Datasets:

RowanTELSCorp

/

train

like 0

A drawer unit includes: a drawer member allowed to shift toward a storage unit in an inserting direction, or shift from the storage unit in a drawing direction; a lock member rotatably supported by the drawer member; a first regulation member that engages with the lock member to regulate a shift of the drawer member when the drawer member is located at a first position; a second regulation member that engages with the lock member to regulate a shift of the drawer member when the drawer member is located at a second position; and an operation unit that receives a first operation that rotates the lock member in the drawing direction to allow engagement between the lock member and the first regulation member, and a second operation that rotates the lock member in the inserting direction to allow engagement between the lock member and the second regulation member.

1. A drawer unit comprising: a drawer member allowed to shift toward a storage unit in an inserting direction, or shift from the storage unit in a drawing direction; a lock member rotatably supported by the drawer member; a first regulation member that is included in the storage unit and engages with the lock member to regulate a shift of the drawer member in the drawing direction when the drawer member is located at a first position within the storage unit; a second regulation member that is included in the storage unit and engages with the lock member to regulate a shift of the drawer member in the drawing direction when the drawer member is located at a second position drawn from the first position; and an operation unit that receives a first operation that rotates the lock member in the drawing direction to allow engagement between the lock member and the first regulation member, and a second operation that rotates the lock member in the inserting direction to allow engagement between the lock member and the second regulation member. 2. The drawer unit according to claim 1, wherein the lock member is allowed to engage with the first regulation member in a first posture of the lock member, is allowed to engage with the second regulation member in a second posture of the lock member rotated in a predetermined direction from the first posture, and is released from engagement with the second regulation member in a third posture of the lock member further rotated in the predetermined direction from the second posture, and the lock member is rotated to the second posture by the first operation, and rotated to the third posture by the second operation. 3. The drawer unit according to claim 2, wherein the operation unit is attached to the drawer member. 4. The drawer unit according to claim 2, wherein the operation unit includes a first contact portion that contacts and presses the lock member in the first operation, and a second contact portion that contacts and presses the lock member in the second operation, and the first contact portion and the second contact portion are disposed on sides opposite to each other with respect to a rotation center of the lock member. 5. The drawer unit according to claim 4, wherein the lock member includes a rotation portion whose intermediate portion is rotatably supported by the drawer member, a lever portion that extends from one end of the rotation portion, and a hook portion that extends in a direction opposite to the rotation portion from a tip of the lever portion, and is allowed to engage with the first regulation member or the second regulation member in accordance with a posture of the lock member, and each of the first regulation member and the second regulation member is a protrusion that protrudes toward the lock member from the storage unit. 6. The drawer unit according to claim 5, wherein the first contact portion contacts another end of the rotation portion, and the second contact portion contacts the one end of the rotation portion. 7. The drawer unit according to claim 6, wherein the operation unit is a member allowed to reciprocate in the inserting direction or the drawing direction of the drawer member, and the operation unit includes an operation lever that supports the first contact portion and the second contact portion. 8. The drawer unit according to claim 7, wherein a shift amount of the operation unit from an initial position to a shift end in the second operation is larger than a shift amount of the operation unit from an initial position to a shift end in the first operation. 9. The drawer unit according to claim 5, wherein a protrusion amount of the first regulation member is smaller than a protrusion amount of the second regulation member. 10. The drawer unit according to claim 9, wherein the operation unit includes a stopper portion that contacts the lock member to regulate rotation of the lock member from the second posture to the third posture. 11. The drawer unit according to claim 10, wherein the lock member does not engage with the first regulation member but engages with the second regulation member when the lock member contacts the stopper portion to regulate the rotation of the lock member. 12. The drawer unit according to claim 10, wherein the stopper portion contacts the lock member when the first operation is performed for the operation unit, but does not contact the lock member when the second operation is performed for the operation unit. 13. The drawer unit according to claim 1, wherein the first position is a position at which the drawer member is inserted to an innermost position of the storage unit, and the second position is a position at which the drawer member is drawn to a maximum in a state supported by the storage unit. 14. The drawer unit according to claim 3, wherein the operation unit includes a first contact portion that contacts and presses the lock member in the first operation, and a second contact portion that contacts and presses the lock member in the second operation, and the first contact portion and the second contact portion are disposed on sides opposite to each other with respect to a rotation center of the lock member. 15. The drawer unit according to claim 14, wherein the lock member includes a rotation portion whose intermediate portion is rotatably supported by the drawer member, a lever portion that extends from one end of the rotation portion, and a hook portion that extends in a direction opposite to the rotation portion from a tip of the lever portion, and is allowed to engage with the first regulation member or the second regulation member in accordance with a posture of the lock member, and each of the first regulation member and the second regulation member is a protrusion that protrudes toward the lock member from the storage unit. 16. The drawer unit according to claim 15, wherein the first contact portion contacts another end of the rotation portion, and the second contact portion contacts the one end of the rotation portion. 17. The drawer unit according to claim 15, wherein a protrusion amount of the first regulation member is smaller than a protrusion amount of the second regulation member. 18. An image forming apparatus comprising: the drawer unit according to claim 1; a paper feeding mechanism that extracts recording paper stored in the drawer unit; and an image forming unit that forms an image on the recording paper extracted from the paper feeding mechanism. 19. A drawer unit comprising: a drawer member allowed to shift toward a storage unit in an inserting direction, or shift from the storage unit in a drawing direction; a lock member rotatably supported by the drawer member; a first regulation member that is included in the storage unit and engages with the lock member to regulate a shift of the drawer member in the drawing direction when the drawer member is located at a first position within the storage unit; a second regulation member that is included in the storage unit and engages with the lock member to regulate a shift of the drawer member in the drawing direction when the drawer member is located at a second position drawn from the first position; and an operation unit that receives a first operation performed for the drawer member to rotate the lock member in the drawing direction and allow engagement between the lock member and the first regulation member, and a second operation performed for the drawer member to rotate the lock member in the inserting direction and allow engagement between the lock member and the second regulation member.

A drawer unit includes: a drawer member allowed to shift toward a storage unit in an inserting direction, or shift from the storage unit in a drawing direction; a lock member rotatably supported by the drawer member; a first regulation member that engages with the lock member to regulate a shift of the drawer member when the drawer member is located at a first position; a second regulation member that engages with the lock member to regulate a shift of the drawer member when the drawer member is located at a second position; and an operation unit that receives a first operation that rotates the lock member in the drawing direction to allow engagement between the lock member and the first regulation member, and a second operation that rotates the lock member in the inserting direction to allow engagement between the lock member and the second regulation member.1. A drawer unit comprising: a drawer member allowed to shift toward a storage unit in an inserting direction, or shift from the storage unit in a drawing direction; a lock member rotatably supported by the drawer member; a first regulation member that is included in the storage unit and engages with the lock member to regulate a shift of the drawer member in the drawing direction when the drawer member is located at a first position within the storage unit; a second regulation member that is included in the storage unit and engages with the lock member to regulate a shift of the drawer member in the drawing direction when the drawer member is located at a second position drawn from the first position; and an operation unit that receives a first operation that rotates the lock member in the drawing direction to allow engagement between the lock member and the first regulation member, and a second operation that rotates the lock member in the inserting direction to allow engagement between the lock member and the second regulation member. 2. The drawer unit according to claim 1, wherein the lock member is allowed to engage with the first regulation member in a first posture of the lock member, is allowed to engage with the second regulation member in a second posture of the lock member rotated in a predetermined direction from the first posture, and is released from engagement with the second regulation member in a third posture of the lock member further rotated in the predetermined direction from the second posture, and the lock member is rotated to the second posture by the first operation, and rotated to the third posture by the second operation. 3. The drawer unit according to claim 2, wherein the operation unit is attached to the drawer member. 4. The drawer unit according to claim 2, wherein the operation unit includes a first contact portion that contacts and presses the lock member in the first operation, and a second contact portion that contacts and presses the lock member in the second operation, and the first contact portion and the second contact portion are disposed on sides opposite to each other with respect to a rotation center of the lock member. 5. The drawer unit according to claim 4, wherein the lock member includes a rotation portion whose intermediate portion is rotatably supported by the drawer member, a lever portion that extends from one end of the rotation portion, and a hook portion that extends in a direction opposite to the rotation portion from a tip of the lever portion, and is allowed to engage with the first regulation member or the second regulation member in accordance with a posture of the lock member, and each of the first regulation member and the second regulation member is a protrusion that protrudes toward the lock member from the storage unit. 6. The drawer unit according to claim 5, wherein the first contact portion contacts another end of the rotation portion, and the second contact portion contacts the one end of the rotation portion. 7. The drawer unit according to claim 6, wherein the operation unit is a member allowed to reciprocate in the inserting direction or the drawing direction of the drawer member, and the operation unit includes an operation lever that supports the first contact portion and the second contact portion. 8. The drawer unit according to claim 7, wherein a shift amount of the operation unit from an initial position to a shift end in the second operation is larger than a shift amount of the operation unit from an initial position to a shift end in the first operation. 9. The drawer unit according to claim 5, wherein a protrusion amount of the first regulation member is smaller than a protrusion amount of the second regulation member. 10. The drawer unit according to claim 9, wherein the operation unit includes a stopper portion that contacts the lock member to regulate rotation of the lock member from the second posture to the third posture. 11. The drawer unit according to claim 10, wherein the lock member does not engage with the first regulation member but engages with the second regulation member when the lock member contacts the stopper portion to regulate the rotation of the lock member. 12. The drawer unit according to claim 10, wherein the stopper portion contacts the lock member when the first operation is performed for the operation unit, but does not contact the lock member when the second operation is performed for the operation unit. 13. The drawer unit according to claim 1, wherein the first position is a position at which the drawer member is inserted to an innermost position of the storage unit, and the second position is a position at which the drawer member is drawn to a maximum in a state supported by the storage unit. 14. The drawer unit according to claim 3, wherein the operation unit includes a first contact portion that contacts and presses the lock member in the first operation, and a second contact portion that contacts and presses the lock member in the second operation, and the first contact portion and the second contact portion are disposed on sides opposite to each other with respect to a rotation center of the lock member. 15. The drawer unit according to claim 14, wherein the lock member includes a rotation portion whose intermediate portion is rotatably supported by the drawer member, a lever portion that extends from one end of the rotation portion, and a hook portion that extends in a direction opposite to the rotation portion from a tip of the lever portion, and is allowed to engage with the first regulation member or the second regulation member in accordance with a posture of the lock member, and each of the first regulation member and the second regulation member is a protrusion that protrudes toward the lock member from the storage unit. 16. The drawer unit according to claim 15, wherein the first contact portion contacts another end of the rotation portion, and the second contact portion contacts the one end of the rotation portion. 17. The drawer unit according to claim 15, wherein a protrusion amount of the first regulation member is smaller than a protrusion amount of the second regulation member. 18. An image forming apparatus comprising: the drawer unit according to claim 1; a paper feeding mechanism that extracts recording paper stored in the drawer unit; and an image forming unit that forms an image on the recording paper extracted from the paper feeding mechanism. 19. A drawer unit comprising: a drawer member allowed to shift toward a storage unit in an inserting direction, or shift from the storage unit in a drawing direction; a lock member rotatably supported by the drawer member; a first regulation member that is included in the storage unit and engages with the lock member to regulate a shift of the drawer member in the drawing direction when the drawer member is located at a first position within the storage unit; a second regulation member that is included in the storage unit and engages with the lock member to regulate a shift of the drawer member in the drawing direction when the drawer member is located at a second position drawn from the first position; and an operation unit that receives a first operation performed for the drawer member to rotate the lock member in the drawing direction and allow engagement between the lock member and the first regulation member, and a second operation performed for the drawer member to rotate the lock member in the inserting direction and allow engagement between the lock member and the second regulation member.

An image forming apparatus includes an image carrier, a developing section, a transfer section, a pre-transfer conveyance passage, and a guide member. The pre-transfer conveyance passage allows conveyance of the sheet from the developing section to the transfer section. The guide member defines a side of the pre-transfer conveyance passage that faces the transfer surface. The guide member includes: a guide body having a guide surface that faces the transfer surface of the sheet; and a tip section having a curved portion joining an end edge of the guide body, and a distal edge that is on a downstream side in the conveyance direction and faces the image carrier. The distal edge is located at such a position as to allow the transfer surface of the sheet to lie at a space therefrom when a leading end of the sheet is in contact with the image carrying surface.

1. An image forming apparatus, comprising: an image carrier having an image carrying surface for carrying thereon a developer image that is to be transferred onto a sheet, the image carrier being rotatable about an axis extending in a first direction perpendicularly intersecting a sheet conveyance direction; a developing section operable to supply developer to the image carrying surface to form the developer image; a transfer section operable to transfer the developer image formed on the image carrying surface onto a transfer surface of the sheet; a pre-transfer conveyance passage for allowing conveyance of the sheet from the developing section to the transfer section; and a guide member defining a side of the pre-transfer conveyance passage that faces the transfer surface, wherein: the guide member includes a guide body in the form of a plate and having a guide surface that faces the transfer surface of the sheet substantially in parallel, the sheet being conveyed in the sheet conveyance direction, and a tip section having a curved portion joining an end edge of the guide body that is on a downstream side in the conveyance direction and defining an outer bulge of the pre-transfer conveyance passage, the curved portion bulging in a second direction perpendicularly intersecting both the sheet conveyance direction and the first direction, and a distal edge that is on a downstream side in the conveyance direction and faces the image carrier; and the distal edge of the tip section is located at such a position as to allow the transfer surface of the sheet having been conveyed along the guide surface to lie at a space therefrom when a leading end of the sheet is in contact with the image carrying surface of the image carrier. 2. The image forming apparatus according to claim 1, wherein the guide body includes a projection extending in the conveyance direction and projecting into the pre-transfer conveyance passage, the projection constituting the guide surface. 3. The image forming apparatus according to claim 1, further comprising: a pair of conveyance rollers disposed upstream of the guide member in the conveyance direction for conveying the sheet to the transfer section while nipping the sheet, the pair of conveyance rollers including a first roller extending in the first direction and a second roller held in pressed contact with the first roller and thereby defining a nip therebetween, wherein when one side in the second direction refers to one side where the pre-transfer conveyance passage lies with respect to the developing section and the other side in the second direction refers to the opposite side of the one side, the transfer section lies on the one side and the guide member lies on the other side of a tangent line of the second roller in the second direction in a plan view looking in the first direction, the tangent line passing through the nip. 4. The image forming apparatus according to claim 3, wherein: the curved portion of the tip section curvedly extends in the direction of the other side in the second direction from the end edge of the guide body that is on the downstream side in the conveyance direction; and the tip section slopes downward toward the distal edge in the direction of the one side. 5. The image forming apparatus according to claim 4, wherein the tip section includes a bent portion bent from the distal edge in the direction of the other side in the second direction. 6. The image forming apparatus according to claim 2, wherein the projection includes a ridge part having a curved surface projecting into the pre-transfer conveyance passage. 7. The image forming apparatus according to claim 2, wherein the guide body includes another projection formed at an interval in the first direction. 8. The image forming apparatus according to claim 1, wherein: the developing section includes a developing roller and a developing housing that houses the developing roller; and the guide member is attached to the developing housing.

An image forming apparatus includes an image carrier, a developing section, a transfer section, a pre-transfer conveyance passage, and a guide member. The pre-transfer conveyance passage allows conveyance of the sheet from the developing section to the transfer section. The guide member defines a side of the pre-transfer conveyance passage that faces the transfer surface. The guide member includes: a guide body having a guide surface that faces the transfer surface of the sheet; and a tip section having a curved portion joining an end edge of the guide body, and a distal edge that is on a downstream side in the conveyance direction and faces the image carrier. The distal edge is located at such a position as to allow the transfer surface of the sheet to lie at a space therefrom when a leading end of the sheet is in contact with the image carrying surface.1. An image forming apparatus, comprising: an image carrier having an image carrying surface for carrying thereon a developer image that is to be transferred onto a sheet, the image carrier being rotatable about an axis extending in a first direction perpendicularly intersecting a sheet conveyance direction; a developing section operable to supply developer to the image carrying surface to form the developer image; a transfer section operable to transfer the developer image formed on the image carrying surface onto a transfer surface of the sheet; a pre-transfer conveyance passage for allowing conveyance of the sheet from the developing section to the transfer section; and a guide member defining a side of the pre-transfer conveyance passage that faces the transfer surface, wherein: the guide member includes a guide body in the form of a plate and having a guide surface that faces the transfer surface of the sheet substantially in parallel, the sheet being conveyed in the sheet conveyance direction, and a tip section having a curved portion joining an end edge of the guide body that is on a downstream side in the conveyance direction and defining an outer bulge of the pre-transfer conveyance passage, the curved portion bulging in a second direction perpendicularly intersecting both the sheet conveyance direction and the first direction, and a distal edge that is on a downstream side in the conveyance direction and faces the image carrier; and the distal edge of the tip section is located at such a position as to allow the transfer surface of the sheet having been conveyed along the guide surface to lie at a space therefrom when a leading end of the sheet is in contact with the image carrying surface of the image carrier. 2. The image forming apparatus according to claim 1, wherein the guide body includes a projection extending in the conveyance direction and projecting into the pre-transfer conveyance passage, the projection constituting the guide surface. 3. The image forming apparatus according to claim 1, further comprising: a pair of conveyance rollers disposed upstream of the guide member in the conveyance direction for conveying the sheet to the transfer section while nipping the sheet, the pair of conveyance rollers including a first roller extending in the first direction and a second roller held in pressed contact with the first roller and thereby defining a nip therebetween, wherein when one side in the second direction refers to one side where the pre-transfer conveyance passage lies with respect to the developing section and the other side in the second direction refers to the opposite side of the one side, the transfer section lies on the one side and the guide member lies on the other side of a tangent line of the second roller in the second direction in a plan view looking in the first direction, the tangent line passing through the nip. 4. The image forming apparatus according to claim 3, wherein: the curved portion of the tip section curvedly extends in the direction of the other side in the second direction from the end edge of the guide body that is on the downstream side in the conveyance direction; and the tip section slopes downward toward the distal edge in the direction of the one side. 5. The image forming apparatus according to claim 4, wherein the tip section includes a bent portion bent from the distal edge in the direction of the other side in the second direction. 6. The image forming apparatus according to claim 2, wherein the projection includes a ridge part having a curved surface projecting into the pre-transfer conveyance passage. 7. The image forming apparatus according to claim 2, wherein the guide body includes another projection formed at an interval in the first direction. 8. The image forming apparatus according to claim 1, wherein: the developing section includes a developing roller and a developing housing that houses the developing roller; and the guide member is attached to the developing housing.

A sheet discharge port is provided with a guide piece extending obliquely downward in a discharge direction from an upper edge of the sheet discharge port to oppose an outlet port. The guide piece blocks flow of cooling air, which has been blown out from the outlet port, into the sheet discharge port and also abuts the sheet discharged from the sheet discharge port to guide the sheet obliquely downward in the discharge direction.

1. An image forming apparatus comprising: an image formation section for forming an image on a sheet; a sheet discharge port for discharging the sheet to a discharge tray; a discharge path communicating with the sheet discharge port; and a cooling section including a cooling fan and a cooling duct having one end part coupled to the cooling fan and another end part having at least one outlet port discharging cooling air generated by the cooling fan, wherein the at least one outlet port opens downward at a position located above the sheet discharge port and on a downstream side in a discharge direction of the sheet, and the sheet discharge port is provided with a guide piece extending obliquely downward in the discharge direction from an upper edge of the sheet discharge port to oppose the outlet port, and the guide piece blocks flow of the cooling air, which has been blown out from the outlet port, into the sheet discharge port and also abuts the sheet discharged from the sheet discharge port to guide the sheet obliquely downward in the discharge direction. 2. The image forming apparatus according to claim 1, further comprising a fixing section fixing a toner image on the sheet, wherein the discharge path connects the sheet discharge port and the fixing section with each other. 3. The image forming apparatus according to claim 1, wherein the guide piece is arranged so as to cover a part of the sheet discharge port from the above in viewed from an outside of the sheet discharge port in the discharge direction of the sheet. 4. The image forming apparatus according to claim 1, wherein the sheet discharge port is provided with at least one pair of discharge rollers discharging the sheet, the at least one pair of discharge rollers including an upper discharge roller and a lower discharge roller abutting each other to form a nip part therebetween, and the at least one pair of discharge rollers includes a tangent line passing through the nip part and extending obliquely upward towards the downstream side in the discharge direction, the at least one pair of discharge roller discharges, obliquely upward, a tip of the sheet. 5. The image forming apparatus according to claim 4, wherein the at least one pair of discharge roller includes a plurality of discharge roller pairs arranged at an interval therebetween in a width direction of the sheet discharge port intersecting the discharge direction, and the at least one outlet port of the cooling duct includes a plurality of outlet ports, the plurality of outlet ports are respectively arranged between the plurality of discharge roller pairs. 6. The image forming apparatus according to claim 4, wherein a tip part of the guide piece is arranged at a position lower than the nip part and on a tangent line extending vertically and touching an outer circumferential surface of the lower discharge roller on a downstream side in the discharge direction. 7. The image forming apparatus according to claim 1, further comprising a sheet pressing member being provided at a position located on a downstream side of the guide piece in the discharge direction, the sheet pressing member abutting the sheet discharged from the sheet discharge port to press the sheet. 8. The image forming apparatus according to claim 1, wherein the guide piece comes in contact with the tip of the sheet being discharged from the sheet discharge port and guides the tip of the sheet obliquely downward.

A sheet discharge port is provided with a guide piece extending obliquely downward in a discharge direction from an upper edge of the sheet discharge port to oppose an outlet port. The guide piece blocks flow of cooling air, which has been blown out from the outlet port, into the sheet discharge port and also abuts the sheet discharged from the sheet discharge port to guide the sheet obliquely downward in the discharge direction.1. An image forming apparatus comprising: an image formation section for forming an image on a sheet; a sheet discharge port for discharging the sheet to a discharge tray; a discharge path communicating with the sheet discharge port; and a cooling section including a cooling fan and a cooling duct having one end part coupled to the cooling fan and another end part having at least one outlet port discharging cooling air generated by the cooling fan, wherein the at least one outlet port opens downward at a position located above the sheet discharge port and on a downstream side in a discharge direction of the sheet, and the sheet discharge port is provided with a guide piece extending obliquely downward in the discharge direction from an upper edge of the sheet discharge port to oppose the outlet port, and the guide piece blocks flow of the cooling air, which has been blown out from the outlet port, into the sheet discharge port and also abuts the sheet discharged from the sheet discharge port to guide the sheet obliquely downward in the discharge direction. 2. The image forming apparatus according to claim 1, further comprising a fixing section fixing a toner image on the sheet, wherein the discharge path connects the sheet discharge port and the fixing section with each other. 3. The image forming apparatus according to claim 1, wherein the guide piece is arranged so as to cover a part of the sheet discharge port from the above in viewed from an outside of the sheet discharge port in the discharge direction of the sheet. 4. The image forming apparatus according to claim 1, wherein the sheet discharge port is provided with at least one pair of discharge rollers discharging the sheet, the at least one pair of discharge rollers including an upper discharge roller and a lower discharge roller abutting each other to form a nip part therebetween, and the at least one pair of discharge rollers includes a tangent line passing through the nip part and extending obliquely upward towards the downstream side in the discharge direction, the at least one pair of discharge roller discharges, obliquely upward, a tip of the sheet. 5. The image forming apparatus according to claim 4, wherein the at least one pair of discharge roller includes a plurality of discharge roller pairs arranged at an interval therebetween in a width direction of the sheet discharge port intersecting the discharge direction, and the at least one outlet port of the cooling duct includes a plurality of outlet ports, the plurality of outlet ports are respectively arranged between the plurality of discharge roller pairs. 6. The image forming apparatus according to claim 4, wherein a tip part of the guide piece is arranged at a position lower than the nip part and on a tangent line extending vertically and touching an outer circumferential surface of the lower discharge roller on a downstream side in the discharge direction. 7. The image forming apparatus according to claim 1, further comprising a sheet pressing member being provided at a position located on a downstream side of the guide piece in the discharge direction, the sheet pressing member abutting the sheet discharged from the sheet discharge port to press the sheet. 8. The image forming apparatus according to claim 1, wherein the guide piece comes in contact with the tip of the sheet being discharged from the sheet discharge port and guides the tip of the sheet obliquely downward.

A rubber camouflage stamp that includes: a convertible stamp apparatus and a locking lid. The convertible stamp apparatus preferably includes a substantially planar body that includes a stamp side opposite a handle side. The stamp side defines a contoured rubber surface that has a camouflage pattern carved, molded, laser engraved or vulcanized therein. Preferably, the stamp side may be deployed in the same manner as conventional rubber stamp to receive an ink coating and transfer the ink coated thereon to a medium by pressing the stamp side against the medium. The stamp side may be used to transfer ink to a user's face.

1. A rubber camouflage stamp comprising: a. a convertible stamp apparatus, wherein the stamp apparatus includes a planar body with a stamp side and a handle side; and b. a locking lid. 2. The rubber camouflage stamp according to claim 1, where the stamp side defines a contoured rubber surface that has a camouflage pattern. 3. The rubber camouflage stamp according to claim 2, where the camouflage pattern is carved, molded, laser engraved or vulcanized therein. 4. The rubber camouflage stamp according to claim 1, wherein the handle side includes a hinged handle member which is operative to swing between a storage position in which it lies flat against the handle side and a deployed position in which it is lifted off the handle side. 5. The rubber camouflage stamp according to claim 4, the hinged handle member includes a permanent magnet integrated therein, where permanent magnet operates to bias the handle member into the storage position when the locking lid is in place. 6. The rubber camouflage stamp according to claim 1, where the locking lid is defined by an interior tray that is surrounded by an elevated perimeter wall, which extends around its edge. 7. The rubber camouflage stamp according to claim 1, where the locking lid includes a ferromagnetic member integrated therewith in a central position which corresponds to the positioning of a permanent magnet in the convertible stamp apparatus.

A rubber camouflage stamp that includes: a convertible stamp apparatus and a locking lid. The convertible stamp apparatus preferably includes a substantially planar body that includes a stamp side opposite a handle side. The stamp side defines a contoured rubber surface that has a camouflage pattern carved, molded, laser engraved or vulcanized therein. Preferably, the stamp side may be deployed in the same manner as conventional rubber stamp to receive an ink coating and transfer the ink coated thereon to a medium by pressing the stamp side against the medium. The stamp side may be used to transfer ink to a user's face.1. A rubber camouflage stamp comprising: a. a convertible stamp apparatus, wherein the stamp apparatus includes a planar body with a stamp side and a handle side; and b. a locking lid. 2. The rubber camouflage stamp according to claim 1, where the stamp side defines a contoured rubber surface that has a camouflage pattern. 3. The rubber camouflage stamp according to claim 2, where the camouflage pattern is carved, molded, laser engraved or vulcanized therein. 4. The rubber camouflage stamp according to claim 1, wherein the handle side includes a hinged handle member which is operative to swing between a storage position in which it lies flat against the handle side and a deployed position in which it is lifted off the handle side. 5. The rubber camouflage stamp according to claim 4, the hinged handle member includes a permanent magnet integrated therein, where permanent magnet operates to bias the handle member into the storage position when the locking lid is in place. 6. The rubber camouflage stamp according to claim 1, where the locking lid is defined by an interior tray that is surrounded by an elevated perimeter wall, which extends around its edge. 7. The rubber camouflage stamp according to claim 1, where the locking lid includes a ferromagnetic member integrated therewith in a central position which corresponds to the positioning of a permanent magnet in the convertible stamp apparatus.

A liquid measurement system for determining a quantity of a liquid within a tank includes a pressurized air supply, a valve connected to the pressurized air supply with the valve able to introduce a known mass of air into the tank, a pressure sensor able to measure the change in air pressure within the tank, and a processor operatively connected to the valve and the pressure sensor. The processor is able to determine the volume of the liquid within the tank from the known mass of air introduced into the tank and the change in air pressure within the tank.

1. A liquid measurement system for determining a quantity of a liquid within a tank, the system comprising: a pressurized air supply; a valve connected to the pressurized air supply, the valve able to introduce a known mass of air into the tank; a pressure sensor able to measure the change in air pressure within the tank; and a processor operatively connected to the valve and the pressure sensor, the processor able to determine the volume of the liquid within the tank from the known mass of air introduced into the tank and the change in air pressure within the tank. 2. The system of claim 1, wherein the pressure sensor is positioned at a top of the tank. 3. The system of claim 1, wherein the valve is positioned at a top of the tank. 4. The system of claim 1, wherein the valve is an air metering valve. 5. The system of claim 1, wherein the processor is operatively connected to the valve and determines the known mass of air introduced into the tank by knowing a pressure of the air at the pressurized air supply and knowing an amount of time the valve is open to allow air to enter the tank. 6. The system of claim 1, further comprising: a densitometer able to measure the density of the liquid within the tank. 7. The system of claim 5, wherein the densitometer is positioned at a bottom of the tank. 8. The system of claim 1, wherein the liquid is fuel. 9. The system of claim 1, further comprising: a vent in the tank able to allow air to leave the tank. 10. A method of measuring a liquid in a tank, the method comprising: introducing a first known mass of air into the tank; measuring a change in air pressure within the tank in response to the introduction of the first known mass of air; measuring a density of the liquid within the tank; and determining the volume of the liquid within the tank depending on the change in air pressure within the tank. 11. The method of claim 10, further comprising: measuring the density of the liquid within the tank; and determining the quantity of the liquid within the tank depending on the change in air pressure and the density of liquid within the tank. 12. The method of claim 10, further comprising: venting air out of the tank. 13. The method of claim 10, further comprising: introducing a second known mass of air into the tank; measuring the change in air pressure within the tank in response to the introduction of the second known mass of air; determining the volume of liquid within the tank depending on the change in air pressure within the tank in response to the introduction of the second known mass of air. 14. The method of claim 12, wherein the second known mass of air is different from the first known mass of air. 15. The method of claim 10, further comprising: conveying a value for the volume of liquid within the tank to a liquid level gauge. 16. The method of claim 10, wherein the step of introducing the first known mass of air into the tank further comprises: measuring a pressure of air at a pressurized air supply; opening a valve in the tank for a known period of time to introduce a mass of air into the tank; and determining the first known mass of air. 17. An aircraft comprising: a fuel tank in a wing of the aircraft; a pressurized air supply; a valve connected to the pressurized air supply, the valve configured to allow a known mass of air into the fuel tank; a vent in the tank configured to allow air to leave the fuel tank; a densitometer configured to measure a density of fuel within the fuel tank; a pressure sensor configured to measure a change in pressure of the air within the fuel tank in response to the addition of the known mass of air; and a processor operatively connected to the valve, the densitometer, and the pressure sensor and configured to determine a quantity of fuel within the fuel tank from the known mass of air added to the fuel tank, the change in pressure of the air within the fuel tank, and the density of fuel within the fuel tank. 18. The aircraft of claim 17, wherein the processor determines the known mass of air added to the tank by knowing a pressure of the air at the pressurized air supply and knowing an amount of time the valve is open to allow air to enter the fuel tank. 19. The aircraft of claim 17, wherein the vent allows the air within the tank to leave the tank after the process determines the quantity of fuel within the fuel tank to return the air pressure within the fuel tank to an ambient air pressure. 20. The aircraft of claim 19, wherein the valve introduces the known mass of air into the fuel tank multiple times during operation of the aircraft, the pressure sensor measures the change in pressure of the air within the fuel tank in response to the addition of each known mass of air, and the quantity of fuel within the tank is determined after each addition of the known mass of air.

A liquid measurement system for determining a quantity of a liquid within a tank includes a pressurized air supply, a valve connected to the pressurized air supply with the valve able to introduce a known mass of air into the tank, a pressure sensor able to measure the change in air pressure within the tank, and a processor operatively connected to the valve and the pressure sensor. The processor is able to determine the volume of the liquid within the tank from the known mass of air introduced into the tank and the change in air pressure within the tank.1. A liquid measurement system for determining a quantity of a liquid within a tank, the system comprising: a pressurized air supply; a valve connected to the pressurized air supply, the valve able to introduce a known mass of air into the tank; a pressure sensor able to measure the change in air pressure within the tank; and a processor operatively connected to the valve and the pressure sensor, the processor able to determine the volume of the liquid within the tank from the known mass of air introduced into the tank and the change in air pressure within the tank. 2. The system of claim 1, wherein the pressure sensor is positioned at a top of the tank. 3. The system of claim 1, wherein the valve is positioned at a top of the tank. 4. The system of claim 1, wherein the valve is an air metering valve. 5. The system of claim 1, wherein the processor is operatively connected to the valve and determines the known mass of air introduced into the tank by knowing a pressure of the air at the pressurized air supply and knowing an amount of time the valve is open to allow air to enter the tank. 6. The system of claim 1, further comprising: a densitometer able to measure the density of the liquid within the tank. 7. The system of claim 5, wherein the densitometer is positioned at a bottom of the tank. 8. The system of claim 1, wherein the liquid is fuel. 9. The system of claim 1, further comprising: a vent in the tank able to allow air to leave the tank. 10. A method of measuring a liquid in a tank, the method comprising: introducing a first known mass of air into the tank; measuring a change in air pressure within the tank in response to the introduction of the first known mass of air; measuring a density of the liquid within the tank; and determining the volume of the liquid within the tank depending on the change in air pressure within the tank. 11. The method of claim 10, further comprising: measuring the density of the liquid within the tank; and determining the quantity of the liquid within the tank depending on the change in air pressure and the density of liquid within the tank. 12. The method of claim 10, further comprising: venting air out of the tank. 13. The method of claim 10, further comprising: introducing a second known mass of air into the tank; measuring the change in air pressure within the tank in response to the introduction of the second known mass of air; determining the volume of liquid within the tank depending on the change in air pressure within the tank in response to the introduction of the second known mass of air. 14. The method of claim 12, wherein the second known mass of air is different from the first known mass of air. 15. The method of claim 10, further comprising: conveying a value for the volume of liquid within the tank to a liquid level gauge. 16. The method of claim 10, wherein the step of introducing the first known mass of air into the tank further comprises: measuring a pressure of air at a pressurized air supply; opening a valve in the tank for a known period of time to introduce a mass of air into the tank; and determining the first known mass of air. 17. An aircraft comprising: a fuel tank in a wing of the aircraft; a pressurized air supply; a valve connected to the pressurized air supply, the valve configured to allow a known mass of air into the fuel tank; a vent in the tank configured to allow air to leave the fuel tank; a densitometer configured to measure a density of fuel within the fuel tank; a pressure sensor configured to measure a change in pressure of the air within the fuel tank in response to the addition of the known mass of air; and a processor operatively connected to the valve, the densitometer, and the pressure sensor and configured to determine a quantity of fuel within the fuel tank from the known mass of air added to the fuel tank, the change in pressure of the air within the fuel tank, and the density of fuel within the fuel tank. 18. The aircraft of claim 17, wherein the processor determines the known mass of air added to the tank by knowing a pressure of the air at the pressurized air supply and knowing an amount of time the valve is open to allow air to enter the fuel tank. 19. The aircraft of claim 17, wherein the vent allows the air within the tank to leave the tank after the process determines the quantity of fuel within the fuel tank to return the air pressure within the fuel tank to an ambient air pressure. 20. The aircraft of claim 19, wherein the valve introduces the known mass of air into the fuel tank multiple times during operation of the aircraft, the pressure sensor measures the change in pressure of the air within the fuel tank in response to the addition of each known mass of air, and the quantity of fuel within the tank is determined after each addition of the known mass of air.

An image forming apparatus includes a sheet cassette, a sheet conveying portion, an image forming portion, a position detecting portion, and an image position correcting portion. The sheet conveying portion conveys a sheet from the sheet cassette attached to the apparatus main body, along a sheet conveyance path whose width direction matches the main direction. The position detecting portion detects a position of a detection-target portion that is a part of the sheet cassette, in the main direction based on the apparatus main body. The image position correcting portion corrects an image formation position in the main direction at which the image is formed by the image forming portion, based on the position detected by the position detecting portion.

1. An image forming apparatus comprising: a sheet cassette configured to store sheets and be attached to and drawn out from an apparatus main body along a main direction; a sheet conveying portion configured to convey a sheet from the sheet cassette attached to the apparatus main body, along a sheet conveyance path whose width direction matches the main direction; an image forming portion configured to form an image on the sheet conveyed along the sheet conveyance path; a position detecting portion configured to detect a position of a detection-target portion that is a part of the sheet cassette, in the main direction on a basis of the apparatus main body; and an image position correcting portion configured to correct an image formation position in the main direction at which the image is formed by the image forming portion, based on the position detected by the position detecting portion. 2. The image forming apparatus according to claim 1, wherein the sheet cassette includes: a movable sheet guide provided in such a way as to be displaced along the main direction in the sheet cassette, and is positioned to extend along an end of the sheets in the main direction, and the detection-target portion is the movable sheet guide or a portion interlocked with the movable sheet guide. 3. The image forming apparatus according to claim 2, further comprising: a sheet size determining portion configured to compare the position detected by the position detecting portion with a predetermined plurality of candidate positions that correspond to a plurality of sheet sizes, and determine, as a size of the sheets in the sheet cassette, a sheet size that corresponds to, among the plurality of candidate positions, a candidate position that is closest to the position detected by the position detecting portion. 4. The image forming apparatus according to claim 1, wherein the position detecting portion includes: a displaceable portion supported by the apparatus main body in such a way as to be displaced along the main direction; an elastic member configured to apply, to the displaceable portion, an elastic force that is directed to an upstream side in the attachment direction of the sheet cassette; and a displacement sensor configured to detect a position of the displaceable portion in the main direction based on the apparatus main body, and when the sheet cassette is attached to the apparatus main body, the displaceable portion contacts the detection-target portion from a downstream side in the attachment direction, and is displaced toward the downstream side in the attachment direction against the elastic force from the elastic member. 5. The image forming apparatus according to claim 4, wherein the displacement sensor is a variable-resistor-type displacement meter. 6. The image forming apparatus according to claim 1, wherein the image forming portion includes: an optical scanning portion configured to write an electrostatic latent image on a surface of a photoconductor by scanning a light beam on the surface of the photoconductor along the main direction; a developing portion configured to develop the electrostatic latent image on the surface of the photoconductor into a toner image; and a transfer portion configured to transfer the toner image from the surface of the photoconductor to the sheet conveyed along the sheet conveyance path, and the image position correcting portion corrects a timing when the optical scanning portion starts to write the electrostatic latent image, based on the position detected by the position detecting portion.

An image forming apparatus includes a sheet cassette, a sheet conveying portion, an image forming portion, a position detecting portion, and an image position correcting portion. The sheet conveying portion conveys a sheet from the sheet cassette attached to the apparatus main body, along a sheet conveyance path whose width direction matches the main direction. The position detecting portion detects a position of a detection-target portion that is a part of the sheet cassette, in the main direction based on the apparatus main body. The image position correcting portion corrects an image formation position in the main direction at which the image is formed by the image forming portion, based on the position detected by the position detecting portion.1. An image forming apparatus comprising: a sheet cassette configured to store sheets and be attached to and drawn out from an apparatus main body along a main direction; a sheet conveying portion configured to convey a sheet from the sheet cassette attached to the apparatus main body, along a sheet conveyance path whose width direction matches the main direction; an image forming portion configured to form an image on the sheet conveyed along the sheet conveyance path; a position detecting portion configured to detect a position of a detection-target portion that is a part of the sheet cassette, in the main direction on a basis of the apparatus main body; and an image position correcting portion configured to correct an image formation position in the main direction at which the image is formed by the image forming portion, based on the position detected by the position detecting portion. 2. The image forming apparatus according to claim 1, wherein the sheet cassette includes: a movable sheet guide provided in such a way as to be displaced along the main direction in the sheet cassette, and is positioned to extend along an end of the sheets in the main direction, and the detection-target portion is the movable sheet guide or a portion interlocked with the movable sheet guide. 3. The image forming apparatus according to claim 2, further comprising: a sheet size determining portion configured to compare the position detected by the position detecting portion with a predetermined plurality of candidate positions that correspond to a plurality of sheet sizes, and determine, as a size of the sheets in the sheet cassette, a sheet size that corresponds to, among the plurality of candidate positions, a candidate position that is closest to the position detected by the position detecting portion. 4. The image forming apparatus according to claim 1, wherein the position detecting portion includes: a displaceable portion supported by the apparatus main body in such a way as to be displaced along the main direction; an elastic member configured to apply, to the displaceable portion, an elastic force that is directed to an upstream side in the attachment direction of the sheet cassette; and a displacement sensor configured to detect a position of the displaceable portion in the main direction based on the apparatus main body, and when the sheet cassette is attached to the apparatus main body, the displaceable portion contacts the detection-target portion from a downstream side in the attachment direction, and is displaced toward the downstream side in the attachment direction against the elastic force from the elastic member. 5. The image forming apparatus according to claim 4, wherein the displacement sensor is a variable-resistor-type displacement meter. 6. The image forming apparatus according to claim 1, wherein the image forming portion includes: an optical scanning portion configured to write an electrostatic latent image on a surface of a photoconductor by scanning a light beam on the surface of the photoconductor along the main direction; a developing portion configured to develop the electrostatic latent image on the surface of the photoconductor into a toner image; and a transfer portion configured to transfer the toner image from the surface of the photoconductor to the sheet conveyed along the sheet conveyance path, and the image position correcting portion corrects a timing when the optical scanning portion starts to write the electrostatic latent image, based on the position detected by the position detecting portion.

A printing screen, comprising a sheet, at least sections of at least one pair of opposite edges of which are folded such as to define attachment elements, and a printing screen unit including at least one pair of interface members attachable to the attachment elements at the at least one pair of opposite edges of the sheet.

1. A printing screen unit, comprising: a printing screen, comprising a sheet having opposite sides; and a rectangular frame comprising interface members attached to the respective sides of the sheet; wherein the interface members can shift relative to one another, whereby the frame can be tensioned by an external tensioning mechanism to tension the sheet. 2. The printing screen unit of claim 1, wherein the interface members are bonded to the printing screen. 3. The printing screen unit of claim 1, wherein the interface members each comprise a plurality of interface elements spaced along a length of a respective edge of the sheet. 4. The printing screen unit of claim 1, wherein the interface members each comprise first and second strips attached to opposite sides of the respective edge of the sheet. 5. The printing screen unit of claim 1, wherein the interface members each comprise first and second strips attached to opposite sides of the respective edge of the sheet, and include a plurality of engagement apertures for engagement to a tensioning mechanism spaced along a length thereof. 6. A printing screen unit, comprising: a printing screen, comprising a flat stainless steel sheet having two pairs of opposite edges; and a frame comprising first and second pairs of interface members adhesively bonded along substantially the entire length thereof to the respective pairs of opposite edges of the sheet and coupled together at corners of the frame, wherein the frame holds the printing screen in an untensioned state when no tension is applied thereto by external tensioning mechanisms separate to the frame, the frame having no element or device mounted thereto or carried thereby for maintaining the printing screen in a tensioned state when no tension is applied thereto by external tensioning mechanisms separate to the frame, and the frame is substantially rigid when in the untensioned state, but allows for movement of the respective pairs of interface members by external tensioning mechanisms separate to the frame to tension the printing screen. 7. A frame for use with a printing screen, the frame comprising: four sides, each side having an interface member adapted for attachment to a printing screen and engagement with an external tensioning mechanism; wherein the interface members each include an attachment section adapted for attachment to the respective side of the sheet, and an engagement section adapted for engagement to an external tensioning mechanism; wherein the engagement section includes an engagement surface for engagement to the external tensioning mechanism and the engagement surface is disposed outwardly of the respective side of the sheet and inclined outwardly from a free edge of the engagement surface relative to the respective side of the sheet; wherein the interface members are adapted to be connected together to form a frame via a tongue and recess interface; and wherein the interface members can shift relative to one another, whereby the frame can be tensioned by the external tensioning mechanism to tension the sheet.

A printing screen, comprising a sheet, at least sections of at least one pair of opposite edges of which are folded such as to define attachment elements, and a printing screen unit including at least one pair of interface members attachable to the attachment elements at the at least one pair of opposite edges of the sheet.1. A printing screen unit, comprising: a printing screen, comprising a sheet having opposite sides; and a rectangular frame comprising interface members attached to the respective sides of the sheet; wherein the interface members can shift relative to one another, whereby the frame can be tensioned by an external tensioning mechanism to tension the sheet. 2. The printing screen unit of claim 1, wherein the interface members are bonded to the printing screen. 3. The printing screen unit of claim 1, wherein the interface members each comprise a plurality of interface elements spaced along a length of a respective edge of the sheet. 4. The printing screen unit of claim 1, wherein the interface members each comprise first and second strips attached to opposite sides of the respective edge of the sheet. 5. The printing screen unit of claim 1, wherein the interface members each comprise first and second strips attached to opposite sides of the respective edge of the sheet, and include a plurality of engagement apertures for engagement to a tensioning mechanism spaced along a length thereof. 6. A printing screen unit, comprising: a printing screen, comprising a flat stainless steel sheet having two pairs of opposite edges; and a frame comprising first and second pairs of interface members adhesively bonded along substantially the entire length thereof to the respective pairs of opposite edges of the sheet and coupled together at corners of the frame, wherein the frame holds the printing screen in an untensioned state when no tension is applied thereto by external tensioning mechanisms separate to the frame, the frame having no element or device mounted thereto or carried thereby for maintaining the printing screen in a tensioned state when no tension is applied thereto by external tensioning mechanisms separate to the frame, and the frame is substantially rigid when in the untensioned state, but allows for movement of the respective pairs of interface members by external tensioning mechanisms separate to the frame to tension the printing screen. 7. A frame for use with a printing screen, the frame comprising: four sides, each side having an interface member adapted for attachment to a printing screen and engagement with an external tensioning mechanism; wherein the interface members each include an attachment section adapted for attachment to the respective side of the sheet, and an engagement section adapted for engagement to an external tensioning mechanism; wherein the engagement section includes an engagement surface for engagement to the external tensioning mechanism and the engagement surface is disposed outwardly of the respective side of the sheet and inclined outwardly from a free edge of the engagement surface relative to the respective side of the sheet; wherein the interface members are adapted to be connected together to form a frame via a tongue and recess interface; and wherein the interface members can shift relative to one another, whereby the frame can be tensioned by the external tensioning mechanism to tension the sheet.

The electro-photographic sheet of paper duplex printing machine includes a sheet supply section, a sheet positioning section which positions sheets and sends out sheets to a backup roller in an electro-photographic printing section, the electro-photographic printing section transfers an image which has been transferred onto the transfer roller onto the sheet, a chain delivery section, a delivery section and a sheet carrying section for turnover. The chain delivery section selectively transfers printed sheets, which has been transferred from the backup roller to the delivery section or sheet carrying section for turnover. The sheet carrying section for turnover supplies one side printed sheet to the sheet positioning section. The sheet fed from the sheet supply section and one side printed sheet fed from the sheet carrying section for turnover are alternately carried to the sheet positioning section and the toner image on the printed sheet is fixed by the fixing device.

1. An electro-photographic sheet of paper duplex printing machine having a sheet supply section, a sheet positioning section, an electro-photographic printing section, a chain delivery section and a delivery section arranged in order from upstream to downstream in a direction of carriage of sheets of paper, and having a sheet carrying section for turnover disposed above the sheet supply, wherein the sheet supply section sends out sheets one by one onto the sheet positioning section, the sheet positioning section positions the sheets and sends out positioned sheets to a backup roller in the electro-photographic printing section, the electro-photographic printing section prints a toner image on a sheet transferred onto the transfer roller onto the sheet on the backup roller by transferring the toner image, the chain delivery section selectively transfers printed sheets transferred from the backup roller to the delivery section or the sheet carrying section for turnover, the delivery section has a fixing device for fixing the toner image, the sheet carrying section for turnover is supplied with one side printed sheet dropped from the chain delivery section, and supplies the one side printed sheet to the sheet positioning section by a suction conveyer which is intermittently driven, and the sheet fed from the sheet supply section and the one side printed sheet carried from the sheet carrying section for turnover are alternately carried to the sheet positioning section, and the printed sheet passes through the fixing device in the delivery section at regular intervals. 2. An electro-photographic sheet of paper duplex printing machine as set forth in claim 1, wherein the sheet positioning section has a suction conveyer carrying the sheet at a constant speed and a pair of upper and lower registration rollers, the backup roller has a sheet support, the sheet horizontally carried by the suction conveyer in the sheet positioning section horizontally enters the pair of upper and lower registration rollers and comes to a stop when coming in contact with the contact portions of the pair of upper and lower registration rollers, and the sheet is carried to the sheet support of the backup roller by the rotation of the pair of upper and lower registration rollers. 3. An electro-photographic sheet of paper duplex printing machine as set forth in claim 1, wherein the suction conveyer in the sheet positioning section comprises a straight suction conveyer which is located in parallel to the carrying direction of the sheet sent out from the sheet supply section and an inclined suction conveyer which is located at an inclination with respect to the carrying direction of the sheet, and air suction power of the inclined suction conveyer is stronger than air suction power of the straight suction conveyer. 4. An electro-photographic sheet of paper duplex printing machine as set forth in claim 2, wherein the suction conveyer in the sheet positioning section comprises a straight suction conveyer which is located in parallel to the carrying direction of the sheet sent out from the sheet supply section and an inclined suction conveyer which is located at an inclination with respect to the carrying direction of the sheet, and air suction power of the inclined suction conveyer is stronger than air suction power of the straight suction conveyer. 5. An electro-photographic sheet of paper duplex printing machine as set forth in claim 1, wherein a drop auxiliary means to apply a downward force to the sheet when making the sheet drop is installed at the sheet dropping position where the sheet is dropped from the chain delivery section to the sheet carrying section for turnover, and the sheet carrying section for turnover has a means to move the printed sheet in the direction orthogonal to the carrying direction. 6. An electro-photographic sheet of paper duplex printing machine as set forth in claim 2, wherein a drop auxiliary means to apply a downward force to the sheet when making the sheet drop is installed at the sheet dropping position where the sheet is dropped from the chain delivery section to the sheet carrying section for turnover, and the sheet carrying section for turnover has a means to move the printed sheet in the direction orthogonal to the carrying direction. 7. An electro-photographic sheet of paper duplex printing machine as set forth in claim 3, wherein a drop auxiliary means to apply a downward force to the sheet when making the sheet drop is installed at the sheet dropping position where the sheet is dropped from the chain delivery section to the sheet carrying section for turnover, and the sheet carrying section for turnover has a means to move the printed sheet in the direction orthogonal to the carrying direction. 8. An electro-photographic sheet of paper duplex printing machine as set forth in claim 4, wherein a drop auxiliary means to apply a downward force to the sheet when making the sheet drop is installed at the sheet dropping position where the sheet is dropped from the chain delivery section to the sheet carrying section for turnover, and the sheet carrying section for turnover has a means to move the printed sheet in the direction orthogonal to the carrying direction.

The electro-photographic sheet of paper duplex printing machine includes a sheet supply section, a sheet positioning section which positions sheets and sends out sheets to a backup roller in an electro-photographic printing section, the electro-photographic printing section transfers an image which has been transferred onto the transfer roller onto the sheet, a chain delivery section, a delivery section and a sheet carrying section for turnover. The chain delivery section selectively transfers printed sheets, which has been transferred from the backup roller to the delivery section or sheet carrying section for turnover. The sheet carrying section for turnover supplies one side printed sheet to the sheet positioning section. The sheet fed from the sheet supply section and one side printed sheet fed from the sheet carrying section for turnover are alternately carried to the sheet positioning section and the toner image on the printed sheet is fixed by the fixing device.1. An electro-photographic sheet of paper duplex printing machine having a sheet supply section, a sheet positioning section, an electro-photographic printing section, a chain delivery section and a delivery section arranged in order from upstream to downstream in a direction of carriage of sheets of paper, and having a sheet carrying section for turnover disposed above the sheet supply, wherein the sheet supply section sends out sheets one by one onto the sheet positioning section, the sheet positioning section positions the sheets and sends out positioned sheets to a backup roller in the electro-photographic printing section, the electro-photographic printing section prints a toner image on a sheet transferred onto the transfer roller onto the sheet on the backup roller by transferring the toner image, the chain delivery section selectively transfers printed sheets transferred from the backup roller to the delivery section or the sheet carrying section for turnover, the delivery section has a fixing device for fixing the toner image, the sheet carrying section for turnover is supplied with one side printed sheet dropped from the chain delivery section, and supplies the one side printed sheet to the sheet positioning section by a suction conveyer which is intermittently driven, and the sheet fed from the sheet supply section and the one side printed sheet carried from the sheet carrying section for turnover are alternately carried to the sheet positioning section, and the printed sheet passes through the fixing device in the delivery section at regular intervals. 2. An electro-photographic sheet of paper duplex printing machine as set forth in claim 1, wherein the sheet positioning section has a suction conveyer carrying the sheet at a constant speed and a pair of upper and lower registration rollers, the backup roller has a sheet support, the sheet horizontally carried by the suction conveyer in the sheet positioning section horizontally enters the pair of upper and lower registration rollers and comes to a stop when coming in contact with the contact portions of the pair of upper and lower registration rollers, and the sheet is carried to the sheet support of the backup roller by the rotation of the pair of upper and lower registration rollers. 3. An electro-photographic sheet of paper duplex printing machine as set forth in claim 1, wherein the suction conveyer in the sheet positioning section comprises a straight suction conveyer which is located in parallel to the carrying direction of the sheet sent out from the sheet supply section and an inclined suction conveyer which is located at an inclination with respect to the carrying direction of the sheet, and air suction power of the inclined suction conveyer is stronger than air suction power of the straight suction conveyer. 4. An electro-photographic sheet of paper duplex printing machine as set forth in claim 2, wherein the suction conveyer in the sheet positioning section comprises a straight suction conveyer which is located in parallel to the carrying direction of the sheet sent out from the sheet supply section and an inclined suction conveyer which is located at an inclination with respect to the carrying direction of the sheet, and air suction power of the inclined suction conveyer is stronger than air suction power of the straight suction conveyer. 5. An electro-photographic sheet of paper duplex printing machine as set forth in claim 1, wherein a drop auxiliary means to apply a downward force to the sheet when making the sheet drop is installed at the sheet dropping position where the sheet is dropped from the chain delivery section to the sheet carrying section for turnover, and the sheet carrying section for turnover has a means to move the printed sheet in the direction orthogonal to the carrying direction. 6. An electro-photographic sheet of paper duplex printing machine as set forth in claim 2, wherein a drop auxiliary means to apply a downward force to the sheet when making the sheet drop is installed at the sheet dropping position where the sheet is dropped from the chain delivery section to the sheet carrying section for turnover, and the sheet carrying section for turnover has a means to move the printed sheet in the direction orthogonal to the carrying direction. 7. An electro-photographic sheet of paper duplex printing machine as set forth in claim 3, wherein a drop auxiliary means to apply a downward force to the sheet when making the sheet drop is installed at the sheet dropping position where the sheet is dropped from the chain delivery section to the sheet carrying section for turnover, and the sheet carrying section for turnover has a means to move the printed sheet in the direction orthogonal to the carrying direction. 8. An electro-photographic sheet of paper duplex printing machine as set forth in claim 4, wherein a drop auxiliary means to apply a downward force to the sheet when making the sheet drop is installed at the sheet dropping position where the sheet is dropped from the chain delivery section to the sheet carrying section for turnover, and the sheet carrying section for turnover has a means to move the printed sheet in the direction orthogonal to the carrying direction.

A system includes an engine block having a plurality of cylinder-piston combinations. At least one of the cylinder-piston combinations includes a cylinder, a piston positioned in the cylinder and coupled to a connecting rod, the piston having an internal cooling gallery about a circumference of the piston, an oil jet for introducing coolant into the cooling gallery, and at least one pressure sensor positioned within the piston to detect pressure fluctuations within the cooling gallery. The system includes a processor having a program coupled thereto. The processor is configured to detect cyclical pressure fluctuations within the cooling gallery, via the at least one pressure sensor, during a linear motion of the piston within the engine block, determine pressures that occur during the detected cyclical pressure fluctuations, and determine a fill ratio of coolant within the cooling gallery based on the determined pressures.

1. A system, comprising: an engine block having a plurality of cylinder-piston combinations, wherein at least one of the cylinder-piston combinations includes: a cylinder; a piston positioned in the cylinder and coupled to a connecting rod, the piston having an internal cooling gallery about a circumference of the piston; an oil jet for introducing coolant into the cooling gallery; and at least one pressure sensor positioned within the piston to detect pressure fluctuations within the cooling gallery; and a processor having a program communicatively coupled to the processor, the processor configured to: detect cyclical pressure fluctuations within the cooling gallery, via the at least one pressure sensor, during a linear motion of the piston within the engine block; determine pressures that occur during the detected cyclical pressure fluctuations; and determine a fill ratio of coolant within the cooling gallery based on the determined pressures. 2. The system of claim 1, wherein the processor is configured to determine the pressures as one of an average peak pressure, an average low pressure, and an average pressure differential that occurs based on the detected cyclical pressure fluctuations, and wherein the processor is configured to determine the fill ratio based off of the one of the average peak pressure, the average low pressure, and the average pressure differential. 3. The system of claim 1, further comprising a test arm attached to the engine block, the test arm having an end effector that is mechanically coupled to the piston, the test arm having a first extension and a second extension, and at least one hinge coupled to one of the first extension and the second extension to allow rotational motion about the at least one hinge during the linear motion of the piston within the cylinder block. 4. The system of claim 1, wherein the processor is configured to: determine a speed of the engine; and determine the fill ratio of coolant within the cooling gallery at the determined speed of the engine based on the determined peak pressures. 5. The system of claim 4, wherein the processor is configured to: access a lookup table that correlates between the speed of the engine and the fill ratio; and determine the fill ratio based on the correlation. 6. The system of claim 4, wherein the processor is configured to: access a curve-fit equation that correlates between the speed of the engine and the fill ratio; and determine the fill ratio based on the correlation. 7. The system of claim 1, wherein the at least one pressure sensor positioned within the piston includes six or more pressure sensors distributed at sensor locations about a circumference of the piston to detect the pressure fluctuations within the cooling gallery at the sensor locations. 8. A method, comprising: measuring cyclical pressure fluctuations within a cooling gallery of a piston with at least one pressure sensor that is positioned within the piston, to detect pressure fluctuations within the cooling gallery; determining one of a peak pressure, a low pressure, and a pressure differential that occurs during the cyclical pressure fluctuations; and determining a fill ratio of coolant within the cooling gallery based on the determined peak, low, or differential pressures. 9. The method of claim 8, comprising determining the one of the peak pressure, the low pressure, and the pressure differential that occurs based on the pressures that occur during the cyclical pressure fluctuations. 10. The method of claim 9, comprising determining the fill ratio as an average fill ratio based on the one of the peak pressure, the low pressure, and the differential pressure. 11. The method of claim 8, comprising: determining a speed of piston movement; and determining the fill ratio of coolant within the cooling gallery at the determined piston speed based on the peak pressures. 12. The method of claim 11, comprising: accessing a lookup table that correlates between piston speed and the fill ratio; and determining the fill ratio based on the correlation. 13. The method of claim 11, comprising: accessing a curve-fit equation that correlates between piston speed and the fill ratio; and determining the fill ratio based on the correlation. 14. The method of claim 8, wherein the at least one pressure sensor positioned within the piston includes six or more pressure sensors distributed at sensor locations about a circumference of the piston to detect the pressure fluctuations within the cooling gallery at the sensor locations. 15. A method, comprising: filling a cooling gallery of a piston with a known volume of coolant, the cooling gallery disposed about a circumference of the piston; sealing the cooling gallery such that the coolant cannot escape from the cooling gallery; operating the piston with a cyclical action and at a known cyclical rate that causes pressure fluctuations within the cooling gallery; measuring the pressure fluctuations within the cooling gallery using at least one pressure sensor positioned to detect the pressure fluctuations; determining peak pressures, low pressures, and pressure differentials that occur during the pressure fluctuations; and correlating one of the determined pressures within the cooling gallery with the known volume of coolant. 16. The method of claim 15, comprising: wherein the known cyclical rate corresponds with an engine speed of the piston within a cylinder of an engine. 17. The method of claim 16, comprising: varying the cyclical rate over a range of engine speeds of the piston; and generating a look-up table that correlates the peak pressures with a given engine speed. 18. The method of claim 16, comprising: varying the cyclical rate over a range of engine speeds of the piston; and generating a curve-fit equation that correlates the determined pressures with a given engine speed. 19. The method of claim 15, comprising determining an average peak pressure that occurs based on the pressures during the pressure fluctuations, and the step of correlating includes correlating the correlated pressure within the cooling gallery with the known volume of coolant at the known cyclical rate. 20. The method of claim 15, wherein the at least one pressure sensor includes six or more pressure sensors distributed at sensor locations about the circumference of the piston to detect the pressure fluctuations within the cooling gallery at the sensor locations.

A system includes an engine block having a plurality of cylinder-piston combinations. At least one of the cylinder-piston combinations includes a cylinder, a piston positioned in the cylinder and coupled to a connecting rod, the piston having an internal cooling gallery about a circumference of the piston, an oil jet for introducing coolant into the cooling gallery, and at least one pressure sensor positioned within the piston to detect pressure fluctuations within the cooling gallery. The system includes a processor having a program coupled thereto. The processor is configured to detect cyclical pressure fluctuations within the cooling gallery, via the at least one pressure sensor, during a linear motion of the piston within the engine block, determine pressures that occur during the detected cyclical pressure fluctuations, and determine a fill ratio of coolant within the cooling gallery based on the determined pressures.1. A system, comprising: an engine block having a plurality of cylinder-piston combinations, wherein at least one of the cylinder-piston combinations includes: a cylinder; a piston positioned in the cylinder and coupled to a connecting rod, the piston having an internal cooling gallery about a circumference of the piston; an oil jet for introducing coolant into the cooling gallery; and at least one pressure sensor positioned within the piston to detect pressure fluctuations within the cooling gallery; and a processor having a program communicatively coupled to the processor, the processor configured to: detect cyclical pressure fluctuations within the cooling gallery, via the at least one pressure sensor, during a linear motion of the piston within the engine block; determine pressures that occur during the detected cyclical pressure fluctuations; and determine a fill ratio of coolant within the cooling gallery based on the determined pressures. 2. The system of claim 1, wherein the processor is configured to determine the pressures as one of an average peak pressure, an average low pressure, and an average pressure differential that occurs based on the detected cyclical pressure fluctuations, and wherein the processor is configured to determine the fill ratio based off of the one of the average peak pressure, the average low pressure, and the average pressure differential. 3. The system of claim 1, further comprising a test arm attached to the engine block, the test arm having an end effector that is mechanically coupled to the piston, the test arm having a first extension and a second extension, and at least one hinge coupled to one of the first extension and the second extension to allow rotational motion about the at least one hinge during the linear motion of the piston within the cylinder block. 4. The system of claim 1, wherein the processor is configured to: determine a speed of the engine; and determine the fill ratio of coolant within the cooling gallery at the determined speed of the engine based on the determined peak pressures. 5. The system of claim 4, wherein the processor is configured to: access a lookup table that correlates between the speed of the engine and the fill ratio; and determine the fill ratio based on the correlation. 6. The system of claim 4, wherein the processor is configured to: access a curve-fit equation that correlates between the speed of the engine and the fill ratio; and determine the fill ratio based on the correlation. 7. The system of claim 1, wherein the at least one pressure sensor positioned within the piston includes six or more pressure sensors distributed at sensor locations about a circumference of the piston to detect the pressure fluctuations within the cooling gallery at the sensor locations. 8. A method, comprising: measuring cyclical pressure fluctuations within a cooling gallery of a piston with at least one pressure sensor that is positioned within the piston, to detect pressure fluctuations within the cooling gallery; determining one of a peak pressure, a low pressure, and a pressure differential that occurs during the cyclical pressure fluctuations; and determining a fill ratio of coolant within the cooling gallery based on the determined peak, low, or differential pressures. 9. The method of claim 8, comprising determining the one of the peak pressure, the low pressure, and the pressure differential that occurs based on the pressures that occur during the cyclical pressure fluctuations. 10. The method of claim 9, comprising determining the fill ratio as an average fill ratio based on the one of the peak pressure, the low pressure, and the differential pressure. 11. The method of claim 8, comprising: determining a speed of piston movement; and determining the fill ratio of coolant within the cooling gallery at the determined piston speed based on the peak pressures. 12. The method of claim 11, comprising: accessing a lookup table that correlates between piston speed and the fill ratio; and determining the fill ratio based on the correlation. 13. The method of claim 11, comprising: accessing a curve-fit equation that correlates between piston speed and the fill ratio; and determining the fill ratio based on the correlation. 14. The method of claim 8, wherein the at least one pressure sensor positioned within the piston includes six or more pressure sensors distributed at sensor locations about a circumference of the piston to detect the pressure fluctuations within the cooling gallery at the sensor locations. 15. A method, comprising: filling a cooling gallery of a piston with a known volume of coolant, the cooling gallery disposed about a circumference of the piston; sealing the cooling gallery such that the coolant cannot escape from the cooling gallery; operating the piston with a cyclical action and at a known cyclical rate that causes pressure fluctuations within the cooling gallery; measuring the pressure fluctuations within the cooling gallery using at least one pressure sensor positioned to detect the pressure fluctuations; determining peak pressures, low pressures, and pressure differentials that occur during the pressure fluctuations; and correlating one of the determined pressures within the cooling gallery with the known volume of coolant. 16. The method of claim 15, comprising: wherein the known cyclical rate corresponds with an engine speed of the piston within a cylinder of an engine. 17. The method of claim 16, comprising: varying the cyclical rate over a range of engine speeds of the piston; and generating a look-up table that correlates the peak pressures with a given engine speed. 18. The method of claim 16, comprising: varying the cyclical rate over a range of engine speeds of the piston; and generating a curve-fit equation that correlates the determined pressures with a given engine speed. 19. The method of claim 15, comprising determining an average peak pressure that occurs based on the pressures during the pressure fluctuations, and the step of correlating includes correlating the correlated pressure within the cooling gallery with the known volume of coolant at the known cyclical rate. 20. The method of claim 15, wherein the at least one pressure sensor includes six or more pressure sensors distributed at sensor locations about the circumference of the piston to detect the pressure fluctuations within the cooling gallery at the sensor locations.

A screen printing apparatus for printing paste on a printed pattern of a print target constituted of a substrate or a plurality of aligned substrates includes a mask having a plurality of opening patterns different in size from one another. The screen printing apparatus images the substrate or one of the aligned substrates constituting the print target, and calculates a level of deformation by expansion and contraction of the print target, based on a result of the imaging. The screen printing apparatus then selects an opening pattern from among the opening patterns, based on the calculated level of deformation by expansion and contraction of the print target, brings the print target into contact with the mask to superimpose the selected opening pattern on the printed pattern, and deposits the paste on the printed pattern.

1. A screen printing apparatus for printing paste on a printed pattern of a print target constituted of one substrate or a plurality of aligned substrates, the screen printing apparatus comprising: a mask having a plurality of opening patterns different in size from one another; a conveyance unit that conveys the print target below the mask; an imaging unit that images the one substrate or one of the aligned substrates constituting the print target; a deformation level calculation unit that calculates a level of deformation by expansion and contraction of the print target, based on a result of the imaging by the imaging unit; a selecting unit that selects one of the opening patterns, based on the level of deformation by expansion and contraction of the print target, the level being calculated by the deformation level calculation unit; and a contact mechanism that brings the print target conveyed below the mask by the conveyance unit, into contact with the mask, wherein the contact mechanism moves the mask and the print target relatively to superimpose the opening pattern selected by the selecting unit on the printed pattern. 2. The screen printing apparatus according to claim 1, wherein the imaging unit images a pair of substrate-side marks of the one substrate or one of the aligned substrates, and the deformation level calculation unit calculates the level of deformation by expansion and contraction of the print target, based on a distance between the substrate-side marks, the distance being obtained from a result of the imaging by the imaging unit. 3. The screen printing apparatus according to claim 1, wherein the one substrate or each of the aligned substrates is a film-shaped substrate. 4. The screen printing apparatus according to claim 1, wherein the opening patterns different in size from one another are analogous to one another. 5. A screen printing method for printing paste on a printed pattern of a print target constituted of one substrate or a plurality of aligned substrates, the screen printing method comprising: a conveyance step of conveying the print target below a mask having a plurality of opening patterns different in size from one another; an imaging step of imaging the one substrate or one of the aligned substrates constituting the print target; a deformation level calculation step of calculating a level of deformation by expansion and contraction of the print target, based on a result of the imaging in the imaging step; a selecting step of selecting one of the opening patterns, based on the level of deformation by expansion and contraction of the print target, the level being calculated in the deformation level calculation step; and a contact step of bringing the print target conveyed below the mask in the conveyance step, into contact with the mask, wherein the contact step includes moving the mask and the print target relatively to superimpose the opening pattern selected in the selecting step on the printed pattern.

A screen printing apparatus for printing paste on a printed pattern of a print target constituted of a substrate or a plurality of aligned substrates includes a mask having a plurality of opening patterns different in size from one another. The screen printing apparatus images the substrate or one of the aligned substrates constituting the print target, and calculates a level of deformation by expansion and contraction of the print target, based on a result of the imaging. The screen printing apparatus then selects an opening pattern from among the opening patterns, based on the calculated level of deformation by expansion and contraction of the print target, brings the print target into contact with the mask to superimpose the selected opening pattern on the printed pattern, and deposits the paste on the printed pattern.1. A screen printing apparatus for printing paste on a printed pattern of a print target constituted of one substrate or a plurality of aligned substrates, the screen printing apparatus comprising: a mask having a plurality of opening patterns different in size from one another; a conveyance unit that conveys the print target below the mask; an imaging unit that images the one substrate or one of the aligned substrates constituting the print target; a deformation level calculation unit that calculates a level of deformation by expansion and contraction of the print target, based on a result of the imaging by the imaging unit; a selecting unit that selects one of the opening patterns, based on the level of deformation by expansion and contraction of the print target, the level being calculated by the deformation level calculation unit; and a contact mechanism that brings the print target conveyed below the mask by the conveyance unit, into contact with the mask, wherein the contact mechanism moves the mask and the print target relatively to superimpose the opening pattern selected by the selecting unit on the printed pattern. 2. The screen printing apparatus according to claim 1, wherein the imaging unit images a pair of substrate-side marks of the one substrate or one of the aligned substrates, and the deformation level calculation unit calculates the level of deformation by expansion and contraction of the print target, based on a distance between the substrate-side marks, the distance being obtained from a result of the imaging by the imaging unit. 3. The screen printing apparatus according to claim 1, wherein the one substrate or each of the aligned substrates is a film-shaped substrate. 4. The screen printing apparatus according to claim 1, wherein the opening patterns different in size from one another are analogous to one another. 5. A screen printing method for printing paste on a printed pattern of a print target constituted of one substrate or a plurality of aligned substrates, the screen printing method comprising: a conveyance step of conveying the print target below a mask having a plurality of opening patterns different in size from one another; an imaging step of imaging the one substrate or one of the aligned substrates constituting the print target; a deformation level calculation step of calculating a level of deformation by expansion and contraction of the print target, based on a result of the imaging in the imaging step; a selecting step of selecting one of the opening patterns, based on the level of deformation by expansion and contraction of the print target, the level being calculated in the deformation level calculation step; and a contact step of bringing the print target conveyed below the mask in the conveyance step, into contact with the mask, wherein the contact step includes moving the mask and the print target relatively to superimpose the opening pattern selected in the selecting step on the printed pattern.

The properties of a fluid body in the form of a surface-attached droplet/bubble can be determined. A data set is stored describing a plurality of droplets/bubbles of different shapes; each shape is captured as a combination of two or more linear dimensional measurements. For each shape the data set includes one or more parameters describing the relationship between the physical properties of a pair of fluids capable of forming that shape as a surface-attached droplet/bubble disposed in a surrounding fluid medium. A fluid body is provided in the form of a surface-attached droplet/bubble and a plurality of linear dimensional measurements are taken and provided as input to a processing apparatus. Processing apparatus determines from the data set the one or more parameters associated with the shape described by said linear dimensional measurements. Particular the surface tension of a fluid can be found in this way based on simple dimensional measurements.

1. A method of determining the properties of a fluid body in the form of a surface-attached droplet/bubble, comprising the steps of: (a) storing, in a memory accessible by a processing apparatus, a set of data describing a plurality of droplets/bubbles of different shapes, wherein each shape is captured in said data set as a combination of two or more linear dimensional measurements, and wherein for each shape the data set includes one or more parameters describing the relationship between the physical properties of a pair of fluids capable of forming said shape when a first of said fluids is a surface-attached droplet/bubble disposed in a surrounding medium of the second of said fluids; (b) providing a fluid body as a surface-attached droplet/bubble of a first fluid in a surrounding medium of a different second fluid; (c) measuring a plurality of linear dimensional measurements of said fluid body; (d) providing said measurements as an input to a processing apparatus; and (e) said processing apparatus determining from said data set said one or more parameters associated with the shape described by said linear dimensional measurements. 2. The method of claim 1, wherein one of the first and second fluids is known and the other is unknown, and wherein the properties of the known fluid permit the derivation from said one or more parameters of corresponding properties of the unknown fluid. 3. The method of claim 1, wherein said one or more parameters comprise a parameter which is a function of an accelerating field, a surface tension of one fluid at the interface with the other fluid, and the respective fluid densities. 4. The method of claim 3, wherein the accelerating field is the local gravitational field as characterised by the acceleration due to gravity, g. 5. The method of claim 1, wherein the two or more linear dimensional measurements are normalised measurements. 6. The method of claim 5, wherein the two or more linear measurements are normalised against a further linear measurement of the bubble/drop. 7. The method of claim 6, wherein the further linear measurement is a base diameter or base radius of the bubble drop at a surface to which it is attached. 8. The method of claim 1, wherein the two or more linear dimensional measurements of the data set comprise any two of the following measurements normalised against the remaining measurement: height normal to attachment surface, maximum width parallel to attachment surface, and base diameter/radius at attachment surface. 9. The method of claim 1, wherein the two or more linear dimensions of the data set are expressed as a combination of dimensions such as an area or a volume. 10. The method of claim 1, wherein the data set is limited based on one or more of the following assumptions used to create the data set: (a) a value for one or more properties of the first fluid; (b) a value for one or more properties of the second fluid; (c) a value for one or more properties of the interface between first and second fluids (d) a value for an acceleration such as gravitational acceleration, g. 11. The method of claim 1, wherein said set of data comprises a plurality of parameter sets, each parameter set describing a unique solution to an equation modelling the shape of a droplet/bubble, and each parameter set including said combination of two or more linear dimensional measurements and said one or more parameters describing the relationship between the physical properties of a pair of fluids capable of providing said solution. 12. A method of obtaining the interfacial surface tension between a liquid in a gas, comprising the steps of: performing the method of claim 1 using a bubble of said gas in said liquid or a droplet of said liquid in said gas in step (b), wherein the resultant shape of the bubble/droplet is encompassed within the data set in step (a), wherein the one or more parameters describing the relationship between the physical properties of a pair of fluids include at least one parameter based on interfacial surface tension, said at least one parameter being determined in step (e). 13. A non-transitory computer program product comprising instructions encoded on a data carrier which, when executed in a computing system, implement operations that comprise: (a) receive as an input a plurality of linear dimensional measurements of a droplet/bubble; (b) access a memory storing a set of data describing a plurality of droplets/bubbles of different shapes, wherein each shape is captured in said data set as a combination of two or more linear dimensional measurements, and wherein for each shape the data set includes one or more parameters describing the relationship between the physical properties of a pair of fluids capable of forming said shape when a first of said fluids is a surface-attached droplet/bubble disposed in a surrounding medium of the second of said fluids; (c) determining from said data set said one or more parameters associated with the shape described by said linear dimensional measurements received as an input; and (d) providing as an output said one or more parameters. 14. An apparatus for determining the properties of a fluid body in the form of a surface-attached droplet/bubble, comprising: (a) a memory storing a set of data describing a plurality of droplets/bubbles of different shapes, wherein each shape is captured in said data set as a combination of two or more linear dimensional measurements, and wherein for each shape the data set includes one or more parameters describing the relationship between the physical properties of a pair of fluids capable of forming said shape when a first of said fluids is a surface-attached droplet/bubble disposed in a surrounding medium of the second of said fluids; (b) a processor programmed to receive as an input, a plurality of linear dimensional measurements of a fluid body as a surface-attached droplet/bubble of a first fluid in a surrounding medium of a different second fluid providing said measurements as an input to a processing apparatus; and (c) a program causing said processor to determine from said data set said one or more parameters associated with the shape described by said linear dimensional measurements. 15. The apparatus as claimed in claim 14, further comprising a measurement system for making said plurality of linear dimensional measurements, and an output therefrom to said processor.

The properties of a fluid body in the form of a surface-attached droplet/bubble can be determined. A data set is stored describing a plurality of droplets/bubbles of different shapes; each shape is captured as a combination of two or more linear dimensional measurements. For each shape the data set includes one or more parameters describing the relationship between the physical properties of a pair of fluids capable of forming that shape as a surface-attached droplet/bubble disposed in a surrounding fluid medium. A fluid body is provided in the form of a surface-attached droplet/bubble and a plurality of linear dimensional measurements are taken and provided as input to a processing apparatus. Processing apparatus determines from the data set the one or more parameters associated with the shape described by said linear dimensional measurements. Particular the surface tension of a fluid can be found in this way based on simple dimensional measurements.1. A method of determining the properties of a fluid body in the form of a surface-attached droplet/bubble, comprising the steps of: (a) storing, in a memory accessible by a processing apparatus, a set of data describing a plurality of droplets/bubbles of different shapes, wherein each shape is captured in said data set as a combination of two or more linear dimensional measurements, and wherein for each shape the data set includes one or more parameters describing the relationship between the physical properties of a pair of fluids capable of forming said shape when a first of said fluids is a surface-attached droplet/bubble disposed in a surrounding medium of the second of said fluids; (b) providing a fluid body as a surface-attached droplet/bubble of a first fluid in a surrounding medium of a different second fluid; (c) measuring a plurality of linear dimensional measurements of said fluid body; (d) providing said measurements as an input to a processing apparatus; and (e) said processing apparatus determining from said data set said one or more parameters associated with the shape described by said linear dimensional measurements. 2. The method of claim 1, wherein one of the first and second fluids is known and the other is unknown, and wherein the properties of the known fluid permit the derivation from said one or more parameters of corresponding properties of the unknown fluid. 3. The method of claim 1, wherein said one or more parameters comprise a parameter which is a function of an accelerating field, a surface tension of one fluid at the interface with the other fluid, and the respective fluid densities. 4. The method of claim 3, wherein the accelerating field is the local gravitational field as characterised by the acceleration due to gravity, g. 5. The method of claim 1, wherein the two or more linear dimensional measurements are normalised measurements. 6. The method of claim 5, wherein the two or more linear measurements are normalised against a further linear measurement of the bubble/drop. 7. The method of claim 6, wherein the further linear measurement is a base diameter or base radius of the bubble drop at a surface to which it is attached. 8. The method of claim 1, wherein the two or more linear dimensional measurements of the data set comprise any two of the following measurements normalised against the remaining measurement: height normal to attachment surface, maximum width parallel to attachment surface, and base diameter/radius at attachment surface. 9. The method of claim 1, wherein the two or more linear dimensions of the data set are expressed as a combination of dimensions such as an area or a volume. 10. The method of claim 1, wherein the data set is limited based on one or more of the following assumptions used to create the data set: (a) a value for one or more properties of the first fluid; (b) a value for one or more properties of the second fluid; (c) a value for one or more properties of the interface between first and second fluids (d) a value for an acceleration such as gravitational acceleration, g. 11. The method of claim 1, wherein said set of data comprises a plurality of parameter sets, each parameter set describing a unique solution to an equation modelling the shape of a droplet/bubble, and each parameter set including said combination of two or more linear dimensional measurements and said one or more parameters describing the relationship between the physical properties of a pair of fluids capable of providing said solution. 12. A method of obtaining the interfacial surface tension between a liquid in a gas, comprising the steps of: performing the method of claim 1 using a bubble of said gas in said liquid or a droplet of said liquid in said gas in step (b), wherein the resultant shape of the bubble/droplet is encompassed within the data set in step (a), wherein the one or more parameters describing the relationship between the physical properties of a pair of fluids include at least one parameter based on interfacial surface tension, said at least one parameter being determined in step (e). 13. A non-transitory computer program product comprising instructions encoded on a data carrier which, when executed in a computing system, implement operations that comprise: (a) receive as an input a plurality of linear dimensional measurements of a droplet/bubble; (b) access a memory storing a set of data describing a plurality of droplets/bubbles of different shapes, wherein each shape is captured in said data set as a combination of two or more linear dimensional measurements, and wherein for each shape the data set includes one or more parameters describing the relationship between the physical properties of a pair of fluids capable of forming said shape when a first of said fluids is a surface-attached droplet/bubble disposed in a surrounding medium of the second of said fluids; (c) determining from said data set said one or more parameters associated with the shape described by said linear dimensional measurements received as an input; and (d) providing as an output said one or more parameters. 14. An apparatus for determining the properties of a fluid body in the form of a surface-attached droplet/bubble, comprising: (a) a memory storing a set of data describing a plurality of droplets/bubbles of different shapes, wherein each shape is captured in said data set as a combination of two or more linear dimensional measurements, and wherein for each shape the data set includes one or more parameters describing the relationship between the physical properties of a pair of fluids capable of forming said shape when a first of said fluids is a surface-attached droplet/bubble disposed in a surrounding medium of the second of said fluids; (b) a processor programmed to receive as an input, a plurality of linear dimensional measurements of a fluid body as a surface-attached droplet/bubble of a first fluid in a surrounding medium of a different second fluid providing said measurements as an input to a processing apparatus; and (c) a program causing said processor to determine from said data set said one or more parameters associated with the shape described by said linear dimensional measurements. 15. The apparatus as claimed in claim 14, further comprising a measurement system for making said plurality of linear dimensional measurements, and an output therefrom to said processor.

An object of the present invention is to provide a waterless lithographic printing plate precursor that sufficiently repels ink, which tends to adhere to non-imaging areas, and maintains its repelling effects, and a printing method using a waterless lithographic printing plate obtained from the waterless lithographic printing plate precursor. The following are provided: a lithographic printing plate precursor having at least a heat sensitive layer and an ink repellent layer, wherein the ink repellent layer contains an ink repelling, the ink repellent liquid having a boiling point of not less than 150° C. at 1 atmospheric pressure; and a method of producing a printed material, comprising the step of transferring an ink containing a photosensitive component in an amount from 10% by mass to 50% by mass to a printing substrate using a lithographic printing plate and then irradiating the printing substrate with ultraviolet light, wherein the lithographic printing plate precursor has at least an ink repellent layer on a substrate, an ink repellent liquid contained in the ink repellent layer has a surface tension of 30 mN/m or less.

1. A lithographic printing plate precursor comprising at least a heat sensitive layer and an ink repellent layer, wherein the ink repellent layer contains an ink repellent liquid, the ink repellent liquid having a boiling point of not less than 150° C. at 1 atmospheric pressure. 2. The lithographic printing plate precursor according to claim 1, wherein the liquid has a surface tension of from 15 mN/m to 30 mN/m at 25° C. 3. The lithographic printing plate precursor according to claim 1 or 2, wherein the ink repellent layer contains the liquid in an amount of from 10% by mass to 30% by mass. 4. The lithographic printing plate precursor according to any one of claims 1 to 3, wherein the heat sensitive layer contains a novolak resin. 5. The lithographic printing plate precursor according to claim 4, wherein the heat sensitive layer contains from 20% by mass to 95% by mass of the novolak resin. 6. The lithographic printing plate precursor according to claim 4 or 5, wherein the heat sensitive layer contains an organic complex compound. 7. The lithographic printing plate precursor according to claim 6, wherein the heat sensitive layer contains the novolak resin and the organic complex compound at a mass ratio of from 2 to 6. 8. The lithographic printing plate precursor according to any one of claims 1 to 7, which has a plate surface elastic modulus of from 4 MPa to 12 MPa when a load of 1400 N/m2 is applied to the surface thereof. 9. A lithographic printing plate, which is obtained by the steps of: exposing the lithographic printing plate precursor according to any one of claims 1 to 8 to light in accordance with a figure; and developing the exposed lithographic printing plate precursor to remove the ink repellent layer. 10. A method of producing a lithographic printing plate, comprising the steps of: exposing the lithographic printing plate precursor according to any one of claims 1 to 8 to light in accordance with a figure; and developing the exposed lithographic printing plate precursor to remove the ink repellent layer. 11. A method of producing a printed material, comprising the steps of: allowing an ink to adhere to the surface of the lithographic printing plate according to claim 9; and transferring the ink directly or via a blanket to a printing substrate. 12. The method of producing the printed material according to claim 10, further comprising a step of irradiating the ink transferred to the printing substrate with an active energy ray. 13. A method of producing a printed material, comprising the step of transferring an ink to a printing substrate using a lithographic printing plate and then irradiating the printing substrate with ultraviolet light, wherein the lithographic printing plate is obtained by the steps of: exposing a lithographic printing plate precursor comprising a heat sensitive layer and an ink repellent layer to light in accordance with a figure; and developing the exposed lithographic printing plate precursor to remove the ink repellent layer, and wherein the lithographic printing plate precursor comprises at least an ink repellent layer on a substrate, an ink repellent liquid contained in the ink repellent layer has a surface tension of 30 mN/m or less, and the ink contains from 10% by mass to 50% by mass of a photosensitive component. 14. The method of producing a printed material according to claim 12, wherein the liquid has a boiling point of 150° C. or more at 1 atmospheric pressure. 15. The method of producing a printed material according to claim 13 or 14, wherein the liquid is a silicone material. 16. The method of producing a printed material according to any one of claims 13 to 15, wherein the ink repellent layer contains from 10% by mass to 25% by mass of the liquid. 17. The method of producing a printed material according to any one of claims 11 to 16, wherein the ink contains from 0.5% by mass to 15% by mass of an acrylate ester or methacrylate ester having a linear-chain alkyl group.

An object of the present invention is to provide a waterless lithographic printing plate precursor that sufficiently repels ink, which tends to adhere to non-imaging areas, and maintains its repelling effects, and a printing method using a waterless lithographic printing plate obtained from the waterless lithographic printing plate precursor. The following are provided: a lithographic printing plate precursor having at least a heat sensitive layer and an ink repellent layer, wherein the ink repellent layer contains an ink repelling, the ink repellent liquid having a boiling point of not less than 150° C. at 1 atmospheric pressure; and a method of producing a printed material, comprising the step of transferring an ink containing a photosensitive component in an amount from 10% by mass to 50% by mass to a printing substrate using a lithographic printing plate and then irradiating the printing substrate with ultraviolet light, wherein the lithographic printing plate precursor has at least an ink repellent layer on a substrate, an ink repellent liquid contained in the ink repellent layer has a surface tension of 30 mN/m or less.1. A lithographic printing plate precursor comprising at least a heat sensitive layer and an ink repellent layer, wherein the ink repellent layer contains an ink repellent liquid, the ink repellent liquid having a boiling point of not less than 150° C. at 1 atmospheric pressure. 2. The lithographic printing plate precursor according to claim 1, wherein the liquid has a surface tension of from 15 mN/m to 30 mN/m at 25° C. 3. The lithographic printing plate precursor according to claim 1 or 2, wherein the ink repellent layer contains the liquid in an amount of from 10% by mass to 30% by mass. 4. The lithographic printing plate precursor according to any one of claims 1 to 3, wherein the heat sensitive layer contains a novolak resin. 5. The lithographic printing plate precursor according to claim 4, wherein the heat sensitive layer contains from 20% by mass to 95% by mass of the novolak resin. 6. The lithographic printing plate precursor according to claim 4 or 5, wherein the heat sensitive layer contains an organic complex compound. 7. The lithographic printing plate precursor according to claim 6, wherein the heat sensitive layer contains the novolak resin and the organic complex compound at a mass ratio of from 2 to 6. 8. The lithographic printing plate precursor according to any one of claims 1 to 7, which has a plate surface elastic modulus of from 4 MPa to 12 MPa when a load of 1400 N/m2 is applied to the surface thereof. 9. A lithographic printing plate, which is obtained by the steps of: exposing the lithographic printing plate precursor according to any one of claims 1 to 8 to light in accordance with a figure; and developing the exposed lithographic printing plate precursor to remove the ink repellent layer. 10. A method of producing a lithographic printing plate, comprising the steps of: exposing the lithographic printing plate precursor according to any one of claims 1 to 8 to light in accordance with a figure; and developing the exposed lithographic printing plate precursor to remove the ink repellent layer. 11. A method of producing a printed material, comprising the steps of: allowing an ink to adhere to the surface of the lithographic printing plate according to claim 9; and transferring the ink directly or via a blanket to a printing substrate. 12. The method of producing the printed material according to claim 10, further comprising a step of irradiating the ink transferred to the printing substrate with an active energy ray. 13. A method of producing a printed material, comprising the step of transferring an ink to a printing substrate using a lithographic printing plate and then irradiating the printing substrate with ultraviolet light, wherein the lithographic printing plate is obtained by the steps of: exposing a lithographic printing plate precursor comprising a heat sensitive layer and an ink repellent layer to light in accordance with a figure; and developing the exposed lithographic printing plate precursor to remove the ink repellent layer, and wherein the lithographic printing plate precursor comprises at least an ink repellent layer on a substrate, an ink repellent liquid contained in the ink repellent layer has a surface tension of 30 mN/m or less, and the ink contains from 10% by mass to 50% by mass of a photosensitive component. 14. The method of producing a printed material according to claim 12, wherein the liquid has a boiling point of 150° C. or more at 1 atmospheric pressure. 15. The method of producing a printed material according to claim 13 or 14, wherein the liquid is a silicone material. 16. The method of producing a printed material according to any one of claims 13 to 15, wherein the ink repellent layer contains from 10% by mass to 25% by mass of the liquid. 17. The method of producing a printed material according to any one of claims 11 to 16, wherein the ink contains from 0.5% by mass to 15% by mass of an acrylate ester or methacrylate ester having a linear-chain alkyl group.

A meter assembly includes: a meter housing including a top portion, the top portion including a mounting boss, the mounting boss including an engagement hook and protruding axially from a top surface of the top portion of the first housing; a register housing connected to the top portion of the first housing and configured to rotate with respect to the first housing about a rotation axis; and a retaining fastener connecting the second housing to the first housing, the retaining fastener including a one of a hook and a flange configured to engage the mounting boss and a one of a hook and a flange configured to engage the second housing.

1. A meter assembly comprising: a meter housing comprising a top portion, the top portion comprising a mounting boss, the mounting boss comprising an engagement hook and protruding axially from a top surface of the top portion of the first housing; a register housing connected to the top portion of the first housing and configured to rotate with respect to the first housing about a rotation axis; and a retaining fastener connecting the second housing to the first housing, the retaining fastener comprising a one of a hook and a flange configured to engage the mounting boss and a one of a hook and a flange configured to engage the second housing. 2. The meter assembly of claim 1, wherein the engagement hook of the mounting boss protrudes radially outward from the rotation axis. 3. The meter assembly of claim 1, wherein the retaining fastener comprises a plurality of engagement hooks, the plurality of engagement hooks arranged in a circular configuration extending radially outward from the rotation axis along an outer periphery of the retaining fastener. 4. The meter assembly of claim 1, wherein each of the plurality of engagement hooks of the retaining fastener comprises a first hook ledge facing a second hook ledge of the register housing. 5. The meter assembly of claim 1, wherein each of the plurality of engagement hooks of the retaining fastener comprises an inclined wall facing radially outward from the rotation axis. 6. The meter assembly of claim 1, wherein the retaining fastener includes a flange configured to engage the mounting boss of the meter housing and a plurality of hooks configured to engage the register housing. 7. The meter assembly of claim 6, wherein the flange is positioned between the engagement hook of the mounting boss of the meter housing and the top portion of the meter housing. 8. The meter assembly of claim 1, wherein the retaining fastener further comprises a tab configured to limit rotation of the register housing with respect to the meter housing about a common axis. 9. The meter assembly of claim 1, wherein the register housing comprises an engagement hook, the engagement hook comprising an inclined wall facing radially inward with respect to the rotation axis, the engagement hook configured to engage the retaining fastener. 10. A meter assembly comprising: a housing comprising a socket defining an axis; a linkage arm comprising a register end positioned at least partly within the socket; and a retaining fastener connecting the register end of the linkage arm to the housing, the linkage arm configured to rotate relative to the housing while fixed in an axial direction defined by the axis. 11. The meter assembly of claim 10, wherein the retaining fastener is a retaining pin, the retaining pin including at least one engagement hook. 12. The meter assembly of claim 11, wherein the linkage arm includes an outer wall defining an elongated slot sized to accept the retaining pin, the retaining pin slidable within the elongated slot to allow the linkage arm to rotate relative to the housing. 13. The meter assembly of claim 10, further comprising a wireless communication device connected to the linkage arm. 14. The method of claim 10, wherein the retaining fastener is configured to visibly break when the linkage arm and the housing are separated. 15. A method of using a meter assembly, the method comprising: rotating a register housing of the meter assembly relative to a meter housing of the meter assembly about a rotation axis to a desired rotation angle, the register housing secured to the meter housing with a retaining fastener; and rotating a linkage arm to a desired rotation angle about a linkage arm axis, the linkage arm connected to the register housing with a second retaining fastener, the linkage arm connecting a communication device to the register housing. 16. The method of claim 15, wherein the linkage arm axis is angled with respect to the rotation axis. 17. The method of claim 15, wherein the linkage arm is configured to rotate an angular displacement about the linkage arm axis from a center position in a positive or a negative direction. 18. The method of claim 17, wherein the center position is aligned along a direction that is parallel to the rotation axis of the register housing. 19. The method of claim 18, wherein the linkage arm is configured to rotate up to an angular displacement of 70 degrees about the linkage arm axis from a center position in a positive or a negative direction. 20. The method of claim 15, wherein a register end of the linkage arm defines a bore extending through a thickness of the linkage arm, the bore being annular in orientation and sized to receive the second retaining fastener, the second retaining fastener being a retaining pin, and wherein rotating the linkage arm to a desired rotation angle about the linkage arm axis comprises rotating the bore with respect to the retaining pin so that the retaining pin slides within the bore.

A meter assembly includes: a meter housing including a top portion, the top portion including a mounting boss, the mounting boss including an engagement hook and protruding axially from a top surface of the top portion of the first housing; a register housing connected to the top portion of the first housing and configured to rotate with respect to the first housing about a rotation axis; and a retaining fastener connecting the second housing to the first housing, the retaining fastener including a one of a hook and a flange configured to engage the mounting boss and a one of a hook and a flange configured to engage the second housing.1. A meter assembly comprising: a meter housing comprising a top portion, the top portion comprising a mounting boss, the mounting boss comprising an engagement hook and protruding axially from a top surface of the top portion of the first housing; a register housing connected to the top portion of the first housing and configured to rotate with respect to the first housing about a rotation axis; and a retaining fastener connecting the second housing to the first housing, the retaining fastener comprising a one of a hook and a flange configured to engage the mounting boss and a one of a hook and a flange configured to engage the second housing. 2. The meter assembly of claim 1, wherein the engagement hook of the mounting boss protrudes radially outward from the rotation axis. 3. The meter assembly of claim 1, wherein the retaining fastener comprises a plurality of engagement hooks, the plurality of engagement hooks arranged in a circular configuration extending radially outward from the rotation axis along an outer periphery of the retaining fastener. 4. The meter assembly of claim 1, wherein each of the plurality of engagement hooks of the retaining fastener comprises a first hook ledge facing a second hook ledge of the register housing. 5. The meter assembly of claim 1, wherein each of the plurality of engagement hooks of the retaining fastener comprises an inclined wall facing radially outward from the rotation axis. 6. The meter assembly of claim 1, wherein the retaining fastener includes a flange configured to engage the mounting boss of the meter housing and a plurality of hooks configured to engage the register housing. 7. The meter assembly of claim 6, wherein the flange is positioned between the engagement hook of the mounting boss of the meter housing and the top portion of the meter housing. 8. The meter assembly of claim 1, wherein the retaining fastener further comprises a tab configured to limit rotation of the register housing with respect to the meter housing about a common axis. 9. The meter assembly of claim 1, wherein the register housing comprises an engagement hook, the engagement hook comprising an inclined wall facing radially inward with respect to the rotation axis, the engagement hook configured to engage the retaining fastener. 10. A meter assembly comprising: a housing comprising a socket defining an axis; a linkage arm comprising a register end positioned at least partly within the socket; and a retaining fastener connecting the register end of the linkage arm to the housing, the linkage arm configured to rotate relative to the housing while fixed in an axial direction defined by the axis. 11. The meter assembly of claim 10, wherein the retaining fastener is a retaining pin, the retaining pin including at least one engagement hook. 12. The meter assembly of claim 11, wherein the linkage arm includes an outer wall defining an elongated slot sized to accept the retaining pin, the retaining pin slidable within the elongated slot to allow the linkage arm to rotate relative to the housing. 13. The meter assembly of claim 10, further comprising a wireless communication device connected to the linkage arm. 14. The method of claim 10, wherein the retaining fastener is configured to visibly break when the linkage arm and the housing are separated. 15. A method of using a meter assembly, the method comprising: rotating a register housing of the meter assembly relative to a meter housing of the meter assembly about a rotation axis to a desired rotation angle, the register housing secured to the meter housing with a retaining fastener; and rotating a linkage arm to a desired rotation angle about a linkage arm axis, the linkage arm connected to the register housing with a second retaining fastener, the linkage arm connecting a communication device to the register housing. 16. The method of claim 15, wherein the linkage arm axis is angled with respect to the rotation axis. 17. The method of claim 15, wherein the linkage arm is configured to rotate an angular displacement about the linkage arm axis from a center position in a positive or a negative direction. 18. The method of claim 17, wherein the center position is aligned along a direction that is parallel to the rotation axis of the register housing. 19. The method of claim 18, wherein the linkage arm is configured to rotate up to an angular displacement of 70 degrees about the linkage arm axis from a center position in a positive or a negative direction. 20. The method of claim 15, wherein a register end of the linkage arm defines a bore extending through a thickness of the linkage arm, the bore being annular in orientation and sized to receive the second retaining fastener, the second retaining fastener being a retaining pin, and wherein rotating the linkage arm to a desired rotation angle about the linkage arm axis comprises rotating the bore with respect to the retaining pin so that the retaining pin slides within the bore.

The present invention relates to an apparatus for measuring the balance ability; postural deviation, reflex and fall risk assessment of a human subject. In particular, the present invention comprises of an elastic support mounted platform with dynamic response to external motion stimuli, a IMU and data analysis software processing device. The dynamic response from the platform also simulates realistic experience in moving over rough terrain with different topography.

1. A method for measuring a balance index of a human subject comprising providing a flat platform mounted on one or more elastic supports to provide a wobbly surface for the subject to stand on, the platform comprises an inertia measurement unit (IMU); placing the subject onto the flat platform; measuring center of gravity (COG) of the subject while the subject balances on the platform; measuring movements of COG of said human subject in three orthogonal vectors over a time interval to obtain a COG trajectory in a three-dimensional space over the time interval; summing over the COG trajectory of said human subject in three-dimensional space to obtain a gait energy over said time interval; dividing said gait energy over said time interval to obtain a gait power value; and normalizing said gait power value to determine as a measure of balance index for said human subject. 2. A method for measuring balance anisotropy and assessing risk of falling for a human subject comprising measuring relative magnitude of the balance index in four orthogonal directions of said human subject, wherein the balance index is measured according to the method of claim 1 and the four orthogonal direction consist of front facing direction, back direction, left direction and right direction of said human subject. 3. A method for measuring postural deviation of a human subject comprising measuring COG trajectory of the human subject on a flat platform according to claim 1 and obtaining a deviation of the COG trajectory of the human subject standing on the flat platform from COG of an unloaded flat platform. 4. The method according to claim 1, wherein the IMU measures acceleration in all three orthogonal directions, and wherein the elastic supports are selected from compression springs, extension springs, leaf springs, magnetic repulsion, elastomer balls and cylinders, closed cell high density elastomer foam cushion, inflated rubber ball, inflated rubber cushion, floats on fluid, suspended platform and a combination thereof. 5. The method according to claim 1, wherein said flat platform is a closed cell high density elastomer foam pad having a rigid base plate at the centre of the platform and the IMU is mounted on a rigid base plate, wherein said rigid base plate is connected to at least one rigid longitudinal body that radiate from the center of the rigid base plate. 6. The method according to claim 5, wherein said flat platform further comprises arrays of cavities. 7. The method according to claim 6, wherein the IMU, the rigid base plate and the at least one rigid longitudinal body are embedded inside the flat platform. 8. The method according to claim 5, wherein the IMU is a tri-axial accelerometer. 9. A balance index measuring apparatus comprising a flat platform mounted on one or more elastic supports to provide a wobbly surface for a human subject to stand on, the platform comprises an IMU. 10. The apparatus according to claim 9, wherein the elastic supports are selected from the group consisting of compression springs, extension springs, leaf springs, magnetic repulsion, elastomer balls and cylinders, elastomer foam cushion, inflated rubber ball, inflated rubber cushion, floats on fluid and suspended platform and a combination thereof. 11. The apparatus according to claim 9, wherein said flat platform is an elastomer foam pad having a rigid base plate at the center of the platform and the IMU is mounted on the rigid base plate, wherein said base plate is connected to at least one rigid longitudinal body that radiate from the center of the base plate. 12. The apparatus according to claim 11 wherein the IMU, the rigid base plate and the at least one rigid longitudinal body are embedded inside the platform. 13. The apparatus according to claim 12, wherein the IMU is a tri-axial accelerometer. 14. The apparatus according to claim 9 further comprises a computing device, wherein the computing device is in electronic connection with the platform via wired or wireless data connection. 15. The apparatus according to claim 9 further comprises a weight scale in connection with the flat platform.

