"Jan 1, 1954"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Open-access, this is cited as reference 1 in the paper"},{"label":"RBK Item","value":"If we have many atoms per cubic wavelength of the emitted radiation, the ensemble can spontaneously decay at a rate that is much faster than the single-atom decay rate."},{"label":"Title","value":"Observation of Dicke Superradiance in Optically Pumped HF Gas"},{"label":"URL","value":"https://journals.aps.org/prl/abstract/10.1103/PhysRevLett.30.309"},{"label":"Date","value":"Feb 19, 1973"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 17 in the paper"}]
|
Physics
|
Nanophotonics Physics
|
MCQ
|
Distance dependent interaction between a single emitter and a single dielectric nanoparticle using DNA origami
|
https://arxiv.org/abs/2505.03580
|
May 06, 2025
|
An experiment investigates the potential of a 140 nm crystalline silicon nanoparticle using a DNA origami scaffold. A 7249-nucleotide-long scaffold extracted from the M13mp18 bacteriophage was folded into the desired shape using 243 staples in 1xTAE, 12 mM MgCl2, pH 8 buffer. It was mixed in a 10-fold excess of staples over the scaffold, and in a 100-fold excess for the functional staples. The mixture was heated to 70 °C and cooled at a rate of 1 °C every 20 minutes to 25 °C. The DNA origami structures were subsequently purified using 1% agarose gel electrophoresis at 70 V for 2 hours and stored at 4 °C. Measurements were performed on an inverted microscope (Olympus IX71). Excitation was performed with a randomly polarized supercontinuum white light laser (FYLA SCT1000) that was spectrally filtered to a wavelength of (635 ±5) nm or (532 ± 5) nm to efficiently excite the dye. Emitting fluorescence was spectrally split into two paths by a dichroic mirror and detected by two avalanche photodiodes with appropriate filters, at short distances (d_1 ≈ 7 nm and d_2 ≈ 20 nm) from the nanoparticle's surface. The APDs and the pulsed laser are connected to a module for time-correlated single-photon counting, which records the arrival times of photons. First, a confocal image of a region of the sample was recorded, and the position of the DNA origami structures was determined. The experiment's goal is to characterize the primary effects on the molecule's key emission properties: its overall brightness (fluorescence intensity) and its fluorescence lifetime ($\tau$).
|
- The fluorescence lifetime ($\tau$) of single molecules at distances of ≈7 nm and ≈20 nm from the silicon nanoparticle.
- The overall fluorescence intensity of single molecules at distances of ≈7 nm and ≈20 nm from the silicon nanoparticle.
|
In the experiment, a single fluorescent molecule is placed at short distances (≈7 nm and ≈20 nm) from a dielectric (silicon) nanoparticle. What is the combined effect on the molecule's fluorescence lifetime ($\tau$) and its overall fluorescence intensity?
A) The fluorescence lifetime is significantly reduced, while the overall fluorescence intensity remains essentially unchanged.
B) The fluorescence lifetime is significantly reduced, and the overall fluorescence intensity is also significantly enhanced.
C) The fluorescence lifetime is significantly reduced, and the overall fluorescence intensity is strongly quenched (reduced).
D) Both the fluorescence lifetime and the overall fluorescence intensity remain essentially unchanged, indicating a weak interaction.
|
A) The fluorescence lifetime is significantly reduced, while the overall fluorescence intensity remains essentially unchanged.
|
- An optical antenna modifies the emission of a nearby light source (emitter) by altering its local electromagnetic environment. This typically speeds up the emitter's decay processes, resulting in a reduced fluorescence lifetime.
- Plasmonic antennas, made from metals like gold or silver, suffer from high ohmic losses. At short distances (<20 nm), this causes a strong non-radiative process called quenching, where the emitter's energy is lost as heat to the metal, significantly reducing its brightness.
- Dielectric antennas, made from high-refractive-index materials like silicon, have negligible ohmic losses. They can reduce an emitter's fluorescence lifetime without causing the significant quenching seen in plasmonic antennas.
- DNA origami is a self-assembly technique used to build precise nanostructures. In this context, it functions as a molecular ruler to place an emitter and a nanoparticle at an exact, predefined distance from each other.
|
[{"label":"RBK Item","value":"An optical antenna modifies the emission of a nearby light source (emitter) by altering its local electromagnetic environment. This typically speeds up the emitter's decay processes, resulting in a reduced fluorescence lifetime."},{"label":"Title","value":"Plasmonic Nanoantennas: Fundamentals and Their Use in Controlling the Radiative Properties of Nanoemitters"},{"label":"URL","value":"https://pubs.acs.org/doi/10.1021/cr1002672"},{"label":"Date","value":"March 24, 2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 1 in the paper"},{"label":"RBK Item","value":"Plasmonic antennas, made from metals like gold or silver, suffer from high ohmic losses. At short distances (<20 nm), this causes a strong non-radiative process called quenching, where the emitter's energy is lost as heat to the metal, significantly reducing its brightness."},{"label":"Title","value":"Enhancement and Quenching of Single-Molecule Fluorescence"},{"label":"URL","value":"https://journals.aps.org/prl/abstract/10.1103/PhysRevLett.96.113002"},{"label":"Date","value":"March 21, 2006"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [16] in the report."},{"label":"RBK Item","value":"Dielectric antennas, made from high-refractive-index materials like silicon, have negligible ohmic losses. They can reduce an emitter's fluorescence lifetime without causing the significant quenching seen in plasmonic antennas."},{"label":"Title","value":"Optically resonant dielectric nanostructures"},{"label":"URL","value":"https://doi.org/10.1126/science.aag2472"},{"label":"Date","value":"November 18, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [19] in the report."},{"label":"RBK Item","value":"DNA origami is a self-assembly technique used to build precise nanostructures. In this context, it functions as a molecular ruler to place an emitter and a nanoparticle at an exact, predefined distance from each other."},{"label":"Title","value":"Folding DNA to create nanoscale shapes and patterns"},{"label":"URL","value":"https://www.nature.com/articles/nature04586"},{"label":"Date","value":"March 16, 2006"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [43] in the report."}]
|
Physics
|
Applied Physics
|
Numerical Values
|
Spalled barium titanate single crystal thin films for functional device applications
|
https://arxiv.org/abs/2505.04045
|
May 7, 2025
|
A ~20 μm thick, ~0.5 x 1.5 mm² barium titanate (BTO) film was fabricated by spalling a (001)-oriented bulk crystal previously coated with a Ti and Au seed layer and electroplated with Ni. The spalled film was analyzed with the Teng-Man technique using an incident light of wavelength 1520 nm, polarized at 45°, to obtain the Pockels coefficient ($r_{33}$). The film had a 100 nm thick Au back reflector and top electrodes consisting of a 50 nm thick indium tin oxide layer, and was poled by applying a constant 20 V voltage for one hour to reduce domain switching. The setup comprised a Soleil-Babinet compensator that controlled the phase retardation by positional adjustment, an analyzer, and a detector. The experiment was conducted using two configurations: (1) irises before and after the sample that limit the probing diameter to less than 300 μm, and (2) lenses of focal length $f=3.5$ instead of the irises.
|
- The DC and modulated output intensities of a reflected laser beam as a function of the modulating voltage, modulating frequency and phase retardation.
|
The electro-optic Pockels coefficient $r_{33}$ of a spalled and poled barium titanate (BTO) thin film was characterized using two different measurement configurations. One measurement averaged the response over a large, multi-domain area of the film. A second, separate measurement used lenses to probe a much smaller, likely single-domain region (tens of microns in size) to assess the material’s local, intrinsic properties. Based on the measurement performed on the small, likely single-domain region for a modulating voltage of 5 V and frequencies ranging from 10 to 18 kHz, what is the measured Pockels coefficient (in pm/V)?
|
120-200 pm/V
|
- Barium titanate (BTO) is a perovskite oxide material with exceptional electro-optic properties suitable for photonic devices.
- Spalling is a fabrication technique where a thin, single-crystal layer is exfoliated from a bulk substrate using a metal stressor layer.
- The Pockels effect is a linear electro-optic effect where a material's refractive index changes in proportion to an applied electric field, quantified by the Pockels coefficient $(r_{33})$.
- Ferroelectric domains are regions within a crystal that have a uniform direction of spontaneous electric polarization.
- Poling is the process of applying a strong electric field to a ferroelectric material to align its domains in a single direction.
- The Teng-Man technique is an experimental method that uses a reflection-based setup to measure the Pockels coefficient of a thin film.
|
[{"label":"RBK Item","value":"Barium titanate (BTO) is a perovskite oxide material with exceptional electro-optic properties suitable for photonic devices."},{"label":"Title","value":"Barium Titanate Nanostructures and Thin Films for Photonics"},{"label":"URL","value":"https://doi.org/10.1002/adom.202001249"},{"label":"Date","value":"November 5, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [4] in the report."},{"label":"RBK Item","value":"Spalling is a fabrication technique where a thin, single-crystal layer is exfoliated from a bulk substrate using a metal stressor layer."},{"label":"Title","value":"Controlled spalling-based mechanical substrate exfoliation for III-V solar cells: A review"},{"label":"URL","value":"https://doi.org/10.1016/j.solmat.2021.111018"},{"label":"Date","value":"June 15, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [35] in the report."},{"label":"RBK Item","value":"The Pockels effect is a linear electro-optic effect where a material's refractive index changes in proportion to an applied electric field, quantified by the Pockels coefficient $(r_{33})$."},{"label":"Title","value":"Large Pockels effect in micro- and nanostructured barium titanate integrated on silicon"},{"label":"URL","value":"https://www.nature.com/articles/s41563-018-0208-0"},{"label":"Date","value":"November 12, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [28] in the report."},{"label":"RBK Item","value":"Ferroelectric domains are regions within a crystal that have a uniform direction of spontaneous electric polarization."},{"label":"Title","value":"R-Curve Behaviour of BaTiO3 Due to Stress-Induced Ferroelastic Domain Switching"},{"label":"URL","value":"https://doi.org/10.1016/S0955-2219(96)00211-7"},{"label":"Date","value":"1997"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [43] in the report."},{"label":"RBK Item","value":"Poling is the process of applying a strong electric field to a ferroelectric material to align its domains in a single direction."},{"label":"Title","value":"A method for poling barium titanate, BaTiO3"},{"label":"URL","value":"https://doi.org/10.1080/00150199108008240"},{"label":"Date","value":"1991"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [3] in the report."},{"label":"RBK Item","value":"The Teng-Man technique is an experimental method that uses a reflection-based setup to measure the Pockels coefficient of a thin film."},{"label":"Title","value":"Simple reflection technique for measuring the electro-optic coefficient of poled polymers"},{"label":"URL","value":"https://doi.org/10.1063/1.103107"},{"label":"Date","value":"Apriil 30, 1990"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [44] in the report."}]
|
Physics
|
Semiconductor Physics
|
Numerical Values
|
Direct Bandgap Photoluminescence of GeSn grown on Si(100) substrate by Molecular Beam Epitaxy Growth
|
https://arxiv.org/abs/2505.04096
|
May 07, 2025
|
Different GeSn layered structures were grown on a 2-inch wafer Si(100) utilizing the molecular beam epitaxy (MBE) with Knudsen cells made of pyrolytic boron nitride (PBN) crucibles, loaded with ultra-high (7N) pure intrinsic Ge and metallic Sn respectively. The samples were grown in an ultra-high vacuum (UHV) MBE chamber at a background pressure of 1×10-11 Torr. The Si substrates were first cleaned by briefly submerging in a diluted HF:H₂O (1:20) solution and blow-dried with nitrogen. Then, they were degassed at 250 °C for over two hours inside the MBE chamber and then heated to ~900 °C to remove the oxide layer. Two Ge buffer layers were deposited, one grown at 400 °C to a thickness of ~70 nm, and a second one at 700 °C to ~120 nm. Three cyclic annealing was performed at 700-800 °C. The first GeSn layer was grown after cooling the substrate to ~180 °C. The second GeSn layer grown at 200 and 220 ⁰C for samples S1 and S2, respectively. The thickness of the final GeSn layers for both samples was then characterized using secondary ion mass spectrometry (SIMS).
|
- The depth profile of Ge and Sn concentration, measured by secondary ion mass spectrometry (SIMS).
- Thickness of the GeSn layer for different Sn concentrations.
|
Two multi-layered GeSn samples, S1 and S2, were grown on Si substrates using MBE in a UHV chamber through a multi-step annealing process. Two Ge buffer layers were grown in The first GeSn layer was grown after cooling the substrate to ~180°C. What is its measured GeSn layer thickness (in nm) for sample S2, whose second GeSn layer was grown at 220°C?
|
GeSn layer thickness = [473-578] nm.
No CI/SE/SD reported → a fallback ±10% applied.
|
- Germanium-Tin (GeSn) is a Group IV semiconductor alloy that is of interest for silicon-based photonics because its bandgap can be tuned to become a direct-gap material by increasing the Sn concentration.
- Molecular Beam Epitaxy (MBE) is a crystal growth technique used to deposit high-quality, single-crystal thin films (epilayers) with very precise control over thickness and composition.
- Strain relaxation is a process in heteroepitaxy where the strain in a crystal layer grown on a substrate with a different lattice spacing is relieved, often through the formation of defects like dislocations.
- Secondary Ion Mass Spectrometry (SIMS) is an analytical technique used to determine the composition and thickness of thin films by sputtering the surface with an ion beam and analyzing the ejected secondary ions.
|
[{"label":"RBK Item","value":"Germanium-Tin (GeSn) is a Group IV semiconductor alloy that is of interest for silicon-based photonics because its bandgap can be tuned to become a direct-gap material by increasing the Sn concentration."},{"label":"Title","value":"Si-Ge-Sn alloys: From growth to applications"},{"label":"URL","value":"https://doi.org/10.1016/j.pcrysgrow.2015.11.001"},{"label":"Date","value":"January 18, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [1] in the report."},{"label":"RBK Item","value":"Molecular Beam Epitaxy (MBE) is a crystal growth technique used to deposit high-quality, single-crystal thin films (epilayers) with very precise control over thickness and composition."},{"label":"Title","value":"Molecular beam epitaxy of metastable, diamond structure SnxGe1-x alloys"},{"label":"URL","value":"https://doi.org/10.1063/1.101152"},{"label":"Date","value":"May 22, 1989"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [11] in the report."},{"label":"RBK Item","value":"Strain relaxation is a process in heteroepitaxy where the strain in a crystal layer grown on a substrate with a different lattice spacing is relieved, often through the formation of defects like dislocations."},{"label":"Title","value":"Critical thickness for strain relaxation of Ge1-xSnx (x≤0.17) grown by molecular beam epitaxy on Ge(001)"},{"label":"URL","value":"https://doi.org/10.1063/1.4922529"},{"label":"Date","value":"June 11, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"This paper is paywalled but is cited as reference [8] in the report."},{"label":"RBK Item","value":"Secondary Ion Mass Spectrometry (SIMS) is an analytical technique used to determine the composition and thickness of thin films by sputtering the surface with an ion beam and analyzing the ejected secondary ions."},{"label":"Title","value":"Depth profiling by secondary ion mass spectrometry"},{"label":"URL","value":"https://onlinelibrary.wiley.com/doi/abs/10.1002/sca.4950030202"},{"label":"Date","value":"July 16, 1979"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Physics
|
Soft Condensed Matter
|
Numerical Values
|
Negative drag force on beating flagellar-shaped bodies in active fluids
|
https://arxiv.org/abs/2508.13129
|
Aug 18, 2025
|
Researchers examined how a translating, periodically beating “virtual flagellum” alters drag in an active colloidal bath by projecting a dynamic light pattern (length 275 µm, thickness 35 µm, waveform amplitude 10 µm with 1.75 oscillations, period 2π/ω ) that moved at constant speed u along −x . The model system was a quasi-2D suspension of active Janus colloids—SiO₂ spheres of diameter 7.89 µm half-coated with a 60 nm carbon layer—dispersed at the critical composition in water–propylene glycol n-propyl ether (40% m) inside a 200 µm-high cell held at 28 °C (below the 32 °C demixing point), forming an area fraction ϕ≈0.03 . Self-propulsion was induced with a 532 nm laser, with power up to 6 mW yielding speeds up to v_0 ≈ 0.2 µm s⁻¹ (tunable by intensity). Repulsion from the flagellum boundary exploited negative phototaxis, with a calibrated repulsive force magnitude of approximately 650 k_B T/σ .
|
- Mean x-component of drag force on the flagellum, ⟨F_x⟩ , as a function of translational speed u , measured at fixed beating frequency ω=0.013Hz and varying active-particle propulsion speed v_0
- Active-particle density maps near the flagellum - particle tracking from time-lapse microscopy with spatial binning/phase-averaging.
- Repulsive force calibration (f_0) - straight-line runs in a constant light gradient with Stokes-drag relation
- Measurement of departure-angle distribution at a light-defined flat wall.
- Particle trajectories and positions - 2D single-particle tracking from video microscopy.
- Self-propulsion speed - single-particle tracking under uniform illumination.
- High-speed force–velocity slope - effective friction coefficient of the body
|
In a quasi-2D bath of light-driven Janus colloids (7.89 µm SiO₂, 60 nm carbon) with self-propulsion set by a scanned 532 nm spot, a translating, periodically beating virtual flagellum (L = 275 µm, d = 35 µm, A₀ = 10 µm, period = 2π/ω) moves at speed (u); the x-component of the time-averaged force (\langle F_x\rangle) is measured versus (u) at fixed (\omega=0.013) Hz while bath activity (v_0) is varied. What is the zero-drag crossing speed (u^*) (in µm s⁻¹) of (\langle F_x\rangle(u))?
|
The zero-drag crossing speed (u^*) of (\langle F_x\rangle(u)) is 0.18–0.22 µm s⁻¹ (No CI/SE/SD is given; The fallback is ±0.02 µm s⁻¹ )
|
- When these particles are illuminated with laser light (λ = 532nm) the carbon caps are selectively heated above TC, which leads to local demixing and eventually to self-propulsion.
- We note that our experimental approach neglects possible hydrodynamic interactions between APs and a physical body, however, whose interaction with walls are dominated by short-range steric forces, AP–wall interactions in our system have been shown to be weak.
- Due to the symmetry, the average force on the flagellum perpendicular to its direction of motion vanishes, and only the x-component ⟨Fx⟩ is considered in the following.
|
[{"label":"RBK Item","value":"When these particles are illuminated with laser light (λ = 532nm) the carbon caps are selectively heated above TC, which leads to local demixing and eventually to self-propulsion"},{"label":"Title","value":"Tuning the motility and directionality of self-propelled colloids"},{"label":"URL","value":"https://www.nature.com/articles/s41598-017-14126-0"},{"label":"Date","value":"Nov 2, 2017"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Open-access, this is cited as reference 27 in the paper"},{"label":"RBK Item","value":"We note that our experimental approach neglects possible hydrodynamic interactions between APs and a physical body, however, whose interaction with walls are dominated by short-range steric forces, AP–wall interactions in our system have been shown to be weak. "},{"label":"Title","value":"Microswimmers in patterned environments"},{"label":"URL","value":"https://pubs.rsc.org/en/content/articlelanding/2011/sm/c1sm05960b"},{"label":"Date","value":"Aug 23, 2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 33 in the paper"}]
|
Biology
|
Microbiology/Infectious Diseases
|
MCQ
|
A novel approach to studying infective endocarditis: Ultrasound-guided wire injury and bacterial challenge in mice.
|
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0318955
|
April 7, 2025
|
Researchers tested whether endothelial injury plus bacteremia induces murine infective endocarditis. Male and female C57BL/6-J mice (10-12 weeks) underwent ultrasound-guided wire injury of the aortic valve via right carotid access using an Abbott HI-TORQUE 0.014 guidewire that moved 50 times across the valve, with 100 rotations under ketamine/xylazine anesthesia; the carotid was ligated afterward, and echocardiography was used to ensure that no aortic regurgitation occurred. At 24 h or 72 h post-injury, the mice received an intravenous Staphylococcus aureus challenge (methicillin-susceptible clinical isolate SA-LT 68/03C12Y7) at 10⁴, 10⁵, or 10⁶ CFU in 100 µL sterile 0.9% NaCl. The inoculum was prepared from LB cultures (8h, 37 °C) and verified by plating 10 µL on 5% blood agar. The control group included mice that received bacterial challenge without prior wire injury (BC-only group). Blood and valve tissues were collected 24 h after challenge for culture (CFU counts) and ex vivo analyses; echocardiography (1.5% isoflurane) assessed valve vegetations and regurgitation. IE incidence at 24 h, valve CFU stratified by dose (10⁴–10⁶) and WI vs BC-only, and echocardiographic detection of vegetations/regurgitation was determined.
|
- Incidence of infective endocarditis (IE) by group (WI + BC vs BC only).
- Bacterial load (CFU) in blood and aortic valve tissue by group, dose (10⁴, 10⁵, or 10⁶ CFU), and time post-challenge (1 d, 3 d); assay: culture on blood agar.
- Valve vegetations (present/absent) and aortic regurgitation grade by echocardiography, across groups and timepoints.
|
Researchers tested whether endothelial injury plus bacteremia induces murine infective endocarditis (IE). Male and female C57BL/6J mice (10–12 weeks) either underwent aortic valve wire injury (WI) or no injury (BC-only). At 24 h or 72 h post-procedure, mice received an intravenous Staphylococcus aureus challenge of 10⁴, 10⁵, or 10⁶ CFU in 100 µL saline. At 24 h post-challenge, IE incidence was recorded, and valve CFU were quantified; echocardiography assessed valve vegetations and aortic regurgitation.
Which outcome pattern is most likely?
A) In WI+BC, IE incidence and valve CFU increase from 10⁴ to 10⁵ and increase further from 10⁵ to 10⁶; BC-only shows negligible IE at all doses
B) In WI+BC, IE induction and valve burden rise from 10⁴ to 10⁵ and then plateau between 10⁵ and 10⁶; BC-only shows dose-dependent IE with substantial induction at 10⁶
C) WI+BC produces IE only at 10⁶ and only when the challenge is given 72 h after WI; at 24 h or lower doses, there are no vegetations or valve CFU; BC-only shows no IE at any dose.
D) BC-only shows minimal IE at 10⁴–10⁵ but matches WI+BC at 10⁶; in WI+BC, delaying bacteremia from 24 h to 72 h markedly reduces valve CFU and IE incidence
|
B) In WI+BC, IE induction and valve burden rise from 10⁴ to 10⁵ and then plateau between 10⁵ and 10⁶; BC-only shows dose-dependent IE with substantial induction at 10⁶
|
- Infective endocarditis (IE) is a bacterial infection that primarily involves the heart valves and can form vegetations composed of fibrin and platelets with bacteria.
- Staphylococcus aureus is a pathogenic bacterium capable of colonizing tissues and producing virulence factors relevant to IE.
- Intact valvular endothelium is a barrier that normally limits bacterial adhesion to the valve surface.
- An endothelial injury is an exposure of subendothelial matrix that promotes platalet activation and fibrin/von Willebrand factor deposition, generating microthombi.
- Valvular microthrombi are fibrin/platelet aggregates that provide surfaces to which bacteria can adhere during bacteremia.
- S. aureus adhesions are surface proteins that mediate attachment to matrix components and damaged valvular tissue.
- Infective vegetation is a structure of bacteria, fibrin, and platelets that can limit immune cells access to the infected site.
|
[{"label":"RBK Item","value":"Infective endocarditis (IE) is a bacterial infection that primarily involves the heart valves and can form vegetations composed of fibrin and platelets with bacteria. "},{"label":"Title","value":"Infective endocarditis"},{"label":"URL","value":"https://www.nature.com/articles/nrdp201659"},{"label":"Date","value":"September 1, 2016 "},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Staphylococcus aureus is a pathogenic bacterium capable of colonizing tissues and producing virulence factors relevant to IE. "},{"label":"Title","value":"Alpha-Toxin Induces Programmed Cell Death of Human T cells, B cells, and Monocytes during USA300 Infection"},{"label":"URL","value":"https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0036532"},{"label":"Date","value":"May, 2012"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Intact valvular endothelium is a barrier that normally limits bacterial adhesion to the valve surface. "},{"label":"Title","value":"Isolating Crucial Steps in Induction of Infective Endocarditis With Preclinical Modeling of Host Pathogen Interaction"},{"label":"URL","value":"https://www.frontiersin.org/journals/microbiology/articles/10.3389/fmicb.2020.01325/full"},{"label":"Date","value":"June 18, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Valvular microthombi is a fibrin/platelet aggregates that provide surfaces to which bacteria can adhere during bacteremia. "},{"label":"Title","value":"Isolating Crucial Steps in Induction of Infective Endocarditis With Preclinical Modeling of Host Pathogen Interaction"},{"label":"URL","value":"https://www.frontiersin.org/journals/microbiology/articles/10.3389/fmicb.2020.01325/full"},{"label":"Date","value":"June 18, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"S. aureus adhesions are surface proteins that mediate attachment to matrix components and damaged valvular tissue. "},{"label":"Title","value":"Staphylococcus aureus Fibronectin Binding Proteins Are Essential for Internalization by Osteoblasts but Do Not Account for Differences in Intracellular Levels of Bacteria"},{"label":"URL","value":"https://journals.asm.org/doi/10.1128/iai.69.5.2872-2877.2001"},{"label":"Date","value":"May 1, 2001"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":" Infective vegatation is a structure of bacteria, fibrin, and platelets that can limit immune-cells access to the infected site. "},{"label":"Title","value":"Infective endocarditi"},{"label":"URL","value":"https://www.nature.com/articles/nrdp201659"},{"label":"Date","value":"September 1, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Microbiology
|
MCQ
|
Growth Optimization Predicts Microbial Success in a Permafrost Thaw Experiment
|
https://www.biorxiv.org/content/10.1101/2025.09.01.673550v2
|
September 4, 2025
|
The researcher conducted controlled thaw experiments on permafrost cores from three Alaskan sites: the CRREL Permafrost Tunnel (AT), the CRREL Farmers Loop Experimental Station (FL), and the Barrow Experimental Observatory (BEO). Two cores were taken per site, with four replicate subsamples each. Cores were thawed at 2 °C for 96 days. DNA was extracted (Qiagen PowerSoil Pro Kit), prepared with Illumina TruSeq DNA Library Prep v2, quantified (Qubit HS Assay), purified (Blue Pippin), and sequenced on a 2×151 bp NextSeq run.
Reads were trimmed (fastp v0.23.4), assembled (metaSPAdes v4.0.0), and binned (MetaBAT2 v2.17; ≥1.5 kb contigs). Bin quality was checked (CheckM2 v1.0.1) and annotated (Prokka v1.14.6; dbCAN v4.1.4). Growth rates were predicted using gRodon v2.4.0. Relative abundances were estimated with CoverM v0.7.0 and transformed using the modified centered log-ratio (mclr) method in SPRING v1.0.4.
|
- Number and quality of metagenome-assembled genomes (MAGs).
- Predicted minimum doubling time of each high-quality MAG to compare fast vs. flow growing taxa.
- Changes in abundance from day 0 to 96 of each MAG quantified.
- Community classification by genomic trait grouping (oligotropic vs. copiotrophic) from genomic annotations.
|
Researchers obtained permafrost cores from three Alaskan sites: the CRREL Permafrost Tunnel (AT), the CRREL Farmers Loop Experimental Station (FL), and the Barrow Experimental Observatory (BEO). They were thawed at 2 °C for 96 days under controlled conditions. DNA was extracted, sequenced and assembled. Metagenome-assembled genomes (MAGs) were binned, quality-checked, and annotated. Predicted minimum doubling times were estimated, and relative abundance changes between day 0 and day 96 were quantified. Select the option that best predicts the outcome of the experiment.