The present invention relates to an apparatus for measuring the balance ability; postural deviation, reflex and fall risk assessment of a human subject. In particular, the present invention comprises of an elastic support mounted platform with dynamic response to external motion stimuli, a IMU and data analysis software processing device. The dynamic response from the platform also simulates realistic experience in moving over rough terrain with different topography.1. A method for measuring a balance index of a human subject comprising providing a flat platform mounted on one or more elastic supports to provide a wobbly surface for the subject to stand on, the platform comprises an inertia measurement unit (IMU); placing the subject onto the flat platform; measuring center of gravity (COG) of the subject while the subject balances on the platform; measuring movements of COG of said human subject in three orthogonal vectors over a time interval to obtain a COG trajectory in a three-dimensional space over the time interval; summing over the COG trajectory of said human subject in three-dimensional space to obtain a gait energy over said time interval; dividing said gait energy over said time interval to obtain a gait power value; and normalizing said gait power value to determine as a measure of balance index for said human subject. 2. A method for measuring balance anisotropy and assessing risk of falling for a human subject comprising measuring relative magnitude of the balance index in four orthogonal directions of said human subject, wherein the balance index is measured according to the method of claim 1 and the four orthogonal direction consist of front facing direction, back direction, left direction and right direction of said human subject. 3. A method for measuring postural deviation of a human subject comprising measuring COG trajectory of the human subject on a flat platform according to claim 1 and obtaining a deviation of the COG trajectory of the human subject standing on the flat platform from COG of an unloaded flat platform. 4. The method according to claim 1, wherein the IMU measures acceleration in all three orthogonal directions, and wherein the elastic supports are selected from compression springs, extension springs, leaf springs, magnetic repulsion, elastomer balls and cylinders, closed cell high density elastomer foam cushion, inflated rubber ball, inflated rubber cushion, floats on fluid, suspended platform and a combination thereof. 5. The method according to claim 1, wherein said flat platform is a closed cell high density elastomer foam pad having a rigid base plate at the centre of the platform and the IMU is mounted on a rigid base plate, wherein said rigid base plate is connected to at least one rigid longitudinal body that radiate from the center of the rigid base plate. 6. The method according to claim 5, wherein said flat platform further comprises arrays of cavities. 7. The method according to claim 6, wherein the IMU, the rigid base plate and the at least one rigid longitudinal body are embedded inside the flat platform. 8. The method according to claim 5, wherein the IMU is a tri-axial accelerometer. 9. A balance index measuring apparatus comprising a flat platform mounted on one or more elastic supports to provide a wobbly surface for a human subject to stand on, the platform comprises an IMU. 10. The apparatus according to claim 9, wherein the elastic supports are selected from the group consisting of compression springs, extension springs, leaf springs, magnetic repulsion, elastomer balls and cylinders, elastomer foam cushion, inflated rubber ball, inflated rubber cushion, floats on fluid and suspended platform and a combination thereof. 11. The apparatus according to claim 9, wherein said flat platform is an elastomer foam pad having a rigid base plate at the center of the platform and the IMU is mounted on the rigid base plate, wherein said base plate is connected to at least one rigid longitudinal body that radiate from the center of the base plate. 12. The apparatus according to claim 11 wherein the IMU, the rigid base plate and the at least one rigid longitudinal body are embedded inside the platform. 13. The apparatus according to claim 12, wherein the IMU is a tri-axial accelerometer. 14. The apparatus according to claim 9 further comprises a computing device, wherein the computing device is in electronic connection with the platform via wired or wireless data connection. 15. The apparatus according to claim 9 further comprises a weight scale in connection with the flat platform.

A computer system can generate a materialized query table (MQT) for data from a base table that has a plurality of rows and columns that each contain stored data. The computer system can receive a query to data stored in a row from the base table. The system can identify a column in the row and determine that data from a cell in the row and the column is above a threshold memory size. The system can generate, in response to determining that the data being above the threshold memory size, an MQT that includes data for the row and that includes a reference pointer that points to a location shared with another table.

1. A computer-implemented method performed by a processor, comprising: receiving a first query to retrieve data stored in a row in a base table; identifying a first cell and a second cell in the base table, the first cell corresponding to a first column in the row, the second cell corresponding to a second column in the row; determining that data in the first cell is above a threshold memory size, wherein the data from the first cell is a large object (LOB) and the threshold memory size is set by a database manager; determining, based on a share parameter of the base table, that the base table is permitted to share the data for the row with a first materialized query table (MQT), wherein the share parameter of the base table is automatically configured based upon a set of configuration rules; generating, in response to determining that the LOB is above the threshold memory size, the first MQT, the first MQT containing the data for the second cell and having a first reference pointer in place of the data of the first cell, the first reference pointer indicating a location of the LOB in the base table; storing the first MQT in a location that is separate from the base table; generating an index that includes a storage space pointer, the storage space pointer being configured to identify the location of the first MQT; identifying a first refresh schedule, the first refresh schedule being associated with the base table; identifying a second refresh schedule, the second refresh schedule being associated with the first MQT; synchronizing the first refresh schedule and the second refresh schedule to a common refresh rate, the common refresh rate maintaining consistency with changes in the base table; receiving a second query to retrieve the data stored in the first cell; accessing the index that stores the storage space pointer to the first MQT; rewriting, by the database manager, the second query to direct the second query to the first MQT; identifying the first reference pointer in the first MQT, the first reference pointer identifying the location of the LOB in the base table; retrieving, from the base table, the data for the LOB; receiving a third query to retrieve data stored in the row in the base table; identifying the first cell and a third cell in the base table, the first cell corresponding to the first column in the row, the third cell corresponding to a third column in the row; determining that data from the first cell is above the threshold memory size; determining, based on a share parameter of the first MQT, that the first MQT is permitted to share the data with a second MQT, wherein the share parameter of the first MQT is automatically configured based upon a set of configuration rules; generating the second MQT, the second MQT containing the data for the third cell and having a second reference pointer in place of the data of the first cell, the second reference pointer indicating a location of the first reference pointer in the first MQT; identifying the first reference pointer in the first MQT, the first reference pointer identifying the location of the first cell; and retrieving, from the base table, the data for the LOB.

A computer system can generate a materialized query table (MQT) for data from a base table that has a plurality of rows and columns that each contain stored data. The computer system can receive a query to data stored in a row from the base table. The system can identify a column in the row and determine that data from a cell in the row and the column is above a threshold memory size. The system can generate, in response to determining that the data being above the threshold memory size, an MQT that includes data for the row and that includes a reference pointer that points to a location shared with another table.1. A computer-implemented method performed by a processor, comprising: receiving a first query to retrieve data stored in a row in a base table; identifying a first cell and a second cell in the base table, the first cell corresponding to a first column in the row, the second cell corresponding to a second column in the row; determining that data in the first cell is above a threshold memory size, wherein the data from the first cell is a large object (LOB) and the threshold memory size is set by a database manager; determining, based on a share parameter of the base table, that the base table is permitted to share the data for the row with a first materialized query table (MQT), wherein the share parameter of the base table is automatically configured based upon a set of configuration rules; generating, in response to determining that the LOB is above the threshold memory size, the first MQT, the first MQT containing the data for the second cell and having a first reference pointer in place of the data of the first cell, the first reference pointer indicating a location of the LOB in the base table; storing the first MQT in a location that is separate from the base table; generating an index that includes a storage space pointer, the storage space pointer being configured to identify the location of the first MQT; identifying a first refresh schedule, the first refresh schedule being associated with the base table; identifying a second refresh schedule, the second refresh schedule being associated with the first MQT; synchronizing the first refresh schedule and the second refresh schedule to a common refresh rate, the common refresh rate maintaining consistency with changes in the base table; receiving a second query to retrieve the data stored in the first cell; accessing the index that stores the storage space pointer to the first MQT; rewriting, by the database manager, the second query to direct the second query to the first MQT; identifying the first reference pointer in the first MQT, the first reference pointer identifying the location of the LOB in the base table; retrieving, from the base table, the data for the LOB; receiving a third query to retrieve data stored in the row in the base table; identifying the first cell and a third cell in the base table, the first cell corresponding to the first column in the row, the third cell corresponding to a third column in the row; determining that data from the first cell is above the threshold memory size; determining, based on a share parameter of the first MQT, that the first MQT is permitted to share the data with a second MQT, wherein the share parameter of the first MQT is automatically configured based upon a set of configuration rules; generating the second MQT, the second MQT containing the data for the third cell and having a second reference pointer in place of the data of the first cell, the second reference pointer indicating a location of the first reference pointer in the first MQT; identifying the first reference pointer in the first MQT, the first reference pointer identifying the location of the first cell; and retrieving, from the base table, the data for the LOB.

A device for random number generation based on an optical process of quantum nature, including a light source emitting photons randomly, a light detector adapted to absorb the randomly emitted photons and to measure a number n of photons produced by the light source in a time interval T, and a randomness extractor. The detector includes a photon sensor acting as a photon-to-electron converter, an amplifier for converting the electron signal received from the photon sensor into a voltage and amplifying the voltage signal, as well as an analog-to-digital converter for processing the amplified signal received from the amplifier by encoding the amplified signal into digital values and sending these digital values to the randomness extractor for further processing such as to produce quantum random numbers (QRNs) based on the number of photons produced by the light source in a time interval T.

1. Device for random number generation based on an optical process of quantum nature comprising: a light source emitting photons randomly, a light detector comprising a photon sensor adapted to absorb the randomly emitted photons, an amplifier for converting an electron signal received from the photon sensor into a voltage and amplifying the voltage signal, and an analog-to-digital converter (ADC) for treating the amplified signal received from the amplifier by encoding the amplified signal into digital values and sending these digital values to a randomness extractor of the device for further processing, wherein the randomness extractor is adapted to generate a number k of high-entropy output bits yj from a number l>k of lower-entropy raw input bits ri, the photon sensor of the detector is adapted to operate in a linear regime and acts as a photon-to-electron converter to allow the detector to be adapted to measure a number n of photons produced by said light source in a time interval T, the randomness extractor is adapted, for raw input bits ri with entropy s per bit, to generate output bits yj having a probability that the output bits yj deviate from a perfectly random bit string bounded by ε=2−(sl−k)/2, such as to produce quantum random numbers (QRNs) based on said number n of photons produced by the light source in the time interval T. 2. The device according to claim 1, wherein the light source is selected from a group of light sources consisting of a light-emitting diode (LED), a laser diode (LD), ambient light, or any other adequate light source emitting photons randomly. 3. The device according to claim 1, wherein the photon sensor is selected from a group of photon detectors consisting of a CCD camera, a CMOS camera, in particular an image sensor with an array of pixels, or any other adequate photon detector having a sufficient single photon resolution. 4. The device according to claim 1, wherein the analog-to-digital converter has an electron-to-digital conversion factor ζ fulfilling the condition ζ≧1. 5. The device according to claim 1, wherein the randomness extractor is implemented by software or by hardware. 6. The device according to claim 1, wherein the randomness extractor is realized by a hash function or by a vector-matrix multiplication between a vector formed by the raw bit values ri generated at the output of the detector and a random l×k matrix M according to y j =ΣM ji r i, 7. The device according to claim 1, wherein the randomness extractor is determined such as to produce digital output bit values yj of the randomness extractor having an amount of quantum entropy per output bit close to 1. 8. The device according to claim 1, wherein the light source, light detector, amplifier, and ADC are integrated at a system, circuit, package or dye level, preferably on a Field Programmable Gate Array (FPGA) or directly on a CMOS sensor chip. 9. An apparatus, in particular a computer, a telephone, a mobile computer or mobile telephone, a tablet computer, a smart phone, a network cryptographic device, a personal cryptographic device, an electronic wallet, or any other type of similar instruments, comprising the of claim 1. 10. A method for random number generation based on an optical process of quantum nature comprising the steps of: providing a light source emitting photons randomly, providing a light detector comprising a photon sensor adapted to absorb the randomly emitted photons, an amplifier, and an analog-to-digital converter, converting an electron signal received from the photon sensor into a voltage and amplifying the voltage signal using said amplifier of detector, treating the amplified signal received from the amplifier by encoding the amplified signal into digital values using said analog-to-digital converter of detector and sending these values to a randomness extractor for further processing, and providing a randomness extractor being adapted to generate a number k of high-entropy output bits yj from a number l>k of lower-entropy raw input bits ri, operating the photon sensor of the detector in a linear regime such as to allow detecting a number n of photons produced by said light source in a time interval T and converting said number of photons into a corresponding number of electrons with the help of said photon sensor of the detector, generating by use of the randomness extractor, for raw input bits ri with entropy s per bit, output bits yj having a probability that the output bits yj deviate from a perfectly random bit string bounded by ε=2−(sl−k)/2, such as to produce quantum random numbers (QRNs) based on said number n of photons produced by the light source in a time interval T. 11. The method according to claim 10, wherein the photon sensor of detector is illuminated by the light source during the time interval T, wherein a mean number of absorbed photons n is sufficient to give a quantum uncertainty σq=√{square root over (n)} as large as possible without saturating the photon sensor. 12. The method according to claim 10, wherein the photon sensor of detector is illuminated by the light source with a photon intensity situated within a range of intensities where the Fano factor of the photon sensor is close to 1. 13. The method according to claim 10, wherein an exposure time during which the photon sensor is illuminated by the light source is selected such that the detector works in its linear regime. 14. The method according to claim 10, wherein the raw digital values ri generated at the output of detector, respectively the digital values yj at the output of the randomness extractor are encoded over b bits, or are encoded on another basis than the binary system. 15. A computer program means stored in a computer readable medium adapted to implement the method according to claim 10.

A device for random number generation based on an optical process of quantum nature, including a light source emitting photons randomly, a light detector adapted to absorb the randomly emitted photons and to measure a number n of photons produced by the light source in a time interval T, and a randomness extractor. The detector includes a photon sensor acting as a photon-to-electron converter, an amplifier for converting the electron signal received from the photon sensor into a voltage and amplifying the voltage signal, as well as an analog-to-digital converter for processing the amplified signal received from the amplifier by encoding the amplified signal into digital values and sending these digital values to the randomness extractor for further processing such as to produce quantum random numbers (QRNs) based on the number of photons produced by the light source in a time interval T.1. Device for random number generation based on an optical process of quantum nature comprising: a light source emitting photons randomly, a light detector comprising a photon sensor adapted to absorb the randomly emitted photons, an amplifier for converting an electron signal received from the photon sensor into a voltage and amplifying the voltage signal, and an analog-to-digital converter (ADC) for treating the amplified signal received from the amplifier by encoding the amplified signal into digital values and sending these digital values to a randomness extractor of the device for further processing, wherein the randomness extractor is adapted to generate a number k of high-entropy output bits yj from a number l>k of lower-entropy raw input bits ri, the photon sensor of the detector is adapted to operate in a linear regime and acts as a photon-to-electron converter to allow the detector to be adapted to measure a number n of photons produced by said light source in a time interval T, the randomness extractor is adapted, for raw input bits ri with entropy s per bit, to generate output bits yj having a probability that the output bits yj deviate from a perfectly random bit string bounded by ε=2−(sl−k)/2, such as to produce quantum random numbers (QRNs) based on said number n of photons produced by the light source in the time interval T. 2. The device according to claim 1, wherein the light source is selected from a group of light sources consisting of a light-emitting diode (LED), a laser diode (LD), ambient light, or any other adequate light source emitting photons randomly. 3. The device according to claim 1, wherein the photon sensor is selected from a group of photon detectors consisting of a CCD camera, a CMOS camera, in particular an image sensor with an array of pixels, or any other adequate photon detector having a sufficient single photon resolution. 4. The device according to claim 1, wherein the analog-to-digital converter has an electron-to-digital conversion factor ζ fulfilling the condition ζ≧1. 5. The device according to claim 1, wherein the randomness extractor is implemented by software or by hardware. 6. The device according to claim 1, wherein the randomness extractor is realized by a hash function or by a vector-matrix multiplication between a vector formed by the raw bit values ri generated at the output of the detector and a random l×k matrix M according to y j =ΣM ji r i, 7. The device according to claim 1, wherein the randomness extractor is determined such as to produce digital output bit values yj of the randomness extractor having an amount of quantum entropy per output bit close to 1. 8. The device according to claim 1, wherein the light source, light detector, amplifier, and ADC are integrated at a system, circuit, package or dye level, preferably on a Field Programmable Gate Array (FPGA) or directly on a CMOS sensor chip. 9. An apparatus, in particular a computer, a telephone, a mobile computer or mobile telephone, a tablet computer, a smart phone, a network cryptographic device, a personal cryptographic device, an electronic wallet, or any other type of similar instruments, comprising the of claim 1. 10. A method for random number generation based on an optical process of quantum nature comprising the steps of: providing a light source emitting photons randomly, providing a light detector comprising a photon sensor adapted to absorb the randomly emitted photons, an amplifier, and an analog-to-digital converter, converting an electron signal received from the photon sensor into a voltage and amplifying the voltage signal using said amplifier of detector, treating the amplified signal received from the amplifier by encoding the amplified signal into digital values using said analog-to-digital converter of detector and sending these values to a randomness extractor for further processing, and providing a randomness extractor being adapted to generate a number k of high-entropy output bits yj from a number l>k of lower-entropy raw input bits ri, operating the photon sensor of the detector in a linear regime such as to allow detecting a number n of photons produced by said light source in a time interval T and converting said number of photons into a corresponding number of electrons with the help of said photon sensor of the detector, generating by use of the randomness extractor, for raw input bits ri with entropy s per bit, output bits yj having a probability that the output bits yj deviate from a perfectly random bit string bounded by ε=2−(sl−k)/2, such as to produce quantum random numbers (QRNs) based on said number n of photons produced by the light source in a time interval T. 11. The method according to claim 10, wherein the photon sensor of detector is illuminated by the light source during the time interval T, wherein a mean number of absorbed photons n is sufficient to give a quantum uncertainty σq=√{square root over (n)} as large as possible without saturating the photon sensor. 12. The method according to claim 10, wherein the photon sensor of detector is illuminated by the light source with a photon intensity situated within a range of intensities where the Fano factor of the photon sensor is close to 1. 13. The method according to claim 10, wherein an exposure time during which the photon sensor is illuminated by the light source is selected such that the detector works in its linear regime. 14. The method according to claim 10, wherein the raw digital values ri generated at the output of detector, respectively the digital values yj at the output of the randomness extractor are encoded over b bits, or are encoded on another basis than the binary system. 15. A computer program means stored in a computer readable medium adapted to implement the method according to claim 10.

An image forming apparatus includes an image forming unit configured to form a predetermined pattern image on a sheet, a notifying unit configured to provide a notification of an orientation for placing the sheet on which the predetermined pattern image is formed by the image forming unit, on a placement portion, a reading unit configured to read the sheet on a line to line basis, to generate image data, and a detection unit configured to detect a streak-shaped image extending in a direction along a predetermined edge of the sheet, by analyzing the image data generated by reading the sheet by the reading unit, wherein the notifying unit provides a notification of a placement orientation for allowing the sheet, on which the predetermined pattern image is formed, to be read on a line to line basis, the line extending in a direction along the predetermined edge.

1. An image forming apparatus comprising: an image forming unit configured to form a predetermined pattern image on a sheet; a notifying unit configured to provide a notification of an orientation for placing, on a placement portion, the sheet on which the predetermined pattern image is formed by the image forming unit; a reading unit configured to read the sheet placed on the placement portion on a line to line basis, to generate image data; and a detection unit configured to detect a streak-shaped image extending in a direction along a predetermined edge of the sheet, by analyzing the image data generated by reading the sheet by the reading unit, wherein the notifying unit provides a notification of a placement orientation for allowing the reading unit to read the sheet on which the predetermined pattern image is formed, on a line to line basis, the line extending in a direction along the predetermined edge. 2. The image forming apparatus according to claim 1, further comprising a display unit, wherein the notifying unit displays, on the display unit, an orientation for placing the sheet on the placement portion, after the image forming unit forms the predetermined pattern image on the sheet. 3. The image forming apparatus according to claim 1, further comprising a control unit configured to perform control in such a manner that the reading unit can start reading the sheet in response to placement of the sheet in the orientation notified by the notifying unit. 4. The image forming apparatus according to claim 1, wherein the image forming unit forms the predetermined pattern image having areas each formed with toner of a different one of CMYK colors. 5. The image forming apparatus according to claim 1, further comprising an estimation unit configured to estimate a cause of the streak-shaped image in the printed predetermined pattern image, based on a feature amount of the streak-shaped image detected by the detection unit. 6. The image forming apparatus according to claim 5, further comprising a transmission unit configured to transmit the cause estimated by the estimation unit to an external information processing apparatus. 7. The image forming apparatus according to claim 5, wherein the estimation unit estimates the cause, based on the feature amount indicating at least one of a formed position, a width, and a pixel value of the streak-shaped image. 8. The image forming apparatus according to claim 1, wherein the detection unit clips a predetermined area of the image data obtained by the reading unit reading the sheet on which the predetermined image is formed, calculates a representative value of pixel values for each line in a direction along the predetermined edge, and detects a line in which the representative value is not included in a predetermined range, as the streak-shaped image. 9. The image forming apparatus according to claim 8, wherein the detection unit sets, as the representative value, an average of pixel values of pixels included in one line in a direction along the predetermined edge. 10. The image forming apparatus according to claim 1, wherein the reading unit reads the image formed on the sheet while the reading unit is moving the sheet placed on the placement portion in a direction perpendicular to a reading line along which the reading unit reads the sheet. 11. The image forming apparatus according to claim 1, wherein the sheet has a predetermined edge and an edge perpendicular to the predetermined edge, and wherein the image forming unit forms the predetermined pattern image by conveying the sheet with the edge perpendicular to the predetermined edge as a leading edge. 12. An image processing system comprising: an image forming apparatus; and an information processing apparatus, wherein the image forming apparatus includes an image forming unit configured to form a predetermined pattern image on a sheet, a notifying unit configured to provide a notification of an orientation for placing, on a placement portion, the sheet on which the predetermined pattern image is formed by the image forming unit, a reading unit configured to read the image formed on the sheet placed on the placement portion on a line to line basis, to generate image data, and a transmission unit configured to transmit the image data generated by reading the sheet by the reading unit, to the information processing apparatus, wherein the information processing apparatus includes a detection unit configured to detect a streak-shaped image extending in a direction along a predetermined edge of the sheet, by analyzing the image data received from the image forming apparatus, and wherein the notifying unit provides a notification of a placement orientation for allowing the reading unit to read the sheet on which the predetermined pattern image is formed on a line to line basis, the line extending in a direction along the predetermined edge. 13. A method for controlling an image processing apparatus, the control method comprising: forming a predetermined pattern image on a sheet; providing a notification of an orientation for placing, on a placement portion, the sheet on which the predetermined pattern image is formed in the forming; reading the sheet placed on the placement portion on a line to line basis to generate image data; and detecting a streak-shaped image extending in a direction along a predetermined edge of the sheet, by analyzing the image data generated by reading the sheet in the reading, wherein, in the notifying, a placement orientation for allowing the sheet, on which the predetermined pattern image is formed, to be read on a line to line basis, the line extending in a direction along the predetermined edge, is notified. 14. A storage medium storing a program for executing a method for controlling an image processing apparatus, the control method comprising: forming a predetermined pattern image on a sheet; providing a notification of an orientation for placing, on a placement portion, the sheet on which the predetermined pattern image is formed in the forming; reading the sheet placed on the placement portion on a line to line basis to generate image data; and detecting a streak-shaped image extending in a direction along a predetermined edge of the sheet, by analyzing the image data generated by reading the sheet in the reading, wherein, in the notifying, a placement orientation for allowing the sheet, on which the predetermined pattern image is formed, to be read on a line to line basis, the line extending in a direction along the predetermined edge, is notified.

An image forming apparatus includes an image forming unit configured to form a predetermined pattern image on a sheet, a notifying unit configured to provide a notification of an orientation for placing the sheet on which the predetermined pattern image is formed by the image forming unit, on a placement portion, a reading unit configured to read the sheet on a line to line basis, to generate image data, and a detection unit configured to detect a streak-shaped image extending in a direction along a predetermined edge of the sheet, by analyzing the image data generated by reading the sheet by the reading unit, wherein the notifying unit provides a notification of a placement orientation for allowing the sheet, on which the predetermined pattern image is formed, to be read on a line to line basis, the line extending in a direction along the predetermined edge.1. An image forming apparatus comprising: an image forming unit configured to form a predetermined pattern image on a sheet; a notifying unit configured to provide a notification of an orientation for placing, on a placement portion, the sheet on which the predetermined pattern image is formed by the image forming unit; a reading unit configured to read the sheet placed on the placement portion on a line to line basis, to generate image data; and a detection unit configured to detect a streak-shaped image extending in a direction along a predetermined edge of the sheet, by analyzing the image data generated by reading the sheet by the reading unit, wherein the notifying unit provides a notification of a placement orientation for allowing the reading unit to read the sheet on which the predetermined pattern image is formed, on a line to line basis, the line extending in a direction along the predetermined edge. 2. The image forming apparatus according to claim 1, further comprising a display unit, wherein the notifying unit displays, on the display unit, an orientation for placing the sheet on the placement portion, after the image forming unit forms the predetermined pattern image on the sheet. 3. The image forming apparatus according to claim 1, further comprising a control unit configured to perform control in such a manner that the reading unit can start reading the sheet in response to placement of the sheet in the orientation notified by the notifying unit. 4. The image forming apparatus according to claim 1, wherein the image forming unit forms the predetermined pattern image having areas each formed with toner of a different one of CMYK colors. 5. The image forming apparatus according to claim 1, further comprising an estimation unit configured to estimate a cause of the streak-shaped image in the printed predetermined pattern image, based on a feature amount of the streak-shaped image detected by the detection unit. 6. The image forming apparatus according to claim 5, further comprising a transmission unit configured to transmit the cause estimated by the estimation unit to an external information processing apparatus. 7. The image forming apparatus according to claim 5, wherein the estimation unit estimates the cause, based on the feature amount indicating at least one of a formed position, a width, and a pixel value of the streak-shaped image. 8. The image forming apparatus according to claim 1, wherein the detection unit clips a predetermined area of the image data obtained by the reading unit reading the sheet on which the predetermined image is formed, calculates a representative value of pixel values for each line in a direction along the predetermined edge, and detects a line in which the representative value is not included in a predetermined range, as the streak-shaped image. 9. The image forming apparatus according to claim 8, wherein the detection unit sets, as the representative value, an average of pixel values of pixels included in one line in a direction along the predetermined edge. 10. The image forming apparatus according to claim 1, wherein the reading unit reads the image formed on the sheet while the reading unit is moving the sheet placed on the placement portion in a direction perpendicular to a reading line along which the reading unit reads the sheet. 11. The image forming apparatus according to claim 1, wherein the sheet has a predetermined edge and an edge perpendicular to the predetermined edge, and wherein the image forming unit forms the predetermined pattern image by conveying the sheet with the edge perpendicular to the predetermined edge as a leading edge. 12. An image processing system comprising: an image forming apparatus; and an information processing apparatus, wherein the image forming apparatus includes an image forming unit configured to form a predetermined pattern image on a sheet, a notifying unit configured to provide a notification of an orientation for placing, on a placement portion, the sheet on which the predetermined pattern image is formed by the image forming unit, a reading unit configured to read the image formed on the sheet placed on the placement portion on a line to line basis, to generate image data, and a transmission unit configured to transmit the image data generated by reading the sheet by the reading unit, to the information processing apparatus, wherein the information processing apparatus includes a detection unit configured to detect a streak-shaped image extending in a direction along a predetermined edge of the sheet, by analyzing the image data received from the image forming apparatus, and wherein the notifying unit provides a notification of a placement orientation for allowing the reading unit to read the sheet on which the predetermined pattern image is formed on a line to line basis, the line extending in a direction along the predetermined edge. 13. A method for controlling an image processing apparatus, the control method comprising: forming a predetermined pattern image on a sheet; providing a notification of an orientation for placing, on a placement portion, the sheet on which the predetermined pattern image is formed in the forming; reading the sheet placed on the placement portion on a line to line basis to generate image data; and detecting a streak-shaped image extending in a direction along a predetermined edge of the sheet, by analyzing the image data generated by reading the sheet in the reading, wherein, in the notifying, a placement orientation for allowing the sheet, on which the predetermined pattern image is formed, to be read on a line to line basis, the line extending in a direction along the predetermined edge, is notified. 14. A storage medium storing a program for executing a method for controlling an image processing apparatus, the control method comprising: forming a predetermined pattern image on a sheet; providing a notification of an orientation for placing, on a placement portion, the sheet on which the predetermined pattern image is formed in the forming; reading the sheet placed on the placement portion on a line to line basis to generate image data; and detecting a streak-shaped image extending in a direction along a predetermined edge of the sheet, by analyzing the image data generated by reading the sheet in the reading, wherein, in the notifying, a placement orientation for allowing the sheet, on which the predetermined pattern image is formed, to be read on a line to line basis, the line extending in a direction along the predetermined edge, is notified.

If it is determined that a sheet on which image data of the front cover is to be printed is the particular sheet, a printing apparatus prints on sheets the image data of the body in an order from an end of the body toward a head of the body, discharges the printed sheets without reversing, finally prints image data of the front cover on the particular sheet, and discharges the particular sheet without reversing by the reversing unit, or firstly prints a mirror image of the image data of the front cover on the particular sheet, discharges the particular sheet without reversing, next prints on sheets the image data of the body in an order from the head of the body toward the end of the body, reverses these printed sheets and discharges these printed sheet.

1-12. (canceled) 13. A printing apparatus for generating a bookbinding product having body sheets and a cover sheet, comprising: a receiver that receives first image data for the body sheets and second image data for the cover sheet; an image converter that converts the second image data into third image data that is mirrored image data of the second image data; an image forming unit that forms images on both sides of each of the body sheets based on the first image data and forms an image on one side of the cover sheet based on the second image data or the third image data; a saddle finisher that receives the body sheets and the cover sheet in turn from the image forming unit, performs a bookbinding process on a sheet bundle including the body sheets and the cover sheet to create the bookbinding product, and discharges the bookbinding product; a reversing mechanism, arranged in the image forming unit, that reverses a front and a back of the cover sheet and conveys the reversed cover sheet to the saddle finisher; a console unit that is operable to cause a user to input information regarding a type of the cover sheet; and a controller that determines whether or not the cover sheet is transparent based on the information regarding the type of the cover sheet and determines whether or not the cover sheet is able to be reversed by the reversing mechanism, wherein the controller causes the image forming unit to form the image on the one side of the cover sheet based on the third image data and causes the reversing mechanism to reverse the front and the back of the cover sheet in a case that it is determined that the cover sheet is transparent and that the cover sheet is able to be reversed by the reversing mechanism, and wherein the controller causes the image forming unit to form the image on the one side of the cover sheet based on the second image data and does not cause the reversing mechanism to reverse the front and the back of the cover sheet in a case that it is determined that the cover sheet is transparent and that the cover sheet is not able to be reversed by the reversing mechanism. 14. The printing apparatus according to claim 13, wherein the controller causes the image forming unit to form the image on the one side of the cover sheet based on the second image data and does not cause the reversing mechanism to reverse the front and the back of the cover sheet in a case that it is determined that the cover sheet is not transparent. 15. The printing apparatus according to claim 13, wherein the saddle finisher comprises: a stacking unit that stacks the sheet bundle including the body sheets and the cover sheet; a protrusion member; and a folding roller, wherein the saddle finisher presses a center of the sheet bundle stacked on the stacking unit using the protrusion member into the folding roller to perform the bookbinding process. 16. The printing apparatus according to claim 13, further comprising: a scanner that reads a plurality of originals, wherein the receiver receives image data obtained by reading the plurality of originals by the scanner as the first image data and the second image data. 17. The printing apparatus according to claim 13, wherein the controller causes the reversing mechanism to convey the body sheets to the saddle finisher without reversing the body sheets. 18. The printing apparatus according to claim 13, further comprising: a plurality of sheet storage units that each store a sheet, wherein a first sheet storage unit of the plurality of sheet storage units stores the body sheets and a second sheet storage unit of the plurality of sheet storage units stores the cover sheet. 19. The printing apparatus according to claim 13, wherein the information regarding the type of the cover sheet includes information regarding a thickness of the cover sheet. 20. The printing apparatus according to claim 13, wherein the information regarding the type of the cover sheet includes information regarding a grammage of the cover sheet. 21. The printing apparatus according to claim 13, wherein the information regarding the type of the cover sheet includes information regarding a color of the cover sheet. 22. The printing apparatus according to claim 13, wherein the information regarding the type of the cover sheet includes information regarding a surface property of the cover sheet. 23. The printing apparatus according to claim 13, wherein the information regarding the type of the cover sheet includes information regarding a gloss of the cover sheet. 24. A printing apparatus connected to a saddle finisher that receives body sheets and a cover sheet in turn from a printing apparatus, performs a bookbinding process on a sheet bundle including the body sheets and the cover sheet to create a bookbinding product, and discharges the bookbinding product, the printing apparatus comprising: a receiver that receives first image data for the body sheets and second image data for the cover sheet; an image converter that converts the second image data into third image data that is mirrored image data of the second image data; an image forming unit that forms images on both sides of each of the body sheets based on the first image data and forms an image on one side of the cover sheet based on the second image data or the third image data; a reversing mechanism, arranged in the image forming unit, that reverses a front and a back of the cover sheet and conveys the reversed cover sheet to the saddle finisher; a console unit that is operable to cause a user to input information regarding a type of the cover sheet; and a controller that determines whether or not the cover sheet is transparent based on the information regarding the type of the cover sheet and determines whether or not the cover sheet is able to be reversed by the reversing mechanism, wherein the controller causes the image forming unit to form the image on the one side of the cover sheet based on the third image data and causes the reversing mechanism to reverse the front and the back of the cover sheet in a case that it is determined that the cover sheet is transparent and that the cover sheet is able to be reversed by the reversing mechanism, and wherein the controller causes the image forming unit to form the image on the one side of the cover sheet based on the second image data and does not cause the reversing mechanism to reverse the front and the back of the cover sheet in a case that it is determined that the cover sheet is transparent and that the cover sheet is not able to be reversed by the reversing mechanism.

If it is determined that a sheet on which image data of the front cover is to be printed is the particular sheet, a printing apparatus prints on sheets the image data of the body in an order from an end of the body toward a head of the body, discharges the printed sheets without reversing, finally prints image data of the front cover on the particular sheet, and discharges the particular sheet without reversing by the reversing unit, or firstly prints a mirror image of the image data of the front cover on the particular sheet, discharges the particular sheet without reversing, next prints on sheets the image data of the body in an order from the head of the body toward the end of the body, reverses these printed sheets and discharges these printed sheet.1-12. (canceled) 13. A printing apparatus for generating a bookbinding product having body sheets and a cover sheet, comprising: a receiver that receives first image data for the body sheets and second image data for the cover sheet; an image converter that converts the second image data into third image data that is mirrored image data of the second image data; an image forming unit that forms images on both sides of each of the body sheets based on the first image data and forms an image on one side of the cover sheet based on the second image data or the third image data; a saddle finisher that receives the body sheets and the cover sheet in turn from the image forming unit, performs a bookbinding process on a sheet bundle including the body sheets and the cover sheet to create the bookbinding product, and discharges the bookbinding product; a reversing mechanism, arranged in the image forming unit, that reverses a front and a back of the cover sheet and conveys the reversed cover sheet to the saddle finisher; a console unit that is operable to cause a user to input information regarding a type of the cover sheet; and a controller that determines whether or not the cover sheet is transparent based on the information regarding the type of the cover sheet and determines whether or not the cover sheet is able to be reversed by the reversing mechanism, wherein the controller causes the image forming unit to form the image on the one side of the cover sheet based on the third image data and causes the reversing mechanism to reverse the front and the back of the cover sheet in a case that it is determined that the cover sheet is transparent and that the cover sheet is able to be reversed by the reversing mechanism, and wherein the controller causes the image forming unit to form the image on the one side of the cover sheet based on the second image data and does not cause the reversing mechanism to reverse the front and the back of the cover sheet in a case that it is determined that the cover sheet is transparent and that the cover sheet is not able to be reversed by the reversing mechanism. 14. The printing apparatus according to claim 13, wherein the controller causes the image forming unit to form the image on the one side of the cover sheet based on the second image data and does not cause the reversing mechanism to reverse the front and the back of the cover sheet in a case that it is determined that the cover sheet is not transparent. 15. The printing apparatus according to claim 13, wherein the saddle finisher comprises: a stacking unit that stacks the sheet bundle including the body sheets and the cover sheet; a protrusion member; and a folding roller, wherein the saddle finisher presses a center of the sheet bundle stacked on the stacking unit using the protrusion member into the folding roller to perform the bookbinding process. 16. The printing apparatus according to claim 13, further comprising: a scanner that reads a plurality of originals, wherein the receiver receives image data obtained by reading the plurality of originals by the scanner as the first image data and the second image data. 17. The printing apparatus according to claim 13, wherein the controller causes the reversing mechanism to convey the body sheets to the saddle finisher without reversing the body sheets. 18. The printing apparatus according to claim 13, further comprising: a plurality of sheet storage units that each store a sheet, wherein a first sheet storage unit of the plurality of sheet storage units stores the body sheets and a second sheet storage unit of the plurality of sheet storage units stores the cover sheet. 19. The printing apparatus according to claim 13, wherein the information regarding the type of the cover sheet includes information regarding a thickness of the cover sheet. 20. The printing apparatus according to claim 13, wherein the information regarding the type of the cover sheet includes information regarding a grammage of the cover sheet. 21. The printing apparatus according to claim 13, wherein the information regarding the type of the cover sheet includes information regarding a color of the cover sheet. 22. The printing apparatus according to claim 13, wherein the information regarding the type of the cover sheet includes information regarding a surface property of the cover sheet. 23. The printing apparatus according to claim 13, wherein the information regarding the type of the cover sheet includes information regarding a gloss of the cover sheet. 24. A printing apparatus connected to a saddle finisher that receives body sheets and a cover sheet in turn from a printing apparatus, performs a bookbinding process on a sheet bundle including the body sheets and the cover sheet to create a bookbinding product, and discharges the bookbinding product, the printing apparatus comprising: a receiver that receives first image data for the body sheets and second image data for the cover sheet; an image converter that converts the second image data into third image data that is mirrored image data of the second image data; an image forming unit that forms images on both sides of each of the body sheets based on the first image data and forms an image on one side of the cover sheet based on the second image data or the third image data; a reversing mechanism, arranged in the image forming unit, that reverses a front and a back of the cover sheet and conveys the reversed cover sheet to the saddle finisher; a console unit that is operable to cause a user to input information regarding a type of the cover sheet; and a controller that determines whether or not the cover sheet is transparent based on the information regarding the type of the cover sheet and determines whether or not the cover sheet is able to be reversed by the reversing mechanism, wherein the controller causes the image forming unit to form the image on the one side of the cover sheet based on the third image data and causes the reversing mechanism to reverse the front and the back of the cover sheet in a case that it is determined that the cover sheet is transparent and that the cover sheet is able to be reversed by the reversing mechanism, and wherein the controller causes the image forming unit to form the image on the one side of the cover sheet based on the second image data and does not cause the reversing mechanism to reverse the front and the back of the cover sheet in a case that it is determined that the cover sheet is transparent and that the cover sheet is not able to be reversed by the reversing mechanism.

Examples of a method and a system for configuring an imaging system are described. These examples involve obtaining a random sample of area coverage representations and grouping these by an estimated color, such as a colorimetric value. In each group a selected area coverage representation is determined with respect to one or more imaging attributes. A color gamut based on the random sample and the selected area coverage representations are used to generate a color mapping from an input color space to an area coverage representation space for use by the imaging system.

1. A method for configuring an imaging system comprising: obtaining a random sample of area coverage representations, an area coverage representation defining a distribution of output combinations for the imaging system; grouping the obtained area coverage representations into a number of groups based on estimated colorimetry for the imaging system; determining a selected area coverage representation for each group that modifies one or more estimated imaging attributes; and generating a color mapping from an input color space to an area coverage representation space for use by the imaging system based on a color gamut for the random sample and the selected area coverage representations. 2. The method of claim 1, wherein obtaining a random sample of area coverage representations comprises: selecting a number of output combinations to have non-zero area coverage values; and randomly generating a set of area coverage values for the selected number of output combinations. 3. The method of claim 2, wherein randomly generating a set of area coverage values comprises: generating a set of random values for the selected number of output combinations; applying a non-linear normalization to the set of random values such that the set of set of area coverage values sum to unity. 4. The method of claim 1, wherein obtaining a random sample of area coverage representations comprises: determining whether an output use value for each area coverage representation exceeds a limit for the imaging system, wherein an area coverage representation is used if it is within the limit and regenerated if it exceeds the limit. 5. The method of claim 2, wherein selecting a number of output combinations comprises randomly selecting the number of output combinations from a configurable weighted probability distribution. 6. The method of claim 1, wherein grouping the obtained area coverage representations comprising: subdividing a color space into a plurality of sub-spaces of a predetermined size; determining a color estimate for the imaging system in the color space for each obtained area coverage representation; and determining a sub-space from the plurality of sub-spaces that is associated with each color estimate. 7. The method of claim 6, wherein determining a color estimate comprises: configuring a system model of the imaging system for use in simulating an output of the imaging system; configuring a color model for the imaging system to predict a color of a simulated output of the imaging system derived from the system model. 8. The method of claim 1, wherein grouping the obtained area coverage representations comprises: grouping the obtained area coverage representations into sub-spaces of a predetermined size within an International Commission on Illumination (CIE) LAB based color space. 9. The method of claim 1, wherein color gamut is computed as a convex hull in an optical integration space for the imaging system based on the area coverage representations and their associated colorimetries. 10. The method of claim 1, grouping the obtained area coverage representations comprises: grouping the obtained area coverage representations with an additional set of imported area coverage representations. 11. Apparatus for configuring an imaging system comprising: a color estimator arranged to access a data model representative of the imaging system and to determine, based on the data model, a color estimate of an area coverage vector, the area coverage vector defining a distribution of output combinations for the imaging system; a sampler arranged to obtain a random sample of area coverage vectors; and a color mapping controller arranged to: access a random sample from the sampler; use the color estimator to group area coverage vectors in the random sample into color groups; select an area coverage vector in each color group based on a comparison of one or more imaging metrics for the group; and determine a color mapping from an input color space to an area coverage vector space for use by the imaging system based on a volume of available colors for the random sample and the selected area coverage vectors. 12. The apparatus of claim 11, wherein the color mapping controller is arranged to generate a color mapping in the form of a look-up table with an area coverage vector as an output. 13. The apparatus of claim 11, wherein the imaging system is a printing system and an area coverage vector defines a distribution of overprint combinations. 14. The apparatus of claim 11, comprising: a print controller arranged to use the color mapping to map color data for an input image from the input color space to a Neugebauer Primary area coverage vector for production of a printed output. 15. A non-transitory computer-readable storage medium comprising a set of computer-readable instructions stored thereon, which, when executed by a processing system, cause the processing system to: obtain a random set of area coverage representations, determine a color estimate for an imaging system in the color space for each obtained area coverage representation; determine a sub-space from a plurality of colorimetric sub-spaces that is associated with each color estimate; determine a set of attribute estimates for each obtained area coverage representation; select an area coverage representation in each sub-space that modifies the set of attribute estimates; determine a color gamut based on the set of random area coverage representations; and generate a color mapping from an input color space to an area coverage representation space for use by the imaging system based on the color gamut and the selected area coverage representations.

Examples of a method and a system for configuring an imaging system are described. These examples involve obtaining a random sample of area coverage representations and grouping these by an estimated color, such as a colorimetric value. In each group a selected area coverage representation is determined with respect to one or more imaging attributes. A color gamut based on the random sample and the selected area coverage representations are used to generate a color mapping from an input color space to an area coverage representation space for use by the imaging system.1. A method for configuring an imaging system comprising: obtaining a random sample of area coverage representations, an area coverage representation defining a distribution of output combinations for the imaging system; grouping the obtained area coverage representations into a number of groups based on estimated colorimetry for the imaging system; determining a selected area coverage representation for each group that modifies one or more estimated imaging attributes; and generating a color mapping from an input color space to an area coverage representation space for use by the imaging system based on a color gamut for the random sample and the selected area coverage representations. 2. The method of claim 1, wherein obtaining a random sample of area coverage representations comprises: selecting a number of output combinations to have non-zero area coverage values; and randomly generating a set of area coverage values for the selected number of output combinations. 3. The method of claim 2, wherein randomly generating a set of area coverage values comprises: generating a set of random values for the selected number of output combinations; applying a non-linear normalization to the set of random values such that the set of set of area coverage values sum to unity. 4. The method of claim 1, wherein obtaining a random sample of area coverage representations comprises: determining whether an output use value for each area coverage representation exceeds a limit for the imaging system, wherein an area coverage representation is used if it is within the limit and regenerated if it exceeds the limit. 5. The method of claim 2, wherein selecting a number of output combinations comprises randomly selecting the number of output combinations from a configurable weighted probability distribution. 6. The method of claim 1, wherein grouping the obtained area coverage representations comprising: subdividing a color space into a plurality of sub-spaces of a predetermined size; determining a color estimate for the imaging system in the color space for each obtained area coverage representation; and determining a sub-space from the plurality of sub-spaces that is associated with each color estimate. 7. The method of claim 6, wherein determining a color estimate comprises: configuring a system model of the imaging system for use in simulating an output of the imaging system; configuring a color model for the imaging system to predict a color of a simulated output of the imaging system derived from the system model. 8. The method of claim 1, wherein grouping the obtained area coverage representations comprises: grouping the obtained area coverage representations into sub-spaces of a predetermined size within an International Commission on Illumination (CIE) LAB based color space. 9. The method of claim 1, wherein color gamut is computed as a convex hull in an optical integration space for the imaging system based on the area coverage representations and their associated colorimetries. 10. The method of claim 1, grouping the obtained area coverage representations comprises: grouping the obtained area coverage representations with an additional set of imported area coverage representations. 11. Apparatus for configuring an imaging system comprising: a color estimator arranged to access a data model representative of the imaging system and to determine, based on the data model, a color estimate of an area coverage vector, the area coverage vector defining a distribution of output combinations for the imaging system; a sampler arranged to obtain a random sample of area coverage vectors; and a color mapping controller arranged to: access a random sample from the sampler; use the color estimator to group area coverage vectors in the random sample into color groups; select an area coverage vector in each color group based on a comparison of one or more imaging metrics for the group; and determine a color mapping from an input color space to an area coverage vector space for use by the imaging system based on a volume of available colors for the random sample and the selected area coverage vectors. 12. The apparatus of claim 11, wherein the color mapping controller is arranged to generate a color mapping in the form of a look-up table with an area coverage vector as an output. 13. The apparatus of claim 11, wherein the imaging system is a printing system and an area coverage vector defines a distribution of overprint combinations. 14. The apparatus of claim 11, comprising: a print controller arranged to use the color mapping to map color data for an input image from the input color space to a Neugebauer Primary area coverage vector for production of a printed output. 15. A non-transitory computer-readable storage medium comprising a set of computer-readable instructions stored thereon, which, when executed by a processing system, cause the processing system to: obtain a random set of area coverage representations, determine a color estimate for an imaging system in the color space for each obtained area coverage representation; determine a sub-space from a plurality of colorimetric sub-spaces that is associated with each color estimate; determine a set of attribute estimates for each obtained area coverage representation; select an area coverage representation in each sub-space that modifies the set of attribute estimates; determine a color gamut based on the set of random area coverage representations; and generate a color mapping from an input color space to an area coverage representation space for use by the imaging system based on the color gamut and the selected area coverage representations.

A guidance apparatus comprises: an operation section configured to receive an operation from a user; a first detection section configured to detect a user in front of the operation section; a confirmation processing section configured to confirm the existence of a user operating the operation section according to the detection result of the first detection section; a determination processing section configured to determine whether or not the operation section receives an operation from the user within a certain period of time after the confirmation processing section confirms the existence of the user; and a guidance information output section configured to output guidance information for guiding the user in operating the operation section if the determination processing section determines that the operation section receives no operation from the user.

1. An operation guiding apparatus, comprising: an operation section configured to receive an operation from a user; a first detection section configured to detect a user in front of the operation section; a second detection section configured to detect the user moving around the operation section in a first detection direction which faces the side opposite to the position of the operation section and in a second detection direction which faces the operation section when compared with the first detection direction; and, a control section configured to: determine whether or not the operation section receives an operation from the user if a user is detected by the second detection section in the first and the second detection direction and kept detected by the first detection section for a first predetermined time, and output a guidance information for guiding an operation if it is determined that no operation is received from the user. 2. The operation guiding apparatus according to claim 1, wherein the control section is further configured to: output basic information in the operation section if the user is kept detected by the first detection section for the first predetermined time after detected by the second detection section, and output the guidance information corresponding to the basic information if it is determined that no operation is carried out based on the basic information from the user within a second predetermined time. 3. The operation guiding apparatus according to claim 2, wherein the control section is further configured to: output no guidance information for guiding the operation if it is determined that an operation is received from the user within the second predetermined time after the basic information is output in the operation section. 4. The operation guiding apparatus according to claim 2, wherein the basic information includes an information to set a function to execute based on the operation from the user. 5. The operation guiding apparatus according to claim 1, wherein the control section is further configured to: switch the detection direction of the second detection section to detect the user by the second detection direction after the user is detected in the first detection direction. 6. An operation guiding apparatus, comprising: an operation section configured to receive an operation from a user; a third detection section configured to detect a user in front of the operation section; and, a control section configured to: detect an abnormality, notify the operation section of a unit which is operated to handle the detected abnormality, determine whether or not the unit receives an operation within a third predetermined time after the user in front of the unit which is operated is detected by the third detection section, and output the guidance information for guiding the operation if it is determined that the unit receives no operation from the user within the third predetermined time. 7. An operation guiding apparatus, comprising: an operation section configured to receive an operation from a user; a first detection section configured to detect a user in front of the operation section; a second detection section configured to detect a user moving around the operation section in a first detection direction which faces the side opposite to the position of the operation section and in a second detection direction which faces the operation section when compared with the first detection direction; and, a control section configured to: detect a user by the second detection section in the first and the second detection direction, determine whether or not the user is kept detected by the first detection section for a first predetermined time, determine whether or not the operation section receives an operation from the user if it is determined that the user is kept detected by the first detection section for the first predetermined time, output the guidance information for guiding the operation if it is determined that no operation is received from the user. 8. The operation guiding apparatus according to claim 7, wherein the control section is further configured to: output the basic information in the operation section if it is determined that the user is kept detected by the first detection section for the first predetermined time, the control section determines whether or not the operation is carried out based on the basic information output to the operation section from the user within a second predetermined time, and output guidance information corresponding to the basic information if it is determined that no operation is carried out based on the basic information from the user within the second predetermined time. 9. The operation guiding apparatus according to claim 8, wherein the control section is further configured to: determine whether or not the operation is carried out based on the basic information output to the operation section from the user within the second predetermined time, and output no guidance information for guiding the operation if it is determined that the operation is carried out based on the basic information from the user within the second predetermined time. 10. The operation guiding apparatus according to claim 8, wherein the basic information includes an information to set a function to execute based on the operation from the user. 11. The operation guiding apparatus according to claim 7, wherein the control section is further configured to: switch the detection direction of the second detection section to detect the user by the second detection direction after the user is detected in the first detection direction.

A guidance apparatus comprises: an operation section configured to receive an operation from a user; a first detection section configured to detect a user in front of the operation section; a confirmation processing section configured to confirm the existence of a user operating the operation section according to the detection result of the first detection section; a determination processing section configured to determine whether or not the operation section receives an operation from the user within a certain period of time after the confirmation processing section confirms the existence of the user; and a guidance information output section configured to output guidance information for guiding the user in operating the operation section if the determination processing section determines that the operation section receives no operation from the user.1. An operation guiding apparatus, comprising: an operation section configured to receive an operation from a user; a first detection section configured to detect a user in front of the operation section; a second detection section configured to detect the user moving around the operation section in a first detection direction which faces the side opposite to the position of the operation section and in a second detection direction which faces the operation section when compared with the first detection direction; and, a control section configured to: determine whether or not the operation section receives an operation from the user if a user is detected by the second detection section in the first and the second detection direction and kept detected by the first detection section for a first predetermined time, and output a guidance information for guiding an operation if it is determined that no operation is received from the user. 2. The operation guiding apparatus according to claim 1, wherein the control section is further configured to: output basic information in the operation section if the user is kept detected by the first detection section for the first predetermined time after detected by the second detection section, and output the guidance information corresponding to the basic information if it is determined that no operation is carried out based on the basic information from the user within a second predetermined time. 3. The operation guiding apparatus according to claim 2, wherein the control section is further configured to: output no guidance information for guiding the operation if it is determined that an operation is received from the user within the second predetermined time after the basic information is output in the operation section. 4. The operation guiding apparatus according to claim 2, wherein the basic information includes an information to set a function to execute based on the operation from the user. 5. The operation guiding apparatus according to claim 1, wherein the control section is further configured to: switch the detection direction of the second detection section to detect the user by the second detection direction after the user is detected in the first detection direction. 6. An operation guiding apparatus, comprising: an operation section configured to receive an operation from a user; a third detection section configured to detect a user in front of the operation section; and, a control section configured to: detect an abnormality, notify the operation section of a unit which is operated to handle the detected abnormality, determine whether or not the unit receives an operation within a third predetermined time after the user in front of the unit which is operated is detected by the third detection section, and output the guidance information for guiding the operation if it is determined that the unit receives no operation from the user within the third predetermined time. 7. An operation guiding apparatus, comprising: an operation section configured to receive an operation from a user; a first detection section configured to detect a user in front of the operation section; a second detection section configured to detect a user moving around the operation section in a first detection direction which faces the side opposite to the position of the operation section and in a second detection direction which faces the operation section when compared with the first detection direction; and, a control section configured to: detect a user by the second detection section in the first and the second detection direction, determine whether or not the user is kept detected by the first detection section for a first predetermined time, determine whether or not the operation section receives an operation from the user if it is determined that the user is kept detected by the first detection section for the first predetermined time, output the guidance information for guiding the operation if it is determined that no operation is received from the user. 8. The operation guiding apparatus according to claim 7, wherein the control section is further configured to: output the basic information in the operation section if it is determined that the user is kept detected by the first detection section for the first predetermined time, the control section determines whether or not the operation is carried out based on the basic information output to the operation section from the user within a second predetermined time, and output guidance information corresponding to the basic information if it is determined that no operation is carried out based on the basic information from the user within the second predetermined time. 9. The operation guiding apparatus according to claim 8, wherein the control section is further configured to: determine whether or not the operation is carried out based on the basic information output to the operation section from the user within the second predetermined time, and output no guidance information for guiding the operation if it is determined that the operation is carried out based on the basic information from the user within the second predetermined time. 10. The operation guiding apparatus according to claim 8, wherein the basic information includes an information to set a function to execute based on the operation from the user. 11. The operation guiding apparatus according to claim 7, wherein the control section is further configured to: switch the detection direction of the second detection section to detect the user by the second detection direction after the user is detected in the first detection direction.

In one example, a document scanner has a fixed-position scan bar and a built-in translatable calibration target. The scan bar has a linear array of imaging elements aimed in an imaging direction. The calibration target is spaced apart from and parallel to the linear array, and has a planar surface orthogonal to the imaging direction spanning the length of the linear array. The target is translatable during a calibration in a direction in a plane of the surface.

1. A document scanner, comprising: a fixed-position scan bar having a linear array of imaging elements aimed in an imaging direction; and a built-in translatable calibration target spaced apart from and parallel to the linear array, the target having a planar surface orthogonal to the imaging direction and spanning the length of the linear array, and the target translatable during a calibration in a direction in a plane of the surface. 2. The scanner of claim 1, comprising: a compliant bias plate having the calibration target; and a resilient member to urge the compliant bias plate toward the linear array. 3. The scanner of claim 2, comprising: a carrier removably attached to the compliant bias plate; a base translateably attached to the carrier and fixedly attached to a chassis of the scanner; and wherein the resilient member is retained between the bias plate and the carrier, the bias plate movable toward the carrier in the imaging direction to compress the resilient member. 4. The scanner of claim 3, comprising: a drive system coupled to the carrier to controllably translate the carrier relative to the base. 5. The scanner of claim 2, wherein the resilient member is to urge the bias plate against a housing of the linear array, and wherein the bias plate conforms to a contacting surface of the housing. 6. The scanner of claim 5 wherein a rib of the compliant bias plate is urged against the housing, the rib maintaining a predefined spacing between the calibration target and the housing. 7. The scanner of claim 1, wherein the planar surface of the calibration target has a uniform color and is a background for scanning transparent and translucent documents. 8. The scanner of claim 1, wherein the direction of target translation in the plane of the planar surface is non-orthogonal to the linear array of imaging elements. 9. A method of calibrating a document scanner without a calibration document, comprising: controllably moving a flat translatable calibration target built into the scanner a predetermined distance relative to a fixed-position scan bar of the scanner; during the moving, repeatedly imaging the calibration target with the fixed-position scan bar such that each imaging element of the fixed-position scan bar captures signals for a zone of a flat uniform color surface of the calibration target; and processing the captured signals from each imaging element to calibrate the scanner. 10. The method of claim 9, wherein the processing includes calibrating at least one of white point and uniformity of the fixed-position scan bar. 11. The method of claim 9, wherein the moving moves the calibration target in a direction different from a document feed direction. 12. The method of claim 9, further comprising, after the processing: returning the calibration target to an initial position; feeding a document through the scanner between the fixed-position scan bar and the calibration target; during the feeding, sequentially imaging strips of the document with the fixed-position scan bar with the calibration target in the initial position; and processing the imaged strips to construct a digital representation of the document. 13. The method of claim 9, further comprising: during the moving, urging the calibration target against a surface of the fixed-position scan bar. 14. A document scanner, comprising: a scan bar array of overlapping staggered fixed-position scan bars each having a linear array of imaging elements; an array of overlapping staggered translatable calibration targets spaced apart from and parallel to the scan bar array, each target having a planar surface that spans a length of a corresponding imaging element array and is imageable by the imaging elements of the corresponding linear array; and a single drive system coupled to all the calibration targets to controllably translate the calibration targets relative to the scan bars during a calibration operation. 15. The scanner of claim 14, wherein the single drive system comprises: a rotatable cam shaft; a plurality of cams each fixed to the cam shaft at an angular position; and a plurality of cam engagement features each coupled to a corresponding one of the calibration targets and engaged with a corresponding one of the cams.

In one example, a document scanner has a fixed-position scan bar and a built-in translatable calibration target. The scan bar has a linear array of imaging elements aimed in an imaging direction. The calibration target is spaced apart from and parallel to the linear array, and has a planar surface orthogonal to the imaging direction spanning the length of the linear array. The target is translatable during a calibration in a direction in a plane of the surface.1. A document scanner, comprising: a fixed-position scan bar having a linear array of imaging elements aimed in an imaging direction; and a built-in translatable calibration target spaced apart from and parallel to the linear array, the target having a planar surface orthogonal to the imaging direction and spanning the length of the linear array, and the target translatable during a calibration in a direction in a plane of the surface. 2. The scanner of claim 1, comprising: a compliant bias plate having the calibration target; and a resilient member to urge the compliant bias plate toward the linear array. 3. The scanner of claim 2, comprising: a carrier removably attached to the compliant bias plate; a base translateably attached to the carrier and fixedly attached to a chassis of the scanner; and wherein the resilient member is retained between the bias plate and the carrier, the bias plate movable toward the carrier in the imaging direction to compress the resilient member. 4. The scanner of claim 3, comprising: a drive system coupled to the carrier to controllably translate the carrier relative to the base. 5. The scanner of claim 2, wherein the resilient member is to urge the bias plate against a housing of the linear array, and wherein the bias plate conforms to a contacting surface of the housing. 6. The scanner of claim 5 wherein a rib of the compliant bias plate is urged against the housing, the rib maintaining a predefined spacing between the calibration target and the housing. 7. The scanner of claim 1, wherein the planar surface of the calibration target has a uniform color and is a background for scanning transparent and translucent documents. 8. The scanner of claim 1, wherein the direction of target translation in the plane of the planar surface is non-orthogonal to the linear array of imaging elements. 9. A method of calibrating a document scanner without a calibration document, comprising: controllably moving a flat translatable calibration target built into the scanner a predetermined distance relative to a fixed-position scan bar of the scanner; during the moving, repeatedly imaging the calibration target with the fixed-position scan bar such that each imaging element of the fixed-position scan bar captures signals for a zone of a flat uniform color surface of the calibration target; and processing the captured signals from each imaging element to calibrate the scanner. 10. The method of claim 9, wherein the processing includes calibrating at least one of white point and uniformity of the fixed-position scan bar. 11. The method of claim 9, wherein the moving moves the calibration target in a direction different from a document feed direction. 12. The method of claim 9, further comprising, after the processing: returning the calibration target to an initial position; feeding a document through the scanner between the fixed-position scan bar and the calibration target; during the feeding, sequentially imaging strips of the document with the fixed-position scan bar with the calibration target in the initial position; and processing the imaged strips to construct a digital representation of the document. 13. The method of claim 9, further comprising: during the moving, urging the calibration target against a surface of the fixed-position scan bar. 14. A document scanner, comprising: a scan bar array of overlapping staggered fixed-position scan bars each having a linear array of imaging elements; an array of overlapping staggered translatable calibration targets spaced apart from and parallel to the scan bar array, each target having a planar surface that spans a length of a corresponding imaging element array and is imageable by the imaging elements of the corresponding linear array; and a single drive system coupled to all the calibration targets to controllably translate the calibration targets relative to the scan bars during a calibration operation. 15. The scanner of claim 14, wherein the single drive system comprises: a rotatable cam shaft; a plurality of cams each fixed to the cam shaft at an angular position; and a plurality of cam engagement features each coupled to a corresponding one of the calibration targets and engaged with a corresponding one of the cams.

Systems and methods for replacing cells of an image based on some pre-determined metric are described herein. For example, systems and methods described herein may improve the functioning of a standard imaging system. For example, the systems and methods described herein may be used to post-process existing images in an imaging system based on one or more pre-determined metrics and improve the halftone images according to those pre-determined metrics.

1. A method for post-processing halftone images, the method comprising: parsing a halftone image into a set of image cells; determining an estimated colorimetric value for each of the image cells; and selectively replacing at least one of the image cells with a replacement cell, wherein the replacement cell has an area coverage representation with a replacement colorimetric value, wherein the replacing is based on comparing the replacement colorimetric value to the estimated colorimetric value of the at least one of the image cells, and wherein the replacing is further based on comparing a value of a pre-determined metric for the replacement cell to a value of the pre-determined metric for the at least one of the image cells. 2. The method of claim 1, further comprising generating a lookup table that associates a plurality of replacement cells with a plurality of colorimetric values. 3. The method of claim 1, wherein generating the lookup table comprises: generating a plurality of halftone patches; parsing each of the plurality of halftone patches into a plurality of patch cells; determining an estimated colorimetric value for each of the plurality of patch cells of each of the plurality of halftone patches; placing the plurality of patch cells into a plurality of bins based on the estimated colorimetric value for each of the plurality of patch cells; and assigning a value of the pre-determined metric to each of the plurality of bins based on a value of the pre-determined metric for an associated halftone patch of the plurality of halftone patches, wherein the replacement cell is one of the plurality of patch cells. 4. The method of claim 3, further comprising selecting the replacement cell from the plurality of patch cells at least in part stochastically. 5. The method of claim 1, wherein a first image cell of the set of image cells is a first size and a second image cell of the set of image cells is a second size that is different than the first size. 6. The method of claim 5, wherein the first size is selected based on content of the first image cell. 7. The method of claim 1, wherein the pre-determined metric is at least one of the following: ink-use, robustness, and grain. 8. Apparatus for post-processing halftone images, comprising: an image processing component arranged to apply a sliding window to a halftone image and predict colorimetry for at least one resulting window area; a color mapping component arranged to determine an area coverage representation for a window area based on predicted colorimetry from the image processing component; a replacement component arranged to compare an imaging metric for a window area with a corresponding imaging metric for an area coverage representation associated with the window area from the color mapping component, wherein the replacement component is further arranged to replace image data for the window area with the area coverage representation based on the comparison. 9. The apparatus of claim 8, wherein the color mapping component is arranged to use one or more look up tables to implement a color mapping from a predicted colorimetric value for a window area to an area coverage representation. 10. The apparatus of claim 9, wherein the one or more look up tables are pre-computed to optimize the imaging metric. 11. The apparatus of claim 9, wherein each look up table is arranged to output an area coverage representation for a pre-defined size of a window area. 12. The apparatus of claim 8, wherein the image processing component is arranged to predict colorimetry for at least one window area by predicting a colorimetric value for an area coverage representation of the window area. 13. The apparatus of claim 8, wherein the color mapping component is arranged to: halftone a set of nodes of a colorimetric-to-area-coverage look-up table to generate a set of halftone patches of a predetermined first size; divide the set of halftone patches into a set of cells of a predetermined second size; determine colorimetry for each cell in the set of cells; and group the set of cells by the determined colorimetry; and wherein the replacement component is arranged to: assign a value of the imaging metric to each group of cells; and compare a value of the imaging metric for a window area of the halftone image with a value of the imaging metric for a group of cells that has a colorimetry that matches the colorimetry of the window area. 14. The apparatus of claim 13, wherein the replacement component is arranged to randomly select a cell within the group of cells to replace the image data of the window area. 15. A non-transitory computer-readable storage medium comprising a set of computer-readable instructions stored thereon, which, when executed by a processing system, cause the processing system to: obtain a first halftone image having a first set of imaging characteristics; parse the first halftone image into a set of image cells; determine an estimated colorimetric value for each of the image cells; and generate a second halftone image having a second set of imaging characteristics by selectively replacing at least one of the image cells with a replacement cell, wherein the replacement cell has an area coverage representation with a replacement colorimetric value, wherein the selectively replacement is based on a comparison of the replacement colorimetric value and the estimated colorimetric value of the at least one of the image cells, and wherein the selectively replacement is further based on a comparison of a value of a pre-determined metric for the replacement cell and a value of the pre-determined metric for the at least one of the image cells.

Systems and methods for replacing cells of an image based on some pre-determined metric are described herein. For example, systems and methods described herein may improve the functioning of a standard imaging system. For example, the systems and methods described herein may be used to post-process existing images in an imaging system based on one or more pre-determined metrics and improve the halftone images according to those pre-determined metrics.1. A method for post-processing halftone images, the method comprising: parsing a halftone image into a set of image cells; determining an estimated colorimetric value for each of the image cells; and selectively replacing at least one of the image cells with a replacement cell, wherein the replacement cell has an area coverage representation with a replacement colorimetric value, wherein the replacing is based on comparing the replacement colorimetric value to the estimated colorimetric value of the at least one of the image cells, and wherein the replacing is further based on comparing a value of a pre-determined metric for the replacement cell to a value of the pre-determined metric for the at least one of the image cells. 2. The method of claim 1, further comprising generating a lookup table that associates a plurality of replacement cells with a plurality of colorimetric values. 3. The method of claim 1, wherein generating the lookup table comprises: generating a plurality of halftone patches; parsing each of the plurality of halftone patches into a plurality of patch cells; determining an estimated colorimetric value for each of the plurality of patch cells of each of the plurality of halftone patches; placing the plurality of patch cells into a plurality of bins based on the estimated colorimetric value for each of the plurality of patch cells; and assigning a value of the pre-determined metric to each of the plurality of bins based on a value of the pre-determined metric for an associated halftone patch of the plurality of halftone patches, wherein the replacement cell is one of the plurality of patch cells. 4. The method of claim 3, further comprising selecting the replacement cell from the plurality of patch cells at least in part stochastically. 5. The method of claim 1, wherein a first image cell of the set of image cells is a first size and a second image cell of the set of image cells is a second size that is different than the first size. 6. The method of claim 5, wherein the first size is selected based on content of the first image cell. 7. The method of claim 1, wherein the pre-determined metric is at least one of the following: ink-use, robustness, and grain. 8. Apparatus for post-processing halftone images, comprising: an image processing component arranged to apply a sliding window to a halftone image and predict colorimetry for at least one resulting window area; a color mapping component arranged to determine an area coverage representation for a window area based on predicted colorimetry from the image processing component; a replacement component arranged to compare an imaging metric for a window area with a corresponding imaging metric for an area coverage representation associated with the window area from the color mapping component, wherein the replacement component is further arranged to replace image data for the window area with the area coverage representation based on the comparison. 9. The apparatus of claim 8, wherein the color mapping component is arranged to use one or more look up tables to implement a color mapping from a predicted colorimetric value for a window area to an area coverage representation. 10. The apparatus of claim 9, wherein the one or more look up tables are pre-computed to optimize the imaging metric. 11. The apparatus of claim 9, wherein each look up table is arranged to output an area coverage representation for a pre-defined size of a window area. 12. The apparatus of claim 8, wherein the image processing component is arranged to predict colorimetry for at least one window area by predicting a colorimetric value for an area coverage representation of the window area. 13. The apparatus of claim 8, wherein the color mapping component is arranged to: halftone a set of nodes of a colorimetric-to-area-coverage look-up table to generate a set of halftone patches of a predetermined first size; divide the set of halftone patches into a set of cells of a predetermined second size; determine colorimetry for each cell in the set of cells; and group the set of cells by the determined colorimetry; and wherein the replacement component is arranged to: assign a value of the imaging metric to each group of cells; and compare a value of the imaging metric for a window area of the halftone image with a value of the imaging metric for a group of cells that has a colorimetry that matches the colorimetry of the window area. 14. The apparatus of claim 13, wherein the replacement component is arranged to randomly select a cell within the group of cells to replace the image data of the window area. 15. A non-transitory computer-readable storage medium comprising a set of computer-readable instructions stored thereon, which, when executed by a processing system, cause the processing system to: obtain a first halftone image having a first set of imaging characteristics; parse the first halftone image into a set of image cells; determine an estimated colorimetric value for each of the image cells; and generate a second halftone image having a second set of imaging characteristics by selectively replacing at least one of the image cells with a replacement cell, wherein the replacement cell has an area coverage representation with a replacement colorimetric value, wherein the selectively replacement is based on a comparison of the replacement colorimetric value and the estimated colorimetric value of the at least one of the image cells, and wherein the selectively replacement is further based on a comparison of a value of a pre-determined metric for the replacement cell and a value of the pre-determined metric for the at least one of the image cells.

An image forming apparatus includes an image processor and an image forming unit. The image processor performs a correction process that corrects first image data corresponding to a first color and second image data corresponding to a second color. The image processor performs the correction process by causing, on the basis of a medium color of a recording medium, a first edge of a first image that is in the first image data and a second edge of a second image that is in the second image data to be away from each other. The second edge corresponds to the first edge. The image forming unit forms the first image and the second image in this order on the recording medium, on a basis of the first image data and the second image data that are corrected by the image processor.

1. An image forming apparatus comprising: an image processor that performs a correction process that corrects first image data corresponding to a first color and second image data corresponding to a second color, the image processor performing the correction process by causing, on a basis of a medium color of a recording medium, a first edge of a first image that is in the first image data and a second edge of a second image that is in the second image data to be away from each other, the second edge corresponding to the first edge; and an image forming unit that forms the first image and the second image in this order on the recording medium, on a basis of the first image data and the second image data that are corrected by the image processor. 2. The image forming apparatus according to claim 1, wherein the image processor makes a comparison between a first lightness level of the medium color and a second lightness level of a region in vicinity of the second edge of the second image, and performs the correction process on a basis of a result of the comparison. 3. The image forming apparatus according to claim 2, wherein the image processor performs the correction process by moving the first edge and thereby reducing area of the first image, when the first lightness level is higher than the second lightness level. 4. The image forming apparatus according to claim 2, wherein the image processor performs the correction process by moving the second edge and thereby increasing area of the second image, when the second lightness level is higher than the first lightness level. 5. The image forming apparatus according to claim 2, wherein the image processor further determines an image width on a basis of the second image data, and performs the correction process on a basis of a result of a comparison between the image width and a predetermined width, the image width being a width between the second edge and an edge, of the second image, that faces the second edge. 6. The image forming apparatus according to claim 5, wherein the image processor performs the correction process by moving the second edge and thereby increasing area of the second image, when the image width is smaller than the predetermined width. 7. The image forming apparatus according to claim 5, wherein the image processor performs the correction process by moving the first edge and thereby reducing area of the first image, when the image width is greater than the predetermined width and the first lightness level is higher than the second lightness level. 8. The image forming apparatus according to claim 5, wherein the image processor performs the correction process by moving the second edge and thereby increasing area of the second image, when the image width is greater than the predetermined width and the second lightness level is higher than the first lightness level. 9. The image forming apparatus according to claim 5, wherein the image processor further determines an image space on a basis of the first image data, and performs the correction process on a basis of a result of a comparison between the image space and a predetermined space, the image space being a distance between the first edge and an edge, of the first image, that faces the first edge. 10. The image forming apparatus according to claim 9, wherein the image processor performs the correction process by moving the first edge and thereby reducing area of the first image while moving the second edge and thereby increasing area of the second image, when the image width is smaller than the predetermined width and the image space is smaller than the predetermined space. 11. The image forming apparatus according to claim 10, wherein the image processor performs the correction process by moving the second edge and thereby increasing the area of the second image, when the image width is smaller than the predetermined width and the image space is greater than the predetermined space, and a first amount is smaller than a second amount, the first amount being an amount by which the second edge is moved when the image width is smaller than the predetermined width and the image space is greater than the predetermined space, the second amount being an amount by which the second edge is moved when the image width is smaller than the predetermined width and the image space is smaller than the predetermined space. 12. The image forming apparatus according to claim 1, further comprising a sensor that detects the medium color. 13. The image forming apparatus according to claim 1, further comprising a setting unit with which a user sets the medium color. 14. The image forming apparatus according to claim 1, wherein the first color is white. 15. The image forming apparatus according to claim 1, wherein the second color is one of yellow, magenta, cyan, and black.

An image forming apparatus includes an image processor and an image forming unit. The image processor performs a correction process that corrects first image data corresponding to a first color and second image data corresponding to a second color. The image processor performs the correction process by causing, on the basis of a medium color of a recording medium, a first edge of a first image that is in the first image data and a second edge of a second image that is in the second image data to be away from each other. The second edge corresponds to the first edge. The image forming unit forms the first image and the second image in this order on the recording medium, on a basis of the first image data and the second image data that are corrected by the image processor.1. An image forming apparatus comprising: an image processor that performs a correction process that corrects first image data corresponding to a first color and second image data corresponding to a second color, the image processor performing the correction process by causing, on a basis of a medium color of a recording medium, a first edge of a first image that is in the first image data and a second edge of a second image that is in the second image data to be away from each other, the second edge corresponding to the first edge; and an image forming unit that forms the first image and the second image in this order on the recording medium, on a basis of the first image data and the second image data that are corrected by the image processor. 2. The image forming apparatus according to claim 1, wherein the image processor makes a comparison between a first lightness level of the medium color and a second lightness level of a region in vicinity of the second edge of the second image, and performs the correction process on a basis of a result of the comparison. 3. The image forming apparatus according to claim 2, wherein the image processor performs the correction process by moving the first edge and thereby reducing area of the first image, when the first lightness level is higher than the second lightness level. 4. The image forming apparatus according to claim 2, wherein the image processor performs the correction process by moving the second edge and thereby increasing area of the second image, when the second lightness level is higher than the first lightness level. 5. The image forming apparatus according to claim 2, wherein the image processor further determines an image width on a basis of the second image data, and performs the correction process on a basis of a result of a comparison between the image width and a predetermined width, the image width being a width between the second edge and an edge, of the second image, that faces the second edge. 6. The image forming apparatus according to claim 5, wherein the image processor performs the correction process by moving the second edge and thereby increasing area of the second image, when the image width is smaller than the predetermined width. 7. The image forming apparatus according to claim 5, wherein the image processor performs the correction process by moving the first edge and thereby reducing area of the first image, when the image width is greater than the predetermined width and the first lightness level is higher than the second lightness level. 8. The image forming apparatus according to claim 5, wherein the image processor performs the correction process by moving the second edge and thereby increasing area of the second image, when the image width is greater than the predetermined width and the second lightness level is higher than the first lightness level. 9. The image forming apparatus according to claim 5, wherein the image processor further determines an image space on a basis of the first image data, and performs the correction process on a basis of a result of a comparison between the image space and a predetermined space, the image space being a distance between the first edge and an edge, of the first image, that faces the first edge. 10. The image forming apparatus according to claim 9, wherein the image processor performs the correction process by moving the first edge and thereby reducing area of the first image while moving the second edge and thereby increasing area of the second image, when the image width is smaller than the predetermined width and the image space is smaller than the predetermined space. 11. The image forming apparatus according to claim 10, wherein the image processor performs the correction process by moving the second edge and thereby increasing the area of the second image, when the image width is smaller than the predetermined width and the image space is greater than the predetermined space, and a first amount is smaller than a second amount, the first amount being an amount by which the second edge is moved when the image width is smaller than the predetermined width and the image space is greater than the predetermined space, the second amount being an amount by which the second edge is moved when the image width is smaller than the predetermined width and the image space is smaller than the predetermined space. 12. The image forming apparatus according to claim 1, further comprising a sensor that detects the medium color. 13. The image forming apparatus according to claim 1, further comprising a setting unit with which a user sets the medium color. 14. The image forming apparatus according to claim 1, wherein the first color is white. 15. The image forming apparatus according to claim 1, wherein the second color is one of yellow, magenta, cyan, and black.

An image scanning apparatus captures multiple images of an object corresponding to different heights at each scanning position, analyzes the resolutions of the multiple images to choose one best partial image, and combines the partial images at different scanning positions to produce a scanned image of the object, so as to improve the resolution of the scanned image.

1. An image scanning apparatus comprising: a scanning light source to provide a light to irradiate an object; an image capturing unit disposed opposite to the object; a first driving unit to drive the image capturing unit and the object to move with respect to each other among multiple scanning positions, so as to scan the object; a second driving unit connected to the image capturing unit to drive the image capturing unit to move along a height direction, wherein the height direction is perpendicular to a surface of the object; and an image processing unit electrically connected to the image capturing unit, the first driving unit and the second driving unit, wherein the image capturing unit captures multiple images of the object corresponding to different heights when moving along the height direction at each the scanning position and delivers the multiple images to the image processing unit, and the image processing unit outputs one of the multiple images as one partial image at the scanning position and combines the partial image at each different scanning position to produce a scanned image of the object. 2. The image scanning apparatus according to claim 1, wherein the image processing unit further comprises a comparing unit to calculate multiple Modulation transfer function values of the multiple images and output the partial image, wherein the Modulation transfer function value of the partial image is the maximum Modulation transfer function value. 3. The image scanning apparatus according to claim 1, wherein the image processing unit further comprises a control unit to produce a control signal to the first driving unit according to the partial image, and the first driving unit drives the image capturing unit and the object to move with respect to each other to adjacent the scanning position according to the control signal. 4. The image scanning apparatus according to claim 1, wherein the image processing unit further comprises a memory unit to store the partial image. 5. The image scanning apparatus according to claim 1, wherein the second driving unit comprises a stepper motor. 6. The image scanning apparatus according to claim 1, wherein an image capturing number of the image capturing unit for capturing multiple images at the same one scanning position is more than or equal to a quotient of a maximum height value of the object divided by a value of the depth of field of the image capturing unit. 7. The image scanning apparatus according to claim 1, wherein the first driving unit comprises a stepper motor connected to the image capturing unit. 8. The image scanning apparatus according to claim 1, wherein the image capturing unit comprises a charge coupled device or a contact image sensor. 9. The image scanning apparatus according to claim 1, wherein the image capturing unit comprises a Line-Scan light-sensing device. 10. The image scanning apparatus according to claim 1, wherein the scanning light source and the image capturing unit are disposed a t opposite sides of the object. 11. The image scanning apparatus according to claim 1, wherein the scanning light source and the image capturing unit are disposed a t the same side of the object. 12. The image scanning apparatus according to claim 1, further comprising a platform having a transparent material.

An image scanning apparatus captures multiple images of an object corresponding to different heights at each scanning position, analyzes the resolutions of the multiple images to choose one best partial image, and combines the partial images at different scanning positions to produce a scanned image of the object, so as to improve the resolution of the scanned image.1. An image scanning apparatus comprising: a scanning light source to provide a light to irradiate an object; an image capturing unit disposed opposite to the object; a first driving unit to drive the image capturing unit and the object to move with respect to each other among multiple scanning positions, so as to scan the object; a second driving unit connected to the image capturing unit to drive the image capturing unit to move along a height direction, wherein the height direction is perpendicular to a surface of the object; and an image processing unit electrically connected to the image capturing unit, the first driving unit and the second driving unit, wherein the image capturing unit captures multiple images of the object corresponding to different heights when moving along the height direction at each the scanning position and delivers the multiple images to the image processing unit, and the image processing unit outputs one of the multiple images as one partial image at the scanning position and combines the partial image at each different scanning position to produce a scanned image of the object. 2. The image scanning apparatus according to claim 1, wherein the image processing unit further comprises a comparing unit to calculate multiple Modulation transfer function values of the multiple images and output the partial image, wherein the Modulation transfer function value of the partial image is the maximum Modulation transfer function value. 3. The image scanning apparatus according to claim 1, wherein the image processing unit further comprises a control unit to produce a control signal to the first driving unit according to the partial image, and the first driving unit drives the image capturing unit and the object to move with respect to each other to adjacent the scanning position according to the control signal. 4. The image scanning apparatus according to claim 1, wherein the image processing unit further comprises a memory unit to store the partial image. 5. The image scanning apparatus according to claim 1, wherein the second driving unit comprises a stepper motor. 6. The image scanning apparatus according to claim 1, wherein an image capturing number of the image capturing unit for capturing multiple images at the same one scanning position is more than or equal to a quotient of a maximum height value of the object divided by a value of the depth of field of the image capturing unit. 7. The image scanning apparatus according to claim 1, wherein the first driving unit comprises a stepper motor connected to the image capturing unit. 8. The image scanning apparatus according to claim 1, wherein the image capturing unit comprises a charge coupled device or a contact image sensor. 9. The image scanning apparatus according to claim 1, wherein the image capturing unit comprises a Line-Scan light-sensing device. 10. The image scanning apparatus according to claim 1, wherein the scanning light source and the image capturing unit are disposed a t opposite sides of the object. 11. The image scanning apparatus according to claim 1, wherein the scanning light source and the image capturing unit are disposed a t the same side of the object. 12. The image scanning apparatus according to claim 1, further comprising a platform having a transparent material.

An image scanning apparatus includes an image capturing unit, a pulse driving unit and a control unit. The image capturing unit captures an image of an object. The pulse driving unit drives the image capturing unit and the object along a scanning direction to move with respect to each other among multiple pulse nodes, so as to scan the object. The control unit is electrically connected to the pulse driving unit and the image capturing unit, and the control unit controls the image capturing unit to capture multiple images of the object between adjacent pulse nodes, so as to synthesize a scanned image corresponding to the object.

1. An image scanning apparatus comprising: an image capturing unit; a pulse driving unit; and a control unit electrically connected to the pulse driving unit and the image capturing unit; wherein the image capturing unit captures an image of an object, the pulse driving unit drives the image capturing unit and the object along a scanning direction to move with respect to each other among multiple pulse nodes so as to scan the object, and the control unit controls the image capturing unit to capture multiple images of the object between adjacent pulse nodes of the multiple pulse nodes, so as to synthesize a scanned image corresponding to the object; wherein an image capturing number of the image capturing unit is digitally controlled by the control unit rather than by the pulse driving unit. 2. (canceled) 3. The image scanning apparatus according to claim 1, wherein the pulse driving unit is a stepper motor. 4. The image scanning apparatus according to claim 1, wherein a node distance between the adjacent pulse nodes is of a micron (um) level. 5. The image scanning apparatus according to claim 1, wherein a quotient of an image capturing number of the image capturing unit between the adjacent pulse nodes divided by a node distance between the adjacent pulse nodes is equal to a scanning resolution of the image scanning apparatus. 6. The image scanning apparatus according to claim 1, wherein a quotient of an image capturing number of the image capturing unit between the adjacent pulse nodes divided by a node distance between the adjacent pulse nodes is equal to or more than 4800 dpi. 7. The image scanning apparatus according to claim 1, wherein a quotient of an image capturing number of the image capturing unit between the adjacent pulse nodes divided by a node distance between the adjacent pulse nodes is equal to or more than 9600 dpi. 8. The image scanning apparatus according to claim 1, further comprising a scanning light source to provide a light to irradiate the object. 9. The image scanning apparatus according to claim 8, wherein the scanning light source and the image capturing unit are disposed at opposite sides of the object respectively. 10. The image scanning apparatus according to claim 8, wherein the scanning light source and the image capturing unit are disposed a t the same side of the object respectively. 11. The image scanning apparatus according to claim 1, wherein the image capturing unit comprises a charge coupled device, a complementary metal oxide semiconductor sensor, or a contact image sensor. 12. The image scanning apparatus according to cl aim 1, wherein the image capturing unit comprises a Line-Scan light-sensing device or an Area-Scan light-sensing device. 13. The image scanning apparatus according to claim 1, further comprising a platform having a transparent material, wherein the object is disposed on the platform.

An image scanning apparatus includes an image capturing unit, a pulse driving unit and a control unit. The image capturing unit captures an image of an object. The pulse driving unit drives the image capturing unit and the object along a scanning direction to move with respect to each other among multiple pulse nodes, so as to scan the object. The control unit is electrically connected to the pulse driving unit and the image capturing unit, and the control unit controls the image capturing unit to capture multiple images of the object between adjacent pulse nodes, so as to synthesize a scanned image corresponding to the object.1. An image scanning apparatus comprising: an image capturing unit; a pulse driving unit; and a control unit electrically connected to the pulse driving unit and the image capturing unit; wherein the image capturing unit captures an image of an object, the pulse driving unit drives the image capturing unit and the object along a scanning direction to move with respect to each other among multiple pulse nodes so as to scan the object, and the control unit controls the image capturing unit to capture multiple images of the object between adjacent pulse nodes of the multiple pulse nodes, so as to synthesize a scanned image corresponding to the object; wherein an image capturing number of the image capturing unit is digitally controlled by the control unit rather than by the pulse driving unit. 2. (canceled) 3. The image scanning apparatus according to claim 1, wherein the pulse driving unit is a stepper motor. 4. The image scanning apparatus according to claim 1, wherein a node distance between the adjacent pulse nodes is of a micron (um) level. 5. The image scanning apparatus according to claim 1, wherein a quotient of an image capturing number of the image capturing unit between the adjacent pulse nodes divided by a node distance between the adjacent pulse nodes is equal to a scanning resolution of the image scanning apparatus. 6. The image scanning apparatus according to claim 1, wherein a quotient of an image capturing number of the image capturing unit between the adjacent pulse nodes divided by a node distance between the adjacent pulse nodes is equal to or more than 4800 dpi. 7. The image scanning apparatus according to claim 1, wherein a quotient of an image capturing number of the image capturing unit between the adjacent pulse nodes divided by a node distance between the adjacent pulse nodes is equal to or more than 9600 dpi. 8. The image scanning apparatus according to claim 1, further comprising a scanning light source to provide a light to irradiate the object. 9. The image scanning apparatus according to claim 8, wherein the scanning light source and the image capturing unit are disposed at opposite sides of the object respectively. 10. The image scanning apparatus according to claim 8, wherein the scanning light source and the image capturing unit are disposed a t the same side of the object respectively. 11. The image scanning apparatus according to claim 1, wherein the image capturing unit comprises a charge coupled device, a complementary metal oxide semiconductor sensor, or a contact image sensor. 12. The image scanning apparatus according to cl aim 1, wherein the image capturing unit comprises a Line-Scan light-sensing device or an Area-Scan light-sensing device. 13. The image scanning apparatus according to claim 1, further comprising a platform having a transparent material, wherein the object is disposed on the platform.

According to detection results of a plurality of original document detectors, an image reading apparatus determines whether or not correcting skew of an original document is possible, controls a pair of a plurality of transport rollers in a case where it is determined that correcting the skew of the original document is possible, and corrects the skew of the original document by making transporting speeds of the pair of the plurality of transport rollers different from each other.

1. An image reading apparatus that transports an original document loaded on an original document loaded stand through an original document transport path and reads an image formed on the original document, the apparatus comprising: a pair of a plurality of transport rollers that is disposed at an interval in an original document width direction, which is orthogonal to a transporting direction of the original document, and transports the original document with the original document being pinched therebetween; a plurality of original document detectors that are disposed at an interval in the original document width direction on an upstream side of the pair of transport rollers in the transporting direction and detect passing of the original document; a determiner that determines whether or not correcting skew of the original document is possible based on detection results of the plurality of original document detectors; and a controller that controls the pair of the plurality of transport rollers and corrects the skew of the original document by making transporting speeds of the pair of the plurality of transport rollers different from each other, in a case where the determiner determines that correcting the skew of the original document is possible. 2. The apparatus of claim 1, wherein there are three or more of the original document detectors, and the determiner determines that correcting the skew of the original document is possible in a case where three or more of the adjacent original document detectors detect the passing of the original document in order of being disposed in the original document width direction and the original document is pinched between the pair of the plurality of transport rollers, based on the detection results of the original document detectors and determines that correcting the skew of the original document is impossible in a case where the passing of the original document is not detected in order of being disposed in the original document width direction or the original document is not pinched between the pair of the plurality of transport rollers. 3. The apparatus of claim 1, further comprising: an image reader that is disposed on a downstream side of the pair of transport rollers in the transporting direction and reads the image formed on the original document, wherein the controller corrects the image read by the image reader without correcting the skew of the original document in a case where the determiner determines that correcting the skew of the original document is impossible. 4. An image reading apparatus that transports an original document loaded on an original document loaded stand through an original document transport path and reads an image formed on the original document, the apparatus comprising: a pair of a plurality of transport rollers that is disposed at an interval in an original document width direction, which is orthogonal to a transporting direction of the original document, and transports the original document with the original document being pinched therebetween; a plurality of original document detectors that are disposed at an interval in the original document width direction on an upstream side of the pair of transport rollers in the transporting direction and detect passing of the original document; a pair of second transport rollers that is disposed on an upstream side of the original document detectors in the transporting direction and transports the original document with the original document being pinched therebetween; a rotation unit that rotates rotary shafts of the second transport rollers, which configure the pair of second transport rollers; a determiner that determines whether or not correcting skew of the original document is possible according to detection results of the plurality of original document detectors; and a controller that controls the pair of the plurality of transport rollers, controls the rotation unit while correcting the skew of the original document by making transporting speeds of the pair of the plurality of transport rollers different from each other, and rotates the rotary shafts of the second transport rollers such that a load, which is applied to the original document in response to operation of correcting the skew of the original document, decreases, in a case where the determiner determines that correcting the skew of the original document is possible. 5. The apparatus of claim 4, wherein there are three or more of the original document detectors, and the determiner determines that correcting the skew of the original document is possible in a case where three or more of the adjacent original document detectors detect passing of the original document in order of being disposed in the original document width direction and the original document is pinched between the pair of the plurality of transport rollers, based on the detection results of the original document detectors and determines that correcting the skew of the original document is impossible in a case where the passing of the original document is not detected in order of being disposed in the original document width direction or the original document is not pinched between the pair of the plurality of transport rollers. 6. The apparatus of claim 4, further comprising: an image reader that is disposed on a downstream side of the pair of transport rollers in the transporting direction and reads the image formed on the original document; wherein the controller corrects the image read by the image reader without correcting the skew of the original document in a case where the determiner determines that correcting the skew of the original document is impossible. 7. An image reading apparatus that transports an original document loaded on an original document loaded stand through an original document transport path and reads an image formed on the original document, the apparatus comprising: a pair of a plurality of transport rollers that is disposed at an interval in an original document width direction, which is orthogonal to a transporting direction of the original document, and transports the original document with the original document being pinched therebetween; a plurality of original document detectors that are disposed at an interval in the original document width direction on an upstream side of the pair of transport rollers in the transporting direction and detect passing of the original document; a double feeding detector that is disposed on an upstream side of the pair of transport rollers in the transporting direction and detects double feeding of the original document; a determiner that determines whether or not correcting skew of the original document is possible according to detection results of the plurality of original document detectors; and a controller that controls the pair of the plurality of transport rollers, corrects the skew of the original document by making transporting speeds of the pair of the plurality of transport rollers different from each other, controls the pair of the plurality of transport rollers according to a correction condition of the skew when the double feeding detector detects double feeding of the original document at a time of the correction, and transports the original document in a direction opposite to the transporting direction, in a case where the determiner determines that correcting the skew of the original document is possible. 8. The apparatus of claim 7, wherein the controller transports the original document in the direction opposite to the transporting direction without making the transporting speeds of the pair of the plurality of transport rollers different from each other when correction of the skew is terminated in a case where the double feeding detector detects the double feeding of the original document. 9. The apparatus of claim 7, wherein the controller transports the original document in the direction opposite to the transporting direction while correcting the skew of the original document by making the transporting speeds of the pair of the plurality of transport rollers different from each other when correction of the skew is not terminated in a case where the double feeding detector detects the double feeding of the original document. 10. The apparatus of claim 7, wherein there are three or more of the original document detectors, and the determiner determines that correcting the skew of the original document is possible in a case where three or more of the adjacent original document detectors detect passing of the original document in order of being disposed in the original document width direction and the original document is pinched between the pair of the plurality of transport rollers, based on the detection results of the original document detectors and determines that correcting the skew of the original document is impossible in a case where the passing of the original document is not detected in order of being disposed in the original document width direction or the original document is not pinched between the pair of the plurality of transport rollers. 11. The apparatus of claim 7, further comprising: an image reader that is disposed on a downstream side of the pair of transport rollers in the transporting direction and reads the image formed on the original document; wherein the controller corrects the image read by the image reader without correcting the skew of the original document in a case where the determiner determines that correcting the skew of the original document is impossible.

According to detection results of a plurality of original document detectors, an image reading apparatus determines whether or not correcting skew of an original document is possible, controls a pair of a plurality of transport rollers in a case where it is determined that correcting the skew of the original document is possible, and corrects the skew of the original document by making transporting speeds of the pair of the plurality of transport rollers different from each other.1. An image reading apparatus that transports an original document loaded on an original document loaded stand through an original document transport path and reads an image formed on the original document, the apparatus comprising: a pair of a plurality of transport rollers that is disposed at an interval in an original document width direction, which is orthogonal to a transporting direction of the original document, and transports the original document with the original document being pinched therebetween; a plurality of original document detectors that are disposed at an interval in the original document width direction on an upstream side of the pair of transport rollers in the transporting direction and detect passing of the original document; a determiner that determines whether or not correcting skew of the original document is possible based on detection results of the plurality of original document detectors; and a controller that controls the pair of the plurality of transport rollers and corrects the skew of the original document by making transporting speeds of the pair of the plurality of transport rollers different from each other, in a case where the determiner determines that correcting the skew of the original document is possible. 2. The apparatus of claim 1, wherein there are three or more of the original document detectors, and the determiner determines that correcting the skew of the original document is possible in a case where three or more of the adjacent original document detectors detect the passing of the original document in order of being disposed in the original document width direction and the original document is pinched between the pair of the plurality of transport rollers, based on the detection results of the original document detectors and determines that correcting the skew of the original document is impossible in a case where the passing of the original document is not detected in order of being disposed in the original document width direction or the original document is not pinched between the pair of the plurality of transport rollers. 3. The apparatus of claim 1, further comprising: an image reader that is disposed on a downstream side of the pair of transport rollers in the transporting direction and reads the image formed on the original document, wherein the controller corrects the image read by the image reader without correcting the skew of the original document in a case where the determiner determines that correcting the skew of the original document is impossible. 4. An image reading apparatus that transports an original document loaded on an original document loaded stand through an original document transport path and reads an image formed on the original document, the apparatus comprising: a pair of a plurality of transport rollers that is disposed at an interval in an original document width direction, which is orthogonal to a transporting direction of the original document, and transports the original document with the original document being pinched therebetween; a plurality of original document detectors that are disposed at an interval in the original document width direction on an upstream side of the pair of transport rollers in the transporting direction and detect passing of the original document; a pair of second transport rollers that is disposed on an upstream side of the original document detectors in the transporting direction and transports the original document with the original document being pinched therebetween; a rotation unit that rotates rotary shafts of the second transport rollers, which configure the pair of second transport rollers; a determiner that determines whether or not correcting skew of the original document is possible according to detection results of the plurality of original document detectors; and a controller that controls the pair of the plurality of transport rollers, controls the rotation unit while correcting the skew of the original document by making transporting speeds of the pair of the plurality of transport rollers different from each other, and rotates the rotary shafts of the second transport rollers such that a load, which is applied to the original document in response to operation of correcting the skew of the original document, decreases, in a case where the determiner determines that correcting the skew of the original document is possible. 5. The apparatus of claim 4, wherein there are three or more of the original document detectors, and the determiner determines that correcting the skew of the original document is possible in a case where three or more of the adjacent original document detectors detect passing of the original document in order of being disposed in the original document width direction and the original document is pinched between the pair of the plurality of transport rollers, based on the detection results of the original document detectors and determines that correcting the skew of the original document is impossible in a case where the passing of the original document is not detected in order of being disposed in the original document width direction or the original document is not pinched between the pair of the plurality of transport rollers. 6. The apparatus of claim 4, further comprising: an image reader that is disposed on a downstream side of the pair of transport rollers in the transporting direction and reads the image formed on the original document; wherein the controller corrects the image read by the image reader without correcting the skew of the original document in a case where the determiner determines that correcting the skew of the original document is impossible. 7. An image reading apparatus that transports an original document loaded on an original document loaded stand through an original document transport path and reads an image formed on the original document, the apparatus comprising: a pair of a plurality of transport rollers that is disposed at an interval in an original document width direction, which is orthogonal to a transporting direction of the original document, and transports the original document with the original document being pinched therebetween; a plurality of original document detectors that are disposed at an interval in the original document width direction on an upstream side of the pair of transport rollers in the transporting direction and detect passing of the original document; a double feeding detector that is disposed on an upstream side of the pair of transport rollers in the transporting direction and detects double feeding of the original document; a determiner that determines whether or not correcting skew of the original document is possible according to detection results of the plurality of original document detectors; and a controller that controls the pair of the plurality of transport rollers, corrects the skew of the original document by making transporting speeds of the pair of the plurality of transport rollers different from each other, controls the pair of the plurality of transport rollers according to a correction condition of the skew when the double feeding detector detects double feeding of the original document at a time of the correction, and transports the original document in a direction opposite to the transporting direction, in a case where the determiner determines that correcting the skew of the original document is possible. 8. The apparatus of claim 7, wherein the controller transports the original document in the direction opposite to the transporting direction without making the transporting speeds of the pair of the plurality of transport rollers different from each other when correction of the skew is terminated in a case where the double feeding detector detects the double feeding of the original document. 9. The apparatus of claim 7, wherein the controller transports the original document in the direction opposite to the transporting direction while correcting the skew of the original document by making the transporting speeds of the pair of the plurality of transport rollers different from each other when correction of the skew is not terminated in a case where the double feeding detector detects the double feeding of the original document. 10. The apparatus of claim 7, wherein there are three or more of the original document detectors, and the determiner determines that correcting the skew of the original document is possible in a case where three or more of the adjacent original document detectors detect passing of the original document in order of being disposed in the original document width direction and the original document is pinched between the pair of the plurality of transport rollers, based on the detection results of the original document detectors and determines that correcting the skew of the original document is impossible in a case where the passing of the original document is not detected in order of being disposed in the original document width direction or the original document is not pinched between the pair of the plurality of transport rollers. 11. The apparatus of claim 7, further comprising: an image reader that is disposed on a downstream side of the pair of transport rollers in the transporting direction and reads the image formed on the original document; wherein the controller corrects the image read by the image reader without correcting the skew of the original document in a case where the determiner determines that correcting the skew of the original document is impossible.

A method and system are provided for monitoring and controlling a mobile device using a supervisory device. In some embodiments, the supervisory device operates in conjunction with the mobile device to monitor an extent of usage of the mobile device as well as to ensure that certain software is being used appropriately. The supervisory device may take one or more responsive actions when an extent of usage of the mobile device reaches a threshold extent of usage, when certain software on the mobile device is not being used appropriately, and/or when certain settings of the mobile device have been changed. The supervisory device may operate in a non-permissible mode and determine that the mobile device is currently enabled. In response to this operation and determination, the supervisory device may disable the mobile device and/or transmit to an external device a notification message.

1. A method comprising: receiving, at a supervisory device, an indication that a mobile device is enabled, the supervisory device being communicatively coupled to the mobile device; making a determination, via the supervisory device, whether to disable the mobile device; and when the determination is to disable the mobile device, disabling the mobile device via the supervisory device. 2. The method of claim 1, wherein the supervisory device is communicatively coupled to the mobile device via a headphone jack on the mobile device, and wherein receiving, at the supervisory device, an indication that a mobile device is enabled comprises the supervisory device measuring a voltage at the headphone jack and determining that the measured voltage exceeds a threshold voltage level. 3. The method of claim 1, wherein receiving, at the supervisory device, an indication that the mobile device is enabled comprises receiving, at the supervisory device, an indication through a wired connection that the mobile device is enabled. 4. The method of claim 1, wherein disabling the mobile device via the supervisory device comprises the supervisory device transmitting through a wired connection a signal that causes the mobile device to be disabled. 5. The method of claim 1, wherein receiving, at the supervisory device, an indication that the mobile device is enabled comprises receiving, at the supervisory device, an indication through a wireless connection that the mobile device is enabled. 6. The method of claim 1, wherein disabling the mobile device via the supervisory device comprises the supervisory device transmitting through a wireless connection a signal that causes the mobile device to be disabled. 7. The method of claim 1, further comprising: measuring, via the supervisory device, an amount of time the mobile device has been enabled; and when the amount of time the mobile device has been enabled exceeds a threshold, disabling the mobile device via the supervisory device. 8. The method of claim 1, wherein making a determination, via the supervisory device, whether to disable the mobile device comprises making a determination, via the supervisory device, whether the mobile device is enabled during a forbidden time of day. 9. The method of claim 1, wherein making a determination, via the supervisory device, whether to disable the mobile device comprises determining that at least one pre-approved application is in-use on the mobile device, and wherein the method further comprises: in response to determining that at least one pre-approved application is in-use on the mobile device, operating the supervisory device so as to not disable the mobile device so long as the at least one pre-approved application is in-use on the mobile device. 10. The method of claim 1, wherein the supervisory device is disposed within a case that substantially surrounds the mobile device, the case including a screen, and wherein disabling the mobile device via the supervisory device comprises manipulating the screen such that viewing of the mobile device through the screen is inhibited. 11. The method of claim 1, further comprising: establishing operating conditions on the supervisory device by manipulating a graphical user interface (GUI) accessible via the mobile device, and wherein making a determination, via the supervisory device, whether to disable the mobile device comprises making a determination, via the supervisory device based on the operating conditions established via the GUI, whether to disable the mobile device. 12. A supervisory device comprising: a case adapted to substantially surround a mobile device; and one or more computing devices coupled to or disposed within the case, the one or more computing devices being configured to carry out operations including; being communicatively coupled to the mobile device; receiving an indication that the mobile device is enabled; making a determination whether to disable the mobile device; and when the determination is to disable the mobile device, disabling the mobile device. 13. The supervisory device of claim 12, wherein the one or more computing devices are communicatively coupled to the mobile device via a headphone jack on the mobile device, and wherein receiving an indication that the mobile device is enabled comprises measuring a voltage at the headphone jack and determining that the measured voltage exceeds a threshold voltage level. 14. The supervisory device of claim 12, wherein receiving an indication that the mobile device is enabled comprises receiving an indication through a wired connection that the mobile device is enabled, and wherein disabling the mobile device comprises transmitting through a wired connection a signal that causes the mobile device to be disabled. 15. The supervisory device of claim 12, wherein making a determination whether to disable the mobile device comprises determining that at least one pre-approved application is in-use on the mobile device, and wherein the operations further comprise: in response to determining that at least one pre-approved application is in-use on the mobile device, operating so as to not disable the mobile device so long as the at least one pre-approved application is in-use on the mobile device. 16. The supervisory device of claim 12, wherein the case comprises a screen, and wherein disabling the mobile device comprises manipulating the screen such that viewing of the mobile device through the screen is inhibited. 17. A non-transitory computer-readable medium (CRM) having program instructions stored thereon, which, when executed by a processor, causes the processor to carry out functions comprising: receiving, at a supervisory device, an indication that a mobile device is enabled; making a determination, via the supervisory device, whether to disable the mobile device; and when the determination is to disable the mobile device, disabling the mobile device via the supervisory device. 18. The CRM of claim 17, wherein the supervisory device is communicatively coupled to the mobile device via a headphone jack on the mobile device, and wherein receiving, at the supervisory device, an indication that a mobile device is enabled comprises the supervisory device measuring a voltage at the headphone jack and determining that the measured voltage exceeds a threshold voltage level. 19. The CRM of claim 17, wherein receiving, at the supervisory device, an indication that the mobile device is enabled comprises receiving, at the supervisory device, an indication through a wired connection that the mobile device is enabled, and wherein disabling the mobile device via the supervisory device comprises the supervisory device transmitting through a wired connection a signal that causes the mobile device to be disabled. 20. The CRM of claim 17, wherein receiving, at the supervisory device, an indication that the mobile device is enabled comprises receiving, at the supervisory device, an indication through a wireless connection that the mobile device is enabled, and wherein disabling the mobile device via the supervisory device comprises the supervisory device transmitting through a wireless connection a signal that causes the mobile device to be disabled. 21. The CRM of claim 17, wherein the functions further comprise: measuring, via the supervisory device, an amount of time the mobile device has been enabled; and when the amount of time the mobile device has been enabled exceeds a threshold, disabling the mobile device via the supervisory device. 22. The CRM of claim 17, wherein making a determination, via the supervisory device, whether to disable the mobile device comprises making a determination, via the supervisory device, whether the mobile device is enabled during a forbidden time of day. 23. The CRM of claim 17, wherein making a determination, via the supervisory device, whether to disable the mobile device comprises determining that at least one pre-approved application is in-use on the mobile device, and wherein the functions further comprise: in response to determining that at least one pre-approved application is in-use on the mobile device, operating the supervisory device so as to not disable the mobile device so long as the at least one pre-approved application is in-use on the mobile device. 24. The CRM of claim 17, wherein disabling the mobile device via the supervisory device comprises manipulating a screen associated with a case that is adapted to substantially surround the mobile device such that viewing of the mobile device through the screen is inhibited. 25. The CRM of claim 17, wherein the functions further comprise: establishing operating conditions on the supervisory device by manipulating a graphical user interface (GUI) accessible via the mobile device, and wherein making a determination, via the supervisory device, whether to disable the mobile device comprises making a determination, via the supervisory device based on the operating conditions established via the GUI, whether to disable the mobile device.

A method and system are provided for monitoring and controlling a mobile device using a supervisory device. In some embodiments, the supervisory device operates in conjunction with the mobile device to monitor an extent of usage of the mobile device as well as to ensure that certain software is being used appropriately. The supervisory device may take one or more responsive actions when an extent of usage of the mobile device reaches a threshold extent of usage, when certain software on the mobile device is not being used appropriately, and/or when certain settings of the mobile device have been changed. The supervisory device may operate in a non-permissible mode and determine that the mobile device is currently enabled. In response to this operation and determination, the supervisory device may disable the mobile device and/or transmit to an external device a notification message.1. A method comprising: receiving, at a supervisory device, an indication that a mobile device is enabled, the supervisory device being communicatively coupled to the mobile device; making a determination, via the supervisory device, whether to disable the mobile device; and when the determination is to disable the mobile device, disabling the mobile device via the supervisory device. 2. The method of claim 1, wherein the supervisory device is communicatively coupled to the mobile device via a headphone jack on the mobile device, and wherein receiving, at the supervisory device, an indication that a mobile device is enabled comprises the supervisory device measuring a voltage at the headphone jack and determining that the measured voltage exceeds a threshold voltage level. 3. The method of claim 1, wherein receiving, at the supervisory device, an indication that the mobile device is enabled comprises receiving, at the supervisory device, an indication through a wired connection that the mobile device is enabled. 4. The method of claim 1, wherein disabling the mobile device via the supervisory device comprises the supervisory device transmitting through a wired connection a signal that causes the mobile device to be disabled. 5. The method of claim 1, wherein receiving, at the supervisory device, an indication that the mobile device is enabled comprises receiving, at the supervisory device, an indication through a wireless connection that the mobile device is enabled. 6. The method of claim 1, wherein disabling the mobile device via the supervisory device comprises the supervisory device transmitting through a wireless connection a signal that causes the mobile device to be disabled. 7. The method of claim 1, further comprising: measuring, via the supervisory device, an amount of time the mobile device has been enabled; and when the amount of time the mobile device has been enabled exceeds a threshold, disabling the mobile device via the supervisory device. 8. The method of claim 1, wherein making a determination, via the supervisory device, whether to disable the mobile device comprises making a determination, via the supervisory device, whether the mobile device is enabled during a forbidden time of day. 9. The method of claim 1, wherein making a determination, via the supervisory device, whether to disable the mobile device comprises determining that at least one pre-approved application is in-use on the mobile device, and wherein the method further comprises: in response to determining that at least one pre-approved application is in-use on the mobile device, operating the supervisory device so as to not disable the mobile device so long as the at least one pre-approved application is in-use on the mobile device. 10. The method of claim 1, wherein the supervisory device is disposed within a case that substantially surrounds the mobile device, the case including a screen, and wherein disabling the mobile device via the supervisory device comprises manipulating the screen such that viewing of the mobile device through the screen is inhibited. 11. The method of claim 1, further comprising: establishing operating conditions on the supervisory device by manipulating a graphical user interface (GUI) accessible via the mobile device, and wherein making a determination, via the supervisory device, whether to disable the mobile device comprises making a determination, via the supervisory device based on the operating conditions established via the GUI, whether to disable the mobile device. 12. A supervisory device comprising: a case adapted to substantially surround a mobile device; and one or more computing devices coupled to or disposed within the case, the one or more computing devices being configured to carry out operations including; being communicatively coupled to the mobile device; receiving an indication that the mobile device is enabled; making a determination whether to disable the mobile device; and when the determination is to disable the mobile device, disabling the mobile device. 13. The supervisory device of claim 12, wherein the one or more computing devices are communicatively coupled to the mobile device via a headphone jack on the mobile device, and wherein receiving an indication that the mobile device is enabled comprises measuring a voltage at the headphone jack and determining that the measured voltage exceeds a threshold voltage level. 14. The supervisory device of claim 12, wherein receiving an indication that the mobile device is enabled comprises receiving an indication through a wired connection that the mobile device is enabled, and wherein disabling the mobile device comprises transmitting through a wired connection a signal that causes the mobile device to be disabled. 15. The supervisory device of claim 12, wherein making a determination whether to disable the mobile device comprises determining that at least one pre-approved application is in-use on the mobile device, and wherein the operations further comprise: in response to determining that at least one pre-approved application is in-use on the mobile device, operating so as to not disable the mobile device so long as the at least one pre-approved application is in-use on the mobile device. 16. The supervisory device of claim 12, wherein the case comprises a screen, and wherein disabling the mobile device comprises manipulating the screen such that viewing of the mobile device through the screen is inhibited. 17. A non-transitory computer-readable medium (CRM) having program instructions stored thereon, which, when executed by a processor, causes the processor to carry out functions comprising: receiving, at a supervisory device, an indication that a mobile device is enabled; making a determination, via the supervisory device, whether to disable the mobile device; and when the determination is to disable the mobile device, disabling the mobile device via the supervisory device. 18. The CRM of claim 17, wherein the supervisory device is communicatively coupled to the mobile device via a headphone jack on the mobile device, and wherein receiving, at the supervisory device, an indication that a mobile device is enabled comprises the supervisory device measuring a voltage at the headphone jack and determining that the measured voltage exceeds a threshold voltage level. 19. The CRM of claim 17, wherein receiving, at the supervisory device, an indication that the mobile device is enabled comprises receiving, at the supervisory device, an indication through a wired connection that the mobile device is enabled, and wherein disabling the mobile device via the supervisory device comprises the supervisory device transmitting through a wired connection a signal that causes the mobile device to be disabled. 20. The CRM of claim 17, wherein receiving, at the supervisory device, an indication that the mobile device is enabled comprises receiving, at the supervisory device, an indication through a wireless connection that the mobile device is enabled, and wherein disabling the mobile device via the supervisory device comprises the supervisory device transmitting through a wireless connection a signal that causes the mobile device to be disabled. 21. The CRM of claim 17, wherein the functions further comprise: measuring, via the supervisory device, an amount of time the mobile device has been enabled; and when the amount of time the mobile device has been enabled exceeds a threshold, disabling the mobile device via the supervisory device. 22. The CRM of claim 17, wherein making a determination, via the supervisory device, whether to disable the mobile device comprises making a determination, via the supervisory device, whether the mobile device is enabled during a forbidden time of day. 23. The CRM of claim 17, wherein making a determination, via the supervisory device, whether to disable the mobile device comprises determining that at least one pre-approved application is in-use on the mobile device, and wherein the functions further comprise: in response to determining that at least one pre-approved application is in-use on the mobile device, operating the supervisory device so as to not disable the mobile device so long as the at least one pre-approved application is in-use on the mobile device. 24. The CRM of claim 17, wherein disabling the mobile device via the supervisory device comprises manipulating a screen associated with a case that is adapted to substantially surround the mobile device such that viewing of the mobile device through the screen is inhibited. 25. The CRM of claim 17, wherein the functions further comprise: establishing operating conditions on the supervisory device by manipulating a graphical user interface (GUI) accessible via the mobile device, and wherein making a determination, via the supervisory device, whether to disable the mobile device comprises making a determination, via the supervisory device based on the operating conditions established via the GUI, whether to disable the mobile device.

An image forming apparatus includes: an image processor configured to perform first image processing on image data having a first resolution and to add tag data to a target pixel where second image processing is to be performed; a resolution converter configured to convert the image data into image data having a second resolution higher than the first resolution, and to perform the second image processing based on arrangement of the image data having the first resolution and the tag data; a pulse generator configured to generate an on-off modulation signal and an application-current switching signal in accordance with the image data having undergone the second image processing; and a light source driver configured to drive the light source in accordance with a current setting value output from an application current setter depending on the application-current switching signal and the on-off modulation signal.

1. An image forming apparatus comprising: an image processor configured to perform first image processing on image data having a first resolution and to add tag data to a target pixel, the target pixel being a pixel where second image processing is to be performed; a resolution converter configured to convert the image data having the first resolution into image data having a second resolution, the second resolution being higher than the first resolution, and to perform the second image processing based on arrangement of the image data having the first resolution and the tag data, both output from the image processor; a pulse generator configured to generate an on-off modulation signal and an application-current switching signal in accordance with the image data having undergone the second image processing; an application current setter configured to output a current setting value for an electric current to be applied to a light source; and a light source driver configured to drive the light source in accordance with the current setting value and the on-off modulation signal, the current setting value being output depending on the application-current switching signal. 2. The image forming apparatus according to claim 1, wherein the application current setter is capable of outputting a plurality of current setting values, and the light source driver acquires a current setting value from the application current setter in accordance with the application-current switching signal. 3. The image forming apparatus according to claim 1, wherein the resolution converter includes a pattern matching part configured to determine whether or not the target pixel is a pixel belonging to an edge in an image based on arrangement of the image data having the first resolution and the tag data in an image matrix, the image matrix being the image data having the first resolution and the tag data in a region containing the target pixel and a pixel around the target pixel, and an image-resolution increasing part configured to covert the pixel detected by the pattern matching part as belonging to the edge in the image to image data having the second resolution. 4. The image forming apparatus according to claim 1, wherein the resolution converter includes a first image-resolution increasing part configured to increase resolution of the target pixel, the target pixel being sequentially selected from the image data having the first resolution, a pattern matching part configured to determine whether or not the target pixel is a pixel belonging to an edge in an image based on arrangement of the image data having the first resolution and the tag data in an image matrix, the image matrix being the image data having the first resolution and the tag data in a region containing the target pixel and a pixel around the target pixel, a second image-resolution increasing part configured to covert the pixel detected by the pattern matching part as belonging to an edge in an image into image data having the second resolution, and a selector configured to select the image data having the second resolution when the target pixel is determined as being the pixel belonging to the edge in the image and output selected image data to the pulse generator, but select image data having the first resolution when the target pixel is determined as not being the pixel belonging to the edge in the image. 5. The image forming apparatus according to claim 3, wherein the resolution converter trims a pixel constituting an edge in the image at the second resolution to perform thinning in the second image processing. 6. The image forming apparatus according to claim 5, wherein the resolution converter generates power modulation information for changing exposure intensity for high light intensity pixel area to be exposed with light intensity higher than normal, at new edges after the thinning in the second image processing, and the pulse generator generates the on-off modulation signal and the application-current switching signal in accordance with the image data having the second resolution and the power modulation information. 7. The image forming apparatus according to claim 6, wherein the resolution converter can set at least one of a degree of thinning being a trimming amount of the pixel, the high light intensity pixel area and the exposure intensity, individually with respect to left and right edges in a horizontal direction of the image, and upper and lower edges in a vertical direction of the image. 8. The image forming apparatus according to claim 1, wherein the application current setter includes a normal current setter configured to generate normal-light-intensity data, and a power-modulation current setter configured to generate high-light-intensity data by magnifying the normal-light-intensity data generated by the normal current setter, and the application current setter outputs either the normal-light-intensity data or the high-light-intensity data to the light source while switching therebetween in accordance with the application-current switching signal generated by the pulse generator. 9. The image forming apparatus according to claim 6, wherein when the exposure intensity for the high light intensity pixel area at the new edges after the thinning in the second image processing is changed, the resolution converter sets the exposure intensity so as to equalize an increase in integral of light intensity caused by changing the exposure intensity with a loss in integral of light intensity caused by the second image processing. 10. A method for driving a light source in an image forming apparatus, the method comprising: performing image processing to perform first image processing on image data having a first resolution and add tag data to a target pixel, the target pixel being a pixel where second image processing is to be performed; performing resolution conversion to convert the image data having the first resolution into image data having a second resolution, the second resolution being higher than the first resolution, and perform the second image processing based on arrangement of the image data having the first resolution and the tag data; performing pulse generation to generate an on-off modulation signal and an application-current switching signal in accordance with the image data having undergone the second image processing; setting an application current by outputting a current setting value for an electric current to be applied to the light source; and driving the light source in accordance with the current setting value and the on-off modulation signal, the current setting value being output depending on the application-current switching signal.

An image forming apparatus includes: an image processor configured to perform first image processing on image data having a first resolution and to add tag data to a target pixel where second image processing is to be performed; a resolution converter configured to convert the image data into image data having a second resolution higher than the first resolution, and to perform the second image processing based on arrangement of the image data having the first resolution and the tag data; a pulse generator configured to generate an on-off modulation signal and an application-current switching signal in accordance with the image data having undergone the second image processing; and a light source driver configured to drive the light source in accordance with a current setting value output from an application current setter depending on the application-current switching signal and the on-off modulation signal.1. An image forming apparatus comprising: an image processor configured to perform first image processing on image data having a first resolution and to add tag data to a target pixel, the target pixel being a pixel where second image processing is to be performed; a resolution converter configured to convert the image data having the first resolution into image data having a second resolution, the second resolution being higher than the first resolution, and to perform the second image processing based on arrangement of the image data having the first resolution and the tag data, both output from the image processor; a pulse generator configured to generate an on-off modulation signal and an application-current switching signal in accordance with the image data having undergone the second image processing; an application current setter configured to output a current setting value for an electric current to be applied to a light source; and a light source driver configured to drive the light source in accordance with the current setting value and the on-off modulation signal, the current setting value being output depending on the application-current switching signal. 2. The image forming apparatus according to claim 1, wherein the application current setter is capable of outputting a plurality of current setting values, and the light source driver acquires a current setting value from the application current setter in accordance with the application-current switching signal. 3. The image forming apparatus according to claim 1, wherein the resolution converter includes a pattern matching part configured to determine whether or not the target pixel is a pixel belonging to an edge in an image based on arrangement of the image data having the first resolution and the tag data in an image matrix, the image matrix being the image data having the first resolution and the tag data in a region containing the target pixel and a pixel around the target pixel, and an image-resolution increasing part configured to covert the pixel detected by the pattern matching part as belonging to the edge in the image to image data having the second resolution. 4. The image forming apparatus according to claim 1, wherein the resolution converter includes a first image-resolution increasing part configured to increase resolution of the target pixel, the target pixel being sequentially selected from the image data having the first resolution, a pattern matching part configured to determine whether or not the target pixel is a pixel belonging to an edge in an image based on arrangement of the image data having the first resolution and the tag data in an image matrix, the image matrix being the image data having the first resolution and the tag data in a region containing the target pixel and a pixel around the target pixel, a second image-resolution increasing part configured to covert the pixel detected by the pattern matching part as belonging to an edge in an image into image data having the second resolution, and a selector configured to select the image data having the second resolution when the target pixel is determined as being the pixel belonging to the edge in the image and output selected image data to the pulse generator, but select image data having the first resolution when the target pixel is determined as not being the pixel belonging to the edge in the image. 5. The image forming apparatus according to claim 3, wherein the resolution converter trims a pixel constituting an edge in the image at the second resolution to perform thinning in the second image processing. 6. The image forming apparatus according to claim 5, wherein the resolution converter generates power modulation information for changing exposure intensity for high light intensity pixel area to be exposed with light intensity higher than normal, at new edges after the thinning in the second image processing, and the pulse generator generates the on-off modulation signal and the application-current switching signal in accordance with the image data having the second resolution and the power modulation information. 7. The image forming apparatus according to claim 6, wherein the resolution converter can set at least one of a degree of thinning being a trimming amount of the pixel, the high light intensity pixel area and the exposure intensity, individually with respect to left and right edges in a horizontal direction of the image, and upper and lower edges in a vertical direction of the image. 8. The image forming apparatus according to claim 1, wherein the application current setter includes a normal current setter configured to generate normal-light-intensity data, and a power-modulation current setter configured to generate high-light-intensity data by magnifying the normal-light-intensity data generated by the normal current setter, and the application current setter outputs either the normal-light-intensity data or the high-light-intensity data to the light source while switching therebetween in accordance with the application-current switching signal generated by the pulse generator. 9. The image forming apparatus according to claim 6, wherein when the exposure intensity for the high light intensity pixel area at the new edges after the thinning in the second image processing is changed, the resolution converter sets the exposure intensity so as to equalize an increase in integral of light intensity caused by changing the exposure intensity with a loss in integral of light intensity caused by the second image processing. 10. A method for driving a light source in an image forming apparatus, the method comprising: performing image processing to perform first image processing on image data having a first resolution and add tag data to a target pixel, the target pixel being a pixel where second image processing is to be performed; performing resolution conversion to convert the image data having the first resolution into image data having a second resolution, the second resolution being higher than the first resolution, and perform the second image processing based on arrangement of the image data having the first resolution and the tag data; performing pulse generation to generate an on-off modulation signal and an application-current switching signal in accordance with the image data having undergone the second image processing; setting an application current by outputting a current setting value for an electric current to be applied to the light source; and driving the light source in accordance with the current setting value and the on-off modulation signal, the current setting value being output depending on the application-current switching signal.

A commercial AC power shutdown detecting apparatus includes a photocoupler including a light-emitting element and a light-receiving element, a lighting circuit that flows a pulsating current through the light-emitting element of the photocoupler to turn on and off light of the light-emitting element, a charging-discharging circuit including a capacitor and a resistor that charges the capacitor via the resistor when the light-emitting element is turned off, and discharges the capacitor via the light-receiving element and the a resistor when the light-emitting element is turned on, and a comparing circuit that compares a voltage value between capacitor terminals with a predetermined voltage value intermediate between a maximum voltage value between the capacitor terminals when the light-emitting element repeats turning light on and off and the consistent DC voltage value, and outputs a shutdown detection signal if the voltage value between the capacitor terminals exceeds the predetermined voltage value.

1. A commercial AC power shutdown detecting apparatus, comprising: a photocoupler including a light emitting element and a light receiving element in a package; a lighting circuit to flow a pulsating current through the light emitting element of the photocoupler to turn on and off light of the light emitting element, the pulsating current being a full-wave rectified alternate current supplied from a commercial AC power; a charging-discharging circuit including a capacitor and at least one resistor, the charging-discharging circuit to charge the capacitor using a DC voltage supplied from a DC power supply via the at least one resistor when the light emitting element is turned off, and discharge the capacitor via the light receiving element and the at least one resistor when the light emitting element is turned on; and a comparing circuit to compare a voltage value between terminals of the capacitor with a predetermined voltage value intermediate between a maximum voltage value between the terminals of the capacitor when the light emitting element repeats turning light on and off and the consistent DC voltage value, and output a shutdown detection signal if the voltage value between the terminals of the capacitor exceeds the predetermined voltage value. 2. A system comprising: the commercial AC power shutdown detecting apparatus according to claim 1; a backup power supply; various loads to which the commercial AC power supplies power; and a power supply switch to switch a power source from the commercial AC power supply to the backup power supply, to cause the backup power supply to supply power to the various loads if the commercial AC power shutdown detecting apparatus outputs the shutdown detection signal. 3. The system according to claim 2, wherein the backup power supply includes: a capacitor; a charger to charge the capacitor with the power from the commercial AC power; and a discharger to discharge electrical power stored in the capacity and supply the electrical power via the power supply switch. 4. The system according to claim 2, wherein the system is an image forming apparatus capable of forming an image. 5. A system comprising: the commercial AC power shutdown detecting apparatus according to claim 1; a backup power supply; various loads to which the commercial AC power supplies power; and a power supply switch to switch a power source from the commercial AC power supply to the backup power supply, to cause the backup power supply to supply power to a specific part if the commercial AC power shutdown detecting apparatus outputs the shutdown detection signal. 6. The system according to claim 5, wherein the system is an image forming apparatus capable of forming an image, and the specific part is a control panel of the image forming apparatus.

A commercial AC power shutdown detecting apparatus includes a photocoupler including a light-emitting element and a light-receiving element, a lighting circuit that flows a pulsating current through the light-emitting element of the photocoupler to turn on and off light of the light-emitting element, a charging-discharging circuit including a capacitor and a resistor that charges the capacitor via the resistor when the light-emitting element is turned off, and discharges the capacitor via the light-receiving element and the a resistor when the light-emitting element is turned on, and a comparing circuit that compares a voltage value between capacitor terminals with a predetermined voltage value intermediate between a maximum voltage value between the capacitor terminals when the light-emitting element repeats turning light on and off and the consistent DC voltage value, and outputs a shutdown detection signal if the voltage value between the capacitor terminals exceeds the predetermined voltage value.1. A commercial AC power shutdown detecting apparatus, comprising: a photocoupler including a light emitting element and a light receiving element in a package; a lighting circuit to flow a pulsating current through the light emitting element of the photocoupler to turn on and off light of the light emitting element, the pulsating current being a full-wave rectified alternate current supplied from a commercial AC power; a charging-discharging circuit including a capacitor and at least one resistor, the charging-discharging circuit to charge the capacitor using a DC voltage supplied from a DC power supply via the at least one resistor when the light emitting element is turned off, and discharge the capacitor via the light receiving element and the at least one resistor when the light emitting element is turned on; and a comparing circuit to compare a voltage value between terminals of the capacitor with a predetermined voltage value intermediate between a maximum voltage value between the terminals of the capacitor when the light emitting element repeats turning light on and off and the consistent DC voltage value, and output a shutdown detection signal if the voltage value between the terminals of the capacitor exceeds the predetermined voltage value. 2. A system comprising: the commercial AC power shutdown detecting apparatus according to claim 1; a backup power supply; various loads to which the commercial AC power supplies power; and a power supply switch to switch a power source from the commercial AC power supply to the backup power supply, to cause the backup power supply to supply power to the various loads if the commercial AC power shutdown detecting apparatus outputs the shutdown detection signal. 3. The system according to claim 2, wherein the backup power supply includes: a capacitor; a charger to charge the capacitor with the power from the commercial AC power; and a discharger to discharge electrical power stored in the capacity and supply the electrical power via the power supply switch. 4. The system according to claim 2, wherein the system is an image forming apparatus capable of forming an image. 5. A system comprising: the commercial AC power shutdown detecting apparatus according to claim 1; a backup power supply; various loads to which the commercial AC power supplies power; and a power supply switch to switch a power source from the commercial AC power supply to the backup power supply, to cause the backup power supply to supply power to a specific part if the commercial AC power shutdown detecting apparatus outputs the shutdown detection signal. 6. The system according to claim 5, wherein the system is an image forming apparatus capable of forming an image, and the specific part is a control panel of the image forming apparatus.

Provided is an audio encoding method. The audio encoding method includes: acquiring envelopes based on a predetermined sub-band for an audio spectrum; quantizing the envelopes based on the predetermined sub-band; and obtaining a difference value between quantized envelopes for adjacent sub-bands and lossless encoding a difference value of a current sub-band by using a difference value of a previous sub-band as a context. Accordingly, the number of bits required to encode envelope information of an audio spectrum may be reduced in a limited bit range, thereby increasing the number of bits required to encode an actual spectral component.

1. An audio encoding apparatus comprising: at least one processing device configured to: obtain an envelope of an audio spectrum by transforming an audio signal from a time domain to a frequency domain, where the audio spectrum comprises a plurality of sub-bands; quantize the envelope to obtain quantization indices including a quantization index of a previous sub-band and a quantization index of a current sub-band; obtain a differential quantization index of the current sub-band from the quantization index of a previous sub-band and the quantization index of a current sub-band; obtain a context of the current sub-band by using a differential quantization index of the previous sub-band; and lossless encode the differential quantization index of the current sub-band based on the context of the current sub-band. 2. The audio encoding apparatus of claim 1, wherein the envelope is one of average energy, average amplitude, power, and a norm value of a corresponding sub-band. 3. The audio encoding apparatus of claim 1, wherein the processing device is configured to lossless encode the differential quantization index of the current sub-band after adjusting the differential quantization index to have a specific range. 4. The audio encoding apparatus of claim 1, wherein the processing device is configured to lossless encode the differential quantization index of the current sub-band by grouping the differential quantization index corresponding to the context into one of a plurality of groups and performing Huffman coding on the differential quantization index of the current sub-band by using a Huffman table defined for each group. 5. The audio encoding apparatus of claim 1, wherein the processing device is configured to lossless encode the differential quantization index of the current sub-band by grouping the differential quantization index corresponding to the context into one of first to third groups and allocating two Huffman tables including a first Huffman table for the second group and a second Huffman table for sharing to the first and third groups. 6. The audio encoding apparatus of claim 5, wherein the processing device is configured to lossless encode the differential quantization index of the current sub-band by using the differential quantization index of the previous sub-band as it is or after reversing, as the context when the second Huffman table is shared. 7. The audio encoding apparatus of claim 1, wherein the processing device is configured to lossless encode the differential quantization index of the current sub-band by Huffman coding the quantization index as it is for a first sub-band for which a previous sub-band does not exist and performing Huffman coding on the differential quantization index of a second sub-band next to the first sub-band by using a difference between the quantization index of the first sub-band and a predetermined reference value as the context.

Provided is an audio encoding method. The audio encoding method includes: acquiring envelopes based on a predetermined sub-band for an audio spectrum; quantizing the envelopes based on the predetermined sub-band; and obtaining a difference value between quantized envelopes for adjacent sub-bands and lossless encoding a difference value of a current sub-band by using a difference value of a previous sub-band as a context. Accordingly, the number of bits required to encode envelope information of an audio spectrum may be reduced in a limited bit range, thereby increasing the number of bits required to encode an actual spectral component.1. An audio encoding apparatus comprising: at least one processing device configured to: obtain an envelope of an audio spectrum by transforming an audio signal from a time domain to a frequency domain, where the audio spectrum comprises a plurality of sub-bands; quantize the envelope to obtain quantization indices including a quantization index of a previous sub-band and a quantization index of a current sub-band; obtain a differential quantization index of the current sub-band from the quantization index of a previous sub-band and the quantization index of a current sub-band; obtain a context of the current sub-band by using a differential quantization index of the previous sub-band; and lossless encode the differential quantization index of the current sub-band based on the context of the current sub-band. 2. The audio encoding apparatus of claim 1, wherein the envelope is one of average energy, average amplitude, power, and a norm value of a corresponding sub-band. 3. The audio encoding apparatus of claim 1, wherein the processing device is configured to lossless encode the differential quantization index of the current sub-band after adjusting the differential quantization index to have a specific range. 4. The audio encoding apparatus of claim 1, wherein the processing device is configured to lossless encode the differential quantization index of the current sub-band by grouping the differential quantization index corresponding to the context into one of a plurality of groups and performing Huffman coding on the differential quantization index of the current sub-band by using a Huffman table defined for each group. 5. The audio encoding apparatus of claim 1, wherein the processing device is configured to lossless encode the differential quantization index of the current sub-band by grouping the differential quantization index corresponding to the context into one of first to third groups and allocating two Huffman tables including a first Huffman table for the second group and a second Huffman table for sharing to the first and third groups. 6. The audio encoding apparatus of claim 5, wherein the processing device is configured to lossless encode the differential quantization index of the current sub-band by using the differential quantization index of the previous sub-band as it is or after reversing, as the context when the second Huffman table is shared. 7. The audio encoding apparatus of claim 1, wherein the processing device is configured to lossless encode the differential quantization index of the current sub-band by Huffman coding the quantization index as it is for a first sub-band for which a previous sub-band does not exist and performing Huffman coding on the differential quantization index of a second sub-band next to the first sub-band by using a difference between the quantization index of the first sub-band and a predetermined reference value as the context.

Techniques for training a tokenizer (or word segmenter) are provided. In one technique, a tokenizer tokenizes a token string to identify individual tokens or words. A language model is generated based on the identified tokens or words. A vocabulary about an entity, such as a person or company, is identified. The vocabulary may be online data that refers to the entity, such as a news article or a profile page of a member of a social network. Some of the tokens in the vocabulary may be weighted higher than others. The language model accepts the weighted vocabulary as input and generates pseudo sentences. Alternatively, regular expressions are used to generate the pseudo sentences. The pseudo sentences are used to train the tokenizer.

1. A method comprising: identifying, in a profile of an entity in a social network, a name of the entity; automatically generating, based on the name of the entity, one or more sentences; based on the one or more sentences, training a tokenizer that is configured to identify tokens within a text string; wherein the method is performed by one or more computing devices. 2. The method of claim 1, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences using one or more regular expressions. 3. The method of claim 2, further comprising: selecting a particular regular expression from among a plurality of regular expressions; wherein the one or more regular expressions includes the particular regular expression and are fewer than the plurality of regular expressions. 4. The method of claim 3, further comprising: prior to generating the one or more sentences, storing type data in association with the name of the entity; wherein selecting the particular regular expression is performed based on the type data. 5. The method of claim 4, wherein the type data indicates a type of the name or a type of the entity. 6. The method of claim 1, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences based on context data. 7. The method of claim 6, wherein the context data include data from the profile of the entity. 8. The method of claim 1, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences to be segmented. 9. The method of claim 8, wherein: generating the one or more sentences comprises, for a sentence, of the one or more sentences, that comprises a plurality of tokens, labeling each token of the plurality of tokens; wherein a label of a token in the plurality of tokens indicates that the token is a beginning of a word. 10. The method of claim 1, wherein: automatically generating the one or more sentences comprises automatically generating a plurality of sentences; the method further comprising: performing an analysis of each sentence of the plurality of sentences; based on the analysis of a particular sentence in the plurality of sentences, filtering the particular sentence, wherein the particular sentence is not used to train the tokenizer. 11. The method of claim 1, wherein the name is of an organization. 12. A system comprising: one or more processors; one or more storage media storing instructions which, when executed by the one or more processors, cause: identifying, in a profile of an entity in a social network, a name of the entity; automatically generating, based on the name of the entity, one or more sentences; based on the one or more sentences, training a tokenizer that is configured to identify tokens within a text string. 13. The system of claim 12, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences using one or more regular expressions. 14. The system of claim 13, wherein the instructions, when executed by the one or more processors, further cause: selecting a particular regular expression from among a plurality of regular expressions; wherein the one or more regular expressions includes the particular regular expression and are fewer than the plurality of regular expressions. 15. The system of claim 14, wherein the instructions, when executed by the one or more processors, further cause: prior to generating the one or more sentences, storing type data in association with the name of the entity; wherein selecting the particular regular expression is performed based on the type data. 16. The system of claim 15, wherein the type data indicates a type of the name or a type of the entity. 17. The system of claim 12, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences based on context data. 18. The system of claim 17, wherein the context data include data from the profile of the entity. 19. The system of claim 12, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences to be segmented. 20. The system of claim 19, wherein: generating the one or more sentences comprises, for a sentence, of the one or more sentences, that comprises a plurality of tokens, labeling each token of the plurality of tokens; wherein a label of a token in the plurality of tokens indicates that the token is a beginning of a word. 21. The system of claim 12, wherein: automatically generating the one or more sentences comprises automatically generating a plurality of sentences; the instructions, when executed by the one or more processors, further cause: performing an analysis of each sentence of the plurality of sentences; based on the analysis of a particular sentence in the plurality of sentences, filtering the particular sentence, wherein the particular sentence is not used to train the tokenizer.

Techniques for training a tokenizer (or word segmenter) are provided. In one technique, a tokenizer tokenizes a token string to identify individual tokens or words. A language model is generated based on the identified tokens or words. A vocabulary about an entity, such as a person or company, is identified. The vocabulary may be online data that refers to the entity, such as a news article or a profile page of a member of a social network. Some of the tokens in the vocabulary may be weighted higher than others. The language model accepts the weighted vocabulary as input and generates pseudo sentences. Alternatively, regular expressions are used to generate the pseudo sentences. The pseudo sentences are used to train the tokenizer.1. A method comprising: identifying, in a profile of an entity in a social network, a name of the entity; automatically generating, based on the name of the entity, one or more sentences; based on the one or more sentences, training a tokenizer that is configured to identify tokens within a text string; wherein the method is performed by one or more computing devices. 2. The method of claim 1, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences using one or more regular expressions. 3. The method of claim 2, further comprising: selecting a particular regular expression from among a plurality of regular expressions; wherein the one or more regular expressions includes the particular regular expression and are fewer than the plurality of regular expressions. 4. The method of claim 3, further comprising: prior to generating the one or more sentences, storing type data in association with the name of the entity; wherein selecting the particular regular expression is performed based on the type data. 5. The method of claim 4, wherein the type data indicates a type of the name or a type of the entity. 6. The method of claim 1, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences based on context data. 7. The method of claim 6, wherein the context data include data from the profile of the entity. 8. The method of claim 1, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences to be segmented. 9. The method of claim 8, wherein: generating the one or more sentences comprises, for a sentence, of the one or more sentences, that comprises a plurality of tokens, labeling each token of the plurality of tokens; wherein a label of a token in the plurality of tokens indicates that the token is a beginning of a word. 10. The method of claim 1, wherein: automatically generating the one or more sentences comprises automatically generating a plurality of sentences; the method further comprising: performing an analysis of each sentence of the plurality of sentences; based on the analysis of a particular sentence in the plurality of sentences, filtering the particular sentence, wherein the particular sentence is not used to train the tokenizer. 11. The method of claim 1, wherein the name is of an organization. 12. A system comprising: one or more processors; one or more storage media storing instructions which, when executed by the one or more processors, cause: identifying, in a profile of an entity in a social network, a name of the entity; automatically generating, based on the name of the entity, one or more sentences; based on the one or more sentences, training a tokenizer that is configured to identify tokens within a text string. 13. The system of claim 12, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences using one or more regular expressions. 14. The system of claim 13, wherein the instructions, when executed by the one or more processors, further cause: selecting a particular regular expression from among a plurality of regular expressions; wherein the one or more regular expressions includes the particular regular expression and are fewer than the plurality of regular expressions. 15. The system of claim 14, wherein the instructions, when executed by the one or more processors, further cause: prior to generating the one or more sentences, storing type data in association with the name of the entity; wherein selecting the particular regular expression is performed based on the type data. 16. The system of claim 15, wherein the type data indicates a type of the name or a type of the entity. 17. The system of claim 12, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences based on context data. 18. The system of claim 17, wherein the context data include data from the profile of the entity. 19. The system of claim 12, wherein automatically generating the one or more sentences comprises automatically generating the one or more sentences to be segmented. 20. The system of claim 19, wherein: generating the one or more sentences comprises, for a sentence, of the one or more sentences, that comprises a plurality of tokens, labeling each token of the plurality of tokens; wherein a label of a token in the plurality of tokens indicates that the token is a beginning of a word. 21. The system of claim 12, wherein: automatically generating the one or more sentences comprises automatically generating a plurality of sentences; the instructions, when executed by the one or more processors, further cause: performing an analysis of each sentence of the plurality of sentences; based on the analysis of a particular sentence in the plurality of sentences, filtering the particular sentence, wherein the particular sentence is not used to train the tokenizer.

Systems and methods are provided for configuring media transport flow paths for directing input image receiving media, including of different types, in sheet or roll form from multiple axes to provide wider latitude in selecting particular input image receiving media and combinations of input image receiving media to support execution of a print job. The disclosed schemes are directed at using one or more stationary turn bars disposed generally at 45° in an input media transport path approaching a marking module in an image forming system to allow for sheets or sheeted materials to be positioned at 90° to the in-line input image receiving media transport path directed toward the marking module thus allowing for flexibility in selection among various sources of stacked, pallet and rolled media.

1. An image receiving media transport module, comprising: a first image receiving media substrate source; a second image receiving media substrate source; a first transport path for transporting image receiving media substrates from the first image receiving media source to a common output; a second transport path for transporting image receiving media substrates from the second image receiving media source to the common output, an exit portion of the first transport path upstream of the common output in a process direction and an exit portion of the second transport path upstream of the common output in the process direction being coincident, and at least one of the first transport path and the second transport path including a stationary turn bar arranged at 45° to the process direction upstream of the common output to align the exit portions of the first transport path and second transport path coincidentally with one another, the stationary turn bar having an outer surface; and at least one guide device associated with the stationary turn bar to guide the image receiving media substrates circulating around the stationary turn bar, the at least one guide device extending about the stationary turn bar to present the image receiving media substrates around the outer surface of the stationary turn bar. 2. The image receiving media transport module of claim 1, the image receiving media substrates approaching the stationary turn bar with a leading edge of the image receiving media substrates proceeding in a first direction, the image receiving media substrates circulating around the turn bar to exit the turn bar with the same leading edge proceeding in a second direction, the second direction being orthogonal to the first direction. 3. (canceled) 4. The image receiving media transport module of claim 1, the at least one guide device cooperating with the stationary turn bar to guide the image receiving media toward the stationary turn bar with a leading edge of the image receiving media substrates proceeding in a first direction and to exit guide the image receiving media substrates away from the stationary turn bar with the leading edge proceeding in a second direction, the second direction being orthogonal to the first direction. 5. The image receiving media transport module of claim 1, the at least one guide device being a fixed guide device. 6. The image receiving media transport module of claim 1, the at least one guide device being a belt guide device. 7. The image receiving media transport module of claim 6, the belt guide device being a pair of cooperating belts for sandwiching the image receiving media substrates in circulation around the stationary turn bar. 8. The image receiving media transport module of claim 1, the first image receiving media substrate source being in line with the exit portion of the first transport path making the first transport path an inline transport path from the first image receiving media substrate source to the common output. 9. The image receiving media transport module of claim 8, the second image receiving media substrate source being offset from the exit portion of the second transport path. 10. The image receiving media transport module of claim 9, the second image receiving media substrate source being positioned such that a first portion of the second transport path is orthogonal to the inline transport path, the stationary turn bar being arranged at 45° in the first portion to align a second portion of the second transport path with the inline transport path. 11. The image receiving media transport module of claim 9, the second image receiving media substrate source being positioned such that a first portion of the second transport path is parallel to the inline transport path, a first stationary turn bar being arranged at 45° in the first portion to align a second portion of the second transport path orthogonally to the inline transport path, and a second stationary turn bar being arranged at 45° in the second portion to align a third portion of the second transport path with the inline transport path. 12. The image receiving media transport module of claim 9, further comprising: at least a third image receiving media substrate source; and at least a third transport path for transporting image receiving media substrates from the third image receiving media substrate source to the common output, the third image receiving media substrate source being positioned such that a first portion of the third transport path is orthogonal to the inline transport path, another stationary turn bar being arranged at 45° in the first portion to align a second portion of the third transport path with the inline transport path. 13. The image receiving media transport module of claim 1, each of the first transport path and the second transport path including a stationary turn bar arranged at 45° to the process direction upstream of the common output to align the exit portions of the first transport path and second transport path coincidentally with one another. 14. The image receiving media transport module of claim 1, at least one of the first image receiving media substrate source and the second substrate source being one of a rolled media substrate source and a pallet substrate source. 15. The image receiving media transport module of claim 1, both of the first image receiving media substrate source and the second substrate source being rolled media substrate sources. 16. A method for transporting image receiving media in an image forming device, comprising: providing first image receiving media at a first image receiving media substrate source; providing second image receiving media at a second image receiving media substrate source; selectively transporting the first image receiving media along a first image receiving media transport path to an input of a marking engine; selectively transporting the second image receiving media along a second image receiving media transport path to the input of the marking engine, an exit portion of the first transport path upstream of the input to the media marking engine in a process direction and an exit portion of the second transport path upstream of the input to the media marking engine in the process direction being coincident with each other, and at least one of the first transport path and the second transport path including a stationary turn bar arranged at 45° to the process direction upstream of the input to the media marking engine to align the exit portions of the first transport path and second transport path coincidentally with each other; employing at least one guide device associated with the stationary turn bar to guide the first image receiving media and the second image receiving media circulating around the stationary turn bar, the at least one guide device extending about the stationary turn bar; and presenting the first image receiving media and the second image receiving media around an outer surface of the stationary turn bar to the input of the marking engine via the at least one guide device. 17. The method of claim 16, further comprising transporting the image receiving media substrates to the stationary turn bar with a leading edge of the image receiving media substrates proceeding in a first direction, the image receiving media substrates circulating around the turn bar to exit the turn bar with the same leading edge proceeding in a second direction, the second direction being orthogonal to the first direction. 18. (canceled) 19. The method of claim 16, the at least one guide device comprising a pair of cooperating belts, the method further comprising sandwiching the image receiving media substrates in circulation around the stationary turn bar between the pair of cooperating belts. 20. The method of claim 16, the first image receiving media substrate source being in line with the exit portion of the first transport path making the first transport path an inline transport path from the first image receiving media substrate source to the common output. 21. The method of claim 20, the second image receiving media substrate source being positioned such that a first portion of the second transport path is orthogonal to the inline transport path, the stationary turn bar being arranged at 45° in the first portion to align a second portion of the second transport path with the inline transport path. 22. The method of claim 21, further comprising: providing at least a third image receiving media substrate source, the image receiving media transport module including at least a third transport path for transporting image receiving media substrates from the third image receiving media substrate source to the common output; and selectively transporting third image receiving media from the third image receiving media substrate source, the third image receiving media source being positioned such that a first portion of the third transport path is orthogonal to the inline transport path, another stationary turn bar being arranged at 45° in the first portion to align a second portion of the third transport path with the inline transport path. 23. An image forming device, comprising: a first image receiving media substrate source; a second image receiving media substrate source; a marking module that deposits marking material on image receiving media substrates; and an image receiving media transport module, including: a common output aligned with an input of the marking module; a first transport path for transporting the image receiving media substrates from the first image receiving media source to the common output; a second transport path for transporting the image receiving media substrates from the second image receiving media source to the common output, an exit portion of the first transport path upstream of the common output in a process direction and an exit portion of the second transport path upstream of the common output in the process direction being coincident, and at least one of the first transport path and the second transport path including a stationary turn bar arranged at 45° to the process direction upstream of the common output to align the exit portions of the first transport path and second transport path coincidentally with one another, the stationary turn bar having an outer surface; and at least one guide device associated with the stationary turn bar to guide the image receiving media substrates circulating around the stationary turn bar, the at least one guide device extending about the stationary turn bar to present the image receiving media substrates around the outer surface of the stationary turn bar.

Systems and methods are provided for configuring media transport flow paths for directing input image receiving media, including of different types, in sheet or roll form from multiple axes to provide wider latitude in selecting particular input image receiving media and combinations of input image receiving media to support execution of a print job. The disclosed schemes are directed at using one or more stationary turn bars disposed generally at 45° in an input media transport path approaching a marking module in an image forming system to allow for sheets or sheeted materials to be positioned at 90° to the in-line input image receiving media transport path directed toward the marking module thus allowing for flexibility in selection among various sources of stacked, pallet and rolled media.1. An image receiving media transport module, comprising: a first image receiving media substrate source; a second image receiving media substrate source; a first transport path for transporting image receiving media substrates from the first image receiving media source to a common output; a second transport path for transporting image receiving media substrates from the second image receiving media source to the common output, an exit portion of the first transport path upstream of the common output in a process direction and an exit portion of the second transport path upstream of the common output in the process direction being coincident, and at least one of the first transport path and the second transport path including a stationary turn bar arranged at 45° to the process direction upstream of the common output to align the exit portions of the first transport path and second transport path coincidentally with one another, the stationary turn bar having an outer surface; and at least one guide device associated with the stationary turn bar to guide the image receiving media substrates circulating around the stationary turn bar, the at least one guide device extending about the stationary turn bar to present the image receiving media substrates around the outer surface of the stationary turn bar. 2. The image receiving media transport module of claim 1, the image receiving media substrates approaching the stationary turn bar with a leading edge of the image receiving media substrates proceeding in a first direction, the image receiving media substrates circulating around the turn bar to exit the turn bar with the same leading edge proceeding in a second direction, the second direction being orthogonal to the first direction. 3. (canceled) 4. The image receiving media transport module of claim 1, the at least one guide device cooperating with the stationary turn bar to guide the image receiving media toward the stationary turn bar with a leading edge of the image receiving media substrates proceeding in a first direction and to exit guide the image receiving media substrates away from the stationary turn bar with the leading edge proceeding in a second direction, the second direction being orthogonal to the first direction. 5. The image receiving media transport module of claim 1, the at least one guide device being a fixed guide device. 6. The image receiving media transport module of claim 1, the at least one guide device being a belt guide device. 7. The image receiving media transport module of claim 6, the belt guide device being a pair of cooperating belts for sandwiching the image receiving media substrates in circulation around the stationary turn bar. 8. The image receiving media transport module of claim 1, the first image receiving media substrate source being in line with the exit portion of the first transport path making the first transport path an inline transport path from the first image receiving media substrate source to the common output. 9. The image receiving media transport module of claim 8, the second image receiving media substrate source being offset from the exit portion of the second transport path. 10. The image receiving media transport module of claim 9, the second image receiving media substrate source being positioned such that a first portion of the second transport path is orthogonal to the inline transport path, the stationary turn bar being arranged at 45° in the first portion to align a second portion of the second transport path with the inline transport path. 11. The image receiving media transport module of claim 9, the second image receiving media substrate source being positioned such that a first portion of the second transport path is parallel to the inline transport path, a first stationary turn bar being arranged at 45° in the first portion to align a second portion of the second transport path orthogonally to the inline transport path, and a second stationary turn bar being arranged at 45° in the second portion to align a third portion of the second transport path with the inline transport path. 12. The image receiving media transport module of claim 9, further comprising: at least a third image receiving media substrate source; and at least a third transport path for transporting image receiving media substrates from the third image receiving media substrate source to the common output, the third image receiving media substrate source being positioned such that a first portion of the third transport path is orthogonal to the inline transport path, another stationary turn bar being arranged at 45° in the first portion to align a second portion of the third transport path with the inline transport path. 13. The image receiving media transport module of claim 1, each of the first transport path and the second transport path including a stationary turn bar arranged at 45° to the process direction upstream of the common output to align the exit portions of the first transport path and second transport path coincidentally with one another. 14. The image receiving media transport module of claim 1, at least one of the first image receiving media substrate source and the second substrate source being one of a rolled media substrate source and a pallet substrate source. 15. The image receiving media transport module of claim 1, both of the first image receiving media substrate source and the second substrate source being rolled media substrate sources. 16. A method for transporting image receiving media in an image forming device, comprising: providing first image receiving media at a first image receiving media substrate source; providing second image receiving media at a second image receiving media substrate source; selectively transporting the first image receiving media along a first image receiving media transport path to an input of a marking engine; selectively transporting the second image receiving media along a second image receiving media transport path to the input of the marking engine, an exit portion of the first transport path upstream of the input to the media marking engine in a process direction and an exit portion of the second transport path upstream of the input to the media marking engine in the process direction being coincident with each other, and at least one of the first transport path and the second transport path including a stationary turn bar arranged at 45° to the process direction upstream of the input to the media marking engine to align the exit portions of the first transport path and second transport path coincidentally with each other; employing at least one guide device associated with the stationary turn bar to guide the first image receiving media and the second image receiving media circulating around the stationary turn bar, the at least one guide device extending about the stationary turn bar; and presenting the first image receiving media and the second image receiving media around an outer surface of the stationary turn bar to the input of the marking engine via the at least one guide device. 17. The method of claim 16, further comprising transporting the image receiving media substrates to the stationary turn bar with a leading edge of the image receiving media substrates proceeding in a first direction, the image receiving media substrates circulating around the turn bar to exit the turn bar with the same leading edge proceeding in a second direction, the second direction being orthogonal to the first direction. 18. (canceled) 19. The method of claim 16, the at least one guide device comprising a pair of cooperating belts, the method further comprising sandwiching the image receiving media substrates in circulation around the stationary turn bar between the pair of cooperating belts. 20. The method of claim 16, the first image receiving media substrate source being in line with the exit portion of the first transport path making the first transport path an inline transport path from the first image receiving media substrate source to the common output. 21. The method of claim 20, the second image receiving media substrate source being positioned such that a first portion of the second transport path is orthogonal to the inline transport path, the stationary turn bar being arranged at 45° in the first portion to align a second portion of the second transport path with the inline transport path. 22. The method of claim 21, further comprising: providing at least a third image receiving media substrate source, the image receiving media transport module including at least a third transport path for transporting image receiving media substrates from the third image receiving media substrate source to the common output; and selectively transporting third image receiving media from the third image receiving media substrate source, the third image receiving media source being positioned such that a first portion of the third transport path is orthogonal to the inline transport path, another stationary turn bar being arranged at 45° in the first portion to align a second portion of the third transport path with the inline transport path. 23. An image forming device, comprising: a first image receiving media substrate source; a second image receiving media substrate source; a marking module that deposits marking material on image receiving media substrates; and an image receiving media transport module, including: a common output aligned with an input of the marking module; a first transport path for transporting the image receiving media substrates from the first image receiving media source to the common output; a second transport path for transporting the image receiving media substrates from the second image receiving media source to the common output, an exit portion of the first transport path upstream of the common output in a process direction and an exit portion of the second transport path upstream of the common output in the process direction being coincident, and at least one of the first transport path and the second transport path including a stationary turn bar arranged at 45° to the process direction upstream of the common output to align the exit portions of the first transport path and second transport path coincidentally with one another, the stationary turn bar having an outer surface; and at least one guide device associated with the stationary turn bar to guide the image receiving media substrates circulating around the stationary turn bar, the at least one guide device extending about the stationary turn bar to present the image receiving media substrates around the outer surface of the stationary turn bar.

A document processing system provides a double check before allowing destruction of a physical document. A user scans a unique identifier on the physical document at a first location, receives verification the document should be destroyed, and places the document in a container for documents to be destroyed. At a second location, a user scans the unique identifier on the document and receives verification the document should be destroyed. The physical document may then be destroyed.

1. A computer-implemented method for verifying physical documents should be destroyed, the method comprising: receiving a first scan of a unique identifier on the document at a first location; providing first verification at the first location the document should be destroyed; receiving a second scan of the unique identifier on the document at a second location; and providing second verification at the second location the document should be destroyed. 2. The method of claim 1 further comprising: a user defining metadata corresponding to the physical document during a reservation session for the physical document, where the metadata includes the unique identifier of a label that is applied to the physical document and further includes a disposition policy for the physical document. 3. The method of claim 2 further comprising: providing a notification that the physical document should be destroyed when the disposition policy for the physical document that was specified by the user during the reservation session for the physical document is satisfied. 4. The method of claim 3 wherein the disposition policy comprises a default disposition policy. 5. The method of claim 3 wherein the disposition policy comprises one of multiple default disposition policies that each correspond to a defined document type. 6. The method of claim 1 further comprising the step of destroying the physical document in response to receiving the second verification at the second location. 7. The method of claim 1 further comprising: creating a reservation for the physical document; specifying in the reservation for the physical document metadata corresponding to the physical document, where the metadata includes a unique identifier of a label that is applied to the physical document and further includes a specified disposition policy for the physical document; applying the label to the physical document; scanning the physical document to generate an electronic document corresponding to the physical document; reading the unique identifier of the label in the electronic document; linking the electronic document with the reservation for the physical document based on the unique identifier of the label; and storing the electronic document in a database. 8. An apparatus comprising: at least one processor; a memory coupled to the at least one processor; a document processing system residing in the memory and executed by the at least one processor, the document processing system comprising: a document disposition mechanism that schedules disposition of a physical document according to a specified disposition policy for the physical document, provides a notification when the physical document should be destroyed according to the specified disposition policy for the physical document, and in response to the notification, prompts a user to retrieve the physical document to a first location, receives a first scan in the first location of a unique identifier on the label on the physical document, and in response to the first scan, provides a first prompt at the first location that verifies the physical document should be destroyed, receives a scan in a second location of the unique identifier on the label on the physical document, and in response to the second scan, provides a second prompt at the second location that verifies the physical document should be destroyed. 9. The apparatus of claim 8 wherein the specified disposition policy for the physical document is specified in metadata by a user during a reservation session for the physical document. 10. The apparatus of claim 8 wherein the document disposition mechanism allows a user to define metadata corresponding to the physical document during a reservation session for the physical document, where the metadata includes the unique identifier of a label that is applied to the physical document and further includes the specified disposition policy for the physical document. 11. The apparatus of claim 8 wherein the document disposition mechanism provides the notification that the physical document should be destroyed according to the specified disposition policy for the physical document that was specified by the user during the reservation session for the physical document. 12. The apparatus of claim 8 wherein the specified disposition policy comprises a default disposition policy. 13. The apparatus of claim 8 wherein the specified disposition policy comprises one of multiple default disposition policies that each correspond to a defined document type. 14. The apparatus of claim 8 wherein after the first scan the document disposition mechanism provides a prompt to place the physical document in a container of documents to be destroyed that is transported to the second location. 15. The apparatus of claim 14 wherein the second scan is performed by a person who retrieves the physical document from the container of documents to be destroyed to verify the document should be destroyed before destroying the document at the second location.

A document processing system provides a double check before allowing destruction of a physical document. A user scans a unique identifier on the physical document at a first location, receives verification the document should be destroyed, and places the document in a container for documents to be destroyed. At a second location, a user scans the unique identifier on the document and receives verification the document should be destroyed. The physical document may then be destroyed.1. A computer-implemented method for verifying physical documents should be destroyed, the method comprising: receiving a first scan of a unique identifier on the document at a first location; providing first verification at the first location the document should be destroyed; receiving a second scan of the unique identifier on the document at a second location; and providing second verification at the second location the document should be destroyed. 2. The method of claim 1 further comprising: a user defining metadata corresponding to the physical document during a reservation session for the physical document, where the metadata includes the unique identifier of a label that is applied to the physical document and further includes a disposition policy for the physical document. 3. The method of claim 2 further comprising: providing a notification that the physical document should be destroyed when the disposition policy for the physical document that was specified by the user during the reservation session for the physical document is satisfied. 4. The method of claim 3 wherein the disposition policy comprises a default disposition policy. 5. The method of claim 3 wherein the disposition policy comprises one of multiple default disposition policies that each correspond to a defined document type. 6. The method of claim 1 further comprising the step of destroying the physical document in response to receiving the second verification at the second location. 7. The method of claim 1 further comprising: creating a reservation for the physical document; specifying in the reservation for the physical document metadata corresponding to the physical document, where the metadata includes a unique identifier of a label that is applied to the physical document and further includes a specified disposition policy for the physical document; applying the label to the physical document; scanning the physical document to generate an electronic document corresponding to the physical document; reading the unique identifier of the label in the electronic document; linking the electronic document with the reservation for the physical document based on the unique identifier of the label; and storing the electronic document in a database. 8. An apparatus comprising: at least one processor; a memory coupled to the at least one processor; a document processing system residing in the memory and executed by the at least one processor, the document processing system comprising: a document disposition mechanism that schedules disposition of a physical document according to a specified disposition policy for the physical document, provides a notification when the physical document should be destroyed according to the specified disposition policy for the physical document, and in response to the notification, prompts a user to retrieve the physical document to a first location, receives a first scan in the first location of a unique identifier on the label on the physical document, and in response to the first scan, provides a first prompt at the first location that verifies the physical document should be destroyed, receives a scan in a second location of the unique identifier on the label on the physical document, and in response to the second scan, provides a second prompt at the second location that verifies the physical document should be destroyed. 9. The apparatus of claim 8 wherein the specified disposition policy for the physical document is specified in metadata by a user during a reservation session for the physical document. 10. The apparatus of claim 8 wherein the document disposition mechanism allows a user to define metadata corresponding to the physical document during a reservation session for the physical document, where the metadata includes the unique identifier of a label that is applied to the physical document and further includes the specified disposition policy for the physical document. 11. The apparatus of claim 8 wherein the document disposition mechanism provides the notification that the physical document should be destroyed according to the specified disposition policy for the physical document that was specified by the user during the reservation session for the physical document. 12. The apparatus of claim 8 wherein the specified disposition policy comprises a default disposition policy. 13. The apparatus of claim 8 wherein the specified disposition policy comprises one of multiple default disposition policies that each correspond to a defined document type. 14. The apparatus of claim 8 wherein after the first scan the document disposition mechanism provides a prompt to place the physical document in a container of documents to be destroyed that is transported to the second location. 15. The apparatus of claim 14 wherein the second scan is performed by a person who retrieves the physical document from the container of documents to be destroyed to verify the document should be destroyed before destroying the document at the second location.

When the generation of intermediate data of the following page is completed before the generation of intermediate data of the preceding page, the rasterization of the intermediate data of the following page is performed after completion of the generation and rasterization of the intermediate data of the preceding page.

1. An image forming apparatus comprising: a receiving unit configured to receive PDL data including a plurality of pages; a plurality of processing units configured to generate, on a page basis, intermediate data of the plurality of pages based on the PDL data; a rasterizing unit configured to rasterize the intermediate data of the plurality of pages generated by the plurality of processing units; and a printing unit configured to print the rasterized pages, wherein, in a case where generation of intermediate data of a following page is completed before generation of intermediate data of a preceding page, a rasterization of the intermediate data of the following page by the rasterizing unit is controlled so that the rasterization of the intermediate data of the following page is delayed until the generation and rasterization of the intermediate data of the preceding page are completed. 2. The image forming apparatus according to claim 1, wherein, in the case where the generation of the intermediate data of the following page is completed before the generation of the intermediate data of the preceding page, the rasterizing unit suspends the rasterization of the intermediate data of the following page, and, before the rasterization of the intermediate data of the following page, completes the rasterization of the intermediate data of the preceding page which has been generated after the intermediate data of the following page. 3. The image forming apparatus according to claim 1, wherein the plurality of processing units generates intermediate data of respective different pages. 4. The image forming apparatus according to claim 1, further comprising a management unit configured to manage a page number, intermediate data of a page with the page number being to be rasterized by the rasterizing unit, wherein, in a case where the generation of the intermediate data of the following page is completed before a generation of the intermediate data of the page with the page number managed by the management unit, the rasterizing unit delays the rasterization of the intermediate data of the following page till completion of a generation and a rasterization of intermediate data of each of pages from the page with the page number to a page immediately before the following page. 5. The image forming apparatus according to claim 1, further comprising a memory area having a predetermined data size, configured to store the intermediate data of respective pages generated by the plurality of processing units, wherein at least one of the plurality of processing units is controlled to suspend a generation of intermediate data of remaining pages based on a free capacity of the memory area. 6. The image forming apparatus according to claim 5, wherein, in a case where the free capacity of the memory area is smaller than a threshold value, the at least one processing unit is controlled to suspend the generation of the intermediate data of the remaining pages. 7. The image forming apparatus according to claim 1, wherein at least one of the processing units is controlled to suspend a generation of intermediate data of remaining pages based on an amount of unrasterized intermediate data out of generated intermediate data of pages. 8. The image forming apparatus according to claim 7, wherein the amount is a total size of the unrasterized intermediate data out of the generated intermediate data of the pages or a number of pages of the unrasterized intermediate data out of the generated intermediate data of the pages, and wherein, in a case where the amount is equal to or greater than a threshold value, the at least one processing unit is controlled to suspend the generation of the intermediate data of the remaining pages. 9. The image forming apparatus according to claim 1, wherein the rasterization unit comprises: a first unit configured to perform, by using intermediate data of one page, a rasterization for a first area in the page; and a second unit configured to perform, by using the intermediate data, a rasterization for a second area in the page, different from the first area in parallel with the rasterization for the first area. 10. The image forming apparatus according to claim 1, wherein the rasterization unit comprises: a first unit configured to perform, by using intermediate data of a first page, a rasterization for the first page; and a second unit configured to perform, by using intermediate data of a second page different from the first page, a rasterization for the second page in parallel with the rasterization for the first page. 11. The image forming apparatus according to claim 1, wherein, when generating intermediate data based on the PDL data on a page basis, the plurality of processing units performs: parallelly generating, for a predetermined page of the PDL data, intermediate data of objects included in the page by using a plurality of the processing units; and parallelly generating, for a page other than the predetermined page, intermediate data of objects included in the page by using a different processing unit on a page basis. 12. The image forming apparatus according to claim 11, wherein, for the predetermined page, one of the plurality of processing units interprets PDL data of objects included in the page, and wherein, for the predetermined page, another one of the plurality of processing units generates intermediate data of the objects based on an interpretation result. 13. The image forming apparatus according to claim 12, wherein, for the predetermined page, the one processing unit transmits the interpretation result to a buffer from a memory in which the interpretation result is stored, and wherein, for the predetermined page, the another processing unit acquires the interpretation result transmitted to the buffer, and generates the intermediate data. 14. The image forming apparatus according to claim 13, wherein, for the page other than the predetermined page, the one processing unit interprets PDL data of objects included in a certain page, and generates intermediate data of the objects based on an interpretation result, and wherein, for the page other than the predetermined page, the another processing unit interprets PDL data of objects included in another page, and generates intermediate data of the objects based on an interpretation result. 15. The image forming apparatus according to claim 14, wherein, for the page other than the predetermined page, the one processing unit acquires the interpretation result without the transmission from the memory in which the interpretation result is stored, and generates the intermediate data. 16. The image forming apparatus according to claim 11, wherein, in a case where a total number of pages of the received PDL data is determined to be one, the plurality of processing units handles all pages included in the PDL data as the predetermined page. 17. The image forming apparatus according to claim 11, wherein, in a case where a total number of pages of the received PDL data is determined to be more than one, the plurality of processing units handles all pages included in the PDL data as the page other than the predetermined page. 18. The image forming apparatus according to claim 16, wherein the total number of pages is acquired upon interruption of the received PDL data. 19. The image forming apparatus according to claim 16, wherein the total number of pages is regarded as one upon determination of a PDL type of the received PDL data. 20. The image forming apparatus according to claim 11, further comprising a determination unit configured to determine whether to handle all pages included in the PDL data as the predetermined page or as the page other than the predetermined page, based on a PDL type of the received PDL data. 21. The image forming apparatus according to claim 11, wherein the predetermined page is a starting page of the PDL data. 22. A method for controlling an image forming apparatus having a plurality of processing units, the method comprising: receiving PDL data including a plurality of pages; controlling the plurality of respective different processing units to generate, on a page basis, intermediate data of the plurality of pages based on the PDL data; rasterizing, on a page basis, the generated intermediate data of the plurality of pages; and printing the rasterized pages by using a printer engine, wherein, in a case where a generation of intermediate data of a following page is completed before a generation of intermediate data of a preceding page, the controlling delays a rasterization of the intermediate data of the following page by the rasterizing until the generation and a rasterization of the intermediate data of the preceding page are completed.

When the generation of intermediate data of the following page is completed before the generation of intermediate data of the preceding page, the rasterization of the intermediate data of the following page is performed after completion of the generation and rasterization of the intermediate data of the preceding page.1. An image forming apparatus comprising: a receiving unit configured to receive PDL data including a plurality of pages; a plurality of processing units configured to generate, on a page basis, intermediate data of the plurality of pages based on the PDL data; a rasterizing unit configured to rasterize the intermediate data of the plurality of pages generated by the plurality of processing units; and a printing unit configured to print the rasterized pages, wherein, in a case where generation of intermediate data of a following page is completed before generation of intermediate data of a preceding page, a rasterization of the intermediate data of the following page by the rasterizing unit is controlled so that the rasterization of the intermediate data of the following page is delayed until the generation and rasterization of the intermediate data of the preceding page are completed. 2. The image forming apparatus according to claim 1, wherein, in the case where the generation of the intermediate data of the following page is completed before the generation of the intermediate data of the preceding page, the rasterizing unit suspends the rasterization of the intermediate data of the following page, and, before the rasterization of the intermediate data of the following page, completes the rasterization of the intermediate data of the preceding page which has been generated after the intermediate data of the following page. 3. The image forming apparatus according to claim 1, wherein the plurality of processing units generates intermediate data of respective different pages. 4. The image forming apparatus according to claim 1, further comprising a management unit configured to manage a page number, intermediate data of a page with the page number being to be rasterized by the rasterizing unit, wherein, in a case where the generation of the intermediate data of the following page is completed before a generation of the intermediate data of the page with the page number managed by the management unit, the rasterizing unit delays the rasterization of the intermediate data of the following page till completion of a generation and a rasterization of intermediate data of each of pages from the page with the page number to a page immediately before the following page. 5. The image forming apparatus according to claim 1, further comprising a memory area having a predetermined data size, configured to store the intermediate data of respective pages generated by the plurality of processing units, wherein at least one of the plurality of processing units is controlled to suspend a generation of intermediate data of remaining pages based on a free capacity of the memory area. 6. The image forming apparatus according to claim 5, wherein, in a case where the free capacity of the memory area is smaller than a threshold value, the at least one processing unit is controlled to suspend the generation of the intermediate data of the remaining pages. 7. The image forming apparatus according to claim 1, wherein at least one of the processing units is controlled to suspend a generation of intermediate data of remaining pages based on an amount of unrasterized intermediate data out of generated intermediate data of pages. 8. The image forming apparatus according to claim 7, wherein the amount is a total size of the unrasterized intermediate data out of the generated intermediate data of the pages or a number of pages of the unrasterized intermediate data out of the generated intermediate data of the pages, and wherein, in a case where the amount is equal to or greater than a threshold value, the at least one processing unit is controlled to suspend the generation of the intermediate data of the remaining pages. 9. The image forming apparatus according to claim 1, wherein the rasterization unit comprises: a first unit configured to perform, by using intermediate data of one page, a rasterization for a first area in the page; and a second unit configured to perform, by using the intermediate data, a rasterization for a second area in the page, different from the first area in parallel with the rasterization for the first area. 10. The image forming apparatus according to claim 1, wherein the rasterization unit comprises: a first unit configured to perform, by using intermediate data of a first page, a rasterization for the first page; and a second unit configured to perform, by using intermediate data of a second page different from the first page, a rasterization for the second page in parallel with the rasterization for the first page. 11. The image forming apparatus according to claim 1, wherein, when generating intermediate data based on the PDL data on a page basis, the plurality of processing units performs: parallelly generating, for a predetermined page of the PDL data, intermediate data of objects included in the page by using a plurality of the processing units; and parallelly generating, for a page other than the predetermined page, intermediate data of objects included in the page by using a different processing unit on a page basis. 12. The image forming apparatus according to claim 11, wherein, for the predetermined page, one of the plurality of processing units interprets PDL data of objects included in the page, and wherein, for the predetermined page, another one of the plurality of processing units generates intermediate data of the objects based on an interpretation result. 13. The image forming apparatus according to claim 12, wherein, for the predetermined page, the one processing unit transmits the interpretation result to a buffer from a memory in which the interpretation result is stored, and wherein, for the predetermined page, the another processing unit acquires the interpretation result transmitted to the buffer, and generates the intermediate data. 14. The image forming apparatus according to claim 13, wherein, for the page other than the predetermined page, the one processing unit interprets PDL data of objects included in a certain page, and generates intermediate data of the objects based on an interpretation result, and wherein, for the page other than the predetermined page, the another processing unit interprets PDL data of objects included in another page, and generates intermediate data of the objects based on an interpretation result. 15. The image forming apparatus according to claim 14, wherein, for the page other than the predetermined page, the one processing unit acquires the interpretation result without the transmission from the memory in which the interpretation result is stored, and generates the intermediate data. 16. The image forming apparatus according to claim 11, wherein, in a case where a total number of pages of the received PDL data is determined to be one, the plurality of processing units handles all pages included in the PDL data as the predetermined page. 17. The image forming apparatus according to claim 11, wherein, in a case where a total number of pages of the received PDL data is determined to be more than one, the plurality of processing units handles all pages included in the PDL data as the page other than the predetermined page. 18. The image forming apparatus according to claim 16, wherein the total number of pages is acquired upon interruption of the received PDL data. 19. The image forming apparatus according to claim 16, wherein the total number of pages is regarded as one upon determination of a PDL type of the received PDL data. 20. The image forming apparatus according to claim 11, further comprising a determination unit configured to determine whether to handle all pages included in the PDL data as the predetermined page or as the page other than the predetermined page, based on a PDL type of the received PDL data. 21. The image forming apparatus according to claim 11, wherein the predetermined page is a starting page of the PDL data. 22. A method for controlling an image forming apparatus having a plurality of processing units, the method comprising: receiving PDL data including a plurality of pages; controlling the plurality of respective different processing units to generate, on a page basis, intermediate data of the plurality of pages based on the PDL data; rasterizing, on a page basis, the generated intermediate data of the plurality of pages; and printing the rasterized pages by using a printer engine, wherein, in a case where a generation of intermediate data of a following page is completed before a generation of intermediate data of a preceding page, the controlling delays a rasterization of the intermediate data of the following page by the rasterizing until the generation and a rasterization of the intermediate data of the preceding page are completed.

An image forming apparatus which is capable of quickly switching the power mode of the image forming apparatus from the power saving mode to the normal mode. The image forming apparatus includes a printer engine and operates in a normal mode and a power saving mode, the image forming apparatus further includes a main system, a sub system communicably connected with the main system, and an engine controller communicably connected with the sub system and configured to control the printer engine. When the image forming apparatus returns from the power saving mode to the normal mode, the sub system completes start-up of software necessary for communication between the sub system and the engine controller before starting software necessary for communication between the main system and the sub system is completed, and transmits, to the engine controller, device information of the image forming apparatus acquired from the main system.

1. An image forming apparatus that includes a printer engine and operates in a normal mode and a power saving mode, the image forming apparatus comprising: a main system; a sub system communicably connected with the main system; and an engine controller communicably connected with the sub system and configured to control the printer engine, wherein when the image forming apparatus returns from the power saving mode to the normal mode, the sub system completes start-up of software necessary for communication between the sub system and the engine controller before starting software necessary for communication between the main system and the sub system is completed, and transmits, to the engine controller, device information of the image forming apparatus acquired from the main system. 2. The image forming apparatus according to claim 1, wherein when the image forming apparatus returns from the power saving mode to the normal mode, the main system transmits, to the sub system, a start-up program of the sub system together with the device information of the image information apparatus. 3. The image forming apparatus according to claim 1, wherein the device information is information based on which the engine controller controls the printer engine. 4. A control method for an image forming apparatus that includes a printer engine and operates in a normal mode and a power saving mode, the image forming apparatus comprising a main system, a sub system communicably connected with the main system, and an engine controller communicably connected with the sub system and configured to control the printer engine, the control method comprising: a step of, when the image forming apparatus returns from the power saving mode to the normal mode, the sub system completing start-up of software necessary for communication between the sub system and the engine controller before starting software necessary for communication between the main system and the sub system is completed, and transmitting, to the engine controller, device information of the image forming apparatus acquired from the main system. 5. The control method for the image forming apparatus according to claim 4, wherein when the image forming apparatus returns from the power saving mode to the normal mode, the main system transmits, to the sub system, a start-up program of the sub system together with the device information of the image information apparatus. 6. The control method for the image forming apparatus according to claim 4, wherein the device information is information based on which the engine controller controls the printer engine. 7. A computer-readable non-transitory storage medium storing a program for causing a computer to execute a control method for an image forming apparatus that includes a printer engine and operates in a normal mode and a power saving mode, the image forming apparatus comprising a main system, a sub system communicably connected with the main system, and an engine controller communicably connected with the sub system and configured to control the printer engine, the control method comprising: a step of, when the image forming apparatus returns from the power saving mode to the normal mode, the sub system completing start-up of software necessary for communication between the sub system and the engine controller before starting software necessary for communication between the main system and the sub system is completed, and transmitting, to the engine controller, device information of the image forming apparatus acquired from the main system. 8. The computer-readable non-transitory storage medium according to claim 7, wherein when the image forming apparatus returns from the power saving mode to the normal mode, the main system transmits, to the sub system, a start-up program of the sub system together with the device information of the image information apparatus. 9. The computer-readable non-transitory storage medium according to claim 7, wherein the device information is information based on which the engine controller controls the printer engine.

An image forming apparatus which is capable of quickly switching the power mode of the image forming apparatus from the power saving mode to the normal mode. The image forming apparatus includes a printer engine and operates in a normal mode and a power saving mode, the image forming apparatus further includes a main system, a sub system communicably connected with the main system, and an engine controller communicably connected with the sub system and configured to control the printer engine. When the image forming apparatus returns from the power saving mode to the normal mode, the sub system completes start-up of software necessary for communication between the sub system and the engine controller before starting software necessary for communication between the main system and the sub system is completed, and transmits, to the engine controller, device information of the image forming apparatus acquired from the main system.1. An image forming apparatus that includes a printer engine and operates in a normal mode and a power saving mode, the image forming apparatus comprising: a main system; a sub system communicably connected with the main system; and an engine controller communicably connected with the sub system and configured to control the printer engine, wherein when the image forming apparatus returns from the power saving mode to the normal mode, the sub system completes start-up of software necessary for communication between the sub system and the engine controller before starting software necessary for communication between the main system and the sub system is completed, and transmits, to the engine controller, device information of the image forming apparatus acquired from the main system. 2. The image forming apparatus according to claim 1, wherein when the image forming apparatus returns from the power saving mode to the normal mode, the main system transmits, to the sub system, a start-up program of the sub system together with the device information of the image information apparatus. 3. The image forming apparatus according to claim 1, wherein the device information is information based on which the engine controller controls the printer engine. 4. A control method for an image forming apparatus that includes a printer engine and operates in a normal mode and a power saving mode, the image forming apparatus comprising a main system, a sub system communicably connected with the main system, and an engine controller communicably connected with the sub system and configured to control the printer engine, the control method comprising: a step of, when the image forming apparatus returns from the power saving mode to the normal mode, the sub system completing start-up of software necessary for communication between the sub system and the engine controller before starting software necessary for communication between the main system and the sub system is completed, and transmitting, to the engine controller, device information of the image forming apparatus acquired from the main system. 5. The control method for the image forming apparatus according to claim 4, wherein when the image forming apparatus returns from the power saving mode to the normal mode, the main system transmits, to the sub system, a start-up program of the sub system together with the device information of the image information apparatus. 6. The control method for the image forming apparatus according to claim 4, wherein the device information is information based on which the engine controller controls the printer engine. 7. A computer-readable non-transitory storage medium storing a program for causing a computer to execute a control method for an image forming apparatus that includes a printer engine and operates in a normal mode and a power saving mode, the image forming apparatus comprising a main system, a sub system communicably connected with the main system, and an engine controller communicably connected with the sub system and configured to control the printer engine, the control method comprising: a step of, when the image forming apparatus returns from the power saving mode to the normal mode, the sub system completing start-up of software necessary for communication between the sub system and the engine controller before starting software necessary for communication between the main system and the sub system is completed, and transmitting, to the engine controller, device information of the image forming apparatus acquired from the main system. 8. The computer-readable non-transitory storage medium according to claim 7, wherein when the image forming apparatus returns from the power saving mode to the normal mode, the main system transmits, to the sub system, a start-up program of the sub system together with the device information of the image information apparatus. 9. The computer-readable non-transitory storage medium according to claim 7, wherein the device information is information based on which the engine controller controls the printer engine.

A process, machine-readable instructions, and a system are described in which two communication sessions are attempted to be established between a client application and an image processing apparatus. In some examples, the first communication session is permitted while delaying the operation of the second communication session until the first communication session has completed.

1. A non-transitory machine-readable medium storing instructions that, when executed by a processor, cause an information processing apparatus connected to an image processing apparatus via a communication interface to: in response to a first request for establishment of a first session by a client application that performs multi-session communication, establish the first session between a communication relay program and the client application; in response to a second request for establishment of a second session by the client application that performs multi-session communication, establish the second session between the communication relay program and the client application; perform a first communication process over the first session and prohibit a second communication process over the second session while both the first session and the second session are established, wherein a first communication is relayed between the client application and the image processing apparatus in the first communication process; and upon completion of the first communication process over the first session, perform the second communication process over the second session, wherein a second communication is relayed between the client application and the image processing apparatus in the second communication process. 2. The non-transitory machine-readable medium according to claim 1, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: after the first session has been established, determine whether the first communication over the first session is permitted; and perform the first communication process over the first session when the first communication over the first session is permitted. 3. The non-transitory machine-readable medium according to claim 1, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: in response to the first request, generate a first thread for establishing the first session between the communication relay program and the client application; in response to the second request, generate a second thread for establishing the second session between the communication relay program and the client application; generate a Mutex; before performing the first communication process over the first session, request an ownership of the Mutex by the first thread; obtain the ownership of the Mutex by the first thread if the ownership of the Mutex is not obtained by the second thread; after obtaining the ownership of the Mutex by the first thread, perform the first communication process over the first session and wait for the ownership of the Mutex by the second thread; and upon completion of the first communication process over the first session, release the ownership of the Mutex by the first thread. 4. The non-transitory machine-readable medium according to claim 1, wherein the communication includes one request and one response corresponding to the request, and wherein the instructions, when executed by the processor, further cause the information processing apparatus to determine that relaying of communication through the first session is completed when relaying of a pair of the request and the response is completed. 5. The non-transitory machine-readable medium according to claim 1, wherein the communication interface is configured to connect a Universal Serial Bus cable. 6. The non-transitory machine-readable medium according to claim 1, wherein the image processing apparatus includes a web server function unit, wherein the client application is a web browser, and wherein communication data is relayed for transmission and reception between the web browser and the web server function unit. 7. The non-transitory machine-readable medium according to claim 1, wherein the communication is communication for configuring for the image processing apparatus from the client application. 8. The non-transitory machine-readable medium according to claim 1, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: when receiving a request from the client application, transmit the request to the image processing apparatus and when receiving a response from the image processing apparatus, transmit the response to the client application, the response corresponding to the request, each of the request and the response includes a plurality of communication data; analyze communication data received from the client application and determine whether the communication data received from the client application indicates the end of the request; analyze communication data received from the image processing apparatus and determine whether the communication data received from the image processing apparatus indicates the end of the response; determine that reception of the request is completed where determined that the communication data received from the client application indicates the end of the request; and determine that reception of the response is completed where determined that the communication data received from the image processing apparatus indicates the end of the response. 9. The non-transitory machine-readable medium according to claim 1, wherein the instructions that, when executed by the processor, cause the information processing apparatus to: when receiving a request from the client application, transmit the request to the image processing apparatus and when receiving a response from the image processing apparatus, transmit the response to the client application, the response corresponding to the request, the request includes a plurality of communication data; provisionally determine that reception of the request from the client application is completed where communication data is not received for at least a first predetermined time after the last communication data has been received from the client application; determine that reception of the request from the client application is not completed where the response is not received from the image processing apparatus within a second predetermined time after the request has been transmitted to the image processing apparatus; and receive the rest of the communication data from the client application when it is determined that reception of the request from the client application is not completed. 10. The non-transitory machine-readable medium according to claim 9, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: inquire to the image processing apparatus as to whether transmission of the response is completed; and determine that reception of the response from the image processing apparatus is completed where a reply that the transmission of the response is completed is received from the image processing apparatus. 11. The non-transitory machine-readable medium according to claim 1, wherein the client application and the information processing apparatus are configured to transmit and receive pairs of a request and a response through each of the first and second sessions, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: permit communication through a second session other than the first session when relaying of a pair of the request and the response is completed; after communication through the second session other than the first session is permitted, start processing again from the determination as to whether communication through the first session is prohibited where a keeping signal, which indicates keeping of the first session, is received within a predetermined time; and close the first session where the keeping signal is not received within the predetermined time. 12. The non-transitory machine-readable medium according to claim 1, wherein the information processing apparatus comprises physical or logical communication interfaces, each communication interface is configured to connect the image processing apparatus, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: select one of the communication interfaces is selected every time establishment of a session is requested by the client application; and prohibit communication through another session by using the same communication interface. 13. An image processing apparatus connected via a communication interface to a non-transitory machine-readable medium storing instructions that, when executed by a processor, cause an information processing apparatus to: in response to a first request for establishment of a first session by a client application that performs multi-session communication, establish the first session between a communication relay program and the client application; in response to a second request for establishment of a second session by the client application that performs multi-session communication, establish the second session between the communication relay program and the client application; perform a first communication process over the first session and prohibit a second communication process over the second session while both the first session and the second session are established, wherein a first communication is relayed between the client application and the image processing apparatus in the first communication process; and upon completion of the first communication process over the first session, perform the second communication process over the second session, wherein a second communication is relayed between the client application and the image processing apparatus in the second communication process.

A process, machine-readable instructions, and a system are described in which two communication sessions are attempted to be established between a client application and an image processing apparatus. In some examples, the first communication session is permitted while delaying the operation of the second communication session until the first communication session has completed.1. A non-transitory machine-readable medium storing instructions that, when executed by a processor, cause an information processing apparatus connected to an image processing apparatus via a communication interface to: in response to a first request for establishment of a first session by a client application that performs multi-session communication, establish the first session between a communication relay program and the client application; in response to a second request for establishment of a second session by the client application that performs multi-session communication, establish the second session between the communication relay program and the client application; perform a first communication process over the first session and prohibit a second communication process over the second session while both the first session and the second session are established, wherein a first communication is relayed between the client application and the image processing apparatus in the first communication process; and upon completion of the first communication process over the first session, perform the second communication process over the second session, wherein a second communication is relayed between the client application and the image processing apparatus in the second communication process. 2. The non-transitory machine-readable medium according to claim 1, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: after the first session has been established, determine whether the first communication over the first session is permitted; and perform the first communication process over the first session when the first communication over the first session is permitted. 3. The non-transitory machine-readable medium according to claim 1, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: in response to the first request, generate a first thread for establishing the first session between the communication relay program and the client application; in response to the second request, generate a second thread for establishing the second session between the communication relay program and the client application; generate a Mutex; before performing the first communication process over the first session, request an ownership of the Mutex by the first thread; obtain the ownership of the Mutex by the first thread if the ownership of the Mutex is not obtained by the second thread; after obtaining the ownership of the Mutex by the first thread, perform the first communication process over the first session and wait for the ownership of the Mutex by the second thread; and upon completion of the first communication process over the first session, release the ownership of the Mutex by the first thread. 4. The non-transitory machine-readable medium according to claim 1, wherein the communication includes one request and one response corresponding to the request, and wherein the instructions, when executed by the processor, further cause the information processing apparatus to determine that relaying of communication through the first session is completed when relaying of a pair of the request and the response is completed. 5. The non-transitory machine-readable medium according to claim 1, wherein the communication interface is configured to connect a Universal Serial Bus cable. 6. The non-transitory machine-readable medium according to claim 1, wherein the image processing apparatus includes a web server function unit, wherein the client application is a web browser, and wherein communication data is relayed for transmission and reception between the web browser and the web server function unit. 7. The non-transitory machine-readable medium according to claim 1, wherein the communication is communication for configuring for the image processing apparatus from the client application. 8. The non-transitory machine-readable medium according to claim 1, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: when receiving a request from the client application, transmit the request to the image processing apparatus and when receiving a response from the image processing apparatus, transmit the response to the client application, the response corresponding to the request, each of the request and the response includes a plurality of communication data; analyze communication data received from the client application and determine whether the communication data received from the client application indicates the end of the request; analyze communication data received from the image processing apparatus and determine whether the communication data received from the image processing apparatus indicates the end of the response; determine that reception of the request is completed where determined that the communication data received from the client application indicates the end of the request; and determine that reception of the response is completed where determined that the communication data received from the image processing apparatus indicates the end of the response. 9. The non-transitory machine-readable medium according to claim 1, wherein the instructions that, when executed by the processor, cause the information processing apparatus to: when receiving a request from the client application, transmit the request to the image processing apparatus and when receiving a response from the image processing apparatus, transmit the response to the client application, the response corresponding to the request, the request includes a plurality of communication data; provisionally determine that reception of the request from the client application is completed where communication data is not received for at least a first predetermined time after the last communication data has been received from the client application; determine that reception of the request from the client application is not completed where the response is not received from the image processing apparatus within a second predetermined time after the request has been transmitted to the image processing apparatus; and receive the rest of the communication data from the client application when it is determined that reception of the request from the client application is not completed. 10. The non-transitory machine-readable medium according to claim 9, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: inquire to the image processing apparatus as to whether transmission of the response is completed; and determine that reception of the response from the image processing apparatus is completed where a reply that the transmission of the response is completed is received from the image processing apparatus. 11. The non-transitory machine-readable medium according to claim 1, wherein the client application and the information processing apparatus are configured to transmit and receive pairs of a request and a response through each of the first and second sessions, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: permit communication through a second session other than the first session when relaying of a pair of the request and the response is completed; after communication through the second session other than the first session is permitted, start processing again from the determination as to whether communication through the first session is prohibited where a keeping signal, which indicates keeping of the first session, is received within a predetermined time; and close the first session where the keeping signal is not received within the predetermined time. 12. The non-transitory machine-readable medium according to claim 1, wherein the information processing apparatus comprises physical or logical communication interfaces, each communication interface is configured to connect the image processing apparatus, wherein the instructions that, when executed by the processor, further cause the information processing apparatus to: select one of the communication interfaces is selected every time establishment of a session is requested by the client application; and prohibit communication through another session by using the same communication interface. 13. An image processing apparatus connected via a communication interface to a non-transitory machine-readable medium storing instructions that, when executed by a processor, cause an information processing apparatus to: in response to a first request for establishment of a first session by a client application that performs multi-session communication, establish the first session between a communication relay program and the client application; in response to a second request for establishment of a second session by the client application that performs multi-session communication, establish the second session between the communication relay program and the client application; perform a first communication process over the first session and prohibit a second communication process over the second session while both the first session and the second session are established, wherein a first communication is relayed between the client application and the image processing apparatus in the first communication process; and upon completion of the first communication process over the first session, perform the second communication process over the second session, wherein a second communication is relayed between the client application and the image processing apparatus in the second communication process.

An image processing device and method of controlling an image processing device to be in communication with one of a plurality of external printer controllers is provided. The method includes monitoring, at initiation of the image processing device, a communication address assigned to the image processing device to detect whether a current communication address is different from a previously assigned communication address and acquiring, from memory, a configuration data object associated with the current communication address in response to detecting that the current communication address is different from the previously assigned communication address. The configuration data object being associated with the current communication address and includes one or more parameters for controlling one or more operations of the image processing device. The image processing device is automatically configured the image processing device using the one or more parameters acquired from the configuration data object.

1. A image processing device comprising: a controller; and a memory storing an application therein, the application, when executed by the controller causes the image processing device to: monitor, at initiation of the image processing device, a communication address assigned to the image processing device to detect whether a current communication address is different from a previously assigned communication address, acquire, from the memory, a configuration data object associated with the current communication address in response to detecting that the current communication address is different from the previously assigned communication address, the configuration data object being associated with the current communication address and includes one or more parameters for controlling one or more operations of the image processing device, and automatically configure the image processing device using the one or more parameters acquired from the configuration data object. 2. The image processing device according to claim 1, wherein a current communication address is associated with a first printer controller and a second communication address is associated with a second, different printer controller. 3. The image processing device according to claim 1, further comprising an input mechanism responsive to input received from a user and which generates a signal indicative of a printer controller selected from a set of printer controllers to be associated with the image processing device, wherein the application controls the image processing device to monitor the signal from the input mechanism, identify a communication address for the printer controller using the signal, determine whether the current communication address is equivalent to the identified communication address, and initiate a reboot of the image processing device in response to determining that the identified communication address is different from the current communication address. 4. The image processing device according to claim 1, wherein initiation of the image processing device includes at least one of (a) initial startup in response to the image processing device being powered on; and (b) a reboot of the image processing device. 5. The image processing device according to claim 1, wherein the current communication address was set prior to initiation of the image processing device and is associated with an external printer controller selected from a set of external printer controllers, each respective external printer controller having a unique communication address associated therewith for assignment to the image processing device to enable communication between the respective external printer controller and the image processing device. 6. The image processing device according to claim 1, wherein the application controls the image processing device to detect a signal indicating that the current communication address is to be changed to an updated communication address different from the current communication address; set the current communication address as a previously registered communication address; and set the updated communication address as the current communication address; and initiate a reboot of the image processing device. 7. The image processing device according to claim 1, wherein the current communication address and previously registered communication address are different private IP addresses. 8. A method of controlling an image processing device to be in communication with one of a plurality of external printer controllers, the method comprising: monitoring, at initiation of the image processing device, a communication address assigned to the image processing device to detect whether a current communication address is different from a previously assigned communication address, acquiring, from memory, a configuration data object associated with the current communication address in response to detecting that the current communication address is different from the previously assigned communication address, the configuration data object being associated with the current communication address and includes one or more parameters for controlling one or more operations of the image processing device, and automatically configure the image processing device using the one or more parameters acquired from the configuration data object. 9. The method according to claim 8, wherein a current communication address is associated with a first printer controller and a second communication address is associated with a second, different printer controller. 10. The method according to claim 1, further comprising monitoring a signal generated by an input mechanism, the signal being received from a user and indicative of a printer controller selected from a set of printer controllers to be associated with the image processing device, identifying a communication address for the printer controller using the signal, determining whether the current communication address is equivalent to the identified communication address, and initiating a reboot of the image processing device in response to determining that the identified communication address is different from the current communication address. 11. The method according to claim 8, wherein initiation of the image processing device includes at least one of (a) initial startup in response to the image processing device being powered on; and (b) a reboot of the image processing device. 12. The method according to claim 8, wherein the current communication address was set prior to initiation of the image processing device and is associated with an external printer controller selected from a set of external printer controllers, each respective external printer controller having a unique communication address associated therewith for assignment to the image processing device to enable communication between the respective external printer controller and the image processing device. 13. The method according to claim 1, further comprising detecting a signal indicating that the current communication address is to be changed to an updated communication address different from the current communication address; setting the current communication address as a previously registered communication address; setting the updated communication address as the current communication address; and initiating a reboot of the image processing device. 14. The method according to claim 1, wherein the current communication address and previously registered communication address are different private IP addresses. 15. A non-transitory computer readable storage medium storing instructions that, when executed by a controller, cause an image processing device to execute a method of controlling an image processing device to be in communication with one of a plurality of external printer controllers, the method comprising: monitoring, at initiation of the image processing device, a communication address assigned to the image processing device to detect whether a current communication address is different from a previously assigned communication address, acquiring, from memory, a configuration data object associated with the current communication address in response to detecting that the current communication address is different from the previously assigned communication address, the configuration data object being associated with the current communication address and includes one or more parameters for controlling one or more operations of the image processing device, and automatically configure the image processing device using the one or more parameters acquired from the configuration data object.

An image processing device and method of controlling an image processing device to be in communication with one of a plurality of external printer controllers is provided. The method includes monitoring, at initiation of the image processing device, a communication address assigned to the image processing device to detect whether a current communication address is different from a previously assigned communication address and acquiring, from memory, a configuration data object associated with the current communication address in response to detecting that the current communication address is different from the previously assigned communication address. The configuration data object being associated with the current communication address and includes one or more parameters for controlling one or more operations of the image processing device. The image processing device is automatically configured the image processing device using the one or more parameters acquired from the configuration data object.1. A image processing device comprising: a controller; and a memory storing an application therein, the application, when executed by the controller causes the image processing device to: monitor, at initiation of the image processing device, a communication address assigned to the image processing device to detect whether a current communication address is different from a previously assigned communication address, acquire, from the memory, a configuration data object associated with the current communication address in response to detecting that the current communication address is different from the previously assigned communication address, the configuration data object being associated with the current communication address and includes one or more parameters for controlling one or more operations of the image processing device, and automatically configure the image processing device using the one or more parameters acquired from the configuration data object. 2. The image processing device according to claim 1, wherein a current communication address is associated with a first printer controller and a second communication address is associated with a second, different printer controller. 3. The image processing device according to claim 1, further comprising an input mechanism responsive to input received from a user and which generates a signal indicative of a printer controller selected from a set of printer controllers to be associated with the image processing device, wherein the application controls the image processing device to monitor the signal from the input mechanism, identify a communication address for the printer controller using the signal, determine whether the current communication address is equivalent to the identified communication address, and initiate a reboot of the image processing device in response to determining that the identified communication address is different from the current communication address. 4. The image processing device according to claim 1, wherein initiation of the image processing device includes at least one of (a) initial startup in response to the image processing device being powered on; and (b) a reboot of the image processing device. 5. The image processing device according to claim 1, wherein the current communication address was set prior to initiation of the image processing device and is associated with an external printer controller selected from a set of external printer controllers, each respective external printer controller having a unique communication address associated therewith for assignment to the image processing device to enable communication between the respective external printer controller and the image processing device. 6. The image processing device according to claim 1, wherein the application controls the image processing device to detect a signal indicating that the current communication address is to be changed to an updated communication address different from the current communication address; set the current communication address as a previously registered communication address; and set the updated communication address as the current communication address; and initiate a reboot of the image processing device. 7. The image processing device according to claim 1, wherein the current communication address and previously registered communication address are different private IP addresses. 8. A method of controlling an image processing device to be in communication with one of a plurality of external printer controllers, the method comprising: monitoring, at initiation of the image processing device, a communication address assigned to the image processing device to detect whether a current communication address is different from a previously assigned communication address, acquiring, from memory, a configuration data object associated with the current communication address in response to detecting that the current communication address is different from the previously assigned communication address, the configuration data object being associated with the current communication address and includes one or more parameters for controlling one or more operations of the image processing device, and automatically configure the image processing device using the one or more parameters acquired from the configuration data object. 9. The method according to claim 8, wherein a current communication address is associated with a first printer controller and a second communication address is associated with a second, different printer controller. 10. The method according to claim 1, further comprising monitoring a signal generated by an input mechanism, the signal being received from a user and indicative of a printer controller selected from a set of printer controllers to be associated with the image processing device, identifying a communication address for the printer controller using the signal, determining whether the current communication address is equivalent to the identified communication address, and initiating a reboot of the image processing device in response to determining that the identified communication address is different from the current communication address. 11. The method according to claim 8, wherein initiation of the image processing device includes at least one of (a) initial startup in response to the image processing device being powered on; and (b) a reboot of the image processing device. 12. The method according to claim 8, wherein the current communication address was set prior to initiation of the image processing device and is associated with an external printer controller selected from a set of external printer controllers, each respective external printer controller having a unique communication address associated therewith for assignment to the image processing device to enable communication between the respective external printer controller and the image processing device. 13. The method according to claim 1, further comprising detecting a signal indicating that the current communication address is to be changed to an updated communication address different from the current communication address; setting the current communication address as a previously registered communication address; setting the updated communication address as the current communication address; and initiating a reboot of the image processing device. 14. The method according to claim 1, wherein the current communication address and previously registered communication address are different private IP addresses. 15. A non-transitory computer readable storage medium storing instructions that, when executed by a controller, cause an image processing device to execute a method of controlling an image processing device to be in communication with one of a plurality of external printer controllers, the method comprising: monitoring, at initiation of the image processing device, a communication address assigned to the image processing device to detect whether a current communication address is different from a previously assigned communication address, acquiring, from memory, a configuration data object associated with the current communication address in response to detecting that the current communication address is different from the previously assigned communication address, the configuration data object being associated with the current communication address and includes one or more parameters for controlling one or more operations of the image processing device, and automatically configure the image processing device using the one or more parameters acquired from the configuration data object.

A print engine is adapted to print image data from a plurality of pre-processing systems that supply image data at different image resolutions and halftoning states. A data interface receives the image data and associated metadata including an image resolution parameter and a halftone state parameter. A metadata interpreter interprets the metadata and determines image processing operations that are required to prepare the image data for printing using a printer module. A resolution modification processor module processes the image data to modify its resolution if the metadata interpreter determines that the image resolution of the image data does not match the printer resolution. A halftone processor module processes the image data by applying a halftoning operation if the metadata interpreter determines that the image data is not in an appropriate halftoning state.

1. A print engine adapted to print image data from a plurality of pre-processing systems, wherein the pre-processing systems supply image data at different image resolutions and halftoning states, comprising: a printer module for printing halftoned image data at a printer resolution; a data interface that receives image data and associated metadata from a particular pre-processing system, wherein the metadata includes an image resolution parameter that provides an indication of an image resolution of the image data provided by the particular pre-processing system and a halftone state parameter that provides an indication of a halftoning state of the image data provided by the particular pre-processing system; a metadata interpreter that interprets the metadata and determines image processing operations required to prepare the image data for printing using the printer module, wherein the metadata interpreter determines that a resolution modification operation is required if the metadata indicates that image resolution of the image data does not match the printer resolution, and wherein the metadata interpreter determines that a halftoning operation is required if the metadata indicates that the image data is not in an appropriate halftoning state; a resolution modification processor module that processes the image data to modify the resolution of the image data if the metadata interpreter determines that a resolution modification operation is required; a halftone processor module that processes the image data by applying a halftoning operation to the image data if the metadata interpreter determines that a halftoning operation is required; and a printer module controller that controls the printer module to produce a printed image in accordance with the processed image data. 2. The print engine of claim 1, wherein the metadata further includes one or more halftoning parameters that are used by the halftone processor module to control the halftoning operation. 3. The print engine of claim 2, wherein the halftoning parameters include a screen angle parameter, a screen frequency parameter, or a screen type parameter. 4. The print engine of claim 2, wherein the halftoning parameters include a halftone configuration index that is used to select one of a predefined set of halftone algorithm configurations. 5. The print engine of claim 1, wherein the halftone state parameter is a variable indicating whether or not the image data has been halftoned. 6. The print engine of claim 1, wherein the print engine is adapted to print image data having an image resolution selected from a set of predefined image resolutions, and wherein the image resolution parameter is an image resolution index indicating which of the predefined image resolutions the image data has. 7. The print engine of claim 1, wherein the image resolution supplied by the pre-processing systems is an integer fraction of the printer resolution, and wherein the resolution modification processor modifies the resolution of the image data using a pixel replication process. 8. The print engine of claim 1, wherein the resolution modification processor modifies the resolution of the image data using an interpolation process. 9. The print engine of claim 1, wherein the metadata interpreter determines that a halftoning operation is not required if the metadata indicates that the received image data is in a halftoned state. 10. The print engine of claim 1, wherein the halftoning operation applies a multi-level halftoning process. 11. The print engine of claim 1, wherein if the metadata indicates that the image resolution of the received image data is lower than the printer resolution and that the received image data is in a halftoned state, then the print engine is configured to emulate a print engine having a resolution equal to the image resolution. 12. The print engine of claim 1, wherein the printer module is an electrophotographic printing system.