A) A small percentage (~10-15%) of oligotrophic bins increased in relative abundance
B) About one-third (~30-40%) of oligotrophic bins showed no meaningful change in abundance
C) Oligotrophic bins increased only at one site
D) Nearly all (>85%) oligotrophic bins declined across sites, with no instances of increase detected
|
A) A small percentage (~10-15%) of oligotrophic bins increased in relative abundance
|
- Upon rapid thawing of permafrost, changes in biophysical conditions lead to a large shift in microbial communities.
|
[{"label":"RBK Item","value":"- Upon rapid thawing of permafrost, changes in biophysical conditions lead to a large shift in microbial communities. "},{"label":"Title","value":"Metagenomic analysis of a permafrost microbial community reveals a rapid response to thaw"},{"label":"URL","value":"https://www.nature.com/articles/nature10576"},{"label":"Date","value":"November 6, 2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Ecology
|
MCQ
|
Soil microbial legacies and cultivar compatibility modulate the responses of wheat to drought
|
https://www.biorxiv.org/content/10.1101/2025.09.29.679177v1
|
September 30, 2025
|
Researchers tested how long-term farming (organic vs conventional) and climate (ambient vs future) histories of soil microbiomes influence wheat performance. Soil samples were provided by a large multi-year field experiment in (51° 23’ 30N, 11° 52’ 49E, 116 m a.s.l.), a field containing 50 plots (16 m x 24 m each) arranged into 10 main plots, with 5 sub-plots consiting of different land-use regime (conventional farming, organic farming, intensively used grassland, mowing and grazing) per main plot. In conventional farming, the crop rotation consisted of winter rape, winter wheat, and winter barley, with the use of synthetic fertilisers and pesticides. Calcium ammonium nitrate was applied several times, at a total rate of 40–60 kg/ha to provide nitrogen, while potassium chloride was added at 110 kg/ha (to provide potassium), and superphosphate was added annually at a rate of 30 kg/ha (to provide phosphate). In organic systems, winter rape was rotated with legumes such as alfalfa and white clover. Organic fields were treated yearly with 120 kg/ha of potassium from patent kali (to provide postassium) and 45 kg/ha of phosphorus from rock phosphate (to provide phosphate). For future conditions, future climate, researchers placed half of the experimental blocks beneath a steel structure with a mobile roof, side panels, and an irrigation system. By adjusting the roof and panels, the night temperatures were raised and summer rainfall was reduced by around 20%, while boosting spring and autumn precipitation by 10% using irrigation. The other half of the blocks served as controls, housed under a similar structure but without any climate interventions, maintaining ambient conditions throughout the experiment. Researchers then collected soil from different treatment combinations: (1) conventional farming under ambient climate (CA), (2) conventional farming under future climate (CF), (3) organic farming under ambient climate (OA), and (4) organic farming under future climate (OF). Twenty soil subsamples (2 farming histories × 2 climate histories × 5 replicate plots) were collected from the topsoil (0–15 cm, ~0.5–0.6 kg per replicate), thoroughly homogenised within each treatment, and pooled to generate one representative composite sample per soil history type (CA, CF, OA, OF). All samples were stored at 4 °C before microbial extraction. For each extraction, 15 g of soil was mixed with 150 ml of Milli-Q water and shaken for 1.5 hours at 300 rpm. The liquid portion was then transferred to 50 ml centrifuge tubes and centrifuged at 22 °C, 1500 rpm for 5 minutes. The supernatant was collected and stored at 4 °C overnight. Next, 300 g of sterilised potting soil was placed into each of 100 pots (11 cm x 11 cm x 21.5 cm, tapering to 8.5 cm x 8.5 cm at the base). Each soil microbial extract (80 ml) was used to inoculate 40 pots, while 40 control pots received 80 ml of Milli-Q water. The pot experiment was conducted at (50.8083°N, 8.7694° E) with controlled light conditions. After two weeks of microbial incubation, half of the pots were sown with Nordkap and the remaining half with the SU Fiete cultivar. Six seeds were planted 5 cm deep per pot. The setup was placed under Neusius LED grow lights (12-hour photoperiod, day-night temperature) in a greenhouse. The pots were watered with 100 ml of tap water every two days for two weeks to ensure consistent initial growth conditions. Germination rate and time were measured over a period of 6 days. Germination rate was calculated as the percentage of seeds that successfully sprouted each day relative to the total number of seeds per pot.
|
- Germination rate (percentage of seeds that sprouted each day) for all groups (CA, CF, OA, OF, and control) over a period of 6 days.
- Germination time (mins) for all groups (CA, CF, OA, OF, and control) over a period of 6 days.
|
Researchers examined how long-term farming practices (organic vs. conventional) and climate histories (ambient vs. simulated future) affect wheat performance through influences on soil microbiomes. Soil samples came from a multi-year experiment with 50 field plots arranged into 10 main plots, each subdivided into different land-use regimes, including conventional and organic farming, intensively used grassland, mowing, and grazing. Conventional farming followed a crop rotation of winter rape, wheat, and barley, using synthetic fertilisers and pesticides, while organic farming incorporated legume rotations and organic fertilisation. To establish future climate, half the blocks were placed beneath structures with adjustable roofs and panels, raising night temperatures and decreasing summer rainfall by 20%, while increasing spring and autumn precipitation by 10% with added irrigation; control blocks were housed similarly but maintained ambient conditions without intervention. Soil from four main treatments was collected: conventional farming under ambient (CA) and future climate (CF), organic farming under ambient (OA) and future climate (OF). Within each treatment, multiple soil subsamples were homogenised and pooled, then stored cold before microbial extraction. Soil microbial extracts were obtained by mixing and incubating soil in water, followed by centrifugation and supernatant collection. Potting soil in 100 pots was inoculated with either microbial extracts or sterile water controls. After incubating the soil for two weeks, pots were sown with either Nordkap or SU Fiete wheat cultivars. The experiment took place under controlled greenhouse conditions with specific lighting and temperature regimes; all pots received consistent watering schedules. Researchers measured wheat germination rate and timing over six days, using the percentage of successfully sprouted seeds in each pot to assess the influence of soil farming and climate histories on plant performance. Which of the following outcomes is most likely?
A. Seeds inoculated with microbes originating from organic farming exhibited the highest germination rates on day 5.
B. Seeds inoculated with microbes originating from conventional farming exhibited the highest germination rates on day 5.
C. Seeds inoculated with microbes originating from conventional farming exhibited germination rates equivalent to those originating from organic farming on day 5.
D. Seeds inoculated with microbes originating from future climate exhibited germination rates equivalent to those originating from organic farming on day 5.
|
B. Seeds inoculated with microbes originating from conventional farming exhibited the highest germination rates on day 5.
|
- Plant genotype-specific exudation patterns chemoattract and selectively enrich microbial taxa that can either mitigate drought effects or strengthen plant stress responses.
- Repeated drought events have been shown to enrich soil and plant microbiomes for taxa with better survival traits.
- Stress‐experienced microbes carry genes for carbohydrate and amino acid metabolism and transport, which can act as inocula to improve plant performance under subsequent droughts.
- Organic farming often supports higher soil microbial diversity and more heterogeneous microbial communities.
- Intensified agricultural practices, such as conventional farming, simplify microbial networks, reduce the abundance of keystone taxa, and lower soil functionality.
|
[{"label":"RBK Item","value":"Plant genotype-specific exudation patterns chemoattract and selectively enrich microbial taxa that can either mitigate drought effects or strengthen plant stress responses"},{"label":"Title","value":"Rhizodeposition under drought and consequences for soil communities and ecosystem resilience"},{"label":"URL","value":"https://link.springer.com/article/10.1007/s11104-016-3090-z"},{"label":"Date","value":"November 10, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Repeated drought events have been shown to enrich soil and plant microbiomes for taxa with better survival traits"},{"label":"Title","value":"Water stress history and wheat genotype modulate rhizosphere microbial response to drought"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S0038071718302943"},{"label":"Date","value":"September 6, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Stress‐experienced microbes carry genes for carbohydrate and amino acid metabolism and transport, which can act as inocula to improve plant performance under subsequent droughts"},{"label":"Title","value":"Legacy effects of intensified drought on the soil microbiome in a mesic grassland"},{"label":"URL","value":"https://esajournals.onlinelibrary.wiley.com/doi/10.1002/ecs2.4545"},{"label":"Date","value":"June 12, 2023"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Organic farming often supports higher soil microbial diversity and more heterogeneous microbial communities"},{"label":"Title","value":"Soil Microbiome Is More Heterogeneous in Organic Than in Conventional Farming System"},{"label":"URL","value":"https://www.frontiersin.org/journals/microbiology/articles/10.3389/fmicb.2016.02064/full"},{"label":"Date","value":"January 04, 2017"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Intensified agricultural practices, such as conventional farming, simplify microbial networks, reduce the abundance of keystone taxa, and lower soil functionality"},{"label":"Title","value":"Agricultural intensification reduces microbial network complexity and the abundance of keystone taxa in roots"},{"label":"URL","value":"https://academic.oup.com/ismej/article/13/7/1722/7475282"},{"label":"Date","value":"March 08, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Ecology, Biogeography
|
MCQ
|
From lowlands to highlands: how elevation and habitat complexity drive anuran multidimensional diversity?
|
https://pmc.ncbi.nlm.nih.gov/articles/PMC12514998/
|
Oct 8, 2025
|
Researchers evaluated how elevation affects the optimal altitudes and altitudinal range size of anuran species (frogs and toads). The study was a test of the applicability of Rapoport's Altitudinal Rule, which states that, as a general principle, species living at higher elevations usually occupy wider altitudinal ranges.
Sampling was conducted in the Serra Bonita Private Reserve of Natural Heritage (RPPN) in the Atlantic Forest of Bahia, Brazil, along an elevational gradient from 200 to 950 m. A total of 24 linear transects (each 100 m long) were established in the forest interior, distributed across four altitudinal bands: 200–300 m (low), 400–500 m (mid), 600–700 m (mid-high), and 800–900 m (high), with six transects per band. Transects were surveyed monthly, each time for six consecutive nights, over one year (December 2009 to November 2010) via active visual and acoustic searches conducted by two researchers for 40 minutes per transect.
All anuran individuals encountered were identified to species level and the altitude at which they were observed was recorded. Altitude was measured precisely within every transect, not merely assigned to the broad band, using GPS coordinates cross-referenced with a topographic map. For each identified species, these data was used to calculate two derived measurements: (1) Altitudinal range-size distribution (in metres above sea level; maximum - minimum recorded altitude); and (2) Optimal altitude (the altitude of peak abundance), in meters above sea level; calculated via both Stevens's midpoint method (simple average of maximum and minimum altitudes) and the "Specimen" method of Almeida-Neto (an abundance-weighted mean).
|
- Precise altitude of each identified anuran specimen: metres above sea level, obtained by GPS coordinates cross-referenced with a topographic map; specimens distributed across 24 transects located in four elevation bands (low 200–300 m, mid 400–500 m, mid-high 600–700 m, high 800–900 m)
- Altitudinal range-size distribution per species (derived): metres, (max elevation − min elevation) recorded for the species
- Optimal altitude per species (derived): metres, calculated as a simple or abundance-weighted mean
|
A study was conducted to assess how geographic elevation affects anuran species occurences and altitudinal range size distributions. Researchers sampled anuran assemblages along an elevational gradient from 200 to 950 m in the Atlantic Forest, recording the altitude at which identified specimens were found. From this data, the researchers calculated the optimal altitude (where abundance is highest), and the altitudinal range-size distribution (the difference between the highest and lowest recorded altitudes), for all identified species. Based on their analysis, which outcome best describes the relationship between optimal altitude and range-size distribution?
A. Species with higher optimal altitudes have wider range-size distributions.
B. Species with higher optimal altitudes have narrower range-size distributions.
C. Range-size distribution is widest for species whose optimal altitude lies near the middle of the gradient (450–650 m) and narrows toward both extremes, indicating a unimodal relationship.
D. There is no consistent relationship between optimal altitude and range-size distribution.
|
B. Species with higher optimal altitudes have narrower range-size distributions.
|
- Altitudinal gradients are changes in environmental conditions like temperature and habitat with increasing elevation, which can create zones of different flora and fauna.
- Rapoport's Rule is a hypothesis suggesting that, as a general principle, species at higher altitudes (or latitudes) have broader geographical range sizes than those at lower altitudes.
- Some studies suggest that amphibians in particular may diverge widely from the predictions of Rapoport's Rule.
|
[{"label":"RBK Item","value":"Altitudinal gradients are changes in environmental conditions like temperature and habitat with increasing elevation, which can create zones of different flora and fauna."},{"label":"Title","value":"Habitat amount and ambient temperature dictate patterns of anuran diversity along a subtropical elevational gradient"},{"label":"URL","value":"https://onlinelibrary.wiley.com/doi/full/10.1111/ddi.13187"},{"label":"Date","value":"November 3, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Rapoport's Rule is a hypothesis suggesting that, as a general principle, species at higher altitudes (or latitudes) have broader geographical range sizes than those at lower altitudes."},{"label":"Title","value":"Altitudinal range-size distribution of breeding birds and environmental factors for the determination of species richness: An empirical test of altitudinal Rapoport’s rule and non-directional rescue effect on a local scale"},{"label":"URL","value":"https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0203511"},{"label":"Date","value":"January 25, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Some studies suggest that amphibians in particular may diverge widely from the predictions of Rapoport's Rule."},{"label":"Title","value":"Distribution of amphibians along an elevation gradient in the Eastern Himalaya, India"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S1439179120300773"},{"label":"Date","value":"September, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Gynecologic Cancer
|
MCQ
|
Efficacy and Safety of Avutometinib ± Defactinib in Recurrent Low-Grade Serous Ovarian Cancer: Primary Analysis of ENGOT-OV6o/GOG-3052/RAMP 201
|
https://ascopubs.org/doi/10.1200/JCO-25-00112
|
July 11, 2025
|
Patients aged ≥18 years with low-grade serous ovarian cancer (LGSOC) were assigned to different groups to evaluate the efficacy and safety of avutometinib alone or in combination with defactinib. Kirsten rat sarcoma virus homolog (KRAS) mutation status was previously validated in all patients before enrollment. Tumor response was assessed using archival tissue evaluated by RECIST v1.1, and KRAS mutation status was centrally confirmed using the tissue-based Tempus xT v4.0 LDT NGS-based assay. Additionally, patients were evaluated for response using computed tomography or magnetic resonance imaging. The trial consisted of Parts A, B, and C. In Part A, patients were randomly assigned (1:1) to one of the following treatments: avutometinib 4.0 mg orally twice per week, or avutometinib 3.2 mg orally twice per week plus defactinib 200 mg orally twice daily. Both treatment regimens were administered for three weeks followed by a one-week rest period. Randomization was stratified to achieve balanced numbers of patients with KRAS-mutant and KRAS wild-type tumors. Part B was an expansion phase using the same treatment regimens as in Part A (avutometinib alone or in combination with defactinib). Part C was an additional expansion phase evaluating only the combination of avutometinib plus defactinib, following the same dosing schedule as in Part A. Finally, the primary end point was evaluated as the objective response rate (ORR) according to RECIST v1.1 as assessed by blinded independent central review (BICR), and the secondary end points, progression-free survival (PFS), was estimated using the Kaplan-Meier method, and a twosided 95% CI median PFS was determined using the Brookmeyer-Crowley method.
|
- KRAS oncogene variant (mutant or wild-type) in patients with low-grade serous ovarian cancer (LGSOC).
- Objective response rate (ORR) following administration of avutometinib (3.2 mg twice weekly) and defactinib (200 mg twice daily) in patients with KRAS-mutant and KRAS wild-type tumors.
- Complete response following administration of avutometinib (3.2 mg twice weekly) and defactinib (200 mg twice daily) in patients with KRAS-mutant and KRAS wild-type tumors.
- Partial response following administration of avutometinib (3.2 mg twice weekly) and defactinib (200 mg twice daily) in patients with KRAS-mutant and KRAS wild-type tumors.
- Progression-free survival (PFS) following administration of avutometinib (3.2 mg twice weekly) and defactinib (200 mg twice daily) in patients with KRAS-mutant and KRAS wild-type tumors.
|
Patients with low-grade serous ovarian cancer (LGSOC) participated in a clinical trial to evaluate the efficacy of avutometinib alone or in combination with defactinib. KRAS (Kirsten rat sarcoma virus homolog) mutation status was assessed prior to enrollment. Archival tissue was used to evaluate tumor response according to RECIST v1.1 and to determine KRAS mutation status using the tissue-based Tempus xT v4.0 LDT NGS-based assay. Tumor response was also assessed using computed tomography (CT) or magnetic resonance imaging (MRI). The trial was conducted in three parts. In Part A, patients were randomly assigned (1:1) to one of these groups: 1) avutometinib 4.0 mg orally twice per week, or 2) avutometinib 3.2 mg orally twice per week plus defactinib 200 mg orally twice daily. Regimens were administered for three weeks with a one-week rest period. Both Part B and C were expansion phases. Part B used both treatments as in Part A, while Part C only followed the same combination treatment. The primary end point was evaluated as the objective response rate (ORR) according to RECIST v1.1 as assessed by blinded independent central review (BICR), and the secondary end points, progression-free survival (PFS), was estimated using the Kaplan-Meier method, and a twosided 95% CI median PFS was determined using the Brookmeyer-Crowley method. What is the expected outcome? Select all the correct options.
A) KRAS wild-types will have the lowest ORR in both avutometinib alone and in combination with defactinib groups compared to KRAS mutants.
B) KRAS wild-types will have the highest ORR only in avutometinib alone groups compared to KRAS mutants.
C) KRAS mutant will have the highest ORR in both avutometinib alone and in combination with defactinib groups compared to KRAS wild-types.
D) KRAS mutant will have the lowest ORR only in avutometinib combination with defactinib groups compared to KRAS wild-types.
|
A) KRAS wild-types will have the lowest ORR in both avutometinib alone and in combination with defactinib groups compared to KRAS mutants.
C) KRAS mutant will have the highest ORR in both avutometinib alone and in combination with defactinib groups compared to KRAS wild-types.
|
- Low-grade serous ovarian cancer (LGSOC) is often driven by mitogen-activated protein kinase (MAPK) mutations, the most common of which are Kirsten rat sarcoma virus homolog (KRAS) mutations.
- Avutometinib is an oral rapidly accelerated fibrosarcoma (RAF)/MEK clamp that inhibits MEK (i.e., mitogen-activated extracellular signal-regulated kinase) while also blocking the compensatory reactivation of MEK.
- Inhibition of the MAPK pathway by avutometinib leads to a compensatory activation of focal adhesion kinase.
- Defactinib is a selective FAK inhibitor.
|
[{"label":"RBK Item","value":"- Low-grade serous ovarian cancer is often driven by mitogen-activated protein kinase (MAPK) mutations, the most common of which are Kirsten rat sarcoma virus homolog (KRAS) mutations."},{"label":"Title","value":"Genomic profiling in low grade serous ovarian cancer: Identification of novel markers for disease diagnosis and therapy"},{"label":"URL","value":"https://pubmed.ncbi nlm.nih.gov/36229265/"},{"label":"Date","value":"Nov, 2022"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"- Avutometinib is an oral rapidly accelerated fibrosarcoma clamp that inhibits MEK while also blocking the compensatory reactivation of MEK."},{"label":"Title","value":"Allosteric MEK inhibitors acts on BRAF/MEK complexes to block MEK activation"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC8433572/"},{"label":"Date","value":"September 1, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Inhibition of the MAPK pathway by avutometinib leads to a compensatory activation of focal adhesion kinase."},{"label":"Title","value":"Targeting FAK in anticancer combination therapies"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC8276817/"},{"label":"Date","value":"March 17, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Defactinib is a selective FAK inhibitor."},{"label":"Title","value":"Phase I study of the combination of the dual RAF/MEK inhibitor VS-6766 and the FAK inhibitor defactinib: Results of efficacy in low grade serous ovarian cancer"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/pii/S0923753421033974"},{"label":"Date","value":"September, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Infectious Disease
|
Free-Format Question
|
Antibacterial and wound healing effects of PEG-coated ciprofloxacin-loaded ZIF-8 nanozymes against ciprofloxacin-resistant Pseudomonas aeruginosa taken from burn wounds
|
https://www.frontiersin.org/journals/pharmacology/articles/10.3389/fphar.2025.1556335/full
|
September 10, 2025
|
Clinical Pseudomonas aeruginosa isolates were collected from burn patients. Sixty ciprofloxacin-resistant isolates were selected based on MIC (CLSI 2023); species identity was confirmed by oprL PCR. ZIF-8 was synthesized from zinc nitrate hexahydrate and 2-methylimidazole, then loaded with ciprofloxacin (1 mg/mL, 6 h, stirring) to obtain ZIF-8-CIP. A PEG coating (PEG:ZIF-8-CIP = 1:1 w/w, 12 h) yielded PEG-ZIF-8-CIP. Formulations (ZIF-8, ZIF-8-CIP, PEG-ZIF-8-CIP, and free CIP) were characterized for morphology/size by FESEM, hydrodynamic size by DLS, zeta potential, encapsulation (entrapment) efficiency, and stability. In vitro antibacterial activity was assessed by disk diffusion (10–50 mg/mL) and MBEC on biofilms grown 1, 3, and 5 days; biofilm removal was quantified after 24 h treatment. Cytotoxicity was measured in human foreskin fibroblasts (HFF) using the MTT assay at 24, 48, 72 h over 10–100,000 ng/mL. For in vivo evaluation, female BALB/c mice (6–9 weeks) received a 5 mm burn wound, were infected with P. aeruginosa, and treated topically once daily (20 µL/wound) for 14 days in six groups (negative control, infected control, ZIF-8, ZIF-8-CIP, PEG-ZIF-8-CIP, free CIP). CFU from wounds were sampled on days 1, 3, 7, and 10; wound diameter/% contraction on days 1, 3, 7, and 14; and histopathology on day 14.
|
- Disk diffusion (in vitro antibacterial activity): Inhibition zone diameter (mm) on Mueller–Hinton agar after 24 h at 37 °C (tested concentrations 10–50 mg/mL for each formulation).
- MBEC (biofilm eradication): Minimum concentration (mg/mL) that eradicates 1-, 3-, and 5-day biofilms after treatment, quantified by TTC assay.
- Biofilm removal efficiency (time-dependent): Percent reduction in OD 470 nm (TTC) measured over 1, 3, and 5 days of treatment on biofilms aged 1, 3, and 5 days.
-Cytotoxicity (HFF cells, MTT): Cell viability at 24, 48, and 72 h across 10–100,000 ng/mL; absorbance read at 570 nm.
- In vivo CFU (wound bacterial burden): Bacterial counts from wound swabs on days 1, 3, 7, and 10.
- Wound healing (% contraction): Calculated from wound area (A) using the paper’s formula, recorded on days 1, 3, 7, and 14.
- Histopathology (H&E, day 14): Evaluation of neutrophil infiltration, fibroblast activity, epithelial regeneration, and neovascularization.
|
Researchers tested the cytotoxicity of PEG-coated ciprofloxacin-loaded ZIF-8 nanozymes against ciprofloxacin ZIF-8 nanozymes in human foreskin fibroblasts (HFF cells) using the MTT assay. They were tested at concentrations of 10 to 100,000 ng/mL and measured at 24, 48, and 72 hours. How would you expect the cytotoxicity profiles of the two treatments to compare over time?
|
PEG-ZIF-8-CIP was consistently less cytotoxic than ZIF-8-CIP in human foreskin fibroblasts, with the most significant safety advantage observed at 24–48 hours. However, by 72 hours, both treatments reached similarly high cytotoxicity levels, with no significant difference between them.
|
- ZIF-8 (zeolite imidazolate framework-8) is a zinc-based metal organic framework used for drug delivery.
- ZIF-8-based formulations can exhibit antibacterial activity; in this work antibacterial performance is empirically measured (disk diffusion, MBEC), without assigning a specific mechanistic pathway
- Pegylation involves coating nanoparticles with polyethylene glycol to improve stability and reduce toxicity.
|
[{"label":"RBK Item","value":"ZIF-8 (zeolite imidazolate framework-8) is a zinc-based metal organic framework used for drug delivery."},{"label":"Title","value":"The resistance mechanisms of bacteria against ciprofloxacin and new approaches for enhancing the efficacy of this antibiotic."},{"label":"URL","value":"https://www.frontiersin.org/journals/public-health/articles/10.3389/fpubh.2022.1025633/full"},{"label":"Date","value":"December 20, 2022"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"ZIF-8-based formulations can exhibit antibacterial activity; in this work antibacterial performance is empirically measured (disk diffusion, MBEC), without assigning a specific mechanistic pathway"},{"label":"Title","value":"ZnO@ZIF-8 Nanoparticles as Nanocarrier of Ciprofloxacin for Antimicrobial Activity"},{"label":"URL","value":"https://www.mdpi.com/1999-4923/15/1/259"},{"label":"Date","value":"January 11, 2023"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Pegylation involves coating nanoparticles with polyethylene glycol to improve stability and reduce toxicity. "},{"label":"Title","value":"Antibacterial countermeasures via metal–organic framework-supported sustained therapeutic release."},{"label":"URL","value":"https://pubs.acs.org/doi/10.1021/acsami.8b21698"},{"label":"Date","value":"January 25, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Neuroscience
|
MCQ
|
Shedding light on left hippocampal mGlu5 in Alzheimer's disease
|
https://www.biorxiv.org/content/10.1101/2025.10.03.680254v1
|
October 3, 2025
|
To investigate the contribution of hippocampal metabotropic glutamate receptor 5 (mGlu5) to memory deficits in J20 Alzheimer’s disease (AD) mice, researchers assessed mGlu5 expression in the hippocampus using western blotting after performing a spatial novelty preference tasks. Hemizygous J20 mice were bred on a C57BL/6J background (>10 backcrosses). Mice were housed in a standard animal facility under a 12 h light/dark cycle at 21 ± 2 °C with ad libitum access to food and water. To assess spatial short-term memory in mice, wild-type or J20 mice were placed in a maze test adapted for performing spatial novelty preference tasks. Initially, mice could explore all but one arm of the maze for 10 minutes. After a 5-minute delay with the novel arm blocked, the barrier was removed, and mice were given 3 minutes to explore the entire maze. The time spent in each arm was recorded, beginning when the mouse exited the start arm. To reduce olfactory cues, the novel arm was wiped with a tissue previously rubbed on the other arms. The main measure was the percentage of time spent in the novel arm, serving as an indicator of spatial memory. Immediately after the spatial novelty preference task, mice were killed by decapitation, hippocampi were dissected, and the tissues were homogenised by sonication in 3% SDS (having protease and phosphatase inhibitors), followed by determining protein concentration using the BCA assay (ThermoFisher Scientific). For western blot analysis, 30 μg of protein were loaded per lane, separated by 12% SDS-PAGE, and transferred onto nitrocellulose membranes. After overnight incubation with primary antibodies at 4 °C, membranes were washed and incubated with HRP-conjugated secondary antibodies for 2 hours, followed by signal reveal using ECL (Luminata Crescendo, Millipore) and resulting images were quantified with ImageJ software. β-Tubulin was used as a loading control for mGlu5.
|
- Total time (sec) spent by wild-type and J20 mice during the spatial novelty preference task.
- Percentage of time (%) spent by wild-type and J20 mice in the novel arm, serving as an indicator of spatial memory.
- Protein concentration (ug) from homogenised brain hippocampus of wild-type and J20 mice immediately after the spatial novelty preference task.
- Metabotropic glutamate receptor 5 (mGlu5) expression (quantification of band signal) in both hemispheres of the hippocampus, for both wild-type and J20 mice, immediately after the spatial novelty preference task.
|
Researchers investigated how hippocampal mGlu5 receptor expression relates to memory deficits in J20 Alzheimer’s disease mice. J20 and wild-type mice (bred on a C57BL/6J background) were maintained under standard conditions and given ad libitum food and water. Mice underwent a spatial novelty preference maze test: they could explore all but one arm for 10 minutes, waited 5 minutes with the novel arm blocked, then explored the entire maze for 3 minutes. Immediately after behavioural testing, mice were sacrificed, and their hippocampi dissected and homogenised. Protein was extracted and quantified, then samples were run on SDS-PAGE gels, transferred to membranes, and incubated with specific antibodies for mGlu5 (using β-tubulin as a loading control). Signals were detected by ECL and quantified with ImageJ. If we assessed maze performance (spatial memory) with hippocampal mGlu5 protein levels in J20 and control mice, which of the following outcomes is most likely?
A. Researchers found that in J20 mice, mGlu5 expression is selectively increased in the left hippocampus compared to wild-type controls.
B. Researchers found that in J20 mice, mGlu5 expression is selectively reduced in the left hippocampus compared to wild-type controls.
C. Researchers found that in J20 mice, mGlu5 expression in the left hippocampus was equivalent to that in the left hippocampus of wild-type controls.