A print engine is adapted to print image data from a plurality of pre-processing systems that supply image data at different image resolutions and halftoning states. A data interface receives the image data and associated metadata including an image resolution parameter and a halftone state parameter. A metadata interpreter interprets the metadata and determines image processing operations that are required to prepare the image data for printing using a printer module. A resolution modification processor module processes the image data to modify its resolution if the metadata interpreter determines that the image resolution of the image data does not match the printer resolution. A halftone processor module processes the image data by applying a halftoning operation if the metadata interpreter determines that the image data is not in an appropriate halftoning state.1. A print engine adapted to print image data from a plurality of pre-processing systems, wherein the pre-processing systems supply image data at different image resolutions and halftoning states, comprising: a printer module for printing halftoned image data at a printer resolution; a data interface that receives image data and associated metadata from a particular pre-processing system, wherein the metadata includes an image resolution parameter that provides an indication of an image resolution of the image data provided by the particular pre-processing system and a halftone state parameter that provides an indication of a halftoning state of the image data provided by the particular pre-processing system; a metadata interpreter that interprets the metadata and determines image processing operations required to prepare the image data for printing using the printer module, wherein the metadata interpreter determines that a resolution modification operation is required if the metadata indicates that image resolution of the image data does not match the printer resolution, and wherein the metadata interpreter determines that a halftoning operation is required if the metadata indicates that the image data is not in an appropriate halftoning state; a resolution modification processor module that processes the image data to modify the resolution of the image data if the metadata interpreter determines that a resolution modification operation is required; a halftone processor module that processes the image data by applying a halftoning operation to the image data if the metadata interpreter determines that a halftoning operation is required; and a printer module controller that controls the printer module to produce a printed image in accordance with the processed image data. 2. The print engine of claim 1, wherein the metadata further includes one or more halftoning parameters that are used by the halftone processor module to control the halftoning operation. 3. The print engine of claim 2, wherein the halftoning parameters include a screen angle parameter, a screen frequency parameter, or a screen type parameter. 4. The print engine of claim 2, wherein the halftoning parameters include a halftone configuration index that is used to select one of a predefined set of halftone algorithm configurations. 5. The print engine of claim 1, wherein the halftone state parameter is a variable indicating whether or not the image data has been halftoned. 6. The print engine of claim 1, wherein the print engine is adapted to print image data having an image resolution selected from a set of predefined image resolutions, and wherein the image resolution parameter is an image resolution index indicating which of the predefined image resolutions the image data has. 7. The print engine of claim 1, wherein the image resolution supplied by the pre-processing systems is an integer fraction of the printer resolution, and wherein the resolution modification processor modifies the resolution of the image data using a pixel replication process. 8. The print engine of claim 1, wherein the resolution modification processor modifies the resolution of the image data using an interpolation process. 9. The print engine of claim 1, wherein the metadata interpreter determines that a halftoning operation is not required if the metadata indicates that the received image data is in a halftoned state. 10. The print engine of claim 1, wherein the halftoning operation applies a multi-level halftoning process. 11. The print engine of claim 1, wherein if the metadata indicates that the image resolution of the received image data is lower than the printer resolution and that the received image data is in a halftoned state, then the print engine is configured to emulate a print engine having a resolution equal to the image resolution. 12. The print engine of claim 1, wherein the printer module is an electrophotographic printing system.

Provided is an image recording apparatus, including: a recording unit recording an image on a recording sheet; a conveying unit conveying a plurality of recording sheets in an overlapping state to the recording unit; and a setting unit setting an overlapping amount so that the image is prevented from being printed on a region of a predetermined range which includes a boundary between an overlapping portion, in which a subsequent sheet and a preceding sheet overlap each other, and a non-overlapping portion, in which the subsequent sheet and the preceding sheet do not overlap each other.

1. An image recording apparatus, comprising: a recording unit recording an image on a recording sheet; a conveying unit conveying a plurality of recording sheets in an overlapping state to the recording unit; and a setting unit setting an overlapping amount so that the image is prevented from being printed on a region of a predetermined range which includes a boundary between an overlapping portion, in which a subsequent sheet and a preceding sheet overlap each other, and a non-overlapping portion, in which the subsequent sheet and the preceding sheet do not overlap each other. 2. An image recording apparatus according to claim 1, wherein the region of the predetermined range is one of a region located downstream of the boundary in a conveying direction of the recording sheet and a region located upstream of the boundary in the conveying direction. 3. An image recording apparatus according to claim 1, wherein the region of the predetermined range is a region in which the subsequent sheet is warped. 4. An image recording apparatus according to claim 1, wherein the region of the predetermined range is an inclined portion between the boundary and a part of the subsequent sheet which is held in contact with a platen plate. 5. An image recording apparatus according to claim 1, further comprising a margin detecting unit detecting a trailing end margin and a leading end margin in the image, wherein the overlapping amount is set based on the trailing end margin of the preceding sheet, the leading end margin of the subsequent sheet, and the predetermined range. 6. An image recording apparatus according to claim 5, wherein a leading end margin amount in the image is compared to a value obtained by adding a width of an inclined portion to a trailing end margin amount in the image, when the leading end margin amount is smaller than the value obtained by adding the width of the inclined portion to the trailing end margin amount, a value obtained by subtracting the width of the inclined portion from the leading end margin amount is set as the overlapping amount, and when the value obtained by adding the width of the inclined portion to the trailing end margin amount is smaller than the leading end margin amount, the trailing end margin amount is set as the overlapping amount. 7. An image recording apparatus according to claim 1, further comprising a blank region detecting unit configured to detect an in-page blank region in the image, wherein the overlapping amount is set based on a trailing end margin of the preceding sheet, a leading end margin of the subsequent sheet, the predetermined range, and the in-page blank region of the subsequent sheet. 8. An image recording apparatus according to claim 1, wherein the predetermined range is changed depending on a kind of sheet. 9. An image recording apparatus according to claim 1, further comprising an attribute detecting unit configured to detect at least one attribute of a character region, an image region, a color region, or a black region in the image, wherein the overlapping amount is set based on a trailing end margin of the preceding sheet, a leading end margin of the subsequent sheet, the predetermined range, and the attribute. 10. A method of controlling an image recording apparatus, comprising: setting an overlapping amount so that an image is prevented from being printed on a region of a predetermined range which includes a boundary between an overlapping portion, in which a subsequent sheet and a preceding sheet overlap each other, and a non-overlapping portion, in which the subsequent sheet and the preceding sheet do not overlap each other; conveying the subsequent sheet and the preceding sheet in an overlapping state; and recording the image on the subsequent sheet. 11. A method of controlling an image recording apparatus according to claim 10, wherein the region of the predetermined range is one of a region located downstream of the boundary in a conveying direction of the subsequent sheet and the preceding sheet and a region located upstream of the boundary in the conveying direction. 12. A method of controlling an image recording apparatus according to claim 10, wherein the region of the predetermined range is a region in which the subsequent sheet is warped. 13. A method of controlling an image recording apparatus according to claim 10, wherein the region of the predetermined range is an inclined portion located between the boundary and a part of the subsequent sheet which is held in contact with a platen plate. 14. A method of controlling an image recording apparatus according to claim 10, further comprising detecting a trailing end margin and a leading end margin in the image, wherein the overlapping amount is set based on the trailing end margin of the preceding sheet, the leading end margin of the subsequent sheet, and the predetermined range. 15. A method of controlling an image recording apparatus according to claim 14, further comprising comparing a leading end margin amount in the image to a value obtained by adding a width of an inclined portion to a trailing end margin amount in the image; setting a value obtained by subtracting the width of the inclined portion from the leading end margin amount as the overlapping amount when the leading end margin amount is smaller than the value obtained by adding the width of the inclined portion to the trailing end margin amount; and setting the trailing end margin amount as the overlapping amount when the value obtained by adding the width of the inclined portion to the trailing end margin amount is smaller than the leading end margin amount. 16. A method of controlling an image recording apparatus according to claim 10, further comprising detecting an in-page blank region in the image, wherein the overlapping amount is set based on a trailing end margin of the preceding sheet, a leading end margin of the subsequent sheet, the predetermined range, and the in-page blank region of the subsequent sheet. 17. A method of controlling an image recording apparatus according to claim 10, further comprising changing the predetermined range depending on a kind of sheet. 18. A method of controlling an image recording apparatus according to claim 10, further comprising detecting at least one attribute of a character region, an image region, a color region, or a black region in the image, wherein the overlapping amount is set based on a trailing end margin of the preceding sheet, a leading end margin of the subsequent sheet, the predetermined range, and the attribute. 19. A non-transitory computer-readable storage medium having a program stored thereon, the program causing an image recording apparatus to execute: setting an overlapping amount so that an image is prevented from being printed on a region of a predetermined range which includes a boundary between an overlapping portion, in which a subsequent sheet and a preceding sheet overlap each other, and a non-overlapping portion, in which the subsequent sheet and the preceding sheet do not overlap each other; conveying the subsequent sheet and the preceding sheet in an overlapping state; and recording the image on the subsequent sheet.

Provided is an image recording apparatus, including: a recording unit recording an image on a recording sheet; a conveying unit conveying a plurality of recording sheets in an overlapping state to the recording unit; and a setting unit setting an overlapping amount so that the image is prevented from being printed on a region of a predetermined range which includes a boundary between an overlapping portion, in which a subsequent sheet and a preceding sheet overlap each other, and a non-overlapping portion, in which the subsequent sheet and the preceding sheet do not overlap each other.1. An image recording apparatus, comprising: a recording unit recording an image on a recording sheet; a conveying unit conveying a plurality of recording sheets in an overlapping state to the recording unit; and a setting unit setting an overlapping amount so that the image is prevented from being printed on a region of a predetermined range which includes a boundary between an overlapping portion, in which a subsequent sheet and a preceding sheet overlap each other, and a non-overlapping portion, in which the subsequent sheet and the preceding sheet do not overlap each other. 2. An image recording apparatus according to claim 1, wherein the region of the predetermined range is one of a region located downstream of the boundary in a conveying direction of the recording sheet and a region located upstream of the boundary in the conveying direction. 3. An image recording apparatus according to claim 1, wherein the region of the predetermined range is a region in which the subsequent sheet is warped. 4. An image recording apparatus according to claim 1, wherein the region of the predetermined range is an inclined portion between the boundary and a part of the subsequent sheet which is held in contact with a platen plate. 5. An image recording apparatus according to claim 1, further comprising a margin detecting unit detecting a trailing end margin and a leading end margin in the image, wherein the overlapping amount is set based on the trailing end margin of the preceding sheet, the leading end margin of the subsequent sheet, and the predetermined range. 6. An image recording apparatus according to claim 5, wherein a leading end margin amount in the image is compared to a value obtained by adding a width of an inclined portion to a trailing end margin amount in the image, when the leading end margin amount is smaller than the value obtained by adding the width of the inclined portion to the trailing end margin amount, a value obtained by subtracting the width of the inclined portion from the leading end margin amount is set as the overlapping amount, and when the value obtained by adding the width of the inclined portion to the trailing end margin amount is smaller than the leading end margin amount, the trailing end margin amount is set as the overlapping amount. 7. An image recording apparatus according to claim 1, further comprising a blank region detecting unit configured to detect an in-page blank region in the image, wherein the overlapping amount is set based on a trailing end margin of the preceding sheet, a leading end margin of the subsequent sheet, the predetermined range, and the in-page blank region of the subsequent sheet. 8. An image recording apparatus according to claim 1, wherein the predetermined range is changed depending on a kind of sheet. 9. An image recording apparatus according to claim 1, further comprising an attribute detecting unit configured to detect at least one attribute of a character region, an image region, a color region, or a black region in the image, wherein the overlapping amount is set based on a trailing end margin of the preceding sheet, a leading end margin of the subsequent sheet, the predetermined range, and the attribute. 10. A method of controlling an image recording apparatus, comprising: setting an overlapping amount so that an image is prevented from being printed on a region of a predetermined range which includes a boundary between an overlapping portion, in which a subsequent sheet and a preceding sheet overlap each other, and a non-overlapping portion, in which the subsequent sheet and the preceding sheet do not overlap each other; conveying the subsequent sheet and the preceding sheet in an overlapping state; and recording the image on the subsequent sheet. 11. A method of controlling an image recording apparatus according to claim 10, wherein the region of the predetermined range is one of a region located downstream of the boundary in a conveying direction of the subsequent sheet and the preceding sheet and a region located upstream of the boundary in the conveying direction. 12. A method of controlling an image recording apparatus according to claim 10, wherein the region of the predetermined range is a region in which the subsequent sheet is warped. 13. A method of controlling an image recording apparatus according to claim 10, wherein the region of the predetermined range is an inclined portion located between the boundary and a part of the subsequent sheet which is held in contact with a platen plate. 14. A method of controlling an image recording apparatus according to claim 10, further comprising detecting a trailing end margin and a leading end margin in the image, wherein the overlapping amount is set based on the trailing end margin of the preceding sheet, the leading end margin of the subsequent sheet, and the predetermined range. 15. A method of controlling an image recording apparatus according to claim 14, further comprising comparing a leading end margin amount in the image to a value obtained by adding a width of an inclined portion to a trailing end margin amount in the image; setting a value obtained by subtracting the width of the inclined portion from the leading end margin amount as the overlapping amount when the leading end margin amount is smaller than the value obtained by adding the width of the inclined portion to the trailing end margin amount; and setting the trailing end margin amount as the overlapping amount when the value obtained by adding the width of the inclined portion to the trailing end margin amount is smaller than the leading end margin amount. 16. A method of controlling an image recording apparatus according to claim 10, further comprising detecting an in-page blank region in the image, wherein the overlapping amount is set based on a trailing end margin of the preceding sheet, a leading end margin of the subsequent sheet, the predetermined range, and the in-page blank region of the subsequent sheet. 17. A method of controlling an image recording apparatus according to claim 10, further comprising changing the predetermined range depending on a kind of sheet. 18. A method of controlling an image recording apparatus according to claim 10, further comprising detecting at least one attribute of a character region, an image region, a color region, or a black region in the image, wherein the overlapping amount is set based on a trailing end margin of the preceding sheet, a leading end margin of the subsequent sheet, the predetermined range, and the attribute. 19. A non-transitory computer-readable storage medium having a program stored thereon, the program causing an image recording apparatus to execute: setting an overlapping amount so that an image is prevented from being printed on a region of a predetermined range which includes a boundary between an overlapping portion, in which a subsequent sheet and a preceding sheet overlap each other, and a non-overlapping portion, in which the subsequent sheet and the preceding sheet do not overlap each other; conveying the subsequent sheet and the preceding sheet in an overlapping state; and recording the image on the subsequent sheet.

A document processing system includes a print job queue management system configured to temporarily hold print jobs in the print queue during periods of light use, so as to maximize the amount of time that the document processing system spends in energy efficient low power modes. The print job queue management system compares print jobs in the queue with print job hold criteria and releases print jobs for printing when certain criteria are met, such as when a threshold number of documents or pages are in the print queue, if an incoming print job is designated as high priority print job to be immediately printed, or during particular times of the day that are designated as peak use times, which can be determined from historical data. A user can manually force a document to print from the user interface of the document processing systems.

1. A document processing device, comprising: an embedded controller including a processor, a memory in data communication with the processor, and a network interface in communication with the processor, the memory operable for storage of data and instructions, and the network interface configured to receive print jobs via an associated network, wherein the processor is configured to receive a print job via the network interface, store the print job in a print queue, compare the print job with print job hold criteria, and perform, based at least in part on the compare operation, exactly one of releasing the print job for printing by the document processing device, or holding the print job in the print queue without immediately printing. 2. The document processing device of claim 1, wherein when the print job is held in the print queue, the processor is further configured to receive a second print job via the network interface, store the second print job in the print queue, compare the print job and the second print job against print job hold criteria, and perform, based at least in part on the compare operation, exactly one of releasing the print job and the second print job for printing by the document processing device, or holding the second print job in the print queue without immediately printing. 3. The document processing device of claim 1, wherein when the document processing device changes from a power saving operational state to a normal operational state, the processor is further configured to release the print job for printing by the document processing device. 4. The document processing device of claim 1, wherein the print job hold criteria are selected from one or more of the group consisting of a threshold priority setting that when met or exceeded by a priority setting of the print job causes the print job to be released for printing, a threshold number of pages of pending print jobs in the print queue that when met or exceeded causes pending print jobs to be released for printing, a threshold number of print jobs in the print queue that when met or exceeded causes pending print jobs to be released for printing, a threshold number of seconds from the start of the document processing device entering a power save mode of operation that when met or exceeded causes pending print jobs to be released for printing, a first administrator configured time period, during which print jobs are released for printing, a second administrator configured time period, during which print jobs are held in the print queue without immediately printing, a time period associated with high electrical costs, during which print jobs are held in the print queue without immediately printing, and a high usage time period based at least in part on historical usage, during which print jobs are released for printing. 5. The document processing device of claim 1, wherein the processor is further configured to poll a second print queue manager of a second document processing system for operational mode information comprising one or more of a current operational mode, or a schedule of a future operational mode, transfer the print job from the print queue to a print queue of the second document processing system based at least in part on the received operational mode information, and send notification of the transfer to a user associated with the print job. 6. The document processing device of claim 1, wherein the processor is further configured to receive an input from a user interface associated with the document processing device and, in response to the input from the user interface, immediately release the print job for printing by the document processing device. 7. A method, comprising: receiving a print job by a document processing device via a network interface; storing, by the document processing device, the print job in a print queue; comparing the print job with print job hold criteria; and performing, based at least in part on the compare operation, exactly one of releasing the print job for printing by the document processing device, or holding the print job in the print queue without immediately printing. 8. The method of claim 7, further comprising: receiving a second print job via the network interface when the print job is held in the print queue; storing the second print job in the print queue; comparing the print job and the second print job with print job hold criteria; and performing, based at least in part on the compare operation, exactly one of releasing the print job and the second print job for printing by the document processing device, or holding the second print job in the print queue without immediately printing. 9. The method of claim 7, further comprising releasing the print job for printing when the document processing device changes from a power saving operational state to a normal operational state. 10. The method of claim 7, further comprising: polling a second print queue manager of a second document processing system for operational mode information comprising one or more of a current operational mode, or a schedule of a future operational mode; transferring the print job from the print queue to a print queue of the second document processing system based at least in part on the received operational mode information; and sending notification of the transfer to a user associated with the print job. 11. The method of claim 7, wherein the print job hold criteria are selected from one or more of the group consisting of a threshold priority setting that when met or exceeded by a priority setting of the print job causes the print job to be immediately released for printing, a threshold number of pages of pending print jobs in the print queue that when met or exceeded causes pending print jobs to be immediately released for printing, a threshold number of print jobs in the print queue that when met or exceeded causes pending print jobs to be immediately released for printing, a threshold number of seconds from the start of the document processing device entering a power save mode of operation that when met or exceeded causes pending print jobs to be immediately released for printing, a first administrator configured time period, during which print jobs are immediately released for printing, a second administrator configured time period, during which print jobs are held in the print queue without immediately printing, a time period associated with high electrical costs, during which print jobs are held in the print queue without immediately printing, and a high usage time period based at least in part on historical usage, during which print jobs are immediately released for printing. 12. The method of claim 7, further comprising: receiving an input from a user interface associated with the document processing device; and releasing the print job for printing by the document processing device in response to receiving the input from the user interface. 13. A document processing system, comprising: a network interface configured to receive a plurality of print jobs; a memory configured to store the print jobs received on the network interface in a print queue; a printer having at least a normal operational mode for printing print jobs and a power save operational mode; and a print job queue manager configure to compare the print jobs in the print queue against one or more print job hold criteria, and selectively hold the print jobs in the print queue, without releasing the print jobs to the printer for printing, based on the printer being in the power save operational mode and based at least in part on the compare operation. 14. The document processing system of claim 13, wherein the print job queue manager is configured to compare the print jobs in the print queue each time that a new print job is received by the network interface and stored in the print queue. 15. The document processing system of claim 14, wherein based on a subsequent compare operation the print job queue manager is further configured to release the print jobs held in the print queue for printing by the printer, and wherein releasing the print jobs in the print queue causes the printer to switch from the power save operational mode to the normal operational mode. 16. The document processing system of claim 13, wherein the print job queue manager is further configured to poll a second print job queue manager of a second document processing system for operational mode information comprising one or more of a current operational mode, or a schedule of a future operational mode; and transfer one or more print jobs from the print queue to a second print queue of the second document processing system based at least in part on the received operational mode information; and sending notification to each user associated with a transferred print job. 17. The document processing system of claim 14, wherein the print job hold criteria include one or more of an administrator configured time period, during which print jobs are immediately released for printing, or a high usage time period based at least in part on historical usage, during which print jobs are immediately released for printing. 18. The document processing system of claim 13, wherein the print job hold criteria are selected from one or more of the group consisting of a threshold priority setting that when not met or exceeded by a priority setting of the print job causes the print jobs to be held in the print queue, a threshold number of pages of print jobs held in the print queue that when not met or exceeded causes the print jobs to be held in the print queue, a threshold number of print jobs in the print queue that when not met or exceeded causes the print jobs to be held in the print queue, a threshold number of seconds from the start of the document processing device entering a power save operational mode that when not met or exceeded causes the print jobs to be held in the print queue, an administrator configured time period, during which the print jobs are held in the print queue without immediately printing, a time period associated with high electrical costs, during which print jobs are held in the print queue without immediately printing, and a low usage time period based at least in part on historical usage, during which the print jobs are held in the print queue without immediately printing. 19. The document processing system of claim 13, further comprising: a user interface configured to accept a user input, wherein in response to the user input, the a print job queue manager is further configured to release the print jobs to the printer and the printer is further configured to switch from the power save operational mode to the normal operational mode and print at least one print job from the print queue. 20. The document processing system of claim 13, wherein the print job queue manager is further configured to release the print jobs to the printer for printing when the document processing device changes from the power save operational mode to the normal operational mode.

A document processing system includes a print job queue management system configured to temporarily hold print jobs in the print queue during periods of light use, so as to maximize the amount of time that the document processing system spends in energy efficient low power modes. The print job queue management system compares print jobs in the queue with print job hold criteria and releases print jobs for printing when certain criteria are met, such as when a threshold number of documents or pages are in the print queue, if an incoming print job is designated as high priority print job to be immediately printed, or during particular times of the day that are designated as peak use times, which can be determined from historical data. A user can manually force a document to print from the user interface of the document processing systems.1. A document processing device, comprising: an embedded controller including a processor, a memory in data communication with the processor, and a network interface in communication with the processor, the memory operable for storage of data and instructions, and the network interface configured to receive print jobs via an associated network, wherein the processor is configured to receive a print job via the network interface, store the print job in a print queue, compare the print job with print job hold criteria, and perform, based at least in part on the compare operation, exactly one of releasing the print job for printing by the document processing device, or holding the print job in the print queue without immediately printing. 2. The document processing device of claim 1, wherein when the print job is held in the print queue, the processor is further configured to receive a second print job via the network interface, store the second print job in the print queue, compare the print job and the second print job against print job hold criteria, and perform, based at least in part on the compare operation, exactly one of releasing the print job and the second print job for printing by the document processing device, or holding the second print job in the print queue without immediately printing. 3. The document processing device of claim 1, wherein when the document processing device changes from a power saving operational state to a normal operational state, the processor is further configured to release the print job for printing by the document processing device. 4. The document processing device of claim 1, wherein the print job hold criteria are selected from one or more of the group consisting of a threshold priority setting that when met or exceeded by a priority setting of the print job causes the print job to be released for printing, a threshold number of pages of pending print jobs in the print queue that when met or exceeded causes pending print jobs to be released for printing, a threshold number of print jobs in the print queue that when met or exceeded causes pending print jobs to be released for printing, a threshold number of seconds from the start of the document processing device entering a power save mode of operation that when met or exceeded causes pending print jobs to be released for printing, a first administrator configured time period, during which print jobs are released for printing, a second administrator configured time period, during which print jobs are held in the print queue without immediately printing, a time period associated with high electrical costs, during which print jobs are held in the print queue without immediately printing, and a high usage time period based at least in part on historical usage, during which print jobs are released for printing. 5. The document processing device of claim 1, wherein the processor is further configured to poll a second print queue manager of a second document processing system for operational mode information comprising one or more of a current operational mode, or a schedule of a future operational mode, transfer the print job from the print queue to a print queue of the second document processing system based at least in part on the received operational mode information, and send notification of the transfer to a user associated with the print job. 6. The document processing device of claim 1, wherein the processor is further configured to receive an input from a user interface associated with the document processing device and, in response to the input from the user interface, immediately release the print job for printing by the document processing device. 7. A method, comprising: receiving a print job by a document processing device via a network interface; storing, by the document processing device, the print job in a print queue; comparing the print job with print job hold criteria; and performing, based at least in part on the compare operation, exactly one of releasing the print job for printing by the document processing device, or holding the print job in the print queue without immediately printing. 8. The method of claim 7, further comprising: receiving a second print job via the network interface when the print job is held in the print queue; storing the second print job in the print queue; comparing the print job and the second print job with print job hold criteria; and performing, based at least in part on the compare operation, exactly one of releasing the print job and the second print job for printing by the document processing device, or holding the second print job in the print queue without immediately printing. 9. The method of claim 7, further comprising releasing the print job for printing when the document processing device changes from a power saving operational state to a normal operational state. 10. The method of claim 7, further comprising: polling a second print queue manager of a second document processing system for operational mode information comprising one or more of a current operational mode, or a schedule of a future operational mode; transferring the print job from the print queue to a print queue of the second document processing system based at least in part on the received operational mode information; and sending notification of the transfer to a user associated with the print job. 11. The method of claim 7, wherein the print job hold criteria are selected from one or more of the group consisting of a threshold priority setting that when met or exceeded by a priority setting of the print job causes the print job to be immediately released for printing, a threshold number of pages of pending print jobs in the print queue that when met or exceeded causes pending print jobs to be immediately released for printing, a threshold number of print jobs in the print queue that when met or exceeded causes pending print jobs to be immediately released for printing, a threshold number of seconds from the start of the document processing device entering a power save mode of operation that when met or exceeded causes pending print jobs to be immediately released for printing, a first administrator configured time period, during which print jobs are immediately released for printing, a second administrator configured time period, during which print jobs are held in the print queue without immediately printing, a time period associated with high electrical costs, during which print jobs are held in the print queue without immediately printing, and a high usage time period based at least in part on historical usage, during which print jobs are immediately released for printing. 12. The method of claim 7, further comprising: receiving an input from a user interface associated with the document processing device; and releasing the print job for printing by the document processing device in response to receiving the input from the user interface. 13. A document processing system, comprising: a network interface configured to receive a plurality of print jobs; a memory configured to store the print jobs received on the network interface in a print queue; a printer having at least a normal operational mode for printing print jobs and a power save operational mode; and a print job queue manager configure to compare the print jobs in the print queue against one or more print job hold criteria, and selectively hold the print jobs in the print queue, without releasing the print jobs to the printer for printing, based on the printer being in the power save operational mode and based at least in part on the compare operation. 14. The document processing system of claim 13, wherein the print job queue manager is configured to compare the print jobs in the print queue each time that a new print job is received by the network interface and stored in the print queue. 15. The document processing system of claim 14, wherein based on a subsequent compare operation the print job queue manager is further configured to release the print jobs held in the print queue for printing by the printer, and wherein releasing the print jobs in the print queue causes the printer to switch from the power save operational mode to the normal operational mode. 16. The document processing system of claim 13, wherein the print job queue manager is further configured to poll a second print job queue manager of a second document processing system for operational mode information comprising one or more of a current operational mode, or a schedule of a future operational mode; and transfer one or more print jobs from the print queue to a second print queue of the second document processing system based at least in part on the received operational mode information; and sending notification to each user associated with a transferred print job. 17. The document processing system of claim 14, wherein the print job hold criteria include one or more of an administrator configured time period, during which print jobs are immediately released for printing, or a high usage time period based at least in part on historical usage, during which print jobs are immediately released for printing. 18. The document processing system of claim 13, wherein the print job hold criteria are selected from one or more of the group consisting of a threshold priority setting that when not met or exceeded by a priority setting of the print job causes the print jobs to be held in the print queue, a threshold number of pages of print jobs held in the print queue that when not met or exceeded causes the print jobs to be held in the print queue, a threshold number of print jobs in the print queue that when not met or exceeded causes the print jobs to be held in the print queue, a threshold number of seconds from the start of the document processing device entering a power save operational mode that when not met or exceeded causes the print jobs to be held in the print queue, an administrator configured time period, during which the print jobs are held in the print queue without immediately printing, a time period associated with high electrical costs, during which print jobs are held in the print queue without immediately printing, and a low usage time period based at least in part on historical usage, during which the print jobs are held in the print queue without immediately printing. 19. The document processing system of claim 13, further comprising: a user interface configured to accept a user input, wherein in response to the user input, the a print job queue manager is further configured to release the print jobs to the printer and the printer is further configured to switch from the power save operational mode to the normal operational mode and print at least one print job from the print queue. 20. The document processing system of claim 13, wherein the print job queue manager is further configured to release the print jobs to the printer for printing when the document processing device changes from the power save operational mode to the normal operational mode.

There is provided a communication apparatus including a communication unit configured to communicate with a control apparatus, which has a recording unit and executes processing in accordance with a command that has been written to the recording unit, an accepting unit configured to accept selection of a command by a user, and a writing unit configured to write the selected command to the recording unit, the communication apparatus comprising: a sensing unit configured to sense connection to the control apparatus via the communication unit; a determination unit configured to determine whether the recording unit has been set to a write inhibit state if the connection has been sensed by the sensing unit; and a notification unit configured to notify the user of the fact that the recording unit has been set to the write inhibit state, if the determination unit determines that the recording unit has been set to the write inhibit state.

1. A control apparatus capable of being connected to a predetermined recording apparatus, which has a recording medium configured to record a control file and executes processing in accordance with a command that is written to the control file, the control apparatus comprising: a processor; and an interface configured to connect to a recording apparatus, wherein: the processor performs functions of at least a display control unit, a writing control unit, and a first determination unit; the display control unit is configured to display, on a display unit, a control menu for accepting a control instruction to the predetermined recording apparatus by a user operation; the writing control unit is configured to control to write a command corresponding to the control instruction accepted using the control menu to the control file in the recording medium; and the first determination unit is configured to determine whether or not a data-writing inhibit state is set by a hardware switch of the recording apparatus after detecting connection to the predetermined recording apparatus and recognizing the predetermined recording apparatus, wherein the data-writing inhibit state is a state for inhibiting data from being written to the recording medium, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit controls the display unit so as to make a user recognize that the user cannot control the predetermined recording apparatus using the control menu. 2. The apparatus according to claim 1, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit controls not to display the control menu. 3. The apparatus according to claim 1, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit controls to display the control menu in a manner that a selection on the control menu is impossible. 4. The apparatus according to claim 3, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit causes the control menu displayed on the display unit to be grayed out. 5. The apparatus according to claim 1, wherein the processor performs a function of a second determination unit, the second determination unit being configured to determine whether or not an apparatus connected to the interface is the predetermined recording apparatus, wherein if it is determined by the second determination unit that the apparatus connected to the interface is not the predetermined recording apparatus, the display control unit controls not to display the control menu regardless of whether or not the data-writing inhibit state is set. 6. The apparatus according to claim 4, wherein the processor performs a function of a second determination unit, the second determination unit being configured to determine whether or not an apparatus connected to the interface is the predetermined recording apparatus, wherein if it is determined by the second determination unit that the apparatus connected to the interface is not the predetermined recording apparatus, the display control unit controls not to display the control menu regardless of whether or not the data-writing inhibit state is set. 7. The apparatus according to claim 1, wherein the writing control unit controls to read the control file to obtain a result of processing corresponding to the command written to the control file. 8. The apparatus according to claim 1, wherein the command and a result of processing corresponding to the command are written to a single control file. 9. The apparatus according to claim 1, wherein the control file has a flag area, and when the control instruction is accepted using the control menu, the writing control unit controls to change a state of a flag in the flag area. 10. The apparatus according to claim 9, wherein the command and the state of the flag are written to a single control file. 11. The apparatus according to claim 1, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit displays a notification on the display unit, the notification notifying that the data-writing inhibit state is set. 12. The apparatus according to claim 1, wherein the control apparatus is a mobile device. 13. The apparatus according to claim 1, wherein the processing is printing processing. 14. The apparatus according to claim 1, wherein the interface connects to the predetermined recording apparatus via a wired connection. 15. A control apparatus capable of being connected to a predetermined recording apparatus, which has a recording medium configured to record a control file and executes processing in accordance with a command that is written to the control file, the control apparatus comprising: a processor; and an interface configured to connect to a recording apparatus, wherein: the processor performs functions of at least a detecting unit, a display control unit, a writing control unit, and a first determination unit; the detecting unit is configured to detect that the predetermined recording apparatus is connected to the interface; the display control unit is configured to display, on a display unit, a control menu for accepting a control instruction to the predetermined recording apparatus by a user operation; the writing control unit is configured to control to write a command corresponding to the control instruction accepted using the control menu to the control file in the recording medium; and the first determination unit is configured to determine, in a state in which the predetermined recording apparatus is connected to the interface, whether or not a data-writing inhibit state is set by a hardware switch of the recording apparatus, wherein the data-writing inhibit state is a state for inhibiting data from being written to the recording medium, wherein if the detecting unit does not detect the connection of the predetermined recording apparatus, the display control unit controls the display unit so as to make a user, by a first display manner, recognize that the user cannot control the predetermined recording apparatus using the control menu, and wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit controls the display unit so as to make a user, by a second display manner which is different from the first display manner, recognize that the user cannot control the predetermined recording apparatus using the control menu. 16. The apparatus according to claim 15, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit controls to display the control menu in a manner that a selection on the control menu is impossible. 17. The apparatus according to claim 16, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit causes the control menu displayed on the display unit to be grayed out. 18. The apparatus according to claim 15, wherein the processor performs a function of a second determination unit, the second determination unit being configured to determine whether or not an apparatus connected to the interface is the predetermined recording apparatus, wherein if it is determined by the second determination unit that the apparatus connected to the interface is not the predetermined recording apparatus, the display control unit controls not to display the control menu regardless of whether or not the data-writing inhibit state is set. 19. The apparatus according to claim 17, wherein the processor performs a function of a second determination unit, the second determination unit being configured to determine whether or not an apparatus connected to the interface is the predetermined recording apparatus, wherein if it is determined by the second determination unit that the apparatus connected to the interface is not the predetermined recording apparatus, the display control unit controls not to display the control menu regardless of whether or not the data-writing inhibit state is set. 20. The apparatus according to claim 15, wherein the writing control unit controls to read the control file to obtain a result of processing corresponding to the command written to the control file. 21. The apparatus according to claim 15, wherein the command and a result of processing corresponding to the command are written to a single control file. 22. The apparatus according to claim 15, wherein the control file has a flag area, and when the control instruction is accepted using the control menu, the writing control unit controls to change a state of a flag in the flag area. 23. The apparatus according to claim 22, wherein the command and the state of the flag are written to a single control file. 24. The apparatus according to claim 15, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit displays a notification on the display unit, the notification notifying that the data-writing inhibit state is set. 25. The apparatus according to claim 15, wherein the control apparatus is a mobile device. 26. The apparatus according to claim 15, wherein the processing is printing processing. 27. The apparatus according to claim 15, wherein the interface connects to the predetermined recording apparatus via a wired connection.

There is provided a communication apparatus including a communication unit configured to communicate with a control apparatus, which has a recording unit and executes processing in accordance with a command that has been written to the recording unit, an accepting unit configured to accept selection of a command by a user, and a writing unit configured to write the selected command to the recording unit, the communication apparatus comprising: a sensing unit configured to sense connection to the control apparatus via the communication unit; a determination unit configured to determine whether the recording unit has been set to a write inhibit state if the connection has been sensed by the sensing unit; and a notification unit configured to notify the user of the fact that the recording unit has been set to the write inhibit state, if the determination unit determines that the recording unit has been set to the write inhibit state.1. A control apparatus capable of being connected to a predetermined recording apparatus, which has a recording medium configured to record a control file and executes processing in accordance with a command that is written to the control file, the control apparatus comprising: a processor; and an interface configured to connect to a recording apparatus, wherein: the processor performs functions of at least a display control unit, a writing control unit, and a first determination unit; the display control unit is configured to display, on a display unit, a control menu for accepting a control instruction to the predetermined recording apparatus by a user operation; the writing control unit is configured to control to write a command corresponding to the control instruction accepted using the control menu to the control file in the recording medium; and the first determination unit is configured to determine whether or not a data-writing inhibit state is set by a hardware switch of the recording apparatus after detecting connection to the predetermined recording apparatus and recognizing the predetermined recording apparatus, wherein the data-writing inhibit state is a state for inhibiting data from being written to the recording medium, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit controls the display unit so as to make a user recognize that the user cannot control the predetermined recording apparatus using the control menu. 2. The apparatus according to claim 1, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit controls not to display the control menu. 3. The apparatus according to claim 1, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit controls to display the control menu in a manner that a selection on the control menu is impossible. 4. The apparatus according to claim 3, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit causes the control menu displayed on the display unit to be grayed out. 5. The apparatus according to claim 1, wherein the processor performs a function of a second determination unit, the second determination unit being configured to determine whether or not an apparatus connected to the interface is the predetermined recording apparatus, wherein if it is determined by the second determination unit that the apparatus connected to the interface is not the predetermined recording apparatus, the display control unit controls not to display the control menu regardless of whether or not the data-writing inhibit state is set. 6. The apparatus according to claim 4, wherein the processor performs a function of a second determination unit, the second determination unit being configured to determine whether or not an apparatus connected to the interface is the predetermined recording apparatus, wherein if it is determined by the second determination unit that the apparatus connected to the interface is not the predetermined recording apparatus, the display control unit controls not to display the control menu regardless of whether or not the data-writing inhibit state is set. 7. The apparatus according to claim 1, wherein the writing control unit controls to read the control file to obtain a result of processing corresponding to the command written to the control file. 8. The apparatus according to claim 1, wherein the command and a result of processing corresponding to the command are written to a single control file. 9. The apparatus according to claim 1, wherein the control file has a flag area, and when the control instruction is accepted using the control menu, the writing control unit controls to change a state of a flag in the flag area. 10. The apparatus according to claim 9, wherein the command and the state of the flag are written to a single control file. 11. The apparatus according to claim 1, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit displays a notification on the display unit, the notification notifying that the data-writing inhibit state is set. 12. The apparatus according to claim 1, wherein the control apparatus is a mobile device. 13. The apparatus according to claim 1, wherein the processing is printing processing. 14. The apparatus according to claim 1, wherein the interface connects to the predetermined recording apparatus via a wired connection. 15. A control apparatus capable of being connected to a predetermined recording apparatus, which has a recording medium configured to record a control file and executes processing in accordance with a command that is written to the control file, the control apparatus comprising: a processor; and an interface configured to connect to a recording apparatus, wherein: the processor performs functions of at least a detecting unit, a display control unit, a writing control unit, and a first determination unit; the detecting unit is configured to detect that the predetermined recording apparatus is connected to the interface; the display control unit is configured to display, on a display unit, a control menu for accepting a control instruction to the predetermined recording apparatus by a user operation; the writing control unit is configured to control to write a command corresponding to the control instruction accepted using the control menu to the control file in the recording medium; and the first determination unit is configured to determine, in a state in which the predetermined recording apparatus is connected to the interface, whether or not a data-writing inhibit state is set by a hardware switch of the recording apparatus, wherein the data-writing inhibit state is a state for inhibiting data from being written to the recording medium, wherein if the detecting unit does not detect the connection of the predetermined recording apparatus, the display control unit controls the display unit so as to make a user, by a first display manner, recognize that the user cannot control the predetermined recording apparatus using the control menu, and wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit controls the display unit so as to make a user, by a second display manner which is different from the first display manner, recognize that the user cannot control the predetermined recording apparatus using the control menu. 16. The apparatus according to claim 15, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit controls to display the control menu in a manner that a selection on the control menu is impossible. 17. The apparatus according to claim 16, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit causes the control menu displayed on the display unit to be grayed out. 18. The apparatus according to claim 15, wherein the processor performs a function of a second determination unit, the second determination unit being configured to determine whether or not an apparatus connected to the interface is the predetermined recording apparatus, wherein if it is determined by the second determination unit that the apparatus connected to the interface is not the predetermined recording apparatus, the display control unit controls not to display the control menu regardless of whether or not the data-writing inhibit state is set. 19. The apparatus according to claim 17, wherein the processor performs a function of a second determination unit, the second determination unit being configured to determine whether or not an apparatus connected to the interface is the predetermined recording apparatus, wherein if it is determined by the second determination unit that the apparatus connected to the interface is not the predetermined recording apparatus, the display control unit controls not to display the control menu regardless of whether or not the data-writing inhibit state is set. 20. The apparatus according to claim 15, wherein the writing control unit controls to read the control file to obtain a result of processing corresponding to the command written to the control file. 21. The apparatus according to claim 15, wherein the command and a result of processing corresponding to the command are written to a single control file. 22. The apparatus according to claim 15, wherein the control file has a flag area, and when the control instruction is accepted using the control menu, the writing control unit controls to change a state of a flag in the flag area. 23. The apparatus according to claim 22, wherein the command and the state of the flag are written to a single control file. 24. The apparatus according to claim 15, wherein if it is determined by the first determination unit that the data-writing inhibit state is set, the display control unit displays a notification on the display unit, the notification notifying that the data-writing inhibit state is set. 25. The apparatus according to claim 15, wherein the control apparatus is a mobile device. 26. The apparatus according to claim 15, wherein the processing is printing processing. 27. The apparatus according to claim 15, wherein the interface connects to the predetermined recording apparatus via a wired connection.

An image forming apparatus includes a main body and an operation unit. The main body includes: a first storage storing device information of the apparatus; and a notifying unit notifying the operation unit of the device information when the apparatus starts up. The operation unit includes: a second storage storing placement information of display information associated with an instruction to process an application for the apparatus, and correspondence information of the device information and the placement information; an acquiring unit acquiring the device information; a selecting unit selecting placement information corresponding to the device information from the placement information; a checking unit checking whether an application of placement display information placed based on the placement information, has been installed on the apparatus; a placing unit placing the placement display information on a display information screen; and a display control unit displaying the display information screen with the placement display information.

1. An image forming apparatus comprising a main body unit and an operation unit, wherein the main body unit includes: a first storage unit configured to store therein device information on the image forming apparatus; and a notifying unit configured to notify the operation unit of the device information acquired from the first storage unit on the startup of the image forming apparatus, and the operation unit includes: a second storage unit configured to store therein placement information, which is information on placement of display information associated with an instruction to process an application available in the image forming apparatus, and correspondence information in which the device information is associated with the placement information; an acquiring unit configured to acquire the device information from the main body unit; a selecting unit configured to select placement information corresponding to the acquired device information from pieces of placement information stored in the second storage unit; a checking unit configured to check whether an application of placement display information, which is a piece of display information placed based on the selected placement information, has been installed on the image forming apparatus; a placing unit configured to place, when the application of the placement display information has been installed, the placement display information on a display information screen, which is a screen on which one or more pieces of display information are displayed, based on the selected placement information; and a display control unit configured to display the display information screen with the placement display information placed on a display unit. 2. The image forming apparatus according to claim 1, wherein the device information includes at least either one of destination information, which indicates the location where the image forming apparatus is used, and the model name of the image forming apparatus. 3. The image forming apparatus according to claim 2, wherein the placement information is placement position information that indicates the placement position of placement display information on the display information screen, the selecting unit selects placement position information corresponding to at least either one of the destination information and the model name, and the placing unit places the placement display information in the placement position on the display information screen indicated by the selected placement position information. 4. The image forming apparatus according to claim 3, wherein when the application of the placement display information has not been installed, the placing unit leaves the placement position on the display information screen indicated by the selected placement position information blank. 5. The image forming apparatus according to claim 1, wherein the placement information is placement order information that indicates the order in which pieces of placement display information are displayed when placed on the display information screen, and when the application of the placement display information has been installed, the placing unit determines a blank space on the display information screen in predetermined order, and places the placement display information in a space determined to be blank in accordance with the order indicated by the placement order information. 6. The image forming apparatus according to claim 5, wherein the display information screen has multiple pages broken down by theme, the second storage unit stores therein the placement order information on a page-by-page basis, and the placing unit determines a blank space on each page of the display information screen in the predetermined order on a page-by-page basis, and places placement display information in a space determined to be blank in accordance with the order indicated by the placement order information corresponding to the page. 7. The image forming apparatus according to claim 1, wherein the checking unit checks whether a new application has been installed on the image forming apparatus, and when a new application has been installed, the placing unit places display information of the new application in the placement position on the display information screen indicated by placement information attached to the new application. 8. An information processing method implemented by an operation unit of an image forming apparatus, the operation unit including a storage unit configured to store therein placement information, which is information on placement of display information associated with an instruction to process an application available in the image forming apparatus, and correspondence information in which device information on the image forming apparatus is associated with the placement information, the information processing method comprising: acquiring the device information; selecting placement information corresponding to the acquired device information from pieces of placement information stored in the storage unit; checking whether an application of placement display information, which is a piece of display information placed based on the selected placement information, has been installed on the image forming apparatus; placing, when the application of the placement display information has been installed, the placement display information on a display information screen, which is a screen on which one or more pieces of display information are displayed, based on the selected placement information; and displaying the display information screen with the placement display information placed on a display unit. 9. A non-transitory computer-readable recording medium having a computer program executed by a computer including a storage unit configured to store therein placement information, which is information on placement of display information associated with an instruction to process an application available in the computer, and correspondence information in which device information on the computer is associated with the placement information, the program causing the computer to execute: acquiring the device information; selecting placement information corresponding to the acquired device information from pieces of placement information stored in the storage unit; checking whether an application of placement display information, which is a piece of display information placed based on the selected placement information, has been installed on the computer; placing, when the application of the placement display information has been installed, the placement display information on a display information screen, which is a screen on which one or more pieces of display information are displayed, based on the selected placement information; and displaying the display information screen with the placement display information placed on a display unit.

An image forming apparatus includes a main body and an operation unit. The main body includes: a first storage storing device information of the apparatus; and a notifying unit notifying the operation unit of the device information when the apparatus starts up. The operation unit includes: a second storage storing placement information of display information associated with an instruction to process an application for the apparatus, and correspondence information of the device information and the placement information; an acquiring unit acquiring the device information; a selecting unit selecting placement information corresponding to the device information from the placement information; a checking unit checking whether an application of placement display information placed based on the placement information, has been installed on the apparatus; a placing unit placing the placement display information on a display information screen; and a display control unit displaying the display information screen with the placement display information.1. An image forming apparatus comprising a main body unit and an operation unit, wherein the main body unit includes: a first storage unit configured to store therein device information on the image forming apparatus; and a notifying unit configured to notify the operation unit of the device information acquired from the first storage unit on the startup of the image forming apparatus, and the operation unit includes: a second storage unit configured to store therein placement information, which is information on placement of display information associated with an instruction to process an application available in the image forming apparatus, and correspondence information in which the device information is associated with the placement information; an acquiring unit configured to acquire the device information from the main body unit; a selecting unit configured to select placement information corresponding to the acquired device information from pieces of placement information stored in the second storage unit; a checking unit configured to check whether an application of placement display information, which is a piece of display information placed based on the selected placement information, has been installed on the image forming apparatus; a placing unit configured to place, when the application of the placement display information has been installed, the placement display information on a display information screen, which is a screen on which one or more pieces of display information are displayed, based on the selected placement information; and a display control unit configured to display the display information screen with the placement display information placed on a display unit. 2. The image forming apparatus according to claim 1, wherein the device information includes at least either one of destination information, which indicates the location where the image forming apparatus is used, and the model name of the image forming apparatus. 3. The image forming apparatus according to claim 2, wherein the placement information is placement position information that indicates the placement position of placement display information on the display information screen, the selecting unit selects placement position information corresponding to at least either one of the destination information and the model name, and the placing unit places the placement display information in the placement position on the display information screen indicated by the selected placement position information. 4. The image forming apparatus according to claim 3, wherein when the application of the placement display information has not been installed, the placing unit leaves the placement position on the display information screen indicated by the selected placement position information blank. 5. The image forming apparatus according to claim 1, wherein the placement information is placement order information that indicates the order in which pieces of placement display information are displayed when placed on the display information screen, and when the application of the placement display information has been installed, the placing unit determines a blank space on the display information screen in predetermined order, and places the placement display information in a space determined to be blank in accordance with the order indicated by the placement order information. 6. The image forming apparatus according to claim 5, wherein the display information screen has multiple pages broken down by theme, the second storage unit stores therein the placement order information on a page-by-page basis, and the placing unit determines a blank space on each page of the display information screen in the predetermined order on a page-by-page basis, and places placement display information in a space determined to be blank in accordance with the order indicated by the placement order information corresponding to the page. 7. The image forming apparatus according to claim 1, wherein the checking unit checks whether a new application has been installed on the image forming apparatus, and when a new application has been installed, the placing unit places display information of the new application in the placement position on the display information screen indicated by placement information attached to the new application. 8. An information processing method implemented by an operation unit of an image forming apparatus, the operation unit including a storage unit configured to store therein placement information, which is information on placement of display information associated with an instruction to process an application available in the image forming apparatus, and correspondence information in which device information on the image forming apparatus is associated with the placement information, the information processing method comprising: acquiring the device information; selecting placement information corresponding to the acquired device information from pieces of placement information stored in the storage unit; checking whether an application of placement display information, which is a piece of display information placed based on the selected placement information, has been installed on the image forming apparatus; placing, when the application of the placement display information has been installed, the placement display information on a display information screen, which is a screen on which one or more pieces of display information are displayed, based on the selected placement information; and displaying the display information screen with the placement display information placed on a display unit. 9. A non-transitory computer-readable recording medium having a computer program executed by a computer including a storage unit configured to store therein placement information, which is information on placement of display information associated with an instruction to process an application available in the computer, and correspondence information in which device information on the computer is associated with the placement information, the program causing the computer to execute: acquiring the device information; selecting placement information corresponding to the acquired device information from pieces of placement information stored in the storage unit; checking whether an application of placement display information, which is a piece of display information placed based on the selected placement information, has been installed on the computer; placing, when the application of the placement display information has been installed, the placement display information on a display information screen, which is a screen on which one or more pieces of display information are displayed, based on the selected placement information; and displaying the display information screen with the placement display information placed on a display unit.

A system and method for representing quasi-periodic waveforms, for example, representing a plurality of limited decompositions of the quasi-periodic waveform. Each decomposition includes a first and second amplitude value and at least one time value. In some embodiments, each of the decompositions is phase adjusted such that the arithmetic sum of the plurality of limited decompositions reconstructs the quasi-periodic waveform. Data-structure attributes are created and used to reconstruct the quasi-periodic waveform. Features of the quasi-periodic wave are tracked using pattern-recognition techniques. The fundamental rate of the signal (e.g., heartbeat) can vary widely, for example by a factor of 2-3 or more from the lowest to highest frequency. To get quarter-phase representations of a component (e.g., lowest frequency “rate” component) that varies over time (by a factor of two to three) many overlapping filters use bandpass and overlap parameters that allow tracking the component's frequency version on changing quarter-phase basis.

1. An apparatus comprising: a computer having a storage device; a source of an initial series of digitized signal values; a first filter bank that includes a first plurality of digital bandpass filters each operably coupled to the source of digitized signal values and each configured to digitally filter the initial series of digitized signal values, wherein each one of the first plurality of digital bandpass filters has a respective center frequency that is unique among respective center frequencies of the first plurality of digital bandpass filters and a respective frequency range, and wherein each one of the first plurality of digital bandpass filters has an output signal; and a first frequency-component tracker that detects and tracks a first tracked frequency component as that first tracked frequency component's frequency moves from one to another frequency range of the first plurality of digital bandpass filters, and that stores information regarding the tracked frequency component into the storage device, wherein the stored information includes instantaneous frequency and amplitude of the tracked frequency component at each of a first sequence of time points. 2. The apparatus of claim 1, wherein each one of the first plurality of digital bandpass filters includes a filter based on a wavelet transform. 3. The apparatus of claim 1, wherein the first frequency-component tracker further includes: a fractional-phase output unit that determines a plurality of amplitude values and a plurality of four phase-determined time points per full waveform cycle of the first tracked frequency component, and that outputs a first series of respective data structures that each indicates the plurality of amplitude values, the plurality of phase-determined time points per respective full waveform cycle of the first tracked frequency component, and a per-time-point instantaneous frequency indication of the first tracked frequency component. 4. The apparatus of claim 1, further comprising: a first plurality of fractional-phase measurement units, each of which determines and outputs a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of an output of the corresponding one of the first plurality of digital bandpass filters; a fractional-phase maximum-amplitude determination unit that determines which one of the first plurality of fractional-phase measurement units has an amplitude value no lower than did any other one of the first plurality of fractional-phase measurement units during a time period and that outputs a selection signal based on the determination; and a first selector that selects information from at least one of the first plurality of fractional-phase measurement units based on the selection signal, and outputs the selected information and an indication of the center frequency of the corresponding at least one of the first plurality of digital bandpass filters, wherein the center frequency of the corresponding at least one of the first plurality of digital bandpass filters is determined by interpolation. 5. The apparatus of claim 4, wherein the fractional-phase maximum-amplitude determination unit further includes a data smoother that smoothes amplitude values from each of the first plurality of fractional-phase measurement units before the fractional-phase maximum-amplitude determination unit determines which one of the first plurality of fractional-phase measurement units has the amplitude value no lower than did any other one of the first plurality of fractional-phase measurement units during a time period. 6. The apparatus of claim 4, wherein the fractional-phase maximum-amplitude determination unit further includes a data smoother that smoothes amplitude values from each of the first plurality of digital bandpass filters before the fractional-phase maximum-amplitude determination unit determines and outputs a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of an output of the corresponding one of the first plurality of digital bandpass filters. 7. The apparatus of claim 1, wherein the first plurality of digital bandpass filters includes a first bandpass filter and a second, neighboring, bandpass filter, wherein the first bandpass filter has a maximum response at the respective center frequency of the first bandpass filter, wherein the second bandpass filter has a maximum response at the respective center frequency of the second bandpass filter, and wherein the first bandpass filter and the second bandpass filter have a cross-over point that is about −0.1 dB from either maximum response. 8. The apparatus of claim 1, further comprising: a first plurality of fractional-phase measurement units, each of which determines and outputs a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of an output of the corresponding one of the first plurality of digital bandpass filters; a second plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters has a respective center frequency that corresponds to the respective center frequency of one of the first plurality of digital bandpass filters and a frequency range that is narrower than the frequency range of the respective frequency range of the one of the first plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters includes a filter based on a wavelet transform, and wherein each one of the second plurality of digital bandpass filters has an output signal; and a second plurality of fractional-phase measurement units operatively coupled to receive the output signals from the second plurality of digital bandpass filters, wherein each of the second plurality of fractional-phase measurement units determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the second plurality of digital bandpass filters, wherein each one of the first plurality of digital bandpass filters includes a filter based on a wavelet transform; wherein the first plurality of digital bandpass filters includes a first bandpass filter and a second, neighboring, bandpass filter, wherein the first bandpass filter has a maximum response at the respective center frequency of the first bandpass filter, wherein the second bandpass filter has a maximum response at the respective center frequency of the second bandpass filter, and wherein the first bandpass filter and the second bandpass filter have a cross-over point that is about −0.1 dB from either maximum response, and wherein the first frequency-component tracker further includes: a fractional-phase maximum-amplitude determination unit that determines which one of the second plurality of fractional-phase measurement units had an amplitude value no lower than did any other one of the second plurality of fractional-phase measurement units during a time period and that outputs a selection signal based on the determination; and a selector that selects information from one of first plurality of fractional-phase measurement units based on the selection signal, and outputs the selected information and an indication of the center frequency of the corresponding one of the first plurality of digital bandpass filters. 9. The apparatus of claim 1, further comprising: a first plurality of fractional-phase measurement units, each of which determines and outputs a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of an output of the corresponding one of the first plurality of digital bandpass filters; a second plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters has a respective center frequency that corresponds to the respective center frequency of one of the first plurality of digital bandpass filters and a frequency range that is narrower than the frequency range of the respective frequency range of the one of the first plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters includes a filter based a wavelet transform, and wherein each one of the second plurality of digital bandpass filters has an output signal; a second plurality of fractional-phase measurement units operatively coupled to receive the output signals from the second plurality of digital bandpass filters, wherein each of the second plurality of fractional-phase measurement units determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the second plurality of digital bandpass filters, wherein each one of the first plurality of digital bandpass filters includes a filter based on a wavelet transform; and wherein the first frequency-component tracker further includes: a fractional-phase maximum-amplitude determination unit that determines which one of the second plurality of fractional-phase measurement units had an amplitude value no lower than did any other one of the second plurality of fractional-phase measurement units during a time period and that outputs a selection signal based on the determination; a selector that selects information from one of first plurality of fractional-phase measurement units based on the selection signal, and outputs the selected information and an indication of the center frequency of the corresponding one of the first plurality of digital bandpass filters; a third plurality of digital bandpass filters, wherein each one of the third plurality of digital bandpass filters has a center frequency that is unique among the third plurality of digital bandpass filters, wherein each one of the third plurality of digital bandpass filters includes a filter based a wavelet transform, and wherein each one of the third plurality of digital bandpass filters has an output signal; and a third plurality of fractional-phase measurement units operatively coupled to receive the output signals from the third plurality of digital bandpass filters, wherein each of the third plurality of fractional-phase measurement units determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the third plurality of digital bandpass filters. 10. The apparatus of claim 1, further comprising: a first plurality of fractional-phase measurement units, each of which determines and outputs a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of an output of the corresponding one of the first plurality of digital bandpass filters; a second plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters has a respective center frequency that corresponds to the respective center frequency of one of the first plurality of digital bandpass filters and a frequency range that is narrower than the frequency range of the respective frequency range of the one of the first plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters includes a filter based on a wavelet transform, and wherein each one of the second plurality of digital bandpass filters has an output signal; a second plurality of fractional-phase measurement units operatively coupled to receive the output signals from the second plurality of digital bandpass filters, wherein each of the second plurality of fractional-phase measurement units determines and outputs a series of QP objects, wherein each one of the series of QP objects has a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the second plurality of digital bandpass filters; and wherein each one of the first plurality of digital bandpass filters includes a filter based on a wavelet transform; and wherein the first frequency-component tracker further includes: a fractional-phase maximum-amplitude determination unit that determines which one of the second plurality of fractional-phase measurement units had an amplitude value no lower than did any other one of the second plurality of fractional-phase measurement units during a time period and that outputs a selection signal based on the determination; a selector that selects information from one of first plurality of fractional-phase measurement units based on the selection signal, and outputs the selected information and an indication of the center frequency of the corresponding one of the first plurality of digital bandpass filters. 11. A computer-implemented method comprising: sensing a quasi-periodic signal and generating an initial series of digitized signal values based on the sensed signal; digitally filtering the initial series of digitized signal values in a computer to generate a first plurality of digitally bandpass-filtered signals, wherein each one of the first plurality of digitally bandpass-filtered signals has a respective center frequency that is unique among respective center frequencies of the first plurality of digitally bandpass-filtered signals and a respective frequency range that overlaps the respective frequency range of a closest neighboring one of the first plurality of digitally bandpass-filtered signals; detecting and tracking, in the computer, a first tracked frequency component as that first tracked frequency component's main component moves from one to another frequency range of the first plurality of digitally bandpass-filtered signals; storing information regarding the tracked frequency component into a storage device; and automatically generating an interpretation of the quasi-periodic waveform using the information processor and based on the information regarding the tracked frequency component, and generating relevant information from the interpretation. 12. The computer-implemented method of claim 11, wherein the digitally filtering includes filtering the initial series of digitized signal values to generate a plurality of wavelet-transformed signals, based on a wavelet transform. 13. The computer-implemented method of claim 11, wherein the detecting and tracking of the first frequency component further includes: determining a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of the first tracked frequency component, and outputting a first series of respective fractional-phase data structures that each indicates the plurality of amplitude values, the plurality of phase-determined time points per respective full waveform cycle of the first tracked frequency component, and a per-cycle center frequency of the first tracked frequency component for the respective full waveform cycle of the first tracked frequency component. 14. The computer-implemented method of claim 11, further comprising: performing a first plurality of fractional-phase measurements, each of which determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the first plurality of digital bandpass filters; wherein each one of the first plurality of digitally bandpass-filtered signals is a wavelet-bandpass-filtered signal; and wherein the detecting and tracking of the first tracked frequency component further includes: determining which one of the first plurality of fractional-phase measurements had an amplitude value no lower than did any other one of the first plurality of fractional-phase measurements during a time period and outputting a selection signal based on the determination; and selecting information from one of first plurality of fractional-phase measurements based on the selection signal, and outputting the selected information and an indication of the center frequency of the corresponding one of the first plurality of digital bandpass filters. 15. The computer-implemented method of claim 11, wherein each one of the first plurality of digitally bandpass-filtered signals is a wavelet-transformed filtered signal; and wherein the detecting and tracking of the first frequency component further includes: performing a first plurality of fractional-phase measurements, each of which determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the first plurality of digitally bandpass-filtered signals; determining which one of the first plurality of fractional-phase measurements has an amplitude value no lower than did any other one of the first plurality of fractional-phase measurements during a time period and outputting a selection signal based on the determination; and selecting information from one of the first plurality of fractional-phase measurements based on the selection signal, and outputting the selected information and an indication of the center frequency of the corresponding one of the first plurality of digitally bandpass-filtered signals. 16. The computer-implemented method of claim 11, wherein the first plurality of digitally bandpass-filtered signals includes a first bandpass-filtered signal and a second, neighboring, bandpass-filtered signal, wherein the first bandpass-filtered signal has a maximum response at the respective center frequency of the first bandpass-filtered signal, wherein the second bandpass-filtered signal has a maximum response at the respective center frequency of the second bandpass-filtered signal, and wherein the first bandpass-filtered signal and the second bandpass-filtered signal have a cross-over point that is about −0.1 dB from either maximum response. 17. The computer-implemented method of claim 11, further comprising: performing a first plurality of fractional-phase measurements, each of which determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the first plurality of digital bandpass filters, wherein each one of the first plurality of digitally bandpass-filtered signals is a wavelet-transformed frequency-filtered signal, wherein the detecting and tracking of the first frequency component further includes: determining which one of the first plurality of fractional-phase measurements had an amplitude value no lower than did any other one of the first plurality of fractional-phase measurements during a time period and outputting a selection signal based on the determination; and selecting information from one of first plurality of fractional-phase measurements based on the selection signal, and outputting the selected information and an indication of the center frequency of the corresponding one of the first plurality of digitally bandpass-filtered signals; digitally filtering the initial series of digitized signal values in a computer to generate a second plurality of digitally bandpass-filtered signals, wherein each one of the second plurality of digitally bandpass-filtered signals has a center frequency that is unique among the second plurality of digitally bandpass-filtered signals and a frequency range that overlaps the frequency range of a closest neighboring one of the second plurality of digitally bandpass-filtered signals, wherein each one of the second plurality of digitally bandpass-filtered signals is a wavelet-transformed frequency-filtered signal; and performing a second plurality of fractional-phase measurements, each of which determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the second plurality of digitally bandpass-filtered signals. 18. The computer-implemented method of claim 11, wherein the initial series of digitized signal values represent certain types of internet messages, wherein the method further includes: tracking and recording a particular frequency component of the certain types of internet messages; and analyzing the recorded particular frequency component to help predict a human activity. 19. A non-transitory computer-readable storage medium having instructions stored thereon, wherein the instructions, when executed by a suitably programmed computer, perform a method comprising: digitally filtering an initial series of digitized signal values in a computer to generate a first plurality of digitally bandpass-filtered signals, wherein each one of the first plurality of digitally bandpass-filtered signals has a respective center frequency that is unique among respective center frequencies of the first plurality of digitally bandpass-filtered signals and a respective frequency range that overlaps the respective frequency range of a closest neighboring one of the first plurality of digitally bandpass-filtered signals; detecting and tracking, in the computer, a first tracked frequency component as that first tracked frequency component's main component moves from one to another frequency range of the first plurality of digitally bandpass-filtered signals; and storing information regarding the tracked frequency component into a storage device. 20. The non-transitory computer-readable storage medium of claim 19, wherein the initial series of digitized signal values represent a seismic signal, and wherein the instructions, when executed by the computer, cause the method to further include: tracking and recording a particular frequency component of the seismic signal; and analyzing the recorded particular frequency component to help predict earthquakes.

A system and method for representing quasi-periodic waveforms, for example, representing a plurality of limited decompositions of the quasi-periodic waveform. Each decomposition includes a first and second amplitude value and at least one time value. In some embodiments, each of the decompositions is phase adjusted such that the arithmetic sum of the plurality of limited decompositions reconstructs the quasi-periodic waveform. Data-structure attributes are created and used to reconstruct the quasi-periodic waveform. Features of the quasi-periodic wave are tracked using pattern-recognition techniques. The fundamental rate of the signal (e.g., heartbeat) can vary widely, for example by a factor of 2-3 or more from the lowest to highest frequency. To get quarter-phase representations of a component (e.g., lowest frequency “rate” component) that varies over time (by a factor of two to three) many overlapping filters use bandpass and overlap parameters that allow tracking the component's frequency version on changing quarter-phase basis.1. An apparatus comprising: a computer having a storage device; a source of an initial series of digitized signal values; a first filter bank that includes a first plurality of digital bandpass filters each operably coupled to the source of digitized signal values and each configured to digitally filter the initial series of digitized signal values, wherein each one of the first plurality of digital bandpass filters has a respective center frequency that is unique among respective center frequencies of the first plurality of digital bandpass filters and a respective frequency range, and wherein each one of the first plurality of digital bandpass filters has an output signal; and a first frequency-component tracker that detects and tracks a first tracked frequency component as that first tracked frequency component's frequency moves from one to another frequency range of the first plurality of digital bandpass filters, and that stores information regarding the tracked frequency component into the storage device, wherein the stored information includes instantaneous frequency and amplitude of the tracked frequency component at each of a first sequence of time points. 2. The apparatus of claim 1, wherein each one of the first plurality of digital bandpass filters includes a filter based on a wavelet transform. 3. The apparatus of claim 1, wherein the first frequency-component tracker further includes: a fractional-phase output unit that determines a plurality of amplitude values and a plurality of four phase-determined time points per full waveform cycle of the first tracked frequency component, and that outputs a first series of respective data structures that each indicates the plurality of amplitude values, the plurality of phase-determined time points per respective full waveform cycle of the first tracked frequency component, and a per-time-point instantaneous frequency indication of the first tracked frequency component. 4. The apparatus of claim 1, further comprising: a first plurality of fractional-phase measurement units, each of which determines and outputs a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of an output of the corresponding one of the first plurality of digital bandpass filters; a fractional-phase maximum-amplitude determination unit that determines which one of the first plurality of fractional-phase measurement units has an amplitude value no lower than did any other one of the first plurality of fractional-phase measurement units during a time period and that outputs a selection signal based on the determination; and a first selector that selects information from at least one of the first plurality of fractional-phase measurement units based on the selection signal, and outputs the selected information and an indication of the center frequency of the corresponding at least one of the first plurality of digital bandpass filters, wherein the center frequency of the corresponding at least one of the first plurality of digital bandpass filters is determined by interpolation. 5. The apparatus of claim 4, wherein the fractional-phase maximum-amplitude determination unit further includes a data smoother that smoothes amplitude values from each of the first plurality of fractional-phase measurement units before the fractional-phase maximum-amplitude determination unit determines which one of the first plurality of fractional-phase measurement units has the amplitude value no lower than did any other one of the first plurality of fractional-phase measurement units during a time period. 6. The apparatus of claim 4, wherein the fractional-phase maximum-amplitude determination unit further includes a data smoother that smoothes amplitude values from each of the first plurality of digital bandpass filters before the fractional-phase maximum-amplitude determination unit determines and outputs a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of an output of the corresponding one of the first plurality of digital bandpass filters. 7. The apparatus of claim 1, wherein the first plurality of digital bandpass filters includes a first bandpass filter and a second, neighboring, bandpass filter, wherein the first bandpass filter has a maximum response at the respective center frequency of the first bandpass filter, wherein the second bandpass filter has a maximum response at the respective center frequency of the second bandpass filter, and wherein the first bandpass filter and the second bandpass filter have a cross-over point that is about −0.1 dB from either maximum response. 8. The apparatus of claim 1, further comprising: a first plurality of fractional-phase measurement units, each of which determines and outputs a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of an output of the corresponding one of the first plurality of digital bandpass filters; a second plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters has a respective center frequency that corresponds to the respective center frequency of one of the first plurality of digital bandpass filters and a frequency range that is narrower than the frequency range of the respective frequency range of the one of the first plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters includes a filter based on a wavelet transform, and wherein each one of the second plurality of digital bandpass filters has an output signal; and a second plurality of fractional-phase measurement units operatively coupled to receive the output signals from the second plurality of digital bandpass filters, wherein each of the second plurality of fractional-phase measurement units determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the second plurality of digital bandpass filters, wherein each one of the first plurality of digital bandpass filters includes a filter based on a wavelet transform; wherein the first plurality of digital bandpass filters includes a first bandpass filter and a second, neighboring, bandpass filter, wherein the first bandpass filter has a maximum response at the respective center frequency of the first bandpass filter, wherein the second bandpass filter has a maximum response at the respective center frequency of the second bandpass filter, and wherein the first bandpass filter and the second bandpass filter have a cross-over point that is about −0.1 dB from either maximum response, and wherein the first frequency-component tracker further includes: a fractional-phase maximum-amplitude determination unit that determines which one of the second plurality of fractional-phase measurement units had an amplitude value no lower than did any other one of the second plurality of fractional-phase measurement units during a time period and that outputs a selection signal based on the determination; and a selector that selects information from one of first plurality of fractional-phase measurement units based on the selection signal, and outputs the selected information and an indication of the center frequency of the corresponding one of the first plurality of digital bandpass filters. 9. The apparatus of claim 1, further comprising: a first plurality of fractional-phase measurement units, each of which determines and outputs a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of an output of the corresponding one of the first plurality of digital bandpass filters; a second plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters has a respective center frequency that corresponds to the respective center frequency of one of the first plurality of digital bandpass filters and a frequency range that is narrower than the frequency range of the respective frequency range of the one of the first plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters includes a filter based a wavelet transform, and wherein each one of the second plurality of digital bandpass filters has an output signal; a second plurality of fractional-phase measurement units operatively coupled to receive the output signals from the second plurality of digital bandpass filters, wherein each of the second plurality of fractional-phase measurement units determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the second plurality of digital bandpass filters, wherein each one of the first plurality of digital bandpass filters includes a filter based on a wavelet transform; and wherein the first frequency-component tracker further includes: a fractional-phase maximum-amplitude determination unit that determines which one of the second plurality of fractional-phase measurement units had an amplitude value no lower than did any other one of the second plurality of fractional-phase measurement units during a time period and that outputs a selection signal based on the determination; a selector that selects information from one of first plurality of fractional-phase measurement units based on the selection signal, and outputs the selected information and an indication of the center frequency of the corresponding one of the first plurality of digital bandpass filters; a third plurality of digital bandpass filters, wherein each one of the third plurality of digital bandpass filters has a center frequency that is unique among the third plurality of digital bandpass filters, wherein each one of the third plurality of digital bandpass filters includes a filter based a wavelet transform, and wherein each one of the third plurality of digital bandpass filters has an output signal; and a third plurality of fractional-phase measurement units operatively coupled to receive the output signals from the third plurality of digital bandpass filters, wherein each of the third plurality of fractional-phase measurement units determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the third plurality of digital bandpass filters. 10. The apparatus of claim 1, further comprising: a first plurality of fractional-phase measurement units, each of which determines and outputs a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of an output of the corresponding one of the first plurality of digital bandpass filters; a second plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters has a respective center frequency that corresponds to the respective center frequency of one of the first plurality of digital bandpass filters and a frequency range that is narrower than the frequency range of the respective frequency range of the one of the first plurality of digital bandpass filters, wherein each one of the second plurality of digital bandpass filters includes a filter based on a wavelet transform, and wherein each one of the second plurality of digital bandpass filters has an output signal; a second plurality of fractional-phase measurement units operatively coupled to receive the output signals from the second plurality of digital bandpass filters, wherein each of the second plurality of fractional-phase measurement units determines and outputs a series of QP objects, wherein each one of the series of QP objects has a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the second plurality of digital bandpass filters; and wherein each one of the first plurality of digital bandpass filters includes a filter based on a wavelet transform; and wherein the first frequency-component tracker further includes: a fractional-phase maximum-amplitude determination unit that determines which one of the second plurality of fractional-phase measurement units had an amplitude value no lower than did any other one of the second plurality of fractional-phase measurement units during a time period and that outputs a selection signal based on the determination; a selector that selects information from one of first plurality of fractional-phase measurement units based on the selection signal, and outputs the selected information and an indication of the center frequency of the corresponding one of the first plurality of digital bandpass filters. 11. A computer-implemented method comprising: sensing a quasi-periodic signal and generating an initial series of digitized signal values based on the sensed signal; digitally filtering the initial series of digitized signal values in a computer to generate a first plurality of digitally bandpass-filtered signals, wherein each one of the first plurality of digitally bandpass-filtered signals has a respective center frequency that is unique among respective center frequencies of the first plurality of digitally bandpass-filtered signals and a respective frequency range that overlaps the respective frequency range of a closest neighboring one of the first plurality of digitally bandpass-filtered signals; detecting and tracking, in the computer, a first tracked frequency component as that first tracked frequency component's main component moves from one to another frequency range of the first plurality of digitally bandpass-filtered signals; storing information regarding the tracked frequency component into a storage device; and automatically generating an interpretation of the quasi-periodic waveform using the information processor and based on the information regarding the tracked frequency component, and generating relevant information from the interpretation. 12. The computer-implemented method of claim 11, wherein the digitally filtering includes filtering the initial series of digitized signal values to generate a plurality of wavelet-transformed signals, based on a wavelet transform. 13. The computer-implemented method of claim 11, wherein the detecting and tracking of the first frequency component further includes: determining a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of the first tracked frequency component, and outputting a first series of respective fractional-phase data structures that each indicates the plurality of amplitude values, the plurality of phase-determined time points per respective full waveform cycle of the first tracked frequency component, and a per-cycle center frequency of the first tracked frequency component for the respective full waveform cycle of the first tracked frequency component. 14. The computer-implemented method of claim 11, further comprising: performing a first plurality of fractional-phase measurements, each of which determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the first plurality of digital bandpass filters; wherein each one of the first plurality of digitally bandpass-filtered signals is a wavelet-bandpass-filtered signal; and wherein the detecting and tracking of the first tracked frequency component further includes: determining which one of the first plurality of fractional-phase measurements had an amplitude value no lower than did any other one of the first plurality of fractional-phase measurements during a time period and outputting a selection signal based on the determination; and selecting information from one of first plurality of fractional-phase measurements based on the selection signal, and outputting the selected information and an indication of the center frequency of the corresponding one of the first plurality of digital bandpass filters. 15. The computer-implemented method of claim 11, wherein each one of the first plurality of digitally bandpass-filtered signals is a wavelet-transformed filtered signal; and wherein the detecting and tracking of the first frequency component further includes: performing a first plurality of fractional-phase measurements, each of which determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the first plurality of digitally bandpass-filtered signals; determining which one of the first plurality of fractional-phase measurements has an amplitude value no lower than did any other one of the first plurality of fractional-phase measurements during a time period and outputting a selection signal based on the determination; and selecting information from one of the first plurality of fractional-phase measurements based on the selection signal, and outputting the selected information and an indication of the center frequency of the corresponding one of the first plurality of digitally bandpass-filtered signals. 16. The computer-implemented method of claim 11, wherein the first plurality of digitally bandpass-filtered signals includes a first bandpass-filtered signal and a second, neighboring, bandpass-filtered signal, wherein the first bandpass-filtered signal has a maximum response at the respective center frequency of the first bandpass-filtered signal, wherein the second bandpass-filtered signal has a maximum response at the respective center frequency of the second bandpass-filtered signal, and wherein the first bandpass-filtered signal and the second bandpass-filtered signal have a cross-over point that is about −0.1 dB from either maximum response. 17. The computer-implemented method of claim 11, further comprising: performing a first plurality of fractional-phase measurements, each of which determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the first plurality of digital bandpass filters, wherein each one of the first plurality of digitally bandpass-filtered signals is a wavelet-transformed frequency-filtered signal, wherein the detecting and tracking of the first frequency component further includes: determining which one of the first plurality of fractional-phase measurements had an amplitude value no lower than did any other one of the first plurality of fractional-phase measurements during a time period and outputting a selection signal based on the determination; and selecting information from one of first plurality of fractional-phase measurements based on the selection signal, and outputting the selected information and an indication of the center frequency of the corresponding one of the first plurality of digitally bandpass-filtered signals; digitally filtering the initial series of digitized signal values in a computer to generate a second plurality of digitally bandpass-filtered signals, wherein each one of the second plurality of digitally bandpass-filtered signals has a center frequency that is unique among the second plurality of digitally bandpass-filtered signals and a frequency range that overlaps the frequency range of a closest neighboring one of the second plurality of digitally bandpass-filtered signals, wherein each one of the second plurality of digitally bandpass-filtered signals is a wavelet-transformed frequency-filtered signal; and performing a second plurality of fractional-phase measurements, each of which determines a plurality of amplitude values and a plurality of phase-determined time points per full waveform cycle of a corresponding one of the second plurality of digitally bandpass-filtered signals. 18. The computer-implemented method of claim 11, wherein the initial series of digitized signal values represent certain types of internet messages, wherein the method further includes: tracking and recording a particular frequency component of the certain types of internet messages; and analyzing the recorded particular frequency component to help predict a human activity. 19. A non-transitory computer-readable storage medium having instructions stored thereon, wherein the instructions, when executed by a suitably programmed computer, perform a method comprising: digitally filtering an initial series of digitized signal values in a computer to generate a first plurality of digitally bandpass-filtered signals, wherein each one of the first plurality of digitally bandpass-filtered signals has a respective center frequency that is unique among respective center frequencies of the first plurality of digitally bandpass-filtered signals and a respective frequency range that overlaps the respective frequency range of a closest neighboring one of the first plurality of digitally bandpass-filtered signals; detecting and tracking, in the computer, a first tracked frequency component as that first tracked frequency component's main component moves from one to another frequency range of the first plurality of digitally bandpass-filtered signals; and storing information regarding the tracked frequency component into a storage device. 20. The non-transitory computer-readable storage medium of claim 19, wherein the initial series of digitized signal values represent a seismic signal, and wherein the instructions, when executed by the computer, cause the method to further include: tracking and recording a particular frequency component of the seismic signal; and analyzing the recorded particular frequency component to help predict earthquakes.

An apparatus equipped with a fax function, including: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data relating to a fax number that does not exist in an address book so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, and the control unit: performs control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to at least one of a fax number that does not exist in the address book and the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data corresponds to neither the fax number that does not exist in the address book nor the specific fax number that is set by the first setting; and performs control so that, in a case where the second setting is not set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number.

1. An apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data relating to a fax number that does not exist in an address book so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, wherein the control unit: performs control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to at least one of a fax number that does not exist in the address book and the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data corresponds to neither the fax number that does not exist in the address book nor the specific fax number that is set by the first setting; and performs control so that, in a case where the second setting is not set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number. 2. The apparatus according to claim 1, wherein the user interface is a user interface with which it is possible to perform the first setting and the second setting on the same operation screen. 3. An apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data the fax number of the source of transmission of which cannot be acquired so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, wherein the control unit: performs control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that at least one of two facts is true that the fax number of the source of transmission of the received fax data cannot be acquired and that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that neither of the two facts is true, and performs control so that, in a case where the second setting is not set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number. 4. The apparatus according to claim 3, wherein the user interface is a user interface with which it is possible to perform the first setting and the second setting on the same operation screen. 5. A control method of an apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data relating to a fax number that does not exist in an address book so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, the control method comprising the steps of: performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to at least one of a fax number that does not exist in the address book and the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data corresponds neither the fax number that does not exist in the address book nor the specific fax number that is set by the first setting; and performing control so that, in a case where the second setting is not set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number. 6. A control method of an apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data the fax number of the source of transmission of which cannot be acquired so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, the control method comprising the steps of: performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that at least one of two facts is true that the fax number of the source of transmission of the received fax data cannot be acquired and that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that neither of the two facts is true; and performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number. 7. A non-transitory computer readable storage medium storing a program for causing a computer to perform a control method of an apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data relating to a fax number that does not exist in an address book so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, the control method comprising the steps of: performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to at least one of a fax number that does not exist in the address book and the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data corresponds neither the fax number that does not exist in the address book nor the specific fax number that is set by the first setting; and performing control so that, in a case where the second setting is not set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number. 8. A non-transitory computer readable storage medium storing a program for causing a computer to perform a control method of an apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data the fax number of the source of transmission of which cannot be acquired so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, the control method comprising the steps of: performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that at least one of two facts is true that the fax number of the source of transmission of the received fax data cannot be acquired and that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that neither of the two facts is true; and performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number.

An apparatus equipped with a fax function, including: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data relating to a fax number that does not exist in an address book so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, and the control unit: performs control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to at least one of a fax number that does not exist in the address book and the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data corresponds to neither the fax number that does not exist in the address book nor the specific fax number that is set by the first setting; and performs control so that, in a case where the second setting is not set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number.1. An apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data relating to a fax number that does not exist in an address book so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, wherein the control unit: performs control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to at least one of a fax number that does not exist in the address book and the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data corresponds to neither the fax number that does not exist in the address book nor the specific fax number that is set by the first setting; and performs control so that, in a case where the second setting is not set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number. 2. The apparatus according to claim 1, wherein the user interface is a user interface with which it is possible to perform the first setting and the second setting on the same operation screen. 3. An apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data the fax number of the source of transmission of which cannot be acquired so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, wherein the control unit: performs control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that at least one of two facts is true that the fax number of the source of transmission of the received fax data cannot be acquired and that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that neither of the two facts is true, and performs control so that, in a case where the second setting is not set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performs control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number. 4. The apparatus according to claim 3, wherein the user interface is a user interface with which it is possible to perform the first setting and the second setting on the same operation screen. 5. A control method of an apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data relating to a fax number that does not exist in an address book so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, the control method comprising the steps of: performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to at least one of a fax number that does not exist in the address book and the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data corresponds neither the fax number that does not exist in the address book nor the specific fax number that is set by the first setting; and performing control so that, in a case where the second setting is not set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number. 6. A control method of an apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data the fax number of the source of transmission of which cannot be acquired so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, the control method comprising the steps of: performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that at least one of two facts is true that the fax number of the source of transmission of the received fax data cannot be acquired and that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that neither of the two facts is true; and performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number. 7. A non-transitory computer readable storage medium storing a program for causing a computer to perform a control method of an apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data relating to a fax number that does not exist in an address book so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, the control method comprising the steps of: performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to at least one of a fax number that does not exist in the address book and the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data corresponds neither the fax number that does not exist in the address book nor the specific fax number that is set by the first setting; and performing control so that, in a case where the second setting is not set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number. 8. A non-transitory computer readable storage medium storing a program for causing a computer to perform a control method of an apparatus equipped with a fax function, the apparatus comprising: a user interface that performs a first setting that can set received fax data relating to one or more specific fax numbers so that a printout of the received fax data is not produced and a second setting that can set received fax data the fax number of the source of transmission of which cannot be acquired so that a printout of the received fax data is not produced; and a control unit configured to control production of a printout of received fax data in accordance with the first and second settings, the control method comprising the steps of: performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that at least one of two facts is true that the fax number of the source of transmission of the received fax data cannot be acquired and that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that neither of the two facts is true; and performing control so that, in a case where the second setting is set, a printout of the received fax data is not produced on a condition that the fax number of the source of transmission of the received fax data corresponds to the specific fax number that is set by the first setting, and performing control so that a printout of the received fax data is produced on a condition that the fax number of the source of transmission of the received fax data does not correspond to the specific fax number.

Aspects of the disclosure provide compositions or compounds for activating or enhancing expression of SMN. Further aspects provide compositions and kits, e.g., comprising single stranded oligonucleotides, for activating or enhancing expression of SMN that comprises exon 7. Methods for modulating expression of SMN are also provided.

1. A compound for increasing expression of SMN protein in a human cell, the compound comprising: a first oligonucleotide comprising at least 8 contiguous nucleotides complementary with the sequence set forth as: ATCTGTTCCACTATG (SEQ ID NO: 1); and a second oligonucleotide that is complementary with a splice control sequence of SMN2 pre-messenger RNA and that promotes inclusion of exon 7 of the SMN2 pre-messenger RNA, wherein the first and second oligonucleotides are covalently linked. 2. The compound of claim 1, wherein the first and second oligonucleotides are covalently linked via an oligonucleotide linker. 3. The compound of claim 1 or 2, wherein the oligonucleotide linker comprises a sequence set forth as Wn, wherein W is a nucleotide selected from A, T, and U, and n is a integer selected from 2, 3 and 4, representing the number of instances of W. 4. The compound of claim 3, wherein each instance of W is A. 5. The compound of claim 4, wherein n is 2 or 3. 6. The compound of claim 4 or 5, wherein the oligonucleotide linker comprises phosphodiester bonds between each instance of W. 7. The compound of any one of claims 1 to 6, wherein the first oligonucleotide has a length in a range of 8 to 14 nucleotides. 8. The compound of any one of claims 1 to 7, wherein the first oligonucleotide has a length in a range of 8 to 10 nucleotides. 9. The compound of any one of claims 1 to 8, wherein the first oligonucleotide comprises at least 8 contiguous nucleotides of the sequence set forth as: AGUGGAACA. 10. The compound of any one of claims 1 to 9, wherein the second oligonucleotide comprises a region of complementarity complementary with at least 8 contiguous nucleotides of the sequence set forth as: GUAAGUCUGCCAGCAUUAUGAAAG (SEQ ID NO: 2). 11. The compound of any one of claims 1 to 10, wherein the region of complementarity is complementary with at least 8 contiguous nucleotides of the sequence set forth as: CUGCCAGCAUUAUGAAAG (SEQ ID NO: 3). 12. The compound of any one of claims 1 to 11, wherein the region of complementarity is complementary with at least 8 contiguous nucleotides of the sequence set forth as: CCAGCAUUAUGAAAG (SEQ ID NO: 4). 13. The compound of any one of claims 1 to 12, wherein the second oligonucleotide has a sequence set forth as TCACTTTCATAATGC (SEQ ID NO: 17). 14. The compound of any one of claims 1 to 12, wherein the second oligonucleotide has a sequence set forth as ACTTTCATAATGCTGG (SEQ ID NO: 20). 15. The compound of any one of claims 1 to 11, wherein the region of complementarity is complementary with the sequence set forth as: CUGCCAGC. 16. The compound of any one of claims 1 to 13, wherein the first oligonucleotide has a sequence set forth as CATAGTGGAACAGAT (SEQ ID NO: 14) and the second oligonucleotide has a sequence set forth as GCUGGCAG or GCTGGCAG, wherein the first oligonucleotide and the second oligonucleotide linker are covalently linked by an oligonucleotide linker. 17. The compound of claim 16, wherein the oligonucleotide linker has a sequence of AA or AAA. 18. The compound of any one of claims 1 to 17, wherein each nucleotide of the first oligonucleotide is a 2′-modified nucleotide. 19. The compound of any one of claims 1 to 18, wherein each nucleotide of the second oligonucleotide is a 2′-modified nucleotide. 20. The compound of claim 18 or 19, wherein at least one 2′-modified nucleotide is a bridged nucleotide comprising a 2′-4′ methylene bridge. 21. The compound of any one of claims 1 to 20, wherein at least 60% of the nucleotides of the first oligonucleotide are bridged nucleotides. 22. The compound of any one of claims 1 to 21, wherein at least 60% of the nucleotides of the second oligonucleotide are bridged nucleotides. 23. The compound of any one of claims 20 to 22, wherein each bridged nucleotide comprises a 2′-4′ methylene bridge. 24. The compound of any one of claims 1 to 23, wherein the first oligonucleotide comprises at least one phosphorothioate internucleotide linkage. 25. The compound of any one of claims 1 to 24, wherein the second oligonucleotide comprises at least one phosphorothioate internucleotide linkage. 26. A composition for increasing expression of SMN protein, the composition comprising: i) a first oligonucleotide having a nucleotide sequence consisting of 8 to 14 contiguous nucleotides complementary with the nucleotide sequence set forth as: ATCTGTTCCACTATG (SEQ ID NO: 1); and ii) an SMN splice correcting agent that promotes inclusion of exon 7 of the SMN2 pre-messenger RNA. 27. The composition of claim 26, wherein the SMN splice correcting agent is a small molecule or an oligonucleotide. 28. The composition of claim 27, wherein the SMN splice correcting agent is a second oligonucleotide that is complementary with a splice control sequence of SMN2 pre-messenger RNA and that promotes inclusion of exon 7 of the SMN2 pre-messenger RNA. 29. The composition of claim 26, wherein the first oligonucleotide has a length in a range of 8 to 10 nucleotides. 30. The composition of any one of claims 26 to 29, wherein the first oligonucleotide comprises at least 8 contiguous nucleotides of the sequence set forth as: AGUGGAACA. 31. The composition of any one of claims 28 to 30, wherein the second oligonucleotide comprises a region of complementarity complementary with at least 8 contiguous nucleotides of the sequence set forth as: GUAAGUCUGCCAGCAUUAUGAAAG (SEQ ID NO: 2). 32. The composition of any one of claims 28 to 31, wherein the region of complementarity is complementary with at least 8 contiguous nucleotides of the sequence set forth as: CUGCCAGCAUUAUGAAAG (SEQ ID NO: 3). 33. The composition of any one of claims 28 to 32, wherein the region of complementarity is complementary with at least 8 contiguous nucleotides of the sequence set forth as: CCAGCAUUAUGAAAG (SEQ ID NO: 4). 34. The composition of any one of claims 28 to 33, wherein the second oligonucleotide has a sequence set forth as TCACTTTCATAATGC (SEQ ID NO: 17). 35. The composition of any one of claims 28 to 33, wherein the second oligonucleotide has a sequence set forth as ACTTTCATAATGCTGG (SEQ ID NO: 20). 36. The composition of any one of claims 28 to 33, wherein the region of complementarity of the second oligonucleotide is complementary with the sequence set forth as: CUGCCAGC. 37. The composition of any one of claims 26 to 36, wherein each nucleotide of the first oligonucleotide is a 2′-modified nucleotide. 38. The composition of any one of claims 26 to 37, wherein each nucleotide of the second oligonucleotide is a 2′-modified nucleotide. 39. The composition of claim 37 or 38, wherein at least one 2′-modified nucleotide is a bridged nucleotide comprising a 2′-4′ methylene bridge. 40. The composition of any one of claims 26 to 39, wherein at least 60% of the nucleotides of the first oligonucleotide are bridged nucleotides. 41. The composition of any one of claims 28 to 40, wherein at least 60% of the nucleotides of the second oligonucleotide are bridged nucleotides. 42. The composition of claim 40 or 41, wherein each bridged nucleotide comprises a 2′-4′ methylene bridge. 43. The composition of any one of claims 26 to 42, wherein the first oligonucleotide comprises at least one phosphorothioate internucleotide linkage. 44. The composition of any one of claims 28 to 43, wherein the second oligonucleotide comprises at least one phosphorothioate internucleotide linkage. 45. A method of increasing expression of SMN protein in a cell, the method comprising delivering to the cell a compound or composition of any one of claims 1 to 44 in an amount effective for increasing expression of SMN protein in the cell. 46. A method of treating expression of SMN protein in a cell, the method comprising delivering to the cell an oligonucleotide of any one of claims 1 to 44 in an amount effective for increasing expression of SMN protein in the cell. 47. A method of treating spinal muscular atrophy (SMA) in a subject, the method comprising administering to the subject a composition comprising: i) an oligonucleotide complementary with a PRC2-associated region of SMN; and ii) an SMN splice correcting agent. 48. The method of claim 47, wherein the oligonucleotide has a nucleotide sequence consisting of 8 to 14 contiguous nucleotides complementary with the PRC2-associated region SMN. 49. The method of claim 47, wherein the oligonucleotide has a nucleotide sequence consisting of 8 to 14 contiguous nucleotides complementary with the nucleotide sequence set forth as: ATCTGTTCCACTATG (SEQ ID NO: 1); 50. The method of claim 48, wherein the SMN splice correcting agent promotes inclusion of exon 7 of the SMN2 pre-messenger RNA. 51. A method of treating spinal muscular atrophy (SMA) in a subject, the method comprising administering to the subject a composition comprising: i) a first oligonucleotide having a nucleotide sequence consisting of 8 to 14 contiguous nucleotides complementary with the nucleotide sequence set forth as: ATCTGTTCCACTATG (SEQ ID NO: 1); and ii) an SMN splice correcting agent that promotes inclusion of exon 7 of the SMN2 pre-messenger RNA. 52. The method of claim 51, wherein the SMN splice correcting agent is a small molecule or an oligonucleotide. 53. The method of claim 51, wherein the SMN splice correcting agent is a second oligonucleotide that is complementary with a splice control sequence of SMN2 pre-messenger RNA and that promotes inclusion of exon 7 of the SMN2 pre-messenger RNA. 54. The method of any one of claims 51 to 53, wherein the first oligonucleotide has a length in a range of 8 to 10 nucleotides. 55. The method of any one of claims 51 to 54, wherein the first oligonucleotide and the SMN splice correcting agent is linked via a linker. 56. The method of claim 55, wherein the linker is an oligonucleotide linker. 57. The method of claim 56, wherein the oligonucleotide linker comprises a sequence set forth as Wn, wherein W is a nucleotide selected from A, T, and U, and n is a integer selected from 2, 3 and 4, representing the number of instances of W. 58. The method of claim 57, wherein each instance of W is A. 59. The method of claim 57 or 58, wherein n is 2 or 3. 60. The method of any one of claims 51 to 59, wherein the first oligonucleotide and the SMN splice correcting agent are separated.

Aspects of the disclosure provide compositions or compounds for activating or enhancing expression of SMN. Further aspects provide compositions and kits, e.g., comprising single stranded oligonucleotides, for activating or enhancing expression of SMN that comprises exon 7. Methods for modulating expression of SMN are also provided.1. A compound for increasing expression of SMN protein in a human cell, the compound comprising: a first oligonucleotide comprising at least 8 contiguous nucleotides complementary with the sequence set forth as: ATCTGTTCCACTATG (SEQ ID NO: 1); and a second oligonucleotide that is complementary with a splice control sequence of SMN2 pre-messenger RNA and that promotes inclusion of exon 7 of the SMN2 pre-messenger RNA, wherein the first and second oligonucleotides are covalently linked. 2. The compound of claim 1, wherein the first and second oligonucleotides are covalently linked via an oligonucleotide linker. 3. The compound of claim 1 or 2, wherein the oligonucleotide linker comprises a sequence set forth as Wn, wherein W is a nucleotide selected from A, T, and U, and n is a integer selected from 2, 3 and 4, representing the number of instances of W. 4. The compound of claim 3, wherein each instance of W is A. 5. The compound of claim 4, wherein n is 2 or 3. 6. The compound of claim 4 or 5, wherein the oligonucleotide linker comprises phosphodiester bonds between each instance of W. 7. The compound of any one of claims 1 to 6, wherein the first oligonucleotide has a length in a range of 8 to 14 nucleotides. 8. The compound of any one of claims 1 to 7, wherein the first oligonucleotide has a length in a range of 8 to 10 nucleotides. 9. The compound of any one of claims 1 to 8, wherein the first oligonucleotide comprises at least 8 contiguous nucleotides of the sequence set forth as: AGUGGAACA. 10. The compound of any one of claims 1 to 9, wherein the second oligonucleotide comprises a region of complementarity complementary with at least 8 contiguous nucleotides of the sequence set forth as: GUAAGUCUGCCAGCAUUAUGAAAG (SEQ ID NO: 2). 11. The compound of any one of claims 1 to 10, wherein the region of complementarity is complementary with at least 8 contiguous nucleotides of the sequence set forth as: CUGCCAGCAUUAUGAAAG (SEQ ID NO: 3). 12. The compound of any one of claims 1 to 11, wherein the region of complementarity is complementary with at least 8 contiguous nucleotides of the sequence set forth as: CCAGCAUUAUGAAAG (SEQ ID NO: 4). 13. The compound of any one of claims 1 to 12, wherein the second oligonucleotide has a sequence set forth as TCACTTTCATAATGC (SEQ ID NO: 17). 14. The compound of any one of claims 1 to 12, wherein the second oligonucleotide has a sequence set forth as ACTTTCATAATGCTGG (SEQ ID NO: 20). 15. The compound of any one of claims 1 to 11, wherein the region of complementarity is complementary with the sequence set forth as: CUGCCAGC. 16. The compound of any one of claims 1 to 13, wherein the first oligonucleotide has a sequence set forth as CATAGTGGAACAGAT (SEQ ID NO: 14) and the second oligonucleotide has a sequence set forth as GCUGGCAG or GCTGGCAG, wherein the first oligonucleotide and the second oligonucleotide linker are covalently linked by an oligonucleotide linker. 17. The compound of claim 16, wherein the oligonucleotide linker has a sequence of AA or AAA. 18. The compound of any one of claims 1 to 17, wherein each nucleotide of the first oligonucleotide is a 2′-modified nucleotide. 19. The compound of any one of claims 1 to 18, wherein each nucleotide of the second oligonucleotide is a 2′-modified nucleotide. 20. The compound of claim 18 or 19, wherein at least one 2′-modified nucleotide is a bridged nucleotide comprising a 2′-4′ methylene bridge. 21. The compound of any one of claims 1 to 20, wherein at least 60% of the nucleotides of the first oligonucleotide are bridged nucleotides. 22. The compound of any one of claims 1 to 21, wherein at least 60% of the nucleotides of the second oligonucleotide are bridged nucleotides. 23. The compound of any one of claims 20 to 22, wherein each bridged nucleotide comprises a 2′-4′ methylene bridge. 24. The compound of any one of claims 1 to 23, wherein the first oligonucleotide comprises at least one phosphorothioate internucleotide linkage. 25. The compound of any one of claims 1 to 24, wherein the second oligonucleotide comprises at least one phosphorothioate internucleotide linkage. 26. A composition for increasing expression of SMN protein, the composition comprising: i) a first oligonucleotide having a nucleotide sequence consisting of 8 to 14 contiguous nucleotides complementary with the nucleotide sequence set forth as: ATCTGTTCCACTATG (SEQ ID NO: 1); and ii) an SMN splice correcting agent that promotes inclusion of exon 7 of the SMN2 pre-messenger RNA. 27. The composition of claim 26, wherein the SMN splice correcting agent is a small molecule or an oligonucleotide. 28. The composition of claim 27, wherein the SMN splice correcting agent is a second oligonucleotide that is complementary with a splice control sequence of SMN2 pre-messenger RNA and that promotes inclusion of exon 7 of the SMN2 pre-messenger RNA. 29. The composition of claim 26, wherein the first oligonucleotide has a length in a range of 8 to 10 nucleotides. 30. The composition of any one of claims 26 to 29, wherein the first oligonucleotide comprises at least 8 contiguous nucleotides of the sequence set forth as: AGUGGAACA. 31. The composition of any one of claims 28 to 30, wherein the second oligonucleotide comprises a region of complementarity complementary with at least 8 contiguous nucleotides of the sequence set forth as: GUAAGUCUGCCAGCAUUAUGAAAG (SEQ ID NO: 2). 32. The composition of any one of claims 28 to 31, wherein the region of complementarity is complementary with at least 8 contiguous nucleotides of the sequence set forth as: CUGCCAGCAUUAUGAAAG (SEQ ID NO: 3). 33. The composition of any one of claims 28 to 32, wherein the region of complementarity is complementary with at least 8 contiguous nucleotides of the sequence set forth as: CCAGCAUUAUGAAAG (SEQ ID NO: 4). 34. The composition of any one of claims 28 to 33, wherein the second oligonucleotide has a sequence set forth as TCACTTTCATAATGC (SEQ ID NO: 17). 35. The composition of any one of claims 28 to 33, wherein the second oligonucleotide has a sequence set forth as ACTTTCATAATGCTGG (SEQ ID NO: 20). 36. The composition of any one of claims 28 to 33, wherein the region of complementarity of the second oligonucleotide is complementary with the sequence set forth as: CUGCCAGC. 37. The composition of any one of claims 26 to 36, wherein each nucleotide of the first oligonucleotide is a 2′-modified nucleotide. 38. The composition of any one of claims 26 to 37, wherein each nucleotide of the second oligonucleotide is a 2′-modified nucleotide. 39. The composition of claim 37 or 38, wherein at least one 2′-modified nucleotide is a bridged nucleotide comprising a 2′-4′ methylene bridge. 40. The composition of any one of claims 26 to 39, wherein at least 60% of the nucleotides of the first oligonucleotide are bridged nucleotides. 41. The composition of any one of claims 28 to 40, wherein at least 60% of the nucleotides of the second oligonucleotide are bridged nucleotides. 42. The composition of claim 40 or 41, wherein each bridged nucleotide comprises a 2′-4′ methylene bridge. 43. The composition of any one of claims 26 to 42, wherein the first oligonucleotide comprises at least one phosphorothioate internucleotide linkage. 44. The composition of any one of claims 28 to 43, wherein the second oligonucleotide comprises at least one phosphorothioate internucleotide linkage. 45. A method of increasing expression of SMN protein in a cell, the method comprising delivering to the cell a compound or composition of any one of claims 1 to 44 in an amount effective for increasing expression of SMN protein in the cell. 46. A method of treating expression of SMN protein in a cell, the method comprising delivering to the cell an oligonucleotide of any one of claims 1 to 44 in an amount effective for increasing expression of SMN protein in the cell. 47. A method of treating spinal muscular atrophy (SMA) in a subject, the method comprising administering to the subject a composition comprising: i) an oligonucleotide complementary with a PRC2-associated region of SMN; and ii) an SMN splice correcting agent. 48. The method of claim 47, wherein the oligonucleotide has a nucleotide sequence consisting of 8 to 14 contiguous nucleotides complementary with the PRC2-associated region SMN. 49. The method of claim 47, wherein the oligonucleotide has a nucleotide sequence consisting of 8 to 14 contiguous nucleotides complementary with the nucleotide sequence set forth as: ATCTGTTCCACTATG (SEQ ID NO: 1); 50. The method of claim 48, wherein the SMN splice correcting agent promotes inclusion of exon 7 of the SMN2 pre-messenger RNA. 51. A method of treating spinal muscular atrophy (SMA) in a subject, the method comprising administering to the subject a composition comprising: i) a first oligonucleotide having a nucleotide sequence consisting of 8 to 14 contiguous nucleotides complementary with the nucleotide sequence set forth as: ATCTGTTCCACTATG (SEQ ID NO: 1); and ii) an SMN splice correcting agent that promotes inclusion of exon 7 of the SMN2 pre-messenger RNA. 52. The method of claim 51, wherein the SMN splice correcting agent is a small molecule or an oligonucleotide. 53. The method of claim 51, wherein the SMN splice correcting agent is a second oligonucleotide that is complementary with a splice control sequence of SMN2 pre-messenger RNA and that promotes inclusion of exon 7 of the SMN2 pre-messenger RNA. 54. The method of any one of claims 51 to 53, wherein the first oligonucleotide has a length in a range of 8 to 10 nucleotides. 55. The method of any one of claims 51 to 54, wherein the first oligonucleotide and the SMN splice correcting agent is linked via a linker. 56. The method of claim 55, wherein the linker is an oligonucleotide linker. 57. The method of claim 56, wherein the oligonucleotide linker comprises a sequence set forth as Wn, wherein W is a nucleotide selected from A, T, and U, and n is a integer selected from 2, 3 and 4, representing the number of instances of W. 58. The method of claim 57, wherein each instance of W is A. 59. The method of claim 57 or 58, wherein n is 2 or 3. 60. The method of any one of claims 51 to 59, wherein the first oligonucleotide and the SMN splice correcting agent are separated.

Aspects of the disclosure provide steric-blocking oligonucleotide-based methods of modulating expression of target genes, e.g., by targeting non-coding RNA scaffolds.

1. A method of producing a steric-blocking oligonucleotide, the method comprising: determining that a non-coding RNA scaffold has a first interaction region that interacts with a repressor of a target gene and a second interaction region that interacts with an activator of the target gene; and producing a steric-blocking oligonucleotide having a region of complementarity that is complementary with the first interaction region or the second interaction region. 2. The method of claim 1, wherein the steric-blocking oligonucleotide is complementary with the first interaction region and selectively inhibits interaction of the repressor with the non-coding RNA scaffold. 3. The method of claim 1 or 2, wherein the steric-blocking oligonucleotide is complementary with the second interaction region and selectively inhibits interaction of the activator with the non-coding RNA scaffold. 4. The method of claim 1, wherein the repressor is a Polycomb Repressive Complex or a subunit thereof. 5. The method of claim 4, wherein the repressor is Polycomb Repressive Complex 1 or 2. 6. The method of claim 4, wherein the repressor is SUZ12, EZH2, EED, AEBP2, JARID2, PCL, RbAp46/48, or EZH1. 7. The method of claim 1, wherein the activator is a histone methyltransferase. 8. The method of claim 7, wherein the activator is SETD2. 9. The method of any one of claims 1 to 8, wherein the region of complementarity is at least 8 contiguous nucleotides in length. 10. The method of any one of claims 1 to 8, wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 11. The method of any one of claims 1 to 8, wherein the steric-blocking oligonucleotide is between 8 and 20 nucleotides in length and wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 12. The method of any one of claims 1 to 11, wherein the steric-blocking oligonucleotide is a mixmer. 13. The method of any one of claims 1 to 12, wherein the non-coding RNA scaffold is expressed from a chromosomal locus containing the target gene. 14. The method of any one of claims 1 to 13, wherein the steric-blocking oligonucleotide modulates expression of the target gene when delivered to a cell containing the target gene. 15. A method of preparing a steric-blocking oligonucleotide, the method comprising: determining that a non-coding RNA scaffold interacts with an activator of the target gene and a repressor of the target gene; identifying an interaction region of the non-coding RNA that interacts with either the activator or the repressor, but not both; and preparing a steric-blocking oligonucleotide having a region of complementarity that is complementary with the interaction region. 16. A method of modulating expression of a target gene in a cell, the method comprising: delivering to the cell an effective amount of a steric-blocking oligonucleotide, wherein the cell expresses a non-coding RNA scaffold, wherein prior to delivering the steric-blocking oligonucleotide it has been determined that the non-coding RNA scaffold has a first interaction region that interacts with a repressor of the target gene and a second interaction region that interacts with an activator of the target gene, and wherein the steric-blocking oligonucleotide has a region of complementarity that is complementary with the first interaction region or the second interaction region. 17. The method of claim 16, wherein the steric-blocking oligonucleotide is complementary with the first interaction region and selectively inhibits interaction of the repressor with the non-coding RNA scaffold. 18. The method of claim 16, wherein the steric-blocking oligonucleotide is complementary with the second interaction region and selectively inhibits interaction of the activator with the non-coding RNA scaffold. 19. The method of any one of claims 16 to 18, wherein the target gene is an SMN gene. 20. The method of claim 16, wherein the repressor is a Polycomb Repressive Complex 2 subunit. 21. The method of claim 20, wherein the repressor is SUZ12, EZH2, EED, AEBP2, JARID2, PCL, RbAp46/48, or EZH1. 22. The method of claim 16, wherein the activator is a hi stone methyltransferase. 23. The method of claim 22, wherein the activator is SETD2. 24. The method of any one of claims 16 to 23, wherein the region of complementarity is at least 8 contiguous nucleotides in length. 25. The method of any one of claims 16 to 24, wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 26. The method of any one of claims 16 to 24, wherein the steric-blocking oligonucleotide is between 8 and 20 nucleotides in length and wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 27. The method of any one of claims 16 to 26, wherein the steric-blocking oligonucleotide is a mixmer. 28. The method of any one of claims 16 to 27, wherein the cell is in vivo. 29. The method of any one of claims 16 to 28, wherein the cell is in vitro. 30. The method of any one of claims 16 to 29, wherein the non-coding RNA scaffold is expressed from a chromosomal locus containing the target gene. 31. A method of modulating expression of a target gene in a cell, wherein it has been determined that a non-coding RNA interacts with both an activator of the target gene and a repressor of a target gene, the method comprising: delivering to the cell a steric-blocking oligonucleotide having a region of complementarity that is complementary with a region of the non-coding RNA that interacts with either the activator or the repressor, but not both. 32. A method of increasing expression of a target gene in a cell, the method comprising: delivering to the cell an effective amount of a steric-blocking oligonucleotide, wherein the cell expresses a non-coding RNA, wherein prior to delivering the steric-blocking oligonucleotide it has been determined that the non-coding RNA scaffold has a first interaction region that interacts with a repressor of the target gene and a second interaction region that interacts with an activator of the target gene, wherein the steric-blocking oligonucleotide has a region of complementarity that is complementary with the first interaction region. 33. The method of claim 32, wherein displacement of the repressor from the first interaction region indicates effectiveness of the steric-blocking oligonucleotide. 34. The method of claim 32, wherein the steric-blocking oligonucleotide is complementary with the first interaction region and selectively inhibits interaction of the repressor with the non-coding RNA scaffold. 35. The method of any one of claims 32 to 34, wherein the target gene is an SMN gene. 36. The method of claim 32, wherein the repressor is a Polycomb Repressive Complex 2 subunit. 37. The method of claim 36, wherein the repressor is SUZ12, EZH2, EED, AEBP2, JARID2, PCL, RbAp46/48, or EZH1. 38. The method of claim 32, wherein the activator is a histone methyltransferase. 39. The method of claim 38, wherein the activator is SETD2. 40. The method of any one of claims 32 to 39, wherein the region of complementarity is at least 8 contiguous nucleotides in length. 41. The method of any one of claims 32 to 39, wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 42. The method of any one of claims 32 to 41, wherein the steric-blocking oligonucleotide is between 8 and 20 nucleotides in length and wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 43. The method of any one of claims 32 to 42, wherein the steric-blocking oligonucleotide is a mixmer. 44. The method of any one of claims 32 to 43, wherein the cell is in vivo. 45. The method of any one of claims 32 to 43, wherein the cell is in vitro. 46. The method of any one of claims 32 to 45, wherein the non-coding RNA scaffold is expressed from a chromosomal locus containing the target gene. 47. A method of increasing expression of a target gene in a cell, the method comprising: delivering to the cell a steric-blocking oligonucleotide having a region of complementarity that is complementary with a region of the non-coding RNA scaffold that interacts with a repressor of the target gene, wherein displacement of the repressor from the non-coding RNA, without displacement an activator of the target gene that also interacts with the non-coding RNA scaffold, indicates effectiveness of the steric-blocking oligonucleotide.

Aspects of the disclosure provide steric-blocking oligonucleotide-based methods of modulating expression of target genes, e.g., by targeting non-coding RNA scaffolds.1. A method of producing a steric-blocking oligonucleotide, the method comprising: determining that a non-coding RNA scaffold has a first interaction region that interacts with a repressor of a target gene and a second interaction region that interacts with an activator of the target gene; and producing a steric-blocking oligonucleotide having a region of complementarity that is complementary with the first interaction region or the second interaction region. 2. The method of claim 1, wherein the steric-blocking oligonucleotide is complementary with the first interaction region and selectively inhibits interaction of the repressor with the non-coding RNA scaffold. 3. The method of claim 1 or 2, wherein the steric-blocking oligonucleotide is complementary with the second interaction region and selectively inhibits interaction of the activator with the non-coding RNA scaffold. 4. The method of claim 1, wherein the repressor is a Polycomb Repressive Complex or a subunit thereof. 5. The method of claim 4, wherein the repressor is Polycomb Repressive Complex 1 or 2. 6. The method of claim 4, wherein the repressor is SUZ12, EZH2, EED, AEBP2, JARID2, PCL, RbAp46/48, or EZH1. 7. The method of claim 1, wherein the activator is a histone methyltransferase. 8. The method of claim 7, wherein the activator is SETD2. 9. The method of any one of claims 1 to 8, wherein the region of complementarity is at least 8 contiguous nucleotides in length. 10. The method of any one of claims 1 to 8, wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 11. The method of any one of claims 1 to 8, wherein the steric-blocking oligonucleotide is between 8 and 20 nucleotides in length and wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 12. The method of any one of claims 1 to 11, wherein the steric-blocking oligonucleotide is a mixmer. 13. The method of any one of claims 1 to 12, wherein the non-coding RNA scaffold is expressed from a chromosomal locus containing the target gene. 14. The method of any one of claims 1 to 13, wherein the steric-blocking oligonucleotide modulates expression of the target gene when delivered to a cell containing the target gene. 15. A method of preparing a steric-blocking oligonucleotide, the method comprising: determining that a non-coding RNA scaffold interacts with an activator of the target gene and a repressor of the target gene; identifying an interaction region of the non-coding RNA that interacts with either the activator or the repressor, but not both; and preparing a steric-blocking oligonucleotide having a region of complementarity that is complementary with the interaction region. 16. A method of modulating expression of a target gene in a cell, the method comprising: delivering to the cell an effective amount of a steric-blocking oligonucleotide, wherein the cell expresses a non-coding RNA scaffold, wherein prior to delivering the steric-blocking oligonucleotide it has been determined that the non-coding RNA scaffold has a first interaction region that interacts with a repressor of the target gene and a second interaction region that interacts with an activator of the target gene, and wherein the steric-blocking oligonucleotide has a region of complementarity that is complementary with the first interaction region or the second interaction region. 17. The method of claim 16, wherein the steric-blocking oligonucleotide is complementary with the first interaction region and selectively inhibits interaction of the repressor with the non-coding RNA scaffold. 18. The method of claim 16, wherein the steric-blocking oligonucleotide is complementary with the second interaction region and selectively inhibits interaction of the activator with the non-coding RNA scaffold. 19. The method of any one of claims 16 to 18, wherein the target gene is an SMN gene. 20. The method of claim 16, wherein the repressor is a Polycomb Repressive Complex 2 subunit. 21. The method of claim 20, wherein the repressor is SUZ12, EZH2, EED, AEBP2, JARID2, PCL, RbAp46/48, or EZH1. 22. The method of claim 16, wherein the activator is a hi stone methyltransferase. 23. The method of claim 22, wherein the activator is SETD2. 24. The method of any one of claims 16 to 23, wherein the region of complementarity is at least 8 contiguous nucleotides in length. 25. The method of any one of claims 16 to 24, wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 26. The method of any one of claims 16 to 24, wherein the steric-blocking oligonucleotide is between 8 and 20 nucleotides in length and wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 27. The method of any one of claims 16 to 26, wherein the steric-blocking oligonucleotide is a mixmer. 28. The method of any one of claims 16 to 27, wherein the cell is in vivo. 29. The method of any one of claims 16 to 28, wherein the cell is in vitro. 30. The method of any one of claims 16 to 29, wherein the non-coding RNA scaffold is expressed from a chromosomal locus containing the target gene. 31. A method of modulating expression of a target gene in a cell, wherein it has been determined that a non-coding RNA interacts with both an activator of the target gene and a repressor of a target gene, the method comprising: delivering to the cell a steric-blocking oligonucleotide having a region of complementarity that is complementary with a region of the non-coding RNA that interacts with either the activator or the repressor, but not both. 32. A method of increasing expression of a target gene in a cell, the method comprising: delivering to the cell an effective amount of a steric-blocking oligonucleotide, wherein the cell expresses a non-coding RNA, wherein prior to delivering the steric-blocking oligonucleotide it has been determined that the non-coding RNA scaffold has a first interaction region that interacts with a repressor of the target gene and a second interaction region that interacts with an activator of the target gene, wherein the steric-blocking oligonucleotide has a region of complementarity that is complementary with the first interaction region. 33. The method of claim 32, wherein displacement of the repressor from the first interaction region indicates effectiveness of the steric-blocking oligonucleotide. 34. The method of claim 32, wherein the steric-blocking oligonucleotide is complementary with the first interaction region and selectively inhibits interaction of the repressor with the non-coding RNA scaffold. 35. The method of any one of claims 32 to 34, wherein the target gene is an SMN gene. 36. The method of claim 32, wherein the repressor is a Polycomb Repressive Complex 2 subunit. 37. The method of claim 36, wherein the repressor is SUZ12, EZH2, EED, AEBP2, JARID2, PCL, RbAp46/48, or EZH1. 38. The method of claim 32, wherein the activator is a histone methyltransferase. 39. The method of claim 38, wherein the activator is SETD2. 40. The method of any one of claims 32 to 39, wherein the region of complementarity is at least 8 contiguous nucleotides in length. 41. The method of any one of claims 32 to 39, wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 42. The method of any one of claims 32 to 41, wherein the steric-blocking oligonucleotide is between 8 and 20 nucleotides in length and wherein the region of complementarity is in a range of 8 to 20 nucleotides in length. 43. The method of any one of claims 32 to 42, wherein the steric-blocking oligonucleotide is a mixmer. 44. The method of any one of claims 32 to 43, wherein the cell is in vivo. 45. The method of any one of claims 32 to 43, wherein the cell is in vitro. 46. The method of any one of claims 32 to 45, wherein the non-coding RNA scaffold is expressed from a chromosomal locus containing the target gene. 47. A method of increasing expression of a target gene in a cell, the method comprising: delivering to the cell a steric-blocking oligonucleotide having a region of complementarity that is complementary with a region of the non-coding RNA scaffold that interacts with a repressor of the target gene, wherein displacement of the repressor from the non-coding RNA, without displacement an activator of the target gene that also interacts with the non-coding RNA scaffold, indicates effectiveness of the steric-blocking oligonucleotide.

An object of this invention is to provide a novel delivery means that enables efficient delivery of an active ingredient to a target cell. Such objective is attained by a lipoplex comprising dioleylphosphatidylethanolamine (DOPE), phosphatidylcholine, a cationic lipid, and an RNAi molecule and an industrial method for producing the same.

1. A method for producing a lipoplex comprising dioleylphosphatidylethanolamine (DOPE), phosphatidylcholine, a cationic lipid, and RNAi molecules, comprising steps of: (a) dissolving in alcohol dioleylphosphatidylethanolamine (DOPE), phosphatidylcholine, wherein the phosphatidylcholine is 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), palmitoyl-oeoyl phosphatidylcholine (POPC), or 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), and a cationic lipid, wherein the cationic lipid is O,O′-ditetradecanoyl-N-(α-trimethylammonioacetyl)diethanolamine chloride (DC-6-14); (b) adding the alcohol solution obtained in (a) dropwise to a solution of RNAi molecules with agitation; and (c) lyophilizing the solution obtained in (b). 2. (canceled) 3. (canceled) 4. The method according to claim 1, wherein the phosphatidylcholine is DOPC. 5. The method according to claim 1, wherein step (a) comprises dissolving and mixing DOPE, DOPC, and DC-6-14 in alcohol. 6. The method according to any one of claim 1, 4, or 5, which further comprises step (d) of mixing the lyophilized product obtained in step (c) in a buffer. 7. A pharmaceutical composition used for topical administration aimed at treatment of peritoneal metastasis of gastric cancer, ovarian cancer, and pancreatic cancer, which comprises: a lipid mixture consisting of dioleylphosphatidylethanolamine (DOPE), phosphatidylcholine, wherein the phosphatidylcholine is 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), palmitoyl-oeoyl phosphatidylcholine (POPC), or 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), and a cationic lipid, wherein the cationic lipid is O,O′-ditetradecanoyl-N-(α-trimethylammonioacetyl)diethanolamine chloride (DC-6-14); and short hairpin RNA (shRNA) capable of inhibiting thymidylate synthase expression via RNAi (TS-shRNA). 8. (canceled) 9. The pharmaceutical composition according to claim 7, wherein the phosphatidylcholine is DOPC. 10. The pharmaceutical composition according to claim 7, wherein the lipid mixture consists of DOPE, DOPC, and DC-6-14. 11. The pharmaceutical composition according to claim 10, which comprises DOPE, DOPC, and DC-6-14 at a molar ratio of 3:2:5. 12. The pharmaceutical composition according to claim 7, wherein the shRNA consists of the nucleotide sequence as shown in SEQ ID NO: 8. 13. The pharmaceutical composition according to claim 7, which is used in combination with a cancer chemotherapeutic agent. 14. A combined product comprising the pharmaceutical composition according to any one of claims 7 and 9-13 and a cancer chemotherapeutic agent. 15. The combined product according to claim 14, wherein the cancer chemotherapeutic agent is selected from the group consisting of an antitumor agent having microtubule depolymerization inhibitory action, a deoxycytidine derivative, and an antitumor agent having TS inhibitory action.

An object of this invention is to provide a novel delivery means that enables efficient delivery of an active ingredient to a target cell. Such objective is attained by a lipoplex comprising dioleylphosphatidylethanolamine (DOPE), phosphatidylcholine, a cationic lipid, and an RNAi molecule and an industrial method for producing the same.1. A method for producing a lipoplex comprising dioleylphosphatidylethanolamine (DOPE), phosphatidylcholine, a cationic lipid, and RNAi molecules, comprising steps of: (a) dissolving in alcohol dioleylphosphatidylethanolamine (DOPE), phosphatidylcholine, wherein the phosphatidylcholine is 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), palmitoyl-oeoyl phosphatidylcholine (POPC), or 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), and a cationic lipid, wherein the cationic lipid is O,O′-ditetradecanoyl-N-(α-trimethylammonioacetyl)diethanolamine chloride (DC-6-14); (b) adding the alcohol solution obtained in (a) dropwise to a solution of RNAi molecules with agitation; and (c) lyophilizing the solution obtained in (b). 2. (canceled) 3. (canceled) 4. The method according to claim 1, wherein the phosphatidylcholine is DOPC. 5. The method according to claim 1, wherein step (a) comprises dissolving and mixing DOPE, DOPC, and DC-6-14 in alcohol. 6. The method according to any one of claim 1, 4, or 5, which further comprises step (d) of mixing the lyophilized product obtained in step (c) in a buffer. 7. A pharmaceutical composition used for topical administration aimed at treatment of peritoneal metastasis of gastric cancer, ovarian cancer, and pancreatic cancer, which comprises: a lipid mixture consisting of dioleylphosphatidylethanolamine (DOPE), phosphatidylcholine, wherein the phosphatidylcholine is 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), palmitoyl-oeoyl phosphatidylcholine (POPC), or 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), and a cationic lipid, wherein the cationic lipid is O,O′-ditetradecanoyl-N-(α-trimethylammonioacetyl)diethanolamine chloride (DC-6-14); and short hairpin RNA (shRNA) capable of inhibiting thymidylate synthase expression via RNAi (TS-shRNA). 8. (canceled) 9. The pharmaceutical composition according to claim 7, wherein the phosphatidylcholine is DOPC. 10. The pharmaceutical composition according to claim 7, wherein the lipid mixture consists of DOPE, DOPC, and DC-6-14. 11. The pharmaceutical composition according to claim 10, which comprises DOPE, DOPC, and DC-6-14 at a molar ratio of 3:2:5. 12. The pharmaceutical composition according to claim 7, wherein the shRNA consists of the nucleotide sequence as shown in SEQ ID NO: 8. 13. The pharmaceutical composition according to claim 7, which is used in combination with a cancer chemotherapeutic agent. 14. A combined product comprising the pharmaceutical composition according to any one of claims 7 and 9-13 and a cancer chemotherapeutic agent. 15. The combined product according to claim 14, wherein the cancer chemotherapeutic agent is selected from the group consisting of an antitumor agent having microtubule depolymerization inhibitory action, a deoxycytidine derivative, and an antitumor agent having TS inhibitory action.

An aspect of an embodiment of the invention relates to providing treatment of disease, in particular age-related disease, through increasing or decreasing the activity of SIRT6 protein. This may be accomplished through upregulation and downregulation of expression of SIRT6 in mammals. It has been found by the inventors that mice over-expressing SIRT6 have a longer lifespan in comparison to control mice, indicating that increasing SIRT6 expression can lengthen lifespan of mammals. Agents which modulate SIRT6 expression through, for example binding to 3′UTR region of human mRNA encoding SIRT6 or by blocking binding of agents to 3′UTR region of human mRNA encoding SIRT6, have been identified.

1. A method for treating an age-related disease comprising: administering to a human subject above the age of 50 in need thereof an effective amount of an agent that inhibits binding of a micro-RNA to a SIRT6 3′UTR, wherein the micro-RNA is characterized by a sequence of one or more of SEQ. ID NO. 3, SEQ. ID NO. 4, SEQ. ID NO. 5 and SEQ. ID NO. 6. 2. The method according to claim 1 wherein the agent comprises one or a combination of one or more of SEQ. ID NO. 7, SEQ. ID NO. 8, SEQ. ID NO. 9 and SEQ. ID NO. 10. 3. The method according to claim 2 wherein the daily dosage of agent administered is between 0.01 and 3000 mg daily. 4. The method according to claim 1 wherein the subject is aged above 65 years old. 5. The method according to claim 4 wherein the subject is aged above 80 years old. 6. The method according to claim 1 wherein the agent is in the form of a composition in combination with a pharmaceutically acceptable carrier. 7. The method according to claim 6 wherein the composition is administered parenterally. 8. The method according to claim 6 wherein the composition is administered intravenously. 9. The method according to claim 1, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 5 and/or SEQ. ID NO. 6. 10. The method according to claim 9, wherein the agent comprises one or a combination of one or more of SEQ. ID NO. 9 or SEQ. ID NO. 10. 11. The method according to claim 9, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 5. 12. The method according to claim 9, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 6. 13. The method according to claim 9, wherein the age-related disease is selected from the group consisting of neurodegenerative disease, cancer, cardiovascular disease, obesity, increased cholesterol levels, hypertension, ocular disorders, cataracts, glaucoma, osteoporosis, blood clotting disorders, arthritis, hearing loss, stroke and Alzheimer's disease, Hutchinson-Gilford progeria syndrome, osteoarthritis, rheumatoid arthritis, chronic obstructive pulmonary disease, Werner syndrome, fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH). 14. The method according to claim 1, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 3 and/or SEQ. ID NO. 4. 15. The method according to claim 14, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 3. 16. The method according to claim 14, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 4. 17. The method according to claim 14, wherein the agent comprises one or a combination of one or more of SEQ. ID NO. 7 or SEQ. ID NO. 8. 18. The method according to claim 14 wherein the age-related disease is selected from the group consisting of type 2 diabetes, neurodegenerative disease, cancer, cardiovascular disease, obesity, increased cholesterol levels, hypertension, ocular disorders, cataracts, glaucoma, osteoporosis, blood clotting disorders, arthritis, hearing loss, stroke and Alzheimer's disease, Hutchinson-Gilford progeria syndrome, osteoarthritis, rheumatoid arthritis, chronic obstructive pulmonary disease, Werner syndrome, fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH).

An aspect of an embodiment of the invention relates to providing treatment of disease, in particular age-related disease, through increasing or decreasing the activity of SIRT6 protein. This may be accomplished through upregulation and downregulation of expression of SIRT6 in mammals. It has been found by the inventors that mice over-expressing SIRT6 have a longer lifespan in comparison to control mice, indicating that increasing SIRT6 expression can lengthen lifespan of mammals. Agents which modulate SIRT6 expression through, for example binding to 3′UTR region of human mRNA encoding SIRT6 or by blocking binding of agents to 3′UTR region of human mRNA encoding SIRT6, have been identified.1. A method for treating an age-related disease comprising: administering to a human subject above the age of 50 in need thereof an effective amount of an agent that inhibits binding of a micro-RNA to a SIRT6 3′UTR, wherein the micro-RNA is characterized by a sequence of one or more of SEQ. ID NO. 3, SEQ. ID NO. 4, SEQ. ID NO. 5 and SEQ. ID NO. 6. 2. The method according to claim 1 wherein the agent comprises one or a combination of one or more of SEQ. ID NO. 7, SEQ. ID NO. 8, SEQ. ID NO. 9 and SEQ. ID NO. 10. 3. The method according to claim 2 wherein the daily dosage of agent administered is between 0.01 and 3000 mg daily. 4. The method according to claim 1 wherein the subject is aged above 65 years old. 5. The method according to claim 4 wherein the subject is aged above 80 years old. 6. The method according to claim 1 wherein the agent is in the form of a composition in combination with a pharmaceutically acceptable carrier. 7. The method according to claim 6 wherein the composition is administered parenterally. 8. The method according to claim 6 wherein the composition is administered intravenously. 9. The method according to claim 1, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 5 and/or SEQ. ID NO. 6. 10. The method according to claim 9, wherein the agent comprises one or a combination of one or more of SEQ. ID NO. 9 or SEQ. ID NO. 10. 11. The method according to claim 9, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 5. 12. The method according to claim 9, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 6. 13. The method according to claim 9, wherein the age-related disease is selected from the group consisting of neurodegenerative disease, cancer, cardiovascular disease, obesity, increased cholesterol levels, hypertension, ocular disorders, cataracts, glaucoma, osteoporosis, blood clotting disorders, arthritis, hearing loss, stroke and Alzheimer's disease, Hutchinson-Gilford progeria syndrome, osteoarthritis, rheumatoid arthritis, chronic obstructive pulmonary disease, Werner syndrome, fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH). 14. The method according to claim 1, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 3 and/or SEQ. ID NO. 4. 15. The method according to claim 14, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 3. 16. The method according to claim 14, wherein the micro-RNA is characterized by a sequence of SEQ. ID NO. 4. 17. The method according to claim 14, wherein the agent comprises one or a combination of one or more of SEQ. ID NO. 7 or SEQ. ID NO. 8. 18. The method according to claim 14 wherein the age-related disease is selected from the group consisting of type 2 diabetes, neurodegenerative disease, cancer, cardiovascular disease, obesity, increased cholesterol levels, hypertension, ocular disorders, cataracts, glaucoma, osteoporosis, blood clotting disorders, arthritis, hearing loss, stroke and Alzheimer's disease, Hutchinson-Gilford progeria syndrome, osteoarthritis, rheumatoid arthritis, chronic obstructive pulmonary disease, Werner syndrome, fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH).

The disclosure features novel lipids and compositions involving the same. Nanoparticle compositions include a novel lipid as well as additional lipids such as phospholipids, structural lipids, and PEG lipids. Nanoparticle compositions further including therapeutic and/or prophylactics such as RNA are useful in the delivery of therapeutic and/or prophylactics to mammalian cells or organs to, for example, regulate polypeptide, protein, or gene expression.

1. An ionizable lipid of Formula D: 2. The ionizable lipid of claim 1, wherein the salt is a pharmaceutically acceptable salt. 3. A nanoparticle composition comprising a lipid component comprising an ionizable lipid of claim 1. 4. The nanoparticle composition of claim 3, wherein the lipid component further comprises a phospholipid. 5. The nanoparticle composition of claim 4, wherein the phospholipid is selected from the group consisting of 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof. 6. The nanoparticle composition of claim 5, wherein the phospholipid is DSPC or DOPE. 7. The nanoparticle composition of claim 4, wherein the lipid component further comprises a structural lipid. 8. The nanoparticle composition of claim 7, wherein the structural lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and mixtures thereof. 9. The nanoparticle composition of claim 8, wherein the structural lipid is cholesterol. 10. The nanoparticle composition of claim 7, wherein the lipid component further comprises a PEG lipid. 11. The nanoparticle composition of claim 10, wherein the PEG lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. 12. The nanoparticle composition of claim 10, wherein the lipid component comprises about 30 mol % to about 60 mol % said ionizable lipid, about 0 mol % to about 30 mol % phospholipid, about 18.5 mol % to about 48.5 mol % structural lipid, and about 0 mol % to about 10 mol % PEG lipid. 13. The nanoparticle composition of claim 10, wherein the lipid component comprises about 35 mol % to about 55 mol % said ionizable lipid, about 5 mol % to about 25 mol % phospholipid, about 30 mol % to about 40 mol % structural lipid, and about 0 mol % to about 10 mol % PEG lipid. 14. The nanoparticle composition of claim 10, wherein the lipid component comprises about 50 mol % said ionizable lipid, about 10 mol % phospholipid, about 38.5 mol % structural lipid, and about 1.5 mol % PEG lipid. 15. The nanoparticle composition of claim 10, further comprising a therapeutic and/or prophylactic agent. 16. The nanoparticle composition of claim 12, further comprising a therapeutic and/or prophylactic agent. 17. The nanoparticle composition of claim 13, further comprising a therapeutic and/or prophylactic agent. 18. The nanoparticle composition of claim 15, wherein the therapeutic and/or prophylactic agent is a nucleic acid. 19. The nanoparticle composition of claim 15, wherein the therapeutic and/or prophylactic agent is a ribonucleic acid (RNA). 20. The nanoparticle composition of claim 19, wherein the RNA is selected from the group consisting of a small interfering RNA (siRNA), an asymmetrical interfering RNA (aiRNA), a microRNA (miRNA), a Dicer-substrate RNA (dsRNA), a small hairpin RNA (shRNA), a messenger RNA (mRNA), and mixtures thereof. 21. The nanoparticle composition of claim 19, wherein the RNA is an mRNA. 22. The nanoparticle composition of claim 21, wherein the mRNA includes one or more of a stem loop, a chain terminating nucleoside, a polyA sequence, a polyadenylation signal, and/or a 5′ cap structure. 23. The nanoparticle composition of claim 21, wherein the encapsulation efficiency of the therapeutic and/or prophylactic agent is at least 80% or at least 90%. 24. The nanoparticle composition of claim 21, wherein the wt/wt ratio of the lipid component to the mRNA is from about 10:1 to about 60:1. 25. The nanoparticle composition of claim 21, wherein the wt/wt ratio of the lipid component to the mRNA is about 20:1. 26. The nanoparticle composition of claim 21, wherein the N:P ratio is from about 5:1 to about 8:1. 27. A pharmaceutical composition comprising the nanoparticle composition of claim 21 and a pharmaceutically acceptable carrier. 28. A method of delivering a therapeutic and/or prophylactic agent to a mammalian cell, the method comprising administering to a subject the nanoparticle composition of claim 15, said administering comprising contacting the cell with the nanoparticle composition, whereby the therapeutic and/or prophylactic agent is delivered to the cell. 29. A method of producing a polypeptide of interest in a mammalian cell, the method comprising contacting the cell with the nanoparticle composition of claim 21, wherein the mRNA encodes the polypeptide of interest, whereby the mRNA is capable of being translated in the cell to produce the polypeptide of interest. 30. A method of synthesizing an ionizable lipid of claim 1, comprising reacting heptadecan-9-yl 8-((2-hydroxyethyl)amino)octanoate with nonyl 4-bromobutanoate under a suitable condition to provide the ionizable lipid of claim 1.

The disclosure features novel lipids and compositions involving the same. Nanoparticle compositions include a novel lipid as well as additional lipids such as phospholipids, structural lipids, and PEG lipids. Nanoparticle compositions further including therapeutic and/or prophylactics such as RNA are useful in the delivery of therapeutic and/or prophylactics to mammalian cells or organs to, for example, regulate polypeptide, protein, or gene expression.1. An ionizable lipid of Formula D: 2. The ionizable lipid of claim 1, wherein the salt is a pharmaceutically acceptable salt. 3. A nanoparticle composition comprising a lipid component comprising an ionizable lipid of claim 1. 4. The nanoparticle composition of claim 3, wherein the lipid component further comprises a phospholipid. 5. The nanoparticle composition of claim 4, wherein the phospholipid is selected from the group consisting of 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof. 6. The nanoparticle composition of claim 5, wherein the phospholipid is DSPC or DOPE. 7. The nanoparticle composition of claim 4, wherein the lipid component further comprises a structural lipid. 8. The nanoparticle composition of claim 7, wherein the structural lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and mixtures thereof. 9. The nanoparticle composition of claim 8, wherein the structural lipid is cholesterol. 10. The nanoparticle composition of claim 7, wherein the lipid component further comprises a PEG lipid. 11. The nanoparticle composition of claim 10, wherein the PEG lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. 12. The nanoparticle composition of claim 10, wherein the lipid component comprises about 30 mol % to about 60 mol % said ionizable lipid, about 0 mol % to about 30 mol % phospholipid, about 18.5 mol % to about 48.5 mol % structural lipid, and about 0 mol % to about 10 mol % PEG lipid. 13. The nanoparticle composition of claim 10, wherein the lipid component comprises about 35 mol % to about 55 mol % said ionizable lipid, about 5 mol % to about 25 mol % phospholipid, about 30 mol % to about 40 mol % structural lipid, and about 0 mol % to about 10 mol % PEG lipid. 14. The nanoparticle composition of claim 10, wherein the lipid component comprises about 50 mol % said ionizable lipid, about 10 mol % phospholipid, about 38.5 mol % structural lipid, and about 1.5 mol % PEG lipid. 15. The nanoparticle composition of claim 10, further comprising a therapeutic and/or prophylactic agent. 16. The nanoparticle composition of claim 12, further comprising a therapeutic and/or prophylactic agent. 17. The nanoparticle composition of claim 13, further comprising a therapeutic and/or prophylactic agent. 18. The nanoparticle composition of claim 15, wherein the therapeutic and/or prophylactic agent is a nucleic acid. 19. The nanoparticle composition of claim 15, wherein the therapeutic and/or prophylactic agent is a ribonucleic acid (RNA). 20. The nanoparticle composition of claim 19, wherein the RNA is selected from the group consisting of a small interfering RNA (siRNA), an asymmetrical interfering RNA (aiRNA), a microRNA (miRNA), a Dicer-substrate RNA (dsRNA), a small hairpin RNA (shRNA), a messenger RNA (mRNA), and mixtures thereof. 21. The nanoparticle composition of claim 19, wherein the RNA is an mRNA. 22. The nanoparticle composition of claim 21, wherein the mRNA includes one or more of a stem loop, a chain terminating nucleoside, a polyA sequence, a polyadenylation signal, and/or a 5′ cap structure. 23. The nanoparticle composition of claim 21, wherein the encapsulation efficiency of the therapeutic and/or prophylactic agent is at least 80% or at least 90%. 24. The nanoparticle composition of claim 21, wherein the wt/wt ratio of the lipid component to the mRNA is from about 10:1 to about 60:1. 25. The nanoparticle composition of claim 21, wherein the wt/wt ratio of the lipid component to the mRNA is about 20:1. 26. The nanoparticle composition of claim 21, wherein the N:P ratio is from about 5:1 to about 8:1. 27. A pharmaceutical composition comprising the nanoparticle composition of claim 21 and a pharmaceutically acceptable carrier. 28. A method of delivering a therapeutic and/or prophylactic agent to a mammalian cell, the method comprising administering to a subject the nanoparticle composition of claim 15, said administering comprising contacting the cell with the nanoparticle composition, whereby the therapeutic and/or prophylactic agent is delivered to the cell. 29. A method of producing a polypeptide of interest in a mammalian cell, the method comprising contacting the cell with the nanoparticle composition of claim 21, wherein the mRNA encodes the polypeptide of interest, whereby the mRNA is capable of being translated in the cell to produce the polypeptide of interest. 30. A method of synthesizing an ionizable lipid of claim 1, comprising reacting heptadecan-9-yl 8-((2-hydroxyethyl)amino)octanoate with nonyl 4-bromobutanoate under a suitable condition to provide the ionizable lipid of claim 1.

Techniques for treating a subject with M-GBM and recurrent GBM are provided. Example methods include obtaining at least two M-GBM tumor samples from different locations within a patient, extracting genomic DNA from each of the tumor samples, and determining whether the subject has a mutation in PI3K-AKT-mTOR (PAM) pathway in both DNA samples. If a mutation in PAM pathway is present in each of the isolated DNA samples, the method can further include treating the subject with an effective amount of an agent that inhibits the PAM pathway. Pharmaceutical agents and kits for use in the treatment of M-GBM and recurrent GBM are also provided.

1. A method for treating a subject with multifocal/multicentric glioblastoma (M-GBM) comprising: obtaining at least two M-GBM tumor samples from different locations within the subject; extracting genomic DNA from each of the at least two tumor samples to obtain at least two corresponding extracted genomic DNA samples; determining whether the subject has a PI3K-AKT-mTOR (PAM) pathway mutation in each of the at least two extracted genomicDNA samples; and if a PAM pathway mutation is determined in each of the at least two DNA samples, treating the subject with an effective amount of a PAM pathway inhibiting agent. 2. The method of claim 1, wherein the mutation in the PAM pathway is a gain-of-function mutation that activates the PAM pathway. 3. The method of claim 1, wherein the mutation is in PIK3CA gene. 4. The method of claim 3, wherein the mutation is at amino acid 4, 364, 1016, 1035, or 1043 of PIK3CA protein, or at equivalent positions of homologous sequences thereto. 5. The method of claim 4, wherein the mutation is selected from the group consisting of R4Q, G364R, F1016C, A1035V, M1043I, and M1043V. 6. The method of claim 1, wherein the mutation is in one or more of AKT1, AKT2, AKT3, and/or mTOR genes. 7. The method of claim 1, wherein the agent is selected from the group consisting of BKM120 (Buparlisib), XL147 (Pilaralisib), GDC0941 (Pictilisib), BYL719 (Alpelisib), GDC0032 (Tazelisib), NVP-BEZ235, LY3023414, GSK2126458, BEZ235, PF-05212384 (PKI-587), AZD5363, MK-2206, GSK21411795 (Uprosertib), GDC-0068 (Lpatasertib), LNK128, AZD2014, AZD8055, MLN0138, CC-223, RAD001 (Everolimus), rapamycin (Sirolimus), CCI-779 (Temsirolimus), AP23573 (Ridaforolimus), and combinations thereof. 8. The method of claim 1, wherein the agent is administered orally. 9. The method of claim 1, wherein the agent is administered intravenously. 10. The method of claim 1, wherein the agent comprises a nucleic acid that specifically binds to a nucleic acid encoding PIK3CA, and reduces P13K expression and/or activity. 11. The method of claim 10, wherein the agent comprises a microRNA (miRNA) molecule, small interfering RNA (siRNA) molecule, short hairpin RNA (shRNA) molecule, catalytic RNA molecule, and/or catalytic DNA molecule. 12. A method of treating M-GBM in a subject, comprising administering, to the subject, an effective amount of a PAM pathway inhibiting agent. 13. The method of claim 12, wherein the agent is selected from the group consisting of BKM120 (Buparlisib), XL147 (Pilaralisib), GDC0941 (Pictilisib), BYL719 (Alpelisib), GDC0032 (Tazelisib), NVP-BEZ235, LY3023414, GSK2126458, BEZ235, PF-05212384 (PKI-587), AZD5363, MK-2206, GSK21411795 (Uprosertib), GDC-0068 (Lpatasertib), LNK128, AZD2014, AZD8055, MLN0138, CC-223, RAD001 (Everolimus), rapamycin (Sirolimus), CCI-779 (Temsirolimus), AP23573 (Ridaforolimus), and combinations thereof. 14. The method of claim 12, wherein the agent comprises a nucleic acid that specifically binds to a nucleic acid encoding PIK3CA, and reduces PI3K expression and/or activity. 15. The method of claim 14, wherein the agent comprises a microRNA (miRNA) molecule, small interfering RNA (siRNA) molecule, short hairpin RNA (shRNA) molecule, catalytic RNA molecule, and/or catalytic DNA molecule. 16. The method of claim 12, further comprising administering to the subject an additional therapeutic agent, a stabilizing compound, and/or a biocompatible pharmaceutical carrier. 17. A kit for determining the presence of a PI3K-AKT-mTOR (PAM) pathway mutation in a subject with multifocal/multicentric glioblastoma (M-GBM), comprising a means for identifying one or more PAM pathway mutation comprising one or more nucleic acid primer, nucleic acid primer pair, nucleic acid probe, and/or an antibody specific for said mutation. 18. The kit of claim 17, wherein the PAM pathway mutation is a gain-of-function mutation that activates the PAM pathway. 19. The kit of claim 17, wherein the mutation is in PIK3CA gene. 20. The kit of claim 19, wherein the mutation is at amino acid 4, 364, 1016, 1035, or 1043 of PIK3CA protein, or at equivalent positions of homologous sequences thereto. 21. The kit of claim 20, wherein the mutation is selected from the group consisting of R4Q, G364R, F1016C, A1035V, M1043I, and M1043V. 22. The kit of claim 17, wherein the one or more primer, primer pair, probe, and/or antibodies constitute at least 10 percent of the primers, primer pairs, probes, and antibodies in the kit. 23. The kit of claim 17, further comprising a positive control. 24. The kit of claim 17, further comprising a pharmaceutical formulation for use in treating M-GBM in a subject in need thereof, comprising at least an effective amount of the PAM pathway inhibiting agent.

Techniques for treating a subject with M-GBM and recurrent GBM are provided. Example methods include obtaining at least two M-GBM tumor samples from different locations within a patient, extracting genomic DNA from each of the tumor samples, and determining whether the subject has a mutation in PI3K-AKT-mTOR (PAM) pathway in both DNA samples. If a mutation in PAM pathway is present in each of the isolated DNA samples, the method can further include treating the subject with an effective amount of an agent that inhibits the PAM pathway. Pharmaceutical agents and kits for use in the treatment of M-GBM and recurrent GBM are also provided.1. A method for treating a subject with multifocal/multicentric glioblastoma (M-GBM) comprising: obtaining at least two M-GBM tumor samples from different locations within the subject; extracting genomic DNA from each of the at least two tumor samples to obtain at least two corresponding extracted genomic DNA samples; determining whether the subject has a PI3K-AKT-mTOR (PAM) pathway mutation in each of the at least two extracted genomicDNA samples; and if a PAM pathway mutation is determined in each of the at least two DNA samples, treating the subject with an effective amount of a PAM pathway inhibiting agent. 2. The method of claim 1, wherein the mutation in the PAM pathway is a gain-of-function mutation that activates the PAM pathway. 3. The method of claim 1, wherein the mutation is in PIK3CA gene. 4. The method of claim 3, wherein the mutation is at amino acid 4, 364, 1016, 1035, or 1043 of PIK3CA protein, or at equivalent positions of homologous sequences thereto. 5. The method of claim 4, wherein the mutation is selected from the group consisting of R4Q, G364R, F1016C, A1035V, M1043I, and M1043V. 6. The method of claim 1, wherein the mutation is in one or more of AKT1, AKT2, AKT3, and/or mTOR genes. 7. The method of claim 1, wherein the agent is selected from the group consisting of BKM120 (Buparlisib), XL147 (Pilaralisib), GDC0941 (Pictilisib), BYL719 (Alpelisib), GDC0032 (Tazelisib), NVP-BEZ235, LY3023414, GSK2126458, BEZ235, PF-05212384 (PKI-587), AZD5363, MK-2206, GSK21411795 (Uprosertib), GDC-0068 (Lpatasertib), LNK128, AZD2014, AZD8055, MLN0138, CC-223, RAD001 (Everolimus), rapamycin (Sirolimus), CCI-779 (Temsirolimus), AP23573 (Ridaforolimus), and combinations thereof. 8. The method of claim 1, wherein the agent is administered orally. 9. The method of claim 1, wherein the agent is administered intravenously. 10. The method of claim 1, wherein the agent comprises a nucleic acid that specifically binds to a nucleic acid encoding PIK3CA, and reduces P13K expression and/or activity. 11. The method of claim 10, wherein the agent comprises a microRNA (miRNA) molecule, small interfering RNA (siRNA) molecule, short hairpin RNA (shRNA) molecule, catalytic RNA molecule, and/or catalytic DNA molecule. 12. A method of treating M-GBM in a subject, comprising administering, to the subject, an effective amount of a PAM pathway inhibiting agent. 13. The method of claim 12, wherein the agent is selected from the group consisting of BKM120 (Buparlisib), XL147 (Pilaralisib), GDC0941 (Pictilisib), BYL719 (Alpelisib), GDC0032 (Tazelisib), NVP-BEZ235, LY3023414, GSK2126458, BEZ235, PF-05212384 (PKI-587), AZD5363, MK-2206, GSK21411795 (Uprosertib), GDC-0068 (Lpatasertib), LNK128, AZD2014, AZD8055, MLN0138, CC-223, RAD001 (Everolimus), rapamycin (Sirolimus), CCI-779 (Temsirolimus), AP23573 (Ridaforolimus), and combinations thereof. 14. The method of claim 12, wherein the agent comprises a nucleic acid that specifically binds to a nucleic acid encoding PIK3CA, and reduces PI3K expression and/or activity. 15. The method of claim 14, wherein the agent comprises a microRNA (miRNA) molecule, small interfering RNA (siRNA) molecule, short hairpin RNA (shRNA) molecule, catalytic RNA molecule, and/or catalytic DNA molecule. 16. The method of claim 12, further comprising administering to the subject an additional therapeutic agent, a stabilizing compound, and/or a biocompatible pharmaceutical carrier. 17. A kit for determining the presence of a PI3K-AKT-mTOR (PAM) pathway mutation in a subject with multifocal/multicentric glioblastoma (M-GBM), comprising a means for identifying one or more PAM pathway mutation comprising one or more nucleic acid primer, nucleic acid primer pair, nucleic acid probe, and/or an antibody specific for said mutation. 18. The kit of claim 17, wherein the PAM pathway mutation is a gain-of-function mutation that activates the PAM pathway. 19. The kit of claim 17, wherein the mutation is in PIK3CA gene. 20. The kit of claim 19, wherein the mutation is at amino acid 4, 364, 1016, 1035, or 1043 of PIK3CA protein, or at equivalent positions of homologous sequences thereto. 21. The kit of claim 20, wherein the mutation is selected from the group consisting of R4Q, G364R, F1016C, A1035V, M1043I, and M1043V. 22. The kit of claim 17, wherein the one or more primer, primer pair, probe, and/or antibodies constitute at least 10 percent of the primers, primer pairs, probes, and antibodies in the kit. 23. The kit of claim 17, further comprising a positive control. 24. The kit of claim 17, further comprising a pharmaceutical formulation for use in treating M-GBM in a subject in need thereof, comprising at least an effective amount of the PAM pathway inhibiting agent.

Some embodiments relate to methods for the recombinant expression of a protein of interest in a mammalian host cell, use of an shRNA or an siRNA directed against the Galectin-1 gene for increasing the expression of a protein of interest in a mammalian host cell and kits comprising an shRNA or an siRNA and a CHO cell.

1. A method for the recombinant expression of a protein of interest in a mammalian host cell, comprising: culturing the mammalian host cell comprising a nucleic acid sequence encoding the protein of interest under conditions suitable for recombinant expression of the protein of interest, and inhibiting the expression of the Galectin-1 gene or the activity of the Galectin-1 gene product in the mammalian host cell. 2. The method of claim 1, wherein the expression of the Galectin-1 gene is inhibited by RNAi. 3. The method of claim 2, wherein the RNAi is shRNA or siRNA. 4. The method of claim 3, wherein the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 3. 5. The method of claim 3, wherein the siRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 4. 6. The method of any one of claim 1, wherein the mammalian host cell is a Chinese hamster ovarian (CHO) cell. 7. The method of claim 1, wherein the mammalian host cell is a Chinese hamster ovarian (CHO) DP-12 cell (ATCC CRL-12445). 8. The method of claim 1, wherein the protein of interest is an antibody. 9. The method of claim 8, wherein the antibody is the monoclonal murine 6G4.2.5 antibody (ATCC-HB-11722). 10. The method of claim 1, wherein the mammalian host cell is cultured by fed-batch process. 11. The method of claim 2, wherein a nucleic acid sequence encoding the RNAi is stably integrated into the genome of the mammalian host cell. 12. A kit comprising a CHO cell and an shRNA or an siRNA, wherein the shRNA or the siRNA inhibit the expression of the Galectin-1. 13. The kit of claim 12, wherein the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 3 or the siRNA comprises the nucleic acid sequence set forth in SEQ ID NO:4. 14. (canceled) 15. (canceled)

Some embodiments relate to methods for the recombinant expression of a protein of interest in a mammalian host cell, use of an shRNA or an siRNA directed against the Galectin-1 gene for increasing the expression of a protein of interest in a mammalian host cell and kits comprising an shRNA or an siRNA and a CHO cell.1. A method for the recombinant expression of a protein of interest in a mammalian host cell, comprising: culturing the mammalian host cell comprising a nucleic acid sequence encoding the protein of interest under conditions suitable for recombinant expression of the protein of interest, and inhibiting the expression of the Galectin-1 gene or the activity of the Galectin-1 gene product in the mammalian host cell. 2. The method of claim 1, wherein the expression of the Galectin-1 gene is inhibited by RNAi. 3. The method of claim 2, wherein the RNAi is shRNA or siRNA. 4. The method of claim 3, wherein the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 3. 5. The method of claim 3, wherein the siRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 4. 6. The method of any one of claim 1, wherein the mammalian host cell is a Chinese hamster ovarian (CHO) cell. 7. The method of claim 1, wherein the mammalian host cell is a Chinese hamster ovarian (CHO) DP-12 cell (ATCC CRL-12445). 8. The method of claim 1, wherein the protein of interest is an antibody. 9. The method of claim 8, wherein the antibody is the monoclonal murine 6G4.2.5 antibody (ATCC-HB-11722). 10. The method of claim 1, wherein the mammalian host cell is cultured by fed-batch process. 11. The method of claim 2, wherein a nucleic acid sequence encoding the RNAi is stably integrated into the genome of the mammalian host cell. 12. A kit comprising a CHO cell and an shRNA or an siRNA, wherein the shRNA or the siRNA inhibit the expression of the Galectin-1. 13. The kit of claim 12, wherein the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 3 or the siRNA comprises the nucleic acid sequence set forth in SEQ ID NO:4. 14. (canceled) 15. (canceled)

The disclosure features novel lipids and compositions involving the same. Nanoparticle compositions include a novel lipid as well as additional lipids such as phospholipids, structural lipids, and PEG lipids. Nanoparticle compositions further including therapeutic and/or prophylactics such as RNA are useful in the delivery of therapeutic and/or prophylactics to mammalian cells or organs to, for example, regulate polypeptide, protein, or gene expression.

1. An ionizable lipid of Formula C: 2. The ionizable lipid of claim 1, wherein the salt is a pharmaceutically acceptable salt. 3. A nanoparticle composition comprising a lipid component comprising an ionizable lipid of claim 1. 4. The nanoparticle composition of claim 3, wherein the lipid component further comprises a phospholipid. 5. The nanoparticle composition of claim 4, wherein the phospholipid is selected from the group consisting of 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof. 6. The nanoparticle composition of claim 5, wherein the phospholipid is DSPC or DOPE. 7. The nanoparticle composition of claim 4, wherein the lipid component further comprises a structural lipid. 8. The nanoparticle composition of claim 7, wherein the structural lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and mixtures thereof. 9. The nanoparticle composition of claim 8, wherein the structural lipid is cholesterol. 10. The nanoparticle composition of claim 7, wherein the lipid component further comprises a PEG lipid. 11. The nanoparticle composition of claim 10, wherein the PEG lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. 12. The nanoparticle composition of claim 10, wherein the lipid component comprises about 30 mol % to about 60 mol % said ionizable lipid, about 0 mol % to about 30 mol % phospholipid, about 18.5 mol % to about 48.5 mol % structural lipid, and about 0 mol % to about 10 mol % PEG lipid. 13. The nanoparticle composition of claim 10, wherein the lipid component comprises about 35 mol % to about 55 mol % said ionizable lipid, about 5 mol % to about 25 mol % phospholipid, about 30 mol % to about 40 mol % structural lipid, and about 0 mol % to about 10 mol % PEG lipid. 14. The nanoparticle composition of claim 10, wherein the lipid component comprises about 50 mol % said ionizable lipid, about 10 mol % phospholipid, about 38.5 mol % structural lipid, and about 1.5 mol % PEG lipid. 15. The nanoparticle composition of claim 10, further comprising a therapeutic and/or prophylactic agent. 16. The nanoparticle composition of claim 12, further comprising a therapeutic and/or prophylactic agent. 17. The nanoparticle composition of claim 13, further comprising a therapeutic and/or prophylactic agent. 18. The nanoparticle composition of claim 15, wherein the therapeutic and/or prophylactic agent is a nucleic acid. 19. The nanoparticle composition of claim 15, wherein the therapeutic and/or prophylactic agent is a ribonucleic acid (RNA). 20. The nanoparticle composition of claim 19, wherein the RNA is selected from the group consisting of a small interfering RNA (siRNA), an asymmetrical interfering RNA (aiRNA), a microRNA (miRNA), a Dicer-substrate RNA (dsRNA), a small hairpin RNA (shRNA), a messenger RNA (mRNA), and mixtures thereof. 21. The nanoparticle composition of claim 19, wherein the RNA is an mRNA. 22. The nanoparticle composition of claim 21, wherein the mRNA includes one or more of a stem loop, a chain terminating nucleoside, a polyA sequence, a polyadenylation signal, and/or a 5′ cap structure. 23. The nanoparticle composition of claim 21, wherein the encapsulation efficiency of the therapeutic and/or prophylactic agent is at least 80% or at least 90%. 24. The nanoparticle composition of claim 21, wherein the wt/wt ratio of the lipid component to 5 the mRNA is from about 10:1 to about 60:1. 25. The nanoparticle composition of claim 21, wherein the wt/wt ratio of the lipid component to the mRNA is about 20:1. 26. The nanoparticle composition of claim 21, wherein the N:P ratio is from about 5:1 to about 8:1. 27. A pharmaceutical composition comprising the nanoparticle composition of claim 21 and a pharmaceutically acceptable carrier. 28. A method of delivering a therapeutic and/or prophylactic agent to a mammalian cell, the method comprising administering to a subject the nanoparticle composition of claim 15, said administering comprising contacting the cell with the nanoparticle composition, whereby the therapeutic and/or prophylactic agent is delivered to the cell. 29. A method of producing a polypeptide of interest in a mammalian cell, the method comprising contacting the cell with the nanoparticle composition of claim 21, wherein the mRNA encodes the polypeptide of interest, whereby the mRNA is capable of being translated in the cell to produce the polypeptide of interest. 30. A method of synthesizing an ionizable lipid of claim 1, comprising reacting heptadecan-9-yl 8-((2-hydroxyethyl)amino)octanoate with (Z)-non-2-en-1-yl 8-bromooctanoate under a suitable condition to provide the ionizable lipid of claim 1.

The disclosure features novel lipids and compositions involving the same. Nanoparticle compositions include a novel lipid as well as additional lipids such as phospholipids, structural lipids, and PEG lipids. Nanoparticle compositions further including therapeutic and/or prophylactics such as RNA are useful in the delivery of therapeutic and/or prophylactics to mammalian cells or organs to, for example, regulate polypeptide, protein, or gene expression.1. An ionizable lipid of Formula C: 2. The ionizable lipid of claim 1, wherein the salt is a pharmaceutically acceptable salt. 3. A nanoparticle composition comprising a lipid component comprising an ionizable lipid of claim 1. 4. The nanoparticle composition of claim 3, wherein the lipid component further comprises a phospholipid. 5. The nanoparticle composition of claim 4, wherein the phospholipid is selected from the group consisting of 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof. 6. The nanoparticle composition of claim 5, wherein the phospholipid is DSPC or DOPE. 7. The nanoparticle composition of claim 4, wherein the lipid component further comprises a structural lipid. 8. The nanoparticle composition of claim 7, wherein the structural lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and mixtures thereof. 9. The nanoparticle composition of claim 8, wherein the structural lipid is cholesterol. 10. The nanoparticle composition of claim 7, wherein the lipid component further comprises a PEG lipid. 11. The nanoparticle composition of claim 10, wherein the PEG lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. 12. The nanoparticle composition of claim 10, wherein the lipid component comprises about 30 mol % to about 60 mol % said ionizable lipid, about 0 mol % to about 30 mol % phospholipid, about 18.5 mol % to about 48.5 mol % structural lipid, and about 0 mol % to about 10 mol % PEG lipid. 13. The nanoparticle composition of claim 10, wherein the lipid component comprises about 35 mol % to about 55 mol % said ionizable lipid, about 5 mol % to about 25 mol % phospholipid, about 30 mol % to about 40 mol % structural lipid, and about 0 mol % to about 10 mol % PEG lipid. 14. The nanoparticle composition of claim 10, wherein the lipid component comprises about 50 mol % said ionizable lipid, about 10 mol % phospholipid, about 38.5 mol % structural lipid, and about 1.5 mol % PEG lipid. 15. The nanoparticle composition of claim 10, further comprising a therapeutic and/or prophylactic agent. 16. The nanoparticle composition of claim 12, further comprising a therapeutic and/or prophylactic agent. 17. The nanoparticle composition of claim 13, further comprising a therapeutic and/or prophylactic agent. 18. The nanoparticle composition of claim 15, wherein the therapeutic and/or prophylactic agent is a nucleic acid. 19. The nanoparticle composition of claim 15, wherein the therapeutic and/or prophylactic agent is a ribonucleic acid (RNA). 20. The nanoparticle composition of claim 19, wherein the RNA is selected from the group consisting of a small interfering RNA (siRNA), an asymmetrical interfering RNA (aiRNA), a microRNA (miRNA), a Dicer-substrate RNA (dsRNA), a small hairpin RNA (shRNA), a messenger RNA (mRNA), and mixtures thereof. 21. The nanoparticle composition of claim 19, wherein the RNA is an mRNA. 22. The nanoparticle composition of claim 21, wherein the mRNA includes one or more of a stem loop, a chain terminating nucleoside, a polyA sequence, a polyadenylation signal, and/or a 5′ cap structure. 23. The nanoparticle composition of claim 21, wherein the encapsulation efficiency of the therapeutic and/or prophylactic agent is at least 80% or at least 90%. 24. The nanoparticle composition of claim 21, wherein the wt/wt ratio of the lipid component to 5 the mRNA is from about 10:1 to about 60:1. 25. The nanoparticle composition of claim 21, wherein the wt/wt ratio of the lipid component to the mRNA is about 20:1. 26. The nanoparticle composition of claim 21, wherein the N:P ratio is from about 5:1 to about 8:1. 27. A pharmaceutical composition comprising the nanoparticle composition of claim 21 and a pharmaceutically acceptable carrier. 28. A method of delivering a therapeutic and/or prophylactic agent to a mammalian cell, the method comprising administering to a subject the nanoparticle composition of claim 15, said administering comprising contacting the cell with the nanoparticle composition, whereby the therapeutic and/or prophylactic agent is delivered to the cell. 29. A method of producing a polypeptide of interest in a mammalian cell, the method comprising contacting the cell with the nanoparticle composition of claim 21, wherein the mRNA encodes the polypeptide of interest, whereby the mRNA is capable of being translated in the cell to produce the polypeptide of interest. 30. A method of synthesizing an ionizable lipid of claim 1, comprising reacting heptadecan-9-yl 8-((2-hydroxyethyl)amino)octanoate with (Z)-non-2-en-1-yl 8-bromooctanoate under a suitable condition to provide the ionizable lipid of claim 1.

The invention relates to the use of a reverse-transcriptase inhibitor in the prevention or treatment of a degenerative disease.

1. A method of treating or preventing a degenerative disease in a subject in need thereof, the method comprising administering a therapeutically effective amount of a reverse transcriptase inhibitor to the subject. 2. The method of claim 1, wherein the reverse transcriptase inhibitor is a nucleoside inhibitor. 3. The method of claim 2, wherein the degenerative disease is linked to aging or oxidative stress. 4. The method of claim 3, wherein the degenerative disease is a neurodegenerative disease. 5. The method of claim 4, wherein the degenerative disease is selected from the group consisting of Parkinson's disease, Alzheimer's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), degenerative diseases affecting eyesight and degenerative diseases affecting hearing. 6. The method of claim 5, wherein the degenerative disease is glaucoma.

The invention relates to the use of a reverse-transcriptase inhibitor in the prevention or treatment of a degenerative disease.1. A method of treating or preventing a degenerative disease in a subject in need thereof, the method comprising administering a therapeutically effective amount of a reverse transcriptase inhibitor to the subject. 2. The method of claim 1, wherein the reverse transcriptase inhibitor is a nucleoside inhibitor. 3. The method of claim 2, wherein the degenerative disease is linked to aging or oxidative stress. 4. The method of claim 3, wherein the degenerative disease is a neurodegenerative disease. 5. The method of claim 4, wherein the degenerative disease is selected from the group consisting of Parkinson's disease, Alzheimer's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), degenerative diseases affecting eyesight and degenerative diseases affecting hearing. 6. The method of claim 5, wherein the degenerative disease is glaucoma.

Described herein are novel polynucleotides associated with prostate and lung cancer. The polynucleotides are miRNAs and miRNA precursors. Related methods and compositions that can be used for diagnosis, prognosis, and treatment of those medical conditions are disclosed. Also described herein are methods that can be used to identify modulators of prostate and lung cancer.

1. An isolated nucleic acid comprising a sequence selected from the group consisting of: (a) the sequence of a hairpin referred to in Table 1; (b) the sequence of sequence identifiers 6757248-6894882 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572; (c) the sequence of sequence identifiers 1-6318 or 18728-18960 of the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094; (d) the sequence of a miRNA referred to in Table 1; (e) the sequence of sequence identifiers 1.117750 or 6894883-10068177 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572; (f) the sequence of sequence identifiers 6319-18727 or 18961-19401 of the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094; (g) the sequence of a target gene binding site referred to in Table 4; (h) the sequence of sequence identifiers 117751-6757247 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572; (i) complement of (a)-(h); (j) nucleotide sequence comprising at least 12 contiguous nucleotides at least 60% identical to (a)-(h); wherein the nucleic acid is from 5-250 nucleotides in length. 2. A probe comprising the nucleic acid of claim 1. 3. The probe of claim 2 wherein the nucleic acid comprises at least 8-22 contiguous nucleotides complementary to a miRNA referred to in Table 2 as differentially expressed in prostate cancer or lung cancer. 4. A plurality of probes of claim 3. 5. The plurality of probes of claim 4 comprising at least one probe complementary to each miRNA referred to in Table 2 as differentially expressed in prostate cancer. 6. The plurality of probes of claim 4 comprising at least one probe complementary to each miRNA referred to in Table 2 as differentially expressed in lung cancer. 7. A composition comprising the plurality of probes of claim 3. 8. A biochip comprising a solid substrate, said substrate comprising a plurality of probes of claim 3, wherein each probe is attached to the substrate at a spatially defined address. 9. The biochip of claim 8 wherein the probes are complementary to a miRNA referred to in Table 2 as differentially expressed in prostate cancer. 10. The biochip of claim 8 wherein the probes are complementary to a miRNA referred to in Table 2 as differentially expressed in lung cancer. 11. A method for detecting differential expression of a miRNA comprising: (a) providing a biological sample; and (b) measuring the level of a nucleic acid at least 70% identical to (i) a sequence of a miRNA referred to in Table 1, (ii) the sequence of sequence identifiers 1-117750 or 6894883-10068177 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572, (iii) the sequence of sequence identifiers 6319-18727 or 18961-19401 of the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094, or (iv) a variant of (i)-(iii), wherein a difference in the level of the nucleic acid compared to a control is indicative of differential expression. 12. A method for identifying a compound that modulates expression of a miRNA: (a) providing a cell that is capable of expressing a nucleic acid at least 70% identical to (i) a sequence of a miRNA referred to in Table 1, (ii) the sequence of sequence identifiers 1-117750 or 6894883-10068177 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572, (iii) the sequence of sequence identifiers 6319-18727 or 18961-19401 of the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094, or (iv) a variant of (i)-(iii); (b) contacting the cell with a candidate modulator; and (c) measuring the level of expression of the nucleic acid, wherein a difference in the level of the nucleic acid compared to a control identifies the compound as a modulator of expression of the miRNA. 13. A method of inhibiting expression of a target gene in a cell comprising introducing a nucleic acid into the cell in an amount sufficient to inhibit expression of the target gene, wherein the target gene comprises a (i) binding site substantially identical to a binding site referred to in Table 4, (ii) sequence of sequence identifiers 117751-6757247 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572, or (iii) a variant of (i) or (ii); and wherein the nucleic acid comprises a sequence (a) of SEQ ID NOS: 1-760616, (b) sequence of sequence identifiers 1-117750 and 6757248-10068177 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572, (c) a sequence set forth on the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094, or (d) a variant of (a)-(c). 14. The method of claim 12 wherein expression is inhibited in vitro or in vivo. 15. A method of increasing expression of a target gene in a cell comprising introducing a nucleic acid into the cell in an amount sufficient to increase expression of the target gene, wherein the target gene comprises a (i) binding site substantially identical to a binding site referred to in Table 4, (ii) sequence of sequence identifiers 117751-6757247 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572, or (iii) a variant of (i) or (ii); wherein the nucleic acid comprises a sequence substantially complementary to a sequence (a) of SEQ ID NOS: 1-760.616, (b) set forth on the Sequence Listing of U.S. patent application Ser. No. 10/709,572, (c) a sequence set forth on the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094, or (d) a variant of (a)-(c). 16. The method of claim 15 wherein expression is inhibited in vitro or in vivo. 17. A method of treating a patient with a disorder set forth on Table 6 comprising administering to a patient in need thereof a composition comprising the nucleic acid of claim 1.

Described herein are novel polynucleotides associated with prostate and lung cancer. The polynucleotides are miRNAs and miRNA precursors. Related methods and compositions that can be used for diagnosis, prognosis, and treatment of those medical conditions are disclosed. Also described herein are methods that can be used to identify modulators of prostate and lung cancer.1. An isolated nucleic acid comprising a sequence selected from the group consisting of: (a) the sequence of a hairpin referred to in Table 1; (b) the sequence of sequence identifiers 6757248-6894882 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572; (c) the sequence of sequence identifiers 1-6318 or 18728-18960 of the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094; (d) the sequence of a miRNA referred to in Table 1; (e) the sequence of sequence identifiers 1.117750 or 6894883-10068177 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572; (f) the sequence of sequence identifiers 6319-18727 or 18961-19401 of the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094; (g) the sequence of a target gene binding site referred to in Table 4; (h) the sequence of sequence identifiers 117751-6757247 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572; (i) complement of (a)-(h); (j) nucleotide sequence comprising at least 12 contiguous nucleotides at least 60% identical to (a)-(h); wherein the nucleic acid is from 5-250 nucleotides in length. 2. A probe comprising the nucleic acid of claim 1. 3. The probe of claim 2 wherein the nucleic acid comprises at least 8-22 contiguous nucleotides complementary to a miRNA referred to in Table 2 as differentially expressed in prostate cancer or lung cancer. 4. A plurality of probes of claim 3. 5. The plurality of probes of claim 4 comprising at least one probe complementary to each miRNA referred to in Table 2 as differentially expressed in prostate cancer. 6. The plurality of probes of claim 4 comprising at least one probe complementary to each miRNA referred to in Table 2 as differentially expressed in lung cancer. 7. A composition comprising the plurality of probes of claim 3. 8. A biochip comprising a solid substrate, said substrate comprising a plurality of probes of claim 3, wherein each probe is attached to the substrate at a spatially defined address. 9. The biochip of claim 8 wherein the probes are complementary to a miRNA referred to in Table 2 as differentially expressed in prostate cancer. 10. The biochip of claim 8 wherein the probes are complementary to a miRNA referred to in Table 2 as differentially expressed in lung cancer. 11. A method for detecting differential expression of a miRNA comprising: (a) providing a biological sample; and (b) measuring the level of a nucleic acid at least 70% identical to (i) a sequence of a miRNA referred to in Table 1, (ii) the sequence of sequence identifiers 1-117750 or 6894883-10068177 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572, (iii) the sequence of sequence identifiers 6319-18727 or 18961-19401 of the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094, or (iv) a variant of (i)-(iii), wherein a difference in the level of the nucleic acid compared to a control is indicative of differential expression. 12. A method for identifying a compound that modulates expression of a miRNA: (a) providing a cell that is capable of expressing a nucleic acid at least 70% identical to (i) a sequence of a miRNA referred to in Table 1, (ii) the sequence of sequence identifiers 1-117750 or 6894883-10068177 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572, (iii) the sequence of sequence identifiers 6319-18727 or 18961-19401 of the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094, or (iv) a variant of (i)-(iii); (b) contacting the cell with a candidate modulator; and (c) measuring the level of expression of the nucleic acid, wherein a difference in the level of the nucleic acid compared to a control identifies the compound as a modulator of expression of the miRNA. 13. A method of inhibiting expression of a target gene in a cell comprising introducing a nucleic acid into the cell in an amount sufficient to inhibit expression of the target gene, wherein the target gene comprises a (i) binding site substantially identical to a binding site referred to in Table 4, (ii) sequence of sequence identifiers 117751-6757247 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572, or (iii) a variant of (i) or (ii); and wherein the nucleic acid comprises a sequence (a) of SEQ ID NOS: 1-760616, (b) sequence of sequence identifiers 1-117750 and 6757248-10068177 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572, (c) a sequence set forth on the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094, or (d) a variant of (a)-(c). 14. The method of claim 12 wherein expression is inhibited in vitro or in vivo. 15. A method of increasing expression of a target gene in a cell comprising introducing a nucleic acid into the cell in an amount sufficient to increase expression of the target gene, wherein the target gene comprises a (i) binding site substantially identical to a binding site referred to in Table 4, (ii) sequence of sequence identifiers 117751-6757247 of the Sequence Listing of U.S. patent application Ser. No. 10/709,572, or (iii) a variant of (i) or (ii); wherein the nucleic acid comprises a sequence substantially complementary to a sequence (a) of SEQ ID NOS: 1-760.616, (b) set forth on the Sequence Listing of U.S. patent application Ser. No. 10/709,572, (c) a sequence set forth on the Sequence Listing of U.S. Provisional Patent Application No. 60/655,094, or (d) a variant of (a)-(c). 16. The method of claim 15 wherein expression is inhibited in vitro or in vivo. 17. A method of treating a patient with a disorder set forth on Table 6 comprising administering to a patient in need thereof a composition comprising the nucleic acid of claim 1.

In some embodiments, the invention is directed to a method for diagnosing fibrosis and/or fibrosis related diseases and to a method for screening a pharmaceutically active compound for the treatment of fibrosis and/or fibrosis related diseases. The present invention further relates to compositions for use in the treatment, amelioration, and/or prevention of fibrosis. In certain embodiments, the compositions modulate the activity of a miRNA for the treatment, amelioration, and/or prevention of fibrosis. In certain embodiments, the compositions inhibit the activity of miR-21 for the treatment, amelioration, and/or prevention of fibrosis.

1.-139. (canceled) 140. A method for treating or preventing kidney fibrosis, comprising administering to a subject having kidney fibrosis or suspected of having kidney fibrosis a modified oligonucleotide consisting of 17 to 21 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to the nucleobase sequence of miR-21 (SEQ ID NO: 1), and wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. 141. The method of claim 140 further comprising identifying the subject having or suspected of having fibrosis prior to administering the compound. 142. The method of claim 140 wherein the subject has a kidney disease or condition. 143. The method of claim 140 further comprising administering one or more additional pharmaceutical agents. 144. The method of claim 143, wherein the one or more additional pharmaceutical agents are independently selected from a diuretic, a vasodilator, an angiotensin II converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), a calcium channel blocker, hydralazine, and a beta blocker. 145. The method of claim 143, wherein the method comprises administering to the subject an ACE inhibitor selected from captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril, and ramipril. 146. The method of claim 143, wherein the method comprises administering to the subject an ARB selected from candesartan, irbesartan, olmesartan, losartan, valsaratan, telmisartan, and eprosartan. 147. The method of claim 140, wherein the administering: a) ameliorates the fibrosis; b) slows further progression of the fibrosis; c) halts further progression of the fibrosis; and/or d) reduces the fibrosis. 148. The method of claim 140 wherein each of a plurality of nucleosides of the modified oligonucleotide comprises a modified sugar. 149. The method of claim 148 wherein each modified sugar is independently selected from a 2′-O-methoxyethyl sugar, a 2′-fluoro sugar, a 2′-O-methyl sugar, or a bicyclic sugar moiety. 150. The method claim 140 wherein the modified oligonucleotide is present within a pharmaceutical composition.

In some embodiments, the invention is directed to a method for diagnosing fibrosis and/or fibrosis related diseases and to a method for screening a pharmaceutically active compound for the treatment of fibrosis and/or fibrosis related diseases. The present invention further relates to compositions for use in the treatment, amelioration, and/or prevention of fibrosis. In certain embodiments, the compositions modulate the activity of a miRNA for the treatment, amelioration, and/or prevention of fibrosis. In certain embodiments, the compositions inhibit the activity of miR-21 for the treatment, amelioration, and/or prevention of fibrosis.1.-139. (canceled) 140. A method for treating or preventing kidney fibrosis, comprising administering to a subject having kidney fibrosis or suspected of having kidney fibrosis a modified oligonucleotide consisting of 17 to 21 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to the nucleobase sequence of miR-21 (SEQ ID NO: 1), and wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage. 141. The method of claim 140 further comprising identifying the subject having or suspected of having fibrosis prior to administering the compound. 142. The method of claim 140 wherein the subject has a kidney disease or condition. 143. The method of claim 140 further comprising administering one or more additional pharmaceutical agents. 144. The method of claim 143, wherein the one or more additional pharmaceutical agents are independently selected from a diuretic, a vasodilator, an angiotensin II converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), a calcium channel blocker, hydralazine, and a beta blocker. 145. The method of claim 143, wherein the method comprises administering to the subject an ACE inhibitor selected from captopril, enalapril, lisinopril, benazepril, quinapril, fosinopril, and ramipril. 146. The method of claim 143, wherein the method comprises administering to the subject an ARB selected from candesartan, irbesartan, olmesartan, losartan, valsaratan, telmisartan, and eprosartan. 147. The method of claim 140, wherein the administering: a) ameliorates the fibrosis; b) slows further progression of the fibrosis; c) halts further progression of the fibrosis; and/or d) reduces the fibrosis. 148. The method of claim 140 wherein each of a plurality of nucleosides of the modified oligonucleotide comprises a modified sugar. 149. The method of claim 148 wherein each modified sugar is independently selected from a 2′-O-methoxyethyl sugar, a 2′-fluoro sugar, a 2′-O-methyl sugar, or a bicyclic sugar moiety. 150. The method claim 140 wherein the modified oligonucleotide is present within a pharmaceutical composition.

This disclosure relates generally to deuterated isotopologues of SMAD7 antisense oligonucleotides, pharmaceutical compositions containing the same, and methods of using the same.

1. A deuterated SMAD7 antisense oligonucleotide, comprising a plurality of hydrogens (H), wherein one or more hydrogens of the plurality of hydrogens are replaced by deuterium (D). 2. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the one or more hydrogen replaced by deuterium is enriched in deuterium to more than 0.02%, more than 0.03%, more than 0.1%, more than 0.3%, more than 1%, more than 3%, more than 10%, more than 15%, more than 20%, more than 25%, more 30%, more than 35%, more than 40%, more than 45%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98% or more than 99%. 3. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein at least 1%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of hydrogens of the plurality of hydrogens are replaced with deuterium. 4. The deuterated SMAD7 antisense oligonucleotide of claim 1, further comprising a plurality of nucleotides, wherein at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of nucleotides of the plurality of nucleotides are partially or fully deuterated. 5. The deuterated SMAD7 antisense oligonucleotide of claim 1, further comprising a plurality of nucleobases, wherein one or more nucleobases of the plurality of nucleobases are deuterated. 6. The deuterated SMAD7 antisense oligonucleotide of claim 5, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the plurality of nucleobases are partially or fully deuterated. 7. The deuterated SMAD7 antisense oligonucleotide of claim 1, further comprising a plurality of riboses or deoxyriboses, wherein one or more riboses or deoxyriboses of the plurality of riboses or deoxyriboses are deuterated. 8. The deuterated SMAD7 antisense oligonucleotide of claim 7, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of riboses or deoxyriboses of the plurality of deoxyriboses are partially or fully deuterated. 9. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide targets a region of 10 or more, 12 or more, 14 or more, 16 or more, 18 or more, 20 or more, 22 or more, 24 or more, 26 or more, 28 or more or 30 or more consecutive nucleotides of human SMAD7 (SEQ ID NO: 1). 10. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide targets region 108-128 of human SMAD7 (SEQ ID NO: 1) (CDS of NM 005904.3). 11. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide targets nucleotides 403, 233, 294, 295, 296, 298, 299 or 533 of human SMAD7 (SEQ ID NO: 1). 12. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide comprises the nucleotide sequence of SEQ ID NO: 2 (5′-GTCGCCCCTTCTCCCCGCAG-3′) 13. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide comprises the nucleotide sequence of SEQ ID NO: 3 (5′-GTCGCCCCTTCTCCCCGCAGC-3′). 14. The deuterated SMAD7 antisense oligonucleotide of claim 13, wherein at least one internucleoside linkage is a phosphorothioate linkage. 15. The deuterated SMAD7 antisense oligonucleotide of claim 14, wherein all internucleoside linkages are phosphorothioate linkages. 16. The deuterated SMAD7 antisense oligonucleotide of claim 13, wherein 2′-deoxyribonucleotides are replaced by corresponding ribonucleotides. 17. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide is an antisense oligonucleotide phosphorothioate against SMAD7 comprising the following sequence: 5′-GTXGCCCCTTCTCCCXGCAG-3′ (SEQ ID NO: 8) wherein X is 5-methyl-2′-deoxycytidine and wherein all internucleotide linkages are phosphorothioate linkages. 18. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide is an antisense oligonucleotide phosphorothioate against SMAD7 comprising the following sequence: 5′-GTXGCCCCTTCTCCCXGCAGC-3′ (SEQ ID NO: 9) wherein X is 5-methyl-2′-deoxycytidine and wherein the internucleotide linkages are phosphorothioate linkages. 19. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the SMAD7 antisense oligonucleotide comprises Formula (I). The following structure of Formula (I) is drawn over four pages: 20. The deuterated SMAD7 antisense oligonucleotide of claim 19, wherein the deuterated SMAD7 antisense oligonucleotide comprises a plurality of deuterated SMAD7 antisense oligonucleotides. 21. The deuterated SMAD7 antisense oligonucleotide of any one of claims 1-20, wherein the deuterated SMAD7 antisense oligonucleotide is a pharmaceutically acceptable salt or solvent. 22. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the SMAD7 antisense oligonucleotide comprises Formula (II). The following structure of Formula (II) is drawn over four pages: 23. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein V is oxygen. 24. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein V is sulfur. 25. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, or more than 97% of W are deuterium. 26. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein more than 1%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, or more than 95% of X are deuterium. 27. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein more than 1%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, or more than 95% of Y are deuterium. 28. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 97%, more than 98%, or more than 99% of Z are deuterium. 29. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein about the same fraction of W, X, Y and Z in Formula (II) are D. 30. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the fractions of W, X, Y and Z in Formula (II) that are D are different. 31. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the relative sizes of the fractions of W, X, Y and Z of Formula (II) that are D has a relationship according to Table 1. 32. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of any one deuterated W of Formula (II) is more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99%. In some embodiments, the degree of deuteration of any one deuterated W of Formula (II) is 100%. 33. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated W of Formula (II) is about the same. 34. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated W of Formula (II) is different. 35. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of only one deuterated X of Formula (II) is more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99%. 36. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of any one deuterated X of Formula (II) is 100%. 37. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of only one deuterated X of Formula (II) is more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99%. 38. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated X of Formula (II) is about the same. 39. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated X of Formula (II) is different. 40. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of only one deuterated Y of Formula (II) is more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99%. 41. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of any one deuterated Y of Formula (II) is 100%. 42. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of only one deuterated Z of Formula (II) is more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99%. 43. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of any one deuterated Z of Formula (II) is 100%. 44. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated Z of Formula (II) is about the same. 45. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated Z of Formula (II) is different. 46. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the average, median, or mean degree of deuteration for the deuterated W, X, Y and Z in Formula (II) is be about the same. 47. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the average, median or mean degree of deuteration is different for deuterated W, X, Y and Z of Formula (II). 48. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the relative average, median or mean degrees of deuteration of deuterated W, X, Y, and Z of Formula (II) has a relationship according to Table 1. 49. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the deuterated SMAD7 antisense oligonucleotide is a pharmaceutically acceptable salt. 50. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the deuterated SMAD7 antisense oligonucleotide is a sodium salt. 51. The deuterated SMAD7 antisense olignucleotide of claim 1, wherein replacing the one or more hydrogens by deuterium (D) creates one or more chiral centers. 52. The deuterated SMAD7 antisense oligonucleotide of claim 51, wherein the one or more chiral centers comprise one or more C2′ or C5′ atoms in a ribose or deoxyribose in the deuterated SMAD7 antisense oligonucleotide. 53. The deuterated SMAD7 antisense oligonucleotide of claim 52, wherein more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 75%, more than 80%, more than 85%, more than 90% or more than 95% or C2′ and/or C5′ of a D-ribose or D-deoxyribose in a deuterated SMAD7 antisense oligonucleotide are chiral centers. 54. The deuterated SMAD7 antisense oligonucleotide of claim 51, wherein the deuterated SMAD7 antisense oligonucleotide comprises a racemic mixture of deuterated SMAD7 antisense oligonucleotides. 55. The deuterated SMAD7 antisense oligonucleotide of claim 51, wherein the deuterated SMAD 7 antisense oligoucleotide comprises an enantiomeric excess. 56. The deuterated SMAD7 antisense oligonucleotide of claim 51, wherein the deuterated SMAD7 antisense oligonucleotide comprises a mixture of diastereomers. 57. The deuterated SMAD7 antisense oligonucleotide of claim 51, wherein the deuterated SMAD7 antisense oligonucleotide includes a SMAD7 antisense oligonucleotide of Formula (III). The following structure of Formula (III) is drawn over four pages: 58. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein essentially all D in the deuterated SMAD7 antisense oligonucleotide are present in one or more nucleotides of interest. 59. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein essentially all D in the deuterated SMAD7 antisense oligonucleotide are present in one or more nucleobases of interest. 60. The deuterated SMAD7 antisense oligonucleotide of claim 59, wherein the nucleobase comprises a purine. 61. The deuterated SMAD7 antisense oligonucleotide of claim 59, wherein the nucleobase comprise a pyrimidine. 62. The deuterated SMAD7 antisense oligonucleotide of claim 59, wherein the one or more nucleobases of interest are selected from the group consisting of adenine, guanine, cytosine, thymine and uracil. 63. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein essentially all D in the deuterated SMAD7 antisense oligonucleotides are present in one or more sugar moieties of interest. 64. The deuterated SMAD7 antisense oligonucleotides of claim 63, wherein the one or more sugar moieties of interest are a ribose or deoxyribose moiety. 65. The deuterated SMAD7 antisense oligonucleotides of claim 1, wherein one or more nucleotides of interest in the deuterated SMAD7 antisense oligonucleotides comprise one or more D. 66. The deuterated SMAD7 antisense oligonucleotide of claim 65, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or 100% of the nucleotides of interest comprise one or more D. 67. The deuterated SMAD7 antisense oligonucleotide of claim 65, wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29 or at least 30 nucleotides of interest comprise one or more D. 68. The deuterated SAMD7 antisense oligonucleotide of claim 65, wherein one or more nucleotides of interest each comprise at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 or at least 12 D. 69. The deuterated SMAD7 antisense oligonucleotide of claim 65, wherein each of the one or more nucleotides of interest comprises the same number of D. 70. The deuterated SMAD7 antisense oligonucleotide of claim 65, wherein two or more nucleotides of interest comprise different numbers of D. 71. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein one or more nucleobases of interest comprise one or more D. 72. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or 100% of nucleobases of interest comprise one or more D. 73. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29 or at least 30 nucleotides of interest comprise one or more D. 74. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein each of the one or more nucleobases of interest comprises at least 1, at least 2, at least 3, at least 4, or at least 5 D. 75. The deuterated SMAD7 antisense oligonucleotide of claim 74, wherein each of the nucleobases of interest comprises the same number of D. 76. The deuterated SMAD7 antisense oligonucleotide of claim 74, wherein two or more nucleobases of interest comprise different numbers of D. 77. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein the one or more nucleobases of interest comprise a purine. 78. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein the purine is an adenine or a guanine. 79. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein the one or more nucleobases of interest comprise a pyrimidine. 80. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein the pyrimidine is a cytosine, thymine or uracil. 81. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein one or more sugar moieties of interest comprise one or more D. 82. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or 100% of sugar moieties of interest comprise one or more D. 83. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29 or at least 30 sugar moieties of interest comprise one or more D. 84. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein each of the one or more sugar moieties of interest comprises at least 1, at least 2, at least 3, at least 4, or at least 5 D. 85. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein each of the sugar moieties of interest comprises the same number of D. 86. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein two or more sugar moieties of interest comprise different numbers of D. 87. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein the one or more sugar moieties of interest comprise a ribose or deoxyribose. 88. A pharmaceutical composition comprising the deuterated SMAD7 antisense oligonucleotide of any one of claims 1-87 and a pharmaceutically acceptable adjuvant and/or excipient. 89. The pharmaceutical composition of claim 88, wherein the pharmaceutical composition is an oral pharmaceutical composition. 90. A method of treating inflammatory bowel disease (IBD), comprising administering to a patient in need thereof an effective amount of the deuterated SMAD7 antisense oligonucleotide of any one of claims 1-87, wherein the deuterated SMAD7 antisense oligonucleotide is effective to treat IBD 91. The method of claim 90, wherein the IBD is Crohn's disease. 92. The method of claim 90, wherein the IBD is ulcerative colitis. 93. The method of claim 90, wherein the antisense oligonucleotide is administered orally.

This disclosure relates generally to deuterated isotopologues of SMAD7 antisense oligonucleotides, pharmaceutical compositions containing the same, and methods of using the same.1. A deuterated SMAD7 antisense oligonucleotide, comprising a plurality of hydrogens (H), wherein one or more hydrogens of the plurality of hydrogens are replaced by deuterium (D). 2. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the one or more hydrogen replaced by deuterium is enriched in deuterium to more than 0.02%, more than 0.03%, more than 0.1%, more than 0.3%, more than 1%, more than 3%, more than 10%, more than 15%, more than 20%, more than 25%, more 30%, more than 35%, more than 40%, more than 45%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98% or more than 99%. 3. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein at least 1%, at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of hydrogens of the plurality of hydrogens are replaced with deuterium. 4. The deuterated SMAD7 antisense oligonucleotide of claim 1, further comprising a plurality of nucleotides, wherein at least 3%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of nucleotides of the plurality of nucleotides are partially or fully deuterated. 5. The deuterated SMAD7 antisense oligonucleotide of claim 1, further comprising a plurality of nucleobases, wherein one or more nucleobases of the plurality of nucleobases are deuterated. 6. The deuterated SMAD7 antisense oligonucleotide of claim 5, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the plurality of nucleobases are partially or fully deuterated. 7. The deuterated SMAD7 antisense oligonucleotide of claim 1, further comprising a plurality of riboses or deoxyriboses, wherein one or more riboses or deoxyriboses of the plurality of riboses or deoxyriboses are deuterated. 8. The deuterated SMAD7 antisense oligonucleotide of claim 7, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of riboses or deoxyriboses of the plurality of deoxyriboses are partially or fully deuterated. 9. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide targets a region of 10 or more, 12 or more, 14 or more, 16 or more, 18 or more, 20 or more, 22 or more, 24 or more, 26 or more, 28 or more or 30 or more consecutive nucleotides of human SMAD7 (SEQ ID NO: 1). 10. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide targets region 108-128 of human SMAD7 (SEQ ID NO: 1) (CDS of NM 005904.3). 11. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide targets nucleotides 403, 233, 294, 295, 296, 298, 299 or 533 of human SMAD7 (SEQ ID NO: 1). 12. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide comprises the nucleotide sequence of SEQ ID NO: 2 (5′-GTCGCCCCTTCTCCCCGCAG-3′) 13. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide comprises the nucleotide sequence of SEQ ID NO: 3 (5′-GTCGCCCCTTCTCCCCGCAGC-3′). 14. The deuterated SMAD7 antisense oligonucleotide of claim 13, wherein at least one internucleoside linkage is a phosphorothioate linkage. 15. The deuterated SMAD7 antisense oligonucleotide of claim 14, wherein all internucleoside linkages are phosphorothioate linkages. 16. The deuterated SMAD7 antisense oligonucleotide of claim 13, wherein 2′-deoxyribonucleotides are replaced by corresponding ribonucleotides. 17. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide is an antisense oligonucleotide phosphorothioate against SMAD7 comprising the following sequence: 5′-GTXGCCCCTTCTCCCXGCAG-3′ (SEQ ID NO: 8) wherein X is 5-methyl-2′-deoxycytidine and wherein all internucleotide linkages are phosphorothioate linkages. 18. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the deuterated SMAD7 antisense oligonucleotide is an antisense oligonucleotide phosphorothioate against SMAD7 comprising the following sequence: 5′-GTXGCCCCTTCTCCCXGCAGC-3′ (SEQ ID NO: 9) wherein X is 5-methyl-2′-deoxycytidine and wherein the internucleotide linkages are phosphorothioate linkages. 19. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the SMAD7 antisense oligonucleotide comprises Formula (I). The following structure of Formula (I) is drawn over four pages: 20. The deuterated SMAD7 antisense oligonucleotide of claim 19, wherein the deuterated SMAD7 antisense oligonucleotide comprises a plurality of deuterated SMAD7 antisense oligonucleotides. 21. The deuterated SMAD7 antisense oligonucleotide of any one of claims 1-20, wherein the deuterated SMAD7 antisense oligonucleotide is a pharmaceutically acceptable salt or solvent. 22. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein the SMAD7 antisense oligonucleotide comprises Formula (II). The following structure of Formula (II) is drawn over four pages: 23. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein V is oxygen. 24. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein V is sulfur. 25. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, or more than 97% of W are deuterium. 26. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein more than 1%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, or more than 95% of X are deuterium. 27. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein more than 1%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, or more than 95% of Y are deuterium. 28. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 97%, more than 98%, or more than 99% of Z are deuterium. 29. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein about the same fraction of W, X, Y and Z in Formula (II) are D. 30. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the fractions of W, X, Y and Z in Formula (II) that are D are different. 31. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the relative sizes of the fractions of W, X, Y and Z of Formula (II) that are D has a relationship according to Table 1. 32. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of any one deuterated W of Formula (II) is more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99%. In some embodiments, the degree of deuteration of any one deuterated W of Formula (II) is 100%. 33. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated W of Formula (II) is about the same. 34. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated W of Formula (II) is different. 35. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of only one deuterated X of Formula (II) is more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99%. 36. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of any one deuterated X of Formula (II) is 100%. 37. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of only one deuterated X of Formula (II) is more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99%. 38. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated X of Formula (II) is about the same. 39. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated X of Formula (II) is different. 40. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of only one deuterated Y of Formula (II) is more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99%. 41. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of any one deuterated Y of Formula (II) is 100%. 42. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of only one deuterated Z of Formula (II) is more than 1% more than 3%, more than 5%, more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 98%, or more than 99%. 43. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of any one deuterated Z of Formula (II) is 100%. 44. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated Z of Formula (II) is about the same. 45. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the degree of deuteration of different deuterated Z of Formula (II) is different. 46. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the average, median, or mean degree of deuteration for the deuterated W, X, Y and Z in Formula (II) is be about the same. 47. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the average, median or mean degree of deuteration is different for deuterated W, X, Y and Z of Formula (II). 48. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the relative average, median or mean degrees of deuteration of deuterated W, X, Y, and Z of Formula (II) has a relationship according to Table 1. 49. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the deuterated SMAD7 antisense oligonucleotide is a pharmaceutically acceptable salt. 50. The deuterated SMAD7 antisense oligonucleotide of claim 22, wherein the deuterated SMAD7 antisense oligonucleotide is a sodium salt. 51. The deuterated SMAD7 antisense olignucleotide of claim 1, wherein replacing the one or more hydrogens by deuterium (D) creates one or more chiral centers. 52. The deuterated SMAD7 antisense oligonucleotide of claim 51, wherein the one or more chiral centers comprise one or more C2′ or C5′ atoms in a ribose or deoxyribose in the deuterated SMAD7 antisense oligonucleotide. 53. The deuterated SMAD7 antisense oligonucleotide of claim 52, wherein more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 75%, more than 80%, more than 85%, more than 90% or more than 95% or C2′ and/or C5′ of a D-ribose or D-deoxyribose in a deuterated SMAD7 antisense oligonucleotide are chiral centers. 54. The deuterated SMAD7 antisense oligonucleotide of claim 51, wherein the deuterated SMAD7 antisense oligonucleotide comprises a racemic mixture of deuterated SMAD7 antisense oligonucleotides. 55. The deuterated SMAD7 antisense oligonucleotide of claim 51, wherein the deuterated SMAD 7 antisense oligoucleotide comprises an enantiomeric excess. 56. The deuterated SMAD7 antisense oligonucleotide of claim 51, wherein the deuterated SMAD7 antisense oligonucleotide comprises a mixture of diastereomers. 57. The deuterated SMAD7 antisense oligonucleotide of claim 51, wherein the deuterated SMAD7 antisense oligonucleotide includes a SMAD7 antisense oligonucleotide of Formula (III). The following structure of Formula (III) is drawn over four pages: 58. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein essentially all D in the deuterated SMAD7 antisense oligonucleotide are present in one or more nucleotides of interest. 59. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein essentially all D in the deuterated SMAD7 antisense oligonucleotide are present in one or more nucleobases of interest. 60. The deuterated SMAD7 antisense oligonucleotide of claim 59, wherein the nucleobase comprises a purine. 61. The deuterated SMAD7 antisense oligonucleotide of claim 59, wherein the nucleobase comprise a pyrimidine. 62. The deuterated SMAD7 antisense oligonucleotide of claim 59, wherein the one or more nucleobases of interest are selected from the group consisting of adenine, guanine, cytosine, thymine and uracil. 63. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein essentially all D in the deuterated SMAD7 antisense oligonucleotides are present in one or more sugar moieties of interest. 64. The deuterated SMAD7 antisense oligonucleotides of claim 63, wherein the one or more sugar moieties of interest are a ribose or deoxyribose moiety. 65. The deuterated SMAD7 antisense oligonucleotides of claim 1, wherein one or more nucleotides of interest in the deuterated SMAD7 antisense oligonucleotides comprise one or more D. 66. The deuterated SMAD7 antisense oligonucleotide of claim 65, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or 100% of the nucleotides of interest comprise one or more D. 67. The deuterated SMAD7 antisense oligonucleotide of claim 65, wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29 or at least 30 nucleotides of interest comprise one or more D. 68. The deuterated SAMD7 antisense oligonucleotide of claim 65, wherein one or more nucleotides of interest each comprise at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 or at least 12 D. 69. The deuterated SMAD7 antisense oligonucleotide of claim 65, wherein each of the one or more nucleotides of interest comprises the same number of D. 70. The deuterated SMAD7 antisense oligonucleotide of claim 65, wherein two or more nucleotides of interest comprise different numbers of D. 71. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein one or more nucleobases of interest comprise one or more D. 72. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or 100% of nucleobases of interest comprise one or more D. 73. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29 or at least 30 nucleotides of interest comprise one or more D. 74. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein each of the one or more nucleobases of interest comprises at least 1, at least 2, at least 3, at least 4, or at least 5 D. 75. The deuterated SMAD7 antisense oligonucleotide of claim 74, wherein each of the nucleobases of interest comprises the same number of D. 76. The deuterated SMAD7 antisense oligonucleotide of claim 74, wherein two or more nucleobases of interest comprise different numbers of D. 77. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein the one or more nucleobases of interest comprise a purine. 78. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein the purine is an adenine or a guanine. 79. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein the one or more nucleobases of interest comprise a pyrimidine. 80. The deuterated SMAD7 antisense oligonucleotide of claim 71, wherein the pyrimidine is a cytosine, thymine or uracil. 81. The deuterated SMAD7 antisense oligonucleotide of claim 1, wherein one or more sugar moieties of interest comprise one or more D. 82. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or 100% of sugar moieties of interest comprise one or more D. 83. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29 or at least 30 sugar moieties of interest comprise one or more D. 84. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein each of the one or more sugar moieties of interest comprises at least 1, at least 2, at least 3, at least 4, or at least 5 D. 85. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein each of the sugar moieties of interest comprises the same number of D. 86. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein two or more sugar moieties of interest comprise different numbers of D. 87. The deuterated SMAD7 antisense oligonucleotide of claim 81, wherein the one or more sugar moieties of interest comprise a ribose or deoxyribose. 88. A pharmaceutical composition comprising the deuterated SMAD7 antisense oligonucleotide of any one of claims 1-87 and a pharmaceutically acceptable adjuvant and/or excipient. 89. The pharmaceutical composition of claim 88, wherein the pharmaceutical composition is an oral pharmaceutical composition. 90. A method of treating inflammatory bowel disease (IBD), comprising administering to a patient in need thereof an effective amount of the deuterated SMAD7 antisense oligonucleotide of any one of claims 1-87, wherein the deuterated SMAD7 antisense oligonucleotide is effective to treat IBD 91. The method of claim 90, wherein the IBD is Crohn's disease. 92. The method of claim 90, wherein the IBD is ulcerative colitis. 93. The method of claim 90, wherein the antisense oligonucleotide is administered orally.

The present invention relates to methods of detecting an increased likelihood of virus infection in a subject. In particular, the present invention relates to methods of detecting an increased likelihood of virus infection in a subject by detecting an altered level of at least one microRNA (miRNA), as well as methods of treating or preventing virus infection. The present invention also relates to nucleotide arrays, oligonucleotides and kits useful for the detection of miRNAs associated with an increased likelihood of virus infection in a subject.

1. A method for determining the likelihood of virus infection in a subject, the method comprising determining the level of at least one miRNA associated with virus infection in the subject, wherein an altered level of the at least one miRNA in the subject when compared to a control is indicative of an increased likelihood of virus infection. 2. The method of claim 1, wherein the virus is Henipavirus. 3. The method of claim 2, wherein the Henipavirus virus is Hendra virus. 4. The method of any one of claims 1 to 3, wherein the at least one miRNA includes a miRNA selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 5. The method of any one of claims 1 to 4, wherein the level of the at least one miRNA is increased when compared to the control. 6. The method of claim 5, wherein the at least one miRNA is selected from miR-146a, miR-150 and/or miR-142-3p. 7. The method of claim 6, wherein the at least one miRNA is miR-146a. 8. The method of any one of claims 1 to 7, wherein the method comprises determining the level of the at least one miRNA in a blood sample obtained from the subject. 9. The method of any one of claims 1 to 8, wherein the method comprises amplifying the miRNA. 10. The method of claim 9, wherein the miRNA is amplified by quantitative reverse transcription polymerase chain reaction. 11. The method of any one of claims 1 to 10, wherein the subject is a human. 12. The method of any one of claims 1 to 10, wherein the subject is a non-human animal. 13. The method of claim 12, wherein the subject is a horse, pig, sheep, bovine, chicken, bat, dog or ferret. 14. The method of any one of claims 1 to 13, wherein the method is performed before virus is detectable in a sample from the subject. 15. The method of any one of claims 1 to 14, further comprising diagnosing virus infection in the subject. 16. The method of claim 15, wherein diagnosing virus infection comprises detecting a viral polypeptide, viral polynucleotide, viral particle and/or antibody to a viral polypeptide in a subject sample. 17. The method of claim 16, wherein diagnosing virus infection comprises performing ELISA, PCR, immunofluorescence assay, serum neutralisation test and/or virus isolation. 18. A method of detecting virus replication in a biological sample obtained from a subject, the method comprising detecting in the sample a level of at least one miRNA associated with virus infection, wherein an altered level of the at least one miRNA in the sample when compared to a control is indicative of virus replication. 19. The method of claim 18, wherein the at least one miRNA is selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 20. A method of treatment comprising performing the method of any one of claims 1 to 19 and administering a therapeutic agent for the treatment of virus infection or a symptom of virus infection. 21. A nucleotide array for determining the likelihood of virus infection in a subject, the microarray comprising miRNA-specific probes for at least one miRNA associated with virus infection. 22. The method of claim 21, wherein the miRNA is selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 23. A set of oligonucleotides for amplifying at least one miRNA associated with virus replication, wherein the at least one miRNA is selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 24. A kit comprising a nucleotide array for determining the likelihood of virus infection in a subject, the nucleotide array comprising miRNA-specific probes for at least one miRNA selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 25. A kit comprising a set of oligonucleotides for amplifying at least one miRNA associated with virus replication, where the at least one miRNA is selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 26. The kit of claim 24 or claim 25, wherein the kit further comprises a control sample. 27. A method of treating or preventing virus infection in a subject, the method comprising administering to the subject an antagonist of at least one miRNA associated with virus infection. 28. The method of claim 27, wherein the at least one miRNA is selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 29. The method of claim 27 or claim 28, wherein the virus is Henipavirus. 30. The method of claim 29, wherein the virus is Hendra virus. 31. The method of any one of claims 27 to 30, wherein the antagonist is an oligonucleotide comprising a nucleotide sequence complementary to the miRNA. 32. The method of any one of claims 27 to 31, wherein the subject is a human. 33. The method of any one of claims 27 to 31, wherein the subject is non-human animal. 34. The method of claim 33, wherein the subject is a horse, pig, sheep, bovine, chicken, bat, dog or ferret. 35. The method of any one of claims 27 to 34, wherein the level of miRNA is increased during virus infection in the absence of the antagonist. 36. The method of claim 35, wherein the miRNA is selected from miR-146a, miR-150 and/or miR-142-3p. 37. The method of any one of claims 27 to 36, wherein the method comprises administering to the subject the antagonist of at least one miRNA associated with virus infection and an NF-κB inhibitor. 38. The method of any one of claims 27 to 37, comprising performing the method of any one of claims 1 to 19 prior to administering the antagonist to the subject. 39. A method of treating or preventing virus infection in a subject, the method comprising administering to the subject an NF-κB inhibitor. 40. Use of an antagonist of a miRNA associated with virus infection in the manufacture of a medicament for the treatment or prevention of virus infection. 41. Use of an antagonist of a miRNA associated with virus infection and an NF-κB inhibitor in the manufacture of a medicament for the treatment or prevention of virus infection. 42. An antagonist of a miRNA associated with virus infection for use in the treatment or prevention of virus infection. 43. An antagonist of a miRNA associated with virus infection and an NF-κB inhibitor for use in the treatment or prevention of virus infection. 44. A pharmaceutical composition comprising an antagonist of a miRNA associated with virus infection and a pharmaceutically acceptable carrier or excipient. 45. The pharmaceutical composition of claim 44 further comprising an NF-κB inhibitor. 46. The use of claim 40 or 41, the antagonist of claim 42 or 43, or the pharmaceutical composition of claim 44 or 45, wherein the virus is Henipavirus.