D. Researchers found that in J20 mice, mGlu5 expression is selectively increased in the right hippocampus compared to wild-type controls.
|
B. Researchers found that in J20 mice, mGlu5 expression is selectively reduced in the left hippocampus compared to wild-type controls.
|
- Alzheimer’s disease is the most prevalent age-related neurodegenerative disorder, characterized by progressive memory loss, cognitive decline, and behavioral changes.
- The metabotropic glutamate receptor 5 (mGlu5) is critically involved in the regulation of both long-term potentiation and long-term depression in the hippocampus, and thus in memory-related processes.
- Hippocampal asymmetry, as left-sided atrophy, has been correlated with memory loss in alzheimer’s disease.
|
[{"label":"RBK Item","value":"- Alzheimer’s disease is the most prevalent age-related neurodegenerative disorder, characterized by progressive memory loss, cognitive decline, and behavioral changes."},{"label":"Title","value":"The neuropathological diagnosis of Alzheimer’s disease"},{"label":"URL","value":"https://doi.org/10.1186/s13024-019-0333-5"},{"label":"Date","value":"August 2, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"The metabotropic glutamate receptor 5 (mGlu5) is critically involved in the regulation of both long-term potentiation and long-term depression in the hippocampus, and thus in memory-related processes"},{"label":"Title","value":"Metabotropic glutamate receptor, mGlu5, regulates hippocampal synaptic plasticity and is required for tetanisation-triggered changes in theta and gamma oscillations"},{"label":"URL","value":"https://doi.org/10.1016/j.neuropharm.2016.06.004"},{"label":"Date","value":"July 6, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Hippocampal asymmetry, as left-sided atrophy, has been correlated with memory loss in alzheimer’s disease"},{"label":"Title","value":"Presymptomatic hippocampal atrophy in Alzheimer's disease: A longitudinal MRI study"},{"label":"URL","value":"https://doi.org/10.1093/brain/119.6.2001"},{"label":"Date","value":"December 1, 1996"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Molecular Biology / Human Genetics
|
Numerical Values
|
Sex differences in alpha galactosidase protein processing and its impact on disease severity in Fabry disease
|
https://www.biorxiv.org/content/10.1101/2025.09.16.676554v1
|
September 17, 2025
|
Researchers measured total α-galactosidase A (GLA) enzymatic activity in cultured peripheral blood mononuclear cells (PBMCs) from Fabry disease (FD) patients and healthy controls. PBMCs were isolated from 10 mL of blood by gradient separation. PBMCs were grown in Roswell Park Memorial Institute (RPMI) 1640 medium with 10% heat-inactivated FBS (fetal bovine serum) and cultured for a total of 6 days with 2 media renewals at 5% CO₂ and 37 °C. After culture, PBMCs were harvested, pelleted by centrifugation at 1500 rpm for 10 minutes at 4 °C. Whole cell lysates were prepared using a mammalian cell lysis solution supplemented with protease inhibitors. Total GLA activity was measured fluorometrically using 2 µg of total protein per reaction with 4-methylumbelliferyl-α-galactopyranoside as a substrate in 0.15 M McIlvaine’s buffer (pH 4.7), with N-acetyl-D-galactosamine as an inhibitor of α-D-galactosidase B, and reactions were terminated with 1.0 M glycine (pH 10.5).
|
- Total α-galactosidase A (GLA) activity (nmol/hr/mg) across Fabry disease patients (female vs. male) and healthy controls under fluorometric assay of cultured PBMC lysates using fluorometry.
|
Researchers measured total α-galactosidase A (GLA) enzymatic activity in cultured peripheral blood mononuclear cells (PBMCs) from Fabry disease (FD) patients and healthy controls. PBMCs were isolated from 10 mL of blood by gradient separation. PBMCs were grown in Roswell Park Memorial Institute (RPMI) 1640 medium with 10% heat-inactivated FBS (fetal bovine serum) and cultured for a total of 6 days with 2 media renewals at 5% CO₂ and 37 °C. After culture, PBMCs were harvested, pelleted by centrifugation at 1500 rpm for 10 minutes at 4 °C. Whole cell lysates were prepared using a mammalian cell lysis solution supplemented with protease inhibitors. Total GLA activity was measured fluorometrically using 2 µg of total protein per reaction with 4-methylumbelliferyl-α-galactopyranoside as a substrate in 0.15 M McIlvaine’s buffer (pH 4.7), with N-acetyl-D-galactosamine as an inhibitor of α-D-galactosidase B, and reactions were terminated with 1.0 M glycine (pH 10.5).
Predict the expected median total GLA activity (nmol/hr/mg) in female Fabry patients.
|
17.3 - 21.1 nmol/hr/mg, derived from median total GLA activity measurements in female Fabry disease patients = 19.2 nmol/hr/mg. Note: no SD/SE/CI reported; ±10 % fallback rule applied.
|
• The GLA protein is synthesized as a precursor in the endoplasmic reticulum (ER) and undergoes glycosylation and processing to become a mature, active enzyme in the lysosome.
• Fabry disease is characterized by a deficiency in α-galactosidase A (GLA) enzyme activity due to GLA mutations that result in a range of phenotypes.
|
[{"label":"RBK Item","value":"The GLA protein is synthesized as a precursor in the endoplasmic reticulum (ER) and undergoes glycosylation and processing to become a mature, active enzyme in the lysosome."},{"label":"Title","value":"Synthesis and processing of alpha-galactosidase A in human fibroblasts. Evidence for different mutations in Fabry disease."},{"label":"URL","value":"https://www.sciencedirect.com/science/article/pii/S0021925818616187"},{"label":"Date","value":"February 15, 1987"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Fabry disease is characterized by a deficiency in α-galactosidase A (GLA) enzyme activity due to GLA mutations that result in a range of phenotypes."},{"label":"Title","value":"A systematic review on screening for Fabry disease: prevalence of individuals with genetic variants of unknown significance"},{"label":"URL","value":"https://jmg.bmj.com/content/51/1/1.long"},{"label":"Date","value":"August 6, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Neuroscience / Neuropathology
|
Free-Format Question
|
The Impact of Formic Acid Treatment on Brain Tissues for Prion Inactivation
|
https://www.biorxiv.org/content/10.1101/2025.09.16.676643v1
|
September 17, 2025
|
Researchers investigated the morphological effects of formic acid treatment on mouse brain tissues used for prion inactivation. Mouse brain hemispheres from three different models (wild-type C57Bl/6N, 5xFAD Alzheimer's model, and Cer-PrP-225SS chronic wasting disease model) were treated with 95% formic acid for 1 hour with gentle agitation in a biosafety cabinet, then returned to 10% formalin for 48 hours. Control hemispheres were placed in fresh 10% formalin for 48 hours. All tissues underwent standard histological processing including dehydration, paraffin embedding, and sectioning at 5 μm. Sagittal sections were stained with hematoxylin and eosin (H&E) or rapid differential stain. Cortical width and hippocampal area were measured using Fiji ImageJ on sections approximately 1800 μm from the medial side of the hemisphere.
|
• Cortical width measurements (in millimeters) between formic acid-treated and control tissues across different brain regions
• Hippocampal surface area measurements (in square millimeters) between formic acid-treated and control tissues across different brain regions
• Tissue structural integrity and morphological preservation between formic acid-treated and control tissues across different brain regions
|
After formic acid treatment (95% for 1 hour) and H&E staining with microscopic analysis, what would you expect to happen to the cortical width in wild-type mouse brain tissues compared to untreated control samples?
|
Formic acid treatment significantly reduces cortical width in wild-type mouse brain tissues by 24% compared to untreated controls.
|
• Prions are infectious, misfolded proteins that cause fatal neurodegenerative diseases and are highly resistant to standard inactivation methods
• Formic acid is commonly used for prion decontamination but its effects on tissue morphology are not well-documented
• Histological assessment using H&E staining requires preserved tissue morphology for accurate structural analysis
• Different brain regions may have varying susceptibility to chemical treatments due to structural and compositional differences
|
[{"label":"RBK Item","value":"Prions are infectious, misfolded proteins that cause fatal neurodegenerative diseases and are highly resistant to standard inactivation methods"},{"label":"Title","value":"Prions"},{"label":"URL","value":"https://doi.org/10.1073/pnas.95.23.13363"},{"label":"Date","value":"November 10, 1998"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Formic acid is commonly used for prion decontamination but its effects on tissue morphology are not well-documented"},{"label":"Title","value":"The effect of formic acid on BSE and scrapie infectivity in fixed and unfixed brain-tissue"},{"label":"URL","value":"https://doi.org/10.1016/s0378-1135(97)00165-x"},{"label":"Date","value":"July 25, 1997"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Histological assessment requires preserved tissue morphology for accurate structural analysis"},{"label":"Title","value":"Rapid staining techniques in cytopathology: a review and comparison of modified protocols for hematoxylin and eosin, Papanicolaou and Romanowsky stains"},{"label":"URL","value":"https://pubmed.ncbi.nlm.nih.gov/12075519/"},{"label":"Date","value":"September 1, 1999"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled "},{"label":"RBK Item","value":"Different brain regions may have varying susceptibility to chemical treatments due to structural and compositional differences"},{"label":"Title","value":"Morphological maturation of the mouse brain: An in vivo MRI and histology investigation"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/pii/S1053811915009039?via%3Dihub"},{"label":"Date","value":"January 15, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Botany / Ecology
|
Numerical Values
|
Pollination and abiotic stress alter the distribution of variation in floral longevity and opportunities for adaptation
|
https://www.biorxiv.org/content/10.1101/2025.09.07.674481v1.full
|
September 12, 2025
|
Researchers experimentally manipulated pollination rates in a wild population of Sabatia angularis (Gentianaceae) to assess how pollination influences floral longevity. The study was conducted in a large population (>1,000 plants) of S. angularis. Prior to flowering, plants were randomly assigned to one of four pollination treatments (pollinated, control, emasculated, and bagged) to create a gradient of pollination rates within the same population. Pollinated plants received supplemental outcross pollen on all flowers, using pollen collected from other plants in the population. Control plants were not manipulated and experienced ambient pollination conditions. Emasculated plants had all anthers removed to reduce visitation rates. Bagged plants were covered with cages made of bridal veil to exclude pollinators. In total, the study included 437 plants: 123 pollinated, 126 control, 119 emasculated, and 69 bagged. Plants were monitored three times per week to record the date the first flower opened. Once a plant began flowering, two flower buds were tagged to measure floral longevity. Tagging was restricted to flowers at secondary positions to control for potential position effects; however, tertiary flowers were used when all secondary flowers had already opened. Tagged flowers were checked daily, and the dates of flower opening and wilting were recorded. A flower was considered wilted when all five petals showed curling. Longevity was calculated as the number of days from opening to wilting. The following statistical procedures were used to evaluate differences among pollination treatments: 1) a general linear mixed model (proc mixed) to test the effect of treatment on floral lifespan; 2) a likelihood ratio test to assess heterogeneity of variance among treatments in the mixed model; and 3) a Kolmogorov-Smirnov (K-S) test on mean-centered data in R (within RStudio), with Bonferroni correction applied to adjust p-values.
|
- Floral longevity calculated as the number of days from petal opening to wilting (curling of all five petals) in tagged buds of S. angularis plants assigned to different pollination treatments (pollinated, control, emasculated, and bagged).
- Day of flower opening in tagged buds of S. angularis plants under different pollination treatments (pollinated, control, emasculated, and bagged).
- Day of flower wilting in tagged buds of S. angularis plants under different pollination treatments (pollinated, control, emasculated, and bagged).
- Flower lifespan in tagged buds of S. angularis plants under different pollination treatments (pollinated, control, emasculated, and bagged).
|
Researchers experimentally manipulated pollination rates in a wild population of Sabatia angularis (Gentianaceae) to assess how this influences pollen gain curves, the phenotypic distribution of floral longevity, trait correlations, and potential costs. This study was conducted in a large (>1,000 plants) population of S. angularis. Prior to flowering, scientists randomly assigned plants to one of four pollination treatments: a) pollinated, which received supplemental outcross pollen on all flowers (N = 123) b) control, not manipulated and experienced ambient pollination conditions (N = 126); c) enmasculated, anthers were removed to reduce visitation rates (N = 119); and d) bagged, covered with cages made of bridal veil (N = 69). Plants were monitored three times per week to record the date the first flower opened. Once a plant began to flower, they tagged two flower buds for measuring floral longevity. They restricted tagging to flowers at secondary positions to control for potential position effects, though in some cases, tertiary positions were used if all secondary flowers had already opened. Tagged flowers were checked daily to record the date each opened and the date each wilted. They considered a flower to be wilted when all five petals had evidence of curling. Three statistical procedures were used to evaluate differences among pollination treatments: 1) a general linear mixed model (proc mixed) to test the effect of treatment on floral lifespan; 2) a likelihood ratio test to assess heterogeneity of variance among treatments in the mixed model; and 3) a Kolmogorov-Smirnov (K-S) test on mean-centered data in R, with Bonferroni correction applied to adjust p-values. What is the expected floral lifespan for the bagged plants?
|
7 days (+/- 2.2 SD)
|
- Empirical studies have shown an inverse correlation between floral longevity and pollinator visitation rates across species or populations.
- In many species, pollination shortens floral lifespan by triggering petal wilting.
- Longer-lived flowers incur costs via resource demands of flower maintenance that are expected to result in a trade-off between flower number and longevity.
- Floral longevity is the length of time a flower remains open and functional. It offers an opportunity to explore how ecological conditions influence selection and trait expression.
|
[{"label":"RBK Item","value":"Empirical studies have shown an inverse correlation between floral longevity and pollinator visitation rates across species or populations"},{"label":"Title","value":"Functional role of long-lived flowers in preventing pollen limitation in a high elevation outcrossing species"},{"label":"URL","value":"https://academic.oup.com/aobpla/article/9/6/plx050/4560779"},{"label":"Date","value":"October 21, 2017"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"In many species, pollination shortens floral lifespan by triggering petal wilting"},{"label":"Title","value":"Pollination-induced flower senescence: a review"},{"label":"URL","value":"https://link.springer.com/article/10.1007/BF00024427"},{"label":"Date","value":"January, 1992"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Longer-lived flowers incur costs via resource demands of flower maintenance that are expected to result in a trade-off between flower number and longevity"},{"label":"Title","value":"Towards the flower economics spectrum"},{"label":"URL","value":"https://nph.onlinelibrary.wiley.com/doi/10.1111/nph.16823"},{"label":"Date","value":"July 22, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Floral longevity is the length of time a flower remains open and functional. It offers an opportunity to explore how ecological conditions influence selection and trait expression."},{"label":"Title","value":"Longevity of Individual Flowers"},{"label":"URL","value":"https://www.annualreviews.org/content/journals/10.1146/annurev.es.16.110185.000311"},{"label":"Date","value":"November 01, 1985"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Molecular Biology/Geroscience
|
Free-Format Question
|
Knockdown of the fly spliceosome component Rbp1(orthologue of SRSF1) extends lifespan
|
https://www.biorxiv.org/content/10.1101/2025.09.18.677196v1
|
September 21, 2025
|
Researchers compared whether the same spliceosome or spliceosome-regulatory genes were differentially expressed in both the mTOR suppression and dietary restriction (DR) datasets, and whether they were modulated in a concordant direction. To test whether spliceosome components associated with both pro-longevity treatments could modulate lifespan, the top five significant genes from the DR dataset that were also differentially expressed in the mTOR dataset were selected for knockdown: barc, Sf3b1, CG4896, CG7974, Prp5, and Rbp1. Gene knockdown was performed via RNAi targeting each spliceosome gene, driven by the daughterless-GeneSwitch (daGS) system in Drosophila melanogaster females, generating the following fly lines: UAS-barc RNAi, UAS-CG4896 RNAi, UAS-CG7974 RNAi, UAS-Rbp1 RNAi, and UAS-Prp5 RNAi. The daughterless-GeneSwitch (daGS) line was used as a control. All flies were maintained at 25 °C in fly culture bottles containing 6% cornmeal, 13% table sugar, 1% agar, 0.225% nipagin, 8% yeast, and 0.4% propanoic acid (all w/v). To activate daGS, 200 μM RU486 was dissolved in ethanol and added to the food; control treatments received the same amount of ethanol without RU486. For survival experiments, flies were allowed to mate for two days after eclosion, then sorted under light CO₂ anesthesia. Females were placed in cages for lifespan assessment, with no more than 100 flies per cage. The number of deaths was recorded every other day, and dead flies were removed. Food vials were replaced at the same interval, continuing until no flies remained.
|
- Survival across different female fly lines (daughterless-GeneSwitch driver line, UAS-barc RNAi, UAS-CG4896 RNAi, UAS-CG7974 RNAi, UAS-Rbp1 RNAi, UAS-Prp5 RNAi, UAS-Sf3b1 RNAi) with RU486 (200 µM) versus ethanol controls in Drosophila melanogaster females.
|
Researchers identified spliceosome genes upregulated under both mTOR suppression and dietary restriction (DR) and tested whether knocking them down affected lifespan in Drosophila melanogaster. Using the daGS driver with RU486 to induce RNAi in adults on a rich diet, they targeted barc, Sf3b1, CG4896, CG7974, Prp5, and Rbp1. Female flies lines (daughterless-GeneSwitch(daGS), UAS-barc RNAi, UAS-CG4896 RNAi, UAS-CG7974 RNAi, UAS-Rbp1 RNAi, UAS-Prp5 RNAi) generated were maintained at 25 °C in fly culture bottles (6% cornmeal, 13% table sugar, 1% agar, 0.225% nipagin, 8% yeast, and 0.4% propanoic acid (all w/v)). 200 μM RU486 dissolved in ethanol was administrated to induce the activation of the daGS driver; control treatments received the same amount of ethanol without RU48. Flies were mated for 2 days, sorted, and monitored for survival with deaths recorded every other day until all had died. What would you expect to happen to lifespan in each gene knockdown scenario?
|
Knockdown of CG4896 and CG7974 did not affect the lifespan, knockdown of barc, Prp5, and Sf3b1 significantly reduced lifespan, whilst Rbp1 knockdown significantly extended lifespan.
|
- The two best studied treatments which positively impact health and lifespan across species are restriction (DR) and suppression of mammalian target of rapamycin (mTOR)
- A shared feature of both mTOR suppression and DR is that they both exert widespread effects on alternative splicing irrespective of species
- A genome wide dysregulation of alternative splicing is observed during ageing
- The manipulation of a single individual spliceosome component can modulate lifespan (overexpression of one spliceosome component gene in C. elegans, sfa-1, extends lifespan)
|
[{"label":"RBK Item","value":"The two best studied treatments which positively impact health and lifespan across species are restriction (DR) and suppression of mammalian target of rapamycin (mTOR) "},{"label":"Title","value":"Comparative idiosyncrasies in life extension by reduced mTOR signalling and its distinctiveness from dietary restriction"},{"label":"URL","value":"https://onlinelibrary.wiley.com/doi/10.1111/acel.12489"},{"label":"Date","value":"May 03, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"A shared feature of both mTOR suppression and DR is that they both exert widespread effects on alternative splicing irrespective of species"},{"label":"Title","value":"Splicing factor 1 modulates dietary restriction and TORC1 pathway longevity in C. elegans"},{"label":"URL","value":"https://www.nature.com/articles/nature20789"},{"label":"Date","value":"December 05, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"A genome wide dysregulation of alternative splicing is observed during ageing"},{"label":"Title","value":"Changes in splicing factor expression are associated with advancing age in man"},{"label":"URL","value":"https://linkinghub.elsevier.com/retrieve/pii/S0047637413000651"},{"label":"Date","value":"June 06, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"The manipulation of a single individual spliceosome component can modulate lifespan (overexpression of one spliceosome component gene in C. elegans, sfa-1, extends lifespan)"},{"label":"Title","value":"Splicing factor 1 modulates dietary restriction and TORC1 pathway longevity in C. elegans"},{"label":"URL","value":"https://www.nature.com/articles/nature20789"},{"label":"Date","value":"December 05, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Microbiology
|
Numerical Values
|
Bacillus cereus-derived α-amylase disrupts biofilm formation and quorum sensing in multidrug-resistant Klebsiella pneumoniae
|
https://bmcmicrobiol.biomedcentral.com/articles/10.1186/s12866-025-04301-z
|
Jul 29, 2025
|
Clinical respiratory Klebsiella pneumoniae isolates (n = 25) were evaluated alongside the biofilm-positive control strain ATCC 700603. A purified soil-derived Bacillus cereus α-amylase was tested against a commercial Bacillus amyloliquefaciens α-amylase comparator. Antibacterial activity was determined by MIC (lowest enzyme concentration inhibiting visible growth) and MBC (no colonies after subculture of ≥MIC wells). Biofilm formation was screened by the tube method and Congo red agar. For anti-biofilm testing, three microtiter assays were performed: (i) biofilm inhibition at ½ MIC for 24 h quantified by crystal violet; (ii) MBIC with enzyme 16–512 μg/mL present during biofilm formation for 48 h; and (iii) MBEC on mature 5-day biofilms (medium refreshed every 48 h) followed by 48 h enzyme exposure at 16–512 μg/mL. MBIC and MBEC were defined as the lowest concentrations achieving ≥80% inhibition (MBIC) or ≥99% eradication with negative subculture (MBEC). Biofilm structure/viability was visualized by confocal laser scanning microscopy on chamber slides using AO/PI live–dead staining (enzyme at ½ MIC). Gene expression of fimH and mrkD (normalized to rpoB) was assessed by qRT-PCR after enzyme treatment.
|
- MIC (growth inhibition): lowest enzyme concentration with no visible growth.
- MBC (bactericidal endpoint): no colonies after subculture from wells at or above the MIC.
- Biofilm screening: tube method (crystal violet) and Congo red agar (morphology-based positivity).
- Biofilm inhibition (24 h CV assay): enzyme at ½ MIC during biofilm formation; OD595 used to calculate % inhibition versus untreated control.
- MBIC (formation-phase inhibition): enzyme 16–512 μg/mL present 48 h during biofilm formation; read at OD610; MBIC = lowest concentration with ≥80% inhibition.
- MBEC (eradication of mature biofilms): 5-day pre-formed biofilms (medium refreshed every 48 h), then 48 h enzyme treatment at 16–512 μg/mL; read at OD610 and confirm ≥99% eradication by negative subculture.
- CLSM live/dead imaging: AO/PI staining to assess biofilm thickness and viability after treatment at ½ MIC.
- qRT-PCR (quorum-/adhesion-related genes): expression of fimH and mrkD, normalized to rpoB.
|
In a microtiter plate assay, mature (5-day) Klebsiella pneumoniae biofilms were treated for 48 h at 37 °C with a purified Bacillus cereus-derived α-amylase at concentrations of 16–512 µg/mL in a 96-well plate. Using the MBEC definition (≥99% eradication confirmed by negative subculture), what enzyme concentration (µg/mL) would be expected to achieve the MBEC against the biofilm-forming isolates?
|
115.2–140.8 µg/mL
|
- Fimbriae, encoded by the fim and mrk gene clusters, are heavily involved in biofilm development and pathogenesis.
- α-amylase is an enzyme that degrades extracellular polysaccharides.
|
[{"label":"RBK Item","value":"Fimbriae, encoded by the fim and mrk gene clusters, are heavily involved in biofilm development and pathogenesis."},{"label":"Title","value":"The Biological Effect of Rosmarinus officinelis L. Essential Oil on Biofilm Formation and Some Fimbrial Genes (fimH-1 and mrkD) of Klebseilla pneumoniae\nAuthors"},{"label":"URL","value":"https://www.ijs.uobaghdad.edu.iq/index.php/eijs/article/view/9621"},{"label":"Date","value":"Mar 14, 2023"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"α-amylase is an enzyme that degrades extracellular polysaccharides. "},{"label":"Title","value":"Overview of Fungal Lipase: A Review"},{"label":"URL","value":"https://link.springer.com/article/10.1007/s12010-011-9444-3"},{"label":"Date","value":"Nov 10, 2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Plant genetics
|
Numerical Values
|
A deep-time landscape of plant cis-regulatory sequence evolution
|
https://www.biorxiv.org/content/10.1101/2025.09.17.676453v1
|
September 19, 2025
|
Researchers developed "Conservatory", an algorithm that leverages microsynteny and iterative alignments to map conserved non-coding sequences (CNS) - gene associations over evolution. To determine the functional role of CNS-gene association in development, they focused on evaluating the ancient CNS S217 from SlWOX9, an embryogenesis-related genes. They evaluated whether a mutation in this CNS produces phenotypic defects in edited plants of CNS-Slwox9 by CRISPR-Cas9. To specifically generate the slwox9^(Pro-Reg1-TFBS) allele, guide RNAs (gRNAs) were designed using the Geneious Prime software to target the transcription factor binding site (TFBS) within the Pro-Reg1 region of the SIWOX9 promoter. The Golden Gate cloning system was used to assemble the binary vector containing Cas9 and the specific gRNAs. Final binary vectors were then transformed into the tomato cultivar M82 or groundcherry by Agrobacterium tumefaciens. First-generation transgenic plants (T0) were genotyped with specific primers surrounding the target sites. All CRISPR-Cas9 T0 transgenic lines were backcrossed to parental wild-type M82 cultivar plants. These F1 populations were then screened for plants lacking the Cas9 transgene, and PCR products of the targeted regions were sequenced to confirm inheritance of alleles. Selected F1 plants were self-fertilized to generate F2 populations, and these segregating populations were used to validate the phenotypic effects of each allele by co-segregation. They defined vegetative trait phenotypes as shoot apical meristem (SAM) termination, cotyledon defects (multiple cotyledons, lobed cotyledons, and fused cotyledons), leaf fusion, and phyllotaxis defects. Vegetative trait phenotyping was done on five F2 families of young seedlings at various stages of vegetative growth.
|
- Count number of aberrant phenotypes (shoot apical meristem (SAM) termination, cotyledon defects (multiple cotyledons, lobed cotyledons, and fused cotyledons), leaf fusion, and phyllotaxis defects)
- Comparison of vegetative defects (%) across F2 families with slwox9^(Pro-Reg1-TFBS) allele.
- Genotyping by PCR amplification flanking the T-DNA
- Edits in the CNS site related to WOX9 (Insertions, deletions, substitutions) by DNA sequencing
|
Researchers investigated the functional role of the conserved non-coding sequence (CNS)-gene association in tomato development by identifying CNSs using their newly developed bioinformatic tool, “Conservatory.” They selected S217 as the CNS associated with the SlWOX9 homeotic gene, an ancient and conserved transcription factor important for embryogenesis in tomato. To determine the effect of the CNS-SlWOX9 interaction, they targeted this CNS using CRISPR-Cas9 to generate a slwox9^(Pro-Reg1-TFBS) allele. All CRISPR-Cas9 T0 transgenic lines were backcrossed to the parental wild-type M82 cultivar. These F1 populations were then screened for plants lacking the Cas9 transgene, and PCR products of the targeted regions were sequenced to confirm the inheritance of alleles. Selected F1 plants were self-fertilized to generate F2 populations, which were used to assess the frequency of aberrant phenotypes. These phenotypes were defined as shoot apical meristem (SAM) termination, cotyledon defects (e.g., multiple cotyledons, lobed cotyledons, and fused cotyledons), leaf fusion, and phyllotaxis defects. After recovering F2 families with the homozygous slwox9^(Pro-Reg1-TFBS) allele, what would be the expected approximate percentage of vegetative with no defects across these families?
|
VD = [ 70 - 80] %. Note: No CI/SE/SD reported -> fallback ±5 pp applied.
|
- WUSCHEL-HOMEOBOX 9 (WOX9) is an ancient and conserved transcription factor important for embryogenesis that has functions in development, and null mutants in tomato are embryonic lethal.