The present invention relates to methods of detecting an increased likelihood of virus infection in a subject. In particular, the present invention relates to methods of detecting an increased likelihood of virus infection in a subject by detecting an altered level of at least one microRNA (miRNA), as well as methods of treating or preventing virus infection. The present invention also relates to nucleotide arrays, oligonucleotides and kits useful for the detection of miRNAs associated with an increased likelihood of virus infection in a subject.1. A method for determining the likelihood of virus infection in a subject, the method comprising determining the level of at least one miRNA associated with virus infection in the subject, wherein an altered level of the at least one miRNA in the subject when compared to a control is indicative of an increased likelihood of virus infection. 2. The method of claim 1, wherein the virus is Henipavirus. 3. The method of claim 2, wherein the Henipavirus virus is Hendra virus. 4. The method of any one of claims 1 to 3, wherein the at least one miRNA includes a miRNA selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 5. The method of any one of claims 1 to 4, wherein the level of the at least one miRNA is increased when compared to the control. 6. The method of claim 5, wherein the at least one miRNA is selected from miR-146a, miR-150 and/or miR-142-3p. 7. The method of claim 6, wherein the at least one miRNA is miR-146a. 8. The method of any one of claims 1 to 7, wherein the method comprises determining the level of the at least one miRNA in a blood sample obtained from the subject. 9. The method of any one of claims 1 to 8, wherein the method comprises amplifying the miRNA. 10. The method of claim 9, wherein the miRNA is amplified by quantitative reverse transcription polymerase chain reaction. 11. The method of any one of claims 1 to 10, wherein the subject is a human. 12. The method of any one of claims 1 to 10, wherein the subject is a non-human animal. 13. The method of claim 12, wherein the subject is a horse, pig, sheep, bovine, chicken, bat, dog or ferret. 14. The method of any one of claims 1 to 13, wherein the method is performed before virus is detectable in a sample from the subject. 15. The method of any one of claims 1 to 14, further comprising diagnosing virus infection in the subject. 16. The method of claim 15, wherein diagnosing virus infection comprises detecting a viral polypeptide, viral polynucleotide, viral particle and/or antibody to a viral polypeptide in a subject sample. 17. The method of claim 16, wherein diagnosing virus infection comprises performing ELISA, PCR, immunofluorescence assay, serum neutralisation test and/or virus isolation. 18. A method of detecting virus replication in a biological sample obtained from a subject, the method comprising detecting in the sample a level of at least one miRNA associated with virus infection, wherein an altered level of the at least one miRNA in the sample when compared to a control is indicative of virus replication. 19. The method of claim 18, wherein the at least one miRNA is selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 20. A method of treatment comprising performing the method of any one of claims 1 to 19 and administering a therapeutic agent for the treatment of virus infection or a symptom of virus infection. 21. A nucleotide array for determining the likelihood of virus infection in a subject, the microarray comprising miRNA-specific probes for at least one miRNA associated with virus infection. 22. The method of claim 21, wherein the miRNA is selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 23. A set of oligonucleotides for amplifying at least one miRNA associated with virus replication, wherein the at least one miRNA is selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 24. A kit comprising a nucleotide array for determining the likelihood of virus infection in a subject, the nucleotide array comprising miRNA-specific probes for at least one miRNA selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 25. A kit comprising a set of oligonucleotides for amplifying at least one miRNA associated with virus replication, where the at least one miRNA is selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 26. The kit of claim 24 or claim 25, wherein the kit further comprises a control sample. 27. A method of treating or preventing virus infection in a subject, the method comprising administering to the subject an antagonist of at least one miRNA associated with virus infection. 28. The method of claim 27, wherein the at least one miRNA is selected from miR-151-5p, miR-146a, miR-128, miR-140-3p, miR-100, miR-28-3p, miR-302c, miR-150 and/or miR142-3p. 29. The method of claim 27 or claim 28, wherein the virus is Henipavirus. 30. The method of claim 29, wherein the virus is Hendra virus. 31. The method of any one of claims 27 to 30, wherein the antagonist is an oligonucleotide comprising a nucleotide sequence complementary to the miRNA. 32. The method of any one of claims 27 to 31, wherein the subject is a human. 33. The method of any one of claims 27 to 31, wherein the subject is non-human animal. 34. The method of claim 33, wherein the subject is a horse, pig, sheep, bovine, chicken, bat, dog or ferret. 35. The method of any one of claims 27 to 34, wherein the level of miRNA is increased during virus infection in the absence of the antagonist. 36. The method of claim 35, wherein the miRNA is selected from miR-146a, miR-150 and/or miR-142-3p. 37. The method of any one of claims 27 to 36, wherein the method comprises administering to the subject the antagonist of at least one miRNA associated with virus infection and an NF-κB inhibitor. 38. The method of any one of claims 27 to 37, comprising performing the method of any one of claims 1 to 19 prior to administering the antagonist to the subject. 39. A method of treating or preventing virus infection in a subject, the method comprising administering to the subject an NF-κB inhibitor. 40. Use of an antagonist of a miRNA associated with virus infection in the manufacture of a medicament for the treatment or prevention of virus infection. 41. Use of an antagonist of a miRNA associated with virus infection and an NF-κB inhibitor in the manufacture of a medicament for the treatment or prevention of virus infection. 42. An antagonist of a miRNA associated with virus infection for use in the treatment or prevention of virus infection. 43. An antagonist of a miRNA associated with virus infection and an NF-κB inhibitor for use in the treatment or prevention of virus infection. 44. A pharmaceutical composition comprising an antagonist of a miRNA associated with virus infection and a pharmaceutically acceptable carrier or excipient. 45. The pharmaceutical composition of claim 44 further comprising an NF-κB inhibitor. 46. The use of claim 40 or 41, the antagonist of claim 42 or 43, or the pharmaceutical composition of claim 44 or 45, wherein the virus is Henipavirus.

Activity-generating delivery molecules comprising the structure R3—(C═O)-Xaa-NH—R4 wherein Xaa is any D- or L-amino acid residue with a non-hydrogen, substituted or unsubstituted side chain, R3—(C═O)— and —NH—R4 are independently a long chain group, each long chain group containing one or more carbon-carbon double bonds, and salts, compositions and methods of use thereof. The activity-generating delivery compounds and compositions are useful for generating activity of an active agent in a cell, tissue, or subject.

1. A compound comprising an amino acid having a long chain alkenoyl group at the N-terminus and a long chain alkenylamino group at the C-terminus, wherein each long chain group has from 12 to 24 carbon atoms and one or more carbon-carbon double bonds. 2. The compound of claim 1, wherein at least one long chain group has two or more carbon-carbon double bonds. 3. The compound of claim 1, comprising the structure shown in Formula I: R3—(C═O)-Xaa-NH—R4  Formula I 4. The compound of claim 3, wherein R3—(C═O)— is independently a substituted or unsubstituted C(12-24)alkenoyl and —NH—R4 is independently a substituted or unsubstituted C(12-24)alkenylamino. 5. The compound of claim 3, wherein R3,R4 are each independently C12alkenyl, C13 alkenyl, C14alkenyl, C15alkenyl, C16alkenyl, C17alkenyl, C18alkenyl, C19alkenyl, C20alkenyl, C21alkenyl, C22alkenyl, C23alkenyl, or C24alkenyl. 6. The compound of claim 3, wherein: R3—(C═O)— is independently C12alkenoyl, C13alkenoyl, C14alkenoyl, C15alkenoyl, C16alkenoyl, C17alkenoyl, C18alkenoyl, C19alkenoyl, C20alkenoyl, C21alkenoyl, C22alkenoyl, C23alkenoyl, or C24alkenoyl; and —NH—R4 is independently C12alkenylamino, C13alkenylamino, C14alkenylamino, C15alkenylamino, C16alkenylamino, C17alkenylamino, C18alkenylamino, C19alkenylamino, C20alkenylamino, C21alkenylamino, C22alkenylamino, C23alkenylamino, or C24alkenylamino. 7. The compound of claim 3, wherein: R3—(C═O)— is independently C(12:1)alkenoyl, C(12:2)alkenoyl, C(12:3)alkenoyl, C(14:1)alkenoyl, C(14:2)alkenoyl, C(14:3)alkenoyl, C(16:1)alkenoyl, C(16:2)alkenoyl, C(16:3)alkenoyl, C(18:1)alkenoyl, C(18:2)alkenoyl, C(18:3)alkenoyl, C(18:4)alkenoyl, C(20:1)alkenoyl, C(20:2)alkenoyl, C(20:3)alkenoyl, C(20:4)alkenoyl, C(20:5)alkenoyl, C(22:1)alkenoyl, C(22:4)alkenoyl, or C(22:6)alkenoyl; and —NH—R4 is independently C(12:1)alkenylamino, C(12:2)alkenylamino, C(12:3)alkenylamino, C(14:1)alkenylamino, C(14:2)alkenylamino, C(14:3)alkenylamino, C(16:1)alkenylamino, C(16:2)alkenylamino, C(16:3)alkenylamino, C(18:1)alkenylamino, C(18:2)alkenylamino, C(18:3)alkenylamino, C(18:4)alkenylamino, C(20:1)alkenylamino, C(20:2)alkenylamino, C(20:3)alkenylamino, C(20:4)alkenylamino, C(20:5)alkenylamino, C(22:1)alkenylamino, C(22:4)alkenylamino, or C(22:6)alkenylamino. 8. The compound of claim 3, wherein: R3—(C═O)— is independently C(14:1(5))alkenoyl, C(14:1(9))alkenoyl, C(16:1(7))alkenoyl, C(16:1(9))alkenoyl, C(18:1(3))alkenoyl, C(18:1(5))alkenoyl, C(18:1(7))alkenoyl, C(18:1(9))alkenoyl, C(18:1(11))alkenoyl, C(18:1(12))alkenoyl, C(18:2(9,12))alkenoyl, C(18:2(9,11))alkenoyl, C(18:3(9,12,15))alkenoyl, C(18:3(6,9,12))alkenoyl, C(18:3(9,11,13))alkenoyl, C(18:4(6,9,12,15))alkenoyl, C(18:4(9,11,13,15))alkenoyl, C(20:1(9))alkenoyl, C(20:1(11))alkenoyl, C(20:2(8,11))alkenoyl, C(20:2(5,8))alkenoyl, C(20:2(11,14))alkenoyl, C(20:3(5,8,11))alkenoyl, C(20:4(5,8,11,14))alkenoyl, C(20:4(7,10,13,16))alkenoyl, C(20:5(5,8,11,14,17))alkenoyl, C(20:6(4,7,10,13,16,19))alkenoyl, C(22:1(9))alkenoyl, C(22:1(13))alkenoyl, or C(24:1(9))alkenoyl; and —NH—R4 is independently C(14:1(5))alkenylamino, C(14:1(9))alkenylamino, C(16:1(7))alkenylamino, C(16:1(9))alkenylamino, C(18:1(3))alkenylamino, C(18:1(5))alkenylamino, C(18:1(7))alkenylamino, C(18:1(9))alkenylamino, C(18:1(11))alkenylamino, C(18:1(12))alkenylamino, C(18:2(9,12))alkenylamino, C(18:2(9,11))alkenylamino, C(18:3(9,12,15))alkenylamino, C(18:3(6,9,12))alkenylamino, C(18:3(9,11,13))alkenylamino, C(18:4(6,9,12,15))alkenylamino, C(18:4(9,11,13,15))alkenylamino, C(20:1(9))alkenylamino, C(20:1(11))alkenylamino, C(20:2(8,11))alkenylamino, C(20:2(5,8))alkenylamino, C(20:2(11,14))alkenylamino, C(20:3(5,8,11))alkenylamino, C(20:4(5,8,11,14))alkenylamino, C(20:4(7,10,13,16))alkenylamino, C(20:5(5,8,11,14,17))alkenylamino, C(20:6(4,7,10,13,16,19))alkenylamino, C(22:1(9))alkenylamino, C(22:1(13))alkenylamino, or C(24:1(9))alkenylamino. 9. The compound of claim 3, selected from (18:1(3))-DAA-(18:1(3)), (18:1(5))-DAA-(18:1(5)), (18:1(7))-DAA-(18:1(7)), (18:1(9))-DAA-(18:1(9)), (18:1(11))-DAA-(18:1(11)), (18:1(12))-DAA-(18:1(12)), (18:1(3))-DAA-(18:1(5)), (18:1(3))-DAA-(18:1(7)), (18:1(3))-DAA-(18:1(9)), (18:1(3))-DAA-(18:1(11)), (18:1(3))-DAA-(18:1(12)), (18:1(5))-DAA-(18:1(7)), (18:1(5))-DAA-(18:1(9)), (18:1(5))-DAA-(18:1(11)), (18:1(5))-DAA-(18:1(12)), (18:1(7))-DAA-(18:1(9)), (18:1(7))-DAA-(18:1(11)), (18:1(7))-DAA-(18:1(12)), (18:1(9))-DAA-(18:1(11)), (18:1(9))-DAA-(18:1(12)), (18:1(11))-DAA-(18:1(12)), (18:1(3))-DAA-(18:2(9,12)), (18:1(5))-DAA-(18:2(9,12)), (18:1(7))-DAA-(18:2(9,12)), (18:1(9))-DAA-(18:2(9,12)), (18:1(11))-DAA-(18:2(9,12)), (18:1(12))-DAA-(18:2(9,12)), (18:2(9,12))-DAA-(18:1(3)), (18:2(9,12))-DAA-(18:1(5)), (18:2(9,12))-DAA-(18:1(7)), (18:2(9,12))-DAA-(18:1(9)), (18:2(9,12))-DAA-(18:1(11)), (18:2(9,12))-DAA-(18:1(12)), (18:2(9,12))-DAA-(18:2(9,12)), and a cationic form of any of the foregoing. 10. The compound of claim 3, selected from (18:1(3))-DAP-(18:1(3)), (18:1(5))-DAP-(18:1(5)), (18:1(7))-DAP-(18:1(7)), (18:1(9))-DAP-(18:1(9)), (18:1(11))-DAP-(18:1(11)), (18:1(12))-DAP-(18:1(12)), (18:1(3))-DAP-(18:1(5)), (18:1(3))-DAP-(18:1(7)), (18:1(3))-DAP-(18:1(9)), (18:1(3))-DAP-(18:1(11)), (18:1(3))-DAP-(18:1(12)), (18:1(5))-DAP-(18:1(7)), (18:1(5))-DAP-(18:1(9)), (18:1(5))-DAP-(18:1(11)), (18:1(5))-DAP-(18:1(12)), (18:1(7))-DAP-(18:1(9)), (18:1(7))-DAP-(18:1(11)), (18:1(7))-DAP-(18:1(12)), (18:1(9))-DAP-(18:1(11)), (18:1(9))-DAP-(18:1(12)), (18:1(11))-DAP-(18:1(12)), (18:1(3))-DAP-(18:2(9,12)), (18:1(5))-DAP-(18:2(9,12)), (18:1(7))-DAP-(18:2(9,12)), (18:1(9))-DAP-(18:2(9,12)), (18:1(11))-DAP-(18:2(9,12)), (18:1(12))-DAP-(18:2(9,12)), (18:2(9,12))-DAP-(18:1(3)), (18:2(9,12))-DAP-(18:1(5)), (18:2(9,12))-DAP-(18:1(7)), (18:2(9,12))-DAP-(18:1(9)), (18:2(9,12))-DAP-(18:1(11)), (18:2(9,12))-DAP-(18:1(12)), (18:2(9,12))-DAP-(18:2(9,12)), and a cationic form of any of the foregoing. 11. The compound of claim 3, selected from (18:1(3))-DAB-(18:1(3)), (18:1(5))-DAB-(18:1(5)), (18:1(7))-DAB-(18:1(7)), (18:1(9))-DAB-(18:1(9)), (18:1(11))-DAB-(18:1(11)), (18:1(12))-DAB-(18:1(12)), (18:1(3))-DAB-(18:1(5)), (18:1(3))-DAB-(18:1(7)), (18:1(3))-DAB-(18:1(9)), (18:1(3))-DAB-(18:1(11)), (18:1(3))-DAB-(18:1(12)), (18:1(5))-DAB-(18:1(7)), (18:1(5))-DAB-(18:1(9)), (18:1(5))-DAB-(18:1(11)), (18:1(5))-DAB-(18:1(12)), (18:1(7))-DAB-(18:1(9)), (18:1(7))-DAB-(18:1(11)), (18:1(7))-DAB-(18:1(12)), (18:1(9))-DAB-(18:1(11)), (18:1(9))-DAB-(18:1(12)), (18:1(11))-DAB-(18:1(12)), (18:1(3))-DAB-(18:2(9,12)), (18:1(5))-DAB-(18:2(9,12)), (18:1(7))-DAB-(18:2(9,12)), (18:1(9))-DAB-(18:2(9,12)), (18:1(11))-DAB-(18:2(9,12)), (18:1(12))-DAB-(18:2(9,12)), (18:2(9,12))-DAB-(18:1(3)), (18:2(9,12))-DAB-(18:1(5)), (18:2(9,12))-DAB-(18:1(7)), (18:2(9,12))-DAB-(18:1(9)), (18:2(9,12))-DAB-(18:1(11)), (18:2(9,12))-DAB-(18:1(12)), (18:2(9,12))-DAB-(18:2(9,12)), and a cationic form of any of the foregoing. 12. The compound of claim 3, selected from (18:1(3))-Orn-(18:1(3)), (18:1(5))-Orn-(18:1(5)), (18:1(7))-Orn-(18:1(7)), (18:1(9))-Orn-(18:1(9)), (18:1(11))-Orn-(18:1(11)), (18:1(12))-Orn-(18:1(12)), (18:1(3))-Orn-(18:1(5)), (18:1(3))-Orn-(18:1(7)), (18:1(3))-Orn-(18:1(9)), (18:1(3))-Orn-(18:1(11)), (18:1(3))-Orn-(18:1(12)), (18:1(5))-Orn-(18:1(7)), (18:1(5))-Orn-(18:1(9)), (18:1(5))-Orn-(18:1(11)), (18:1(5))-Orn-(18:1(12)), (18:1(7))-Orn-(18:1(9)), (18:1(7))-Orn-(18:1(11)), (18:1(7))-Orn-(18:1(12)), (18:1(9))-Orn-(18:1(11)), (18:1(9))-Orn-(18:1(12)), (18:1(11))-Orn-(18:1(12)), (18:1(3))-Orn-(18:2(9,12)), (18:1(5))-Orn-(18:2(9,12)), (18:1(7))-Orn-(18:2(9,12)), (18:1(9))-Orn-(18:2(9,12)), (18:1(11))-Orn-(18:2(9,12)), (18:1(12))-Orn-(18:2(9,12)), (18:2(9,12))-Orn-(18:1(3)), (18:2(9,12))-Orn-(18:1(5)), (18:2(9,12))-Orn-(18:1(7)), (18:2(9,12))-Orn-(18:1(9)), (18:2(9,12))-Orn-(18:1(11)), (18:2(9,12))-Orn-(18:1(12)), (18:2(9,12))-Orn-(18:2(9,12)), and a cationic form of any of the foregoing. 13. The compound of claim 3, selected from (18:1(3))-Lys-(18:1(3)), (18:1(5))-Lys-(18:1(5)), (18:1(7))-Lys-(18:1(7)), (18:1(9))-Lys-(18:1(9)), (18:1(11))-Lys-(18:1(11)), (18:1(12))-Lys-(18:1(12)), (18:1(3))-Lys-(18:1(5)), (18:1(3))-Lys-(18:1(7)), (18:1(3))-Lys-(18:1(9)), (18:1(3))-Lys-(18:1(11)), (18:1(3))-Lys-(18:1(12)), (18:1(5))-Lys-(18:1(7)), (18:1(5))-Lys-(18:1(9)), (18:1(5))-Lys-(18:1(11)), (18:1(5))-Lys-(18:1(12)), (18:1(7))-Lys-(18:1(9)), (18:1(7))-Lys-(18:1(11)), (18:1(7))-Lys-(18:1(12)), (18:1(9))-Lys-(18:1(11)), (18:1(9))-Lys-(18:1(12)), (18:1(11))-Lys-(18:1(12)), (18:1(3))-Lys-(18:2(9,12)), (18:1(5))-Lys-(18:2(9,12)), (18:1(7))-Lys-(18:2(9,12)), (18:1(9))-Lys-(18:2(9,12)), (18:1(11))-Lys-(18:2(9,12)), (18:1(12))-Lys-(18:2(9,12)), (18:2(9,12))-Lys-(18:1(3)), (18:2(9,12))-Lys-(18:1(5)), (18:2(9,12))-Lys-(18:1(7)), (18:2(9,12))-Lys-(18:1(9)), (18:2(9,12))-Lys-(18:1(11)), (18:2(9,12))-Lys-(18:1(12)), (18:2(9,12))-Lys-(18:2(9,12)), and a cationic form of any of the foregoing. 14. The compound of claim 3, selected from (18:1(3))-norArg-(18:1(3)), (18:1(5))-norArg-(18:1(5)), (18:1(7))-norArg-(18:1(7)), (18:1(9))-norArg-(18:1(9)), (18:1(11))-norArg-(18:1(11)), (18:1(12))-norArg-(18:1(12)), (18:1(3))-norArg-(18:1(5)), (18:1(3))-norArg-(18:1(7)), (18:1(3))-norArg-(18:1(9)), (18:1(3))-norArg-(18:1(11)), (18:1(3))-norArg-(18:1(12)), (18:1(5))-norArg-(18:1(7)), (18:1(5))-norArg-(18:1(9)), (18:1(5))-norArg-(18:1(11)), (18:1(5))-norArg-(18:1(12)), (18:1(7))-norArg-(18:1(9)), (18:1(7))-norArg-(18:1(11)), (18:1(7))-norArg-(18:1(12)), (18:1(9))-norArg-(18:1(11)), (18:1(9))-norArg-(18:1(12)), (18:1(11))-norArg-(18:1(12)), (18:1(3))-norArg-(18:2(9,12)), (18:1(5))-norArg-(18:2(9,12)), (18:1(7))-norArg-(18:2(9,12)), (18:1(9))-norArg-(18:2(9,12)), (18:1(11))-norArg-(18:2(9,12)), (18:1(12))-norArg-(18:2(9,12)), (18:2(9,12))-norArg-(18:1(3)), (18:2(9,12))-norArg-(18:1(5)), (18:2(9,12))-norArg-(18:1(7)), (18:2(9,12))-norArg-(18:1(9)), (18:2(9,12))-norArg-(18:1(11)), (18:2(9,12))-norArg-(18:1(12)), (18:2(9,12))-norArg-(18:2(9,12)), and a cationic form of any of the foregoing. 15. The compound of claim 3, selected from (18:1(3))-His-(18:1(3)), (18:1(5))-His-(18:1(5)), (18:1(7))-His-(18:1(7)), (18:1(9))-His-(18:1(9)), (18:1(11))-His-(18:1(11)), (18:1(12))-His-(18:1(12)), (18:1(3))-His-(18:1(5)), (18:1(3))-His-(18:1(7)), (18:1(3))-His-(18:1(9)), (18:1(3))-His-(18:1(11)), (18:1(3))-His-(18:1(12)), (18:1(5))-His-(18:1(7)), (18:1(5))-His-(18:1(9)), (18:1(5))-His-(18:1(11)), (18:1(5))-His-(18:1(12)), (18:1(7))-His-(18:1(9)), (18:1(7))-His-(18:1(11)), (18:1(7))-His-(18:1(12)), (18:1(9))-His-(18:1(11)), (18:1(9))-His-(18:1(12)), (18:1(11))-His-(18:1(12)), (18:1(3))-His-(18:2(9,12)), (18:1(5))-His-(18:2(9,12)), (18:1(7))-His-(18:2(9,12)), (18:1(9))-His-(18:2(9,12)), (18:1(11))-His-(18:2(9,12)), (18:1(12))-His-(18:2(9,12)), (18:2(9,12))-His-(18:1(3)), (18:2(9,12))-His-(18:1(5)), (18:2(9,12))-His-(18:1(7)), (18:2(9,12))-His-(18:1(9)), (18:2(9,12))-His-(18:1(11)), (18:2(9,12))-His-(18:1(12)), (18:2(9,12))-His-(18:2(9,12)), and a cationic form of any of the foregoing. 16. The compound of claim 3, selected from (18:1(3))-Pro-(18:1(3)), (18:1(5))-Pro-(18:1(5)), (18:1(7))-Pro-(18:1(7)), (18:1(9))-Pro-(18:1(9)), (18:1(11))-Pro-(18:1(11)), (18:1(12))-Pro-(18:1(12)), (18:1(3))-Pro-(18:1(5)), (18:1(3))-Pro-(18:1(7)), (18:1(3))-Pro-(18:1(9)), (18:1(3))-Pro-(18:1(11)), (18:1(3))-Pro-(18:1(12)), (18:1(5))-Pro-(18:1(7)), (18:1(5))-Pro-(18:1(9)), (18:1(5))-Pro-(18:1(11)), (18:1(5))-Pro-(18:1(12)), (18:1(7))-Pro-(18:1(9)), (18:1(7))-Pro-(18:1(11)), (18:1(7))-Pro-(18:1(12)), (18:1(9))-Pro-(18:1(11)), (18:1(9))-Pro-(18:1(12)), (18:1(11))-Pro-(18:1(12)), (18:1(3))-Pro-(18:2(9,12)), (18:1(5))-Pro-(18:2(9,12)), (18:1(7))-Pro-(18:2(9,12)), (18:1(9))-Pro-(18:2(9,12)), (18:1(11))-Pro-(18:2(9,12)), (18:1(12))-Pro-(18:2(9,12)), (18:2(9,12))-Pro-(18:1(3)), (18:2(9,12))-Pro-(18:1(5)), (18:2(9,12))-Pro-(18:1(7)), (18:2(9,12))-Pro-(18:1(9)), (18:2(9,12))-Pro-(18:1(11)), (18:2(9,12))-Pro-(18:1(12)), (18:2(9,12))-Pro-(18:2(9,12)), (18:1(3))-Pro(4-amino)-(18:1(3)), (18:1(5))-Pro(4-amino)-(18:1(5)), (18:1(7))-Pro(4-amino)-(18:1(7)), (18:1(9))-Pro(4-amino)-(18:1(9)), (18:1(11))-Pro(4-amino)-(18:1(11)), (18:1(12))-Pro(4-amino)-(18:1(12)), (18:1(3))-Pro(4-amino)-(18:1(5)), (18:1(3))-Pro(4-amino)-(18:1(7)), (18:1(3))-Pro(4-amino)-(18:1(9)), (18:1(3))-Pro(4-amino)-(18:1(11)), (18:1(3))-Pro(4-amino)-(18:1(12)), (18:1(5))-Pro(4-amino)-(18:1(7)), (18:1(5))-Pro(4-amino)-(18:1(9)), (18:1(5))-Pro(4-amino)-(18:1(11)), (18:1(5))-Pro(4-amino)-(18:1(12)), (18:1(7))-Pro(4-amino)-(18:1(9)), (18:1(7))-Pro(4-amino)-(18:1(11)), (18:1(7))-Pro(4-amino)-(18:1(12)), (18:1(9))-Pro(4-amino)-(18:1(11)), (18:1(9))-Pro(4-amino)-(18:1(12)), (18:1(11))-Pro(4-amino)-(18:1(12)), (18:1(3))-Pro(4-amino)-(18:2(9,12)), (18:1(5))-Pro(4-amino)-(18:2(9,12)), (18:1(7))-Pro(4-amino)-(18:2(9,12)), (18:1(9))-Pro(4-amino)-(18:2(9,12)), (18:1(11))-Pro(4-amino)-(18:2(9,12)), (18:1(12))-Pro(4-amino)-(18:2(9,12)), (18:2(9,12))-Pro(4-amino)-(18:1(3)), (18:2(9,12))-Pro(4-amino)-(18:1(5)), (18:2(9,12))-Pro(4-amino)-(18:1(7)), (18:2(9,12))-Pro(4-amino)-(18:1(9)), (18:2(9,12))-Pro(4-amino)-(18:1(11)), (18:2(9,12))-Pro(4-amino)-(18:1(12)), (18:2(9,12))-Pro(4-amino)-(18:2(9,12)), and a cationic form of any of the foregoing. 17. A composition comprising a compound of claim 1 contacted with an active agent. 18. A composition comprising a compound of claim 1 contacted with an active nucleic acid agent. 19. A composition comprising a compound of claim 1 contacted with an active RNA agent. 20. A composition comprising a compound of claim 1 contacted with a UsiRNA agent. 21. A composition comprising a compound of claim 1 contacted with a siRNA agent. 22. A composition comprising a compound of claim 1 admixed with a lipid, a cationic lipid, or a non-cationic lipid. 23. A method for delivering a therapeutic nucleic acid to a cell comprising contacting the cell with a formulation containing a compound according to claim 1 and a nucleic acid agent. 24. A method for inhibiting expression of a gene in a cell comprising contacting the cell with a formulation containing a compound according to claim 1 and a nucleic acid agent. 25. A method for inhibiting expression of a gene in a mammal comprising administering to the mammal a formulation containing a compound according to claim 1 and a nucleic acid agent. 26. A method for treating a disease in a human comprising administering a formulation containing a compound according to claim 1 and a nucleic acid agent to the human, wherein the disease is cancer, bladder cancer, cervical cancer, liver cancer, liver disease, hypercholesterolemia, an inflammatory disease, a metabolic disease, inflammation, arthritis, rheumatoid arthritis, encephalitis, bone fracture, heart disease, and viral disease. 27-29. (canceled)

Activity-generating delivery molecules comprising the structure R3—(C═O)-Xaa-NH—R4 wherein Xaa is any D- or L-amino acid residue with a non-hydrogen, substituted or unsubstituted side chain, R3—(C═O)— and —NH—R4 are independently a long chain group, each long chain group containing one or more carbon-carbon double bonds, and salts, compositions and methods of use thereof. The activity-generating delivery compounds and compositions are useful for generating activity of an active agent in a cell, tissue, or subject.1. A compound comprising an amino acid having a long chain alkenoyl group at the N-terminus and a long chain alkenylamino group at the C-terminus, wherein each long chain group has from 12 to 24 carbon atoms and one or more carbon-carbon double bonds. 2. The compound of claim 1, wherein at least one long chain group has two or more carbon-carbon double bonds. 3. The compound of claim 1, comprising the structure shown in Formula I: R3—(C═O)-Xaa-NH—R4  Formula I 4. The compound of claim 3, wherein R3—(C═O)— is independently a substituted or unsubstituted C(12-24)alkenoyl and —NH—R4 is independently a substituted or unsubstituted C(12-24)alkenylamino. 5. The compound of claim 3, wherein R3,R4 are each independently C12alkenyl, C13 alkenyl, C14alkenyl, C15alkenyl, C16alkenyl, C17alkenyl, C18alkenyl, C19alkenyl, C20alkenyl, C21alkenyl, C22alkenyl, C23alkenyl, or C24alkenyl. 6. The compound of claim 3, wherein: R3—(C═O)— is independently C12alkenoyl, C13alkenoyl, C14alkenoyl, C15alkenoyl, C16alkenoyl, C17alkenoyl, C18alkenoyl, C19alkenoyl, C20alkenoyl, C21alkenoyl, C22alkenoyl, C23alkenoyl, or C24alkenoyl; and —NH—R4 is independently C12alkenylamino, C13alkenylamino, C14alkenylamino, C15alkenylamino, C16alkenylamino, C17alkenylamino, C18alkenylamino, C19alkenylamino, C20alkenylamino, C21alkenylamino, C22alkenylamino, C23alkenylamino, or C24alkenylamino. 7. The compound of claim 3, wherein: R3—(C═O)— is independently C(12:1)alkenoyl, C(12:2)alkenoyl, C(12:3)alkenoyl, C(14:1)alkenoyl, C(14:2)alkenoyl, C(14:3)alkenoyl, C(16:1)alkenoyl, C(16:2)alkenoyl, C(16:3)alkenoyl, C(18:1)alkenoyl, C(18:2)alkenoyl, C(18:3)alkenoyl, C(18:4)alkenoyl, C(20:1)alkenoyl, C(20:2)alkenoyl, C(20:3)alkenoyl, C(20:4)alkenoyl, C(20:5)alkenoyl, C(22:1)alkenoyl, C(22:4)alkenoyl, or C(22:6)alkenoyl; and —NH—R4 is independently C(12:1)alkenylamino, C(12:2)alkenylamino, C(12:3)alkenylamino, C(14:1)alkenylamino, C(14:2)alkenylamino, C(14:3)alkenylamino, C(16:1)alkenylamino, C(16:2)alkenylamino, C(16:3)alkenylamino, C(18:1)alkenylamino, C(18:2)alkenylamino, C(18:3)alkenylamino, C(18:4)alkenylamino, C(20:1)alkenylamino, C(20:2)alkenylamino, C(20:3)alkenylamino, C(20:4)alkenylamino, C(20:5)alkenylamino, C(22:1)alkenylamino, C(22:4)alkenylamino, or C(22:6)alkenylamino. 8. The compound of claim 3, wherein: R3—(C═O)— is independently C(14:1(5))alkenoyl, C(14:1(9))alkenoyl, C(16:1(7))alkenoyl, C(16:1(9))alkenoyl, C(18:1(3))alkenoyl, C(18:1(5))alkenoyl, C(18:1(7))alkenoyl, C(18:1(9))alkenoyl, C(18:1(11))alkenoyl, C(18:1(12))alkenoyl, C(18:2(9,12))alkenoyl, C(18:2(9,11))alkenoyl, C(18:3(9,12,15))alkenoyl, C(18:3(6,9,12))alkenoyl, C(18:3(9,11,13))alkenoyl, C(18:4(6,9,12,15))alkenoyl, C(18:4(9,11,13,15))alkenoyl, C(20:1(9))alkenoyl, C(20:1(11))alkenoyl, C(20:2(8,11))alkenoyl, C(20:2(5,8))alkenoyl, C(20:2(11,14))alkenoyl, C(20:3(5,8,11))alkenoyl, C(20:4(5,8,11,14))alkenoyl, C(20:4(7,10,13,16))alkenoyl, C(20:5(5,8,11,14,17))alkenoyl, C(20:6(4,7,10,13,16,19))alkenoyl, C(22:1(9))alkenoyl, C(22:1(13))alkenoyl, or C(24:1(9))alkenoyl; and —NH—R4 is independently C(14:1(5))alkenylamino, C(14:1(9))alkenylamino, C(16:1(7))alkenylamino, C(16:1(9))alkenylamino, C(18:1(3))alkenylamino, C(18:1(5))alkenylamino, C(18:1(7))alkenylamino, C(18:1(9))alkenylamino, C(18:1(11))alkenylamino, C(18:1(12))alkenylamino, C(18:2(9,12))alkenylamino, C(18:2(9,11))alkenylamino, C(18:3(9,12,15))alkenylamino, C(18:3(6,9,12))alkenylamino, C(18:3(9,11,13))alkenylamino, C(18:4(6,9,12,15))alkenylamino, C(18:4(9,11,13,15))alkenylamino, C(20:1(9))alkenylamino, C(20:1(11))alkenylamino, C(20:2(8,11))alkenylamino, C(20:2(5,8))alkenylamino, C(20:2(11,14))alkenylamino, C(20:3(5,8,11))alkenylamino, C(20:4(5,8,11,14))alkenylamino, C(20:4(7,10,13,16))alkenylamino, C(20:5(5,8,11,14,17))alkenylamino, C(20:6(4,7,10,13,16,19))alkenylamino, C(22:1(9))alkenylamino, C(22:1(13))alkenylamino, or C(24:1(9))alkenylamino. 9. The compound of claim 3, selected from (18:1(3))-DAA-(18:1(3)), (18:1(5))-DAA-(18:1(5)), (18:1(7))-DAA-(18:1(7)), (18:1(9))-DAA-(18:1(9)), (18:1(11))-DAA-(18:1(11)), (18:1(12))-DAA-(18:1(12)), (18:1(3))-DAA-(18:1(5)), (18:1(3))-DAA-(18:1(7)), (18:1(3))-DAA-(18:1(9)), (18:1(3))-DAA-(18:1(11)), (18:1(3))-DAA-(18:1(12)), (18:1(5))-DAA-(18:1(7)), (18:1(5))-DAA-(18:1(9)), (18:1(5))-DAA-(18:1(11)), (18:1(5))-DAA-(18:1(12)), (18:1(7))-DAA-(18:1(9)), (18:1(7))-DAA-(18:1(11)), (18:1(7))-DAA-(18:1(12)), (18:1(9))-DAA-(18:1(11)), (18:1(9))-DAA-(18:1(12)), (18:1(11))-DAA-(18:1(12)), (18:1(3))-DAA-(18:2(9,12)), (18:1(5))-DAA-(18:2(9,12)), (18:1(7))-DAA-(18:2(9,12)), (18:1(9))-DAA-(18:2(9,12)), (18:1(11))-DAA-(18:2(9,12)), (18:1(12))-DAA-(18:2(9,12)), (18:2(9,12))-DAA-(18:1(3)), (18:2(9,12))-DAA-(18:1(5)), (18:2(9,12))-DAA-(18:1(7)), (18:2(9,12))-DAA-(18:1(9)), (18:2(9,12))-DAA-(18:1(11)), (18:2(9,12))-DAA-(18:1(12)), (18:2(9,12))-DAA-(18:2(9,12)), and a cationic form of any of the foregoing. 10. The compound of claim 3, selected from (18:1(3))-DAP-(18:1(3)), (18:1(5))-DAP-(18:1(5)), (18:1(7))-DAP-(18:1(7)), (18:1(9))-DAP-(18:1(9)), (18:1(11))-DAP-(18:1(11)), (18:1(12))-DAP-(18:1(12)), (18:1(3))-DAP-(18:1(5)), (18:1(3))-DAP-(18:1(7)), (18:1(3))-DAP-(18:1(9)), (18:1(3))-DAP-(18:1(11)), (18:1(3))-DAP-(18:1(12)), (18:1(5))-DAP-(18:1(7)), (18:1(5))-DAP-(18:1(9)), (18:1(5))-DAP-(18:1(11)), (18:1(5))-DAP-(18:1(12)), (18:1(7))-DAP-(18:1(9)), (18:1(7))-DAP-(18:1(11)), (18:1(7))-DAP-(18:1(12)), (18:1(9))-DAP-(18:1(11)), (18:1(9))-DAP-(18:1(12)), (18:1(11))-DAP-(18:1(12)), (18:1(3))-DAP-(18:2(9,12)), (18:1(5))-DAP-(18:2(9,12)), (18:1(7))-DAP-(18:2(9,12)), (18:1(9))-DAP-(18:2(9,12)), (18:1(11))-DAP-(18:2(9,12)), (18:1(12))-DAP-(18:2(9,12)), (18:2(9,12))-DAP-(18:1(3)), (18:2(9,12))-DAP-(18:1(5)), (18:2(9,12))-DAP-(18:1(7)), (18:2(9,12))-DAP-(18:1(9)), (18:2(9,12))-DAP-(18:1(11)), (18:2(9,12))-DAP-(18:1(12)), (18:2(9,12))-DAP-(18:2(9,12)), and a cationic form of any of the foregoing. 11. The compound of claim 3, selected from (18:1(3))-DAB-(18:1(3)), (18:1(5))-DAB-(18:1(5)), (18:1(7))-DAB-(18:1(7)), (18:1(9))-DAB-(18:1(9)), (18:1(11))-DAB-(18:1(11)), (18:1(12))-DAB-(18:1(12)), (18:1(3))-DAB-(18:1(5)), (18:1(3))-DAB-(18:1(7)), (18:1(3))-DAB-(18:1(9)), (18:1(3))-DAB-(18:1(11)), (18:1(3))-DAB-(18:1(12)), (18:1(5))-DAB-(18:1(7)), (18:1(5))-DAB-(18:1(9)), (18:1(5))-DAB-(18:1(11)), (18:1(5))-DAB-(18:1(12)), (18:1(7))-DAB-(18:1(9)), (18:1(7))-DAB-(18:1(11)), (18:1(7))-DAB-(18:1(12)), (18:1(9))-DAB-(18:1(11)), (18:1(9))-DAB-(18:1(12)), (18:1(11))-DAB-(18:1(12)), (18:1(3))-DAB-(18:2(9,12)), (18:1(5))-DAB-(18:2(9,12)), (18:1(7))-DAB-(18:2(9,12)), (18:1(9))-DAB-(18:2(9,12)), (18:1(11))-DAB-(18:2(9,12)), (18:1(12))-DAB-(18:2(9,12)), (18:2(9,12))-DAB-(18:1(3)), (18:2(9,12))-DAB-(18:1(5)), (18:2(9,12))-DAB-(18:1(7)), (18:2(9,12))-DAB-(18:1(9)), (18:2(9,12))-DAB-(18:1(11)), (18:2(9,12))-DAB-(18:1(12)), (18:2(9,12))-DAB-(18:2(9,12)), and a cationic form of any of the foregoing. 12. The compound of claim 3, selected from (18:1(3))-Orn-(18:1(3)), (18:1(5))-Orn-(18:1(5)), (18:1(7))-Orn-(18:1(7)), (18:1(9))-Orn-(18:1(9)), (18:1(11))-Orn-(18:1(11)), (18:1(12))-Orn-(18:1(12)), (18:1(3))-Orn-(18:1(5)), (18:1(3))-Orn-(18:1(7)), (18:1(3))-Orn-(18:1(9)), (18:1(3))-Orn-(18:1(11)), (18:1(3))-Orn-(18:1(12)), (18:1(5))-Orn-(18:1(7)), (18:1(5))-Orn-(18:1(9)), (18:1(5))-Orn-(18:1(11)), (18:1(5))-Orn-(18:1(12)), (18:1(7))-Orn-(18:1(9)), (18:1(7))-Orn-(18:1(11)), (18:1(7))-Orn-(18:1(12)), (18:1(9))-Orn-(18:1(11)), (18:1(9))-Orn-(18:1(12)), (18:1(11))-Orn-(18:1(12)), (18:1(3))-Orn-(18:2(9,12)), (18:1(5))-Orn-(18:2(9,12)), (18:1(7))-Orn-(18:2(9,12)), (18:1(9))-Orn-(18:2(9,12)), (18:1(11))-Orn-(18:2(9,12)), (18:1(12))-Orn-(18:2(9,12)), (18:2(9,12))-Orn-(18:1(3)), (18:2(9,12))-Orn-(18:1(5)), (18:2(9,12))-Orn-(18:1(7)), (18:2(9,12))-Orn-(18:1(9)), (18:2(9,12))-Orn-(18:1(11)), (18:2(9,12))-Orn-(18:1(12)), (18:2(9,12))-Orn-(18:2(9,12)), and a cationic form of any of the foregoing. 13. The compound of claim 3, selected from (18:1(3))-Lys-(18:1(3)), (18:1(5))-Lys-(18:1(5)), (18:1(7))-Lys-(18:1(7)), (18:1(9))-Lys-(18:1(9)), (18:1(11))-Lys-(18:1(11)), (18:1(12))-Lys-(18:1(12)), (18:1(3))-Lys-(18:1(5)), (18:1(3))-Lys-(18:1(7)), (18:1(3))-Lys-(18:1(9)), (18:1(3))-Lys-(18:1(11)), (18:1(3))-Lys-(18:1(12)), (18:1(5))-Lys-(18:1(7)), (18:1(5))-Lys-(18:1(9)), (18:1(5))-Lys-(18:1(11)), (18:1(5))-Lys-(18:1(12)), (18:1(7))-Lys-(18:1(9)), (18:1(7))-Lys-(18:1(11)), (18:1(7))-Lys-(18:1(12)), (18:1(9))-Lys-(18:1(11)), (18:1(9))-Lys-(18:1(12)), (18:1(11))-Lys-(18:1(12)), (18:1(3))-Lys-(18:2(9,12)), (18:1(5))-Lys-(18:2(9,12)), (18:1(7))-Lys-(18:2(9,12)), (18:1(9))-Lys-(18:2(9,12)), (18:1(11))-Lys-(18:2(9,12)), (18:1(12))-Lys-(18:2(9,12)), (18:2(9,12))-Lys-(18:1(3)), (18:2(9,12))-Lys-(18:1(5)), (18:2(9,12))-Lys-(18:1(7)), (18:2(9,12))-Lys-(18:1(9)), (18:2(9,12))-Lys-(18:1(11)), (18:2(9,12))-Lys-(18:1(12)), (18:2(9,12))-Lys-(18:2(9,12)), and a cationic form of any of the foregoing. 14. The compound of claim 3, selected from (18:1(3))-norArg-(18:1(3)), (18:1(5))-norArg-(18:1(5)), (18:1(7))-norArg-(18:1(7)), (18:1(9))-norArg-(18:1(9)), (18:1(11))-norArg-(18:1(11)), (18:1(12))-norArg-(18:1(12)), (18:1(3))-norArg-(18:1(5)), (18:1(3))-norArg-(18:1(7)), (18:1(3))-norArg-(18:1(9)), (18:1(3))-norArg-(18:1(11)), (18:1(3))-norArg-(18:1(12)), (18:1(5))-norArg-(18:1(7)), (18:1(5))-norArg-(18:1(9)), (18:1(5))-norArg-(18:1(11)), (18:1(5))-norArg-(18:1(12)), (18:1(7))-norArg-(18:1(9)), (18:1(7))-norArg-(18:1(11)), (18:1(7))-norArg-(18:1(12)), (18:1(9))-norArg-(18:1(11)), (18:1(9))-norArg-(18:1(12)), (18:1(11))-norArg-(18:1(12)), (18:1(3))-norArg-(18:2(9,12)), (18:1(5))-norArg-(18:2(9,12)), (18:1(7))-norArg-(18:2(9,12)), (18:1(9))-norArg-(18:2(9,12)), (18:1(11))-norArg-(18:2(9,12)), (18:1(12))-norArg-(18:2(9,12)), (18:2(9,12))-norArg-(18:1(3)), (18:2(9,12))-norArg-(18:1(5)), (18:2(9,12))-norArg-(18:1(7)), (18:2(9,12))-norArg-(18:1(9)), (18:2(9,12))-norArg-(18:1(11)), (18:2(9,12))-norArg-(18:1(12)), (18:2(9,12))-norArg-(18:2(9,12)), and a cationic form of any of the foregoing. 15. The compound of claim 3, selected from (18:1(3))-His-(18:1(3)), (18:1(5))-His-(18:1(5)), (18:1(7))-His-(18:1(7)), (18:1(9))-His-(18:1(9)), (18:1(11))-His-(18:1(11)), (18:1(12))-His-(18:1(12)), (18:1(3))-His-(18:1(5)), (18:1(3))-His-(18:1(7)), (18:1(3))-His-(18:1(9)), (18:1(3))-His-(18:1(11)), (18:1(3))-His-(18:1(12)), (18:1(5))-His-(18:1(7)), (18:1(5))-His-(18:1(9)), (18:1(5))-His-(18:1(11)), (18:1(5))-His-(18:1(12)), (18:1(7))-His-(18:1(9)), (18:1(7))-His-(18:1(11)), (18:1(7))-His-(18:1(12)), (18:1(9))-His-(18:1(11)), (18:1(9))-His-(18:1(12)), (18:1(11))-His-(18:1(12)), (18:1(3))-His-(18:2(9,12)), (18:1(5))-His-(18:2(9,12)), (18:1(7))-His-(18:2(9,12)), (18:1(9))-His-(18:2(9,12)), (18:1(11))-His-(18:2(9,12)), (18:1(12))-His-(18:2(9,12)), (18:2(9,12))-His-(18:1(3)), (18:2(9,12))-His-(18:1(5)), (18:2(9,12))-His-(18:1(7)), (18:2(9,12))-His-(18:1(9)), (18:2(9,12))-His-(18:1(11)), (18:2(9,12))-His-(18:1(12)), (18:2(9,12))-His-(18:2(9,12)), and a cationic form of any of the foregoing. 16. The compound of claim 3, selected from (18:1(3))-Pro-(18:1(3)), (18:1(5))-Pro-(18:1(5)), (18:1(7))-Pro-(18:1(7)), (18:1(9))-Pro-(18:1(9)), (18:1(11))-Pro-(18:1(11)), (18:1(12))-Pro-(18:1(12)), (18:1(3))-Pro-(18:1(5)), (18:1(3))-Pro-(18:1(7)), (18:1(3))-Pro-(18:1(9)), (18:1(3))-Pro-(18:1(11)), (18:1(3))-Pro-(18:1(12)), (18:1(5))-Pro-(18:1(7)), (18:1(5))-Pro-(18:1(9)), (18:1(5))-Pro-(18:1(11)), (18:1(5))-Pro-(18:1(12)), (18:1(7))-Pro-(18:1(9)), (18:1(7))-Pro-(18:1(11)), (18:1(7))-Pro-(18:1(12)), (18:1(9))-Pro-(18:1(11)), (18:1(9))-Pro-(18:1(12)), (18:1(11))-Pro-(18:1(12)), (18:1(3))-Pro-(18:2(9,12)), (18:1(5))-Pro-(18:2(9,12)), (18:1(7))-Pro-(18:2(9,12)), (18:1(9))-Pro-(18:2(9,12)), (18:1(11))-Pro-(18:2(9,12)), (18:1(12))-Pro-(18:2(9,12)), (18:2(9,12))-Pro-(18:1(3)), (18:2(9,12))-Pro-(18:1(5)), (18:2(9,12))-Pro-(18:1(7)), (18:2(9,12))-Pro-(18:1(9)), (18:2(9,12))-Pro-(18:1(11)), (18:2(9,12))-Pro-(18:1(12)), (18:2(9,12))-Pro-(18:2(9,12)), (18:1(3))-Pro(4-amino)-(18:1(3)), (18:1(5))-Pro(4-amino)-(18:1(5)), (18:1(7))-Pro(4-amino)-(18:1(7)), (18:1(9))-Pro(4-amino)-(18:1(9)), (18:1(11))-Pro(4-amino)-(18:1(11)), (18:1(12))-Pro(4-amino)-(18:1(12)), (18:1(3))-Pro(4-amino)-(18:1(5)), (18:1(3))-Pro(4-amino)-(18:1(7)), (18:1(3))-Pro(4-amino)-(18:1(9)), (18:1(3))-Pro(4-amino)-(18:1(11)), (18:1(3))-Pro(4-amino)-(18:1(12)), (18:1(5))-Pro(4-amino)-(18:1(7)), (18:1(5))-Pro(4-amino)-(18:1(9)), (18:1(5))-Pro(4-amino)-(18:1(11)), (18:1(5))-Pro(4-amino)-(18:1(12)), (18:1(7))-Pro(4-amino)-(18:1(9)), (18:1(7))-Pro(4-amino)-(18:1(11)), (18:1(7))-Pro(4-amino)-(18:1(12)), (18:1(9))-Pro(4-amino)-(18:1(11)), (18:1(9))-Pro(4-amino)-(18:1(12)), (18:1(11))-Pro(4-amino)-(18:1(12)), (18:1(3))-Pro(4-amino)-(18:2(9,12)), (18:1(5))-Pro(4-amino)-(18:2(9,12)), (18:1(7))-Pro(4-amino)-(18:2(9,12)), (18:1(9))-Pro(4-amino)-(18:2(9,12)), (18:1(11))-Pro(4-amino)-(18:2(9,12)), (18:1(12))-Pro(4-amino)-(18:2(9,12)), (18:2(9,12))-Pro(4-amino)-(18:1(3)), (18:2(9,12))-Pro(4-amino)-(18:1(5)), (18:2(9,12))-Pro(4-amino)-(18:1(7)), (18:2(9,12))-Pro(4-amino)-(18:1(9)), (18:2(9,12))-Pro(4-amino)-(18:1(11)), (18:2(9,12))-Pro(4-amino)-(18:1(12)), (18:2(9,12))-Pro(4-amino)-(18:2(9,12)), and a cationic form of any of the foregoing. 17. A composition comprising a compound of claim 1 contacted with an active agent. 18. A composition comprising a compound of claim 1 contacted with an active nucleic acid agent. 19. A composition comprising a compound of claim 1 contacted with an active RNA agent. 20. A composition comprising a compound of claim 1 contacted with a UsiRNA agent. 21. A composition comprising a compound of claim 1 contacted with a siRNA agent. 22. A composition comprising a compound of claim 1 admixed with a lipid, a cationic lipid, or a non-cationic lipid. 23. A method for delivering a therapeutic nucleic acid to a cell comprising contacting the cell with a formulation containing a compound according to claim 1 and a nucleic acid agent. 24. A method for inhibiting expression of a gene in a cell comprising contacting the cell with a formulation containing a compound according to claim 1 and a nucleic acid agent. 25. A method for inhibiting expression of a gene in a mammal comprising administering to the mammal a formulation containing a compound according to claim 1 and a nucleic acid agent. 26. A method for treating a disease in a human comprising administering a formulation containing a compound according to claim 1 and a nucleic acid agent to the human, wherein the disease is cancer, bladder cancer, cervical cancer, liver cancer, liver disease, hypercholesterolemia, an inflammatory disease, a metabolic disease, inflammation, arthritis, rheumatoid arthritis, encephalitis, bone fracture, heart disease, and viral disease. 27-29. (canceled)

Disclosed herein are antisense compounds and methods for decreasing PKK mRNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate PKK-associated diseases, disorders, and conditions.

1.-24. (canceled) 25. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 12 consecutive nucleobases complementary to an equal length portion of nucleobases 30570-30610 or 33183-33242 of SEQ ID NO: 10. 26-33. (canceled) 34. The compound of claim 25, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 10. 35. The compound of claim 25, comprising a single-stranded modified oligonucleotide. 36. The compound of claim 25, wherein at least one internucleoside linkage is a modified internucleoside linkage. 37. The compound of claim 36, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. 38. The compound of claim 37, wherein each internucleoside linkage is a phosphorothioate linkage. 39. The compound of claim 25, wherein at least one nucleoside comprises a modified nucleobase. 40. The compound of claim 39, wherein the modified nucleobase is a 5-methylcytosine. 41. The compound of claim 25, wherein the modified oligonucleotide comprises at least one modified sugar. 42. The compound of claim 41, wherein the modified sugar is a 2′ modified sugar, a BNA, or a THP. 43. The compound of claim 42, wherein the modified sugar is any of a 2′-O-methoxyethyl, 2′-O-methyl, a constrained ethyl, a LNA, or a 3′-fluoro-HNA. 44. (canceled) 45. The compound of claim 25, wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5′ wing segment consisting of 5 linked nucleosides; and a 3′ wing segment consisting of 5 linked nucleosides; wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. 46-49. (canceled) 50. A compound consisting of a modified oligonucleotide according to the following formula: mCes mCes mCes mCes mCes Tds Tds mCds Tds Tds Tds Ads Tds Ads Gds mCes mCes Aes Ges mCe; wherein, A=an adenine, mC=a 5′-methylcytosine; G=a guanine, T=a thymine, e=a 2′-O-methoxyethyl modified nucleoside, d=a 2′-deoxynucleoside, and s=a phosphorothioate internucleoside linkage. 51-52. (canceled) 53. A compound consisting of a modified oligonucleotide according to the following formula: 54. (canceled) 55. A composition comprising the compound of claim 25 or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. 56. A method comprising administering to an animal the composition of claim 55. 57. The method of claim 56, wherein the animal is a human. 58. The method of claim 57, wherein administering the compound prevents, treats, or ameliorates a PKK associated disease, disorder or condition. 59. The method of claim 57, wherein the PKK associated disease, disorder or condition is a hereditary angioedema (HAE), edema, angioedema, swelling, angioedema of the lids, ocular edema, macular edema, cerebral edema, thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, stroke, or infarct. 60. (canceled)

Disclosed herein are antisense compounds and methods for decreasing PKK mRNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate PKK-associated diseases, disorders, and conditions.1.-24. (canceled) 25. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising at least 12 consecutive nucleobases complementary to an equal length portion of nucleobases 30570-30610 or 33183-33242 of SEQ ID NO: 10. 26-33. (canceled) 34. The compound of claim 25, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 10. 35. The compound of claim 25, comprising a single-stranded modified oligonucleotide. 36. The compound of claim 25, wherein at least one internucleoside linkage is a modified internucleoside linkage. 37. The compound of claim 36, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. 38. The compound of claim 37, wherein each internucleoside linkage is a phosphorothioate linkage. 39. The compound of claim 25, wherein at least one nucleoside comprises a modified nucleobase. 40. The compound of claim 39, wherein the modified nucleobase is a 5-methylcytosine. 41. The compound of claim 25, wherein the modified oligonucleotide comprises at least one modified sugar. 42. The compound of claim 41, wherein the modified sugar is a 2′ modified sugar, a BNA, or a THP. 43. The compound of claim 42, wherein the modified sugar is any of a 2′-O-methoxyethyl, 2′-O-methyl, a constrained ethyl, a LNA, or a 3′-fluoro-HNA. 44. (canceled) 45. The compound of claim 25, wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5′ wing segment consisting of 5 linked nucleosides; and a 3′ wing segment consisting of 5 linked nucleosides; wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. 46-49. (canceled) 50. A compound consisting of a modified oligonucleotide according to the following formula: mCes mCes mCes mCes mCes Tds Tds mCds Tds Tds Tds Ads Tds Ads Gds mCes mCes Aes Ges mCe; wherein, A=an adenine, mC=a 5′-methylcytosine; G=a guanine, T=a thymine, e=a 2′-O-methoxyethyl modified nucleoside, d=a 2′-deoxynucleoside, and s=a phosphorothioate internucleoside linkage. 51-52. (canceled) 53. A compound consisting of a modified oligonucleotide according to the following formula: 54. (canceled) 55. A composition comprising the compound of claim 25 or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. 56. A method comprising administering to an animal the composition of claim 55. 57. The method of claim 56, wherein the animal is a human. 58. The method of claim 57, wherein administering the compound prevents, treats, or ameliorates a PKK associated disease, disorder or condition. 59. The method of claim 57, wherein the PKK associated disease, disorder or condition is a hereditary angioedema (HAE), edema, angioedema, swelling, angioedema of the lids, ocular edema, macular edema, cerebral edema, thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, stroke, or infarct. 60. (canceled)

Methods and systems for engineering a nanostructure are provided. An exemplary method includes creating at least one cytosine-cytosine and/or thymine-thymine mismatch in at least one oligonucleotide sequence, placing a metal ion into the mismatch of the oligonucleotide sequence to form an electronically functionalized nanostructure, and inducing self-assembly of the oligonucleotide sequence into a defined structure.

1. A method for engineering a nanostructure, comprising: creating at least one cytosine-cytosine and/or thymine-thymine mismatch in at least one oligonucleotide sequence, placing a metal ion into the mismatch of the oligonucleotide sequence to form an electronically functionalized nanostructure, and inducing self-assembly of the oligonucleotide sequence into a defined structure. 2. The method of claim 1, wherein the nanostructure is incorporated to other nanomaterials. 3. The method of claim 1, wherein the placing, further comprises providing at least one metal ions to each mismatch. 4. The method of claim 1, wherein the metal ion is silver. 5. The method of claim 1, wherein the metal ion is mercury. 6. The method of claim 1, wherein the nanostructure comprises at least one fluorophore. 7. The method of claim 1, wherein the nanostructure comprises at least one biotin linker. 8. The method of claim 1, wherein the nanostructure comprises at least one fluorophore and at least one biotin linker. 9. The method of claim 1, wherein the nanostructure is designed by an optimization, wherein a method for the optimization comprises: setting design constraints; initializing populations; evaluating fitness score; and generating new solutions based on high-fitness current solutions. 10. The method of claim 9, wherein the method for the optimization analysis, further comprises evaluating population dynamics, subpopulations, fitness tournaments, random mutation, extinction, recessive traits or/and random death of solutions. 11. The method of claim 1, wherein the nanowire is a duplex DNA nanostructure having at least one core-functionalized region. 12. The method of claim 11, wherein each of the core-functionalized region comprises at least one mismatch or at least one ion-binding site. 13. The method of claim 1, wherein the nanostructure comprises a continuous or discontinuous 1-atom thick chain of the silver ions surrounded by the 2 nm diameter oligonucleotides. 14. The method of claim 1, wherein the nanostructure is assembled through annealing and/or ligation. 15. The method of claim 11, wherein the core-functionalized region, upon incorporation into at least one nanostructure, provide electrical functionalization to the nanostructure. 16. The method of claim 1, wherein the nanostructure is a DNA lattice. 17. The method of claim 1, wherein the oligonucleotide sequence comprises DNA, RNA, LNA, PNA, or XNA.

Methods and systems for engineering a nanostructure are provided. An exemplary method includes creating at least one cytosine-cytosine and/or thymine-thymine mismatch in at least one oligonucleotide sequence, placing a metal ion into the mismatch of the oligonucleotide sequence to form an electronically functionalized nanostructure, and inducing self-assembly of the oligonucleotide sequence into a defined structure.1. A method for engineering a nanostructure, comprising: creating at least one cytosine-cytosine and/or thymine-thymine mismatch in at least one oligonucleotide sequence, placing a metal ion into the mismatch of the oligonucleotide sequence to form an electronically functionalized nanostructure, and inducing self-assembly of the oligonucleotide sequence into a defined structure. 2. The method of claim 1, wherein the nanostructure is incorporated to other nanomaterials. 3. The method of claim 1, wherein the placing, further comprises providing at least one metal ions to each mismatch. 4. The method of claim 1, wherein the metal ion is silver. 5. The method of claim 1, wherein the metal ion is mercury. 6. The method of claim 1, wherein the nanostructure comprises at least one fluorophore. 7. The method of claim 1, wherein the nanostructure comprises at least one biotin linker. 8. The method of claim 1, wherein the nanostructure comprises at least one fluorophore and at least one biotin linker. 9. The method of claim 1, wherein the nanostructure is designed by an optimization, wherein a method for the optimization comprises: setting design constraints; initializing populations; evaluating fitness score; and generating new solutions based on high-fitness current solutions. 10. The method of claim 9, wherein the method for the optimization analysis, further comprises evaluating population dynamics, subpopulations, fitness tournaments, random mutation, extinction, recessive traits or/and random death of solutions. 11. The method of claim 1, wherein the nanowire is a duplex DNA nanostructure having at least one core-functionalized region. 12. The method of claim 11, wherein each of the core-functionalized region comprises at least one mismatch or at least one ion-binding site. 13. The method of claim 1, wherein the nanostructure comprises a continuous or discontinuous 1-atom thick chain of the silver ions surrounded by the 2 nm diameter oligonucleotides. 14. The method of claim 1, wherein the nanostructure is assembled through annealing and/or ligation. 15. The method of claim 11, wherein the core-functionalized region, upon incorporation into at least one nanostructure, provide electrical functionalization to the nanostructure. 16. The method of claim 1, wherein the nanostructure is a DNA lattice. 17. The method of claim 1, wherein the oligonucleotide sequence comprises DNA, RNA, LNA, PNA, or XNA.

Disclosed herein is a method for inhibiting expression of a gene of a subject comprising administering (1) a composition comprising R-(L)a-(G)b; wherein R is an oligonucleotide selected from the group consisting of DNA, RNA, siRNA, and microRNA; L is a linker and each occurrence of L is independently selected from Table 3; G is a targeting ligand and each occurrence of G is independently selected from Table 4; each of a and b is independently 0, 1, 2, 3 or 4; and (2) a composition comprising (P)c-(L)d-(G)e; wherein P is a peptide and each occurrence of P is independently selected from Table 2; L is a linker and each occurrence of L is independently selected from Table 3; G is a targeting ligand and each occurrence of G is independently selected from Table 4; d is 0, 1, 2, 3, 4, 5 or 6; and each of c and e is independently 1, 2, 3, 4, 5 or 6. Compositions in (1) and (2) can be co-administered or sequentially administered.

1. A method for inhibiting expression of a gene of a subject comprising administering: (1) a composition comprising R-(L)a-(G)b to the subject; wherein: R is an oligonucleotide selected from the group consisting of DNA, RNA, siRNA, and microRNA; L is a linker and each occurrence of L is independently selected from Table 3; G is a targeting ligand and each occurrence of G is independently selected from Table 4; and each of a and b is independently 0, 1, 2, 3 or 4; and (2) a composition comprising (P)c-(L)d-(G)e to the subject; wherein: P is a peptide and each occurrence of P is independently selected from Table 2; L is a linker and each occurrence of L is independently selected from Table 3; G is a targeting ligand and each occurrence of G is independently selected from Table 4; d is 0, 1, 2, 3, 4, 5 or 6; and each of c and e is independently 1, 2, 3, 4, 5 or 6. 2. The method of claim 1, wherein R is a ds siRNA or ss siRNA. 3. The method of claim 1, wherein each occurrence of P is independently selected from Table 2b. 4. The method of claim 1, wherein each occurrence of L is independently selected from Table 3a. 5. The method of claim 1, wherein each occurrence of G is independently selected from Table 4a. 6. The method of claim 5, wherein G is a ligand of the following formula: 7. The method of claim 1, wherein: each of a and b is independently 0, 1 or 2; cis 1 or 2; and each of d and e is independently 1, 2 or 3. 8. The method of claim 1, comprising administering: (1) a composition comprising R-(L)a-(G)b to the subject; wherein: R is an siRNA; L is a linker and each occurrence of L is independently selected from Table 3a; G is a targeting ligand and each occurrence of G is independently selected from Table 4a; and each of a and b is independently 0, 1 or 2; and (2) a composition comprising (P)c-(L)d-(G)e to the subject; wherein: P is a peptide and each occurrence of P is independently selected from Table 2b; L is a linker and each occurrence of L is independently selected from Table 3a; G is a targeting ligand and each occurrence of G is independently selected from Table 4a; and each of c, d and e is independently 1, 2 or 3. 9. The method of claim 8, wherein: L of R-(L)a-(G)b is selected from 10. The method of claim 9, wherein each L of compositions (1) and (2) is independently 11. The method of claim 1, wherein: the composition comprising R-(L)a-(G)b and the composition comprising (P)c-(L)d-(G)e are co-administered at the same time. 12. The method of claim 1, wherein: the composition comprising R-(L)a-(G)b and the composition comprising (P)c-(L)d-(G)e are sequentially administered about 0.1 to 1 hour apart. 13. The method of claim 1, wherein the oligonucleotide is administered at a dose of 0.1 to 5 mpk; and the peptide is administered at a dose of 1 to 100 mpk. 14. A composition for dual molecular delivery of an oligonucleotide and a peptide conjugate comprising: (1) R-(L)a-(G)b; and (2) (P)c-(L)d-(G)e; wherein: R is an oligonucleotide selected from the group consisting of DNA, RNA, siRNA, and microRNA; P is a peptide and each occurrence of P is independently selected from Table 2; L is a linker and each occurrence of L is independently selected from Table 3; G is a targeting ligand and each occurrence of G is independently selected from Table 4; each of a and b is independently 0, 1, 2, 3 or 4; and each of c, d and e is independently 1, 2, 3, 4, 5 or 6. 15. The composition of claim 14, wherein: R is an siRNA; each occurrence of P is independently selected from Table 2b; each occurrence of L is independently selected from Table 3a; each occurrence of G is independently selected from Table 4a; each of a and b is independently 0, 1 or 2; cis 1 or 2; and each of d and e is independently 1, 2 or 3. 16. The composition of claim 14, wherein Y comprises a ligand of the following formula: 17. The composition of claim 14, wherein each of a and b is independently 0 or 1; c is 1; and each of d and e is an 1. 18. The composition of claim 14, wherein: (1) G of R-(L)a-(G)b is: 19. The composition of claim 14, wherein R-(L)a-(G)b further comprises a lipid and/or solubilizing agent. 20. The composition of claim 14, wherein: the oligonucleotide is a double stranded siRNA; and G is attached to the guide strand or the passenger strand of the siRNA at different 2′-position of the ribose rings and/or at different terminal 3′ and/or 5′-positions.

Disclosed herein is a method for inhibiting expression of a gene of a subject comprising administering (1) a composition comprising R-(L)a-(G)b; wherein R is an oligonucleotide selected from the group consisting of DNA, RNA, siRNA, and microRNA; L is a linker and each occurrence of L is independently selected from Table 3; G is a targeting ligand and each occurrence of G is independently selected from Table 4; each of a and b is independently 0, 1, 2, 3 or 4; and (2) a composition comprising (P)c-(L)d-(G)e; wherein P is a peptide and each occurrence of P is independently selected from Table 2; L is a linker and each occurrence of L is independently selected from Table 3; G is a targeting ligand and each occurrence of G is independently selected from Table 4; d is 0, 1, 2, 3, 4, 5 or 6; and each of c and e is independently 1, 2, 3, 4, 5 or 6. Compositions in (1) and (2) can be co-administered or sequentially administered.1. A method for inhibiting expression of a gene of a subject comprising administering: (1) a composition comprising R-(L)a-(G)b to the subject; wherein: R is an oligonucleotide selected from the group consisting of DNA, RNA, siRNA, and microRNA; L is a linker and each occurrence of L is independently selected from Table 3; G is a targeting ligand and each occurrence of G is independently selected from Table 4; and each of a and b is independently 0, 1, 2, 3 or 4; and (2) a composition comprising (P)c-(L)d-(G)e to the subject; wherein: P is a peptide and each occurrence of P is independently selected from Table 2; L is a linker and each occurrence of L is independently selected from Table 3; G is a targeting ligand and each occurrence of G is independently selected from Table 4; d is 0, 1, 2, 3, 4, 5 or 6; and each of c and e is independently 1, 2, 3, 4, 5 or 6. 2. The method of claim 1, wherein R is a ds siRNA or ss siRNA. 3. The method of claim 1, wherein each occurrence of P is independently selected from Table 2b. 4. The method of claim 1, wherein each occurrence of L is independently selected from Table 3a. 5. The method of claim 1, wherein each occurrence of G is independently selected from Table 4a. 6. The method of claim 5, wherein G is a ligand of the following formula: 7. The method of claim 1, wherein: each of a and b is independently 0, 1 or 2; cis 1 or 2; and each of d and e is independently 1, 2 or 3. 8. The method of claim 1, comprising administering: (1) a composition comprising R-(L)a-(G)b to the subject; wherein: R is an siRNA; L is a linker and each occurrence of L is independently selected from Table 3a; G is a targeting ligand and each occurrence of G is independently selected from Table 4a; and each of a and b is independently 0, 1 or 2; and (2) a composition comprising (P)c-(L)d-(G)e to the subject; wherein: P is a peptide and each occurrence of P is independently selected from Table 2b; L is a linker and each occurrence of L is independently selected from Table 3a; G is a targeting ligand and each occurrence of G is independently selected from Table 4a; and each of c, d and e is independently 1, 2 or 3. 9. The method of claim 8, wherein: L of R-(L)a-(G)b is selected from 10. The method of claim 9, wherein each L of compositions (1) and (2) is independently 11. The method of claim 1, wherein: the composition comprising R-(L)a-(G)b and the composition comprising (P)c-(L)d-(G)e are co-administered at the same time. 12. The method of claim 1, wherein: the composition comprising R-(L)a-(G)b and the composition comprising (P)c-(L)d-(G)e are sequentially administered about 0.1 to 1 hour apart. 13. The method of claim 1, wherein the oligonucleotide is administered at a dose of 0.1 to 5 mpk; and the peptide is administered at a dose of 1 to 100 mpk. 14. A composition for dual molecular delivery of an oligonucleotide and a peptide conjugate comprising: (1) R-(L)a-(G)b; and (2) (P)c-(L)d-(G)e; wherein: R is an oligonucleotide selected from the group consisting of DNA, RNA, siRNA, and microRNA; P is a peptide and each occurrence of P is independently selected from Table 2; L is a linker and each occurrence of L is independently selected from Table 3; G is a targeting ligand and each occurrence of G is independently selected from Table 4; each of a and b is independently 0, 1, 2, 3 or 4; and each of c, d and e is independently 1, 2, 3, 4, 5 or 6. 15. The composition of claim 14, wherein: R is an siRNA; each occurrence of P is independently selected from Table 2b; each occurrence of L is independently selected from Table 3a; each occurrence of G is independently selected from Table 4a; each of a and b is independently 0, 1 or 2; cis 1 or 2; and each of d and e is independently 1, 2 or 3. 16. The composition of claim 14, wherein Y comprises a ligand of the following formula: 17. The composition of claim 14, wherein each of a and b is independently 0 or 1; c is 1; and each of d and e is an 1. 18. The composition of claim 14, wherein: (1) G of R-(L)a-(G)b is: 19. The composition of claim 14, wherein R-(L)a-(G)b further comprises a lipid and/or solubilizing agent. 20. The composition of claim 14, wherein: the oligonucleotide is a double stranded siRNA; and G is attached to the guide strand or the passenger strand of the siRNA at different 2′-position of the ribose rings and/or at different terminal 3′ and/or 5′-positions.

The present invention discloses microRNAs (miR) involved in the regulation of the lipid and glucose metabolism. Several conserved miR molecules were found as direct targets of the glucocorticoid hormone/glucocorticoid receptor signaling axis. Hence, the present invention pertains to inhibitors of these miRs—such as antimiRs and blockmiRs—as well as isolated miR molecules or miR expression constructs for the treatment or prevention of metabolic disorders caused by deregulated glucocorticoid signaling, such as insulin resistance, the metabolic syndrome, obesity and/or diabetes type II. Particular preferred embodiments of the invention pertain to antagonists or agonists of a miR of the conserved miR-379-410 cluster, particularly of miR-379.

1. A method: a) for the treatment or prevention of a glucocorticoid hormone driven metabolic dysfunction and/or a disease associated with elevated serum levels of triglycerides wherein said method comprises administering, to a patient in need of such treatment, an inhibitor of a micro RNA (miR), or of a target site of a miR, wherein the miR is selected from the group consisting of miR-379, miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541, or b) for the treatment of Addison's disease or in increasing triglyceride serum levels in a patient, wherein said method comprises administering, to a patient in need of such treatment, an inhibitor of a miR, or of a target site of a miR, wherein the miR is selected from the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a. 2. The method according to claim 1, used for the treatment or prevention of a glucocorticoid hormone driven metabolic dysfunction and/or a disease associated with elevated serum levels of triglycerides wherein said miR is selected from the group consisting of miR-379, miR-541, miR-127, miR-134, miR-337-5p, miR-382, miR-592, miR-711, miR-762 and mir-2861. 3. (canceled) 4. The method according to claim 1, wherein the inhibitor is a nucleic acid molecule comprising a sequence complementary to, or hybridizing under stringent conditions to, the sequence of said miR, or said target site of said miR. 5. The method according to claim 1, wherein the inhibitor comprises a chemical modification selected from the group of nucleic acid analogs consisting of phosphorothioate DNA (PS), 2′-O-methyl RNA (OMe), 2′-O-methoxy-ethyl RNA (MOE), peptide nucleic acid (PNA), N3′-P5′ phosphoroamidate (NP), 2′-fluoro-arabino nucleic acid (FANA), locked nucleic acid (LNA), morpholino phosphoroamidate (MF), cyclohexene nucleic acid (CeNA), and tricycle-DNA (tc-DNA). 6. The inhibitor method according to claim 1, comprising wherein the inhibitor comprises a sequence according to SEQ ID NO: 13 (GTTCCATAGTCTACC). 7. An isolated miR-molecule selected from: a) the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a, for use in the treatment or prevention of a glucocorticoid hormone driven metabolic dysfunction and/or a disease associated with elevated serum levels of triglycerides; or b) the group consisting of miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-379, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541, for use in the treatment or prevention of Addison's disease or in increasing triglyceride serum levels in a patient. 8. (canceled) 9. A genetic construct comprising an expressible sequence of an isolated miR-molecule according to claim 7, for use in the treatment or prevention of a disease. 10. A method for altering glucocorticoid activity in a cell, the method comprising the steps of: a. for decreasing glucocorticoid activity in said cell: i. inhibiting the activity or expression of a micro RNA (miR) selected from the group consisting of miR-379, miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541; or ii. increasing the activity or expression of a miR selected from the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a; or b. for increasing glucocorticoid activity in said cell: i. increasing the activity or expression of a miR selected from the group consisting of miR-379, miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541; or ii. inhibiting the activity or expression of a miR selected from the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a. 11. The method according to claim 10, where the activity of a miR is inhibited by introducing into said cell an antisense molecule (antimiR) targeting said miR or a blockmiR targeting the target site of said miR; and/or wherein the activity or expression of said miR is increased by introducing into said cell an expression construct comprising an expressible sequence of said miR. 12. The method according to claim 10, which is an ex-vivo or in-vitro method. 13. The method according to claim 10, wherein said cell is a human cell, such as a human liver or fat cell. 14. A vector comprising an inhibitor of claim 1, or an isolated miR-molecule selected from: a) the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a, for use in the treatment or prevention of a glucocorticoid hormone driven metabolic dysfunction and/or a disease associated with elevated serum levels of triglycerides; and b) the group consisting of miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-379, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541, for use in the treatment or prevention of Addison's disease or in increasing triglyceride serum levels in a patient. 15. A pharmaceutical composition comprising an inhibitor of claim 1 or an isolated miR-molecule selected from: a) the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a, for use in the treatment or prevention of a glucocorticoid hormone driven metabolic dysfunction and/or a disease associated with elevated serum levels of triglycerides; or b) the group consisting of miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-379, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541, for use in the treatment or prevention of Addison's disease or in increasing triglyceride serum levels in a patient; together with pharmaceutically acceptable carriers and/or excipients. 16. The method, according to claim 1, used to treat obesity, diabetes, diabesity, metabolic syndrome, insulin resistance, hyperglycemia, systemic dyslipidemia, Cushing's syndrome, adverse effects associated with glucocorticoid treatment or excess, atherosclerosis, heart disease, stroke or growth defects. 17. The method, according to claim 1, used to increase the weight of a patient. 18. The method, according to claim 2, wherein said miR is miR-379. 19. The method, according to claim 4, wherein said sequence of said miR is a sequence according to any one of SEQ ID NO: 1 to 12.

The present invention discloses microRNAs (miR) involved in the regulation of the lipid and glucose metabolism. Several conserved miR molecules were found as direct targets of the glucocorticoid hormone/glucocorticoid receptor signaling axis. Hence, the present invention pertains to inhibitors of these miRs—such as antimiRs and blockmiRs—as well as isolated miR molecules or miR expression constructs for the treatment or prevention of metabolic disorders caused by deregulated glucocorticoid signaling, such as insulin resistance, the metabolic syndrome, obesity and/or diabetes type II. Particular preferred embodiments of the invention pertain to antagonists or agonists of a miR of the conserved miR-379-410 cluster, particularly of miR-379.1. A method: a) for the treatment or prevention of a glucocorticoid hormone driven metabolic dysfunction and/or a disease associated with elevated serum levels of triglycerides wherein said method comprises administering, to a patient in need of such treatment, an inhibitor of a micro RNA (miR), or of a target site of a miR, wherein the miR is selected from the group consisting of miR-379, miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541, or b) for the treatment of Addison's disease or in increasing triglyceride serum levels in a patient, wherein said method comprises administering, to a patient in need of such treatment, an inhibitor of a miR, or of a target site of a miR, wherein the miR is selected from the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a. 2. The method according to claim 1, used for the treatment or prevention of a glucocorticoid hormone driven metabolic dysfunction and/or a disease associated with elevated serum levels of triglycerides wherein said miR is selected from the group consisting of miR-379, miR-541, miR-127, miR-134, miR-337-5p, miR-382, miR-592, miR-711, miR-762 and mir-2861. 3. (canceled) 4. The method according to claim 1, wherein the inhibitor is a nucleic acid molecule comprising a sequence complementary to, or hybridizing under stringent conditions to, the sequence of said miR, or said target site of said miR. 5. The method according to claim 1, wherein the inhibitor comprises a chemical modification selected from the group of nucleic acid analogs consisting of phosphorothioate DNA (PS), 2′-O-methyl RNA (OMe), 2′-O-methoxy-ethyl RNA (MOE), peptide nucleic acid (PNA), N3′-P5′ phosphoroamidate (NP), 2′-fluoro-arabino nucleic acid (FANA), locked nucleic acid (LNA), morpholino phosphoroamidate (MF), cyclohexene nucleic acid (CeNA), and tricycle-DNA (tc-DNA). 6. The inhibitor method according to claim 1, comprising wherein the inhibitor comprises a sequence according to SEQ ID NO: 13 (GTTCCATAGTCTACC). 7. An isolated miR-molecule selected from: a) the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a, for use in the treatment or prevention of a glucocorticoid hormone driven metabolic dysfunction and/or a disease associated with elevated serum levels of triglycerides; or b) the group consisting of miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-379, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541, for use in the treatment or prevention of Addison's disease or in increasing triglyceride serum levels in a patient. 8. (canceled) 9. A genetic construct comprising an expressible sequence of an isolated miR-molecule according to claim 7, for use in the treatment or prevention of a disease. 10. A method for altering glucocorticoid activity in a cell, the method comprising the steps of: a. for decreasing glucocorticoid activity in said cell: i. inhibiting the activity or expression of a micro RNA (miR) selected from the group consisting of miR-379, miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541; or ii. increasing the activity or expression of a miR selected from the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a; or b. for increasing glucocorticoid activity in said cell: i. increasing the activity or expression of a miR selected from the group consisting of miR-379, miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541; or ii. inhibiting the activity or expression of a miR selected from the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a. 11. The method according to claim 10, where the activity of a miR is inhibited by introducing into said cell an antisense molecule (antimiR) targeting said miR or a blockmiR targeting the target site of said miR; and/or wherein the activity or expression of said miR is increased by introducing into said cell an expression construct comprising an expressible sequence of said miR. 12. The method according to claim 10, which is an ex-vivo or in-vitro method. 13. The method according to claim 10, wherein said cell is a human cell, such as a human liver or fat cell. 14. A vector comprising an inhibitor of claim 1, or an isolated miR-molecule selected from: a) the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a, for use in the treatment or prevention of a glucocorticoid hormone driven metabolic dysfunction and/or a disease associated with elevated serum levels of triglycerides; and b) the group consisting of miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-379, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541, for use in the treatment or prevention of Addison's disease or in increasing triglyceride serum levels in a patient. 15. A pharmaceutical composition comprising an inhibitor of claim 1 or an isolated miR-molecule selected from: a) the group consisting of miR-719, miR-483, miR-669j, miR-146a, miR-1948, miR-342-3p, miR-24-2*, miR-132, miR-182, mir-677 and miR-18a, for use in the treatment or prevention of a glucocorticoid hormone driven metabolic dysfunction and/or a disease associated with elevated serum levels of triglycerides; or b) the group consisting of miR-331-5p, miR-378*, miR-210, miR-152, miR-676*, mir-187, miR-1981, miR-203, miR-337-5p, miR-221, miR-222, miR-31*, miR-29b, miR-676, miR-34a, miR-383, miR-379, miR-301a, miR-1274a, miR-134, miR-409-5p, miR-431, miR-382, miR-127 and miR-541, for use in the treatment or prevention of Addison's disease or in increasing triglyceride serum levels in a patient; together with pharmaceutically acceptable carriers and/or excipients. 16. The method, according to claim 1, used to treat obesity, diabetes, diabesity, metabolic syndrome, insulin resistance, hyperglycemia, systemic dyslipidemia, Cushing's syndrome, adverse effects associated with glucocorticoid treatment or excess, atherosclerosis, heart disease, stroke or growth defects. 17. The method, according to claim 1, used to increase the weight of a patient. 18. The method, according to claim 2, wherein said miR is miR-379. 19. The method, according to claim 4, wherein said sequence of said miR is a sequence according to any one of SEQ ID NO: 1 to 12.

Compounds, compositions and methods are provided for modulating the expression of apolipoprotein C-III. The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein C-III. Methods of using these compounds for modulation of apolipoprotein C-III expression and for diagnosis and treatment of disease associated with expression of apolipoprotein C-III are provided

1. A compound comprising an antisense oligonucleotide, wherein said antisense oligonucleotide specifically hybridizes within nucleotides 3253-3558 of SEQ ID NO: 4 and consists of 15 to 30 linked nucleosides. 2. The compound of claim 1, wherein said compound comprises at least one modified internucleoside linkage, sugar moiety, or nucleobase. 3. The compound of claim 2, wherein said modified internucleoside linkage is a phosphorothioate linkage. 4. The compound of claim 2, wherein said modified sugar moiety is a 2′-O-methoxyethyl (2′-MOE), 2′-fluoro (2′-F) or 2′-methoxy (2′-O—CH3) sugar moiety. 5. The compound of claim 2, wherein said modified nucleobase is a 5-methylcytosine. 6. The compound of claim 1, wherein said compound consists of an antisense oligonucleotide. 7. The compound of claim 1, wherein said antisense oligonucleotide is fully complementary to SEQ ID NO: 4. 8. The compound of claim 1, wherein said antisense oligonucleotide consists of 18, 19, 20, 21, or 22 linked nucleosides. 9. The compound of claim 1, wherein said antisense oligonucleotide consists of 20 linked nucleosides. 10. The compound of claim 1, wherein said compound demonstrates a reduction in apolipoprotein C-III mRNA levels of at least 45% when applied in vitro to cultured HepG2 cells at a concentration of 50 to 300 nM. 11. The compound of claim 1, wherein said antisense oligonucleotide comprises a plurality of 2′-deoxynucleotides flanked on each side by at least one 2′-O-methoxyethyl nucleotide. 12. The compound of claim 1, wherein said antisense oligonucleotide specifically hybridizes within nucleotides 3253-3380, 3417-3445, 3445-3491, 3451-3500 or 3509-3558 of SEQ ID NO: 4. 13. The compound of claim 1, wherein said antisense oligonucleotide consists of: a gap segment consisting often linked 2′-deoxynucleosides; a 5′ wing segment consisting of five linked nucleosides; a 3′ wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar moiety, and wherein each internucleoside linkage is a phosphorothioate linkage. 14. The compound of claim 13, wherein said antisense oligonucleotide comprises at least one cytosine that is a 5-methylcytosine. 15. The compound of claim 14, wherein each cytosine is a 5-methylcytosine. 16. The compound of claim 15, wherein the antisense oligonucleotide is fully complementary to SEQ ID NO: 4. 17. The compound of claim 1, wherein said antisense oligonucleotide comprises at least 8 consecutive nucleobases selected from the nucleobase sequence of SEQ ID NO:78. 18. The compound of claim 1, wherein said antisense oligonucleotide is in salt form. 19. A composition comprising the compound of claim 1, or a salt thereof, and a pharmaceutically acceptable carrier or diluent 20. The compound of claim 1, wherein said compound is single-stranded or double-stranded. 21. The compound of claim 1, further comprising a conjugate group.

Compounds, compositions and methods are provided for modulating the expression of apolipoprotein C-III. The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein C-III. Methods of using these compounds for modulation of apolipoprotein C-III expression and for diagnosis and treatment of disease associated with expression of apolipoprotein C-III are provided1. A compound comprising an antisense oligonucleotide, wherein said antisense oligonucleotide specifically hybridizes within nucleotides 3253-3558 of SEQ ID NO: 4 and consists of 15 to 30 linked nucleosides. 2. The compound of claim 1, wherein said compound comprises at least one modified internucleoside linkage, sugar moiety, or nucleobase. 3. The compound of claim 2, wherein said modified internucleoside linkage is a phosphorothioate linkage. 4. The compound of claim 2, wherein said modified sugar moiety is a 2′-O-methoxyethyl (2′-MOE), 2′-fluoro (2′-F) or 2′-methoxy (2′-O—CH3) sugar moiety. 5. The compound of claim 2, wherein said modified nucleobase is a 5-methylcytosine. 6. The compound of claim 1, wherein said compound consists of an antisense oligonucleotide. 7. The compound of claim 1, wherein said antisense oligonucleotide is fully complementary to SEQ ID NO: 4. 8. The compound of claim 1, wherein said antisense oligonucleotide consists of 18, 19, 20, 21, or 22 linked nucleosides. 9. The compound of claim 1, wherein said antisense oligonucleotide consists of 20 linked nucleosides. 10. The compound of claim 1, wherein said compound demonstrates a reduction in apolipoprotein C-III mRNA levels of at least 45% when applied in vitro to cultured HepG2 cells at a concentration of 50 to 300 nM. 11. The compound of claim 1, wherein said antisense oligonucleotide comprises a plurality of 2′-deoxynucleotides flanked on each side by at least one 2′-O-methoxyethyl nucleotide. 12. The compound of claim 1, wherein said antisense oligonucleotide specifically hybridizes within nucleotides 3253-3380, 3417-3445, 3445-3491, 3451-3500 or 3509-3558 of SEQ ID NO: 4. 13. The compound of claim 1, wherein said antisense oligonucleotide consists of: a gap segment consisting often linked 2′-deoxynucleosides; a 5′ wing segment consisting of five linked nucleosides; a 3′ wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar moiety, and wherein each internucleoside linkage is a phosphorothioate linkage. 14. The compound of claim 13, wherein said antisense oligonucleotide comprises at least one cytosine that is a 5-methylcytosine. 15. The compound of claim 14, wherein each cytosine is a 5-methylcytosine. 16. The compound of claim 15, wherein the antisense oligonucleotide is fully complementary to SEQ ID NO: 4. 17. The compound of claim 1, wherein said antisense oligonucleotide comprises at least 8 consecutive nucleobases selected from the nucleobase sequence of SEQ ID NO:78. 18. The compound of claim 1, wherein said antisense oligonucleotide is in salt form. 19. A composition comprising the compound of claim 1, or a salt thereof, and a pharmaceutically acceptable carrier or diluent 20. The compound of claim 1, wherein said compound is single-stranded or double-stranded. 21. The compound of claim 1, further comprising a conjugate group.

This invention relates to a novel screening method that identifies simple molecular markers that are predictive of whether a particular disease condition is responsive to a specific treatment. Also, a method of diagnosing the susceptibility of an individual suffering from a disease to treatment with an HDAC inhibitor is provided. Also provided is a method of treating a proliferative disease or a condition which involves a change in cell differentiation or growth rate in a patient.

1.-17. (canceled) 18. A method of diagnosing the susceptibility of an individual suffering from cancer to treatment with an HDAC inhibitor, the method comprising assessing the level of expression or activity of a gene's expression product in a sample from a patient and comparing said level of expression or activity to a reference, wherein a level of expression or activity that is different to said reference is indicative of an altered susceptibility to treatment with the HDAC inhibitor relative to the reference state, wherein said gene is Myd88 (myeloid differentiation primary response gene 88), wherein the expression product is a protein, and wherein the protein is detected by an antibody that binds specifically to the Myd88 protein, and wherein the sample comprises tumor cells. 19. The method of claim 18, wherein a level that is significantly higher than the reference level indicates that the individual is more susceptible to treatment with an HDAC inhibitor, and wherein if a significantly higher level is detected then the method further comprises referring the patient for treatment with the HDAC inhibitor. 20. The method of claim 18, wherein the method further comprises treating said patient with an HDAC inhibitor if they are found to be susceptible to treatment with an HDAC inhibitor. 21. The method of claim 18, wherein a level that is significantly lower than the reference level is indicative of an individual's potential resistance to treatment with the HDAC inhibitor. 22. The method of claim 18, wherein the Myd88 gene is a nucleic acid molecule, which: (a) comprises a Myd88 sequence recited in accession number NM 002468; or (b) is a fragment of a sequence according to (a). 23. The method of claim 18, wherein the expression product is a protein, which: (a) has an amino acid sequence encoded by a nucleic acid sequence of claim 22(a); or (b) is a fragment of a protein according to (a), provided that said fragment retains a biological activity possessed by the full length polypeptide of (a) of acting as an adaptor molecule involved in Toll receptor family signaling, or has an antigenic determinant in common with the polypeptide of (a). 24. The method of claim 18, wherein the method of diagnosis is facilitated by an array comprising at least two different types of antibody species, wherein each antibody species is immunospecific with a Myd88 protein. 25. The method of claim 18, wherein said sample is a tissue sample. 26. The method of claim 25, wherein said sample is blood, urine, saliva, or a specific tissue biopsy. 27. A kit for diagnosing the susceptibility of an individual suffering from a disease to treatment with an HDAC inhibitor comprising: (a) one or more antibodies that binds to Myd88; and (b) a reagent useful for the detection of a binding reaction between the antibody and the protein. 28. A method of diagnosing the susceptibility of an individual suffering from a disease to treatment with an HDAC inhibitor, the method comprising assessing the level of expression of a gene or the sequence of a gene in a sample from a patient and comparing said level of expression or sequence to a reference, wherein a level of expression or sequence that is different to said reference is indicative of an altered susceptibility to treatment with the HDAC inhibitor relative to the reference state, and wherein said gene is Myd88 (myeloid differentiation primary response gene 88), wherein the method comprises the steps of: (a) isolating a nucleic acid molecule encoding Myd88 from a sample from a patient being tested for disease; and (b) diagnosing the patient by detecting the presence of a mutation which is associated with an altered susceptibility to treatment with the HDAC inhibitor, or wherein the method comprises the steps of: (i) contacting a sample of tissue from the patient with a nucleic acid probe under stringent conditions that allow the formation of a hybrid complex between a nucleic acid molecule coding for Myd88 and the probe; (ii) contacting a reference sample with the probe under the same conditions used in step (i); and (iii) detecting the presence of hybrid complexes in said samples. 29. A method of diagnosing the susceptibility of an individual suffering from cancer to treatment with an HDAC inhibitor, the method comprising assessing the level of expression or activity of a gene or its expression products, or the sequence of a gene, in a sample from a patient and comparing said level of expression or activity or sequence to a reference, wherein a level of expression or activity or sequence that is different to said reference is indicative of an altered susceptibility to treatment with the HDAC inhibitor relative to the reference state, wherein said gene is Myd88 (myeloid differentiation primary response gene 88), and wherein the disease is cancer, and wherein the sample comprises tumor cells. 30. A method of diagnosing the susceptibility of an individual suffering from cancer to treatment with an HDAC inhibitor, the method comprising assessing the level of expression or activity of a gene or its expression products, or the sequence of a gene, in a sample from a patient and comparing said level of expression or activity or sequence to a reference, wherein a level of expression or activity or sequence that is different to said reference is indicative of an altered susceptibility to treatment with the HDAC inhibitor relative to the reference state, and wherein said gene is Myd88 (myeloid differentiation primary response gene 88), wherein a level that is significantly higher than the reference level indicates that the individual is more susceptible to treatment with an HDAC inhibitor, and wherein if a significantly higher level is detected then the method further comprises treating said patient with an HDAC inhibitor, and wherein the sample comprises tumor cells. 31. The method of claim 28, wherein the method of diagnosis is facilitated by an array comprising at least two nucleic acid molecules, wherein each of said nucleic acid molecules corresponds to the sequence of, is complementary to the sequence of, or hybridises specifically to a Myd88 nucleic acid molecule.

This invention relates to a novel screening method that identifies simple molecular markers that are predictive of whether a particular disease condition is responsive to a specific treatment. Also, a method of diagnosing the susceptibility of an individual suffering from a disease to treatment with an HDAC inhibitor is provided. Also provided is a method of treating a proliferative disease or a condition which involves a change in cell differentiation or growth rate in a patient.1.-17. (canceled) 18. A method of diagnosing the susceptibility of an individual suffering from cancer to treatment with an HDAC inhibitor, the method comprising assessing the level of expression or activity of a gene's expression product in a sample from a patient and comparing said level of expression or activity to a reference, wherein a level of expression or activity that is different to said reference is indicative of an altered susceptibility to treatment with the HDAC inhibitor relative to the reference state, wherein said gene is Myd88 (myeloid differentiation primary response gene 88), wherein the expression product is a protein, and wherein the protein is detected by an antibody that binds specifically to the Myd88 protein, and wherein the sample comprises tumor cells. 19. The method of claim 18, wherein a level that is significantly higher than the reference level indicates that the individual is more susceptible to treatment with an HDAC inhibitor, and wherein if a significantly higher level is detected then the method further comprises referring the patient for treatment with the HDAC inhibitor. 20. The method of claim 18, wherein the method further comprises treating said patient with an HDAC inhibitor if they are found to be susceptible to treatment with an HDAC inhibitor. 21. The method of claim 18, wherein a level that is significantly lower than the reference level is indicative of an individual's potential resistance to treatment with the HDAC inhibitor. 22. The method of claim 18, wherein the Myd88 gene is a nucleic acid molecule, which: (a) comprises a Myd88 sequence recited in accession number NM 002468; or (b) is a fragment of a sequence according to (a). 23. The method of claim 18, wherein the expression product is a protein, which: (a) has an amino acid sequence encoded by a nucleic acid sequence of claim 22(a); or (b) is a fragment of a protein according to (a), provided that said fragment retains a biological activity possessed by the full length polypeptide of (a) of acting as an adaptor molecule involved in Toll receptor family signaling, or has an antigenic determinant in common with the polypeptide of (a). 24. The method of claim 18, wherein the method of diagnosis is facilitated by an array comprising at least two different types of antibody species, wherein each antibody species is immunospecific with a Myd88 protein. 25. The method of claim 18, wherein said sample is a tissue sample. 26. The method of claim 25, wherein said sample is blood, urine, saliva, or a specific tissue biopsy. 27. A kit for diagnosing the susceptibility of an individual suffering from a disease to treatment with an HDAC inhibitor comprising: (a) one or more antibodies that binds to Myd88; and (b) a reagent useful for the detection of a binding reaction between the antibody and the protein. 28. A method of diagnosing the susceptibility of an individual suffering from a disease to treatment with an HDAC inhibitor, the method comprising assessing the level of expression of a gene or the sequence of a gene in a sample from a patient and comparing said level of expression or sequence to a reference, wherein a level of expression or sequence that is different to said reference is indicative of an altered susceptibility to treatment with the HDAC inhibitor relative to the reference state, and wherein said gene is Myd88 (myeloid differentiation primary response gene 88), wherein the method comprises the steps of: (a) isolating a nucleic acid molecule encoding Myd88 from a sample from a patient being tested for disease; and (b) diagnosing the patient by detecting the presence of a mutation which is associated with an altered susceptibility to treatment with the HDAC inhibitor, or wherein the method comprises the steps of: (i) contacting a sample of tissue from the patient with a nucleic acid probe under stringent conditions that allow the formation of a hybrid complex between a nucleic acid molecule coding for Myd88 and the probe; (ii) contacting a reference sample with the probe under the same conditions used in step (i); and (iii) detecting the presence of hybrid complexes in said samples. 29. A method of diagnosing the susceptibility of an individual suffering from cancer to treatment with an HDAC inhibitor, the method comprising assessing the level of expression or activity of a gene or its expression products, or the sequence of a gene, in a sample from a patient and comparing said level of expression or activity or sequence to a reference, wherein a level of expression or activity or sequence that is different to said reference is indicative of an altered susceptibility to treatment with the HDAC inhibitor relative to the reference state, wherein said gene is Myd88 (myeloid differentiation primary response gene 88), and wherein the disease is cancer, and wherein the sample comprises tumor cells. 30. A method of diagnosing the susceptibility of an individual suffering from cancer to treatment with an HDAC inhibitor, the method comprising assessing the level of expression or activity of a gene or its expression products, or the sequence of a gene, in a sample from a patient and comparing said level of expression or activity or sequence to a reference, wherein a level of expression or activity or sequence that is different to said reference is indicative of an altered susceptibility to treatment with the HDAC inhibitor relative to the reference state, and wherein said gene is Myd88 (myeloid differentiation primary response gene 88), wherein a level that is significantly higher than the reference level indicates that the individual is more susceptible to treatment with an HDAC inhibitor, and wherein if a significantly higher level is detected then the method further comprises treating said patient with an HDAC inhibitor, and wherein the sample comprises tumor cells. 31. The method of claim 28, wherein the method of diagnosis is facilitated by an array comprising at least two nucleic acid molecules, wherein each of said nucleic acid molecules corresponds to the sequence of, is complementary to the sequence of, or hybridises specifically to a Myd88 nucleic acid molecule.

Disclosed herein are compounds, compositions and methods for modulating the expression of huntingtin in a cell, tissue or animal. Further provided are methods of slowing or preventing Huntington's Disease (HD) progression using an antisense compound targeted to huntingtin. Additionally provided are methods of delaying or preventing the onset of Huntington's Disease (HD) in an individual susceptible to Huntington's Disease (HD). Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders.