- S217 is a conserved non-coding sequence from SlWOX9.
|
[{"label":"RBK Item","value":"WUSCHEL-HOMEOBOX 9 (WOX9) is an ancient and conserved transcription factor important for embryogenesis that has functions in development, and null mutants in tomato are embryonic lethal."},{"label":"Title","value":"Conserved pleiotropy of an ancient plant homeobox gene uncovered by cis-regulatory dissection"},{"label":"URL","value":"https://www.cell.com/cell/fulltext/S0092-8674(21)00151-3?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS0092867421001513%3Fshowall%3Dtrue"},{"label":"Date","value":"Apr 01, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Chemistry
|
Analytical chemistry
|
Free-Format Question
|
Direct infusion acoustic droplet ejection mass spectrometry (diADE-MS): enabling high-throughput shotgun lipidomics
|
https://chemrxiv.org/engage/chemrxiv/article-details/68b6d7d3a94eede15419aaf9
|
September 08, 2025
|
Researchers optimized the ADE-MS/MS workflow for high-throughput lipidomics using lipid extracts prepared from human plasma. To evaluate the effect of solvent choice on signal intensity and lipid coverage, five solvents octanol, pentanol, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), and heptanol were tested. Each solvent was analyzed under identical ADE-MS/MS acquisition conditions at room temperature, using 1 μL injection volumes, a carrier flow rate of 350 μL/min, and an accumulation time of 40 ms. Measurements were conducted in both positive and negative electrospray ionization modes at +5500 V and −4500 V, respectively. The resulting signal intensity was compared to determine which solvent demonstrated higher lipid coverage.
|
- Signal intensity of lipid ions measured under ADE-MS/MS conditions using octanol, pentanol, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), and heptanol. as sample solvents at room temperature.
- Lipid coverage determined from precursor ion scans in both positive and negative electrospray ionization modes (+5500 V/−4500 V) and under ADE-MS/MS conditions using octanol, pentanol, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), and heptanol. as sample solvents at room temperature
|
During the optimization of the ADE-MS/MS workflow for high-throughput lipidomics using human plasma extracts, researchers evaluated various solvents octanol, pentanol, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), and heptanol, to determine which provided the most stable ion signal and effective lipid ejection. Each solvent was tested at room temperature under identical ADE-MS/MS acquisition conditions, including 1 μL injection volumes, a carrier flow rate of 350 μL/min, and accumulation time of 40 ms, using positive and negative electrospray ionization modes at +5500 V/−4500 V. Predict which solvent demonstrated higher lipid coverage in terms of signal intensity.
|
Octanol demonstrated larger lipid coverage in terms of signal intensity.
|
- ADE-MS/MS: couples high-speed acoustic droplet ejection with electrospray ionization mass spectrometry (ZenoTOF) via an OPI.
- Solvent: key factor for achieving a stable spray and consistent ionization in the ADE-MS system.
- Electrospray Ionization (ESI): The ADE-MS flow is directed to the ESI source for direct infusion and MS/MS detection. Its role is to enable the high-throughput parallel monitoring of multiple transitions.
|
[{"label":"RBK Item","value":"-Lipidomics Basics: Lipid species (TG, LPE, SM, etc.) and their variation in human plasma."},{"label":"Title","value":"Analytical Methods in Lipidomics and Their Applications"},{"label":"URL","value":"https://pubs.acs.org/doi/full/10.1021/ac403554h"},{"label":"Date","value":"November 11, 1023"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Chemistry
|
Nanomaterials Chemistry
|
MCQ
|
Aluminum-Rich Reconstructed Sapphire as a High-Quality Substrate for Tungsten Disulfide Synthesis
|
https://chemrxiv.org/engage/chemrxiv/article-details/68cd0d2b23be8e43d613d1ae
|
September 24, 2025
|
An AIXTRON cold-wall MOCVD reactor (CCS2D) was used for high-temperature annealing of sapphire substrates. To form the aluminum-rich (√31 × √31)R±9º reconstructed surface (reconstructed sapphire), sapphire substrates (C-plane (0001) 0.2º off M-axis, 2-inch wafers, Silian optoelectronics) were heated >1200 ºC temperature. The substrates were kept at processing temperature for 10 minutes under 40 standard liter per minute (SLM) H2 gas flow at 150 mbar pressure. For comparison purposes, sapphire substrates prepared in a standard method (standard sapphire)(C-plane (0001) 0.2º off M-axis, Silian optoelectronics) were annealed before growth at 1000 ºC temperature for 1 hour under 800 standard cubic centimeters per minute (SCCM) Ar flow at 5 mbar pressure.
Tungsten disulfide (WS2) crystals were synthesized by chemical vapor deposition (CVD) using WO3 powder (99.995%) and sulfur powder (99.998%) on sapphire substrates prepared as described above. The sapphire growth substrates were placed directly above the WO3 precursor powder with sapphire spacers. The distance between the precursor powder and the growth substrate was controlled with the thickness of the spacers. The samples and precursors were then loaded into a quartz tube furnace (Carbolite Gero TS1 12/200/600) for synthesis. The atmosphere of the reaction chamber was replaced with Ar by performing three consecutive pump-purge cycles to ensure an inert environment prior to deposition. The chamber was filled to about 950 mbar pressure and heated to a temperature of 930 ºC with a ramp of 10 ºC/min under 125 SCCM of Ar flow. Right before reaching the growth temperature, the pressure was lowered to 100 mbar and both pumping and injection gas flow was stopped, so that the growth was carried out under quasi-static conditions. After growth, the chamber was let to naturally cool under 125 SCCM Ar flow.
Some samples were transferred to SiO2/Si substrates. Before transfer, the samples were spin coated with PMMA support at 4000 rpm for 60 seconds and baked at 90 ºC for 2 minutes, followed by placement of the PDMS frame on the PMMA. The support polymers with the WS2 crystals were delaminated by immersing the sample in deionized (DI) water or 1 M NaOH. Then, the entire stack was rinsed in DI water and let to dry in air before placing the stack on the target substrate. The samples were heated to 100 ºC to detach the PDMS frame and the PMMA was dissolved in acetone, followed by a rinse in isopropyl alcohol and drying with a nitrogen gun.
Standard brightfield microscopy was employed to determine crystal size and nucleation density. Photoluminescence measurements were performed using a Renishaw inVia Raman microscope. Raman spectra were collected using a 532 nm laser, a 1800 1/mm diffraction grating, and a 100x 0.85 NA objective, yielding an approximately 0.77 μm spot size. Hyperspectral photoluminescence (PL) measurements were performed using a commercial epi-illumination optical microscope (Leica DMRBE) that was customized to enable fiber coupling. The standard eyepiece was replaced with a Translated Wedge-based Identical Pulses eNcoding System (TWINS) common-path birefringent interferometer. Above the interferometer an EMCCD camera (Andor LucaEM R, 1004 Å~ 1002 pixels, 8 μm pixel size, 14-bit depth) was mounted to capture the interferometric signal. For excitation, a green diode laser (λ = 532 nm) with a power density of approximately 10 μW/μm2, delivered through a 300 μm core diameter multimode fiber, was used. This configuration produced an illumination spot size of approximately 98.4 μm on the sample surface. A filter cube within the microscope directed the excitation light toward the sample and transmitted the emitted or reflected light toward the detection path. Light from the sample was collected using a 50Å~ HC PL FLUOTAR objective lens with a numerical aperture (N.A.) of 0.8. For hyperspectral data acquisition, the birefringent wedges of the TWINS interferometer were translated over a °æ1 mm range centered around the zero-path delay position, with a step size of 5 μm. This resulted in a total of 400 steps.The Fourier transform of the temporal interferometric data to generate the spectral hypercube was performed on a standard commercial PC.
|
- Crystal size and nucleation density of WS₂ on reconstructed vs standard sapphire, from optical micrographs (optical microscopy).
- PL maps/spectra of WS₂ on both substrate types, before and after transfer to SiO₂/Si: Renishaw inVia; excitation 532 nm, grating 1800 l/mm, objective 100×, NA 0.85, spot ~0.77 µm; record emission intensity and peak wavelength/energy at positions spanning flake centers and edges.
- Hyperspectral PL image cubes on both substrate types, before and after transfer: Leica DMRBE + TWINS; EMCCD LucaEM R (1004×1002, 8 µm, 14-bit); 532 nm excitation at ~10 µW µm⁻² via 300 µm fiber; illumination spot ~98.4 µm; 50×, NA 0.8 collection; wedge travel ±1 mm, step 5 µm (400 frames); extract intensity and peak position per pixel, enabling edge–center spatial comparisons.
|
In a CVD experiment, tungsten disulfide (WS₂) was synthesized on two types of sapphire substrates: Standard sapphire and Al-rich reconstructed sapphire. Both substrates were exposed to WO₃ and sulfur precursors under identical furnace conditions. Also, some samples were transferred to SiO2/Si substrates. Which of the following outcomes are most likely? (Mark all the correct answers)
A) WS₂ crystals on reconstructed sapphire were significantly larger and denser than on standard sapphire.
B) Photoluminescence (PL) of WS₂ grown on reconstructed sapphire was quenched in the center and enhanced at the edges.
C) Transfer of WS₂ crystals onto SiO₂ substrates removed the edge–center PL difference, confirming substrate coupling effects.
D) Reconstructed sapphire reduced nucleation density compared to standard sapphire.
|
A) WS₂ crystals on reconstructed sapphire were significantly larger and denser than on standard sapphire.
B) Photoluminescence (PL) of WS₂ grown on reconstructed sapphire was quenched in the center and enhanced at the edges.
C) Transfer of WS₂ crystals onto SiO₂ substrates removed the edge–center PL difference, confirming substrate coupling effects.
|
- In the aluminum-rich (√31 × √31)R±9º reconstructed surface, oxygen atoms are removed from the first few layers of the material, leaving an excess of aluminum (Al) atoms on the surface, having metallic properties which should be beneficial for the synthesis of 2D materials.
- The low-energy tail and the slight red-shift of the photoluminiscence peak can be explained by a higher density of sulfur defects at the edges, which have been observed before for TMD materials synthesized by chemical vapor deposition.
|
[{"label":"RBK Item","value":"- In the aluminum-rich (√31 × √31)R±9º reconstructed surface, oxygen atoms are removed from the first few layers of the material, leaving an excess of aluminum (Al) atoms on the surface, having metallic properties which should be beneficial for the synthesis of 2D materials."},{"label":"Title","value":"Metallic Character of the Al2O3(0001)-(√31 × √31)R ± 9° Surface Reconstruction"},{"label":"URL","value":"https://pubs.acs.org/doi/10.1021/jp003587c"},{"label":"Date","value":"February 17, 2001"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the cited RBK item by this paper."},{"label":"RBK Item","value":"- The low-energy tail and the slight red-shift of the photoluminiscence peak can be explained by a higher density of sulfur defects at the edges, which have been observed before for TMD materials synthesized by chemical vapor deposition."},{"label":"Title","value":"Visualizing nanoscale excitonic relaxation properties of disordered edges and grain boundaries in monolayer molybdenum disulfide"},{"label":"URL","value":"https://www.nature.com/articles/ncomms8993"},{"label":"Date","value":"August 13, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Chemistry
|
Radiocarbon chemistry
|
MCQ
|
Towards online ramped oxidation (ORO)-AMS for thermal dissection and serial radiocarbon analysis of complex organic matter
|
https://www.cambridge.org/core/journals/radiocarbon/article/towards-online-ramped-oxidation-oroams-for-thermal-dissection-and-serial-radiocarbon-analysis-of-complex-organic-matter/D4ABF56D7E4759B9137234637A2F793E
|
Apr 4, 2025
|
Researchers present a compact, online ramped oxidation (ORO) setup, where CO₂ fractions resulting from environmental organic sample combustion are directly collected and transferred for ¹⁴C content measurement using an AMS equipped with a gas ion source. The instrumental configuration consists of an online ramped oxidation (ORO) system that includes two sequential ceramic fiber furnaces, where the first furnace is programmed to heat with a constant temperature ramp, and evolved products are continuously carried downstream by a combustion gas containing a mixture of O₂ (18 mol%) and He (82 mol%) and the second furnace, which is constantly held at 900°C and contains copper oxide (CuO) and silver (Ag) wool catalysts to ensure complete combustion to CO₂ and to remove unwanted nitrogen- and sulphur-containing compounds, while the excess O₂ is fed directly into the AMS source. After exiting the second furnace, generated CO₂ passes through a magnesium perchlorate (MgClO₄) water trap and is quantified at a frequency of 1 Hz using a non-dispersive infrared sensor (NDIR; smartGas flowEvo; precalibrated with N₂). There is also a double trap interface (DTI), where CO₂ is collected using parallel molecular sieve (zeolite) traps. During the release and measurement phase, the molecular sieve is heated from ∼10°C to 400°C in ∼3 min. This setup is then directly coupled to a Mini Carbon Dating System (MICADAS) AMS or Low Energy AMS (LEA) equipped with a CO₂-accepting ion source.
Before analysis, soil and sediment samples are fumigated in the presence of concentrated acid (HCl 37%) to remove carbonates and subsequently neutralized with NaOH base (both steps at 65ºC for 72 hr in a vacuum desiccator). As standard procedure, samples are then homogenized with a mortar and pestle and weighed into precombusted (∼600°C, > 2 hr) quartz glass tubes along with CuO and Ag catalysts.
When using the resulting thermogram for quantification, a conversion factor is required to determine the carbon mass released during combustion; this is obtained from a calibration curve created using compounds with known carbon content. For this purpose, known masses of acetanilide (ACE, Merck KgaA; 71% C content) and phthalic anhydride (PHA, Sigma-Aldrich; 60% C content) were oxidized at several flow rates. Conversion factors can then be calculated using the relationship M=sA, where M (mg) is the mass of carbon loaded, s (mg⋅ppm⁻¹⋅s⁻¹) is a flow-rate-specific conversion factor,
and A (ppm⋅s) is the area of the thermogram.
|
Conversion factors, calculated using the relationship M=sA, where M (mg) is the mass of carbon loaded, s (mg⋅ppm⁻¹⋅s⁻¹) is a flow-rate-specific conversion factor, and A (ppm⋅s) is the area of the thermogram.
|
ACE and PHA standard materials were oxidized at several masses ranging from ∼0.1 to 0.8 mg with a complete combustion, independent of loaded mass. Using these thermograms, the researchers estimate the conversion factor.
Which of the following outcomes is most likely?
A) The conversion factor of ACE is higher than the PHA one because the oxidation is slower, decreasing the gas flow in the CO₂ sensor, thus increasing the integrated CO₂ signal.
B) The conversion factor of ACE is smaller than the PHA one because the oxidation is slower, decreasing the gas flow in the CO₂ sensor, thus decreasing the integrated CO₂ signal.
C) The conversion factor of ACE is higher than the PHA one because the oxidation is faster, increasing the gas flow in the CO₂ sensor, thus increasing the integrated CO₂ signal.
D)The conversion factor of ACE is smaller than the PHA one because the C content of ACE is higher.
|
A) The conversion factor of ACE is higher than the PHA one because the oxidation is slower, decreasing the gas flow in the CO₂ sensor, thus increasing the integrated CO₂ signal.
|
• Ramped oxidation involves serial organic carbon (OC) combustion while increasing the temperature to ∼900°C at a constant ramp rate. This method separates OC as a function of thermal stability.
• The concentration of evolved CO₂ is monitored continuously as a function of temperature to yield a so-called “thermogram” and aliquots are subsequently collected
according to user-prescribed temperature intervals or “thermal fractions”.
|
[{"label":"RBK Item","value":" Ramped oxidation involves serial organic carbon (OC) combustion while increasing the temperature to ∼900°C at a constant ramp rate. This method separates OC as a function of thermal stability."},{"label":"Title","value":"A Study of Soil Organic Matter Stability Using Derivatography and Long-Term Incubation Methods"},{"label":"URL","value":"https://link.springer.com/article/10.1134/S1064229321040141"},{"label":"Date","value":"April 29, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":" The concentration of evolved CO₂ is monitored continuously as a function of temperature to yield a so-called “thermogram” and aliquots are subsequently collected\naccording to user-prescribed temperature intervals or “thermal fractions”."},{"label":"Title","value":"Antarctic sediment chronology by programmed-temperature pyrolysis: Methodology and data treatment"},{"label":"URL","value":"https://agupubs.onlinelibrary.wiley.com/doi/full/10.1029/2007GC001816"},{"label":"Date","value":"April 2, 2008"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Chemistry
|
Organic Chemistry
|
Numerical Values
|
Potassium Hydrogen Sulfate - Promoted One-Pot Synthesis of Bis(indolyl)alkanes from α-keto Carboxylic acids and Indole Derivatives: Experimental and Computational Studies
|
https://chemrxiv.org/engage/chemrxiv/article-details/68de2ca7f4163037703af14d
|
Oct 5, 2025
|
Researchers developed a green, metal-free one-pot synthesis of 3,3′-bis(indolyl)alkane derivatives from α-keto carboxylic acids and indole derivatives promoted by potassium hydrogen sulfate (KHSO₄) in methanol as both reagent and solvent. The optimized experiment was conducted by combining indole (1 equiv.), glyoxylic acid (2 equiv.), and KHSO₄ in methanol (2 mL) at room temperature (~25 °C) under open-air atmosphere for 4 h. Reaction parameters such as KHSO₄ molar ratios, solvent type (MeOH, 0.1 M), atmosphere (air, O₂, Ar), and acid equivalents were systematically controlled. Analytical characterization included ¹H NMR (500 MHz, CDCl₃), ¹³C NMR (125 MHz), and HRMS (ESI) for structural confirmation. Additional controlled variables were reaction scale (0.256–8.536 mmol) and reaction duration (1–24 h) to assess efficiency and scalability. All reactions were performed under ambient conditions without external heating or metal catalysts to evaluate the catalytic efficiency and selectivity of KHSO₄ in promoting bis(indolyl)alkane formation.
|
• ¹H NMR (500 MHz, CDCl₃), ¹³C NMR (125 MHz), and HRMS (ESI) for structural confirmation
• Reaction yield (%) measured after completion of each reaction to evaluate product formation efficiency under varying conditions.
• Catalyst loading (equivalents of KHSO₄) varied systematically to determine optimal acid concentration.
|
A metal-free one-pot synthesis of 3,3′-bis(indolyl)alkane derivatives was achieved using potassium hydrogen sulfate (KHSO₄) as a green catalyst in methanol. The reaction combined indole and glyoxylic acid at room temperature (25 °C) under open air, optimized for different reagent ratios, solvent, and acid equivalents. Structural and purity analyses were conducted using ¹H/¹³C NMR and HRMS, confirming efficient and selective formation of bis(indolyl)alkanes under mild, sustainable conditions.
What is the minimum number of KHSO₄ equivalents that may be used to obtain a yield of 80% in the synthesis of methyl 2,2-di(1H-indol-3-yl)acetate from indole and glyoxylic acid?
|
Number of equivalents that may be used to obtain a minimum yield of 80%: [0.3-0.7] equivalents.
Note: No CI/SE/SD reported -> fallback ±0.2 equivalents applied.
|
-Brønsted acids are widely applied as homogeneous catalysts in hydrolysis and esterification, but their use in carbon–carbon bond formation remains limited and is often constrained by safety and environmental concerns.
- Potassium hydrogen sulfate (KHSO₄) acts as a mild, solid Brønsted acid catalyst that can activate carbonyl groups under solvent-friendly and environmentally benign conditions. Its bifunctional nature as a hydrogen bond donor and acceptor allows it to activate substrates and enhance catalysis in various organic transformations.
- Acid-catalyzed formation of bis(indolyl)methanes typically proceeds via activation of a carbonyl compound followed by electrophilic substitution at indole’s C3 position.
|
[{"label":"RBK Item","value":"Brønsted acids are widely applied as homogeneous catalysts in hydrolysis and esterification, but their use in carbon–carbon bond formation remains limited and is often constrained by safety and environmental concerns."},{"label":"Title","value":"Acid Catalysts in Industrial Hydrocarbon Chemistry"},{"label":"URL","value":"https://doi.org/10.1021/cr068042e"},{"label":"Date","value":"October 31, 2007"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Potassium hydrogen sulfate (KHSO₄) acts as a mild, solid Brønsted acid catalyst that can activate carbonyl groups under solvent-friendly and environmentally benign conditions. Its bifunctional nature as a hydrogen bond donor and acceptor allows it to activate substrates and enhance catalysis in various organic transformations."},{"label":"Title","value":"Widely Applicable Hydrofluorination of Alkenes via Bifunctional Activation of Hydrogen Fluoride"},{"label":"URL","value":"https://pubs.acs.org/doi/10.1021/jacs.7b12704"},{"label":"Date","value":"December 5, 2017"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Acid-catalyzed formation of bis(indolyl)methanes typically proceeds via activation of a carbonyl compound followed by electrophilic substitution at indole’s C3 position."},{"label":"Title","value":"Regioselective C3Alkylation of Indoles for the Synthesis of Bis(indolyl)methanes and 3-Styryl Indoles"},{"label":"URL","value":"https://pubs.acs.org/doi/10.1021/acs.joc.3c02551"},{"label":"Date","value":"January 12, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Physics
|
Nuclear Experiment
|
MCQ
|
Laser Mossbauer spectroscopy of 229 Th
|
https://arxiv.org/abs/2509.00041
|
August 23, 2025
|
Researchers excited the $^229$Th nuclear clock transition in CaF₂ single crystals using vacuum-ultraviolet (VUV) pulsed laser light near 148 nm and monitored de-excitation photons with a solar-blind photomultiplier. Three crystals were used with $^229$Th concentrations of $4 \times 10^14$ mm⁻³ (C10), $8 \times 10^14$ mm⁻³ (C13), and $5 \times 10^15$ mm⁻³ (X2), where C13 and X2 were annealed at 1250 °C in CF₄ to improve VUV transmittance. Each crystal was cut to ~1 mm³, wire-mounted, and kept at room temperature. The laser system comprised two external-cavity diode lasers at 749 nm and 786 nm that seeded Ti:sapphire ring cavities pumped by a 10 Hz, 532 nm Nd:YAG laser (40–50 mJ); the 749 nm pulses (4.5–6.0 mJ, 40–50 ns) were tripled in BBO to 250 nm and, together with the 786 nm pulses, drove xenon-resonant four-wave mixing to generate VUV radiation, which was separated by an MgF₂ prism, monitored by a VUV-filtered photodiode, and frequency-tracked with a wavemeter calibrated to a rubidium-locked 780 nm reference. For spectroscopy, the VUV frequency was scanned in 10 MHz steps over a 1.2 GHz range (C10/C13) or a 1.8 GHz range (X2) around the transition, applying 60 s of irradiation followed by 300 s of detection at each step. Emitted photons were collected by a parabolic mirror, passed through four right-angle dichroic mirrors (reflectance peak ~150 nm), focused by an MgF₂ lens, and detected by a Hamamatsu R10454 photomultiplier; a second photomultiplier (Hamamatsu R11265-203) provided temporal vetoing, and a rotating wheel blocked light during irradiation. In additional tests on X2, a continuous-wave 405 nm “quench” laser (~10 mW) was directed diagonally below the crystal to study laser-induced quenching under otherwise identical conditions.
|
- VUV nuclear excitation spectrum (photon counts vs. excitation frequency) by laser scan with solar-blind PMT detection.
- Time-resolved de-excitation photon counts (isomer lifetime) by delayed photon counting with PMT.
- Site-selective spectral components (crystal-field/quadruple sublevels) by laser Mössbauer excitation in CaF₂.
- Photon count rate during and after 405 nm continuous-wave laser illumination (for quenching assessment).
- Background photon count rate by veto PMT timing cuts and rotating shutter gating.
|
VUV laser Mossbauer spectroscopy (60 s irradiation / 300 s detection per frequency step) of $^229$Th:CaF₂ single crystals resolves four thorium doping sites, namely S1, S2, S3, and S4 with electric field gradient $V_{zz}$ of 0 V/$\AA$, 110 V/$\AA$, -320 V/$\AA$, and 260 V/$\AA$, respectively. Site-selective excitation was performed by detuning the excitation laser by 0 MHz, -90 MHz, 240 MHz, and -210 MHz for S1 to S4, respectively. A 405 nm continuous-wave laser is then applied during detection for the crystal with a $^229$Th concentration of $5 \times 10^15$ mm⁻³ to probe laser-induced quenching. Based on this experimental configuration, which statement correctly describes (i) the unquenched isomeric lifetime and (ii) the observed quenching behaviour within the crystal?
A) Lifetime is ~630 s and site-independent; quenching is most efficient for S3 among other sites.
B) Lifetime varies by site (550–750 s range); quenching is most efficient for S1 because it contributes the most in the spectroscopic signal.
C) Lifetime is ~630 s and site-independent; quenching lifetime for S2 is at least twice that of S1.
D) Lifetime is longer for S2 (>750 s); quenching is negligible for S1 due to its structural symmetry.
|
C) Lifetime is ~630 s and site-independent; quenching lifetime for S2 is at least twice that of S1.
|
- ^229Th possesses an unusually low-energy nuclear isomeric transition in the vacuum-ultraviolet, enabling direct optical excitation and making it a candidate for a solid-state nuclear clock.
- Incorporating Th⁴⁺ into wide-band-gap fluoride crystals (e.g., CaF₂) creates local lattice environments and electric-field gradients that split nuclear sublevels via quadrupole interactions.
- Narrow-linewidth laser spectroscopy of embedded nuclei (often described as nuclear laser/Mössbauer-type excitation) probes hyperfine structure and timing of de-excitation by recording VUV-induced photon signals with high spectral and temporal resolution.
- Nonradiative decay channels in solids - mediated by defects, impurities, or multiphonon coupling - can compete with radiative de-excitation; auxiliary optical fields may influence these pathways by altering carrier or defect populations.
|
[{"label":"RBK Item","value":"^229Th possesses an unusually low-energy nuclear isomeric transition in the vacuum-ultraviolet, enabling direct optical excitation and making it a candidate for a solid-state nuclear clock."},{"label":"Title","value":"Nuclear laser spectroscopy of the 3.5 eV transition in Th-229"},{"label":"URL","value":"https://epljournal.edpsciences.org/articles/epl/abs/2003/02/7463/7463.html"},{"label":"Date","value":"January 1, 2003"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is reference 1 in the paper. It explains why laser spectroscopy is possible for Th-229."},{"label":"RBK Item","value":"Incorporating Th⁴⁺ into wide-band-gap fluoride crystals (e.g., CaF₂) creates local lattice environments and electric-field gradients that split nuclear sublevels via quadrupole interactions."},{"label":"Title","value":"Performance of a 229 Thorium solid-state nuclear clock"},{"label":"URL","value":"https://arxiv.org/abs/1204.3268"},{"label":"Date","value":"April 15, 2012"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA; this is reference 4 in the paper. It justifies site-dependent spectral splitting."},{"label":"RBK Item","value":"Narrow-linewidth laser spectroscopy of embedded ^229Th nuclei probes hyperfine structure and de-excitation timing by recording VUV-induced photon signals with high spectral and temporal resolution."},{"label":"Title","value":"The thorium-229 low-energy isomer and the nuclear clock"},{"label":"URL","value":"https://www.nature.com/articles/s42254-021-00286-6"},{"label":"Date","value":"February 25, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is reference 12 in the paper. It describes the core measurement technique."},{"label":"RBK Item","value":"Nonradiative decay channels in solids - mediated by defects, impurities, or multiphonon coupling - can compete with radiative de-excitation; auxiliary optical fields may influence these pathways by altering carrier or defect populations."},{"label":"Title","value":"Extending Our Knowledge about the 229Th Nuclear Isomer"},{"label":"URL","value":"https://doi.org/10.3390/atoms10010024"},{"label":"Date","value":"February 14, 2022"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA; this provides basis for 405 nm laser-induced quenching."}]
|
Physics
|
High Energy Physics/ Detector Physics
|
Free-Format Question
|
Preparation and measurement of an 37Ar source for liquid xenon detector calibration
|
https://arxiv.org/abs/2509.04829
|
Sep 5, 2025
|
High purity (99.935%) ³⁶Ar was sealed in a quartz ampoule with a diameter of 1 cm, length of 4 cm and wall thickness of 1 mm to an inner pressure of 0.4 bar. The sealing was done by cooling the bottom side of the quartz ampoule and applying a high-temperature hydrogen torch to the other side. The ampoule was irradiated with a thermal neutron flux of 1.5×10¹³ n/(cm²·s) for 2.17 hours in a reactor to produce ³⁷Ar isotopes. After irradiation, the ampoule was placed in a pressure-transfer apparatus to recover all gases generated after irradiation. The extraction was done by evacuating the apparatus to achieve vacuum and applying pressure to the ampoule. The gas was then stored in a stainless steel container with a volume of 500 mL and progressively injected into a gaseous xenon time projection chamber (GXe TPC) to measure radioactivity. In each injection, 11% of the source volume was pumped into the system, which had an overall volume of 28 L. Gaseous xenon continuously circulated through a hot-getter system for purification.
The TPC had Teflon walls and was operated using gaseous xenon at room temperature and a pressure of ~170 kPa. It was mounted inside a double-walled cryostat and equipped with 14 Hamamatsu R8520-406 PMTs operating at -800 V. These PMTs were placed on the top and bottom in regular hexagonal patterns comprising seven elements each. The electron drift region of the TPC had a volume of 181 mL and was defined by an anode at +1200 V, a gate at -2400 V, a cathode at -1800V, and a screen at -800 V. The waveforms from the PMTs were digitized using CAEN V1725 digitizers, which employ a dynamic acquisition window. Peaks were defined as two or more PMT signals within ~300 ns. The time spread of a peak was characterized by the leading time, defined as the time interval between the 0% and 50% percentiles of the waveform area. Data acquisition was carried over 8 hours. Photoelectron (PE) units were calibrated by single-photon counting with an LED.
|
- Peak leading time (in ns) and area (in PE) obtained from the processed PMT signals.
|
A sample of ³⁶Ar gas was irradiated in a thermal neutron flux. The reactor neutron source generated a thermal neutron flux. The target gas was sealed in a quartz ampoule under slightly negative pressure. After exposure, the ampoule was cooled. The ³⁷Ar decay activity was characterized using a gaseous xenon time projection chamber (GXe TPC) operated at room temperature. The chamber, equipped with photomultiplier tubes (PMTs), detected the scintillation (S1) and ionization (S2) signals resulting from the low-energy electron-capture decays of ³⁷Ar. The ³⁷Ar source is introduced through multiple injections. Peaks were defined as two or more PMT signals within ~300 ns. The time spread of a peak was characterized by the leading time, defined as the time interval between the 0% and 50% percentiles of the waveform area. Predict which type of signal features greater maximum density in the area and leading time of peaks distribution after injection.
|
The largest density is observed for ionization signals (S2) from K-shell decay.
|
- The radioactive isotope ³⁷Ar, with a half-life of 35.01 days, can decay to ³⁷Cl and neutrinos via the electron capture process.
- Thermal neutron irradiation of ³⁶Ar is an effective technique for preparing radioactive isotopes 37Ar.
|
[{"label":"RBK Item","value":"The radioactive isotope ³⁷Ar, with a half-life of 35.01 days, can decay to ³⁷Cl and neutrinos via the electron capture process. "},{"label":"Title","value":"Table of Radionuclides (Vol. 1 - A = 1 to 150)"},{"label":"URL","value":"https://ftp.cdc.gov/pub/FOIAREQ/168372-A45.pdf"},{"label":"Date","value":"Oct 2004"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Open-access, this is cited as reference 13 in the paper. It is a reference volume that has some details about the sample."}]
|
Physics
|
Physics/Optics
|
Free-Format Question
|
Terahertz amplification by injection locking of waveguide resonant tunneling diode
|
https://arxiv.org/pdf/2509.14377
|
September 17, 2025
|
Researchers investigated terahertz amplification by injection locking a waveguide resonant tunneling diode (RTD) to a low-phase-noise dual-wavelength Brillouin laser (DWBL). A waveguide-mounted RTD (ROHM semiconductor) biased at 620 mV produced about 40 µW of power at 260 GHz. The output passed through a WR-3.4 isolator (Micro Harmonics FR34M2) into a fundamental mixer (VDI WR3.4BAM-ULP).
The local oscillator (LO) of the mixer was driven by a DWBL turned to 250 GHz and photomixed using a uni-traveling-carrier photodiode (NTT IOD-PMJ-13001). The resulting intermediate frequency (IF) signal, fIF=∣fRTD−fDWBL∣, was analyzed with an electrical spectrum analyzer to determine the free-running linewidth and phase noise. The dual-wavelength Brillouin laser (DWBL) uses best-in-class phase noise from 300 GHz to 3 THz. For injection locking, the RTD received a signal from another DWBL through a low-loss WR-3.4 circulator (Micro Harmonics HC034). Optical power from the DWBL was amplified by an erbium-doped fiber amplifier (EDFA) and tuned with a variable optical attenuator (VOA), while injection power was calibrated using a Schottky diode detector (VDI ZBD-F).
|
- RTD terahertz frequency and output power measured using a fundamental mixer and electrical spectrum analyzer.
- Intermediate frequency (IF) spectra recorded.
- Phase noise power spectral density measured with a phase noise analyzer for both free-running and injection-locked conditions.
- Bias voltage dependence of RTD output measured between 530 - 620 mV at room temperature.
|
An investigation of terahertz amplification is conducted by injecting a waveguide resonant tunneling diode (RTD) into a low-phase-noise, dual-wavelength Brillouin laser (DWBL). The output was passed through a WR-3.4 isolator and then into a fundamental mixer. A DWBL drove the local oscillator (LO) of the mixer, turned to 250 GHz, and photomixed using a uni-traveling-carrier photodiode. The resulting intermediate frequency (IF) signal was analyzed with an electrical spectrum analyzer to determine the free-running linewidth and phase noise. The dual-wavelength Brillouin laser (DWBL) operates within a frequency range of 300 GHz to 3 THz. For injection locking, the RTD received a signal from another DWBL through a low-loss WR-3.4 circulator. Predict what was a key observation about the residual phase noise under low-injection conditions.
|
Under low-injection conditions, residual phase noise was much more significant.
|
- Frequencies at or above 1THz tend to show much lower output power, dropping to ~ 10nW at 3THz.
- Injecting an RTD with a low-noise photomixed source has been shown to considerably improve the linewidth of an RTD.
- The DWBL exhibited lower instability than the RTD at all timescales, and thus did not affect the measurement.
|
[{"label":"RBK Item","value":" Frequencies at or above 1THz tend to show much lower output power, dropping to ~ 10nW at 3THz. "},{"label":"Title","value":"Collector Series-Resistor to Stabilize a Broadband 400 GHz Common-Base Amplifier."},{"label":"URL","value":"https://ieeexplore.ieee.org/document/9573439"},{"label":"Date","value":"Oct 14, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 16 in the paper"},{"label":"RBK Item","value":"Injecting an RTD with a low-noise photomixed source has been shown to considerably improve the linewidth of an RTD. "},{"label":"Title","value":"Injection locking and noise reduction of resonant tunneling diode terahertz oscillator"},{"label":"URL","value":"https://pubs.aip.org/aip/app/article/6/2/021301/123536/Injection-locking-and-noise-reduction-of-resonant"},{"label":"Date","value":"Feb 23, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Open-access, this is cited as reference 19 in the paper"},{"label":"RBK Item","value":"The DWBL exhibited lower instability than the RTD at all timescales, and thus did not affect the measurement."},{"label":"Title","value":"Brillouin laser-driven terahertz oscillator up to 3 THz with femtosecond-level timing jitter"},{"label":"URL","value":"https://www.nature.com/articles/s41566-024-01513-z"},{"label":"Date","value":"Sept 13, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 12 in the paper"}]
|
Physics
|
Physics / Nuclear Physics
|
Free-Format Question
|
High-spin spectroscopy and the onset of quasicollective structures in 69Ga
|
https://arxiv.org/abs/2510.01423
|
October 1, 2025
|
High-spin states in 69-Ga were populated using the fusion-evaporation reaction 26-Mg (48-Ca, p4nγ) at a beam energy of 195 MeV—the experiment utilized the Gammasphere multidetector array in conjunction with the Fragment Mass Analyzer. The measurement used a highly enriched (>98%), self-supporting 26-Mg target with a thickness of 0.5mg/cm², bombarded by a 195-MeV 48Ca beam from the Argonne Tandem Linac Accelerator System (ATLAS). Particle detectors were incorporated into the experimental setup alongside Gammasphere to facilitate the clean selection of reaction exit channels. Neutrons were measured using a Neutron Shell made of liquid scintillation detectors, which replaced the HPGe-BGO modules in the five most forward rings of Gammasphere with respect to the beam direction. Charged-particle detection and identification were carried out using Microball, along with two double-sided silicon strip detectors (DSSD) positioned within the target chamber. A parallel plate avalanche counter (PPAC), placed at the focal plane, was used to record the position and time-of-flight information of the recoils on an event-by-event basis. For Z identification, a three-fold segmented ionization chamber, located behind the focal plane, was used to measure the energy loss of the reaction products. The events were recorded under the condition that the detection of a reaction product in the PPAC detector coincided with at least two γ rays detected by Gammasphere within a prompt time window.
|
- γ-ray energies recorded by the Gammasphere HPGe detector array to identify de-excitation transitions from the ²⁶Mg(⁴⁸Ca, p4nγ) reaction populating ⁶⁹Ga.
- Recoil ions separated by the Fragment Mass Analyzer (FMA) using mass-to-charge (A/Q) selection and time-of-flight data from the PPAC detector.
- Angular distributions of γ rays measured at eight detector angles (17.3°–90°).
|
High-spin states in 69-Ga were populated using the fusion-evaporation reaction 26-Mg at a beam energy of 195 MeV. Particle detectors were incorporated into the experimental setup alongside Gammasphere to facilitate the clean selection of reaction exit channels. Neutrons were measured using a Neutron Shell made of liquid scintillation detectors, which replaced the HPGe-BGO modules in the five most forward rings of Gammasphere with respect to the beam direction. The events were recorded under the condition that the detection of a reaction product in the PPAC detector coincided with at least two γ rays detected by Gammasphere within a prompt time window. What are the energies (in keV) of the two most intense transitions measured for 69-Ga?
|
The gamma-ray energies of the most intense observed transitions are (574.5±0.3) keV and (1337.3±1.2) keV.
|
- Results from (3He,d) reactions on 64, 66, 68, 70Zn targets showed significant shifts in transition strengths and excitation energies for low-lying states in 71Ga when compared to 65, 67, 69Ga.
- There is a sharp rise in excitation energy of the 1/2− state from 320 keV in 69Ga to 1109 keV in 71Ga.
|
[{"label":"RBK Item","value":"Results from (3He,d) reactions on 64, 66, 68, 70Zn targets showed significant shifts in transition strengths and excitation energies for low-lying states in 71Ga when compared to 65, 67, 69Ga."},{"label":"Title","value":"The reactions 68, 70Zn(3He, d)69, 71Ga and level systematics of the odd-mass Ga isotopes"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/0375947474906150?via%3Dihub"},{"label":"Date","value":"Aug 19, 1974"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 27 in the paper"},{"label":"RBK Item","value":"There is a sharp rise in excitation energy of the 1/2− state from 320 keV in 69Ga to 1109 keV in 71Ga. "},{"label":"Title","value":"Spectroscopy of 68Zn, 70Zn, and 74Ge via the (𝑑, 3\tHe ) reaction"},{"label":"URL","value":"https://journals.aps.org/prc/abstract/10.1103/PhysRevC.16.1825"},{"label":"Date","value":"Nov 1, 1977"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is cited as reference 28 in the paper"}]
|
Physics
|
Condensed Matter Physics/ Microwave Engineering
|
Free-Format Question
|
Development of composite material with epoxy resin–magnetite for dielectric resonator antenna
|
https://pubs.aip.org/aip/jap/article/138/13/134901/3366161
|
October 3, 2025
|
Researchers developed epoxy resin-magnetite (Fe3O4) composite materials with four different weight percentages of magnetite, which have 32.25% (ER/M1), 48.78% (ER/M2), 58.82% (ER/M3), and 65.57% (ER/M4) powder, polydimethylsiloxane (PDMS) elastic polymer material, and BaFe12O19. The composite was prepared by mixing epoxy resin and hardener in a 2:1 weight ratio for 5 minutes, followed by adding magnetite nanoparticles and mixing for another 10 minutes, which is derived from a range of materials such as (Zr0.8Sn0.2) TiO4, Al2O3, Fe3O4, iron, and a mixture of iron oxide (Fe3O4) and nickel (Ni). The mixture was poured into a 3D printed mold and cured at room temperature for three days. A four-probe-fed cylindrical DRA is designed using four epoxy resin–magnetite composites, which have a radius of 7.5mm and a height of 8.5mm. Dielectric characterization was performed at the X-band (8 to 12 GHz) using an Agilent E8362C PNA Series Vector Network Analyzer with samples placed in a metallic holder between coaxial to waveguide adapters, based on the Nicolson Ross Weir (NRW) method, and the dielectric properties, such as permittivity, density, permeability, and loss tangent, were measured for the four prepared samples.
|
- Permittivity of ER/M1, ER/M2, ER/M3, ER/M4 measured across 8 to 12 GHz.
- Permeability of ER/M1, ER/M2, ER/M3, ER/M4 measured across 8 to 12 GHz.
- Loss tangent of ER/M1, ER/M2, ER/M3, ER/M4 measured across 8 to 12 GHz.
- Density (kg/m3) of ER/M1, ER/M2, ER/M3, ER/M4 measured.
|
An epoxy resin-magnetite (Fe3O4) composite material with four different weight percentages of magnetite, which have 32.25% (ER/M1), 48.78% (ER/M2), 58.82% (ER/M3), and 65.57% (ER/M4) powder, polydimethylsiloxane (PDMS) elastic polymer material, and BaFe12O19 was prepared. The composite was prepared by mixing epoxy resin, followed by adding magnetite nanoparticles. The mixture was poured into a 3D printed mold and cured at room temperature for three days. A four-probe-fed cylindrical DRA is designed using four epoxy resin–magnetite composites, which have a radius of 7.5mm and a height of 8.5mm. Dielectric characterization was performed at the X-band with samples placed in a metallic holder between coaxial to waveguide adapters, and the dielectric properties, such as permittivity, density, permeability, and loss tangent, were measured for the four prepared samples. Predict how do the permittivity, density, permeability, and loss tangent of the developed epoxy resin–magnetite composite materials vary with the increasing weight percentage of Fe₃O₄?
|
Both permittivity and density increase with the increasing weight percentages of magnetite, while permeability and loss tangent are not significantly affected.
|
- Dielectric resonator antennas are suitable for ultrawideband applications due to their wide bandwidth and design flexibility.
- 3D printed DRAs are popular due to their simple fabrication process.
- Metamaterial-based antennas are reported to enhance bandwidth and improve isolation in MIMO configurations.
|
[{"label":"RBK Item","value":"Dielectric resonator antennas are suitable for ultrawideband applications due to their wide bandwidth and design flexibility."},{"label":"Title","value":"Balanis, C. A. (2016). Antenna Theory: Analysis and Design"},{"label":"URL","value":"https://www.wiley.com/en-us/Antenna+Theory%3A+Analysis+and+Design%2C+4th+Edition-p-9781118642061"},{"label":"Date","value":"February, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled - Citation [1] in the paper states \"DRAs are preferred for ultra-wideband (UWB) applications due to their wide bandwidth and design flexibility\" (p.1), with Balanis cited as the canonical reference for antenna fundamentals."},{"label":"RBK Item","value":"3D printed DRAs are popular due to their simple fabrication process."},{"label":"Title","value":"3-D-Printed Dielectric Resonator Antenna Arrays Based on Standing-Wave Feeding Approach"},{"label":"URL","value":"https://doi.org/10.1109/LAWP.2019.2939734"},{"label":"Date","value":"October 10, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled - Citation [15] in the paper (p.1) mentions 3D printed DRAs' fabrication advantages. This IEEE journal article requires subscription access but is directly cited by the main paper."},{"label":"RBK Item","value":"Metamaterial-based antennas are reported to enhance bandwidth and improve isolation in MIMO configurations."},{"label":"Title","value":"Dual-band 5G MIMO antenna with enhanced coupling reduction using metamaterials"},{"label":"URL","value":"https://www.nature.com/articles/s41598-023-50446-0"},{"label":"Date","value":"January 2, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA - Citation [8] in the paper (p.1) references metamaterial-based antennas for bandwidth enhancement in MIMO systems. This Scientific Reports article is open access."}]
|
Physics
|
Physics / Material Science
|
MCQ
|
Superlubricity of Borophene: Tribological Properties in Comparison to hBN
|
https://arxiv.org/abs/2507.07716
|
July 10, 2025
|
Researchers prepared Ir(111) single crystals by repeated cycles of sputtering (Ar+ ions at an energy of 1 keV) and annealing at 1250 K. $\chi_6$-borophene and borophene-hBN heterostructures were grown on Ir(111) by dosing diborane and/or borazine while keeping the substrates at high temperature. The growth of the borophene-hBN lateral heterostructures was promoted by dosing a diborane-borazine mixture on a sample kept at 1200 K, controlled by mass spectrometry. The growth of borophene was promoted through a a diborane-borazine mixture dosed onto the sample at 1350 K, which resulted n the formation of pure borophene. The annealing was maintained for 10 min after the end of the dosing. Contact AFM measurements were performed with a microscope operated at room temperature using PPP-CONT cantilevers. The cantilevers preparation consisted of an annealing for 1 h at 400 K followed by an Ar+ sputtering for 2 min at 1 keV at an Ar+ pressure of 3e-6mbar. STM tips were made from Pt/Ir wire. The UHV system was maintained at a base pressure of 5e-11 mbar during the measurements.
|
- Lateral force (nN) of $\chi_6$ borophene and borophene hBN layers on Ir(111) for backward and forward traces spanning 10 nm under loads below 120 nN.
|
Consider an experiments, where researchers grow $\chi_6$ borophene and hexagonal Boron Nitride (hBN) domains, separately, on top of Ir(111) crystals by dosing diborane and or borazine while keeping the substrates at high temperature. By changing the normal force in contact atomic force microscopy (AFM) measurements from 0 to 80 nN, load dependent frictional force measurements are performed on these domains. Considering the standard definition of superlubricity, which of the following outcome of the experiment is more likely?
A) Superlubricity: $\chi_6$ borophene and hBN. Low-friction: none.
B) Superlubricity: $\chi_6$ borophene. Low-friction: hBN.
C) Superlubricity: hBN. Low-friction: $\chi_6$ borophene.
D) Superlubricity: none. Low-friction: $\chi_6$ borophene and hBN.
|
B) Superlubricity: $\chi_6$ borophene. Low-friction: hBN.
|
- Borophene has been theoretically studied as a potential tribological material.
- Different polymorphs of borophene can be formed, depending on the growth method, the support material, or other treatments that can influence the desired properties.
- Hexagonal boron nitride (hBN) is established as lubricant or as an intercalation layer, given its tribological performance.
- Frictional force can be calculated with an Atomic Force Microscope from the lateral friction profiles, the force applied and the cantilever properties.
- The thresholds for low friction and superlubricity are typically set to 0.1 and 0.01, respectively.
|
[{"label":"RBK Item","value":"Borophene has been theoretically studied as a potential tribological material."},{"label":"Title","value":"Disclosing boron’s thinnest side"},{"label":"URL","value":"https://www.science.org/doi/10.1126/science.aad7021"},{"label":"Date","value":"December 18, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled: No OA version available"},{"label":"RBK Item","value":"Different polymorphs of borophene can be formed, depending on the growth method, the support material, or other treatments that can influence the desired properties"},{"label":"Title","value":"Borophenes made easy"},{"label":"URL","value":"https://www.science.org/doi/10.1126/sciadv.abk1490"},{"label":"Date","value":"Novemeber 3, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Hexagonal boron nitride (hBN) is established as lubricant or as an intercalation layer, given its tribological performance."},{"label":"Title","value":"Robust microscale superlubricity in graphite/hexagonal boron nitride layered heterojunctions"},{"label":"URL","value":"https://www.nature.com/articles/s41563-018-0144-z#article-info"},{"label":"Date","value":"July 30, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but it is a flagship publication provided as the reference 41 in the paper."},{"label":"RBK Item","value":"Frictional force can be calculated with an Atomic Force Microscope from the lateral friction profiles, the force applied and the cantilever properties."},{"label":"Title","value":"Scanning Probe Microscopy: The Lab on a Tip"},{"label":"URL","value":"https://link.springer.com/book/10.1007/978-3-030-37089-3"},{"label":"Date","value":"January 1, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but it is an established reference book on SPM listed in the main paper as reference 59."},{"label":"RBK Item","value":"The thresholds for low friction and superlubricity are typically set to 0.1 and 0.01, respectively."},{"label":"Title","value":"Overcoming friction and steps towards superlubricity: A review of underlying mechanisms"},{"label":"URL","value":"https://doi.org/10.1016/j.apsadv.2021.100175"},{"label":"Date","value":"December 1, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Physics
|
Optics
|
Free-Format Question
|
Holographic Gaseous Lenses for High-Power Lasers
|
https://arxiv.org/abs/2510.02659
|
October 3, 2025
|
Researchers conducted an experiment at atmospheric temperature and pressure to demonstrate the performance of diffractive gaseous lenses capable of withstanding high-energy laser pulses. The lenses were formed by the interference of two ultraviolet (266 nm) write laser pulses within a controlled gas flow and were tested using a 532 nm read laser. Two electronically triggered Nd:YAG lasers were used: one frequency-quadrupled to 266 nm for the write beams (5 ns, ≤7.8 mJ total) and one frequency-doubled to 532 nm for the read beam (5 ns, ≤220 mJ). The write beams, 3 mm in diameter, intersected in the gas at angles from 0.4° to 1.0°, with one beam collimated and the other having adjustable divergence (−4.2 mrad to +4.5 mrad). The read beam was either collimated (2 mm, low energy) or focused (f/230, 1.2 mm, full energy). The gas flow cell consisted of nested rectangular channels: the inner channel carried a mixture of ozone (<10%), oxygen, and carbon dioxide (<50%) flowing at ~1 m/s, while an outer nitrogen flow reduced turbulence. The gas layer thickness was 5 mm or 10 mm, with a 10 mm channel height. Beam timing and alignment were optimized to maximize diffraction.
|
- UV interference patterns of write beams for different focal position of one of the write beams to vary the fringe curvature
- Focusing and defocusing of the read beam for varying UV interference fringe curvatures
|
An experiment uses two interfering 266-nm ultraviolet "write" beams to create a holographic gaseous lens inside an ozone-based gas mixture. This UV interference pattern "writes" a transient phase grating into the gas via refractive index variations. This structure is then used to manipulate a separate 532-nm "read" beam, which diffracts off it. In the initial configuration, the "write" beams are set up with specific wavefronts to produce a pattern of curved interference fringes. This configuration successfully causes the gas optic to function as a focusing lens, converging the diffracted 532-nm "read" beam to a real focal spot at a distance of $+31$ cm after the gas. Now, the experimenter adjusts the "write" beam optics to reverse the sign of the wavefront curvature that generates the interference pattern. All other parameters (gas composition, beam wavelengths, and incident angles) remain identical. What is the predicted primary effect on the diffracted 532-nm "read" beam as it passes through this modified gas optic?
|
Reversing the sign of the interference fringe curvature converts the optic's function from a focusing (positive) lens to a defocusing (negative) lens. Instead of converging the "read" beam to a real focal point after the gas, this change will cause the beam to diverge, making it appear as if it is emanating from a virtual focal point located before the gas optic.
|
- Two overlapping "write" pulsed laser beams transiently write interference fringe patterns into a gas, creating a structure that diffracts the "read" beam.
- Laser driven gratings can be designed to create holographic optics such as a diffractive lens.
- Fringe curvature makes the gaseous structure behave like a focusing or defocusing lens. The curvature determines the focal length of the gaseous lens.
-Just like a solid-state lens, a specific curvature will cause the "read" beam to converge (focus). Reversing the sign of that curvature creates the opposite effect, causing the beam to diverge (defocus).
|
[{"label":"RBK Item","value":"Two overlapping \"write\" pulsed laser beams transiently write interference fringe patterns into a gas, creating a structure that diffracts the \"read\" beam."},{"label":"Title","value":" Ultra high damage threshold optics for high power lasers"},{"label":"URL","value":"https://doi.org/10.1038/s42005-020-0286-6"},{"label":"Date","value":"January 24, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA, this is reference 56 in the paper."},{"label":"RBK Item","value":"Laser driven gratings can be designed to create holographic optics such as a diffractive lens."},{"label":"Title","value":"Holographic Plasma Lenses"},{"label":"URL","value":"https://journals.aps.org/prl/abstract/10.1103/PhysRevLett.128.065003"},{"label":"Date","value":"February 8, 2022"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but this is reference 66 in the paper."}]
|
Physics
|
Experimental condensed matter / materials science (spintronics-focused thin-film magnetism).
|
MCQ
|
Altermagnetic band splitting in 10 nm epitaxial CrSb thin films
|
https://arxiv.org/abs/2505.00239
|
May 1, 2025
|
Researchers tested whether altermagnetic band splitting persists in ultrathin CrSb by growing CrSb(0001) films on SrTiO₃(111) with an ≈2 nm Sb₂Te₃ buffer using MBE (UHV < 5 × 10⁻¹⁰ mbar). STO substrates were ultrasonically cleaned (acetone, isopropanol, DI water; 2 min each), DI-water treated (90 °C, 45 min), HCl (25% at RT, 45 min), oxygen-annealed (980 °C, 3 h), and outgassed (600 °C, 1 h). Cr and Sb were co-evaporated at 240 °C with flux ratio 1:5.8; 30 nm films grew at 0.2 nm min⁻¹ and 10 nm films at 0.04 nm min⁻¹; growth was RHEED-monitored (13 keV). Electronic structure was probed in-vacuo by ARPES: (i) He-lamp 21.2 eV at 300 K with a Scienta Omicron DA30L analyzer, and (ii) synchrotron ARPES (SSRL 5-2 and ALS 10.0.1.2, p-polarized, -10 K, chamber < 3 × 10⁻¹¹ Torr), with UHV suitcase transfer (< 4 × 10⁻¹¹ Torr) to preserve clean surfaces. These measurements targeted momentum-dependent band splitting in 10 nm films.
|
- ARPES band dispersions of 10 nm CrSb(0001) vs photon energy (synchrotron, p-polarized; kz-tuned cuts along bulk Γ–A; ~10 K).
- ARPES in-plane band maps at 21.2 eV (~300 K): K̄–Γ̄–K̄, P̄–Γ̄–P̄, M̄–Γ̄–M̄ directions (in-vacuo He-lamp)
- Fermi-surface map (hexagonal Brillouin zone) to identify high-symmetry nodal lines.
- Thickness-comparison ARPES: 10 nm vs 100 nm along Γ̄–P̄ to assess quantum confinement effects.
|
Epitaxial CrSb(0001) films (10 nm with an ≈2 nm Sb₂Te₃ buffer on SrTiO₃(111)) were grown by MBE and measured in-vacuo by ARPES (synchrotron kz-tuned at low T; He-lamp at room T). Which of the following outcomes is most likely?
A. “The distinct altermagnetic band structure required for potential spin-transport applications survives down to the ∼ 10 nm thin film limit at room temperature.”
B. No band splitting is detected in 10 nm films; only spin-degenerate bands are observed.
C. Only surface Rashba-like splitting is present; bulk-like altermagnetic features are absent at all thicknesses.
D. Altermagnetic band splitting occurs only at cryogenic temperatures and disappears at room temperature.
|
A. The distinct altermagnetic band structure required for potential spin-transport applications survives down to the -10 nm thin film limit at room temperature.
|
- Altermagnets are collinear antiferromagnets that break PT symmetry and exhibit spin-split electronic bands without net magnetization.
- In altermagnets the sign of the spin splitting reverses with momentum direction (d-/g-/i-wave symmetry) and does not arise from strong spin–orbit coupling.
- CrSb (NiAs phase) is a canonical g-wave altermagnet; A-type antiferromagnet with T_N ~ 700 K in bulk.
|
[{"label":"RBK Item","value":"In altermagnets the sign of the spin splitting reverses with momentum direction (d-/g-/i-wave symmetry) and does not arise from strong spin–orbit coupling."},{"label":"Title","value":"Recent progress on correlated electron systems with strong spin–orbit coupling"},{"label":"URL","value":"https://doi.org/10.1088/0034-4885/79/9/094504"},{"label":"Date","value":"August 16, 2016"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, cited as reference 4 in the paper."},{"label":"RBK Item","value":"CrSb (NiAs phase) is a canonical g-wave altermagnet; A-type antiferromagnet with T_N ~ 700 K in bulk."},{"label":"Title","value":"Neutron diffraction investigation of the atomic magnetic moment orientation in the antiferromagnetic compound CrSb"},{"label":"URL","value":"https://doi.org/10.1103/PhysRev.85.365"},{"label":"Date","value":"January 15, 1952"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, cited as reference 20 in the paper."}]
|
Physics
|
Biological Physics
|
MCQ
|
Confinement reduces surface accumulation of swimming bacteria
|
https://arxiv.org/abs/2510.08092
|
October 9, 2025
|
Researchers loaded e. coli suspensions at concentrations varying from 0.1*n0 to 1*n0 (where n0 = 8×10^8 bacteria per mL) into closed chambers formed by two horizontal parallel plates separated by a height "H" ranging from 5µm to 160 µm.