1. An antisense oligonucleotide 12 to 35 nucleotides in length comprising at least 12 consecutive nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs 53-65. 2. The antisense oligonucleotide of claim 1, wherein said antisense oligonucleotide has at least at least 95% complementarity to SEQ ID NO: 4. 3. The antisense oligonucleotide of claim 1, wherein said antisense oligonucleotide has at least at least 100% complementarity to SEQ ID NO: 4. 4. The antisense oligonucleotide of claim 1 having at least one modified internucleoside linkage, sugar moiety, or nucleobase. 5. The antisense oligonucleotide of claim 1 comprising a chimeric oligonucleotide having a gap segment positioned between 5′ and 3′ wing segments. 6. The antisense oligonucleotide of claim 5, wherein the gap segment of the chimeric oligonucleotide is comprised of 2′-deoxynucleotides and the wing segments are comprised of nucleotides having modified sugar moieties. 7. The antisense oligonucleotide of claim 6, wherein the modified sugar moiety is 2′-OMe or a bicyclic nucleic acid. 8. The antisense oligonucleotide of claim 5, wherein the gap segment of the chimeric oligonucleotide consists of ten 2′-deoxynucleotides and each wing segment consists of five 2′-O-methoxyethyl-modified nucleotides. 9. The antisense oligonucleotide of claim 8, wherein said antisense oligonucleotide is 20 nucleotides in length. 10. The antisense oligonucleotide of claim 1, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. 11. The antisense oligonucleotide of claim 1, wherein the each cytosine is a 5-methylcytosine. 12. The antisense oligonucleotide of claim 1, wherein said oligonucleotide is 17 to 25 nucleotides in length. 13. The antisense oligonucleotide of claim 1, wherein said oligonucleotide is 19 to 23 nucleotides in length. 14. The antisense oligonucleotide of claim 1, wherein said oligonucleotide is 20 nucleotides in length. 15. A pharmaceutical composition comprising an antisense oligonucleotide of claim 1 and a pharmaceutically acceptable diluent. 16. The antisense oligonucleotide of claim 1, wherein said nucleotide sequence is selected from the group consisting of SEQ ID NOs: 55 and 60. 17. The antisense oligonucleotide of claim 16, wherein said antisense oligonucleotide has at least at least 95% complementarity to SEQ ID NO: 4. 18. The antisense oligonucleotide of claim 16, wherein said antisense oligonucleotide has at least at least 100% complementarity to SEQ ID NO: 4. 19. The antisense oligonucleotide of claim 16 having at least one modified internucleoside linkage, sugar moiety, or nucleobase. 20. The antisense oligonucleotide of claim 16 comprising a chimeric oligonucleotide having a gap segment positioned between 5′ and 3′ wing segments.

Disclosed herein are compounds, compositions and methods for modulating the expression of huntingtin in a cell, tissue or animal. Further provided are methods of slowing or preventing Huntington's Disease (HD) progression using an antisense compound targeted to huntingtin. Additionally provided are methods of delaying or preventing the onset of Huntington's Disease (HD) in an individual susceptible to Huntington's Disease (HD). Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders.1. An antisense oligonucleotide 12 to 35 nucleotides in length comprising at least 12 consecutive nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs 53-65. 2. The antisense oligonucleotide of claim 1, wherein said antisense oligonucleotide has at least at least 95% complementarity to SEQ ID NO: 4. 3. The antisense oligonucleotide of claim 1, wherein said antisense oligonucleotide has at least at least 100% complementarity to SEQ ID NO: 4. 4. The antisense oligonucleotide of claim 1 having at least one modified internucleoside linkage, sugar moiety, or nucleobase. 5. The antisense oligonucleotide of claim 1 comprising a chimeric oligonucleotide having a gap segment positioned between 5′ and 3′ wing segments. 6. The antisense oligonucleotide of claim 5, wherein the gap segment of the chimeric oligonucleotide is comprised of 2′-deoxynucleotides and the wing segments are comprised of nucleotides having modified sugar moieties. 7. The antisense oligonucleotide of claim 6, wherein the modified sugar moiety is 2′-OMe or a bicyclic nucleic acid. 8. The antisense oligonucleotide of claim 5, wherein the gap segment of the chimeric oligonucleotide consists of ten 2′-deoxynucleotides and each wing segment consists of five 2′-O-methoxyethyl-modified nucleotides. 9. The antisense oligonucleotide of claim 8, wherein said antisense oligonucleotide is 20 nucleotides in length. 10. The antisense oligonucleotide of claim 1, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage. 11. The antisense oligonucleotide of claim 1, wherein the each cytosine is a 5-methylcytosine. 12. The antisense oligonucleotide of claim 1, wherein said oligonucleotide is 17 to 25 nucleotides in length. 13. The antisense oligonucleotide of claim 1, wherein said oligonucleotide is 19 to 23 nucleotides in length. 14. The antisense oligonucleotide of claim 1, wherein said oligonucleotide is 20 nucleotides in length. 15. A pharmaceutical composition comprising an antisense oligonucleotide of claim 1 and a pharmaceutically acceptable diluent. 16. The antisense oligonucleotide of claim 1, wherein said nucleotide sequence is selected from the group consisting of SEQ ID NOs: 55 and 60. 17. The antisense oligonucleotide of claim 16, wherein said antisense oligonucleotide has at least at least 95% complementarity to SEQ ID NO: 4. 18. The antisense oligonucleotide of claim 16, wherein said antisense oligonucleotide has at least at least 100% complementarity to SEQ ID NO: 4. 19. The antisense oligonucleotide of claim 16 having at least one modified internucleoside linkage, sugar moiety, or nucleobase. 20. The antisense oligonucleotide of claim 16 comprising a chimeric oligonucleotide having a gap segment positioned between 5′ and 3′ wing segments.

The level of miRNAs in a sample from a patient is assayed and used as an indicator of the efficacy of a therapeutic intervention for a cardiovascular disease, such as heart failure. The levels of a plurality of miRNAs, such as myomirs, may be measured. Based on the measured level of the miRNAs, the therapeutic intervention may be modified, adjusted, continued or discontinued. The miRNA level may also be used to assess the severity or disease progression of a cardiovascular disease.

1. A method for identifying a subject in need of treatment for a cardiovascular disease, the method comprising the steps of: (a) obtaining a sample from the subject; (b) assaying the levels of a plurality of miRNAs in the sample, wherein the plurality of miRNAs comprise 3 or more miRNAs listed in Table 1 (SEQ ID NOs: 1-504), or in any of Tables 3-7; (c) comparing the levels obtained in step (b) with the levels of the plurality of miRNAs in a control sample; and (d) treating the subject for a cardiovascular disease, if the levels of at least 2 miRNAs obtained in step (b) are at least 2 fold of their levels in the control sample. 2. The method of claim 1, wherein the at least 2 miRNAs in step (d) are any combination of two or more miRNAs selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-203 and miR-126. 3. The method of claim 2, wherein the miRNAs are selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 4. The method of claim 1, wherein the at least 2 miRNAs in step (d) are any combination of two or more miRNAs selected from the group consisting of miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320. 5. The method of claim 1, wherein in step (d) the subject is treated for a cardiovascular disease, if the levels of at least 2 miRNAs obtained in step (b) are at least 10 fold of their levels in the control sample. 6. The method of claim 1, wherein in step (d) the subject is treated for a cardiovascular disease, if the levels of at least 2 miRNAs obtained in step (b) are between about 10 fold and about 200 fold of their levels in the control sample. 7. The method of claim 1, wherein the sample is a plasma or serum sample. 8. The method of claim 1, wherein the cardiovascular disease is heart failure. 9. The method of claim 8, wherein the heart failure is advanced or stable heart failure. 10. The method of claim 1, wherein the subject is treated with a pharmacologic composition, a medical device, surgery, or any combination thereof. 11. The method of claim 10, wherein the medical device is a left ventricular assist device (LVAD). 12. The method of claim 11, wherein the subject is treated with the LVAD for at least three months. 13. The method of claim 1, wherein the subject is treated with antisense oligonucleotides targeting at least one miRNA selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-203 and miR-126. 14. The method of claim 13, wherein the miRNA is selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 15. The method of claim 1, wherein the subject is treated with antisense oligonucleotides targeting at least one miRNA selected from the group consisting of miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320. 16. The method of claim 1, wherein the levels of the plurality of microRNA are determined by RNA sequencing, microarray profiling or real-time PCR. 17. The method of claim 1, wherein the control sample is from a healthy subject or a plurality of healthy subjects. 18. A method for assessing efficacy of a therapy for a cardiovascular disease in a patient, the method comprising the steps of: (a) obtaining a first sample from the patient before initiation of the therapy; (b) assaying the levels of a plurality of miRNAs in the first sample, wherein the plurality of miRNAs comprise 3 or more miRNAs listed in Table 1 (SEQ ID NOs: 1-504), or in any of Tables 3-7; (c) obtaining a second sample from the patient after initiation of the therapy; (d) assaying the levels of the plurality of miRNAs in the second sample; and (e) comparing the levels of step (b) with the levels of step (d). 19. The method of claim 18, wherein the therapy is effective, if the levels of at least 2 miRNAs obtained in step (d) are less than about 20% of their levels obtained in step (b). 20. The method of claim 18, wherein the at least 2 miRNAs in step (f) are any combination of two or more miRNAs selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-203 and miR-126. 21. The method of claim 20, wherein the miRNAs are selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 22. The method of claim 18, wherein the at least 2 miRNAs in step (f) are any combination of two or more miRNAs selected from the group consisting of miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320. 23. The method of claim 18, wherein the therapy is continued if the levels of at least 2 miRNAs obtained in step (d) are less than about 10% of their levels obtained in step (b). 24. The method of claim 18, wherein the sample is a plasma or serum sample. 25. The method of claim 18, wherein the cardiovascular disease is heart failure. 26. The method of claim 18, wherein the therapy is pharmacologic intervention, implantation of a medical device, surgery, or any combination thereof. 27. The method of claim 26, wherein the medical device is a left ventricular assist device (LVAD). 28. The method of claim 27, wherein the therapy with the LVAD is carried out for at least three months. 29. The method of claim 18, wherein the therapy is treatment with antisense oligonucleotides targeting at least one miRNA selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-203 and miR-126. 30. The method of claim 29, wherein the miRNAs are selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 31. The method of claim 18, wherein the therapy is treatment with antisense oligonucleotides targeting at least one miRNA selected from the group consisting of miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320. 32. The method of claim 18, wherein the levels of the plurality of microRNA are determined by RNA sequencing, microarray profiling or real-time PCR. 33. A method for assessing efficacy of a therapy for a cardiovascular disease in a patient, the method comprising the steps of: (a) obtaining a first sample from the patient before initiation of the therapy; (b) assaying the levels of a plurality of miRNAs in the first sample, wherein the plurality of miRNAs comprises 3 or more miRNAs selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-126, miR-203, miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320; (c) obtaining a second sample from the patient after initiation of the therapy; (d) testing the second sample for levels of the plurality of microRNAs; and (e) comparing the levels of step (b) with the levels of step (d). 34. The method of claim 33, wherein the plurality of miRNAs comprises two or more myomirs. 35. The method of claim 33, wherein the miRNAs are selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 36. The method of claim 33, wherein the sample is a plasma or serum sample. 37. The method of claim 33, wherein the cardiovascular disease is heart failure. 38. The method of claim 33, wherein the therapy is implantation of an LVAD. 39. The method of claim 38, wherein the therapy with the LVAD is carried out for at least three months. 40. The method of claim 33, wherein the levels of the plurality of microRNA are determined by RNA sequencing, microarray profiling or real-time PCR. 41. A method for evaluating a cardiovascular disease or monitoring progression of a cardiovascular disease in a patient, the method comprising the steps of: (a) obtaining a sample from the patient; (b) assaying the levels of a plurality of miRNAs in the sample, wherein the plurality of miRNAs comprises 3 or more miRNAs selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-126, miR-203, miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320; and (c) comparing the levels of step (b) with the levels of the plurality of miRNAs in a control sample. 42. A method for evaluating a cardiovascular disease or monitoring progression of a cardiovascular disease in a patient, the method comprising the steps of: (a) obtaining a sample from the patient; (b) testing the sample for levels of a plurality of miRNAs, wherein the plurality of miRNAs comprises 3 or more miRNAs listed in Table 1 (SEQ ID NOs: 1-504), or in any of Tables 3-7; and (c) comparing the levels of step (b) with the levels of the plurality of miRNAs in a control sample. 43. The method of claim 41 or 42, wherein the plurality of miRNAs comprises two or more myomirs. 44. The method of claim 41 or 42, wherein the control sample is from a healthy subject or a plurality of healthy subjects. 45. The method of claim 41 or 42, wherein the sample is a plasma or serum sample. 46. The method of claim 41 or 42, wherein the cardiovascular disease is heart failure. 47. The method of claim 41 or 42, wherein the therapy is implantation of an LVAD. 48. The method of claim 47, wherein the therapy with the LVAD is carried out for at least three months. 49. The method of claim 41 or 42, wherein the levels of the plurality of microRNA are determined by RNA sequencing. 50. A kit comprising: miRNA-specific primers for reverse transcribing or amplifying 3 or more miRNAs selected from Table 1, or selected from any of Tables 3-7, in a plasma or serum sample from a patient receiving treatment for a cardiovascular disease; and instructions for measuring the 3 or more miRNAs for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiovascular disease in the patient. 51. The kit of claim 50, wherein the kit comprises miRNA-specific primers for 3 or more miRNAs selected from miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-126 and miR-203. 52. The method of claim 50, wherein the miRNAs are selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 53. The kit of claim 50, wherein the kit comprises miRNA-specific primers for 3 or more miRNAs selected from miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320. 54. The kit of claim 50, further comprising a labeled-nucleic acid probe specific for each miRNA of the kit.

The level of miRNAs in a sample from a patient is assayed and used as an indicator of the efficacy of a therapeutic intervention for a cardiovascular disease, such as heart failure. The levels of a plurality of miRNAs, such as myomirs, may be measured. Based on the measured level of the miRNAs, the therapeutic intervention may be modified, adjusted, continued or discontinued. The miRNA level may also be used to assess the severity or disease progression of a cardiovascular disease.1. A method for identifying a subject in need of treatment for a cardiovascular disease, the method comprising the steps of: (a) obtaining a sample from the subject; (b) assaying the levels of a plurality of miRNAs in the sample, wherein the plurality of miRNAs comprise 3 or more miRNAs listed in Table 1 (SEQ ID NOs: 1-504), or in any of Tables 3-7; (c) comparing the levels obtained in step (b) with the levels of the plurality of miRNAs in a control sample; and (d) treating the subject for a cardiovascular disease, if the levels of at least 2 miRNAs obtained in step (b) are at least 2 fold of their levels in the control sample. 2. The method of claim 1, wherein the at least 2 miRNAs in step (d) are any combination of two or more miRNAs selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-203 and miR-126. 3. The method of claim 2, wherein the miRNAs are selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 4. The method of claim 1, wherein the at least 2 miRNAs in step (d) are any combination of two or more miRNAs selected from the group consisting of miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320. 5. The method of claim 1, wherein in step (d) the subject is treated for a cardiovascular disease, if the levels of at least 2 miRNAs obtained in step (b) are at least 10 fold of their levels in the control sample. 6. The method of claim 1, wherein in step (d) the subject is treated for a cardiovascular disease, if the levels of at least 2 miRNAs obtained in step (b) are between about 10 fold and about 200 fold of their levels in the control sample. 7. The method of claim 1, wherein the sample is a plasma or serum sample. 8. The method of claim 1, wherein the cardiovascular disease is heart failure. 9. The method of claim 8, wherein the heart failure is advanced or stable heart failure. 10. The method of claim 1, wherein the subject is treated with a pharmacologic composition, a medical device, surgery, or any combination thereof. 11. The method of claim 10, wherein the medical device is a left ventricular assist device (LVAD). 12. The method of claim 11, wherein the subject is treated with the LVAD for at least three months. 13. The method of claim 1, wherein the subject is treated with antisense oligonucleotides targeting at least one miRNA selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-203 and miR-126. 14. The method of claim 13, wherein the miRNA is selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 15. The method of claim 1, wherein the subject is treated with antisense oligonucleotides targeting at least one miRNA selected from the group consisting of miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320. 16. The method of claim 1, wherein the levels of the plurality of microRNA are determined by RNA sequencing, microarray profiling or real-time PCR. 17. The method of claim 1, wherein the control sample is from a healthy subject or a plurality of healthy subjects. 18. A method for assessing efficacy of a therapy for a cardiovascular disease in a patient, the method comprising the steps of: (a) obtaining a first sample from the patient before initiation of the therapy; (b) assaying the levels of a plurality of miRNAs in the first sample, wherein the plurality of miRNAs comprise 3 or more miRNAs listed in Table 1 (SEQ ID NOs: 1-504), or in any of Tables 3-7; (c) obtaining a second sample from the patient after initiation of the therapy; (d) assaying the levels of the plurality of miRNAs in the second sample; and (e) comparing the levels of step (b) with the levels of step (d). 19. The method of claim 18, wherein the therapy is effective, if the levels of at least 2 miRNAs obtained in step (d) are less than about 20% of their levels obtained in step (b). 20. The method of claim 18, wherein the at least 2 miRNAs in step (f) are any combination of two or more miRNAs selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-203 and miR-126. 21. The method of claim 20, wherein the miRNAs are selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 22. The method of claim 18, wherein the at least 2 miRNAs in step (f) are any combination of two or more miRNAs selected from the group consisting of miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320. 23. The method of claim 18, wherein the therapy is continued if the levels of at least 2 miRNAs obtained in step (d) are less than about 10% of their levels obtained in step (b). 24. The method of claim 18, wherein the sample is a plasma or serum sample. 25. The method of claim 18, wherein the cardiovascular disease is heart failure. 26. The method of claim 18, wherein the therapy is pharmacologic intervention, implantation of a medical device, surgery, or any combination thereof. 27. The method of claim 26, wherein the medical device is a left ventricular assist device (LVAD). 28. The method of claim 27, wherein the therapy with the LVAD is carried out for at least three months. 29. The method of claim 18, wherein the therapy is treatment with antisense oligonucleotides targeting at least one miRNA selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-203 and miR-126. 30. The method of claim 29, wherein the miRNAs are selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 31. The method of claim 18, wherein the therapy is treatment with antisense oligonucleotides targeting at least one miRNA selected from the group consisting of miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320. 32. The method of claim 18, wherein the levels of the plurality of microRNA are determined by RNA sequencing, microarray profiling or real-time PCR. 33. A method for assessing efficacy of a therapy for a cardiovascular disease in a patient, the method comprising the steps of: (a) obtaining a first sample from the patient before initiation of the therapy; (b) assaying the levels of a plurality of miRNAs in the first sample, wherein the plurality of miRNAs comprises 3 or more miRNAs selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-126, miR-203, miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320; (c) obtaining a second sample from the patient after initiation of the therapy; (d) testing the second sample for levels of the plurality of microRNAs; and (e) comparing the levels of step (b) with the levels of step (d). 34. The method of claim 33, wherein the plurality of miRNAs comprises two or more myomirs. 35. The method of claim 33, wherein the miRNAs are selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 36. The method of claim 33, wherein the sample is a plasma or serum sample. 37. The method of claim 33, wherein the cardiovascular disease is heart failure. 38. The method of claim 33, wherein the therapy is implantation of an LVAD. 39. The method of claim 38, wherein the therapy with the LVAD is carried out for at least three months. 40. The method of claim 33, wherein the levels of the plurality of microRNA are determined by RNA sequencing, microarray profiling or real-time PCR. 41. A method for evaluating a cardiovascular disease or monitoring progression of a cardiovascular disease in a patient, the method comprising the steps of: (a) obtaining a sample from the patient; (b) assaying the levels of a plurality of miRNAs in the sample, wherein the plurality of miRNAs comprises 3 or more miRNAs selected from the group consisting of miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-126, miR-203, miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320; and (c) comparing the levels of step (b) with the levels of the plurality of miRNAs in a control sample. 42. A method for evaluating a cardiovascular disease or monitoring progression of a cardiovascular disease in a patient, the method comprising the steps of: (a) obtaining a sample from the patient; (b) testing the sample for levels of a plurality of miRNAs, wherein the plurality of miRNAs comprises 3 or more miRNAs listed in Table 1 (SEQ ID NOs: 1-504), or in any of Tables 3-7; and (c) comparing the levels of step (b) with the levels of the plurality of miRNAs in a control sample. 43. The method of claim 41 or 42, wherein the plurality of miRNAs comprises two or more myomirs. 44. The method of claim 41 or 42, wherein the control sample is from a healthy subject or a plurality of healthy subjects. 45. The method of claim 41 or 42, wherein the sample is a plasma or serum sample. 46. The method of claim 41 or 42, wherein the cardiovascular disease is heart failure. 47. The method of claim 41 or 42, wherein the therapy is implantation of an LVAD. 48. The method of claim 47, wherein the therapy with the LVAD is carried out for at least three months. 49. The method of claim 41 or 42, wherein the levels of the plurality of microRNA are determined by RNA sequencing. 50. A kit comprising: miRNA-specific primers for reverse transcribing or amplifying 3 or more miRNAs selected from Table 1, or selected from any of Tables 3-7, in a plasma or serum sample from a patient receiving treatment for a cardiovascular disease; and instructions for measuring the 3 or more miRNAs for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiovascular disease in the patient. 51. The kit of claim 50, wherein the kit comprises miRNA-specific primers for 3 or more miRNAs selected from miR-208a, miR-208b, miR-499, miR-1, miR-206, miR-133a, miR-133b, miR-221, miR-216a, miR-375, miR-210, miR-1908, miR-1180, miR-195, miR-199a, miR-199b, miR-29a, miR-22, miR-122, miR-126 and miR-203. 52. The method of claim 50, wherein the miRNAs are selected from the group consisting of miR-208a, miR-208b, miR-499 or mixtures thereof. 53. The kit of claim 50, wherein the kit comprises miRNA-specific primers for 3 or more miRNAs selected from miR-16, miR-421, miR-195, miR-628, miR-30a, miR-30e, miR-1307, miR-142, miR-101, miR-215, miR-30a, miR-146b, miR-190a, miR-629, miR-378, miR-93, miR-106a, miR-106b, miR-15a, miR-125b, miR-199a, miR-199b, miR-100, miR-216a, miR-370, miR-766, miR-887, miR-1180, miR-129, miR-92b, miR-769, and miR-320. 54. The kit of claim 50, further comprising a labeled-nucleic acid probe specific for each miRNA of the kit.

The present invention includes compositions and methods for making and using a bifunctional shRNAs capable of reducing an expression of a K-ras gene, e.g., a mutated K-ras gene, wherein at least one target site sequence of the bifunctional RNA molecule is located within the K-ras gene and wherein the bifunctional RNA molecule is capable of activating a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras.

1. A bifunctional shRNA capable of reducing an expression of a K-ras gene, wherein at least one target site sequence of the bifunctional RNA molecule is located within the K-ras gene and wherein the bifunctional RNA molecule is capable of activating a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras. 2. The bifunctional shRNAs of claim 1, wherein the bifunctional shRNA comprises at least one sequence defined by SEQ ID NOS: 1 to 22 or 31 to 56. 3. (canceled) 4. The bifunctional shRNAs of claim 1, wherein at least one target site sequence is within a human K-ras gene cDNA sequence (SEQ ID NOS: 27 to 30). 5. The bifunctional shRNAs of claim 1, wherein the K-ras is a mutated K-ras. 6. An expression vector comprising: a promoter; and a nucleic acid insert operably linked to the promoter, wherein the insert encodes one or more shRNA capable of inhibiting an expression of at least one target gene that is a K-ras gene via RNA interference; wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras. 7. The expression vector of claim 6, wherein the target gene sequence comprises SEQ ID NO: 1 to 5. 8. The expression vector of claim 6, wherein a sequence arrangement for the shRNA comprises a 5′ stem arm-19 nucleotide target, which is K-ras-TA-15 nucleotide loop-19 nucleotide target complementary sequence-3′stem arm-Spacer-5′ stem arm-19 nucleotide target variant-TA-15 nucleotide loop-19 nucleotide target complementary sequence-3′ stem arm. 9. The expression vector of claim 6, wherein the nucleic acid insert comprises at least one sequence selected from SEQ ID NO: 6 to 27 or 53 to 56. 10. The expression vector of claim 6, wherein the vector comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 20, 21, 25, 50, 75, or 100 copies of bifunctional shRNAs inserts capable of reducing an expression of one or more mutated K-ras genes. 11. The expression vector of claim 6, wherein at least one shRNA has a target site sequence that is within a mutated K-ras gene cDNA sequence. 12. A therapeutic delivery system comprising: a therapeutic agent carrier; and an expression vector comprising a promoter and a nucleic acid insert operably linked to the promoter, the nucleic acid insert encoding one or more short hairpin RNA (shRNA) capable inhibiting an expression of a target gene sequence that is K-ras gene via RNA interference; wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras. 13. The delivery system of claim 12, wherein the therapeutic agent carrier is a compacted DNA nanoparticle, or a compacted DNA nanoparticle with one or more polycations. 14. The delivery system of claim 13, wherein the one or more polycations is a 10 kDA polyethylene glycol (PEG)-substituted cysteine-lysine 3-mer peptide (CK3oPEG10k). 15. The delivery system of claim 13, wherein the compacted DNA nanoparticles are further encapsulated in at least one of a liposome, a reversibly masked liposome, or a bilamellar invaginated vesicle (BIV). 16. The delivery system of claim 12, wherein the target gene sequence comprises SEQ ID NOS: 27 to 30. 17. (canceled) 18. The delivery system of claim 12, wherein the nucleic acid insert is selected from SEQ ID NOS: 1 to 22 or 31 to 56. 19. A method to deliver one or more shRNAs to a target tissue expressing a K-ras gene comprising the steps of: preparing an expression vector comprising a promoter and a nucleic acid insert operably linked to the promoter that encodes the one or more shRNA, wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras; combining the expression vector with a therapeutic agent carrier, wherein the therapeutic agent carrier comprises a liposome; and administering a therapeutically effective amount of the expression vector and therapeutic agent carrier complex to a patient in need thereof. 20. The method of claim 19, wherein the therapeutic agent carrier is a compacted DNA nanoparticle. 21. The method of claim 20, wherein the DNA nanoparticle is compacted with one or more polycations, wherein the one or more polycations comprise a 10 kDA polyethylene glycol (PEG)-substituted cysteine-lysine 3-mer peptide (CK3oPEG10k) or a 30-mer lysine condensing peptide. 22. The method of claim 20, wherein the compacted DNA nanoparticles are further encapsulated in a liposome, wherein the liposome is a bilamellar invaginated vesicle (BIV) that comprises one or more receptor targeting moieties. 23. The method of claim 22, wherein the one or more receptor targeting moieties comprise small molecule bivalent beta-turn mimics. 24. The method of claim 19, wherein the nucleic acid insert comprises a sequence selected from SEQ ID NOS: 1 to 22 or 53 to 56. 25. A method to inhibit an expression of a K-ras gene in one or more target cells comprising the steps of: selecting the one or more target cells; and transfecting the target cell with a vector that expresses one or more short hairpin RNA (shRNAs) capable of inhibiting an expression of a K-ras gene in the one or more target cells via RNA interference, wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras. 26. (canceled) 27. A method of suppressing a tumor cell growth in a human subject comprising the steps of: identifying the human subject in need for suppression of the tumor cell growth; and administering an expression vector in a therapeutic agent carrier complex to the human subject in an amount sufficient to suppress the tumor cell growth, wherein the expression vector expresses one or more shRNA capable inhibiting an expression of a target gene that is a mutated K-ras in the one or more target cells via RNA interference; wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of the target gene; wherein the inhibition results in an apoptosis, an arrested proliferation, or a reduced invasiveness of the tumor cells. 28-48. (canceled)

The present invention includes compositions and methods for making and using a bifunctional shRNAs capable of reducing an expression of a K-ras gene, e.g., a mutated K-ras gene, wherein at least one target site sequence of the bifunctional RNA molecule is located within the K-ras gene and wherein the bifunctional RNA molecule is capable of activating a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras.1. A bifunctional shRNA capable of reducing an expression of a K-ras gene, wherein at least one target site sequence of the bifunctional RNA molecule is located within the K-ras gene and wherein the bifunctional RNA molecule is capable of activating a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras. 2. The bifunctional shRNAs of claim 1, wherein the bifunctional shRNA comprises at least one sequence defined by SEQ ID NOS: 1 to 22 or 31 to 56. 3. (canceled) 4. The bifunctional shRNAs of claim 1, wherein at least one target site sequence is within a human K-ras gene cDNA sequence (SEQ ID NOS: 27 to 30). 5. The bifunctional shRNAs of claim 1, wherein the K-ras is a mutated K-ras. 6. An expression vector comprising: a promoter; and a nucleic acid insert operably linked to the promoter, wherein the insert encodes one or more shRNA capable of inhibiting an expression of at least one target gene that is a K-ras gene via RNA interference; wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras. 7. The expression vector of claim 6, wherein the target gene sequence comprises SEQ ID NO: 1 to 5. 8. The expression vector of claim 6, wherein a sequence arrangement for the shRNA comprises a 5′ stem arm-19 nucleotide target, which is K-ras-TA-15 nucleotide loop-19 nucleotide target complementary sequence-3′stem arm-Spacer-5′ stem arm-19 nucleotide target variant-TA-15 nucleotide loop-19 nucleotide target complementary sequence-3′ stem arm. 9. The expression vector of claim 6, wherein the nucleic acid insert comprises at least one sequence selected from SEQ ID NO: 6 to 27 or 53 to 56. 10. The expression vector of claim 6, wherein the vector comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 20, 21, 25, 50, 75, or 100 copies of bifunctional shRNAs inserts capable of reducing an expression of one or more mutated K-ras genes. 11. The expression vector of claim 6, wherein at least one shRNA has a target site sequence that is within a mutated K-ras gene cDNA sequence. 12. A therapeutic delivery system comprising: a therapeutic agent carrier; and an expression vector comprising a promoter and a nucleic acid insert operably linked to the promoter, the nucleic acid insert encoding one or more short hairpin RNA (shRNA) capable inhibiting an expression of a target gene sequence that is K-ras gene via RNA interference; wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras. 13. The delivery system of claim 12, wherein the therapeutic agent carrier is a compacted DNA nanoparticle, or a compacted DNA nanoparticle with one or more polycations. 14. The delivery system of claim 13, wherein the one or more polycations is a 10 kDA polyethylene glycol (PEG)-substituted cysteine-lysine 3-mer peptide (CK3oPEG10k). 15. The delivery system of claim 13, wherein the compacted DNA nanoparticles are further encapsulated in at least one of a liposome, a reversibly masked liposome, or a bilamellar invaginated vesicle (BIV). 16. The delivery system of claim 12, wherein the target gene sequence comprises SEQ ID NOS: 27 to 30. 17. (canceled) 18. The delivery system of claim 12, wherein the nucleic acid insert is selected from SEQ ID NOS: 1 to 22 or 31 to 56. 19. A method to deliver one or more shRNAs to a target tissue expressing a K-ras gene comprising the steps of: preparing an expression vector comprising a promoter and a nucleic acid insert operably linked to the promoter that encodes the one or more shRNA, wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras; combining the expression vector with a therapeutic agent carrier, wherein the therapeutic agent carrier comprises a liposome; and administering a therapeutically effective amount of the expression vector and therapeutic agent carrier complex to a patient in need thereof. 20. The method of claim 19, wherein the therapeutic agent carrier is a compacted DNA nanoparticle. 21. The method of claim 20, wherein the DNA nanoparticle is compacted with one or more polycations, wherein the one or more polycations comprise a 10 kDA polyethylene glycol (PEG)-substituted cysteine-lysine 3-mer peptide (CK3oPEG10k) or a 30-mer lysine condensing peptide. 22. The method of claim 20, wherein the compacted DNA nanoparticles are further encapsulated in a liposome, wherein the liposome is a bilamellar invaginated vesicle (BIV) that comprises one or more receptor targeting moieties. 23. The method of claim 22, wherein the one or more receptor targeting moieties comprise small molecule bivalent beta-turn mimics. 24. The method of claim 19, wherein the nucleic acid insert comprises a sequence selected from SEQ ID NOS: 1 to 22 or 53 to 56. 25. A method to inhibit an expression of a K-ras gene in one or more target cells comprising the steps of: selecting the one or more target cells; and transfecting the target cell with a vector that expresses one or more short hairpin RNA (shRNAs) capable of inhibiting an expression of a K-ras gene in the one or more target cells via RNA interference, wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of K-ras. 26. (canceled) 27. A method of suppressing a tumor cell growth in a human subject comprising the steps of: identifying the human subject in need for suppression of the tumor cell growth; and administering an expression vector in a therapeutic agent carrier complex to the human subject in an amount sufficient to suppress the tumor cell growth, wherein the expression vector expresses one or more shRNA capable inhibiting an expression of a target gene that is a mutated K-ras in the one or more target cells via RNA interference; wherein the one or more shRNA comprise a bifunctional RNA molecule that activates a cleavage-dependent and a cleavage-independent RNA-induced silencing complex for reducing the expression level of the target gene; wherein the inhibition results in an apoptosis, an arrested proliferation, or a reduced invasiveness of the tumor cells. 28-48. (canceled)

Compositions and methods for selective partial or complete eradication of senescent cells in a mammal are provided. The involves inhibition of the expression of genes that are identified as being related to a senescent phenotype. The inhibition is produced using methods which include but are not necessarily limited to pharmacological inhibition, or inhibition by using RNAi-mediated approaches. As a consequence of selectively targeting senescent cells, prolonging or restoring healthy physiological conditions in a mammal can be achieved, and age related conditions can be treated or prevented, and undesirable accumulated senescent cells can be reduced or eradicated from a variety of tissues.

1. A method for selectively killing senescent cells in a mammal comprising administering to the mammal at least one agent such the expression of at least one gene selected from the genes presented in Table 1 is inhibited. 2. The method of claim 1, wherein the inhibition of at least one gene is achieved by RNAi-mediated downregulation of mRNA encoded by the gene. 3. The method of claim 2, wherein the agent is an shRNA, an siRNA, or an antisense oligonucleotide. 4. The method of claim 2, wherein the senescent cells are selected from irreversibly arrested cells present in connective tissue, epithelial tissue, and combinations of said senescent cells. 5. The method of claim 2, where senescent cells are irreversibly arrested melanocytes 6. The method of claim 2, where senescent cells are irreversibly arrested tumor cells. 7. The method of claim 6, wherein the irreversibly arrested tumor cells are arrested subsequent to exposure to a chemotherapeutic agent or radiation. 8. The method of claim 7, where the senescent cells are eliminated from a tumor subsequent to treatment of the mammal by radiation or chemotherapy. 9. The method of claim 1, where the selective eradication of senescent cells is in a mammal suspected of having or at risk for developing an age-related disease. 10. The method of claim 1, wherein the subject is in need of or is undergoing treatment for cancer. 11. The method of claim 10, wherein the cancer is selected from prostate cancer, melanoma, lung cancer, sarcoma, breast cancer, and colon cancer. 12. The method of claim 1, wherein the individual is in need of therapy for tissue impaired by accumulated senescent cells. 13. The method of claim 12, wherein the accumulated cells are present in a pigmented skin lesion. 14. The method of claim 1, wherein administering the agent improves the outcome of a cancer treatment of the mammal, wherein the cancer treatment is radiation or chemotherapy. 15. The method of claim 1, wherein the mammal is in need of treatment for a metastatic cancer, and wherein the administering the agent is such that dormant cancer cells in the mammal are killed. 16. The method of claim 1, wherein the mammal is a human 17. The method of claim 1, where the mammal is a non-human mammal. 18. The method of claim 1, wherein the at least one gene is selected from the group consisting of ITGAV, RAC1, ARHGAP1, RAPGEF1, CRKL, NCKAP1, CDC42, CAPNS2, EBP, FGF1, ISG20, KITLG, LPHN1, MAG, MEF2C, OSBPL3, PFN1, POU5F1, PPP1CB, PRKRA, and combinations thereof. 19. The method of claim 1, wherein lifespan of the mammal is increased subsequent to the administering of the agent. 20. The method of claim 9, wherein the age-related disease is Alzheimer's disease, Type II diabetes, macular degeneration, or a disease comprising chronic inflammation. 21. The method of claim 20, wherein the disease comprising chronic inflammation is arthritis.

Compositions and methods for selective partial or complete eradication of senescent cells in a mammal are provided. The involves inhibition of the expression of genes that are identified as being related to a senescent phenotype. The inhibition is produced using methods which include but are not necessarily limited to pharmacological inhibition, or inhibition by using RNAi-mediated approaches. As a consequence of selectively targeting senescent cells, prolonging or restoring healthy physiological conditions in a mammal can be achieved, and age related conditions can be treated or prevented, and undesirable accumulated senescent cells can be reduced or eradicated from a variety of tissues.1. A method for selectively killing senescent cells in a mammal comprising administering to the mammal at least one agent such the expression of at least one gene selected from the genes presented in Table 1 is inhibited. 2. The method of claim 1, wherein the inhibition of at least one gene is achieved by RNAi-mediated downregulation of mRNA encoded by the gene. 3. The method of claim 2, wherein the agent is an shRNA, an siRNA, or an antisense oligonucleotide. 4. The method of claim 2, wherein the senescent cells are selected from irreversibly arrested cells present in connective tissue, epithelial tissue, and combinations of said senescent cells. 5. The method of claim 2, where senescent cells are irreversibly arrested melanocytes 6. The method of claim 2, where senescent cells are irreversibly arrested tumor cells. 7. The method of claim 6, wherein the irreversibly arrested tumor cells are arrested subsequent to exposure to a chemotherapeutic agent or radiation. 8. The method of claim 7, where the senescent cells are eliminated from a tumor subsequent to treatment of the mammal by radiation or chemotherapy. 9. The method of claim 1, where the selective eradication of senescent cells is in a mammal suspected of having or at risk for developing an age-related disease. 10. The method of claim 1, wherein the subject is in need of or is undergoing treatment for cancer. 11. The method of claim 10, wherein the cancer is selected from prostate cancer, melanoma, lung cancer, sarcoma, breast cancer, and colon cancer. 12. The method of claim 1, wherein the individual is in need of therapy for tissue impaired by accumulated senescent cells. 13. The method of claim 12, wherein the accumulated cells are present in a pigmented skin lesion. 14. The method of claim 1, wherein administering the agent improves the outcome of a cancer treatment of the mammal, wherein the cancer treatment is radiation or chemotherapy. 15. The method of claim 1, wherein the mammal is in need of treatment for a metastatic cancer, and wherein the administering the agent is such that dormant cancer cells in the mammal are killed. 16. The method of claim 1, wherein the mammal is a human 17. The method of claim 1, where the mammal is a non-human mammal. 18. The method of claim 1, wherein the at least one gene is selected from the group consisting of ITGAV, RAC1, ARHGAP1, RAPGEF1, CRKL, NCKAP1, CDC42, CAPNS2, EBP, FGF1, ISG20, KITLG, LPHN1, MAG, MEF2C, OSBPL3, PFN1, POU5F1, PPP1CB, PRKRA, and combinations thereof. 19. The method of claim 1, wherein lifespan of the mammal is increased subsequent to the administering of the agent. 20. The method of claim 9, wherein the age-related disease is Alzheimer's disease, Type II diabetes, macular degeneration, or a disease comprising chronic inflammation. 21. The method of claim 20, wherein the disease comprising chronic inflammation is arthritis.

The present invention provides nucleic acid markers for rapid diagnosis of KD and a kit for detection of the nucleic acid markers. The nucleic acid markers are 4 miRNAs, and the kit comprises primers for quantitative detection of the 4 miRNAs by fluorescent quantitative PCR. The diagnosis of KD can be performed only by quantificationally detecting the contents of the 4 miRNAs in serum exosomes and then analyzing the Ct values of the 4 miRNAs. The present invention possesses the advantages of easily-obtained sample, simple operation, high specificity, time saving, accurate and reliable detection result, etc., so children with KD can be timely and accurately diagnosed. Particularly, KD can be easily distinguished from common virus infection with similar symptoms only by one test. The present invention may play an important role in rapid diagnosis of KD of children and further provide a direction for developing rapid diagnostic kit of KD.

1. Use of a combination of small molecule RNAs consisting of miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p as a biomarker set for rapid diagnosis of kawasaki disease. 2. The use according to claim 1, wherein the small molecule RNAs consisting of miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p are miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p in serum exosomes. 3. A kit for rapid diagnosis of kawasaki disease, comprising: reagents for quantitative detection of the expression of miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p in serum exosomes. 4. The kit for rapid diagnosis of kawasaki disease according to claim 3, wherein the kit comprises primers as set forth in SEQ ID NOs: 9-16 for the detection of miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p by fluorescence-based quantitative PCR. 5. The kit for rapid diagnosis of kawasaki disease according to claim 4, wherein the kit further comprises primers as set forth in SEQ ID NOs: 5-8 for reverse transcription of miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p.

The present invention provides nucleic acid markers for rapid diagnosis of KD and a kit for detection of the nucleic acid markers. The nucleic acid markers are 4 miRNAs, and the kit comprises primers for quantitative detection of the 4 miRNAs by fluorescent quantitative PCR. The diagnosis of KD can be performed only by quantificationally detecting the contents of the 4 miRNAs in serum exosomes and then analyzing the Ct values of the 4 miRNAs. The present invention possesses the advantages of easily-obtained sample, simple operation, high specificity, time saving, accurate and reliable detection result, etc., so children with KD can be timely and accurately diagnosed. Particularly, KD can be easily distinguished from common virus infection with similar symptoms only by one test. The present invention may play an important role in rapid diagnosis of KD of children and further provide a direction for developing rapid diagnostic kit of KD.1. Use of a combination of small molecule RNAs consisting of miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p as a biomarker set for rapid diagnosis of kawasaki disease. 2. The use according to claim 1, wherein the small molecule RNAs consisting of miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p are miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p in serum exosomes. 3. A kit for rapid diagnosis of kawasaki disease, comprising: reagents for quantitative detection of the expression of miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p in serum exosomes. 4. The kit for rapid diagnosis of kawasaki disease according to claim 3, wherein the kit comprises primers as set forth in SEQ ID NOs: 9-16 for the detection of miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p by fluorescence-based quantitative PCR. 5. The kit for rapid diagnosis of kawasaki disease according to claim 4, wherein the kit further comprises primers as set forth in SEQ ID NOs: 5-8 for reverse transcription of miR-1246, miR-4436b-5p, miR-197-3p and miR-671-5p.

A novel family of human mitochondrial RNAs, referred to as chimeric RNAs, which are differentially expressed in normal, pre-cancer and cancer cells, are described. Oligonucleotides targeted to the chimeric RNAs are provided. The described oligonucleotides or their analogs can be used for cancer diagnostics and cancer therapy as well as for research. In one embodiment of this invention, these oligonucleotides hybridize with the sense or with the antisense mitochondrial chimeric RNAs, and the result of the hybridization is useful to differentiate between normal proliferating cells, pre-cancer cells and cancer cells. In another embodiment of the invention, the compositions comprise oligonucleotides that hybridize with the human chimeric RNAs resulting in cancer cell and pre-cancer cell death, while there is no effect in normal cells, constituting therefore, a novel approach for cancer therapy.

1. A kit for distinguishing between normal proliferating cells and transformed or malignant cells, the kit comprising one or more oligonucleotides targeted to the antisense mitochondrial chimeric RNA of SEQ ID NO 4, SEQ ID NO 5, or SEQ ID NO 6 and/or the sense mitochondrial chimeric RNA of SEQ ID NO 1, SEQ ID NO 2, or SEQ ID NO 3, wherein the one or more oligonucleotides is conjugated to a label. 2. The kit of claim 1 wherein the label comprises digoxigenin, biotin, or fluorescein. 3. The kit of claim 1, further comprising an antibody reagent for the detection of the label. 4. The kit of claim 1, wherein antibody reagent comprises antibiotin antibodies, antidigoxigenin antibodies, or antifluorescein antibodies. 5. The kit of claim 4, wherein the antibody reagent is conjugated. 6. The kit of claim 5, wherein the antibody reagent is conjugated to alkaline phosphatase or peroxidase. 7. The kit of claim 1, further comprising one or more slides of fixed normal proliferating cells and one or more slides of fixed transformed or malignant cells, as controls. 8. The kit of claim 1, wherein the oligonucleotide is 10-50 nucleobases in length. 9. The kit of claim 1, wherein the oligonucleotide is 10-30 nucleobases in length.

A novel family of human mitochondrial RNAs, referred to as chimeric RNAs, which are differentially expressed in normal, pre-cancer and cancer cells, are described. Oligonucleotides targeted to the chimeric RNAs are provided. The described oligonucleotides or their analogs can be used for cancer diagnostics and cancer therapy as well as for research. In one embodiment of this invention, these oligonucleotides hybridize with the sense or with the antisense mitochondrial chimeric RNAs, and the result of the hybridization is useful to differentiate between normal proliferating cells, pre-cancer cells and cancer cells. In another embodiment of the invention, the compositions comprise oligonucleotides that hybridize with the human chimeric RNAs resulting in cancer cell and pre-cancer cell death, while there is no effect in normal cells, constituting therefore, a novel approach for cancer therapy.1. A kit for distinguishing between normal proliferating cells and transformed or malignant cells, the kit comprising one or more oligonucleotides targeted to the antisense mitochondrial chimeric RNA of SEQ ID NO 4, SEQ ID NO 5, or SEQ ID NO 6 and/or the sense mitochondrial chimeric RNA of SEQ ID NO 1, SEQ ID NO 2, or SEQ ID NO 3, wherein the one or more oligonucleotides is conjugated to a label. 2. The kit of claim 1 wherein the label comprises digoxigenin, biotin, or fluorescein. 3. The kit of claim 1, further comprising an antibody reagent for the detection of the label. 4. The kit of claim 1, wherein antibody reagent comprises antibiotin antibodies, antidigoxigenin antibodies, or antifluorescein antibodies. 5. The kit of claim 4, wherein the antibody reagent is conjugated. 6. The kit of claim 5, wherein the antibody reagent is conjugated to alkaline phosphatase or peroxidase. 7. The kit of claim 1, further comprising one or more slides of fixed normal proliferating cells and one or more slides of fixed transformed or malignant cells, as controls. 8. The kit of claim 1, wherein the oligonucleotide is 10-50 nucleobases in length. 9. The kit of claim 1, wherein the oligonucleotide is 10-30 nucleobases in length.

The methods and uses described herein relate to the treatment of age-related conditions, e.g. by administering an agent that inhibits the interaction of GDF11 and follistatin. In some embodiments, the agent can bind to an epitope of GDF11 as described herein.

1. A method of treating an age-related condition, the method comprising administering to a subject a follistatin-GDF11 inhibitor. 2. The method of claim 1, wherein the age-related condition is selected from the group consisting of: a cardiovascular condition; aging of the heart; aging of skeletal muscle; aging of the brain; a metabolic disorder; and obesity. 3. The method of claim 1, wherein the subject has or has been diagnosed with a condition selected from the group consisting of: diastolic heart failure; cardiac hypertrophy; age-related cardiac hypertrophy; hypertension; valvular disease; aortic stenosis; genetic hypertrophic cardiomyopathy; or stiffness of the heart due to aging. 4. The method of claim 1, wherein the level of GDF11 polypeptide in the subject is increased. 5. The method of claim 4, wherein in the level of GDF11 polypeptide is the level of free GDF11. 6. The method of claim 4, wherein the level of GDF11 polypeptide is the level of GDF11 in the circulation of the subject. 7. The method of claim 4, wherein the level of GDF11 polypeptide is the level of GDF11 in the cardiac tissue of the subject. 8. The method of claim 1, wherein the follistatin-GDF11 inhibitor comprises an inhibitory nucleic acid; an antibody reagent; an antibody; or a small molecule. 9. The method of claim 1, wherein the follistatin-GDF11 inhibitor comprises an antibody reagent that binds specifically to an epitope comprised by SEQ ID NO: 15 or SEQ ID NO: 16. 10. The method of claim 9, wherein the antibody reagent is selected from the group consisting of: a humanized antibody reagent; a monoclonal antibody; and a humanized monoclonal antibody. 11. The method of claim 1, wherein the composition is administered via a route selected from the group consisting of: intravenously; subcutaneously; intra-arterial; and intra-coronary arterial. 12. The method of claim 1, wherein the level of GDF11 is increased by at least 100%. 13. The method of claim 1, wherein the level of GDF11 is increased to at least 75% of a healthy reference level. 14. A pharmaceutical composition comprising an isolated follistatin-GDF11 inhibitor and a pharmaceutically acceptable carrier. 15.-25. (canceled)

The methods and uses described herein relate to the treatment of age-related conditions, e.g. by administering an agent that inhibits the interaction of GDF11 and follistatin. In some embodiments, the agent can bind to an epitope of GDF11 as described herein.1. A method of treating an age-related condition, the method comprising administering to a subject a follistatin-GDF11 inhibitor. 2. The method of claim 1, wherein the age-related condition is selected from the group consisting of: a cardiovascular condition; aging of the heart; aging of skeletal muscle; aging of the brain; a metabolic disorder; and obesity. 3. The method of claim 1, wherein the subject has or has been diagnosed with a condition selected from the group consisting of: diastolic heart failure; cardiac hypertrophy; age-related cardiac hypertrophy; hypertension; valvular disease; aortic stenosis; genetic hypertrophic cardiomyopathy; or stiffness of the heart due to aging. 4. The method of claim 1, wherein the level of GDF11 polypeptide in the subject is increased. 5. The method of claim 4, wherein in the level of GDF11 polypeptide is the level of free GDF11. 6. The method of claim 4, wherein the level of GDF11 polypeptide is the level of GDF11 in the circulation of the subject. 7. The method of claim 4, wherein the level of GDF11 polypeptide is the level of GDF11 in the cardiac tissue of the subject. 8. The method of claim 1, wherein the follistatin-GDF11 inhibitor comprises an inhibitory nucleic acid; an antibody reagent; an antibody; or a small molecule. 9. The method of claim 1, wherein the follistatin-GDF11 inhibitor comprises an antibody reagent that binds specifically to an epitope comprised by SEQ ID NO: 15 or SEQ ID NO: 16. 10. The method of claim 9, wherein the antibody reagent is selected from the group consisting of: a humanized antibody reagent; a monoclonal antibody; and a humanized monoclonal antibody. 11. The method of claim 1, wherein the composition is administered via a route selected from the group consisting of: intravenously; subcutaneously; intra-arterial; and intra-coronary arterial. 12. The method of claim 1, wherein the level of GDF11 is increased by at least 100%. 13. The method of claim 1, wherein the level of GDF11 is increased to at least 75% of a healthy reference level. 14. A pharmaceutical composition comprising an isolated follistatin-GDF11 inhibitor and a pharmaceutically acceptable carrier. 15.-25. (canceled)

A construct for selectively delivering a compound of interest to a cell, includes (a) a bioresorbable polymer shell; (b) a nucleic acid duplex contained in said shell, the duplex comprising (i) an ATP binding nucleic acid, and (ii) a complementary nucleic acid hybridized to the ATP binding nucleic acid; (c) a compound of interest intercalated in or caged by the nucleic acid duplex; (d) optionally, but in some embodiments preferably, a cationic polymer in said polysaccharide shell; and (e) optionally, but in some embodiments preferably, a cell targeting ligand coupled to the polymer shell. The polymer shell is degraded in a cell of interest, or in the extracellular matrix of a tissue carrying said cell of interest, to release said duplex therein. The wherein said duplex is destabilized by binding of ATP in the cell of interest to release the compound of interest therein.

1. A construct for selectively delivering a compound of interest to a cell, comprising: (a) a bioresorbabie polymer shell; (b) a nucleic acid duplex contained in said shell, said duplex comprising (i) an ATP binding nucleic acid, and (ii) a complementary nucleic acid hybridized to said ATP binding nucleic acid; (c) a compound of interest intercalated in or caged by said nucleic acid duplex; (d) optionally, a cationic polymer in said polysaccharide shell; and (e) optionally, a cell targeting ligand coupled to said polymer shell; wherein said polymer shell is degraded in a cell of interest, or in the extracellular matrix of a tissue carrying said cell of interest, to release said duplex therein; and wherein said duplex is destabilized by binding of ATP in said cell of interest to release said compound of interest therein. 2. The construct of claim 1, wherein said bioresorbable polymer shell comprises a crosslinked polymer or copolymer of a polyacrylic acid, polymethacrylic acid, polyethylene amine, a polysaccharide, alginic acid, a pectinic acid, carboxy methyl cellulose, hyaluronic acid, heparin, chitosan, carboxymethyl chitosan, carboxymethyl starch, carboxymethyl dextran, heparin sulfate, chondroitin sulfate, cationic starch, or salts thereof. 3. The construct of claim 1, wherein said bioresorbable polymer shell has an average diameter of from 1 or 10 nanometers to 500 or 1000 nanometers. 4. The construct of claim 1, wherein said ATP binding nucleic acid comprises, an ATP binding aptamer. 5. The construct of claim 1, wherein said complementary nucleic acid comprises DNA. 6. The construct of claim 1, wherein said compound of interest is a detectable compound or a cytotoxic compound. 7. The construct of claim 1, wherein said compound of interest comprises a DNA intercalating agent. 8. The construct of claim 7, wherein said intercalating agent comprises doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicine, mitoxantrone, or a combination thereof. 9. The construct of claim 1, wherein said cationic polymer is present. 10. The construct of claim 1, wherein said cell-targeting ligand is present. 11. A composition comprising a construct of claim 1 in a pharmaceutically acceptable carrier. 12. A method of delivering a compound of interest to a cell, comprising the steps of: (a) providing a construct of claim 1; and (b) contacting said construct to said cell or a tissue carrying said cell, under conditions in which said compound of interest is released therefrom. 13. The method of claim 12, wherein said cell or tissue comprises mammalian cell or tissue. 14. The method of claim 12, wherein said contacting step is carried out in vitro. 15. The method of claim 12, wherein said contacting step is carried out in vivo. 16. A method of treating cancer in a subject in need thereof, comprising administering said subject a construct of claim 1 in a treatment effective amount, wherein said compound of interest comprises an anticancer or antineoplastic agent. 17. The method of claim 16, wherein said cancer is lung, skin, prostate, breast, ovarian, endometrial, colorectal, pancreatic, kidney, bladder, liver, or brain cancer, or leukemia or lymphoma. 18-37. (canceled)

A construct for selectively delivering a compound of interest to a cell, includes (a) a bioresorbable polymer shell; (b) a nucleic acid duplex contained in said shell, the duplex comprising (i) an ATP binding nucleic acid, and (ii) a complementary nucleic acid hybridized to the ATP binding nucleic acid; (c) a compound of interest intercalated in or caged by the nucleic acid duplex; (d) optionally, but in some embodiments preferably, a cationic polymer in said polysaccharide shell; and (e) optionally, but in some embodiments preferably, a cell targeting ligand coupled to the polymer shell. The polymer shell is degraded in a cell of interest, or in the extracellular matrix of a tissue carrying said cell of interest, to release said duplex therein. The wherein said duplex is destabilized by binding of ATP in the cell of interest to release the compound of interest therein.1. A construct for selectively delivering a compound of interest to a cell, comprising: (a) a bioresorbabie polymer shell; (b) a nucleic acid duplex contained in said shell, said duplex comprising (i) an ATP binding nucleic acid, and (ii) a complementary nucleic acid hybridized to said ATP binding nucleic acid; (c) a compound of interest intercalated in or caged by said nucleic acid duplex; (d) optionally, a cationic polymer in said polysaccharide shell; and (e) optionally, a cell targeting ligand coupled to said polymer shell; wherein said polymer shell is degraded in a cell of interest, or in the extracellular matrix of a tissue carrying said cell of interest, to release said duplex therein; and wherein said duplex is destabilized by binding of ATP in said cell of interest to release said compound of interest therein. 2. The construct of claim 1, wherein said bioresorbable polymer shell comprises a crosslinked polymer or copolymer of a polyacrylic acid, polymethacrylic acid, polyethylene amine, a polysaccharide, alginic acid, a pectinic acid, carboxy methyl cellulose, hyaluronic acid, heparin, chitosan, carboxymethyl chitosan, carboxymethyl starch, carboxymethyl dextran, heparin sulfate, chondroitin sulfate, cationic starch, or salts thereof. 3. The construct of claim 1, wherein said bioresorbable polymer shell has an average diameter of from 1 or 10 nanometers to 500 or 1000 nanometers. 4. The construct of claim 1, wherein said ATP binding nucleic acid comprises, an ATP binding aptamer. 5. The construct of claim 1, wherein said complementary nucleic acid comprises DNA. 6. The construct of claim 1, wherein said compound of interest is a detectable compound or a cytotoxic compound. 7. The construct of claim 1, wherein said compound of interest comprises a DNA intercalating agent. 8. The construct of claim 7, wherein said intercalating agent comprises doxorubicin, daunorubicin, epirubicin, idarubicin, valrubicine, mitoxantrone, or a combination thereof. 9. The construct of claim 1, wherein said cationic polymer is present. 10. The construct of claim 1, wherein said cell-targeting ligand is present. 11. A composition comprising a construct of claim 1 in a pharmaceutically acceptable carrier. 12. A method of delivering a compound of interest to a cell, comprising the steps of: (a) providing a construct of claim 1; and (b) contacting said construct to said cell or a tissue carrying said cell, under conditions in which said compound of interest is released therefrom. 13. The method of claim 12, wherein said cell or tissue comprises mammalian cell or tissue. 14. The method of claim 12, wherein said contacting step is carried out in vitro. 15. The method of claim 12, wherein said contacting step is carried out in vivo. 16. A method of treating cancer in a subject in need thereof, comprising administering said subject a construct of claim 1 in a treatment effective amount, wherein said compound of interest comprises an anticancer or antineoplastic agent. 17. The method of claim 16, wherein said cancer is lung, skin, prostate, breast, ovarian, endometrial, colorectal, pancreatic, kidney, bladder, liver, or brain cancer, or leukemia or lymphoma. 18-37. (canceled)

Described herein are methods and assays relating to the presence and/or level of circulating tumor cells (CTCs). These CTC-Cs represent a highly metastatic subpopulation of CTCs. In some embodiments, the methods and assays described herein relate to the treatment of cancer.

1. (canceled) 2. A method of treating breast or epithelial cancer, the method comprising administering a treatment to prevent or reduce metastasis in a subject determined to have a level of CTC cluster which is increased relative to a control level. 3. The method of claim 2, the method further comprising not administering a treatment to prevent or reduce metastasis in a subject determined to have a level of CTC clusters is not increased relative to a control level. 4. The method of claim 2, wherein the treatment to prevent or reduce metastasis is selected from the group consisting of: an inhibitor of a CTC-C marker gene selected from the list of Table 2, 3, or 4; chemotherapy; radiation therapy; or removal of a tumor. 5. The method of claim 3, wherein not administering a treatment can comprise a clinical approach of monitoring without therapeutic intervention. 6. The method of claim 2, wherein the level of CTC clusters is measured by measuring the expression level of a CTC cluster (CTC-C) marker gene in the sample obtained from the subject; wherein the CTC-C marker gene is a gene selected from the list of Table 2, 3, or 4. 7. The method of claim 6, wherein the CTC-C marker gene is plakoglobin. 8. The method of claim 6, wherein the expression level of a CTC-C marker gene in circulating tumor cells in the sample is measured. 9. The method of claim 6, wherein the expression level of a CTC-C marker gene in cancer cells obtained from the subject is measured. 10. The method of claim 2, wherein the level of CTC clusters is measured using a HBCTC-Chip. 11. The method of claim 2, wherein the subject is a subject in need of treatment for cancer. 12. The method of claim 2, wherein an increased level of CTC clusters is a level at least 1.5× greater than the control level. 13. The method of claim 7, wherein an increased level of plakoglobin expression is a level at least 1.5× greater than the control level. 14. A method of treating cancer metastasis, the method comprising reducing the level of expression or activity of a CTC-C marker gene; wherein the CTC-C marker gene is a gene selected from the list of Table 2, 3, or 4. 15. The method of claim 14, wherein reducing the level of expression or activity of a CTC-C marker gene comprises administering a CTC-C marker gene inhibitory nucleic acid. 16. The method of claim 15, wherein the inhibitory nucleic acid is a siRNA. 17. The method of claim 14, wherein the CTC-C marker gene is plakoglobin. 18.-35. (canceled) 36. A method of reducing the level of circulating tumor cell (CTC) clusters in a subject with cancer, the method comprising reducing the level of expression or activity of a CTC-C marker gene; wherein the CTC-C marker gene is a gene selected from the list of Table 2, 3, or 4. 37.-39. (canceled) 40. The method of claim 2, further comprising a first step of measuring the level of circulating tumor cell (CTC) clusters in a sample obtained from a subject with a breast or epithelial cancer.

Described herein are methods and assays relating to the presence and/or level of circulating tumor cells (CTCs). These CTC-Cs represent a highly metastatic subpopulation of CTCs. In some embodiments, the methods and assays described herein relate to the treatment of cancer.1. (canceled) 2. A method of treating breast or epithelial cancer, the method comprising administering a treatment to prevent or reduce metastasis in a subject determined to have a level of CTC cluster which is increased relative to a control level. 3. The method of claim 2, the method further comprising not administering a treatment to prevent or reduce metastasis in a subject determined to have a level of CTC clusters is not increased relative to a control level. 4. The method of claim 2, wherein the treatment to prevent or reduce metastasis is selected from the group consisting of: an inhibitor of a CTC-C marker gene selected from the list of Table 2, 3, or 4; chemotherapy; radiation therapy; or removal of a tumor. 5. The method of claim 3, wherein not administering a treatment can comprise a clinical approach of monitoring without therapeutic intervention. 6. The method of claim 2, wherein the level of CTC clusters is measured by measuring the expression level of a CTC cluster (CTC-C) marker gene in the sample obtained from the subject; wherein the CTC-C marker gene is a gene selected from the list of Table 2, 3, or 4. 7. The method of claim 6, wherein the CTC-C marker gene is plakoglobin. 8. The method of claim 6, wherein the expression level of a CTC-C marker gene in circulating tumor cells in the sample is measured. 9. The method of claim 6, wherein the expression level of a CTC-C marker gene in cancer cells obtained from the subject is measured. 10. The method of claim 2, wherein the level of CTC clusters is measured using a HBCTC-Chip. 11. The method of claim 2, wherein the subject is a subject in need of treatment for cancer. 12. The method of claim 2, wherein an increased level of CTC clusters is a level at least 1.5× greater than the control level. 13. The method of claim 7, wherein an increased level of plakoglobin expression is a level at least 1.5× greater than the control level. 14. A method of treating cancer metastasis, the method comprising reducing the level of expression or activity of a CTC-C marker gene; wherein the CTC-C marker gene is a gene selected from the list of Table 2, 3, or 4. 15. The method of claim 14, wherein reducing the level of expression or activity of a CTC-C marker gene comprises administering a CTC-C marker gene inhibitory nucleic acid. 16. The method of claim 15, wherein the inhibitory nucleic acid is a siRNA. 17. The method of claim 14, wherein the CTC-C marker gene is plakoglobin. 18.-35. (canceled) 36. A method of reducing the level of circulating tumor cell (CTC) clusters in a subject with cancer, the method comprising reducing the level of expression or activity of a CTC-C marker gene; wherein the CTC-C marker gene is a gene selected from the list of Table 2, 3, or 4. 37.-39. (canceled) 40. The method of claim 2, further comprising a first step of measuring the level of circulating tumor cell (CTC) clusters in a sample obtained from a subject with a breast or epithelial cancer.

The present disclosure provides diagnostic methods useful for predicting a patient's response to alvocidib and guiding a physician decision to administer alvocidib to the patient.

1. A method for treatment of cancer in a patient in need thereof, the method comprising: a) requesting BH3 profiling data for a cancer cell specimen obtained from the bone marrow of the patient; and b) administering a treatment regimen comprising alvocidib to the patient if NOXA priming in the cancer cell specimen is at least 15%. 2. The method of claim 1, wherein the treatment regimen is administered to the patient only if NOXA priming in the cancer cell specimen is at least 20%. 3. The method of claim 1, wherein the treatment regimen is administered to the patient only if NOXA priming in the cancer cell specimen is at least 25%. 4. The method of claim 1, wherein the treatment regimen is administered to the patient only if NOXA priming in the cancer cell specimen is at least 30%. 5. The method of claim 1, further comprising requesting MCL-1 expression data obtained from the cancer cell specimen, and administering the treatment regimen to the patient only if MCL-1 expression in the cancer cell specimen is at least 1.1× the MCL-1 expression in a normal cell. 6. The method of claim 1, wherein the treatment regimen is administered to the patient only if the patient's cytogenetics are high risk. 7. The method of claim 1, wherein the treatment regimen is administered to the patient only if the patient has a prior history of myelodysplasic syndrome (MDS). 8. The method of claim 1, wherein the BH3 profiling data is obtained from a method comprising permeabilizing the cancer cell specimen, determining a change in mitochondrial membrane potential upon contacting the permeabilized cell with one or more BH3 domain peptides; and correlating a loss of mitochondrial membrane potential with chemosensitivity of the cell to apoptosis-inducing chemotherapeutic agents. 9. The method of claim 8, wherein the BH3 domain peptide is BIM, BIM2A, BAD, BID, HRK, PUMA, NOXA, BMF, BIK or PUMA2A, or combinations thereof. 10. The method of claim 8, wherein the BH3 domain peptide is used at a concentration ranging from 0.1 μM to 200 μM. 11. A method for treatment of cancer in a patient in need thereof, the method comprising: a) requesting MCL-1 expression data for a cancer cell specimen obtained from the bone marrow of the patient; and b) administering a treatment regimen comprising alvocidib to the patient if MCL-1 expression in the cancer cell specimen is at least 1.1× the MCL-1 expression in a normal cell. 12. The method of claim 11, wherein the treatment regimen is administered to the patient only if MCL-1 expression in the cancer cell specimen is at least 1.5× the MCL-1 expression in a normal cell. 13. The method of claim 11, wherein the treatment regimen is administered to the patient only if MCL-1 expression in the cancer cell specimen is at least 2× the MCL-1 expression in a normal cell. 14. The method of claim 11, wherein the treatment regimen is administered to the patient only if MCL-1 expression in the cancer cell specimen is at least 5× the MCL-1 expression in a normal cell. 15. The method of claim 11, further comprising requesting BH3 profiling data for the cancer cell specimen and administering the treatment regimen only if NOXA priming in the tumor or cancer cell specimen is at least 15%. 16. The method of claim 11, wherein the treatment regimen is administered to the patient only if the patient's cytogenetics are high risk. 17. The method of claim 11, wherein the treatment regimen is administered to the patient only if the patient has a prior history of myelodysplasic syndrome (MDS). 18. The method of claim 1, wherein the cancer is a hematologic cancer. 19. The method of claim 18, wherein the hematologic cancer is selected from acute myelogenous leukemia (AML), multiple myeloma, follicular lymphoma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia, and non-Hodgkin's lymphoma. 20. The method of claim 19, wherein the hematological cancer is acute myelogenous leukemia (AML). 21. The method of claim 18, wherein the hematologic cancer is myelodysplasic syndrome (MDS) or chronic lymphocytic leukemia (CLL). 22. (canceled) 23. The method of claim 1, wherein the treatment regimen comprises alvocidib, cytarabine, and mitoxantrone (FLAM). 24. The method of claim 1, wherein the cancer cell specimen is derived from the biopsy of a non-solid tumor. 25. The method of claim 24, wherein the cancer cell specimen is derived from the biopsy of a patient with multiple myeloma, acute myelogenous leukemia, acute lymphocytic leukemia, chronic lymphogenous leukemia, mantle cell lymphoma, diffuse large B-cell lymphoma or non-Hodgkin's lymphoma. 26-31. (canceled) 32. The method of claim 11, wherein the cancer is a hematologic cancer. 33. The method of claim 32, wherein the hematologic cancer is selected from acute myelogenous leukemia (AML), multiple myeloma, follicular lymphoma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia, and non-Hodgkin's lymphoma. 34. The method of claim 33, wherein the hematological cancer is acute myelogenous leukemia (AML). 35. The method of claim 32, wherein the hematologic cancer is myelodysplasic syndrome (MDS) or chronic lymphocytic leukemia (CLL). 36. The method of claim 11, wherein the cancer cell specimen is derived from the biopsy of a non-solid tumor. 37. The method of claim 36, wherein the cancer cell specimen is derived from the biopsy of a patient with multiple myeloma, acute myelogenous leukemia, acute lymphocytic leukemia, chronic lymphogenous leukemia, mantle cell lymphoma, diffuse large B-cell lymphoma or non-Hodgkin's lymphoma.

The present disclosure provides diagnostic methods useful for predicting a patient's response to alvocidib and guiding a physician decision to administer alvocidib to the patient.1. A method for treatment of cancer in a patient in need thereof, the method comprising: a) requesting BH3 profiling data for a cancer cell specimen obtained from the bone marrow of the patient; and b) administering a treatment regimen comprising alvocidib to the patient if NOXA priming in the cancer cell specimen is at least 15%. 2. The method of claim 1, wherein the treatment regimen is administered to the patient only if NOXA priming in the cancer cell specimen is at least 20%. 3. The method of claim 1, wherein the treatment regimen is administered to the patient only if NOXA priming in the cancer cell specimen is at least 25%. 4. The method of claim 1, wherein the treatment regimen is administered to the patient only if NOXA priming in the cancer cell specimen is at least 30%. 5. The method of claim 1, further comprising requesting MCL-1 expression data obtained from the cancer cell specimen, and administering the treatment regimen to the patient only if MCL-1 expression in the cancer cell specimen is at least 1.1× the MCL-1 expression in a normal cell. 6. The method of claim 1, wherein the treatment regimen is administered to the patient only if the patient's cytogenetics are high risk. 7. The method of claim 1, wherein the treatment regimen is administered to the patient only if the patient has a prior history of myelodysplasic syndrome (MDS). 8. The method of claim 1, wherein the BH3 profiling data is obtained from a method comprising permeabilizing the cancer cell specimen, determining a change in mitochondrial membrane potential upon contacting the permeabilized cell with one or more BH3 domain peptides; and correlating a loss of mitochondrial membrane potential with chemosensitivity of the cell to apoptosis-inducing chemotherapeutic agents. 9. The method of claim 8, wherein the BH3 domain peptide is BIM, BIM2A, BAD, BID, HRK, PUMA, NOXA, BMF, BIK or PUMA2A, or combinations thereof. 10. The method of claim 8, wherein the BH3 domain peptide is used at a concentration ranging from 0.1 μM to 200 μM. 11. A method for treatment of cancer in a patient in need thereof, the method comprising: a) requesting MCL-1 expression data for a cancer cell specimen obtained from the bone marrow of the patient; and b) administering a treatment regimen comprising alvocidib to the patient if MCL-1 expression in the cancer cell specimen is at least 1.1× the MCL-1 expression in a normal cell. 12. The method of claim 11, wherein the treatment regimen is administered to the patient only if MCL-1 expression in the cancer cell specimen is at least 1.5× the MCL-1 expression in a normal cell. 13. The method of claim 11, wherein the treatment regimen is administered to the patient only if MCL-1 expression in the cancer cell specimen is at least 2× the MCL-1 expression in a normal cell. 14. The method of claim 11, wherein the treatment regimen is administered to the patient only if MCL-1 expression in the cancer cell specimen is at least 5× the MCL-1 expression in a normal cell. 15. The method of claim 11, further comprising requesting BH3 profiling data for the cancer cell specimen and administering the treatment regimen only if NOXA priming in the tumor or cancer cell specimen is at least 15%. 16. The method of claim 11, wherein the treatment regimen is administered to the patient only if the patient's cytogenetics are high risk. 17. The method of claim 11, wherein the treatment regimen is administered to the patient only if the patient has a prior history of myelodysplasic syndrome (MDS). 18. The method of claim 1, wherein the cancer is a hematologic cancer. 19. The method of claim 18, wherein the hematologic cancer is selected from acute myelogenous leukemia (AML), multiple myeloma, follicular lymphoma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia, and non-Hodgkin's lymphoma. 20. The method of claim 19, wherein the hematological cancer is acute myelogenous leukemia (AML). 21. The method of claim 18, wherein the hematologic cancer is myelodysplasic syndrome (MDS) or chronic lymphocytic leukemia (CLL). 22. (canceled) 23. The method of claim 1, wherein the treatment regimen comprises alvocidib, cytarabine, and mitoxantrone (FLAM). 24. The method of claim 1, wherein the cancer cell specimen is derived from the biopsy of a non-solid tumor. 25. The method of claim 24, wherein the cancer cell specimen is derived from the biopsy of a patient with multiple myeloma, acute myelogenous leukemia, acute lymphocytic leukemia, chronic lymphogenous leukemia, mantle cell lymphoma, diffuse large B-cell lymphoma or non-Hodgkin's lymphoma. 26-31. (canceled) 32. The method of claim 11, wherein the cancer is a hematologic cancer. 33. The method of claim 32, wherein the hematologic cancer is selected from acute myelogenous leukemia (AML), multiple myeloma, follicular lymphoma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia, and non-Hodgkin's lymphoma. 34. The method of claim 33, wherein the hematological cancer is acute myelogenous leukemia (AML). 35. The method of claim 32, wherein the hematologic cancer is myelodysplasic syndrome (MDS) or chronic lymphocytic leukemia (CLL). 36. The method of claim 11, wherein the cancer cell specimen is derived from the biopsy of a non-solid tumor. 37. The method of claim 36, wherein the cancer cell specimen is derived from the biopsy of a patient with multiple myeloma, acute myelogenous leukemia, acute lymphocytic leukemia, chronic lymphogenous leukemia, mantle cell lymphoma, diffuse large B-cell lymphoma or non-Hodgkin's lymphoma.

The present invention concerns methods and compositions for diagnosing and/or treating vascular diseases including cancer, cardiac diseases, vascular diseases of the eye, and inflammatory diseases. The methods involve measuring the levels of one or multiple miRNAs in patient samples and using the test results to diagnose and/or predict an optimal treatment regimen for the patient. Compositions described in the invention include nucleic acids that function as miRNAs or miRNA inhibitors that can be introduced to a patient to reduce or increase vascularization as needed.

1. A method for reducing vascularization in a subject or tissue comprising administering to the subject or tissue in need of such a reduction, in an amount sufficient to reduce vascularization, one or more nucleic acid molecule comprising: (a) a nucleic acid sequence that is at least 80% identical to one or more of miR-184, miR-31, miR-150, miR-409, miR-375, miR-129-5p, miR-142a, miR-29a, miR-129-3p, miR-10b, miR-96, miR-183, miR-16, miR-182, miR-191, miR-29c, miR-181c, miR-335, miR-7026, miR-210, miR-512-3p, miR-132, miR-500, miR-339, miR-511, miR-26b, miR-30b, or miR-15a, or complement thereof; and/or (b) an inhibitor of miR-451, miR-424, miR-146, miR-214, miR-199a, miR-181, miR-350, miR-21, miR-218, miR-148b, miR-106a, miR-205, miR-365, miR-299-5p, ambi-miR-7079, miR-200a, miR-351, miR-329, miR-122a, miR-20a, miR-520h, miR-142-5p, miR-203, miR-211, miR-145, let-7b, miR-93, miR-192, miR-201, miR-18a, miR-17-5p, miR-7085, miR-106b, or miR-223. 2. The method of claim 1, wherein the nucleic acid is administered topically, enterally, parenterally or intravitreally. 3. The method of claim 1, wherein the nucleic acid molecule is an RNA. 4. The method of claim 3, wherein the RNA comprises a complementary RNA region. 5. The method of claim 4, wherein the RNA comprises a hairpin structure. 6. The method of claim 4, wherein the RNA comprises two RNA strands. 7. The method of claim 3, wherein the RNA molecule includes a nucleotide analog or a modified nucleotide. 8. The method of claim 1, wherein the nucleic acid molecule or miRNA inhibitor is a DNA molecule or is produced from a DNA molecule. 9. The method of claim 8, wherein the miRNA inhibitor is an antisense oligonucleotide. 10. The method of claim 9, wherein the oligonucleotide comprises a nucleotide analog. 11. The method of claim 8, wherein the DNA is comprised in an expression cassette. 12. The method of claim 11, wherein the expression cassette is comprised in a plasmid expression vector. 13. The method of claim 11, wherein the nucleic acid molecule is comprised in a viral expression vector. 14. The method of claim 1, wherein the nucleic acid molecule is comprised in a lipid or viral delivery vehicle. 15. The method of claim 1, wherein the subject has, is at risk of developing, or is suspected of having ocular or retinal/choroidal neovascular diseases, cancer, diabetic nephropathy, rheumatoid arthritis, atherosclerotic plaques, endometriosis, Crohn's disease, uterine fibroids, benign prostatic hyperplasia, or psoriasis. 16. A method of stimulating vascularization in subject or tissue comprising administering to a subject in need of such stimulation, in an amount sufficient to stimulate vascularization, one or more nucleic acid molecule comprising (a) a miRNA sequence that is at least 80% identical to one or more of miR-451, miR-424, miR-146, miR-214, miR-199a, miR-181, miR-350, miR-21, miR-218, miR-148b, miR-106a, miR-205, miR-365, miR-299-5p, ambi-miR-7079, miR-200a, miR-351, miR-329, miR-122a, miR-20a, miR-520h, miR-142-5p, miR-203, miR-211, miR-145, let-7b, miR-93, miR-192, miR-201, miR-18a, miR-17-5p, miR-7085, miR-106b, and/or miR-223; and/or (b) an inhibitor of miR-184, miR-31, miR-150, miR-409, miR-375, miR-129-5p, miR-142a, miR-29a, miR-129-3p, miR-10b, miR-96, miR-183, miR-16, miR-182, miR-191, miR-29c, miR-181c, miR-335, miR-7026, miR-210, miR-512-3p, miR-132, miR-500, miR-339, miR-511, miR-26b, miR-30b, and/or miR-15a. 17. The method of claim 16, wherein the nucleic acid is administered topically, enterally, parenterally or intravitreally. 18. The method of claim 16 wherein the subject has, is at risk of developing, or is suspected of having coronary artery disease (CAD), cardiac failure, tissue injury, or ischemia. 19. A method for selecting a vascular therapy for a patient comprising: (a) measuring an expression profile of one or more of miR-184, miR-31, miR-150, miR-409, miR-375, miR-129-5p, miR-142a, miR-29a, miR-129-3p, miR-10b, miR-96, miR-183, miR-16, miR-182, miR-191, miR-29c, miR-181c, miR-335, miR-7026, miR-210, miR-512-3p, miR-132, miR-500, miR-339, miR-511, miR-26b, miR-30b, miR-15a, miR-451, miR-424, miR-146, miR-214, miR-199a, miR-181, miR-350, miR-21, miR-218, miR-148b, miR-106a, miR-205, miR-365, miR-299-5p, ambi-miR-7079, miR-200a, miR-351, miR-329, miR-122a, miR-20a, miR-520h, miR-142-5p, miR-203, miR-211, miR-145, let-7b, miR-93, miR-192, miR-201, miR-18a, miR-17-5p, miR-7085, miR-106b, and/or miR-223 in a sample; and (b) selecting a therapy based on a comparision of the miRNA expression profile in the patient sample to an expression profile of a normal or non-pathogenic sample, wherein a difference between the expresson profiles is indicative of a pathological condition. 20. The method of claim 19, wherein the altered expression for any of the miRNAs indicates that the patient should be treated with a corresponding therapeutic directed toward the altered miRNA. 21. A method for evaluating a patient comprising the steps of: (a) determining expression levels of one or more of miR-451, miR-424, miR-146, miR-214, miR-199a, miR-181, miR-350, miR-21, miR-218, miR-148b, miR-106a, miR-205, miR-365, miR-299-5p, ambi-miR-7079, miR-200a, miR-351, miR-329, miR-122a, miR-20a, miR-520h, miR-142-5p, miR-203, miR-211, miR-145, let-7b, miR-93, miR-192, miR-201, miR-18a, miR-17-5p, miR-7085, miR-106b, miR-223, miR-184, miR-31, miR-150, miR-409, miR-375, miR-129-5p, miR-142a, miR-29a, miR-129-3p, miR-10b, miR-96, miR-183, miR-16, miR-182, miR-191, miR-29c, miR-181c, miR-335, miR-7026, miR-210, miR-512-3p, miR-132, miR-500, miR-339, miR-511, miR-26b, miR-30b, and/or miR-15a in a biological sample comprising a portion of a tissue or fluid associated with a condition associated with aberrant vacularization, and (b) determining a diagnosis or prognosis for the aberrant vascularization condition based on the miRNA expression levels. 22. The method of claim 21, wherein the patient is suspected of having a condition associated with aberrant vascularization. 23. The method of claim 21, wherein determining a diagnosis is screening for a pathological condition, staging a pathological condition, or assessing response of a pathological condition to therapy. 24. The method of claim 23, wherein determining a diagnosis is determining if the patient has a condition associated with aberrant neovascularization or aberrant angiogenesis. 25. The method of claim 21, further comprising normalizing the expression levels of miRNA. 26. The method of claim 25, wherein normalizing is adjusting expression levels of miRNA relative to expression levels of one or more nucleic acid in the sample. 27. The method of claim 21, further comprising comparing miRNA expression levels in the sample to miRNA expression levels in a normal tissue sample or reference tissue sample. 28. The method of claim 27, wherein the normal tissue sample is taken from the patient being evaluated. 29. The method of claim 27, wherein the normal tissue sample is normal adjacent tissue. 30. The method of claim 21, wherein expression of the miRNA is determined by an amplification assay or a hybridization assay. 31. The method of claim 30, wherein amplification assay is a quantitative amplification assay. 32. The method of claim 31, wherein the quantitative amplification assay is quantitative RT-PCR. 33. The method of claim 30, wherein the hybridization assay is an array hybridization assay or a solution hybridization assay. 34. The method of claim 21, further comprising providing a report of the diagnosis or prognosis. 35. The method of claim 21, further comprising obtaining a sample from the patient. 36. The method of claim 35, further comprising extracting RNA from the sample. 37. The method of claim 36, further comprising labeling miRNA from the sample. 38. The method of claim 35, wherein the sample is a tissue sample. 39. The method of claim 38, wherein the sample is fresh, frozen, fixed, or embedded. 40. The method of claim 39, wherein the sample is a formalin fixed, paraffin-embedded (FFPE) tissue. 41. A kit for analysis of a sample by assessing miRNA profile for a sample comprising, in suitable container means, two or more miRNA hybridization or amplification reagents comprising one or more probe or amplification primer for one or more miRNA selected from miR-451, miR-424, miR-146, miR-214, miR-199a, miR-181, miR-350, miR-21, miR-218, miR-148b, miR-106a, miR-205, miR-365, miR-299-5p, ambi-miR-7079, miR-200a, miR-351, miR-329, miR-122a, miR-20a, miR-520h, miR-142-5p, miR-203, miR-211, miR-145, let-7b, miR-93, miR-192, miR-201, miR-18a, miR-17-5p, miR-7085, miR-106b, miR-223, miR-184, miR-31, miR-150, miR-409, miR-375, miR-129-5p, miR-142a, miR-29a, miR-129-3p, miR-10b, miR-96, miR-183, miR-16, miR-182, miR-191, miR-29c, miR-181c, miR-335, miR-7026, miR-210, miR-512-3p, miR-132, miR-500, miR-339, miR-511, miR-26b, miR-30b, and/or miR-15a. 42. The kit of claim 41, further comprising reagents for detecting an miRNA in the sample. 43. The kit of claim 41, wherein miRNA hybridization reagent comprises hybridization probes. 44. The kit of claim 41, wherein miRNA amplification reagent comprises one or more of amplification primers or a probe for the detection of an miRNA sequence.

The present invention concerns methods and compositions for diagnosing and/or treating vascular diseases including cancer, cardiac diseases, vascular diseases of the eye, and inflammatory diseases. The methods involve measuring the levels of one or multiple miRNAs in patient samples and using the test results to diagnose and/or predict an optimal treatment regimen for the patient. Compositions described in the invention include nucleic acids that function as miRNAs or miRNA inhibitors that can be introduced to a patient to reduce or increase vascularization as needed.1. A method for reducing vascularization in a subject or tissue comprising administering to the subject or tissue in need of such a reduction, in an amount sufficient to reduce vascularization, one or more nucleic acid molecule comprising: (a) a nucleic acid sequence that is at least 80% identical to one or more of miR-184, miR-31, miR-150, miR-409, miR-375, miR-129-5p, miR-142a, miR-29a, miR-129-3p, miR-10b, miR-96, miR-183, miR-16, miR-182, miR-191, miR-29c, miR-181c, miR-335, miR-7026, miR-210, miR-512-3p, miR-132, miR-500, miR-339, miR-511, miR-26b, miR-30b, or miR-15a, or complement thereof; and/or (b) an inhibitor of miR-451, miR-424, miR-146, miR-214, miR-199a, miR-181, miR-350, miR-21, miR-218, miR-148b, miR-106a, miR-205, miR-365, miR-299-5p, ambi-miR-7079, miR-200a, miR-351, miR-329, miR-122a, miR-20a, miR-520h, miR-142-5p, miR-203, miR-211, miR-145, let-7b, miR-93, miR-192, miR-201, miR-18a, miR-17-5p, miR-7085, miR-106b, or miR-223. 2. The method of claim 1, wherein the nucleic acid is administered topically, enterally, parenterally or intravitreally. 3. The method of claim 1, wherein the nucleic acid molecule is an RNA. 4. The method of claim 3, wherein the RNA comprises a complementary RNA region. 5. The method of claim 4, wherein the RNA comprises a hairpin structure. 6. The method of claim 4, wherein the RNA comprises two RNA strands. 7. The method of claim 3, wherein the RNA molecule includes a nucleotide analog or a modified nucleotide. 8. The method of claim 1, wherein the nucleic acid molecule or miRNA inhibitor is a DNA molecule or is produced from a DNA molecule. 9. The method of claim 8, wherein the miRNA inhibitor is an antisense oligonucleotide. 10. The method of claim 9, wherein the oligonucleotide comprises a nucleotide analog. 11. The method of claim 8, wherein the DNA is comprised in an expression cassette. 12. The method of claim 11, wherein the expression cassette is comprised in a plasmid expression vector. 13. The method of claim 11, wherein the nucleic acid molecule is comprised in a viral expression vector. 14. The method of claim 1, wherein the nucleic acid molecule is comprised in a lipid or viral delivery vehicle. 15. The method of claim 1, wherein the subject has, is at risk of developing, or is suspected of having ocular or retinal/choroidal neovascular diseases, cancer, diabetic nephropathy, rheumatoid arthritis, atherosclerotic plaques, endometriosis, Crohn's disease, uterine fibroids, benign prostatic hyperplasia, or psoriasis. 16. A method of stimulating vascularization in subject or tissue comprising administering to a subject in need of such stimulation, in an amount sufficient to stimulate vascularization, one or more nucleic acid molecule comprising (a) a miRNA sequence that is at least 80% identical to one or more of miR-451, miR-424, miR-146, miR-214, miR-199a, miR-181, miR-350, miR-21, miR-218, miR-148b, miR-106a, miR-205, miR-365, miR-299-5p, ambi-miR-7079, miR-200a, miR-351, miR-329, miR-122a, miR-20a, miR-520h, miR-142-5p, miR-203, miR-211, miR-145, let-7b, miR-93, miR-192, miR-201, miR-18a, miR-17-5p, miR-7085, miR-106b, and/or miR-223; and/or (b) an inhibitor of miR-184, miR-31, miR-150, miR-409, miR-375, miR-129-5p, miR-142a, miR-29a, miR-129-3p, miR-10b, miR-96, miR-183, miR-16, miR-182, miR-191, miR-29c, miR-181c, miR-335, miR-7026, miR-210, miR-512-3p, miR-132, miR-500, miR-339, miR-511, miR-26b, miR-30b, and/or miR-15a. 17. The method of claim 16, wherein the nucleic acid is administered topically, enterally, parenterally or intravitreally. 18. The method of claim 16 wherein the subject has, is at risk of developing, or is suspected of having coronary artery disease (CAD), cardiac failure, tissue injury, or ischemia. 19. A method for selecting a vascular therapy for a patient comprising: (a) measuring an expression profile of one or more of miR-184, miR-31, miR-150, miR-409, miR-375, miR-129-5p, miR-142a, miR-29a, miR-129-3p, miR-10b, miR-96, miR-183, miR-16, miR-182, miR-191, miR-29c, miR-181c, miR-335, miR-7026, miR-210, miR-512-3p, miR-132, miR-500, miR-339, miR-511, miR-26b, miR-30b, miR-15a, miR-451, miR-424, miR-146, miR-214, miR-199a, miR-181, miR-350, miR-21, miR-218, miR-148b, miR-106a, miR-205, miR-365, miR-299-5p, ambi-miR-7079, miR-200a, miR-351, miR-329, miR-122a, miR-20a, miR-520h, miR-142-5p, miR-203, miR-211, miR-145, let-7b, miR-93, miR-192, miR-201, miR-18a, miR-17-5p, miR-7085, miR-106b, and/or miR-223 in a sample; and (b) selecting a therapy based on a comparision of the miRNA expression profile in the patient sample to an expression profile of a normal or non-pathogenic sample, wherein a difference between the expresson profiles is indicative of a pathological condition. 20. The method of claim 19, wherein the altered expression for any of the miRNAs indicates that the patient should be treated with a corresponding therapeutic directed toward the altered miRNA. 21. A method for evaluating a patient comprising the steps of: (a) determining expression levels of one or more of miR-451, miR-424, miR-146, miR-214, miR-199a, miR-181, miR-350, miR-21, miR-218, miR-148b, miR-106a, miR-205, miR-365, miR-299-5p, ambi-miR-7079, miR-200a, miR-351, miR-329, miR-122a, miR-20a, miR-520h, miR-142-5p, miR-203, miR-211, miR-145, let-7b, miR-93, miR-192, miR-201, miR-18a, miR-17-5p, miR-7085, miR-106b, miR-223, miR-184, miR-31, miR-150, miR-409, miR-375, miR-129-5p, miR-142a, miR-29a, miR-129-3p, miR-10b, miR-96, miR-183, miR-16, miR-182, miR-191, miR-29c, miR-181c, miR-335, miR-7026, miR-210, miR-512-3p, miR-132, miR-500, miR-339, miR-511, miR-26b, miR-30b, and/or miR-15a in a biological sample comprising a portion of a tissue or fluid associated with a condition associated with aberrant vacularization, and (b) determining a diagnosis or prognosis for the aberrant vascularization condition based on the miRNA expression levels. 22. The method of claim 21, wherein the patient is suspected of having a condition associated with aberrant vascularization. 23. The method of claim 21, wherein determining a diagnosis is screening for a pathological condition, staging a pathological condition, or assessing response of a pathological condition to therapy. 24. The method of claim 23, wherein determining a diagnosis is determining if the patient has a condition associated with aberrant neovascularization or aberrant angiogenesis. 25. The method of claim 21, further comprising normalizing the expression levels of miRNA. 26. The method of claim 25, wherein normalizing is adjusting expression levels of miRNA relative to expression levels of one or more nucleic acid in the sample. 27. The method of claim 21, further comprising comparing miRNA expression levels in the sample to miRNA expression levels in a normal tissue sample or reference tissue sample. 28. The method of claim 27, wherein the normal tissue sample is taken from the patient being evaluated. 29. The method of claim 27, wherein the normal tissue sample is normal adjacent tissue. 30. The method of claim 21, wherein expression of the miRNA is determined by an amplification assay or a hybridization assay. 31. The method of claim 30, wherein amplification assay is a quantitative amplification assay. 32. The method of claim 31, wherein the quantitative amplification assay is quantitative RT-PCR. 33. The method of claim 30, wherein the hybridization assay is an array hybridization assay or a solution hybridization assay. 34. The method of claim 21, further comprising providing a report of the diagnosis or prognosis. 35. The method of claim 21, further comprising obtaining a sample from the patient. 36. The method of claim 35, further comprising extracting RNA from the sample. 37. The method of claim 36, further comprising labeling miRNA from the sample. 38. The method of claim 35, wherein the sample is a tissue sample. 39. The method of claim 38, wherein the sample is fresh, frozen, fixed, or embedded. 40. The method of claim 39, wherein the sample is a formalin fixed, paraffin-embedded (FFPE) tissue. 41. A kit for analysis of a sample by assessing miRNA profile for a sample comprising, in suitable container means, two or more miRNA hybridization or amplification reagents comprising one or more probe or amplification primer for one or more miRNA selected from miR-451, miR-424, miR-146, miR-214, miR-199a, miR-181, miR-350, miR-21, miR-218, miR-148b, miR-106a, miR-205, miR-365, miR-299-5p, ambi-miR-7079, miR-200a, miR-351, miR-329, miR-122a, miR-20a, miR-520h, miR-142-5p, miR-203, miR-211, miR-145, let-7b, miR-93, miR-192, miR-201, miR-18a, miR-17-5p, miR-7085, miR-106b, miR-223, miR-184, miR-31, miR-150, miR-409, miR-375, miR-129-5p, miR-142a, miR-29a, miR-129-3p, miR-10b, miR-96, miR-183, miR-16, miR-182, miR-191, miR-29c, miR-181c, miR-335, miR-7026, miR-210, miR-512-3p, miR-132, miR-500, miR-339, miR-511, miR-26b, miR-30b, and/or miR-15a. 42. The kit of claim 41, further comprising reagents for detecting an miRNA in the sample. 43. The kit of claim 41, wherein miRNA hybridization reagent comprises hybridization probes. 44. The kit of claim 41, wherein miRNA amplification reagent comprises one or more of amplification primers or a probe for the detection of an miRNA sequence.

The present invention in one aspect relates generally to the identification, provision and use of a plurality of biomarkers to provide risk assessment of a subject having glioblastoma multiforme, and products and processes related thereto. In one aspect, a novel plurality of biomarkers as described herein is provided to determine a risk of glioblastoma multiforme. In another aspect, a novel plurality of biomarkers as described herein is provided to diagnose a subject having glioblastoma multiforme. In yet another aspect are methods for treating a subject having glioblastoma multiforme by administering one or more therapeutic regimens for glioblastoma multiforme. In yet another aspect are nucleic acid arrays comprising nucleic acid probes that hybridize to one or more glioblastoma multiforme genes.

1. A method of diagnosing whether a subject has, or is at risk for developing, a brain tumor, comprising: (i) obtaining from a biological sample from the subject a set of expression profiles of a plurality of brain tumor marker genes from Table 1; (ii) comparing (a) the set of expression profiles of brain tumor marker genes in a biological sample from the subject, the set comprising expression profiles of a plurality of brain tumor marker genes from Table 1, to (b) a set of expression profiles of brain tumor marker genes in a biological sample from a control subject; and (iii) providing a diagnosis for, or a risk assessment of, a brain tumor based on the comparison. 2. A method for identifying a subject having a brain tumor, comprising determining expression profiles of no more than five to five hundred genes in a biological sample comprising cells from a subject, wherein at least 20% of the genes are selected from the brain tumor marker genes listed in Table 1. 3. A method of determining the prognosis of a subject with a brain tumor comprising measuring the level of at least one miRNA selected from Table 1 in a test biological sample from said subject, wherein the miRNA expression level is associated with an adverse prognosis; and an alteration in the level of the at least one miRNA in the test biological sample, relative to the level of a corresponding miRNA in a control biological sample, is indicative of an adverse prognosis. 4. The method of any of the preceding claims, wherein biological sample comprises a tissue sample containing cancer cells, biopsy fluid, blood or urine. 5. The method of claim 4, further comprising obtaining or storing the biological sample prior to determining the set of expression profiles. 6. The method of claim 4, wherein obtaining the biological sample comprising isolating a cell fraction from a biopsy. 7. The method of claim 4, wherein obtaining the biological sample comprising isolating a cell fraction from a whole blood sample from the patient. 8. The method of any of the preceding claims, wherein the biological sample comprises an enriched cell fraction. 9. The method of claim 8, wherein the cell fraction is enriched for lymphocytes. 10. The method of claim any of the preceding claims, wherein providing a diagnosis comprises providing a providing a probability score. 11. The method of any of the preceding claims, wherein providing the diagnosis comprises providing a classification. 12. The method of any of the preceding claims, wherein the plurality of brain tumor marker genes comprises at least three of the brain tumor marker genes listed in Table 1. 13. The method of any of the preceding claims, wherein the plurality of brain tumor marker genes comprises at least five of the brain tumor marker genes listed in Table 1. 14. The method of any of the preceding claims, wherein the plurality of brain tumor marker genes comprises at least ten of the brain tumor marker genes listed in Table 1. 15. The method of any of the preceding claims, wherein the diagnoses indicates that the subject has a high risk of a brain tumor, further prescribing or providing a prophylactic therapy for reducing the risk of, or treating the brain tumor. 16. The method of claim 15, wherein the prophylactic therapy comprises administration of one or more anti-cancer therapies. 17. The method of any of the preceding claims, wherein at least 30% of the genes are selected from the brain tumor marker genes listed in Table 1. 18. The method of any of the preceding claims, wherein at least 50% of the genes are selected from the brain tumor marker genes listed in Table 1. 19. The method of any of the preceding claims, wherein at least 75% of the genes are selected from the brain tumor marker genes listed in Table 1. 20. The method of any of the preceding claims, wherein at least 90% of the genes are selected from the brain tumor marker genes listed in Table 1. 21. The method of any of the preceding claims, wherein said brain tumor is glioblastoma multiforme. 22. A method of treating a brain tumor in a subject, comprising: (a) determining the amount of at least one miRNA selected from the genes in Table 1 in cancer cells, relative to control cells; and (b) altering the amount of miRNA expressed in the cells by (i) administering to the subject an effective amount of at least one isolated miRNA, a precursor thereof, an isolated variant thereof, or a biologically active fragment thereof, or (ii) administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miRNA. 23. The method of claim 22, wherein said cancer cells comprise cells obtained from a tissue sample containing cancer cells, biopsy fluid, blood or urine. 24. The method of claim 22, wherein said brain tumor is glioblastoma multiforme. 25. The method of any one of claims 22-24, further comprising administering to the subject one or more therapeutic regimens. 26. The method of claim 22, wherein determining the amount of at least one miRNA selected from the genes in Table 1 in cancer cells, relative to control cells comprises (i) comparing (a) a set of expression profiles of brain tumor marker genes in a biological sample from the subject, the set comprising expression profiles of a plurality of brain tumor marker genes from Table 1, to (b) a set of expression profiles of brain tumor marker genes in a biological sample from a control subject. 27. The method of claim 26, further comprising obtaining the set of expression profiles prior to the comparing step. 28. The method of claim 22, wherein said cancer cells are obtained from a tissue sample containing cancer cells, biopsy fluid, blood or urine. 29. The method of claim 22, wherein at least 30% of the genes are selected from the brain tumor marker genes listed in Table 1. 30. The method of claim 22, wherein at least 50% of the genes are selected from the brain tumor marker genes listed in Table 1. 31. The method of claim 22, wherein at least 75% of the genes are selected from the brain tumor marker genes listed in Table 1. 32. The method of claim 22, wherein at least 90% of the genes are selected from the brain tumor marker genes listed in Table 1. 33. The method of claim 22, wherein said brain tumor is glioblastoma multiforme.