The e. coli express green fluorescent protein and the researchers used spinning-disk confocal microscopy to image the bacteria.
For any given value "H", researchers measured the vertical density profile Ψ(z) = A(z)/∫ 0H A(z′)dz′, where z is the height from the bottom plate and A(z) is the area occupied by bacterial bodies at z.
To quantify the effect of confinement on surface accumulation, the researchers calculate the ratio of bacterial density at the mid-plane to its peak value, Ψmid/Ψpeak, as a function of H.
|
- Height, z, of bacterial body from bottom of plate
- Area occupied by bacterial body at a height z, A(z)
- Vertical density profile, Ψ(z)
|
For any given value "H", researchers measured the vertical density profile Ψ(z) = A(z)/∫ 0H A(z′)dz′, where z is the height from the bottom plate and A(z) is the area occupied by bacterial bodies at z.
To quantify the effect of confinement on surface accumulation, the researchers calculate the ratio of bacterial density at the mid-plane to its peak value, Ψmid/Ψpeak, as a function of H. Sustained surface accumulation is where the ratio plateaus.
Which of the following scenarios is most likely to happen?
A) At H=80 µm, sustained surface accumulation starts to be observed.
B) At H=40 µm, sustained surface accumulation starts to be observed.
C) At H=30 µm, sustained surface accumulation starts to be observed.
D) At H=20 µm, sustained surface accumulation starts to be observed.
|
B) At H=40 µm, sustained surface accumulation starts to be observed.
|
- As the plate separation decreases, bacterial accumulation near the surfaces reduces and can even shift into the bulk.
- The profile Ψ(z) varies progressively from surface accumulation in thick chambers to bulk accumulation under strong confinement.
- To quantify the effect of confinement on surface accumulation, we calculate the ratio of bacterial density at the mid-plane to its peak value, Ψmid/Ψpeak, as a function of H
|
[{"label":"RBK Item","value":"The profile Ψ(z) varies progressively from surface accumulation in thick chambers to bulk accumulation under strong confinement."},{"label":"Title","value":""}]
|
Physics
|
Physics/Superconductivity
|
Numerical Values
|
Effect of decorating NiO nanoparticles on superconducting properties of YBCO
|
https://arxiv.org/abs/2510.14322
|
Oct 16, 2025
|
A series of YBa₂Cu₃O_{7 - delta) (YBCO) samples were synthesized with NiO nanoparticle additions ranging from 0.1 to 6 wt.% (0.1, 0.5, 1.0, 2.0, 4.0 and 6.0 wt.%). The parent YBCO compound was produced via a conventional solid-state synthesis route using Y₂O₃, BaO, and CuO precursors. The NiO nanoparticles, having an average particle diameter of 23 nm, were supplied by the Institute of Catalysis SB RAS.
For each composition, a specified mass of NiO nanoparticles was dispersed into the YBCO powder using ethyl alcohol as a suspension medium (ten times the powder mass). After thorough mixing, the alcohol was evaporated under mild heating, and the resulting powder was ground and hydrostatically pressed at 100 MPa. The compacts then underwent fast annealing: first heated to 920 °C for 2 min, followed by a secondary anneal at 400 °C for 10 h. The critical current density (𝐽_𝑐) for each sample was determined from the width of the magnetic hysteresis loop (ΔM) using the Bean model formula
Surface morphology was characterised with a Hitachi TM4000Plus scanning electron microscope,. Magnetic measurements were obtained using a Lakeshore VSM 8604 vibrating-sample magnetometer.
|
- Magnetization measured while heating from 77 to 100 K in an applied field of 100 Oe after zero-field cooling for all NiO concentrations and an undoped sample.
- Magnetization measured at 77 K under applied fields ranging from -15 to +15 kOe for all NiO concentrations and an undoped sample.
- YBCO granule size determined from scanning electron microscopy images.
|
Researchers investigated the enhancement of superconducting performance of YBCO caused by the addition of NiO nanoparticles. Under a magnetic field H, the critical current density of the samples can be determined from the width of the magnetic hysteresis loop (ΔM) and the granule size D using the formula J_c(H) = 3ΔM/D. When a magnetic field of 10 kOe is applied at 77 K, by what numerical factor does the critical current density J_c of the YBCO sample doped with 0.5 wt.% NiO exceeds, at most, that of undoped YBCO?
|
Maximum increase in J_c by a factor of 1.22-1.50.
Note: No CI/SE/SD reported -> ±10% fallback applied to the 1.36 factor reported.
|
- Critical current density can increase significantly when incorporating magnetic nanoparticles into superconductors.
- Placing nanoparticles in the surface of the superconductor can reduce chemical interactions that lead to degradation.
|
[{"label":"RBK Item","value":"Critical current density can increase significantly when incorporating magnetic nanoparticles into superconductors."},{"label":"Title","value":"Practical Magnetic Pinning in YBCO"},{"label":"URL","value":"https://doi.org/10.1109/TASC.2009.2017861"},{"label":"Date","value":"June 5, 2009"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but cited as reference 8."},{"label":"RBK Item","value":"Placing nanoparticles in the surface of the superconductor can reduce chemical interactions that lead to degradation."},{"label":"Title","value":"Enhanced flux pinning and critical currents in films by nanoparticle surface decoration: Extension to coated conductor templates"},{"label":"URL","value":"https://doi.org/10.1063/1.2969771"},{"label":"Date","value":"August 20, 2008"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but cited as reference 16."}]
|
Physics
|
Instrumentation and Detectors
|
Free-Format Question
|
High-resolution multi-reflection time-of-flight mass spectrometer for exotic nuclei at IGISOL
|
https://arxiv.org/abs/2508.10048
|
Aug 12, 2025
|
Researchers investigated the performance of a Multi-Reflection Time-of-Flight Mass Spectrometer (MR-ToF-MS) at the IGISOL facility. A continuous beam of ions entered a RFQ cooler-buncher through injection electrodes. The main cooling section potential was closely
matched with the 30 kV acceleration potential of IGISOL to efficiently capture the ions. The ions were bunched and accelerated to 2 kV through extraction electrodes. The 2 kV bunches were then guided to the MR-ToF-MS with a 90◦ electrostatic quadrupole bender, a double XY-steerer, a quadrupole triplet, an einzel lens, and an XY steerer. The MR-ToF-MS consisted of two six-electrode stacks and a central pulsed drift-tube used to inject and extract ions. A set of three cylindrical electrodes on the exit side of the spectrometer spatially focused the ions before a DM291 MagneToF-detector.
The mass-resolving power of the instrument was evaluated using a beam of (39)K+ ions. In the experiment, the number of revolutions (n) that the ions completed inside the spectrometer was varied from 0 to over 1000. This was tested under three different pulsed drift-tube voltage conditions, corresponding to an energy change per revolution (\lambda) of 3 eV, 6 eV and 15 eV.
|
- Time-of-flight (ToF) of (39)K+ ions constructed from the time differences of the signal of ion impact on a DM291 MagneToF-detector and a initial timing signal matched with the buncher extraction time.
- Number of revolutions that the ions completed inside the spectrometer.
|
Researchers used a Multi-Reflection Time-of-Flight Mass Spectrometer (MR-ToF-MS) to analyze the behavior (39)K+ ions. From the ToF data, they estimated the mass-resolving power as a function of the number of revolutions of ions completed inside the spectrometer, for different pulsed drift-tube voltage (\lambda). Based in this setup, predict the general trend of the mass-resolving power as the number of revolutions increases from 0 to 1000 for \lambda = 6 eV.
|
For \lambda = 6 eV, the mass-resolving power initially increases with the number of revolutions, peaks at approximately n=300 revolutions, and then gradually trails off.
|
- Multi-Reflection Time-of-Flight Mass Spectrometry (MR-ToF-MS): A technique for mass separation where ions are reflected multiple times along a defined path. This method significantly extends the flight path and time, enabling high-resolution mass measurements based on the ions' unique time-of-flight.
- IGISOL: A research facility that produces and separates exotic radioactive ion beams, which are then delivered to various experiments.
|
[{"label":"RBK Item","value":"Multi-Reflection Time-of-Flight Mass Spectrometry (MR-ToF-MS): A technique for mass separation where ions are reflected multiple times along a defined path. This method significantly extends the flight path and time, enabling high-resolution mass measurements based on the ions' unique time-of-flight."},{"label":"Title","value":"Time-of-flight mass spectrometers with multiply reflected ion trajectories"},{"label":"URL","value":"https://doi.org/10.1016/0168-1176(90)85127-N"},{"label":"Date","value":"April 16, 1990"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled, but cited as reference [8]. Also, a cannonical reference on the subject matter."},{"label":"RBK Item","value":"IGISOL: A research facility that produces and separates exotic radioactive ion beams, which are then delivered to various experiments."},{"label":"Title","value":"Towards commissioning the new IGISOL-4 facility"},{"label":"URL","value":"https://doi.org/10.1016/j.nimb.2013.06.036"},{"label":"Date","value":"December 15, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Microbiology
|
MCQ
|
Temporal dynamics of the vaginal microbiome and host immune markers before, during, and after metronidazole treatment for bacterial vaginosis
|
https://journals.asm.org/doi/epub/10.1128/msystems.00380-25
|
July 3, 2025
|
Seven women (across nine symptomatic bacterial vaginosis episodes) participated in a 10-week longitudinal study, collecting daily vaginal swabs around the time of symptomatic bacterial vaginosis (BV) and metronidazole treatment. Samples were taken two days before symptom onset, at BV diagnosis (BVDX), during early and late metronidazole treatment (days 1–4 and 5–7, respectively), and two days after treatment ended. Each BV episode was treated with oral metronidazole (500 mg twice daily for seven days). Microbial DNA was extracted: D-lactic-acid producing Lactobacillus (DL) species (L. crispatus, L. jensenii, L. gasseri, L. paragasseri, L. mulieris), L. iners, BV taxa (Gardnerella, Prevotella, F. vaginae, M. lornae, Ca. Lachnocurva vaginae) from one swab per time point and sequenced using Illumina NovaSeq 6000 (around 55 million reads per sample). Negative and positive controls were included to monitor contamination and sequencing accuracy. Human reads were removed, low-quality reads filtered, and remaining reads mapped to the VIRGO2 reference database. Gene abundances were normalized for gene length and library size, then summed to estimate species-level abundances. Absolute abundance for each taxon was calculated by multiplying its relative abundance (from metagenomics) by total bacterial load (measured by panbacterial 16S rRNA qPCR).
|
- Bacterial DNA concentration and total 16S rRNA copy number for DL species (L. crispatus, L. jensenii, L. gasseri, L. paragasseri, L. mulieris), L. iners, BV taxa (Gardnerella, Prevotella, F. vaginae, M. lornae, Ca. Lachnocurva vaginae).
- Sequence read counts per sample.
- Reads mapped to bacterial genes against VIRGO2 reference database per sample.
|
Seven women (across nine symptomatic bacterial vaginosis episodes) participated in a 10-week longitudinal study, collecting daily vaginal swabs around the time of symptomatic bacterial vaginosis (BV) and metronidazole treatment. Samples were taken two days before symptom onset, at BV diagnosis (BVDX), during early and late metronidazole treatment (days 1–4 and 5–7, respectively), and two days after treatment ended. Each BV episode was treated with oral metronidazole (500 mg twice daily for seven days). Microbial DNA was extracted: D-lactic-acid producing Lactobacillus (DL) species (L. crispatus, L. jensenii, L. gasseri, L. paragasseri, L. mulieris), L. iners, BV taxa (Gardnerella, Prevotella, F. vaginae, M. lornae, Ca. Lachnocurva vaginae). Choose the option that best predicts the changes in abundance of DL species, L. iners, and BV-associated taxa in the early MET phase (days 1-4).
A. DL species increased; L. iners remained relatively stable; Gardnerella, Prevotella, and F. vaginae decreased, while M. lornae and Ca. Lachnocurva vaginae showed little or no change
B. DL species remained unchanged, but L. iners and all BV-associated taxa decreased significantly
C. DL species and L. iners both increased, while all BV-associated taxa decreased
D. All bacterial groups, including DL species and L. iners, increased during early MET treatment
|
A. DL species increased; L. iners remained relatively stable; Gardnerella, Prevotella, and F. vaginae decreased, while M. lornae and Ca. Lachnocurva vaginae showed little or no change
|
-Bacterial vaginosis (BV) is defined by an imbalanced vaginal microbiome, where beneficial Lactobacillus species are reduced and a diverse community of anaerobic bacteria, particularly Gardnerella species, dominates.
-Lactobacillus species that produce D-lactic acid, such as L. crispatus, L. jensenii, and L. gasseri, form a mutualistic relationship with the host, contributing to vaginal health and protection against pathogens.
-The recommended treatment for BV is oral or topical metronidazole (MET), but the microbial composition rarely returns completely to its pre-BV state.
|
[{"label":"RBK Item","value":"-Bacterial vaginosis (BV) is defined by an imbalanced vaginal microbiome, where beneficial Lactobacillus species are reduced and a diverse community of anaerobic bacteria, particularly Gardnerella species, dominates."},{"label":"Title","value":"Vaginal microbiome of reproductive-age women"},{"label":"URL","value":"https://www.pnas.org/doi/10.1073/pnas.1002611107?url_ver=Z39.88-2003&rfr_id=ori%3Arid%3Acrossref.org&rfr_dat=cr_pub++0pubmed"},{"label":"Date","value":"June 3, 2010"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"-Lactobacillus species that produce D-lactic acid, such as L. crispatus, L. jensenii, and L. gasseri, form a mutualistic relationship with the host, contributing to vaginal health and protection against pathogens."},{"label":"Title","value":"Prevalence of hydrogen peroxide-producing Lactobacillus species in normal women and women with bacterial vaginosis"},{"label":"URL","value":"Vaginal microbiome of reproductive-age women"},{"label":"Date","value":"Februrary 1, 1989"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"-The recommended treatment for BV is oral or topical metronidazole (MET), but the microbial composition rarely returns completely to its pre-BV state."},{"label":"Title","value":"Sexually Transmitted Infections Treatment Guidelines, 2021"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC8344968/"},{"label":"Date","value":"July 23, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Bat ecology, Immunoecology
|
MCQ
|
Presence of white-nose syndrome in bats from Southern Mexico
|
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0318461
|
May 19, 2025
|
Researchers evaluated the thermotolerance of the fungus Pseudogymnoascus destructans, the causative agent of white-nose syndrome. The P. destructans reference strain ATCC MYA 4855 was cultured on Sabouraud Dextrose Agar (SDA) in Petri dishes. A 4 mm mycelium disk was placed in the center of each Petri dish and incubated at 5°C, 17°C, 20°C, and 28°C for 60 days. The minimum and maximum colony diameter were measured daily, and micromorphology was verified. The experiments were performed in triplicate on different dates.
|
- Colony diameter (cm) of P. destructans reference strain ATCC MYA 4855 on Sabouraud Dextrose Agar (SDA) plates measurement across four temperature conditions (5°C, 17°C, 20°C, and 28°C) over a 60-day period.
- Fungal micromorphology as a visual characterization of fungal structures (e.g., conidia shape, hyphae) for each temperature condition (5°C, 17°C, 20°C, and 28°C) through daily microscopic examination.
|
Researchers cultured the fungus Pseudogymnoascus destructans (strain ATCC MYA 4855) on Sabouraud Dextrose Agar plates at four different temperatures: 5°C, 17°C, 20°C, and 28°C for 60 days. They measured the fungal colony diameter daily and examined its microscopic structures to assess growth and morphological changes across this temperature range. Which of the following outcomes is most likely based on this experimental setup?
A. The fungus failed to grow at the two highest temperatures (20°C and 28°C), indicating a strict limitation to cold environments.
B. The fungus grew equally well across all four temperatures, showing no difference in growth rate or final colony size.
C. The fungus grew fastest at 28°C, demonstrating it is a heat-adapted species.
D. The fungus grew at all four temperatures, but with the fastest rate at 5°C and the slowest at 28°C, and its microscopic structures changed with temperature.
|
D. The fungus grew at all four temperatures, but with the fastest rate at 5°C and the slowest at 28°C, and its microscopic structures changed with temperature.
|
- White-Nose Syndrome (WNS) is caused by the fungus Pseudogymnoascus destructans and is a significant threat to vespertilionid bat populations in North America.
- Pseudogymnoascus destructans has the capacity to thrive in climates across a wide range of temperatures (5–28 °C) and its ease of dispersal via migratory species of bats and other hosts makes WNS a major threat to bat populations.
|
[{"label":"RBK Item","value":"White-Nose Syndrome (WNS) is caused by the fungus Pseudogymnoascus destructans and is a significant threat to vespertilionid bat populations in North America."},{"label":"Title","value":"Spread of white-nose syndrome on a network regulated by geography and climate"},{"label":"URL","value":"https://www.nature.com/articles/ncomms2301"},{"label":"Date","value":"Dec 18, 2012"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Pseudogymnoascus destructans has the capacity to thrive in climates across a wide range of temperatures (5–28 °C) and its ease of dispersal via migratory species of bats and other hosts makes WNS a major threat to bat populations."},{"label":"Title","value":"LONG-TERM SURVIVAL OF PSEUDOGYMNOASCUS DESTRUCTANS AT ELEVATED TEMPERATURES"},{"label":"URL","value":"https://pubmed.ncbi.nlm.nih.gov/31622188/"},{"label":"Date","value":"Apr, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Physiology
|
MCQ
|
The effect of cold exposure on energy expenditure of mice fed an obesogenic diet
|
https://www.biorxiv.org/content/10.1101/2025.09.29.679278v1
|
October 01, 2025
|
Researchers investigated the response to cold exposure between mice fed a standard (normal-fat) diet and a higher-fat diet. C57BL/6J mice were housed in micro-isolator cages with 4 mice per cage, kept at 25ºC, prior to temperature manipulations, and under a 12 h light/dark cycle. Water and food were provided ad libitum. Cold exposure was conducted differently for the standard diet (13.1% kcal from fat) and the higher-fat diet (21.6% kcal from fat). For cold treatment 1, mice fed the standard diet (n = 4) were singly housed at 10.5 weeks of age and exposed to a gradual temperature drop from 30ºC to 4-6ºC over 9 days, followed by a return to 25ºC. Energy expenditure and respiratory exchange ratio were assessed throughout the temperature decrease. For cold treatment 2, another group of mice (n = 15) was maintained on a standard diet until 13 weeks of age, after which they were fed the higher-fat diet. Then, they were singly housed at 13 weeks and placed in a cold room (4-6 °C) at 15 weeks of age, for four weeks. Body weights were measured daily, while rectal temperature was first measured four hours after the onset of cold exposure, and then daily, using a rectal probe. During the final week of cold exposure, energy expenditure and respiratory exchange ratio were assessed for 2.5 days at 4-6 °C. Oxygen consumption (VO2), carbon dioxide production (VCO2), and respiratory exchange ratio (RER, VCO2/ VO2) were determined using the TSE PhenoMaster System. Energy expenditure was calculated as the product of the caloric value of oxygen (3.815+1.232 x RER) and VO2 and expressed as kcal/kg body weight/h.
|
- Oxygen consumption (VO2) for both groups of mice (standard diet vs higher-fat diet) using the TSE PhenoMaster System at different timepoints for each group during cold treatment 1 and 2..
- Carbon dioxide production (VCO2) for both groups of mice (standard diet vs higher-fat diet) using the TSE PhenoMaster System at different timepoints for each group during cold treatment 1 and 2..
- Respiratory exchange ratio (RER, VCO2/ VO2) for both groups of mice (standard diet vs higher-fat diet) using the TSE PhenoMaster System at different timepoints for each group during cold treatment 1 and 2..
- Energy expenditure (calculated as the product of the caloric value of oxygen (3.815+1.232 x RER) and VO2 and expressed as kcal/kg body weight/h) for both groups of mice (standard diet vs higher-fat diet) at different timepoints for each group during cold treatment 1 and 2..
- Body weight for each mouse (at different timepoints for each group) during cold treatment 1 and 2.
|
C57BL/6J mice were housed in micro-isolator cages with 4 mice per cage, kept at 25ºC, prior to temperature manipulations, and under a 12 h light/dark cycle. Water and food were provided ad libitum. Mice fed the standard diet (13.1% kcal from fat)(n = 4) were singly housed at 10.5 weeks of age and exposed to a gradual temperature drop from 30ºC to 4-6ºC over 9 days, followed by a return to 25ºC. Another group of mice (n = 15) was maintained on a standard diet until 13 weeks of age, after which they were fed the higher-fat diet(21.6% kcal from fat). Then, they were singly housed at 13 weeks and placed in a cold room (4-6 °C) at 15 weeks of age, for four weeks. Oxygen consumption (VO2), carbon dioxide production (VCO2), and respiratory exchange ratio (RER, VCO2/ VO2) were determined using the TSE PhenoMaster System. Energy expenditure was calculated as the product of the caloric value of oxygen (3.815+1.232 x RER) and VO2 and expressed as kcal/kg body weight/h. Which of the following outcomes is the most likely?
A. For both groups, energy expenditure increased in response to temperature decrease, and the values obtained for mice fed with a higher-fat diet were only slightly higher than those for mice fed a standard diet
B. For both groups, energy expenditure increased in response to temperature decrease, and the values obtained for mice fed with a higher-fat diet were only slightly lower than those for mice fed a standard diet
C. For both groups, energy expenditure increased in response to temperature decrease, and the values obtained for mice fed with a higher-fat diet were significantly higher than those for mice fed a standard diet
D. For both groups, energy expenditure increased in response to temperature decrease, and the values obtained for mice fed with a higher-fat diet were significantly lower than those for mice fed a standard diet
|
B. For both groups, energy expenditure increased in response to temperature decrease, and the values obtained for mice fed with a higher-fat diet were only slightly lower than those for mice fed a standard diet
|
- Thermogenic adipose tissue is specialized for the oxidation of nutrient substrates to generate heat through non-shivering thermogenesis.
- Thermogenic adipose tissue plays a critical role in regulating systemic energy balance in mice.
- Cold exposure is the most powerful physiologic stimuli for activating thermogenic adipocytes, known for increasing energy expenditure and
reducing body mass.
|
[{"label":"RBK Item","value":"- Thermogenic adipose tissue plays a critical role in regulating systemic energy balance in mice."},{"label":"Title","value":"Emerging debates and resolutions in brown adipose tissue research"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S1550413124004480"},{"label":"Date","value":"December 06, 2024"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"- Cold exposure is the most powerful physiologic stimuli for activating thermogenic adipocytes, known for increasing energy expenditure and\nreducing body mass."},{"label":"Title","value":"Brown and Beige Fat: Physiological Roles beyond Heat Generation"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/pii/S1550413115004647"},{"label":"Date","value":"October 06, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Microbiology
|
MCQ
|
Interactions between Streptococcus agalactiae and Candida albicans affect persistence and virulence
|
https://www.biorxiv.org/content/10.1101/2025.10.07.681024v1
|
Oct 8, 2025
|
To examine how interactions between Streptococcus agalactiae (GBS) and Candida albicans affect virulence, researchers utilized a larval zebrafish (wild-type ZF1 strain) model to investigate differences in solo infections vs co-infections with both pathogens in vivo. The Streptococcus agalactiae strain GBS 515 was inoculated in Todd-Hewitt medium supplemented with 0.2% yeast extract (THY) in sealed conical tubes and grown statically at 37°C overnight. The fungal strain of Candida albicans (C. albicans) SC5314-NEON was inoculated onto a THY agar plate and grown overnight at 37°C aerobically. Adult zebrafish used for breeding were maintained at 29°C on recirculating systems. Embryos were stored at a density of 50 embryos per petri dish, with sterilized water obtained from the recirculating system supplemented with 0.1% methylene blue, and kept at 29°C. Larvae at ~48 hours post fertilization were manually dechorionated and anesthetized in 0.32 mg/mL of tricaine prior to injection of either 1 nL of GBS 515 at 2 X 10^7 cfu/ml, 1 nL of SC5314-NEON at 2 X 10^7 cfu/ml, or 1 nL of GBS at 1 X 10^7cfu/ml and SC5314-NEON at 1 X 10^7 cfu/ml combined into the yolk sac of the larval zebrafish to simulate an infection. Following use in experiments, zebrafish were transferred to a 31°C incubator and monitored for survival every 24 hours for 72 hours. Mortality of the fish was determined by observation of a loss of heartbeat and no movement when gently probed on the tail.
|
- Zebrafish survivability (as a percentage) monitored every 24 hours for 72 hours post-infection.
- Survival curves for larvae in solo GBS, solo C. albicans, and GBS + C. albicans co-infection groups.
- Pathogen inoculum concentration (cfu/mL) for each infection group, confirmed by serial dilution and plating.
- Final zebrafish survival percentage at 72 hours post-infection (hpi) for each group.
|
To examine how interactions between Streptococcus agalactiae (strain GBS 515) and Candida albicans (strain SC5314-NEON) affect virulence, researchers utilized a larval zebrafish (wild-type ZF1 strain) model to investigate differences in solo infections vs co-infections with both pathogens in vivo. Zebrafish embryos were stored at a density of 50 embryos per petri dish, with sterilized water obtained from the recirculating system supplemented with 0.1% methylene blue, and kept at 29ºC. Larvae at ~48 hours post fertilization were manually dechorionated and anesthetized in 0.32 mg/mL of tricaine prior to injection of either 1 nL of GBS 515 at 2 X 10^7 cfu/ml, 1 nL of SC5314-NEON at 2 X 10^7 cfu/ml, or 1 nL of GBS at 1 X 10^7cfu/ml and SC5314-NEON at 1 X 10^7 cfu/ml combined into the yolk sac of the larval zebrafish to simulate an infection. Following use in experiments, zebrafish were transferred to a 31°C incubator and monitored for survival every 24 hours for 72 hours. Which of the following outcomes is most likely?
A. Co-infections of GBS and C. albicans by yolk sac injection were more virulent than solo infections with either pathogen
B. Co-infections of GBS and C. albicans by yolk sac injection were as virulent as solo infections with either pathogen
C. Co-infections of GBS and C. albicans by yolk sac injection were less virulent than solo infections with either pathogen
|
B. Co-infections of GBS and C. albicans by yolk sac injection were as virulent as solo infections with either pathogen
|
- Streptococcus agalactiae (GBS): A Gram-positive, opportunistic pathogen that colonizes the gastrointestinal and/or vaginal tract of many healthy people. While often commensal, it can cause severe, life-threatening infections in high-risk patients like newborns.
- Candida albicans: An opportunistic pathogenic yeast that commonly colonizes the vaginal tract. It is polymorphic (growing as yeast or hyphae) and can cause infections ranging from superficial thrush to severe systemic disease.
- Polymicrobial interactions: The complex relationships between different microbial species, such as bacteria and fungi, co-existing in a shared environment. These interactions can alter the growth, virulence, and treatment susceptibility of the microbes involved.
- Zebrafish (larval) infection model: A common vertebrate model used to study infectious diseases in vivo. Its larvae are transparent, allowing visualization of systemic infections simulated by yolk sac injection.
|
[{"label":"RBK Item","value":"- Streptococcus agalactiae (GBS): A Gram-positive, opportunistic pathogen that colonizes the gastrointestinal and/or vaginal tract of many healthy people. While often commensal, it can cause severe, life-threatening infections in high-risk patients like newborns."},{"label":"Title","value":"Group B Streptococcus (Streptococcus agalactiae)"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC6432937/"},{"label":"Date","value":"Mar 22, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Candida albicans: An opportunistic pathogenic yeast that commonly colonizes the vaginal tract. It is polymorphic (growing as yeast or hyphae) and can cause infections ranging from superficial thrush to severe systemic disease."},{"label":"Title","value":"Candida albicans pathogenicity mechanisms"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC3654610/"},{"label":"Date","value":"Jan 9, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Polymicrobial interactions: The complex relationships between different microbial species, such as bacteria and fungi, co-existing in a shared environment. These interactions can alter the growth, virulence, and treatment susceptibility of the microbes involved."},{"label":"Title","value":"Polymicrobial Interactions: Impact on Pathogenesis and Human Disease"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC3255964/"},{"label":"Date","value":"Jan 1, 2012"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Zebrafish (larval) infection model: A common vertebrate model used to study infectious diseases in vivo. Its larvae are transparent, allowing visualization of systemic infections simulated by yolk sac injection."},{"label":"Title","value":"A zebrafish larval model reveals early tissue-specific innate immune responses to Mucor circinelloides"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC4631785/"},{"label":"Date","value":"Nov 1, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Cancer Biology
|
MCQ
|
Targeting the Glucose–Insulin Link in Head and Neck Squamous Cell Carcinoma Induces Cytotoxic Oxidative Stress and Inhibits Cancer Growth
|
https://aacrjournals.org/cancerrescommun/article/5/6/921/762850/Targeting-the-Glucose-Insulin-Link-in-Head-and
|
June 06, 2025
|
Researchers evaluated whether treatment with streptozotocin (STZ) alters the growth of head and neck squamous cell carcinoma (HNSCC) xenografts in immunodeficient mice. Six-week-old male NOD/SCID and NOD/SCID gamma mice were individually marked and weighed, and baseline tail-vein blood glucose was measured with a OneTouch Ultra glucometer. STZ was freshly dissolved in ice-cold 0.1 M sodium citrate buffer (pH 4.5) and administered intraperitoneally at 40 mg/kg once daily for five consecutive days; age-matched controls received buffer alone. Mice were housed under SPF conditions with chow and water ad libitum and observed daily for health and body weight. One week after the final injection, non-fasted blood glucose was re-measured. For tumor implantation, HNSCC cells FaDu, authenticated and Mycoplasma-free, were harvested in log phase, counted, and resuspended 1:1 in serum-free medium and growth-factor–reduced Matrigel on ice; 5 × 10^6 cells in 100 μL were injected subcutaneously into the right flank of diabetic and control mice. Tumor length and width were recorded with digital calipers 2-3 times per week for up to three weeks, and volume was calculated as (length × width^2)/2; body weight and clinical condition were recorded concurrently. At endpoint, mice were euthanized; blood was collected by cardiac puncture for plasma isolation and insulin ELISA, and tumors were excised, weighed, and divided for histopathology (10% neutral-buffered formalin, FFPE), protein analysis (snap-frozen for immunoblotting), and RNA analysis (snap-frozen for qPCR/RNA-seq).
|
- Baseline blood glucose concentration measured from tail-vein samples using a glucometer (pre-STZ vs. post-STZ induction; STZ-treated vs. buffer-treated controls).
- Plasma insulin concentration measured by ELISA from terminal blood samples
- Tumor volume measured by digital calipers 2-3 times per week for up to three weeks
- Quantification of IHC markers Ki67, pS6, 4HNE and γ-H2A.X (% positive area) using ImageJ
- Protein expression from snap-frozen tumor lysates analyzed by immunoblot (pS6, Ki67, 4HNE-modified proteins, y-H@A.X normalized to β-actin or GAPDH).
- RNA expression from tumor tissue analyzed by qPCR or RNA-seq (mTOR pathway genes, cell proliferation genes, oxidative stress genes, DNA damage response genes, insulin receptor pathway genes).
|
Researchers evaluated whether streptozotocin (STZ) treatment alters the growth and molecular characteristics of head and neck squamous cell carcinoma (HNSCC) xenografts in immunodeficient mice. Six-week-old NOD/SCID and NOD/SCID gamma mice received daily intraperitoneal injections of STZ or buffer for five days. FaDu cells were then implanted subcutaneously, and tumor growth was monitored for three weeks. Predict which of the following occured?
A. Tumors in STZ-treated mice have larger tumours and show increased 4HNE and γ-H2A.X staining compared with controls
B. Tumors in STZ-treated mice show decreased Ki67and pS6 staining compared with controls
C. Tumors in STZ-treated mice are smaller with increased 4HNE and pS6
D. STZ-treated mice have smaller tumours with decreased Ki67, pS6 and 4HNE
|
B. Tumors in STZ-treated mice show decreased Ki67and pS6 staining compared with controls
|
- HNSCC is a malignancy derived from the squamous epithelium of the upper aerodigestive tract, including the oral cavity, pharynx, and larynx, often displaying metabolic reprogramming toward elevated glycolysis and oxidative stress tolerance.
- Streptozotocin is a nitrosourea compound that selectively destroys pancreatic β-cells via DNA alkylation and oxidative stress, producing insulin-deficient diabetic models.
- Insulin activates PI3K-AKT-mTOR signaling to regulate glucose uptake, cell proliferation, and protein synthesis; loss of insulin signaling limits anabolic metabolism.
- Ki67 is a nuclear protein expressed during active cell-cycle phases (G₁, S, G₂, M); in tumors, high Ki67 labeling indicates rapid proliferation and is reduced when growth is metabolically or therapeutically suppressed.
- pS6 is a downstream marker of mTORC1 activity; its phosphorylation correlates with active protein synthesis and tumor growth signaling, and decreases when nutrient or insulin pathways are inhibited.
- 4HNE is a lipid peroxidation product that accumulates under oxidative stress; in tumor tissues, elevated 4HNE immunostaining indicates increased ROS-mediated damage and impaired redox homeostasis.
- γ-H2A.X is the phosphorylated form of histone H2A.X at Ser139 that marks DNA double-strand breaks; in tumors, elevated γ-H2A.X indicates genotoxic or oxidative stress–induced DNA damage.
|
[{"label":"RBK Item","value":"HNSCC is a malignancy derived from the squamous epithelium of the upper aerodigestive tract, including the oral cavity, pharynx, and larynx, often displaying metabolic reprogramming toward elevated glycolysis and oxidative stress tolerance."},{"label":"Title","value":"Head and neck squamous cell carcinoma"},{"label":"URL","value":"https://www.nature.com/articles/s41572-020-00224-3"},{"label":"Date","value":"November 26, 2020"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Streptozotocin is a nitrosourea compound that selectively destroys pancreatic β-cells via DNA alkylation and oxidative stress, producing insulin-deficient diabetic models."},{"label":"Title","value":"The Streptozotocin-Induced Diabetic Nude Mouse Model: Differences between Animals from Different Sources"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC3155402/"},{"label":"Date","value":"August 1, 2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Insulin activates PI3K-AKT-mTOR signaling to regulate glucose uptake, cell proliferation, and protein synthesis; loss of insulin signaling limits anabolic metabolism."},{"label":"Title","value":"The PI3K-AKT network at the interface of oncogenic signalling and cancer metabolism"},{"label":"URL","value":"https://www.nature.com/articles/s41568-019-0216-7"},{"label":"Date","value":"November 4, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Ki67 is a nuclear protein expressed during active cell-cycle phases (G₁, S, G₂, M); in tumors, high Ki67 labeling indicates rapid proliferation and is reduced when growth is metabolically or therapeutically suppressed."},{"label":"Title","value":"The Ki-67 protein: from the known and the unknown"},{"label":"URL","value":"https://onlinelibrary.wiley.com/doi/10.1002/(SICI)1097-4652(200003)182:3%3C311::AID-JCP1%3E3.0.CO;2-9"},{"label":"Date","value":"January 31, 2000"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"pS6 is a downstream marker of mTORC1 activity; its phosphorylation correlates with active protein synthesis and tumor growth signaling, and decreases when nutrient or insulin pathways are inhibited."},{"label":"Title","value":"Regulation and function of ribosomal protein S6 kinase (S6K) within mTOR signalling networks"},{"label":"URL","value":"https://portlandpress.com/biochemj/article-abstract/441/1/1/47374/Regulation-and-function-of-ribosomal-protein-S6?redirectedFrom=fulltext"},{"label":"Date","value":"August 5, 2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"4HNE is a lipid peroxidation product that accumulates under oxidative stress; in tumor tissues, elevated 4HNE immunostaining indicates increased ROS-mediated damage and impaired redox homeostasis. "},{"label":"Title","value":"4-Hydroxy-2-nonenal: a product and mediator of oxidative stress"},{"label":"URL","value":"linkinghub.elsevier.com/retrieve/pii/S0163782703000146"},{"label":"Date","value":"April 3, 2003"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"γ-H2A.X is the phosphorylated form of histone H2A.X at Ser139 that marks DNA double-strand breaks; in tumors, elevated γ-H2A.X indicates genotoxic or oxidative stress–induced DNA damage."},{"label":"Title","value":"DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139"},{"label":"URL","value":"https://www.jbc.org/article/S0021-9258(18)67851-2/fulltext"},{"label":"Date","value":"March 6, 1998"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Immunology
|
MCQ
|
P2RY2 is a purinergic immune checkpoint linking extracellular ATP to immune
evasion and adaptive resistance to immunotherapy.
|
https://www.biorxiv.org/content/10.1101/2025.10.09.681049v1
|
October 10, 2025
|
Scientists investigated how extracellular ATP (eATP) and its non-hydrolyzable analog (nhATP) protect tumor cells by suppressing T-cell activation and cytotoxicity. In this research, the coculture of tumor cells (BxPC-3 or SW480 cells) and T cells (MART-1-TCR-T and CEA CAR-T) was used. For the cocultures of tumor cells and T cells, 50,000–200,000 tumor cells were seeded in each well of a 6-well plate, while for 96-well plates, 5,000–10,000 tumor cells were seeded. T cells and antigen-expressing tumor cells were mixed at ratios ranging from 1:1 to 1:32 as indicated. After incubation at 37°C and 5% CO₂ for the specified durations, tumor cell viability was assessed using either the CellTiter Blue Assay (Promega, Cat# G8020). Cocultures were conducted in the absence or presence of 200 μM ATP or non-hydrolyzable ATP analog (nhATP) at specified effector-to-target (T: Tumor) ratios. After 72 hours, tumor cell viability was assessed using the CellTiterBlue Cell Viability assay. In the monoculture assay, tumor cells (such as BxPC-3 or SW480) were cultured alone, without T cells, and treated with 200 μM ATP or the non-hydrolyzable analog ATPγS (nhATP) for 72 hours; after incubation, tumor cell proliferation was assessed using the CellTiter-Blue Cell Viability Assay.
|
- Tumor cell proliferation for monoculture experiments (T-cell growth rate with ATP, nhATP, and controls).
- Tumor cell viability for coculture experiments (tumor cells culture with T-cells with ATP or nhATP).
|
Scientists investigated how extracellular ATP (eATP) and its non-hydrolyzable analog (nhATP) protect tumor cells by suppressing T-cell activation and cytotoxicity. They cocultured tumor cells (BxPC-3 or SW480 cells) and T cells (MART-1-TCR-T and CEA CAR-T) in the absence or presence of 200 μM ATP or non-hydrolyzable ATP analog (nhATP) and checked tumor cell viability after 72 hours. They also cultured tumor cells alone without T-cells and treated them with 200 μM ATP or non-hydrolyzable ATP analog (nhATP) to measure tumor cell proliferation at 72 hours. Which of the following is the most likely outcome?
A) ATP enhanced tumor survival more strongly than nhATP in coculture, while neither affected proliferation in monoculture
B) Both ATP and nhATP enhanced tumor cell survival in coculture at the same level, but ATP had slightly greater impact on proliferation in monoculture
C) nhATP had a greater impact on tumor survival in coculture, while neither affected proliferation in monoculture
D) Both ATP and nhATP enhanced tumor cell survival in coculture, while neither had an impact on proliferation in monoculture
|
D) Both ATP and nhATP enhanced tumor cell survival in coculture, while neither had an impact on proliferation in monoculture
|
- Extracellular ATP (eATP) accumulates in the tumor microenvironment and rises during immunotherapy.
- eATP exhibits paradoxical immunomodulatory roles, as it acts as a pro-inflammatory “danger” signal that activates innate immune responses and facilitates adaptive immune priming, while persistently high concentrations of eATP (micromolar–millimolar range) exerts immunosuppressive effects.
|
[{"label":"RBK Item","value":"- Extracellular ATP (eATP) accumulates in the tumor microenvironment and rises during immunotherapy."},{"label":"Title","value":"Increased level of extracellular ATP at tumor sites: in vivo imaging with plasma membrane luciferase"},{"label":"URL","value":"https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0002599"},{"label":"Date","value":"July 9, 2008"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- eATP exhibits paradoxical immunomodulatory roles, as it acts as a pro-inflammatory “danger” signal that activates innate immune responses and facilitates adaptive immune priming, while persistently high concentrations of eATP (micromolar–millimolar range) exerts immunosuppressive effects."},{"label":"Title","value":"Extracellular ATP and P2 purinergic signalling in the tumour microenvironment"},{"label":"URL","value":"https://www.nature.com/articles/s41568-018-0037-0"},{"label":"Date","value":"July 13, 2018"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Neuropharmacology / Electrophysiology
|
MCQ
|
Positive Modulators of N-Methyl-D-Aspartate Receptor: Structure-Activity Relationship Study on Steroidal C-17 and C-20 Oxime Ethers
|
https://www.biorxiv.org/content/10.1101/2025.10.03.680025v1
|
October 3, 2025
|
Researchers synthesized a series of pregn-5-ene and androst-5-ene derivatives and evaluated their positive allosteric modulator (PAM) activity on N-methyl-D-aspartate receptors (NMDARs). For this aim, HEK293 cells were plated in 24-well plates at a density of 2 × 10^5 cells per well. The next day, the cells were transfected with cDNA encoding rat GluN1-1a and GluN2B subunits, along with green fluorescent protein, using the pCI-neo expression vector. Briefly, equal amounts (200 ng) of cDNAs encoding GluN1-1a, GluN2B, and GFP were mixed with 0.6 μl of Matra-A reagent (IBA, Gottingen, Germany) in 50 μL of Opti-MEM I and added to confluent HEK293 cells cultured in 24-well plates. After trypsinization, the cells were resuspended in Opti-MEM I containing 1% FBS, supplemented with 20 mM MgCl2, 1 mM D,L-2-amino-5-phosphonovaleric acid, 3 mM kynurenic acid, and 1 μM ketamine, and plated on 30 mm glass coverslips coated with collagen and poly-L-lysine. Transfected cells were identified by GFP epifluorescence. Electrophysiology experiments were performed 24–48 h after transfection.
Whole-cell current recordings, voltage-clamped at a holding potential of -60 mV, were performed at room temperature using a patch-clamp amplifier (Axopatch 200B; Molecular Devices, Sunnyvale, CA, USA) after capacitance and series resistance (<10 MΩ) compensation (80–90%). NMDAR current responses were low-pass filtered at 2 kHz, digitally sampled at 5 kHz, and analysed using pClamp software (version 10.6; Molecular Devices). Patch pipettes (3–5 MΩ), pulled from borosilicate glass, were filled with an intracellular solution (ICS) containing 15 mM CsCl, 10 mM BAPTA, 3 mM MgCl2, 1 mM CaCl2, 120 mM gluconic acid, 10 mM HEPES, and 2 mM ATP-Mg salt (pH adjusted to 7.2 with CsOH). The extracellular solution (ECS) contained: 160 mM NaCl, 2.5 mM KCl, 0.2 mM EDTA, 10 mM glucose, 10 mM HEPES, and 0.7 mM CaCl2 (pH adjusted to 7.3 with NaOH). NMDAR responses were induced by 1 μM glutamate and 30 μM glycine. 1% DMSO was present in all control and testing solutions. Solution applications were performed using a microprocessor-controlled multibarrel fast-perfusion system with a solution exchange rate around the cells of ~10 ms. Compound 12 (20-Oxo-pregn-5-en-3β-yl hemiglutarate O-ethyloxime), or pregnenolone sulfate (PES) were included in the testing solutions, over a concentration range of 0.3 - 100 μM.
The degree of modulation (E; potentiation/ inhibition) for the newly synthesized compounds was determined using the following formula: E (%) = ((Ie − Ia)/Ia) × 100; where Ie is the value of the current amplitude during glutamate and compound co-application and Ia is the current amplitude value for glutamate application. Emax was defined as the maximal value of potentiation induced by a saturating concentration of the compound, and EC50 was defined as the concentration of the compound that produces half-maximal potentiation of the agonist-evoked current.
|
- Degree of modulation (%) of the glutamate-evoked current, in GluN1-1a + GluN2B co-transfected HEK293 cells, under application of compound 12 (20-Oxo-pregn-5-en-3β-yl hemiglutarate O-ethyloxime) or pregnenolone sulfate (PES) (0.3 - 100 μM).
- Maximal potentiation values (Emax) (%) of compound 12 (20-Oxo-pregn-5-en-3β-yl hemiglutarate O-ethyloxime) or pregnenolone sulfate (PES) in GluN1-1a + GluN2B co-transfected HEK293 cells.
- Half-maximal potentiation concentration (EC50) (μM) of compound 12 (20-Oxo-pregn-5-en-3β-yl hemiglutarate O-ethyloxime) or pregnenolone sulfate (PES) in GluN1-1a + GluN2B co-transfected HEK293 cells.
|
Under whole-cell recordings at -60 mV from HEK293 cells co-expressing rat GluN1/GluN2B, glutamate (1 μM) + glycine (30 μM) were rapidly applied with 0.3-100 μM of a neurosteroid (20-Oxo-pregn-5-en-3β-yl hemiglutarate O-ethyloxime) named compound 12. Relative to pregnenolone sulfate (PES), which quantitative profile best matches compound 12?
A. High-gain positive allosteric modulator: E_max ≈ 470% with EC_50 ≈ 6 μM. Both significantly more efficacious and more potent than PES measured in the same assay windows.
B. Efficacy-limited positive allosteric modulator: E_max ≈ 290% with EC_50 ≈ 7μM. More potent than PES but only ~2.5x its efficacy, with responses plateauing by ~30 μM.
C. High-gain positive allosteric modulator: E_max ≈ 670% with EC_50 ≈ 9 μM. Both more efficacious and more potent than PES.
D. Ultra-potent ceiling-effect positive allosteric modulator: EC_50 < 1 μM with E_max ≈ 250%. Substantially more potent but constrained by a low efficacy ceiling relative to PES.
|
C. High-gain positive allosteric modulator: E_max ≈ 670% with EC_50 ≈ 9 μM. Both more efficacious and more potent than PES.
|
- Endogenous neurosteroids such as pregnanolone sulfate and pregnenolone sulfate are well-established modulators of N-methyl-D-aspartate receptors.
- For steroidal N-methyl-D-aspartate receptors modulators, planar 3β-hydroxy-Δ5,6-ene scaffolds are associated with potentiation, and bent 3α-hydroxy-5β scaffolds are associated with inhibition.
|
[{"label":"RBK Item","value":"- Endogenous neurosteroids such as pregnanolone sulfate and pregnenolone sulfate are well-established modulators of N-methyl-D-aspartate receptors."},{"label":"Title","value":"Neurosteroid modulation of N-methyl-d-aspartate receptors: Molecular mechanism and behavioral effects"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S0039128X11002807?via%3Dihub"},{"label":"Date","value":"September 7, 2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the RBK item cited by this paper"},{"label":"RBK Item","value":"- For steroidal N-methyl-D-aspartate receptors modulators, planar 3β-hydroxy-Δ5,6-ene scaffolds are associated with potentiation, and bent 3α-hydroxy-5β scaffolds are associated with inhibition."},{"label":"Title","value":"Geometry and Charge Determine Pharmacological Effects of Steroids on N-Methyl-d-aspartate Receptor-Induced Ca2+ Accumulation and Cell Death"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S0022356524392948"},{"label":"Date","value":"June, 2000"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the RBK item cited by this paper"}]
|
Biology
|
Molecular Biology
|
Free-Format Question
|
Molecular determinants underlying functional divergence of TBP homologs
|
https://www.biorxiv.org/content/10.1101/2025.10.03.680374v1
|
October 4, 2025
|
To examine the evolutionary divergence of TATA-box binding protein (TBP) homologs in different species, researchers determined the ability of murine TBP and its paralogs to complement endogenous TBP in Saccharomyces cerevisiae. To generate a TBP replacement system, a S. cerevisiae strain with a temperature-sensitive TBP allele (tsTBP) was used; which is conditionally inactivated at the restrictive temperature of 36.5 ± 0.5 ºC. S. cerevisiae (tsTBP) strain was transformed with HA-tagged constructs expressing wild-type yeast TBP (HA-yTBP), mouse TBP (HA-mTBP), a mouse TBP with truncated conserved core domain (HA-mTBPc) and an empty vector control. All constructs were driven by the 5’ and 3’ UTR of the endogenous yeast TBP, and protein expression was verified by anti-HA Western blotting. Yeast cultures were grown in either selective media after transformation or YPD media (1% yeast extract, 2% peptone, and 2% dextrose).
To examine DNA binding of the different TBP variants, transformed strains were grown under restrictive temperature (36.5 ± 0.5 ºC), and after 3 hours at the restrictive temperature, a spike-in normalized HA ChIP-seq was performed. For this purpose, cells were harvested, crosslinked in 1% formaldehyde for 20 minutes and quenched with the addition of liquid glycine to 300 mM for a further 5 minutes at room temperature. Cells were lysed by bead beating, and cell lysate was spun down at 15,000g for 30 minutes. The cell pellet was resuspended in lysis buffer (50 mM HEPES, pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate) and sonicated (Covaris Sonicator S220) to produce an average fragment size of 250 bp. The lysate was spun down at 9000g for 10 minutes, and the supernatant was precleared by rotating with Protein G Dynabeads for 1 hour at 4 °C. Five percent of the lysate was reserved for input, and the remaining was split and incubated with α-HA (EpiCypher 13-2010), antibody overnight at 4 °C, respectively. Antibody immunoprecipitations were isolated by adding magnetic Protein G Dynabeads and rotating at 4 °C for 1 h, and 5 minute washes were performed twice with lysis buffer, twice with high salt buffer (50 mM HEPES pH 7.5, 500 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium-deoxycholate), twice with LiCl wash buffer (10 mM Tris-HCl pH 8.0, 250 mM LiCl, 0.6% NP-40, 0.5% sodium-deoxycholate, 1 mM EDTA), and once with TE (10mM Tris pH 8.0, 1 mM EDTA). Synthetic spike-in E coli DNA was added to eluates, to aid in quantification. Following proteinase K digestion, DNA was purified by phenol, chloroform, isoamyl alcohol extraction and RNase A treated. ChIP-seq libraries were prepared using a library prep strategy for Illumina sequencing that uses TruSeq-Y Adapters with a free 3'T overhang. Reads were trimmed for adapters sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCA and mapped on sacCre3 genome build using Bowtie2 with the following parameters: --local --very-sensitive-local --no-unal --no- mixed --no-discordant --phred33 -I 10 -X 700. Polymerase chain reaction (PCR) duplicate reads were removed. A normalization factor was determined from E coli DNA (normalized to the control) alignment from Bowtie2 mapping and used to scale during the generation of bigwig files. Replicates were averaged using bigwigAverage, which averages the reads after normalization. Downstream analyses, heatmaps, TSS plots, gene plots, and k-means clustering were performed using IGV, DeepTools, and BedTools suite. ComputeMatrix from deeptools was done using binsize 10. After alignment and de-duplication, spike-in normalized reads from averaged and individual replicates were displayed as average profiles and heatmaps in a 2kb window around the transcription start site (TSS) for all genes.
|
- Normalized reads around the transcription start site (± 2kb) for all genes of S. cerevisiae (tsTBP) strains transformed HA-yTBP, HA-mTBP, HA-mTBPc and empty vector control, after 3h of culture under restrictive temperature (36.5 ± 0.5 ºC) (spike-in normalized HA ChIP-seq)
- RNA polymerase II promoter occupancy in S. cerevisiae (tsTBP) strains transformed HA-yTBP, HA-mTBP, HA-mTBPc and empty vector control, after 3h of culture under restrictive temperature (36.5 ± 0.5 ºC) (spike-in normalized HA ChIP-seq)
|
To examine the evolutionary divergence of TATA-box binding protein (TBP) homologs, a S. cerevisiae strain with a temperature-sensitive TBP allele (tsTBP), conditionally inactivated at the restrictive temperature of 36.5 ± 0.5 ºC, was transformed with HA-tagged constructs expressing wild-type yeast TBP (HA-yTBP), mouse TBP (HA-mTBP), a mouse TBP with truncated conserved core domain (HA-mTBPc) and an empty vector control. Transformed strains were grown under restrictive temperature (36.5 ± 0.5 ºC), and after 3 hours at the restrictive temperature, a spike-in normalized HA ChIP-seq was performed. Spike-in normalized reads in a 2kb window around the transcription start site (TSS) for all genes were employed to determine the ability of the different TBPs to bind gene promoters. What is the expected difference in terms of RNA polymerase II promoter occupancy observed between HA-mTBP, HA-mTBPc, and HA-yTBP?
|
HA-yTBP bound strongly at promoters of expressed genes, while both HA-mTBP and HA-mTBPc bound RNA Pol II promoters, though globally at only ~28% HA-yTBP levels. HA-mTBPc displayed a modestly higher promoter occupancy than HA-mTBP.
|
- Eukaryotes share three RNA Pols (Pol I-III), largely responsible for ribosomal, messenger, and transfer RNA (rRNA, mRNA, tRNA), respectively.
- The TATA-box binding protein (TBP) is the only general transcription factor required by all three RNA Pols (Pol I-III): The RNA polymerase I transcription factor, upstream binding factor, interacts directly with the TATA box-binding protein.
- The TATA-box binding protein (TBP) contains a conserved DNA-binding core domain that recognizes the promoters and binds to the DNA minor groove, and a divergent N-terminal domain (NTD): TFIID binds in the minor groove of the TATA box.
|
[{"label":"RBK Item","value":"- Eukaryotes share three RNA Pols (Pol I-III), largely responsible for ribosomal, messenger, and transfer RNA (rRNA, mRNA, tRNA), respectively."},{"label":"Title","value":"Evolution of multisubunit RNA polymerases in the three domains of life"},{"label":"URL","value":"https://www.nature.com/articles/nrmicro2507"},{"label":"Date","value":"January 13, 2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the RBK item cited by this article"},{"label":"RBK Item","value":"- The TATA-box binding protein (TBP) is the only general transcription factor required by all three RNA Pols (Pol I-III): The RNA polymerase I transcription factor, upstream binding factor, interacts directly with the TATA box-binding protein."},{"label":"Title","value":"The RNA polymerase I transcription factor, upstream binding factor, interacts directly with the TATA box-binding protein"},{"label":"URL","value":"https://pubmed.ncbi.nlm.nih.gov/7982918/"},{"label":"Date","value":"December 2, 1994"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- The TATA-box binding protein (TBP) contains a conserved DNA-binding core domain that recognizes the promoters and binds to the DNA minor groove, and a divergent N-terminal domain (NTD)"},{"label":"Title","value":"TFIID binds in the minor groove of the TATA box"},{"label":"URL","value":"https://linkinghub.elsevier.com/retrieve/pii/0092-8674(91)90299-E"},{"label":"Date","value":"December 20, 1991"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled version is the RBK item cited by this article"}]
|
Biology
|
Cytotoxic natural products
|
Free-Format Question
|
Pomegranate root extract possesses anti-metastatic potential by suppressing invasiveness and vasculogenic mimicry capability of cancer cells
|
https://pmc.ncbi.nlm.nih.gov/articles/PMC12505693/pdf/main.pdf
|
Sep 26, 2025
|
Cell viability in A549 lung cancer cells was measured by seeding cells into 96-well plates at a density of 1 × 10 4 cells/well and incubated for 24 h. After that, cells were incubated with leaf extract (PL) (0.1 µg/ml), root extract (PR) (0.1 µg/ml), and without extract (control) for 24 hs. At the end of treatment, culture media in each well were replaced with media containing MTT and further incubated for 2 h. Then, the media in each well were replaced with DMSO to solubilize formazan product. Absorbance was measured by using a microplate reader, absorbance at 550 nm was subtracted with absorbance at 650 nm. The number of viable cells was determined from the absorbance and expressed as percent cell viability compared with control.
|
- Number of viable A549 cells after treatment with extracts (Leaf extract or pomegranate root extract).
- Cell viability (%) of A549 cells after treatment with extracts (Leaf extract or pomegranate root extract).
|
Researchers treated A549 lung cancer cells (1x10⁴ cells/well) grown in vitro with 0.1 µg/ml of pomegranate leaf (PL) and root (PR) extracts in order to determine the cell viability after treatment with these extracts. After 24 h, culture media was replaced with media containing MTT and incubated for 2 h. Formazan product was solubilized by replacing media with DMSO, and absorbance was measured with a microplate reader at 550 nm and 650 nm. The number of viable cells and the percentage cell viability was calculated. Which of the extract would be less cytotoxic for A549 cells?
|
Pomegranate root extract
|
- Pomegranate (Punica granatum L.) is a fruit tree that has been reported to prevent cancer metastasis of various cancers.
- Pomegranate leaf extract induces apoptosis and inhibits migration and invasion in non-small cell lung carcinoma.
|
[{"label":"RBK Item","value":"Pomegranate (Punica granatum L.) is a fruit tree that has been reported to prevent cancer metastasis of various cancers."},{"label":"Title","value":"Molecular targets of pomegranate (Punica granatum) in preventing cancer metastasis"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC6880535/"},{"label":"Date","value":"Sep 22, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Pomegranate leaf extract induces apoptosis and inhibits migration and invasion in non-small cell lung carcinoma. "},{"label":"Title","value":"Punica granatum (pomegranate) leaves extract induces apoptosis through mitochondrial intrinsic pathway and inhibits migration and invasion in non-small cell lung cancer in vitro"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/S0753332215303772"},{"label":"Date","value":"May, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Microbiology
|
Free-Format Question
|
Investigating Bacterial Vaginosis Pathogenesis Using Peptide Nucleic Acid-Fluorescence In Situ Hybridization With a Focus on the Roles of Gardnerella Species, Prevotella bivia, and Fannyhessea vaginae
|
https://academic.oup.com/ofid/article/12/9/ofaf556/8246403
|
September 3, 2025
|
Researchers tracked bacterial colonization dynamics before, during, and after incident bacterial vaginosis (iBV) in women. Over the course of 60 days, vaginal specimens were collected twice daily from women (heterosexual, non-pregnant, aged 18-45, optimal microbiota at enrollment) who developed incident bacterial vaginosis (iBV). iBV diagnosis was defined as a Nugent score of 7–10 on ≥4 consecutive specimens with age, race, and contraceptive matched controls. Samples from iBV cases covered 14 days before diagnosis (day −14), the day of diagnosis (day 0), and 3 days after (day +3); controls provided 18 daily samples matched by menstrual cycle. Each 20 µL specimen was fixed on epoxy-coated slides at 37°C using methanol, paraformaldehyde, and ethanol, then hybridized with 10 µL of 200 nM peptide nucleic acid (PNA) probes targeting 23S rRNA of Prevotella bivia species. Hybridization (PNA–fluorescence in situ hybridization [PNA-FISH]) and washing were performed (incubation at 60 °C for 90 min and washing at 60 °C for 30 min), followed by 4′,6-diamidino-2-phenylindole (DAPI) counterstaining. Slides were imaged under fluorescence microscopy, and bacterial counts were obtained manually or with Fiji/ImageJ. Median bacterial counts per species were calculated from six fields per sample and compared between cases and controls.
|
- Prevotella bivia bacterial cell count (number of bacteria per microscopic field) in incident BV (iBV) cases vs. matched controls -14 to +3 days relative to iBV diagnosis under fluorescence microscopy after PNA-FISH staining.
|
Researchers tracked bacterial colonization dynamics before, during, and after incident bacterial vaginosis (iBV) in women. Over the course of 60 days, vaginal specimens were collected twice daily from women (heterosexual, non-pregnant, aged 18-45, optimal microbiota at enrollment) who developed incident bacterial vaginosis (iBV). iBV diagnosis was defined as a Nugent score of 7–10 on ≥4 consecutive specimens with age, race, and contraceptive matched controls. Samples from iBV cases covered 14 days before diagnosis (day −14), the day of diagnosis (day 0), and 3 days after (day +3); controls provided 18 daily samples matched by menstrual cycle. Each 20 µL specimen was fixed on epoxy-coated slides at 37°C using methanol, paraformaldehyde, and ethanol, then hybridized with 10 µL of 200 nM peptide nucleic acid (PNA) probes targeting 23S rRNA of Prevotella bivia species. Hybridization (PNA–fluorescence in situ hybridization [PNA-FISH]) and washing were performed (incubation at 60 °C for 90 min and washing at 60 °C for 30 min), followed by 4′,6-diamidino-2-phenylindole (DAPI) counterstaining. Slides were imaged under fluorescence microscopy, and bacterial counts were obtained manually or with Fiji/ImageJ. Median bacterial counts per species were calculated from six fields per sample and compared between cases and controls.
Predict the change in relative abundance (higher, lower, or no change) from pre-infection (14 days prior to infection) to post-infection phases (day 3 post-infection) of Prevotella bivia counts in women who develop iBV.
|
The relative abundance of Prevotella bivia is expected to show no significant change from the pre-infection to post-infection phases in women who develop iBV.
|
- Prevotella bivia is thought to be an early colonizer of the BV (bacterial vaginosis) biofilm.
- Mechanistically, BV is characterized by loss of protective, lactic acid and hydrogen peroxide-producing Lactobacillus spp. (eg, Lactobacillus crispatus, L. jensenii, and L. gasseri) and an overgrowth of facultative (Gardnerella spp.) and strict anaerobic bacteria such as Prevotella spp. and Fannyhessea vaginae.
|
[{"label":"RBK Item","value":"- Prevotella bivia is thought to be an early colonizer of the BV (bacterial vaginosis) biofilm.\n\n\n"},{"label":"Title","value":"An updated conceptual model on the pathogenesis of bacterial vaginosis"},{"label":"URL","value":"https://academic.oup.com/jid/article/220/9/1399/5542783"},{"label":"Date","value":"August 1, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Mechanistically, BV is characterized by loss of protective, lactic acid and hydrogen peroxide-producing Lactobacillus spp. (eg, Lactobacillus crispatus, L. jensenii, and L. gasseri) and an overgrowth of facultative (Gardnerella spp.) and strict anaerobic bacteria such as Prevotella spp. and Fannyhessea vaginae."},{"label":"Title","value":"Influence of biofilm formation by Gardnerella vaginalis and other anaerobes on bacterial vaginosis."},{"label":"URL","value":"https://academic.oup.com/jid/article-abstract/212/12/1856/2911944?redirectedFrom=fulltext&login=false"},{"label":"Date","value":"June 16, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Pharmacology/ Biotechnology
|
Numerical Values
|
Synthesis of silver nanoparticles from Vicia faba aqueous extract with cytotoxic activity against human acute T cell leukemia
|
https://www.nature.com/articles/s41598-025-03679-0
|
Sep 30, 2025
|
The researchers aimed to evaluate whether anticancer activity of silver nanoparticles (AgNPs) and aqueous extract of Vicia faba is concentration-dependent. The effect of AgNPs and aqueous extract of Vicia faba on the human acute T-cell leukemia cell line Jurkat was evaluated. Previously, seed coats from V. faba beans dry seeds were separated, milled to a 0.5 mm particle size and boiled in distilled water (1:100, 100° C, 5 minutes). Particles were filtered. For AgNPs synthesis the bottom-up method was employed. 50 mL of 1 mM AgNO3 solution were mixed with 50 mL of V. faba water extract and exposed to light for 10 minutes. The Jurkat cells were cultured in 48-well plates and exposed to five different concentrations of AgNPs or V. faba water extract: 0.375, 0.750, 1.5, 3, and 6 mg/mL, while untreated cells were used as a control. After 24 hours of incubation, cell viability was determined using the trypan blue exclusion test. The assay was performed in triplicate, and the results were calculated as the percentage of viable cells compared to the control. The 50% inhibitory concentration (IC50) was calculated from the dose-response curves.
|
- Cell viability (%) of Jurkat cells across concentrations (0.375, 0.750, 1.5, 3, 6 mg/mL) in AgNPs vs Vicia faba extract compared to control cells after 24 hours of exposure.
- Inhibitory concentration (IC50) after treatment with AgNPs or Vicia faba extract across concentrations (0.375, 0.750, 1.5, 3, 6 mg/mL) in Jurkat cells.
|
Jurkat cells (human acute T-cell leukemia cells) were cultured in 48-well plates and exposed to five different concentrations of silver nanoparticles (AgNPs) or Vicia faba aqueous extract: 0.375, 0.750, 1.5, 3, and 6 mg/mL. After 24 hours of incubation, cell viability was determined using the trypan blue dye-exclusion test, and the IC50 was calculated from dose–response curves.
After 24 hours of treatment, what is the predicted IC50 (in mg/mL) of AgNP on Jurkat cells?
|
2.04-2.50
|
- AgNPs are extremely small particles of silver with unique properties that can target cancer cells.
- A method of producing nanoparticles is the green synthesis using plant extract.
|
[{"label":"RBK Item","value":"- AgNPs are extremely small particles of silver with unique properties that can target cancer cells."},{"label":"Title","value":"Applications of nanoparticles in treatment and diagnosis of leukemia"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/pii/S0928493114006638?via%3Dihub"},{"label":"Date","value":"February 1, 2015"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- A method of producing nanoparticles is the green synthesis using plant extract.\n"},{"label":"Title","value":"A systematic review of biosynthesized metallic nanoparticles as a promising anti-cancer-strategy."},{"label":"URL","value":"https://www.mdpi.com/2072-6694/13/11/2818"},{"label":"Date","value":"June 5, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Molecular Biology, Cell Biology
|
Free-Format Question
|
Vector-free DNA transfection by nuclear envelope mechanoporation
|
https://www.arxiv.org/abs/2510.02468
|
October 2, 2025
|
An experiment was carried out to compare the temporal dynamics of EGFP expression in HeLa cells following transfection by three different delivery methods.
HeLa S3 cells were suspended in OptiMEM. EGFP-encoding plasmid DNA (gWiz-GFP) was added to the suspension at 0.1 mg/ml. The cell-DNA mixture was flowed through a microfluidic device, called NEST, at 28 psi using a pressure-driven syringe pump. The device incorporated nanolancets that mechanically porated both plasma membrane and nuclear envelope as cells passed through microchannels. After treatment, cells were collected, incubated on ice for 5 minutes, then recovered in antibiotic-free warm growth medium (DMEM with 10% FBS) at 37°C with 5% CO₂ for 10 minutes before culture.
For PEI transfection, HeLa cells at 70-90% confluence were transfected using 6.5 µg PEI complexed with 1 µg plasmid DNA in 150 mM NaCl per 500 µL medium. For Lipofectamine 2000 transfection, cells were transfected using 2 µL Lipofectamine complexed with 0.8 µg DNA per 500 µL growth medium per manufacturer protocol. Both chemical treatments were applied to plated cells 12-24 hours after seeding. Additional HeLa cells receiving no transfection treatment to served as a negative control.
Measurement of EGFP Expression: Following all treatments, cells were cultured in standard growth medium. At time points 0, 1, 2, 4, 12, and 24 hours post-treatment, cells were harvested and fixed with 2% paraformaldehyde for 15 minutes at room temperature. Transfection efficiency was assessed by multicolor flow cytometry (BD FACSCelesta Cell Analyzer), by measuring the percentage of viable cells expressing EGFP fluorescence above background. Each measurement comprised analysis of 10,000 cells per sample.
|
- EGFP expression level: percentage of total viable HeLa cells analyszed expressing EGFP, as measured by GFP fluorescence flow cytometry with a BD FACSCelesta Cell Analyzer, under four treatments (NEST device, PEI transfection, Lipofectamine 2000 transfection, negative control), at 0, 1, 2, 4, 12, and 24 hours post-treatment
|
Researchers investigated the temporal dynamics of protein expression following transfection of HeLa cells with EGFP-encoding plasmid DNA. Three delivery methods were evaluated: (1) a NEST microfluidic device operating at 28 psi flow pressure; (2) polyethylenimine (PEI)-based chemical transfection; and (3) Lipofectamine 2000 lipid-based transfection. Following treatment, cells were cultured under standard conditions and EGFP expression was monitored at multiple time points, including 4 hours and 12 hours. What is the expected pattern of EGFP expression across these delivery methods and two time points?
|
NEST treatment results in substantial EGFP expression by 4 hours that further increases by 12 hours, while PEI and Lipofectamine transfection show no detectable expression at 4 hours and only begin to show expression by the 12-hour time point.
|
- The most common transfection methods for producing genetically modified cells, using viral vectors, have a number of drawbacks, such as low throughput and immunogenicity.
- Mechanical delivery systems are an alternative to viral transfection, but typically have other drawbacks such a cell damage and imprecise delivery sites.
- Transfected DNA must reach the cell nucleus before being transcribed and expressing proteins; a plasmid not delivered to the nucleus must wait until cellular division to be incorporated.
- Microfluidics are an emerging platform for transfection overcoming the drawbacks of transfection using viruses and previous mechanical methods, and can achieve direct delivery into the cell nucleus.
- Expression levels of GFP, measured by flow cytometry, can be used as a suitable metric for transfection success and efficiency
|
[{"label":"RBK Item","value":"The most common transfection methods for producing genetically modified cells, using viral vectors, have a number of drawbacks, such as low throughput and immunogenicity."},{"label":"Title","value":"Transfection types, methods and strategies: a technical review"},{"label":"URL","value":"https://peerj.com/articles/11165/"},{"label":"Date","value":"April 21, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Mechanical delivery systems are an alternative to purely viral transfection, but typically have other drawbacks such a cell damage and imprecise delivery sites."},{"label":"Title","value":"Massively-Parallelized, Deterministic Mechanoporation for Intracellular Delivery"},{"label":"URL","value":"https://pubs.acs.org/doi/abs/10.1021/acs.nanolett.9b03175"},{"label":"Date","value":"October 24, 2019"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Transfected DNA must reach the cell nucleus before being transcribed and expressing proteins; a plasmid not delivered to the nucleus must wait until cellular division to be incorporated."},{"label":"Title","value":"Cytoplasmic transport and nuclear import of plasmid DNA"},{"label":"URL","value":"https://pmc.ncbi.nlm.nih.gov/articles/PMC5705778/"},{"label":"Date","value":"November 29, 2017"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Microfluidics are an emerging platform for transfection overcoming the drawbacks of transfection using viruses and previous mechanical methods, and can achieve direct delivery into the cell nucleus."},{"label":"Title","value":"A vector-free microfluidic platform for intracellular delivery"},{"label":"URL","value":"https://www.pnas.org/doi/abs/10.1073/pnas.1218705110"},{"label":"Date","value":"January 22, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Expression levels of GFP, measured by flow cytometry, can be used as a suitable metric for transfection success and efficiency."},{"label":"Title","value":"An Overview of Methods and Tools for Transfection of Eukaryotic Cells in vitro"},{"label":"URL","value":"https://www.frontiersin.org/journals/bioengineering-and-biotechnology/articles/10.3389/fbioe.2021.701031/full"},{"label":"Date","value":"July 19, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"}]
|
Biology
|
Neurobiology / Animal Behavior and Cognition.
|
MCQ
|
Dopamine supports reward prediction to constrain reward seeking
|
https://www.biorxiv.org/content/10.1101/2025.08.22.671841v1
|
Aug 24, 2025
|
Researchers tested whether cue-evoked nucleus accumbens (NAc) dopamine at cue onset shapes Pavlovian-to-instrumental transfer test (PIT) behavior using Long-Evans rats (Th-Cre⁺ and wild-type littermates). Th-Cre⁺ rats received bilateral ventral tegmental area (VTA) injections of AAV-FLEX-ArchT-tdTomato (opsin) or a fluorescent control; controls were handled identically; all rats had bilateral NAc optic fibers. The preliminary training included magazine (2 sessions; 30×45-mg pellets; ITI 60 s), Pavlovian (8 sessions; two 10-s cues at 75–78 dB: click 10 Hz, tone 1.5 kHz with 0.25-s on/off; CS90=90% reward, CS30=30%; 20 trials/cue; variable ITI 60–160 s, mean 110 s), and instrumental (≥8 sessions; CRF → RI-15 → RI-30 → RI-60; end after 30 outcomes or 40 min) → Pavlovian retraining (4 sessions). The PIT test (lever present, no rewards) included a 10 min lever-reward extinction, and then each 10-s cue was presented 10× in pseudorandom order (≤2 repeats) with fixed 110-s ITI and counterbalanced starting cue. During this PIT test, inhibit VTA-DA→NAc terminals at cue onset via the NAc fibers with continuous 532 nm light, 10 mW, 2.5 s, starting 0.5 s before each cue.
|
- Reward Seeking (Lever Presses): Lever presses measured during the $15\text{-s}$ analysis window ($10\text{-s}$ cue $+ 5\text{-s}$ post-cue period) compared to the $15\text{-s}$ pre-cue baseline period.
- Reward Checking (Food-Port Entries): Food-port checking responses measured during the $15\text{-s}$ analysis window, specifically excluding entries that occurred immediately ($\le 2~\text{s}$) following a lever press to isolate Pavlovian conditional responses.
- Behavioral Change ($\Delta$): The cue-induced change ($\Delta$) in lever presses and unlinked food-port entries calculated by subtracting baseline values from the values in the $15\text{-s}$ cue period.
- Optogenetic Effect: Comparison of lever presses and food-port entries between the ArchT group (inhibition applied) and the Control group (no inhibition effect).
|
Rats were trained on Pavlovian short-delay conditioning with two 10-s auditory cues predicting a 45-mg pellet at 30% (CS30) or 90% (CS90), then on instrumental lever pressing. In a Pavlovian-to-instrumental transfer (PIT) test (lever present; no rewards), Th-Cre⁺ rats expressing ArchT in VTA dopamine neurons received bilateral inhibition of VTA-DA→NA terminals via NAc optic fibers (continuous 532 nm, 10 mW, 2.5 s, starting 0.5 s before cue onset); controls expressed fluorescent proteins or were wild-type. Measurements: (i) lever presses during the 15-s analysis window (10-s cue + 5-s post-cue) relative to pre-cue baseline; (ii) food-port checking responses during the cue window that were not linked to presses. Relative to controls, which pattern best describes the behavioral effect of inhibiting VTA-DA→NAc terminals at cue onset?
A) Optical inhibition of cue-evoked VTA-DA→NAc activity decreased the reward-seeking motivational response to the low-probability cue, and no change in cue-evoked reward checking during both cues.
B) Optical inhibition of cue-evoked VTA-DA→NAc activity elevated the reward-seeking motivational response to both cues, and decreased cue-evoked reward checking during the high-probability cue.
C) Optical inhibition of cue-evoked VTA-DA→NAc activity led to no change in the reward-seeking motivational response to both cues, and elevated cue-evoked reward checking during the low-probability cue.
D) Optical inhibition of cue-evoked VTA-DA→NAc activity decreased the reward-seeking motivational response to the high-probability cue, and elevated cue-evoked reward checking during the high-probability cue.
|
B) Optical inhibition of cue-evoked VTA-DA→NAc activity elevated the reward-seeking motivational response to both cues, and decreased cue-evoked reward checking during the high-probability cue.
|
• Reward prediction & dopamine. Reward-predictive cues evoke brief dopamine signals that convey expected value; these transients can bias how animals pursue rewards.
• Mesolimbic pathway (VTA→NAc). Dopamine neurons in the ventral tegmental area project to the nucleus accumbens, a hub that shapes goal-directed approach and evaluation of reward-predictive cues.
• Pavlovian conditioning with probabilities. Repeated pairing of a cue (CS) with reward at defined probabilities (e.g., 30% vs 90%) assigns predictive value that differs by cue.
• Instrumental learning. Lever pressing is acquired because it produces pellets under schedules such as CRF and random-interval programs, creating an operant “seeking” response.
• Pavlovian-to-Instrumental Transfer (PIT). In extinction (no pellets delivered), Pavlovian cues can modulate ongoing instrumental pressing, allowing the effects of cues to be measured without new learning.
• Optogenetic terminal inhibition (ArchT). ArchT is a light-driven proton pump; green light (~532 nm) transiently suppresses activity in opsin-expressing neurons or their axon terminals at the illuminated site.
• Genetic targeting with Th-Cre. Th-Cre rats express Cre recombinase in tyrosine-hydroxylase–positive (dopaminergic) neurons, enabling Cre-dependent AAVs to restrict opsin expression to DA circuits.
• Behavioral readouts. “Reward seeking” refers to lever presses; “reward checking” refers to food-port entries not linked to a press, typically scored within defined cue/post-cue windows.
|
[{"label":"RBK Item","value":"The human gut microbiome exerts both local and distant effects involving hormonal intermediates, metabolites, and immunologic pathways."},{"label":"Title","value":"Role of the Microbiota in Immunity and Inflammation"},{"label":"URL","value":"https://www.cell.com/cell/fulltext/S0092-8674(14)00345-6?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS0092867414003456%3Fshowall%3Dtrue"},{"label":"Date","value":"March 27, 2014"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Interactions between the human host and microbes have the potential to influence carcinogenesis through mechanisms such as chronic inflammation, metabolism, induction of genotoxic responses, and alteration of the microenvironment."},{"label":"Title","value":"Evolving Concepts: How Diet and the Intestinal Microbiome Act as Modulators of Breast Malignancy"},{"label":"URL","value":"https://onlinelibrary.wiley.com/doi/10.1155/2013/693920"},{"label":"Date","value":"September 25, 2013"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"The ‘estrobolome’ is the aggregate of intestinal bacteria capable of metabolizing estrogens."},{"label":"Title","value":"Microbiome and Malignancy"},{"label":"URL","value":"https://www.cell.com/cell-host-microbe/fulltext/S1931-3128(11)00296-4?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS1931312811002964%3Fshowall%3Dtrue"},{"label":"Date","value":"October 20,2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"Modulation of estrogen homeostasis through the enterohepatic circulation by the gut microbiome can differ amongst individuals."},{"label":"Title","value":"Studies on the role of intestinal bacteria in metabolism of synthetic and natural steroid hormones"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/abs/pii/0022473184902085?via%3Dihub"},{"label":"Date","value":"January 1984"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"Conjugated estrogens excreted in bile can be deconjugated by resident bacterial taxa in the gut with β-glucuronidase\nenzymatic activity, subsequently leading to estrogen reabsorption into the circulation."},{"label":"Title","value":"The influence of the host on expression of intestinal microbial enzyme activities involved in metabolism of foreign compounds"},{"label":"URL","value":"https://pubmed.ncbi.nlm.nih.gov/3938453/"},{"label":"Date","value":"December 1985"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Biology
|
Behavioral ecology
|
Numerical Values
|
Foraging competence and scrounging tolerance enhance social relationships in a socially tolerant wild primate
|
https://www.biorxiv.org/content/10.1101/2025.06.12.659242v1
|
June 13, 2025
|
To investigate the influence of an individual’s role (in a foraging context) on its social relationships, researchers conducted experiments on four groups of human habituated red-fronted lemurs (Eulemur rufifrons), comprising a total of 31 individuals. The study animals were marked with a collar and a tag for individual identification. Two-option food dispenser (20x20x30 cm) was used for this experiment, with the apparatus composed of two main sections: a wooden base containing a cavity that held the food reward and an upper box constructed from four square panels with a sliding front door, forming a cube-like structure. To obtain the food reward, individuals could either lift the sliding door at the front or push the entire upper box backwards along the wooden foundation. The sliding door would fall back shut if not held open. Similarly, if the box was opened by pushing, metal springs would return it to its initial position after release. Eight cameras, at a distance of about 50 m from a study group, were placed to record activity as well as to prevent animals from witnessing experimenters filling the food boxes with the food rewards. These included four front-facing ground cameras, two overview cameras on tripods, and two tree-mounted cameras capturing top views. Next, red-fronted lemurs were attracted to the experimental setup using an acoustic signal produced by a standard animal training clicker. To minimise any association between humans and food, experimenters wore white lab coats throughout the procedure. The lemurs were first habituated to the food dispensers during three to four sessions in which the boxes were presented open or half-open and contained visible food rewards. Following this habituation period, the animals participated in ten experimental sessions where the food boxes were fully closed. Depending on the group, these sessions were conducted over four to six weeks. Each session lasted between 10 and 30 minutes and was concluded when all individuals had lost interest and left the testing area for at least one minute. For each session, synchronised video recordings were obtained and annotated using BORIS v.7.13.9. Annotations were scored based on the following behaviours: scrounging duration (feeding from a food box that another individual had opened), manipulating the box duration (touching the food box with either the hand or any part of the head for at least 1 s), success count (successfully opening of the food box), obseration duration (looking at an individual that successfully opened the food box) and the technique used to open the food box.
|
- Video record annotation of scrounging behaviour (duration) of members of the four groups of human habituated red-fronted lemurs during a session.
- Video record annotation of manipulating behaviour (duration) of members of the four groups of human habituated red-fronted lemurs during a session.
- Video record annotation of the success (count) of members of the four groups of human habituated red-fronted lemurs during a session.
- Video record annotation of the technique of members of the four groups of human habituated red-fronted lemurs during a session.
- Video record annotation of observation behaviour (duration) of members of the four groups of human habituated red-fronted lemurs during a session.
|
To investigate the influence of an individual’s role (in a foraging context) on its social relationships, researchers conducted experiments on four groups of human habituated red-fronted lemurs (Eulemur rufifrons), comprising a total of 31 individuals. The study animals were marked with a collar and a tag for individual identification. They used a two-option food dispenser (20x20x30 cm) for this experiment. They used a two-option food dispenser (20x20x30 cm) for this experiment. The food box consisted of two parts: a wooden foundation with a cavity containing the food reward (a mixture of raisins and pieces of peeled oranges) and an upper box composed of four square boards and a sliding door aligned in a cube-shaped manner. Individuals could access the food reward by lifting the sliding front door or pushing back the box on the foundation. Researchers placed eight cameras at a distance of about 50 m from a study group, recorded and annotated scores based on the animals' scrounging duration, and four other behaviours. What is the expected average percentage of successful openings with individuals scrounging?
|
Individuals scrounged for successful openings on average = [3.89 - 48.38] % obtained from 26.12 ± 22.26%. SD was provided and used as a fallback.
|
- Non-human primates are able to monitor and recognise the expertise of others and adapt their own behaviour in a fine-tuned manner to take advantage of these capabilities.
- Social learning is defined as changes in an individual's behaviour that result from exposure to another individual's behaviour or its products.
- In social learning experiments in which several individuals can interact at the experimental apparatus, naïve individuals exhibit scrounging behaviour, benefiting from the efforts of others rather than actively learning by themselves.
- Lemurs (Lemuriformes) are considered a model for early primate cognitive evolution
|
[{"label":"RBK Item","value":"- Non-human primates are able to monitor and recognise the expertise of others and adapt their own behaviour in a fine-tuned manner to take advantage of these capabilities."},{"label":"Title","value":"Group Responses To Specially Skilled Individuals in a Macaca Fascicularis Group"},{"label":"URL","value":"https://doi.org/10.1163/156853988X00368"},{"label":"Date","value":"January 01, 1988"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"- In social learning experiments in which several individuals can interact at the experimental apparatus, naïve individuals exhibit scrounging behaviour, benefiting from the efforts of others rather than actively learning by themselves."},{"label":"Title","value":"Social influences on the acquisition of tool-using behaviors in tufted capuchin monkeys (Cebus apella)"},{"label":"URL","value":"https://doi.org/10.1037/0735-7036.103.2.159"},{"label":"Date","value":"1989"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"},{"label":"RBK Item","value":"- Lemurs (Lemuriformes) are considered a model for early primate cognitive evolution."},{"label":"Title","value":"The gray mouse lemur (Microcebus murinus) as a model for early primate brain evolution"},{"label":"URL","value":"https://www.sciencedirect.com/science/article/pii/S0959438821001124"},{"label":"Date","value":"November 09, 2021"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"OA"},{"label":"RBK Item","value":"- Social learning is defined as changes in an individual's behaviour that result from exposure to another individual's behaviour or its products."},{"label":"Title","value":"Detecting social learning using networks: a users guide."},{"label":"URL","value":"https://doi.org/10.1002/ajp.20920"},{"label":"Date","value":"January 18, 2011"},{"label":"Justification (\"Paywalled\", \"OA\", \"Other (justify)\")","value":"Paywalled"}]
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.