The present invention in one aspect relates generally to the identification, provision and use of a plurality of biomarkers to provide risk assessment of a subject having glioblastoma multiforme, and products and processes related thereto. In one aspect, a novel plurality of biomarkers as described herein is provided to determine a risk of glioblastoma multiforme. In another aspect, a novel plurality of biomarkers as described herein is provided to diagnose a subject having glioblastoma multiforme. In yet another aspect are methods for treating a subject having glioblastoma multiforme by administering one or more therapeutic regimens for glioblastoma multiforme. In yet another aspect are nucleic acid arrays comprising nucleic acid probes that hybridize to one or more glioblastoma multiforme genes.1. A method of diagnosing whether a subject has, or is at risk for developing, a brain tumor, comprising: (i) obtaining from a biological sample from the subject a set of expression profiles of a plurality of brain tumor marker genes from Table 1; (ii) comparing (a) the set of expression profiles of brain tumor marker genes in a biological sample from the subject, the set comprising expression profiles of a plurality of brain tumor marker genes from Table 1, to (b) a set of expression profiles of brain tumor marker genes in a biological sample from a control subject; and (iii) providing a diagnosis for, or a risk assessment of, a brain tumor based on the comparison. 2. A method for identifying a subject having a brain tumor, comprising determining expression profiles of no more than five to five hundred genes in a biological sample comprising cells from a subject, wherein at least 20% of the genes are selected from the brain tumor marker genes listed in Table 1. 3. A method of determining the prognosis of a subject with a brain tumor comprising measuring the level of at least one miRNA selected from Table 1 in a test biological sample from said subject, wherein the miRNA expression level is associated with an adverse prognosis; and an alteration in the level of the at least one miRNA in the test biological sample, relative to the level of a corresponding miRNA in a control biological sample, is indicative of an adverse prognosis. 4. The method of any of the preceding claims, wherein biological sample comprises a tissue sample containing cancer cells, biopsy fluid, blood or urine. 5. The method of claim 4, further comprising obtaining or storing the biological sample prior to determining the set of expression profiles. 6. The method of claim 4, wherein obtaining the biological sample comprising isolating a cell fraction from a biopsy. 7. The method of claim 4, wherein obtaining the biological sample comprising isolating a cell fraction from a whole blood sample from the patient. 8. The method of any of the preceding claims, wherein the biological sample comprises an enriched cell fraction. 9. The method of claim 8, wherein the cell fraction is enriched for lymphocytes. 10. The method of claim any of the preceding claims, wherein providing a diagnosis comprises providing a providing a probability score. 11. The method of any of the preceding claims, wherein providing the diagnosis comprises providing a classification. 12. The method of any of the preceding claims, wherein the plurality of brain tumor marker genes comprises at least three of the brain tumor marker genes listed in Table 1. 13. The method of any of the preceding claims, wherein the plurality of brain tumor marker genes comprises at least five of the brain tumor marker genes listed in Table 1. 14. The method of any of the preceding claims, wherein the plurality of brain tumor marker genes comprises at least ten of the brain tumor marker genes listed in Table 1. 15. The method of any of the preceding claims, wherein the diagnoses indicates that the subject has a high risk of a brain tumor, further prescribing or providing a prophylactic therapy for reducing the risk of, or treating the brain tumor. 16. The method of claim 15, wherein the prophylactic therapy comprises administration of one or more anti-cancer therapies. 17. The method of any of the preceding claims, wherein at least 30% of the genes are selected from the brain tumor marker genes listed in Table 1. 18. The method of any of the preceding claims, wherein at least 50% of the genes are selected from the brain tumor marker genes listed in Table 1. 19. The method of any of the preceding claims, wherein at least 75% of the genes are selected from the brain tumor marker genes listed in Table 1. 20. The method of any of the preceding claims, wherein at least 90% of the genes are selected from the brain tumor marker genes listed in Table 1. 21. The method of any of the preceding claims, wherein said brain tumor is glioblastoma multiforme. 22. A method of treating a brain tumor in a subject, comprising: (a) determining the amount of at least one miRNA selected from the genes in Table 1 in cancer cells, relative to control cells; and (b) altering the amount of miRNA expressed in the cells by (i) administering to the subject an effective amount of at least one isolated miRNA, a precursor thereof, an isolated variant thereof, or a biologically active fragment thereof, or (ii) administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miRNA. 23. The method of claim 22, wherein said cancer cells comprise cells obtained from a tissue sample containing cancer cells, biopsy fluid, blood or urine. 24. The method of claim 22, wherein said brain tumor is glioblastoma multiforme. 25. The method of any one of claims 22-24, further comprising administering to the subject one or more therapeutic regimens. 26. The method of claim 22, wherein determining the amount of at least one miRNA selected from the genes in Table 1 in cancer cells, relative to control cells comprises (i) comparing (a) a set of expression profiles of brain tumor marker genes in a biological sample from the subject, the set comprising expression profiles of a plurality of brain tumor marker genes from Table 1, to (b) a set of expression profiles of brain tumor marker genes in a biological sample from a control subject. 27. The method of claim 26, further comprising obtaining the set of expression profiles prior to the comparing step. 28. The method of claim 22, wherein said cancer cells are obtained from a tissue sample containing cancer cells, biopsy fluid, blood or urine. 29. The method of claim 22, wherein at least 30% of the genes are selected from the brain tumor marker genes listed in Table 1. 30. The method of claim 22, wherein at least 50% of the genes are selected from the brain tumor marker genes listed in Table 1. 31. The method of claim 22, wherein at least 75% of the genes are selected from the brain tumor marker genes listed in Table 1. 32. The method of claim 22, wherein at least 90% of the genes are selected from the brain tumor marker genes listed in Table 1. 33. The method of claim 22, wherein said brain tumor is glioblastoma multiforme.

The present invention provides antisense antiviral compounds, compositions, and methods of their use and production, mainly for inhibiting the replication of viruses of the Filoviridae family, including Ebola and Marburg viruses. The compounds, compositions, and methods also relate to the treatment of viral infections in mammals including primates by Ebola and Marburg viruses. The antisense antiviral compounds include phosphorodiamidate morpholino oligonucleotides (PMOplus) having a nuclease resistant backbone, about 15-40 nucleotide bases, at least two but typically no more than half piperazine-containing intersubunit linkages, and a targeting sequence that is targeted against the AUG start site region of Ebola virus VP35, Ebola virus VP24, Marburg virus VP24, or Marburg virus NP, including combinations and mixtures thereof.

1.-4. (canceled) 5. A method of treating a Marburg virus infection in a mammalian subject, comprising administering to the mammalian subject a therapeutically effective amount of a morpholino antisense oligonucleotide of 23 bases comprising the base sequence of SEQ ID NO:79, wherein the morpholino antisense oligonucleotide is linked to a polyethylene glycol moiety. 6. The method of claim 5, wherein the morpholino antisense oligonucleotide is a phosphorodiamidate oligonucleotide. 7. The method of claim 5, wherein at least two to no more than half of the total number of phosphorus-containing intersubunit linkages are positively charged. 8. The method of claim 7, wherein the morpholino antisense oligonucleotide comprises positively charged phosphorus-containing intersubunit linkages between bases 10 and 11, bases 12 and 13, bases 14 and 15, bases 18 and 19, and bases 19 and 20 of SEQ ID NO:79. 9. The method of claim 5, wherein the morpholino antisense oligonucleotide comprises phosphorus-containing intersubunit linkages in accordance with the structure: 10. The method of claim 9, wherein X is NH2, NHR or NR2, wherein each R is a lower alkyl. 11. The method of claim 10, wherein X is N(CH3)2. 12. The method of claim 9, wherein X is 1-piperazine for two to no more than half of the total number of phosphorus-containing intersubunit linkages. 13. The method of claim 9, wherein X is 1-piperazine at phosphorus-containing intersubunit linkages between bases 10 and 11, bases 12 and 13, bases 14 and 15, bases 18 and 19, and bases 19 and 20 of SEQ ID NO:79, and X is N(CH3)2 for the remaining phosphorus-containing intersubunit linkages. 14. The method of claim 5, wherein the morpholino antisense oligonucleotide is formulated as a composition comprising a pharmaceutically acceptable carrier. 15. The method of claim 5, wherein the morpholino antisense oligonucleotide comprises a formula of: 16. The method of claim 15, wherein the morpholino antisense oligonucleotide is formulated as a composition comprising a pharmaceutically acceptable carrier. 17. A method of vaccinating a mammalian subject against a Marburg virus, comprising administering to the mammalian subject an effective amount of a morpholino antisense oligonucleotide of 23 bases comprising the base sequence of SEQ ID NO:79, wherein the morpholino antisense oligonucleotide is linked to a polyethylene glycol moiety, and exposing the mammalian subject to an attenuated Marburg virus. 18. The method of claim 17, wherein the morpholino antisense oligonucleotide is a phosphorodiamidate oligonucleotide. 19. The method of claim 17, wherein at least two to no more than half of the total number of phosphorus-containing intersubunit linkages are positively charged. 20. The method of claim 17, wherein the morpholino antisense oligonucleotide comprises positively charged phosphorus-containing intersubunit linkages between bases 10 and 11, bases 12 and 13, bases 14 and 15, bases 18 and 19, and bases 19 and 20 of SEQ ID NO:79. 21. The method of claim 17, wherein the morpholino antisense oligonucleotide comprises phosphorus-containing intersubunit linkages in accordance with the structure: 22. The method of claim 21, wherein X is NH2, NHR or NR2, wherein each R is a lower alkyl. 23. The method of claim 22, wherein X is N(CH3)2. 24. The method of claim 21, wherein X is 1-piperazine for two to no more than half of the total number of phosphorus-containing intersubunit linkages. 25. The method of claim 21, wherein X is-1-piperazine at phosphorus-containing intersubunit linkages between bases 10 and 11, bases 12 and 13, bases 14 and 15, bases 18 and 19, and bases 19 and 20 of SEQ ID NO:79, and X is N(CH3)2 for the remaining phosphorus-containing intersubunit linkages. 26. The method of claim 17, wherein the morpholino antisense oligonucleotide is formulated as a composition comprising a pharmaceutically acceptable carrier. 27. The method of claim 17, wherein the morpholino antisense oligonucleotide comprises a formula of:

The present invention provides antisense antiviral compounds, compositions, and methods of their use and production, mainly for inhibiting the replication of viruses of the Filoviridae family, including Ebola and Marburg viruses. The compounds, compositions, and methods also relate to the treatment of viral infections in mammals including primates by Ebola and Marburg viruses. The antisense antiviral compounds include phosphorodiamidate morpholino oligonucleotides (PMOplus) having a nuclease resistant backbone, about 15-40 nucleotide bases, at least two but typically no more than half piperazine-containing intersubunit linkages, and a targeting sequence that is targeted against the AUG start site region of Ebola virus VP35, Ebola virus VP24, Marburg virus VP24, or Marburg virus NP, including combinations and mixtures thereof.1.-4. (canceled) 5. A method of treating a Marburg virus infection in a mammalian subject, comprising administering to the mammalian subject a therapeutically effective amount of a morpholino antisense oligonucleotide of 23 bases comprising the base sequence of SEQ ID NO:79, wherein the morpholino antisense oligonucleotide is linked to a polyethylene glycol moiety. 6. The method of claim 5, wherein the morpholino antisense oligonucleotide is a phosphorodiamidate oligonucleotide. 7. The method of claim 5, wherein at least two to no more than half of the total number of phosphorus-containing intersubunit linkages are positively charged. 8. The method of claim 7, wherein the morpholino antisense oligonucleotide comprises positively charged phosphorus-containing intersubunit linkages between bases 10 and 11, bases 12 and 13, bases 14 and 15, bases 18 and 19, and bases 19 and 20 of SEQ ID NO:79. 9. The method of claim 5, wherein the morpholino antisense oligonucleotide comprises phosphorus-containing intersubunit linkages in accordance with the structure: 10. The method of claim 9, wherein X is NH2, NHR or NR2, wherein each R is a lower alkyl. 11. The method of claim 10, wherein X is N(CH3)2. 12. The method of claim 9, wherein X is 1-piperazine for two to no more than half of the total number of phosphorus-containing intersubunit linkages. 13. The method of claim 9, wherein X is 1-piperazine at phosphorus-containing intersubunit linkages between bases 10 and 11, bases 12 and 13, bases 14 and 15, bases 18 and 19, and bases 19 and 20 of SEQ ID NO:79, and X is N(CH3)2 for the remaining phosphorus-containing intersubunit linkages. 14. The method of claim 5, wherein the morpholino antisense oligonucleotide is formulated as a composition comprising a pharmaceutically acceptable carrier. 15. The method of claim 5, wherein the morpholino antisense oligonucleotide comprises a formula of: 16. The method of claim 15, wherein the morpholino antisense oligonucleotide is formulated as a composition comprising a pharmaceutically acceptable carrier. 17. A method of vaccinating a mammalian subject against a Marburg virus, comprising administering to the mammalian subject an effective amount of a morpholino antisense oligonucleotide of 23 bases comprising the base sequence of SEQ ID NO:79, wherein the morpholino antisense oligonucleotide is linked to a polyethylene glycol moiety, and exposing the mammalian subject to an attenuated Marburg virus. 18. The method of claim 17, wherein the morpholino antisense oligonucleotide is a phosphorodiamidate oligonucleotide. 19. The method of claim 17, wherein at least two to no more than half of the total number of phosphorus-containing intersubunit linkages are positively charged. 20. The method of claim 17, wherein the morpholino antisense oligonucleotide comprises positively charged phosphorus-containing intersubunit linkages between bases 10 and 11, bases 12 and 13, bases 14 and 15, bases 18 and 19, and bases 19 and 20 of SEQ ID NO:79. 21. The method of claim 17, wherein the morpholino antisense oligonucleotide comprises phosphorus-containing intersubunit linkages in accordance with the structure: 22. The method of claim 21, wherein X is NH2, NHR or NR2, wherein each R is a lower alkyl. 23. The method of claim 22, wherein X is N(CH3)2. 24. The method of claim 21, wherein X is 1-piperazine for two to no more than half of the total number of phosphorus-containing intersubunit linkages. 25. The method of claim 21, wherein X is-1-piperazine at phosphorus-containing intersubunit linkages between bases 10 and 11, bases 12 and 13, bases 14 and 15, bases 18 and 19, and bases 19 and 20 of SEQ ID NO:79, and X is N(CH3)2 for the remaining phosphorus-containing intersubunit linkages. 26. The method of claim 17, wherein the morpholino antisense oligonucleotide is formulated as a composition comprising a pharmaceutically acceptable carrier. 27. The method of claim 17, wherein the morpholino antisense oligonucleotide comprises a formula of:

A significant challenge in cancer research field is to define molecular features that distinguish cancer stem cells from normal stem cells. In this study, microRNA (miRNA) expression profiles in human glioblastoma stem cells were compared to that of normal neural stem cells using combined microarray and deep sequencing analyses. These studies led to the identification of several miRNAs that are differentially expressed in glioblastoma stem cells and normal neural stem cells. Characterizing the role of these miRNAs in glioblastoma stem cells is important for the development of miRNA-based therapies that specifically target tumor stem cells, but spare normal stem cells.

1. A method of treating a cancer comprising: administering a therapeutically effective amount of a pharmaceutical composition to a subject having the cancer, wherein the pharmaceutical composition comprises one or more therapeutic agents which target one or more miRNA molecules that is upregulated in cancer stem cells as compared to normal cells. 2-4. (canceled) 5. The method of claim 2, wherein the one or more therapeutic agents includes at least one miRNA inhibitor that inhibits an upregulated miRNA molecule. 6. The method of claim 5, wherein the upregulated miRNA is selected from miR-10a, miR-10b, miR-140-3p, miR-140-5p, miR-204, miR-424, miR-34a, miR-193a-3p, miR-455-5p, miR-455-3p, miR-9, miR-10a, miR-148a, miR-488, miR-196a1, miR-182, miR-96, miR-193b, miR-27a, miR-196b, miR-10b, miR-29b2, miR-23a, miR-107, miR-542-3p, miR-93, miR-365a4, miR-450a, miR-100, miR-105, miR-363, miR-105, miR-106b, miR-15b, miR-21, miR-376c, miR-93, miR-99b, miR-155, miR-33a, miR-876-3p, miR-362-3p, miR-25, let-7i, miR-423-3p, miR-34b, miR-16-2, miR-29a, miR-30d, miR-320, miR-181c, miR-128a, miR-21, let-7d, and miR-450b-5p. 7. The method of claim 1, wherein the cancer is glioblastoma. 8-22. (canceled) 23. The method of claim 5, wherein the at inhibitor comprises a nucleic acid that is sufficiently complementary to the miRNA molecule to hybridize to the miRNA molecule under physiological conditions. 24. The method of claim 1, further comprising administering to the subject at least one miRNA that is down regulated in a cancer stem cell as compared to a normal cell or an miRNA expression vector that overexpresses a downregulated miRNA molecule. 25. The method of claim 24, wherein the downregulated miRNA molecule is selected from miR-371-5p, miR-1245, miR-335, miR-492, miR-874, miR-30b, miR-193a-5p, miR-602, miR-346, miR-663, miR-25, miR-219-5p6, miR-184, miR-135a7, miR-584, miR-665, miR-638, miR-503, miR-628-3p, miR-381, miR-78, miR-92b, miR-149, miR-135b, miR-302d, miR-498, miR-766, miR-1389, miR-623, miR-519c-5p, miR-182, miR-494, miR-129-5p10, miR-513-5p, miR-200b, miR-634, miR-654-5p, miR-518b, miR-658, miR-373, miR-30c-2, miR-130a, miR-557, miR-551a, miR-637, miR-518c, miR-525-5p, miR-596, miR-552, miR-625, miR-183, miR-187, miR-544, miR-891a, miR-519e, miR-933, miR-939, miR-214, miR-671-5p, miR-137, miR-92b, miR-525-3p, miR-19a, and miR-409-5p.

A significant challenge in cancer research field is to define molecular features that distinguish cancer stem cells from normal stem cells. In this study, microRNA (miRNA) expression profiles in human glioblastoma stem cells were compared to that of normal neural stem cells using combined microarray and deep sequencing analyses. These studies led to the identification of several miRNAs that are differentially expressed in glioblastoma stem cells and normal neural stem cells. Characterizing the role of these miRNAs in glioblastoma stem cells is important for the development of miRNA-based therapies that specifically target tumor stem cells, but spare normal stem cells.1. A method of treating a cancer comprising: administering a therapeutically effective amount of a pharmaceutical composition to a subject having the cancer, wherein the pharmaceutical composition comprises one or more therapeutic agents which target one or more miRNA molecules that is upregulated in cancer stem cells as compared to normal cells. 2-4. (canceled) 5. The method of claim 2, wherein the one or more therapeutic agents includes at least one miRNA inhibitor that inhibits an upregulated miRNA molecule. 6. The method of claim 5, wherein the upregulated miRNA is selected from miR-10a, miR-10b, miR-140-3p, miR-140-5p, miR-204, miR-424, miR-34a, miR-193a-3p, miR-455-5p, miR-455-3p, miR-9, miR-10a, miR-148a, miR-488, miR-196a1, miR-182, miR-96, miR-193b, miR-27a, miR-196b, miR-10b, miR-29b2, miR-23a, miR-107, miR-542-3p, miR-93, miR-365a4, miR-450a, miR-100, miR-105, miR-363, miR-105, miR-106b, miR-15b, miR-21, miR-376c, miR-93, miR-99b, miR-155, miR-33a, miR-876-3p, miR-362-3p, miR-25, let-7i, miR-423-3p, miR-34b, miR-16-2, miR-29a, miR-30d, miR-320, miR-181c, miR-128a, miR-21, let-7d, and miR-450b-5p. 7. The method of claim 1, wherein the cancer is glioblastoma. 8-22. (canceled) 23. The method of claim 5, wherein the at inhibitor comprises a nucleic acid that is sufficiently complementary to the miRNA molecule to hybridize to the miRNA molecule under physiological conditions. 24. The method of claim 1, further comprising administering to the subject at least one miRNA that is down regulated in a cancer stem cell as compared to a normal cell or an miRNA expression vector that overexpresses a downregulated miRNA molecule. 25. The method of claim 24, wherein the downregulated miRNA molecule is selected from miR-371-5p, miR-1245, miR-335, miR-492, miR-874, miR-30b, miR-193a-5p, miR-602, miR-346, miR-663, miR-25, miR-219-5p6, miR-184, miR-135a7, miR-584, miR-665, miR-638, miR-503, miR-628-3p, miR-381, miR-78, miR-92b, miR-149, miR-135b, miR-302d, miR-498, miR-766, miR-1389, miR-623, miR-519c-5p, miR-182, miR-494, miR-129-5p10, miR-513-5p, miR-200b, miR-634, miR-654-5p, miR-518b, miR-658, miR-373, miR-30c-2, miR-130a, miR-557, miR-551a, miR-637, miR-518c, miR-525-5p, miR-596, miR-552, miR-625, miR-183, miR-187, miR-544, miR-891a, miR-519e, miR-933, miR-939, miR-214, miR-671-5p, miR-137, miR-92b, miR-525-3p, miR-19a, and miR-409-5p.

The invention relates to si RNA molecules and their use in methods and pharmaceutical compositions for inhibiting the expression of the FLAP gene. The invention also relates to the use of said si RNAs molecules in the treatment and/or prevention of an eye condition characterised by increased expression and/or activity of FLAP gene, preferably said eye condition is conjunctivitis and/or an ocular allergy such as seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, and giant papillary conjunctivitis.

1. An siRNA molecule which specifically targets at least one sequence selected from SEQ ID NO. 1 to SEQ ID NO. 89, for treating and/or preventing an eye condition characterized by increased expression and/or activity of FLAP. 2. (canceled) 3. The siRNA molecule according to claim 1, wherein said eye condition is an ocular allergy and/or conjunctivitis. 4. The siRNA molecule according to claim 3, wherein said eye condition is selected from seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, dry eye syndrome, or combinations thereof. 5. The siRNA molecule according to claim 1, wherein said siRNA comprises a 19 nucleotide double-stranded region. 6. The siRNA molecule according to claim 5, wherein said siRNA is blunt-ended. 7. The siRNA molecule according to claim 6, wherein said siRNA includes at least one sequence selected from SEQ ID NO. 90 to SEQ ID NO. 178. 8. A double stranded, blunt-ended siRNA molecule consisting of 19 nucleotides, which siRNA molecule specifically targets at least one sequence selected from SEQ ID NO. 1 to SEQ ID NO. 89 and reduces expression of the FLAP gene when introduced into a cell. 9. The siRNA molecule according to claim 1, wherein at least one nucleotide of said siRNA molecule comprises a chemical modification. 10. The siRNA molecule according to claim 9, wherein said chemical modification is selected from the group consisting of 2′-O-methylation; substitution of uracyl ribose nucleotides with deoxythymidine nucleotides; and combinations thereof. 11. The siRNA molecule according to claim 9, wherein said chemical modification is on the sense strand, the antisense strand, or on both the sense and the antisense strand. 12. A method of treating an eye condition characterised by increased expression and/or activity of FLAP in a subject in need thereof, the method comprising: topically administering to the corneal surface of the eye of the subject an amount of the siRNA according to claim 8 effective to decrease the expression and/or activity of FLAP in cells of the eye and to treat the eye condition. 13. The method according to claim 12, wherein said eye condition is an ocular allergy and/or conjunctivitis. 14. The method according to claim 13, wherein said eye condition is selected from the group consisting of seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, dry eye syndrome and combinations thereof. 15. A pharmaceutical composition comprising the siRNA molecule according to claim 8. 16. The siRNA molecule according to claim 8, wherein said siRNA molecule specifically targets at least one sequence selected from SEQ ID NO. 1 to SEQ ID NO. 8. 17. The siRNA molecule according to claim 8, having the nucleotide sequence set forth in any one of SEQ ID NO. 90 to SEQ ID NO. 97. 18. The siRNA molecule according to claim 17, having the nucleotide sequence set forth in SEQ ID NO. 90. 19. The siRNA molecule according to claim 8, wherein at least one nucleotide of said siRNA molecule comprises a chemical modification. 20. The siRNA molecule according to claim 19, wherein said chemical modification is selected from the group consisting of 2′-O-methylation; substitution of uracyl ribose nucleotides with deoxythymidine nucleotides; and combinations thereof. 21. The siRNA molecule according to claim 19, wherein said chemical modification is on the sense strand, the antisense strand, or on both the sense and the antisense strand.

The invention relates to si RNA molecules and their use in methods and pharmaceutical compositions for inhibiting the expression of the FLAP gene. The invention also relates to the use of said si RNAs molecules in the treatment and/or prevention of an eye condition characterised by increased expression and/or activity of FLAP gene, preferably said eye condition is conjunctivitis and/or an ocular allergy such as seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, and giant papillary conjunctivitis.1. An siRNA molecule which specifically targets at least one sequence selected from SEQ ID NO. 1 to SEQ ID NO. 89, for treating and/or preventing an eye condition characterized by increased expression and/or activity of FLAP. 2. (canceled) 3. The siRNA molecule according to claim 1, wherein said eye condition is an ocular allergy and/or conjunctivitis. 4. The siRNA molecule according to claim 3, wherein said eye condition is selected from seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, dry eye syndrome, or combinations thereof. 5. The siRNA molecule according to claim 1, wherein said siRNA comprises a 19 nucleotide double-stranded region. 6. The siRNA molecule according to claim 5, wherein said siRNA is blunt-ended. 7. The siRNA molecule according to claim 6, wherein said siRNA includes at least one sequence selected from SEQ ID NO. 90 to SEQ ID NO. 178. 8. A double stranded, blunt-ended siRNA molecule consisting of 19 nucleotides, which siRNA molecule specifically targets at least one sequence selected from SEQ ID NO. 1 to SEQ ID NO. 89 and reduces expression of the FLAP gene when introduced into a cell. 9. The siRNA molecule according to claim 1, wherein at least one nucleotide of said siRNA molecule comprises a chemical modification. 10. The siRNA molecule according to claim 9, wherein said chemical modification is selected from the group consisting of 2′-O-methylation; substitution of uracyl ribose nucleotides with deoxythymidine nucleotides; and combinations thereof. 11. The siRNA molecule according to claim 9, wherein said chemical modification is on the sense strand, the antisense strand, or on both the sense and the antisense strand. 12. A method of treating an eye condition characterised by increased expression and/or activity of FLAP in a subject in need thereof, the method comprising: topically administering to the corneal surface of the eye of the subject an amount of the siRNA according to claim 8 effective to decrease the expression and/or activity of FLAP in cells of the eye and to treat the eye condition. 13. The method according to claim 12, wherein said eye condition is an ocular allergy and/or conjunctivitis. 14. The method according to claim 13, wherein said eye condition is selected from the group consisting of seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, dry eye syndrome and combinations thereof. 15. A pharmaceutical composition comprising the siRNA molecule according to claim 8. 16. The siRNA molecule according to claim 8, wherein said siRNA molecule specifically targets at least one sequence selected from SEQ ID NO. 1 to SEQ ID NO. 8. 17. The siRNA molecule according to claim 8, having the nucleotide sequence set forth in any one of SEQ ID NO. 90 to SEQ ID NO. 97. 18. The siRNA molecule according to claim 17, having the nucleotide sequence set forth in SEQ ID NO. 90. 19. The siRNA molecule according to claim 8, wherein at least one nucleotide of said siRNA molecule comprises a chemical modification. 20. The siRNA molecule according to claim 19, wherein said chemical modification is selected from the group consisting of 2′-O-methylation; substitution of uracyl ribose nucleotides with deoxythymidine nucleotides; and combinations thereof. 21. The siRNA molecule according to claim 19, wherein said chemical modification is on the sense strand, the antisense strand, or on both the sense and the antisense strand.

The invention relates to siRNA molecules and their use in methods and pharmaceutical compositions for inhibiting the expression of the PDK1 gene. The invention also relates to the use of said siRNAs molecules in the treatment and/or prevention of an eye condition characterised by increased expression and/or activity of PDK1 gene, preferably said eye condition is conjunctivitis and/or an ocular allergy such as seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, and giant papillary conjunctivitis.

1. An siRNA molecule wherein said molecule specifically targets at least one sequence selected from the group consisting of SEQ ID NO. 1-SEQ ID NO. 687, for use as a medicament. 2. An siRNA molecule according to claim 1, for use in the treatment and/or prevention of an eye condition characterised by increased expression and/or activity of PDK1. 3. An siRNA molecule according to claim 2, wherein said eye condition is an ocular allergy and/or conjunctivitis. 4. An siRNA molecule according to claim 2 or 3, wherein said eye condition is selected from seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, dry eye syndrome and combinations thereof. 5. An siRNA molecule according to any preceding claim wherein said siRNA comprises a 19 nucleotide double-stranded region. 6. An siRNA molecule according to claim 5 wherein said siRNA is blunt-ended. 7. An siRNA molecule according to any preceding claim wherein said siRNA comprises or consists of at least one sequence selected from the group consisting of SEQ ID NO. 688-SEQ ID NO. 1374. 8. An siRNA molecule wherein said molecule specifically targets at least one sequence selected from the group consisting of SEQ ID NO. 1-SEQ ID NO. 687 and reduces expression of PDK1 gene when introduced in a cell and wherein said siRNA comprises a 19 nucleotide blunt-ended double-stranded structure. 9. An siRNA molecule according to any preceding claim, wherein at least one nucleotide comprises a chemical modification. 10. An siRNA molecule according to claim 9, wherein said chemical modification of a nucleotide is selected from: 2′-OMethylation and substitution of uracyl ribose nucleotides with deoxythymidine nucleotides and combinations thereof. 11. An siRNA molecule according to claim 9 or 10 wherein said chemical modification is on the sense strand, the antisense strand or on both. 12. Use of an siRNA molecule according to any preceding claim in the manufacture of a medicament for the treatment of an eye condition characterised by increased expression and/or activity of PDK1. 13. Use according to claim 12 wherein said eye condition is an ocular allergy and/or conjunctivitis. 14. Use according to claim 12 or 13 wherein said eye condition is selected from seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, dry eye syndrome and combinations thereof. 15. A pharmaceutical composition wherein said composition comprises at least an siRNA molecule described in claims 1 to 11.

The invention relates to siRNA molecules and their use in methods and pharmaceutical compositions for inhibiting the expression of the PDK1 gene. The invention also relates to the use of said siRNAs molecules in the treatment and/or prevention of an eye condition characterised by increased expression and/or activity of PDK1 gene, preferably said eye condition is conjunctivitis and/or an ocular allergy such as seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, and giant papillary conjunctivitis.1. An siRNA molecule wherein said molecule specifically targets at least one sequence selected from the group consisting of SEQ ID NO. 1-SEQ ID NO. 687, for use as a medicament. 2. An siRNA molecule according to claim 1, for use in the treatment and/or prevention of an eye condition characterised by increased expression and/or activity of PDK1. 3. An siRNA molecule according to claim 2, wherein said eye condition is an ocular allergy and/or conjunctivitis. 4. An siRNA molecule according to claim 2 or 3, wherein said eye condition is selected from seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, dry eye syndrome and combinations thereof. 5. An siRNA molecule according to any preceding claim wherein said siRNA comprises a 19 nucleotide double-stranded region. 6. An siRNA molecule according to claim 5 wherein said siRNA is blunt-ended. 7. An siRNA molecule according to any preceding claim wherein said siRNA comprises or consists of at least one sequence selected from the group consisting of SEQ ID NO. 688-SEQ ID NO. 1374. 8. An siRNA molecule wherein said molecule specifically targets at least one sequence selected from the group consisting of SEQ ID NO. 1-SEQ ID NO. 687 and reduces expression of PDK1 gene when introduced in a cell and wherein said siRNA comprises a 19 nucleotide blunt-ended double-stranded structure. 9. An siRNA molecule according to any preceding claim, wherein at least one nucleotide comprises a chemical modification. 10. An siRNA molecule according to claim 9, wherein said chemical modification of a nucleotide is selected from: 2′-OMethylation and substitution of uracyl ribose nucleotides with deoxythymidine nucleotides and combinations thereof. 11. An siRNA molecule according to claim 9 or 10 wherein said chemical modification is on the sense strand, the antisense strand or on both. 12. Use of an siRNA molecule according to any preceding claim in the manufacture of a medicament for the treatment of an eye condition characterised by increased expression and/or activity of PDK1. 13. Use according to claim 12 wherein said eye condition is an ocular allergy and/or conjunctivitis. 14. Use according to claim 12 or 13 wherein said eye condition is selected from seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, giant papillary conjunctivitis, dry eye syndrome and combinations thereof. 15. A pharmaceutical composition wherein said composition comprises at least an siRNA molecule described in claims 1 to 11.

Disclosed herein are compositions and methods for reducing expression of C9ORF72 mRNA and protein in an animal. Such methods are useful to treat, prevent, ameliorate, or slow progression of neurodegenerative diseases in an individual in need thereof.

1. A compound consisting of a modified oligonucleotide according to the following formula, or a salt thereof: 2. A method comprising administering to an animal the compound of claim 1. 3. The method of claim 2, wherein the animal is a human. 4. The method of claim 3, wherein the administering inhibits C9ORF72. 5. The method of claim 3, wherein the administering prevents, treats, ameliorates, or slows progression of a C9ORF72 associated disease. 6. The method of claim 5, wherein the C9ORF72 associated disease is caused by a hexanucleotide repeat expansion. 7. The method of claim 5, wherein the C9ORF72 associated disease is any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, or olivopontocerebellar degeneration (OPCD). 8. The method of claim 3, wherein the administering reduces nuclear foci. 9. The method of claim 3, wherein the administering reduces expression of C9ORF72 associated RAN translation products. 10. The method of claim 9, wherein the C9ORF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine). 11. A composition consisting of the sodium salt of a modified oligonucleotide according to the following formula: 12. A method comprising administering to an animal the composition of claim 10. 13. The method of claim 12, wherein the animal is a human. 14. The method of claim 13, wherein the administering inhibits C9ORF72. 15. The method of claim 12, wherein the administering prevents, treats, ameliorates, or slows progression of a C9ORF72 associated disease. 16. The method of claim 15, wherein the C9ORF72 associated disease is caused by a hexanucleotide repeat expansion. 17. The method of claim 15, wherein the C9ORF72 associated disease is any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, or olivopontocerebellar degeneration (OPCD). 18. The method of claim 13, wherein the administering reduces nuclear foci. 19. The method of claim 13, wherein the administering reduces expression of C9ORF72 associated RAN translation products. 20. The method of claim 19, wherein the C9ORF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine).

Disclosed herein are compositions and methods for reducing expression of C9ORF72 mRNA and protein in an animal. Such methods are useful to treat, prevent, ameliorate, or slow progression of neurodegenerative diseases in an individual in need thereof.1. A compound consisting of a modified oligonucleotide according to the following formula, or a salt thereof: 2. A method comprising administering to an animal the compound of claim 1. 3. The method of claim 2, wherein the animal is a human. 4. The method of claim 3, wherein the administering inhibits C9ORF72. 5. The method of claim 3, wherein the administering prevents, treats, ameliorates, or slows progression of a C9ORF72 associated disease. 6. The method of claim 5, wherein the C9ORF72 associated disease is caused by a hexanucleotide repeat expansion. 7. The method of claim 5, wherein the C9ORF72 associated disease is any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, or olivopontocerebellar degeneration (OPCD). 8. The method of claim 3, wherein the administering reduces nuclear foci. 9. The method of claim 3, wherein the administering reduces expression of C9ORF72 associated RAN translation products. 10. The method of claim 9, wherein the C9ORF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine). 11. A composition consisting of the sodium salt of a modified oligonucleotide according to the following formula: 12. A method comprising administering to an animal the composition of claim 10. 13. The method of claim 12, wherein the animal is a human. 14. The method of claim 13, wherein the administering inhibits C9ORF72. 15. The method of claim 12, wherein the administering prevents, treats, ameliorates, or slows progression of a C9ORF72 associated disease. 16. The method of claim 15, wherein the C9ORF72 associated disease is caused by a hexanucleotide repeat expansion. 17. The method of claim 15, wherein the C9ORF72 associated disease is any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, or olivopontocerebellar degeneration (OPCD). 18. The method of claim 13, wherein the administering reduces nuclear foci. 19. The method of claim 13, wherein the administering reduces expression of C9ORF72 associated RAN translation products. 20. The method of claim 19, wherein the C9ORF72 associated RAN translation products are any of poly-(glycine-proline), poly-(glycine-alanine), and poly-(glycine-arginine).

The present invention provides pharmaceutical formulations for oral administration of antisense oligonucleotides, such as antisense oligonucleotides against SMAD7. The pharmaceutical formulations can be used to treat Crohn's disease, ulcera-five colitis and chronic inflammatory bowel disease.

1-23. (canceled) 24. A method for confirming topical delivery of an oligonucleotide of SEQ ID NO:1, or a pharmaceutically acceptable salt thereof, to a gastrointestinal tract of a human, wherein the method comprises, orally administering an oral dosage form comprising the oligonucleotide, or a pharmaceutically acceptable salt thereof, and an enteric coating to the human, and measuring plasma concentration of the oligonucleotide, or a pharmaceutically acceptable salt thereof, in the human; wherein minimal or absent plasma concentration of the oligonucleotide, or a pharmaceutically acceptable salt thereof, confirms topical delivery of the oligonucleotide, or a pharmaceutically acceptable salt thereof, to the gastrointestinal tract of the human. 25. The method of claim 24, wherein the plasma concentration is measured using a hybridization assay specific for the oligonucleotide. 26. The method of claim 24, wherein all internucleoside linkages in the oligonucleotide are O,O-linked phosphorothioates. 27. The method of claim 24, wherein the enteric coating comprises cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymer, cellulose acetate succinate, hydroxypropylmethyl cellulose phthalate, methyl methacrylate-methacrylic acid copolymer, ethylacrylate-methacrylic acid copolymer, methacrylic acid copolymer type C, polyvinyl acetate phthalate or cellulose acetate phthalate. 28. The method of claim 27, wherein the enteric coating comprises ethylacrylate-methacrylic acid copolymer. 29. The method of claim 24, wherein the oral dosage form comprises about 5% to about 20% by weight of the enteric coating. 30. The method of claim 24, wherein the oral dosage form comprises about 8% to about 18% by weight of the enteric coating. 31. The method of claim 24, wherein the oral dosage form comprises about 8% to about 15% by weight of the enteric coating. 32. The method of claim 24, wherein the oral dosage form comprises about 10% to about 12% by weight of the enteric coating. 33. The method of claim 24, wherein the oral dosage form comprises about 12% to about 16% by weight of the enteric coating. 34. The method of claim 24, wherein the oral dosage form comprises about 10%, about 12%, about 13%, about 15%, about 16%, or about 17% by weight of the enteric coating. 35. The method of claim 24, wherein the oral dosage form comprises about 10% by weight of the enteric coating. 36. The method of claim 24, wherein the oral dosage form comprises about 12% by weight of the enteric coating. 37. The method of claim 24, wherein the human is a chronic inflammatory bowel disease patient. 38. The method of claim 24, wherein the human is a Crohn's disease patient. 39. The method of claim 24, wherein the human is an ulcerative colitis patient. 40. The method of claim 24 wherein upon orally administering the oral dosage form said oral dosage form is substantially delivered to the terminal ileum and/or right colon of the patient. 41. The method of claim 24, wherein the oral dosage form is a tablet. 42. The method of claim 24, wherein the oral dosage form comprises about 35 mg to about 500 mg of the oligonucleotide or pharmaceutically acceptable salt thereof.

The present invention provides pharmaceutical formulations for oral administration of antisense oligonucleotides, such as antisense oligonucleotides against SMAD7. The pharmaceutical formulations can be used to treat Crohn's disease, ulcera-five colitis and chronic inflammatory bowel disease.1-23. (canceled) 24. A method for confirming topical delivery of an oligonucleotide of SEQ ID NO:1, or a pharmaceutically acceptable salt thereof, to a gastrointestinal tract of a human, wherein the method comprises, orally administering an oral dosage form comprising the oligonucleotide, or a pharmaceutically acceptable salt thereof, and an enteric coating to the human, and measuring plasma concentration of the oligonucleotide, or a pharmaceutically acceptable salt thereof, in the human; wherein minimal or absent plasma concentration of the oligonucleotide, or a pharmaceutically acceptable salt thereof, confirms topical delivery of the oligonucleotide, or a pharmaceutically acceptable salt thereof, to the gastrointestinal tract of the human. 25. The method of claim 24, wherein the plasma concentration is measured using a hybridization assay specific for the oligonucleotide. 26. The method of claim 24, wherein all internucleoside linkages in the oligonucleotide are O,O-linked phosphorothioates. 27. The method of claim 24, wherein the enteric coating comprises cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymer, cellulose acetate succinate, hydroxypropylmethyl cellulose phthalate, methyl methacrylate-methacrylic acid copolymer, ethylacrylate-methacrylic acid copolymer, methacrylic acid copolymer type C, polyvinyl acetate phthalate or cellulose acetate phthalate. 28. The method of claim 27, wherein the enteric coating comprises ethylacrylate-methacrylic acid copolymer. 29. The method of claim 24, wherein the oral dosage form comprises about 5% to about 20% by weight of the enteric coating. 30. The method of claim 24, wherein the oral dosage form comprises about 8% to about 18% by weight of the enteric coating. 31. The method of claim 24, wherein the oral dosage form comprises about 8% to about 15% by weight of the enteric coating. 32. The method of claim 24, wherein the oral dosage form comprises about 10% to about 12% by weight of the enteric coating. 33. The method of claim 24, wherein the oral dosage form comprises about 12% to about 16% by weight of the enteric coating. 34. The method of claim 24, wherein the oral dosage form comprises about 10%, about 12%, about 13%, about 15%, about 16%, or about 17% by weight of the enteric coating. 35. The method of claim 24, wherein the oral dosage form comprises about 10% by weight of the enteric coating. 36. The method of claim 24, wherein the oral dosage form comprises about 12% by weight of the enteric coating. 37. The method of claim 24, wherein the human is a chronic inflammatory bowel disease patient. 38. The method of claim 24, wherein the human is a Crohn's disease patient. 39. The method of claim 24, wherein the human is an ulcerative colitis patient. 40. The method of claim 24 wherein upon orally administering the oral dosage form said oral dosage form is substantially delivered to the terminal ileum and/or right colon of the patient. 41. The method of claim 24, wherein the oral dosage form is a tablet. 42. The method of claim 24, wherein the oral dosage form comprises about 35 mg to about 500 mg of the oligonucleotide or pharmaceutically acceptable salt thereof.

The present invention provides siRNAs for inhibiting the expression of plk1 gene, and the method for inhibiting the expression of plk1 gene in mammalian cells. The siRNAs of the present invention have the double-stranded structure, and said double-stranded structure is composed of the first single strand and the second single strand that are fully complementary, wherein the sequence of said first single strand is the same as the target sequence within the sequence as shown in SEQ ID NO: 1, and the sequence of said second single strand is complementary to the target sequence within the sequence as shown in SEQ ID NO: 1. The siRNAs of the present invention can sequence specifically mediate the inhibition of plk1 gene expression, and have a good serum stability. By the introduction of the siRNAs of the present invention into the tumor cells, the expression of plk1 gene can be effectively inhibited, and the growth of tumor cells is inhibited and the apoptosis of tumor cells is promoted.

1. A siRNA with a double-stranded structure, the double-stranded structure consisting of a first single strand and a second single strand which are completely complementary, wherein, the first single strand has a nucleotide sequence represented by SEQ ID NO: 77, which is the same as a target site sequence in a plk1 mRNA sequence represented by SEQ ID NO: 1; and the second single strand complementary to the first single strand has a nucleotide sequence represented by SEQ ID NO: 209, which is complementary to the target site sequence in the plk1 mRNA sequence represented by SEQ ID NO: 1, wherein each of the first single strand and the second single strand contains at least one modified nucleotide group respectively, wherein the modified nucleotide group is a nucleotide group in which the 2′-hydroxy of the ribose group is substituted by methoxy or fluorine, wherein the siRNA is selected from the following: PLK(m)-76-1 in which the first single strand is C(OMe)GAGCU(OMe)GCUUAAUG(OMe)ACGAGdTdT (SEC) ID NO: 278); and the second single strand is CU(OMe)CGUC(F)AUUAAGCAGCUCGdTdT (SEC) ID NO: 279), wherein (OMe) means that the 2′-hydroxy of the pentose group in the nucleotide residue on its left is substituted by methoxy, while (F) means that the 2′-hydroxy of the pentose group in the nucleotide residue on its left is substituted by fluorine. 2. A pharmaceutical composition containing the siRNA according to claim 1 as a pharmaceutically active ingredient, as well as a cationic ingredient, a non-cationic ingredient and a pharmaceutically acceptable carrier. 3. The pharmaceutical composition according to claim 2, wherein the cationic ingredient is at least one selected from the group consisting of N,N-dihydroxyethyl-N-methyl-N-2-(cholesteryloxycarbonylamino) ethylammonium bromide, (2,3-dioleoyloxy)propyl-trimethylammonium chloride, N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride, polyethylenimine, poly β-amino ester and chitosan quaternary ammonium salt, and preferably is polycaprolactone-poly(N,N-dimethylaminoethylmethacrylate) block copolymer; the non-cationic ingredient is at least one selected from the group consisting of polyethylene glycol-polylactic acid diblock copolymer, polyethylene glycol-polylactic acid triblock copolymer, polyethylene glycol-poly(lactic acid-glycolic acid) diblock copolymer and polyethylene glycol-poly(lactic acid-glycolic acid) triblock copolymer, and preferably is polyethylene glycol-polyglutamic acid block copolymer in which the polyethylene glycol block is modified by folic acid (folate-PEG-PGA); and the pharmaceutically acceptable carrier is selected from the group consisting of phosphate buffer solution with a pH of 4.0-9.0, tris(hydroxymethyl) aminomethane hydrochloride buffer solution with a pH of 7.5-8.5, normal saline, or 7-15 wt % sucrose solution. 4. A method for inhibiting the expression of plk1 gene in mammalian cells, wherein the method comprises introducing the siRNA according to claim 1 into mammalian cells, thereby allowing the siRNA to sequence-specifically induce inhibition of the expression of the plk1 gene. 5. The method according to claim 4, wherein modes for the introducing include introducing the siRNA directly, or introducing the siRNA in a form of the pharmaceutical composition, wherein the pharmaceutical composition containing the siRNA as a pharmaceutically active ingredient further comprises a cationic ingredient, a non-cationic ingredient and a pharmaceutically acceptable carrier, wherein the cationic ingredient comprises at least one of N,N-dihydroxyethyl-N-methyl-N-2-(cholesteryloxycarbonylamino) ethylammonium bromide, (2,3-dioleoyloxy)propyl-trimethylammonium chloride, N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride, polyethylenimine, poly β-amino ester and chitosan quaternary ammonium salt, or polycaprolactone-poly(N,N-dimethylaminoethylmethacrylate) block copolymer, wherein the non-cationic ingredient comprises at least one of polyethylene glycol-polylactic acid diblock copolymer, polyethylene glycol-polylactic acid triblock copolymer, polyethylene glycol-poly(lactic acid-glycolic acid) diblock copolymer and polyethylene glycol-poly(lactic acid-glycolic acid) triblock copolymer, or polyethylene glycol-polyglutamic acid block copolymer in which the polyethylene glycol block is modified by folic acid (folate-PEG-PGA), and wherein the pharmaceutically acceptable carrier comprises at least one of phosphate buffer solution with a pH of 4.0-9.0, tris(hydroxymethyl) aminomethane hydrochloride buffer solution with a pH of 7.5-8.5, normal saline, or 7-15 wt % sucrose solution. 6. A method for treating tumor, comprising administering a pharmaceutical composition according to claim 2 to a subject in need thereof. 7. The method according to claim 6, wherein the tumor is breast cancer, liver cancer, lung cancer, cervical cancer or colon cancer with abnormally high expression of plk1 gene. 8. A method for treating tumor, comprising administering an siRNA according to claim 1 to a subject in need thereof. 9. The method according to claim 8, wherein the tumor is breast cancer, liver cancer, lung cancer, cervical cancer or colon cancer with abnormally high expression of plk1 gene.

The present invention provides siRNAs for inhibiting the expression of plk1 gene, and the method for inhibiting the expression of plk1 gene in mammalian cells. The siRNAs of the present invention have the double-stranded structure, and said double-stranded structure is composed of the first single strand and the second single strand that are fully complementary, wherein the sequence of said first single strand is the same as the target sequence within the sequence as shown in SEQ ID NO: 1, and the sequence of said second single strand is complementary to the target sequence within the sequence as shown in SEQ ID NO: 1. The siRNAs of the present invention can sequence specifically mediate the inhibition of plk1 gene expression, and have a good serum stability. By the introduction of the siRNAs of the present invention into the tumor cells, the expression of plk1 gene can be effectively inhibited, and the growth of tumor cells is inhibited and the apoptosis of tumor cells is promoted.1. A siRNA with a double-stranded structure, the double-stranded structure consisting of a first single strand and a second single strand which are completely complementary, wherein, the first single strand has a nucleotide sequence represented by SEQ ID NO: 77, which is the same as a target site sequence in a plk1 mRNA sequence represented by SEQ ID NO: 1; and the second single strand complementary to the first single strand has a nucleotide sequence represented by SEQ ID NO: 209, which is complementary to the target site sequence in the plk1 mRNA sequence represented by SEQ ID NO: 1, wherein each of the first single strand and the second single strand contains at least one modified nucleotide group respectively, wherein the modified nucleotide group is a nucleotide group in which the 2′-hydroxy of the ribose group is substituted by methoxy or fluorine, wherein the siRNA is selected from the following: PLK(m)-76-1 in which the first single strand is C(OMe)GAGCU(OMe)GCUUAAUG(OMe)ACGAGdTdT (SEC) ID NO: 278); and the second single strand is CU(OMe)CGUC(F)AUUAAGCAGCUCGdTdT (SEC) ID NO: 279), wherein (OMe) means that the 2′-hydroxy of the pentose group in the nucleotide residue on its left is substituted by methoxy, while (F) means that the 2′-hydroxy of the pentose group in the nucleotide residue on its left is substituted by fluorine. 2. A pharmaceutical composition containing the siRNA according to claim 1 as a pharmaceutically active ingredient, as well as a cationic ingredient, a non-cationic ingredient and a pharmaceutically acceptable carrier. 3. The pharmaceutical composition according to claim 2, wherein the cationic ingredient is at least one selected from the group consisting of N,N-dihydroxyethyl-N-methyl-N-2-(cholesteryloxycarbonylamino) ethylammonium bromide, (2,3-dioleoyloxy)propyl-trimethylammonium chloride, N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride, polyethylenimine, poly β-amino ester and chitosan quaternary ammonium salt, and preferably is polycaprolactone-poly(N,N-dimethylaminoethylmethacrylate) block copolymer; the non-cationic ingredient is at least one selected from the group consisting of polyethylene glycol-polylactic acid diblock copolymer, polyethylene glycol-polylactic acid triblock copolymer, polyethylene glycol-poly(lactic acid-glycolic acid) diblock copolymer and polyethylene glycol-poly(lactic acid-glycolic acid) triblock copolymer, and preferably is polyethylene glycol-polyglutamic acid block copolymer in which the polyethylene glycol block is modified by folic acid (folate-PEG-PGA); and the pharmaceutically acceptable carrier is selected from the group consisting of phosphate buffer solution with a pH of 4.0-9.0, tris(hydroxymethyl) aminomethane hydrochloride buffer solution with a pH of 7.5-8.5, normal saline, or 7-15 wt % sucrose solution. 4. A method for inhibiting the expression of plk1 gene in mammalian cells, wherein the method comprises introducing the siRNA according to claim 1 into mammalian cells, thereby allowing the siRNA to sequence-specifically induce inhibition of the expression of the plk1 gene. 5. The method according to claim 4, wherein modes for the introducing include introducing the siRNA directly, or introducing the siRNA in a form of the pharmaceutical composition, wherein the pharmaceutical composition containing the siRNA as a pharmaceutically active ingredient further comprises a cationic ingredient, a non-cationic ingredient and a pharmaceutically acceptable carrier, wherein the cationic ingredient comprises at least one of N,N-dihydroxyethyl-N-methyl-N-2-(cholesteryloxycarbonylamino) ethylammonium bromide, (2,3-dioleoyloxy)propyl-trimethylammonium chloride, N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride, polyethylenimine, poly β-amino ester and chitosan quaternary ammonium salt, or polycaprolactone-poly(N,N-dimethylaminoethylmethacrylate) block copolymer, wherein the non-cationic ingredient comprises at least one of polyethylene glycol-polylactic acid diblock copolymer, polyethylene glycol-polylactic acid triblock copolymer, polyethylene glycol-poly(lactic acid-glycolic acid) diblock copolymer and polyethylene glycol-poly(lactic acid-glycolic acid) triblock copolymer, or polyethylene glycol-polyglutamic acid block copolymer in which the polyethylene glycol block is modified by folic acid (folate-PEG-PGA), and wherein the pharmaceutically acceptable carrier comprises at least one of phosphate buffer solution with a pH of 4.0-9.0, tris(hydroxymethyl) aminomethane hydrochloride buffer solution with a pH of 7.5-8.5, normal saline, or 7-15 wt % sucrose solution. 6. A method for treating tumor, comprising administering a pharmaceutical composition according to claim 2 to a subject in need thereof. 7. The method according to claim 6, wherein the tumor is breast cancer, liver cancer, lung cancer, cervical cancer or colon cancer with abnormally high expression of plk1 gene. 8. A method for treating tumor, comprising administering an siRNA according to claim 1 to a subject in need thereof. 9. The method according to claim 8, wherein the tumor is breast cancer, liver cancer, lung cancer, cervical cancer or colon cancer with abnormally high expression of plk1 gene.

The present invention relates to RNAi constructs with improved tissue and cellular uptake characteristics and methods of use of these compounds in dermal and fibrotic applications.

1.-33. (canceled) 34. A method for treating or preventing a fibrotic disorder, the method comprising administering to a subject in need thereof a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of 35. The method of claim 34, wherein the dsRNA is administered via intradermal injection. 36. The method of claim 34, wherein the dsRNA is administered locally to the skin. 37. The method of claim 34, wherein two or more dsRNAs are administered simultaneously or sequentially. 38. The method of claim 34, wherein the dsRNA is hydrophobically modified. 39. The method of claim 34, wherein the dsRNA is linked to a hydrophobic conjugate. 40.-44. (canceled) 45. The method of claim 34, wherein the sense strand comprises 46. The method of claim 45, wherein the sense strand comprises 47. The method of claim 34, wherein the sense strand comprises 48. The method of claim 47, wherein the sense strand comprises 49.-50. (canceled) 51. The method of claim 34, wherein the sense strand comprises 52. The method of claim 51, wherein the sense strand comprises 53.-54. (canceled) 55. The method of claim 34, wherein the fibrotic disorder is selected from the group consisting of pulmonary fibrosis, liver cirrhosis, scleroderma and glomerulonephritis, lung fibrosis, liver fibrosis, skin fibrosis, muscle fibrosis, radiation fibrosis, kidney fibrosis, proliferative vitreoretinopathy, restenosis and uterine fibrosis, and trabeculectomy failure due to scarring. 56. The method of claim 34 wherein the dsRNA is formulated for delivery to the skin, for topical delivery, for intradermal injection and/or wherein the dsRNA is in a neutral formulation. 57. A method for treating or preventing a fibrotic disorder, the method comprising administering to a subject in need thereof a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs: 2459 (GUGACCAAAAGUA) or 3493 (G.mU. G. A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl) and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of SEQ ID NOs: 2460 (UACUUUUGGUCACACUCUC) or 3494 (P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC. A.mC* A*mC*mU*mC*mU* C.), wherein the dsRNA is an sd-rxRNA, wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double-stranded region and a single-stranded region, wherein the double-stranded region is from 8-15 nucleotides long, wherein the single-stranded region is at the 3′ end of the antisense strand and is 4-12 nucleotides long, wherein the single-stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double-stranded nucleic acid molecule are modified. 58. The method of claim 57, wherein the sense strand comprises SEQ ID NO:2459 (GUGACCAAAAGUA) and the antisense strand comprises SEQ ID NO:2460 (UACUUUUGGUCACACUCUC), or the sense strand comprises SEQ ID NO:3493 (G.mU. G. A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl) and the antisense strand comprises SEQ ID NO:3494 (P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC. A.mC* A*mC*mU*mC*mU* C.). 59. The method of claim 56, wherein the dsRNA is administered via intradermal injection. 60. The method of claim 56, wherein the dsRNA is administered locally to the skin. 61. The method of claim 56, wherein dsRNA is hydrophobically modified. 62. The method of claim 56, wherein the dsRNA is linked to a hydrophobic conjugate.

The present invention relates to RNAi constructs with improved tissue and cellular uptake characteristics and methods of use of these compounds in dermal and fibrotic applications.1.-33. (canceled) 34. A method for treating or preventing a fibrotic disorder, the method comprising administering to a subject in need thereof a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of 35. The method of claim 34, wherein the dsRNA is administered via intradermal injection. 36. The method of claim 34, wherein the dsRNA is administered locally to the skin. 37. The method of claim 34, wherein two or more dsRNAs are administered simultaneously or sequentially. 38. The method of claim 34, wherein the dsRNA is hydrophobically modified. 39. The method of claim 34, wherein the dsRNA is linked to a hydrophobic conjugate. 40.-44. (canceled) 45. The method of claim 34, wherein the sense strand comprises 46. The method of claim 45, wherein the sense strand comprises 47. The method of claim 34, wherein the sense strand comprises 48. The method of claim 47, wherein the sense strand comprises 49.-50. (canceled) 51. The method of claim 34, wherein the sense strand comprises 52. The method of claim 51, wherein the sense strand comprises 53.-54. (canceled) 55. The method of claim 34, wherein the fibrotic disorder is selected from the group consisting of pulmonary fibrosis, liver cirrhosis, scleroderma and glomerulonephritis, lung fibrosis, liver fibrosis, skin fibrosis, muscle fibrosis, radiation fibrosis, kidney fibrosis, proliferative vitreoretinopathy, restenosis and uterine fibrosis, and trabeculectomy failure due to scarring. 56. The method of claim 34 wherein the dsRNA is formulated for delivery to the skin, for topical delivery, for intradermal injection and/or wherein the dsRNA is in a neutral formulation. 57. A method for treating or preventing a fibrotic disorder, the method comprising administering to a subject in need thereof a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs: 2459 (GUGACCAAAAGUA) or 3493 (G.mU. G. A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl) and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of SEQ ID NOs: 2460 (UACUUUUGGUCACACUCUC) or 3494 (P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC. A.mC* A*mC*mU*mC*mU* C.), wherein the dsRNA is an sd-rxRNA, wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double-stranded region and a single-stranded region, wherein the double-stranded region is from 8-15 nucleotides long, wherein the single-stranded region is at the 3′ end of the antisense strand and is 4-12 nucleotides long, wherein the single-stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double-stranded nucleic acid molecule are modified. 58. The method of claim 57, wherein the sense strand comprises SEQ ID NO:2459 (GUGACCAAAAGUA) and the antisense strand comprises SEQ ID NO:2460 (UACUUUUGGUCACACUCUC), or the sense strand comprises SEQ ID NO:3493 (G.mU. G. A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl) and the antisense strand comprises SEQ ID NO:3494 (P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC. A.mC* A*mC*mU*mC*mU* C.). 59. The method of claim 56, wherein the dsRNA is administered via intradermal injection. 60. The method of claim 56, wherein the dsRNA is administered locally to the skin. 61. The method of claim 56, wherein dsRNA is hydrophobically modified. 62. The method of claim 56, wherein the dsRNA is linked to a hydrophobic conjugate.

The invention relates to oligonucleotides for inducing skipping of exon 51 of the dystrophin gene. The invention also relates to methods of inducing exon 51 skipping using the oligonucleotides.

1. An isolated antisense oligonucleotide 16 to 50 nucleotides in length, wherein a part of said oligonucleotide is complementary to a strand of a double-stranded closed structure of the dystrophin exon 51 pre-mRNA and another part of said oligonucleotide is complementary to a single stranded open structure of the dystrophin exon 51 pre-mRNA, wherein said exon 51 pre-mRNA assumes a secondary structure within said exon comprising said open and closed structures, wherein said single stranded open structure is contiguous with said strand of said closed structure, wherein said oligonucleotide is capable of inducing exon 51 skipping, said oligonucleotide comprising a modification. 2. The oligonucleotide of claim 1, wherein said single stranded open structure is contiguous with both strands of said double-stranded closed structure. 3. The oligonucleotide of claim 1, wherein said oligonucleotide is fully complementary to said open and closed structures. 4. The oligonucleotide of claim 1, wherein said open and closed structures comprise a consecutive part of between 16 and 50 nucleotides of said exon and said oligonucleotide is complementary to said consecutive part. 5. The oligonucleotide of claim 4, wherein oligonucleotide is fully complementary to said consecutive part. 6. The oligonucleotide of claim 1, wherein said modification is selected from the group consisting of: 2′-O-methyl, 2′-O-methyl-phosphorothioate, a morpholine ring, a phosphorodiamidate linkage, a modification to increase resistance to RNAseH, a peptide nucleic acid and a locked nucleic acid. 7. The oligonucleotide of claim 1, wherein said oligonucleotide is a 2′-O-methyl oligonucleotide. 8. The oligonucleotide of claim 7, wherein said oligonucleotide is a 2′-O-methyl phosphorothioate oligonucleotide. 9. The oligonucleotide of claim 1, wherein said oligonucleotide is morpholino oligonucleotide. 10. The oligonucleotide of claim 9, wherein said oligonucleotide is a morpholino phosphorodiamidate oligonucleotide. 11. The oligonucleotide of claim 1, wherein oligonucleotide is capable of inducing exon 51 skipping in a human myotube in culture. 12. The oligonucleotide of claim 11, wherein said human myotube is from a Duchenne Muscular Dystrophy (DMD) patient. 13. The oligonucleotide of claim 12, wherein said oligonucleotide is capable of inducing exon 51 skipping of the human dystrophin pre-mRNA upon transfection of said oligonucleotide into human myotubes in culture so as to induce dystrophin expression. 14. The oligonucleotide of claim 13, wherein said transfection comprises introducing at least 100nM of said oligonucleotide into human myotubes so as to induce dystrophin expression. 15. The oligonucleotide of claim 14, wherein said exon 51 skipping is detected by RT-PCR and/or sequence analysis. 16. The oligonucleotide of claim 14, wherein said dystrophin expression is detected at least 16 hours after transfection by immunohistochemical and/or western blot analysis. 17. The oligonucleotide of claim 1, wherein said oligonucleotide is an RNA oligonucleotide. 18. The oligonucleotide of claim 1, said oligonucleotide comprising 20 to 50 nucleotides in length. 19. The oligonucleotide of claim 1, comprising less than 50 nucleotides in length. 20. The oligonucleotide of claim 1, wherein said oligonucleotide comprises a greater number of purine residues than pyrimidine residues. 21. The oligonucleotide of claim 1 wherein said oligonucleotide does not bind to a splice donor and/or a splice acceptor sequence of said exon. 22. A pharmaceutical composition comprising the oligonucleotide of claim 1 and a pharmaceutically acceptable carrier.

The invention relates to oligonucleotides for inducing skipping of exon 51 of the dystrophin gene. The invention also relates to methods of inducing exon 51 skipping using the oligonucleotides.1. An isolated antisense oligonucleotide 16 to 50 nucleotides in length, wherein a part of said oligonucleotide is complementary to a strand of a double-stranded closed structure of the dystrophin exon 51 pre-mRNA and another part of said oligonucleotide is complementary to a single stranded open structure of the dystrophin exon 51 pre-mRNA, wherein said exon 51 pre-mRNA assumes a secondary structure within said exon comprising said open and closed structures, wherein said single stranded open structure is contiguous with said strand of said closed structure, wherein said oligonucleotide is capable of inducing exon 51 skipping, said oligonucleotide comprising a modification. 2. The oligonucleotide of claim 1, wherein said single stranded open structure is contiguous with both strands of said double-stranded closed structure. 3. The oligonucleotide of claim 1, wherein said oligonucleotide is fully complementary to said open and closed structures. 4. The oligonucleotide of claim 1, wherein said open and closed structures comprise a consecutive part of between 16 and 50 nucleotides of said exon and said oligonucleotide is complementary to said consecutive part. 5. The oligonucleotide of claim 4, wherein oligonucleotide is fully complementary to said consecutive part. 6. The oligonucleotide of claim 1, wherein said modification is selected from the group consisting of: 2′-O-methyl, 2′-O-methyl-phosphorothioate, a morpholine ring, a phosphorodiamidate linkage, a modification to increase resistance to RNAseH, a peptide nucleic acid and a locked nucleic acid. 7. The oligonucleotide of claim 1, wherein said oligonucleotide is a 2′-O-methyl oligonucleotide. 8. The oligonucleotide of claim 7, wherein said oligonucleotide is a 2′-O-methyl phosphorothioate oligonucleotide. 9. The oligonucleotide of claim 1, wherein said oligonucleotide is morpholino oligonucleotide. 10. The oligonucleotide of claim 9, wherein said oligonucleotide is a morpholino phosphorodiamidate oligonucleotide. 11. The oligonucleotide of claim 1, wherein oligonucleotide is capable of inducing exon 51 skipping in a human myotube in culture. 12. The oligonucleotide of claim 11, wherein said human myotube is from a Duchenne Muscular Dystrophy (DMD) patient. 13. The oligonucleotide of claim 12, wherein said oligonucleotide is capable of inducing exon 51 skipping of the human dystrophin pre-mRNA upon transfection of said oligonucleotide into human myotubes in culture so as to induce dystrophin expression. 14. The oligonucleotide of claim 13, wherein said transfection comprises introducing at least 100nM of said oligonucleotide into human myotubes so as to induce dystrophin expression. 15. The oligonucleotide of claim 14, wherein said exon 51 skipping is detected by RT-PCR and/or sequence analysis. 16. The oligonucleotide of claim 14, wherein said dystrophin expression is detected at least 16 hours after transfection by immunohistochemical and/or western blot analysis. 17. The oligonucleotide of claim 1, wherein said oligonucleotide is an RNA oligonucleotide. 18. The oligonucleotide of claim 1, said oligonucleotide comprising 20 to 50 nucleotides in length. 19. The oligonucleotide of claim 1, comprising less than 50 nucleotides in length. 20. The oligonucleotide of claim 1, wherein said oligonucleotide comprises a greater number of purine residues than pyrimidine residues. 21. The oligonucleotide of claim 1 wherein said oligonucleotide does not bind to a splice donor and/or a splice acceptor sequence of said exon. 22. A pharmaceutical composition comprising the oligonucleotide of claim 1 and a pharmaceutically acceptable carrier.

A method for reconstructing a replication-selective oncolytic adenovirus using a subgroup B recombinant human adenovirus vector Ad11-5EP. The method includes: 1) deleting E1A CR2 gene and/or anti-apoptotic gene E1B 21K that is necessary for viability of an adenovirus in normal cells but not necessary in tumor cells; 2) inserting a tumor-specific promoter to drive the expression of E1A gene; 3) re-directing a cellular tropism of Ad11-5EP according to receptors on a tumor cell surface; or 4) allowing adenovirus to selectively replicate in tumor cells.

1. A method for reconstructing a replication-selective oncolytic adenovirus using a subgroup B recombinant human adenovirus vector Ad11-5EP (SEQ ID NO: 1), the method comprising one of the following steps: 1) deleting E1A CR2 (SEQ ID NO: 8) gene and/or anti-apoptotic gene E1B 21K (SEQ ID NO: 9) that is necessary for viability of an adenovirus in normal cells but not necessary in tumor cells; 2) inserting a tumor-specific promoter to drive the expression of E1A gene; 3) re-directing a cellular tropism of Ad11-5EP (SEQ ID NO: 1) according to receptors on a tumor cell surface; or 4) allowing adenovirus to selectively replicate in tumor cells. 2. A method for constructing a subgroup B recombinant human adenovirus vector Ad11-5ETel-GFP (SEQ ID NO: 10), the method comprising: 1) constructing vectors pSS-ChI (SEQ ID NO: 12) and pSS-kna (SEQ ID NO: 13) by using two different antibiotics-resistance cassettes, introducing SwaI restriction sites to two flanks of a chloramphenicol-resistance gene sequence cassette, and introducing sbfI restriction sites to two flanks of a kanamycin-resistance gene sequence cassette; 2) cloning an initiation sequence for replication of pBR322 (SEQ ID NO: 14) by pUC18 (SEQ ID NO: 15), ligating a first synthetic nucleotide sequence comprising multi-cloning sites to the chloramphenicol-resistance gene sequence cassette to yield pSS-ChI (SEQ ID NO: 12), homologously recombining an upstream of a left arm sequence and a downstream of a right arm sequence of the chloramphenicol-resistance gene sequence cassette, and inserting the upstream of the left arm sequence of the chloramphenicol-resistance gene sequence cassette and the downstream of the right arm sequence of the chloramphenicol-resistance gene sequence cassette into the multi-cloning sites on two sides of pSS-ChI (SEQ ID NO: 12) by blunt end insertion or cohesive end insertion, respectively, to construct a shuttle vector pSSENTel (SEQ ID NO: 16) for recombination; 3) cloning an initiation sequence for replication of pBR322 (SEQ ID NO: 14) by pUC18 (SEQ ID NO: 15), ligating a second synthetic nucleotide sequence comprising multi-cloning sites to the kanamycin-resistance gene sequence cassette to yield pSS-kna (SEQ ID NO: 13), homologously recombining an upstream of a left arm sequence and a downstream of a right arm sequence of the kanamycin-resistance gene sequence cassette, and inserting the upstream of the left arm sequence of the kanamycin-resistance gene sequence cassette and the downstream of the right arm sequence of the kanamycin-resistance gene sequence cassette into the multi-cloning sites on two sides of pSS-kna (SEQ ID NO: 13) by blunt end insertion or cohesive end insertion, respectively, to construct a shuttle vector pSSGFP (SEQ ID NO: 17) for recombination; 4) constructing pSSENTel (SEQ ID NO: 16), comprising: amplifying a 329 bp in the front of Ad11 (SEQ ID NO: 3) genome as a left arm sequence, providing a fragment formed by ligating 195-378 bp of Ad5 E1A (SEQ ID NO: 2) enhancer, −714-0 bp of human TERT promoter, and 568-1125 bp of Ad11 E1A (SEQ ID NO: 4) in order as a right arm sequence, introducing two restriction enzyme sites XbaI and NcoI to two sides of the human TERT promoter, and inserting the left arm sequence and the right arm sequence into Snabl and EcoRV arranged on two sides of pSS-ChI (SEQ ID NO: 12), respectively, by blunt end insertion, to yield pSSENTel (SEQ ID NO: 16); 5) constructing pSSGFP (SEQ ID NO: 17), comprising: providing a left arm being a product by ligating 27301-27837 bp of DNA segment of Ad11 (SEQ ID NO: 3) genome with EGFP gene via NcoI, and introducing a SnaBI site to 3′ terminal of EGFP; providing a right arm being 28337-28920 bp of DNA segment of Ad11 (SEQ ID NO: 3) genome; and inserting the left arm and the right arm into Snabl and EcoRV sites arranged on two sides of pSS-kna (SEQ ID NO: 13) by blunt end insertion, to yield pSSGFP (SEQ ID NO: 17); and 6) digesting and purifying the pSSENTel (SEQ ID NO: 16) and pSSGFP (SEQ ID NO: 17) by PmeI, to yield two PmeI digested segments, performing homogenous recombination synchronously between the two PmeI digested segments and pAd11 (SEQ ID NO: 6) plasmid, respectively, in BJ5183 cells; screening positive clones using agar plates comprising ampicillin, kanamycin, and chloramphenicol; digesting the positive clones by SwaI and SbfI, and deleting chloramphenicol-resistance gene expression cassette and kanamycin-resistance gene expression cassette to yield pAd11-5ETel-GFP (SEQ ID NO: 11); and digesting and linearizing the pAd11-5ETel-GFP (SEQ ID NO: 11) by NotI, and transfecting 293 cells to produce adenovirs vector Ad11-5ETel-GFP (SEQ ID NO: 10). 3. The method of claim 2, wherein concentrations of the ampicillin, kanamycin, and chloramphenicol are 100 mg/mL, 50 ug/mL, and 25 mg/mL, respectively. 4. The method of claim 2, wherein Tel sequence of pSSENTel (SEQ ID NO: 16) is substitutable by promoters of other tumor specific genes to yield a tumor-specific oncolytic adenovirus; and GFP sequence of pSSGFP (SEQ ID NO: 17) is substitutable by a signal gene or therapeutic gene. 5. The method of claim 2, wherein Ad11 18.5 K gene promoter of pSSGFP (SEQ ID NO: 17) is substitutable by a tumor-specific promoter. 6. A method for treatment of tumor, the method comprising applying a subgroup B recombinant human adenovirus vector Ad11-5EP (SEQ ID NO: 1). 7. A method for treatment of tumor or detection of tumor cells in circulating blood, the method comprising applying a subgroup B adenovirus vector Ad11-5ETel-GFP (SEQ ID NO: 10) constructed according to a method of claim 2. 8. A subgroup B recombinant human adenovirus vector Ad11-5EP (SEQ ID NO: 1), wherein the subgroup B recombinant human adenovirus vector Ad11-5EP (SEQ ID NO: 1) is constructed by a method comprising substituting a 365 bp fragment comprising an enhancer and a promoter of an upstream coding sequence of Ad5 E1A (SEQ ID NO: 2) for a corresponding region of a serotype Ad11 (SEQ ID NO: 3) of the subgroup B human adenovirus vector by homologous recombination to construct the subgroup B recombinant human adenovirus vector Ad11-5EP (SEQ ID NO: 1).

A method for reconstructing a replication-selective oncolytic adenovirus using a subgroup B recombinant human adenovirus vector Ad11-5EP. The method includes: 1) deleting E1A CR2 gene and/or anti-apoptotic gene E1B 21K that is necessary for viability of an adenovirus in normal cells but not necessary in tumor cells; 2) inserting a tumor-specific promoter to drive the expression of E1A gene; 3) re-directing a cellular tropism of Ad11-5EP according to receptors on a tumor cell surface; or 4) allowing adenovirus to selectively replicate in tumor cells.1. A method for reconstructing a replication-selective oncolytic adenovirus using a subgroup B recombinant human adenovirus vector Ad11-5EP (SEQ ID NO: 1), the method comprising one of the following steps: 1) deleting E1A CR2 (SEQ ID NO: 8) gene and/or anti-apoptotic gene E1B 21K (SEQ ID NO: 9) that is necessary for viability of an adenovirus in normal cells but not necessary in tumor cells; 2) inserting a tumor-specific promoter to drive the expression of E1A gene; 3) re-directing a cellular tropism of Ad11-5EP (SEQ ID NO: 1) according to receptors on a tumor cell surface; or 4) allowing adenovirus to selectively replicate in tumor cells. 2. A method for constructing a subgroup B recombinant human adenovirus vector Ad11-5ETel-GFP (SEQ ID NO: 10), the method comprising: 1) constructing vectors pSS-ChI (SEQ ID NO: 12) and pSS-kna (SEQ ID NO: 13) by using two different antibiotics-resistance cassettes, introducing SwaI restriction sites to two flanks of a chloramphenicol-resistance gene sequence cassette, and introducing sbfI restriction sites to two flanks of a kanamycin-resistance gene sequence cassette; 2) cloning an initiation sequence for replication of pBR322 (SEQ ID NO: 14) by pUC18 (SEQ ID NO: 15), ligating a first synthetic nucleotide sequence comprising multi-cloning sites to the chloramphenicol-resistance gene sequence cassette to yield pSS-ChI (SEQ ID NO: 12), homologously recombining an upstream of a left arm sequence and a downstream of a right arm sequence of the chloramphenicol-resistance gene sequence cassette, and inserting the upstream of the left arm sequence of the chloramphenicol-resistance gene sequence cassette and the downstream of the right arm sequence of the chloramphenicol-resistance gene sequence cassette into the multi-cloning sites on two sides of pSS-ChI (SEQ ID NO: 12) by blunt end insertion or cohesive end insertion, respectively, to construct a shuttle vector pSSENTel (SEQ ID NO: 16) for recombination; 3) cloning an initiation sequence for replication of pBR322 (SEQ ID NO: 14) by pUC18 (SEQ ID NO: 15), ligating a second synthetic nucleotide sequence comprising multi-cloning sites to the kanamycin-resistance gene sequence cassette to yield pSS-kna (SEQ ID NO: 13), homologously recombining an upstream of a left arm sequence and a downstream of a right arm sequence of the kanamycin-resistance gene sequence cassette, and inserting the upstream of the left arm sequence of the kanamycin-resistance gene sequence cassette and the downstream of the right arm sequence of the kanamycin-resistance gene sequence cassette into the multi-cloning sites on two sides of pSS-kna (SEQ ID NO: 13) by blunt end insertion or cohesive end insertion, respectively, to construct a shuttle vector pSSGFP (SEQ ID NO: 17) for recombination; 4) constructing pSSENTel (SEQ ID NO: 16), comprising: amplifying a 329 bp in the front of Ad11 (SEQ ID NO: 3) genome as a left arm sequence, providing a fragment formed by ligating 195-378 bp of Ad5 E1A (SEQ ID NO: 2) enhancer, −714-0 bp of human TERT promoter, and 568-1125 bp of Ad11 E1A (SEQ ID NO: 4) in order as a right arm sequence, introducing two restriction enzyme sites XbaI and NcoI to two sides of the human TERT promoter, and inserting the left arm sequence and the right arm sequence into Snabl and EcoRV arranged on two sides of pSS-ChI (SEQ ID NO: 12), respectively, by blunt end insertion, to yield pSSENTel (SEQ ID NO: 16); 5) constructing pSSGFP (SEQ ID NO: 17), comprising: providing a left arm being a product by ligating 27301-27837 bp of DNA segment of Ad11 (SEQ ID NO: 3) genome with EGFP gene via NcoI, and introducing a SnaBI site to 3′ terminal of EGFP; providing a right arm being 28337-28920 bp of DNA segment of Ad11 (SEQ ID NO: 3) genome; and inserting the left arm and the right arm into Snabl and EcoRV sites arranged on two sides of pSS-kna (SEQ ID NO: 13) by blunt end insertion, to yield pSSGFP (SEQ ID NO: 17); and 6) digesting and purifying the pSSENTel (SEQ ID NO: 16) and pSSGFP (SEQ ID NO: 17) by PmeI, to yield two PmeI digested segments, performing homogenous recombination synchronously between the two PmeI digested segments and pAd11 (SEQ ID NO: 6) plasmid, respectively, in BJ5183 cells; screening positive clones using agar plates comprising ampicillin, kanamycin, and chloramphenicol; digesting the positive clones by SwaI and SbfI, and deleting chloramphenicol-resistance gene expression cassette and kanamycin-resistance gene expression cassette to yield pAd11-5ETel-GFP (SEQ ID NO: 11); and digesting and linearizing the pAd11-5ETel-GFP (SEQ ID NO: 11) by NotI, and transfecting 293 cells to produce adenovirs vector Ad11-5ETel-GFP (SEQ ID NO: 10). 3. The method of claim 2, wherein concentrations of the ampicillin, kanamycin, and chloramphenicol are 100 mg/mL, 50 ug/mL, and 25 mg/mL, respectively. 4. The method of claim 2, wherein Tel sequence of pSSENTel (SEQ ID NO: 16) is substitutable by promoters of other tumor specific genes to yield a tumor-specific oncolytic adenovirus; and GFP sequence of pSSGFP (SEQ ID NO: 17) is substitutable by a signal gene or therapeutic gene. 5. The method of claim 2, wherein Ad11 18.5 K gene promoter of pSSGFP (SEQ ID NO: 17) is substitutable by a tumor-specific promoter. 6. A method for treatment of tumor, the method comprising applying a subgroup B recombinant human adenovirus vector Ad11-5EP (SEQ ID NO: 1). 7. A method for treatment of tumor or detection of tumor cells in circulating blood, the method comprising applying a subgroup B adenovirus vector Ad11-5ETel-GFP (SEQ ID NO: 10) constructed according to a method of claim 2. 8. A subgroup B recombinant human adenovirus vector Ad11-5EP (SEQ ID NO: 1), wherein the subgroup B recombinant human adenovirus vector Ad11-5EP (SEQ ID NO: 1) is constructed by a method comprising substituting a 365 bp fragment comprising an enhancer and a promoter of an upstream coding sequence of Ad5 E1A (SEQ ID NO: 2) for a corresponding region of a serotype Ad11 (SEQ ID NO: 3) of the subgroup B human adenovirus vector by homologous recombination to construct the subgroup B recombinant human adenovirus vector Ad11-5EP (SEQ ID NO: 1).

Described herein are compositions and methods for the inhibition of miR-21 activity. The compositions have certain nucleoside modifications that yield potent inhibitors of miR-21 activity. The compounds may comprise conjugates to facilitate delivery to the liver. The compositions may be administered to subjects with liver conditions, such as liver cancer.

1. A compound having the structure: Ln-linker-X—Nm—X-MO wherein each L is, independently, a ligand and n is from 1 to 10; each N is, independently, a modified or unmodified nucleoside and m is from 1 to 5; each X is, independently, a phosphodiester linkage or a phosphorothioate linkage; and MO is a modified oligonucleotide, wherein a. the modified oligonucleotide comprises at least 8 contiguous nucleosides of the following nucleoside pattern I in the 5′ to 3′ orientation: (R)X—NB—NQ—NQ—NB—(NQ—NQ—NQ—NB)3—NQ—NZ wherein each R is, independently, a non-bicyclic nucleoside; X is from 1 to 4; each NB is, independently, a bicyclic nucleoside; each NQ is, independently, a non-bicyclic nucleoside; and each NZ is, independently, a modified nucleoside; 2. (canceled) 3. (canceled) 4. The compound of claim 1, wherein if n is greater than 1, Ln-linker has the structure: 5. (canceled) 6. The compound of claim 4, wherein the scaffold links 2, 3, 4, or 5 ligands to a modified oligonucleotide. 7. (canceled) 8. The compound of claim 1, comprising the structure: 9. The compound of claim 1, wherein n is from 1 to 5, 1 to 4, 1 to 3, or 1 to 2. 10. (canceled) 11. The compound of claim 1, wherein at least one ligand is selected from a carbohydrate, cholesterol, a lipid, a phospholipid, an antibody, a lipoprotein, a hormone, a peptide, a vitamin, a steroid, and a cationic lipid. 12. (canceled) 13. The compound of claim 1, wherein at least one ligand is selected from N-acetylgalactosamine, galactose, galactosamine, N-formylgalactosamine, N-propionyl-galactosamine, N-n-butanoylgalactosamine, and N-iso-butanoyl-galactosamine. 14. (canceled) 15. The compound of claim 1, wherein the compound has the structure: 16. The compound of claim 0, wherein at least one of X1 and X2 is a phosphodiester linkage. 17. The compound of claim 0, wherein each of X1 and X2 is a phosphodiester linkage. 18. The compound of claim 1, wherein m is 1, 2, 3, 4 or 5. 19-31. (canceled) 32. The compound of claim 1, wherein the sugar moiety of each N is independently selected from a β-D-ribose, a β-D-deoxyribose, a 2′-O-methoxy sugar, a 2′-O-methyl sugar, a 2′-fluoro sugar, and a bicyclic sugar moiety. 33-44. (canceled) 45. The compound of claim 1, wherein each bicyclic nucleoside is independently selected from an LNA nucleoside, a cEt nucleoside, and an ENA nucleoside. 46. (canceled) 47. (canceled) 48. The compound of claim 1, wherein each non-bicyclic nucleoside is independently selected from a β-D-deoxyribonucleoside, a 2′-O-methyl, and a 2′-O-methoxyethyl nucleoside. 49-51. (canceled) 52. The compound of claim 1 wherein: i. the compound is a compound of claim 1(a), wherein: a. R consists of four linked nucleosides NR1—NR2—NR3—NR4 wherein NR1 is a 2′-O-methoxyethyl nucleoside and each of NR2—NR3—NR4 is a β-D-deoxyribonucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; b. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; c. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a 2′-O-methoxyethyl nucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; d. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; e. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an LNA nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; or f. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an LNA nucleoside; each NQ is a 3-D-deoxyribonucleoside; and NZ is an LNA nucleoside; ii. the compound is a compound of claim 1(b), wherein: a. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; b. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a 2′-O-methoxyethyl nucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; c. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; each N is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; d. NM is a 2′-O-methoxyethyl nucleoside; each NB is an LNA nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; or e. NM is a 2′-O-methoxyethyl nucleoside; each NB is an LNA nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is an LNA nucleoside; iii. the compound is a compound of claim 1(c), wherein: a. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is aβ-D-deoxyribonucleoside; NY is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; b. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is aβ-D-deoxyribonucleoside; NY is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; or c. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; NY is an S-cEt nucleoside; and NZ is an S-cEt nucleoside; d. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is independently selected from a β-D-deoxyribonucleoside and a 2′-O-methoxyethyl nucleoside; NY is selected from an S-cEt nucleoside and a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; iv. the compound is a compound of claim 1(d), wherein: a. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; NY is a β-D-deoxyribonucleoside; NZ is a 2′-O-methoxyethyl nucleoside; and b. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; NY is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; c. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is aβ-D-deoxyribonucleoside; NY is an S-cEt nucleoside; and NZ is an S-cEt nucleoside; d. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is independently selected from a β-D-deoxyribonucleoside and a 2′-O-methoxyethyl nucleoside; NY is selected from an S-cEt nucleoside and a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; v. the compound is a compound of claim 1(e), wherein: a. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; vi. the compound is a compound of claim 1(f), wherein: a. each NB is an S-cEt nucleoside; and each NQ is a 2′-O-methoxyethyl nucleoside; b. each NB is an S-cEt nucleoside; and each NQ is a β-D-deoxyribonucleoside; vii. the compound is a compound of claim 1(g), wherein: a. each NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is independently selected from a 2′-O-methyl nucleoside and a β-D-deoxyribonucleoside; and NZ is selected from an S-cEt nucleoside and a 2′-O-methoxyethyl nucleoside; b. each NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; c. each NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is independently selected from a 2′-O-methyl nucleoside and a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; or d. each NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is independently selected from a 2′-O-methyl nucleoside and a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside. 53-57. (canceled) 58. The compound of claim 1 having the structure: 59-65. (canceled) 66. The compound of claim 1, wherein the modified oligonucleotide consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 linked nucleosides of nucleoside pattern I, II, III, IV, V, VI, or VII. 67. (canceled) 68. (canceled) 69. The compound of claim 1, wherein the nucleobase sequence of the modified oligonucleotide is selected from SEQ ID NOs: 3 to 10, wherein each T is independently selected from T and U. 70. The compound of claim 1, wherein the modified oligonucleotide has 0, 1, 2, or 3 mismatches with respect to the nucleobase sequence of miR-21. 71-74. (canceled) 75. The compound of claim 1, wherein the modified oligonucleotide has a structure selected from the structures in Table 1. 76. A method of inhibiting the activity of miR-21 comprising contacting a cell with a compound of claim 1. 77-79. (canceled) 80. A method of treating, preventing or delaying the onset of a disease associated with miR-21 comprising administering to a subject having a disease associated with miR-21 a compound of claim 1. 81. The method of claim 80, wherein the disease is fibrosis. 82-88. (canceled) 89. The method of claim 80, wherein the disease is cancer. 90-106. (canceled)

Described herein are compositions and methods for the inhibition of miR-21 activity. The compositions have certain nucleoside modifications that yield potent inhibitors of miR-21 activity. The compounds may comprise conjugates to facilitate delivery to the liver. The compositions may be administered to subjects with liver conditions, such as liver cancer.1. A compound having the structure: Ln-linker-X—Nm—X-MO wherein each L is, independently, a ligand and n is from 1 to 10; each N is, independently, a modified or unmodified nucleoside and m is from 1 to 5; each X is, independently, a phosphodiester linkage or a phosphorothioate linkage; and MO is a modified oligonucleotide, wherein a. the modified oligonucleotide comprises at least 8 contiguous nucleosides of the following nucleoside pattern I in the 5′ to 3′ orientation: (R)X—NB—NQ—NQ—NB—(NQ—NQ—NQ—NB)3—NQ—NZ wherein each R is, independently, a non-bicyclic nucleoside; X is from 1 to 4; each NB is, independently, a bicyclic nucleoside; each NQ is, independently, a non-bicyclic nucleoside; and each NZ is, independently, a modified nucleoside; 2. (canceled) 3. (canceled) 4. The compound of claim 1, wherein if n is greater than 1, Ln-linker has the structure: 5. (canceled) 6. The compound of claim 4, wherein the scaffold links 2, 3, 4, or 5 ligands to a modified oligonucleotide. 7. (canceled) 8. The compound of claim 1, comprising the structure: 9. The compound of claim 1, wherein n is from 1 to 5, 1 to 4, 1 to 3, or 1 to 2. 10. (canceled) 11. The compound of claim 1, wherein at least one ligand is selected from a carbohydrate, cholesterol, a lipid, a phospholipid, an antibody, a lipoprotein, a hormone, a peptide, a vitamin, a steroid, and a cationic lipid. 12. (canceled) 13. The compound of claim 1, wherein at least one ligand is selected from N-acetylgalactosamine, galactose, galactosamine, N-formylgalactosamine, N-propionyl-galactosamine, N-n-butanoylgalactosamine, and N-iso-butanoyl-galactosamine. 14. (canceled) 15. The compound of claim 1, wherein the compound has the structure: 16. The compound of claim 0, wherein at least one of X1 and X2 is a phosphodiester linkage. 17. The compound of claim 0, wherein each of X1 and X2 is a phosphodiester linkage. 18. The compound of claim 1, wherein m is 1, 2, 3, 4 or 5. 19-31. (canceled) 32. The compound of claim 1, wherein the sugar moiety of each N is independently selected from a β-D-ribose, a β-D-deoxyribose, a 2′-O-methoxy sugar, a 2′-O-methyl sugar, a 2′-fluoro sugar, and a bicyclic sugar moiety. 33-44. (canceled) 45. The compound of claim 1, wherein each bicyclic nucleoside is independently selected from an LNA nucleoside, a cEt nucleoside, and an ENA nucleoside. 46. (canceled) 47. (canceled) 48. The compound of claim 1, wherein each non-bicyclic nucleoside is independently selected from a β-D-deoxyribonucleoside, a 2′-O-methyl, and a 2′-O-methoxyethyl nucleoside. 49-51. (canceled) 52. The compound of claim 1 wherein: i. the compound is a compound of claim 1(a), wherein: a. R consists of four linked nucleosides NR1—NR2—NR3—NR4 wherein NR1 is a 2′-O-methoxyethyl nucleoside and each of NR2—NR3—NR4 is a β-D-deoxyribonucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; b. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; c. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a 2′-O-methoxyethyl nucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; d. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; e. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an LNA nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; or f. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an LNA nucleoside; each NQ is a 3-D-deoxyribonucleoside; and NZ is an LNA nucleoside; ii. the compound is a compound of claim 1(b), wherein: a. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; b. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a 2′-O-methoxyethyl nucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; c. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; each N is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; d. NM is a 2′-O-methoxyethyl nucleoside; each NB is an LNA nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; or e. NM is a 2′-O-methoxyethyl nucleoside; each NB is an LNA nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is an LNA nucleoside; iii. the compound is a compound of claim 1(c), wherein: a. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is aβ-D-deoxyribonucleoside; NY is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; b. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is aβ-D-deoxyribonucleoside; NY is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; or c. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; NY is an S-cEt nucleoside; and NZ is an S-cEt nucleoside; d. each R is a 2′-O-methoxyethyl nucleoside; X is 1; each NB is an S-cEt nucleoside; each NQ is independently selected from a β-D-deoxyribonucleoside and a 2′-O-methoxyethyl nucleoside; NY is selected from an S-cEt nucleoside and a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; iv. the compound is a compound of claim 1(d), wherein: a. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; NY is a β-D-deoxyribonucleoside; NZ is a 2′-O-methoxyethyl nucleoside; and b. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; NY is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; c. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is aβ-D-deoxyribonucleoside; NY is an S-cEt nucleoside; and NZ is an S-cEt nucleoside; d. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is independently selected from a β-D-deoxyribonucleoside and a 2′-O-methoxyethyl nucleoside; NY is selected from an S-cEt nucleoside and a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; v. the compound is a compound of claim 1(e), wherein: a. NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside; vi. the compound is a compound of claim 1(f), wherein: a. each NB is an S-cEt nucleoside; and each NQ is a 2′-O-methoxyethyl nucleoside; b. each NB is an S-cEt nucleoside; and each NQ is a β-D-deoxyribonucleoside; vii. the compound is a compound of claim 1(g), wherein: a. each NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is independently selected from a 2′-O-methyl nucleoside and a β-D-deoxyribonucleoside; and NZ is selected from an S-cEt nucleoside and a 2′-O-methoxyethyl nucleoside; b. each NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; c. each NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is independently selected from a 2′-O-methyl nucleoside and a β-D-deoxyribonucleoside; and NZ is an S-cEt nucleoside; or d. each NM is a 2′-O-methoxyethyl nucleoside; each NB is an S-cEt nucleoside; each NQ is independently selected from a 2′-O-methyl nucleoside and a β-D-deoxyribonucleoside; and NZ is a 2′-O-methoxyethyl nucleoside. 53-57. (canceled) 58. The compound of claim 1 having the structure: 59-65. (canceled) 66. The compound of claim 1, wherein the modified oligonucleotide consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 linked nucleosides of nucleoside pattern I, II, III, IV, V, VI, or VII. 67. (canceled) 68. (canceled) 69. The compound of claim 1, wherein the nucleobase sequence of the modified oligonucleotide is selected from SEQ ID NOs: 3 to 10, wherein each T is independently selected from T and U. 70. The compound of claim 1, wherein the modified oligonucleotide has 0, 1, 2, or 3 mismatches with respect to the nucleobase sequence of miR-21. 71-74. (canceled) 75. The compound of claim 1, wherein the modified oligonucleotide has a structure selected from the structures in Table 1. 76. A method of inhibiting the activity of miR-21 comprising contacting a cell with a compound of claim 1. 77-79. (canceled) 80. A method of treating, preventing or delaying the onset of a disease associated with miR-21 comprising administering to a subject having a disease associated with miR-21 a compound of claim 1. 81. The method of claim 80, wherein the disease is fibrosis. 82-88. (canceled) 89. The method of claim 80, wherein the disease is cancer. 90-106. (canceled)

The invention relates to isolated nucleic acids and rAAV-based compositions, methods and kits useful for treating genetic diseases (e.g., alpha-1 antitrypsin deficiency).

1. A recombinant adenoviral associated vector (rAAV vector) comprising: (a) a first region that encodes one or more first miRNAs comprising a nucleic acid having sufficient sequence complementary with an endogenous mRNA of a subject to hybridize with and inhibit expression of the endogenous mRNA, wherein the endogenous mRNA encodes a first protein having a dominant negative or gain of function mutation; and (b) a second region encoding an exogenous mRNA that encodes a second protein, wherein the second protein has an amino acid sequence that is at least 85% identical to the first protein and does not have the dominant negative or gain of function mutation, wherein the one or more first miRNAs do not comprise a nucleic acid having sufficient sequence complementary to hybridize with and inhibit expression of the exogenous mRNA, and wherein the first region is positioned within between a portion of the second region encoding the last codon of the exogenous mRNA and a polyadenylation sequence of the exogenous mRNA. 2-4. (canceled) 5. The rAAV vector of claim 11, further comprising a third region encoding a one or more second miRNAs comprising a nucleic acid having sufficient sequence complementary to hybridize with and inhibit expression of the endogenous mRNA, wherein the third region is positioned within an untranslated portion of the second region. 6-7. (canceled) 8. The rAAV vector of claim 5, wherein the third region is between the first codon of the exogenous mRNA and a position 1000 nucleotides upstream of the first codon. 9. The rAAV vector of claim 1, wherein the first region encodes two first miRNAs. 10. The rAAV vector of claim 1, wherein the first region encodes three first miRNAs. 11. The rAAV vector of claim 5, wherein the third region encodes two second miRNAs. 12. The rAAV vector of claim 5, wherein the third region encodes three second miRNAs. 13-23. (canceled) 24. The rAAV vector of claim 1, wherein the exogenous mRNA has one or more silent mutations compared with the endogenous mRNA. 25. (canceled) 26. The rAAV vector of claim 1, further comprising an inverted terminal repeats (ITR) of an AAV serotypes selected from the group consisting of: AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11 and variants thereof. 27. The rAAV vector of claim 1, further comprising a promoter operably linked with the region(s) encoding the one or more first miRNAs, the exogenous mRNA, and/or the one or more second miRNAs. 28. The rAAV vector of claim 27, wherein the promoter is a tissue-specific promoter. 29. The rAAV vector of claim 27, wherein the promoter is a β-actin promoter. 30. (canceled) 31. A recombinant Adeno-Associated Virus (AAV) comprising an rAAV vector of claim 1. 32. (canceled) 33. A composition comprising the recombinant AAV of claim 31. 34. The composition of claim 33, further comprising a pharmaceutically acceptable carrier. 35. A kit comprising a container housing the composition of claim 33. 36. The kit of claim 35, further comprising written instructions for administering the rAAV to a subject. 37. A method of treating a disorder associated with a dominant negative or gain of function mutation in a subject, the method comprising: administering to a subject an effective amount of the rAAV of claim 31. 38. The method of claim 37, wherein the rAAV is administered with a pharmaceutically acceptable carrier. 39-77. (canceled)

The invention relates to isolated nucleic acids and rAAV-based compositions, methods and kits useful for treating genetic diseases (e.g., alpha-1 antitrypsin deficiency).1. A recombinant adenoviral associated vector (rAAV vector) comprising: (a) a first region that encodes one or more first miRNAs comprising a nucleic acid having sufficient sequence complementary with an endogenous mRNA of a subject to hybridize with and inhibit expression of the endogenous mRNA, wherein the endogenous mRNA encodes a first protein having a dominant negative or gain of function mutation; and (b) a second region encoding an exogenous mRNA that encodes a second protein, wherein the second protein has an amino acid sequence that is at least 85% identical to the first protein and does not have the dominant negative or gain of function mutation, wherein the one or more first miRNAs do not comprise a nucleic acid having sufficient sequence complementary to hybridize with and inhibit expression of the exogenous mRNA, and wherein the first region is positioned within between a portion of the second region encoding the last codon of the exogenous mRNA and a polyadenylation sequence of the exogenous mRNA. 2-4. (canceled) 5. The rAAV vector of claim 11, further comprising a third region encoding a one or more second miRNAs comprising a nucleic acid having sufficient sequence complementary to hybridize with and inhibit expression of the endogenous mRNA, wherein the third region is positioned within an untranslated portion of the second region. 6-7. (canceled) 8. The rAAV vector of claim 5, wherein the third region is between the first codon of the exogenous mRNA and a position 1000 nucleotides upstream of the first codon. 9. The rAAV vector of claim 1, wherein the first region encodes two first miRNAs. 10. The rAAV vector of claim 1, wherein the first region encodes three first miRNAs. 11. The rAAV vector of claim 5, wherein the third region encodes two second miRNAs. 12. The rAAV vector of claim 5, wherein the third region encodes three second miRNAs. 13-23. (canceled) 24. The rAAV vector of claim 1, wherein the exogenous mRNA has one or more silent mutations compared with the endogenous mRNA. 25. (canceled) 26. The rAAV vector of claim 1, further comprising an inverted terminal repeats (ITR) of an AAV serotypes selected from the group consisting of: AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11 and variants thereof. 27. The rAAV vector of claim 1, further comprising a promoter operably linked with the region(s) encoding the one or more first miRNAs, the exogenous mRNA, and/or the one or more second miRNAs. 28. The rAAV vector of claim 27, wherein the promoter is a tissue-specific promoter. 29. The rAAV vector of claim 27, wherein the promoter is a β-actin promoter. 30. (canceled) 31. A recombinant Adeno-Associated Virus (AAV) comprising an rAAV vector of claim 1. 32. (canceled) 33. A composition comprising the recombinant AAV of claim 31. 34. The composition of claim 33, further comprising a pharmaceutically acceptable carrier. 35. A kit comprising a container housing the composition of claim 33. 36. The kit of claim 35, further comprising written instructions for administering the rAAV to a subject. 37. A method of treating a disorder associated with a dominant negative or gain of function mutation in a subject, the method comprising: administering to a subject an effective amount of the rAAV of claim 31. 38. The method of claim 37, wherein the rAAV is administered with a pharmaceutically acceptable carrier. 39-77. (canceled)

This disclosure describes modular miRNA regulator molecules and methods of using modular miRNA regulator molecules. Generally, the modular miRNA regulator molecules include a recognition module and an inhibition module. Generally, the recognition module includes a polynucleotide in which at least a portion of the polynucleotide recognizes at least a portion of a preselected pre-miRNA. Generally, the inhibition module includes a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA.

1. A modular RNA regulator molecule comprising: a recognition module comprising a polynucleotide, wherein at least a portion of the polynucleotide recognizes at least a portion of a preselected pre-RNA; and an inhibition module comprising a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA. 2. The modular RNA regulator molecule of claim 1 wherein the recognition module comprises a morpholino, a locked nucleic acid (LNA), a peptide nucleic acid (PNA), a phosphorothioate (S-oligo), or a synthetic/natural molecule that specifically recognizes unique pre-RNA sequences. 3. The modular RNA regulator molecule of claim 1 wherein at least a portion of the recognition module forms a duplex with at least a portion of the preselected RNA. 4. The modular RNA regulator molecule of claim 1 wherein the recognition module polynucleotide comprises no more than 14 nucleotides. 5. The modular RNA regulator molecule of claim 1 wherein the inhibition module comprises a moiety that directly interferes with the nuclease. 6. The modular RNA regulator molecule of claim 1 wherein the nuclease comprises Dicer. 7. The modular RNA regulator molecule of claim 6 wherein the inhibition module comprises an N-hydroxyphthalimide moiety. 8. The modular RNA regulator molecule of claim 1 wherein the inhibition module comprises a moiety that indirectly interferes with the nuclease. 9. The modular RNA regulator molecule of claim 8 wherein the inhibition module comprises a ligand that selectively binds to a compound that directly interferes with the nuclease. 10. The modular RNA regulator molecule of claim 9 wherein the ligand comprises a synthetic ligand of FKBP (SLF), tacrolimus, a molecule that binds FKBP12 selectively, or a ligand that can selectively recruit a endogenous protein. 11. The modular RNA regulator molecule of claim 9 wherein the endogenous protein comprises FKBP12. 12. The modular RNA regulator molecule of claim 1 further comprising a linker module. 13. The modular RNA regulator molecule of claim 12 wherein the linker module is light-cleavable. 14. The modular RNA regulator molecule of claim 1 further comprising an accessory module. 15. The modular RNA regulator molecule of claim 1 wherein the preselected pre-RNA comprises a pre-miRNA. 16. A method of inhibiting processing of a pre-RNA to a mature RNA, the method comprising; contacting a modular RNA regulator molecule with a sample that comprises a nuclease capable of processing the pre-RNA to a mature RNA, wherein the modular RNA regulator molecule: is provided in an amount effective to inhibit the nuclease from processing the pre-RNA to a mature RNA, and comprises: a recognition module comprising a polynucleotide, wherein at least a portion of the polynucleotide forms a duplex with at least a portion of a preselected pre-RNA; and an inhibition module comprising a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA. 17. A method of inhibiting processing of a pre-RNA to a mature RNA in a cell, the method comprising: introducing into a cell a modular RNA regulator molecule in an amount effective to inhibit a nuclease from processing the pre-RNA to a mature RNA, the modular RNA regulator molecule comprising: a recognition module comprising a polynucleotide, wherein at least a portion of the polynucleotide forms a duplex with at least a portion of a preselected pre-RNA; and an inhibition module comprising a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA. 18. The method of claim 16 wherein the modular RNA regulator molecule comprises: a recognition module comprising a polynucleotide, wherein at least a portion of the polynucleotide recognizes at least a portion of a preselected pre-RNA; and an inhibition module comprising a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA. 19. The method of claim 17 wherein the modular RNA regulator molecule comprises: a recognition module comprising a polynucleotide, wherein at least a portion of the polynucleotide recognizes at least a portion of a preselected pre-RNA; and an inhibition module comprising a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA.

This disclosure describes modular miRNA regulator molecules and methods of using modular miRNA regulator molecules. Generally, the modular miRNA regulator molecules include a recognition module and an inhibition module. Generally, the recognition module includes a polynucleotide in which at least a portion of the polynucleotide recognizes at least a portion of a preselected pre-miRNA. Generally, the inhibition module includes a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA.1. A modular RNA regulator molecule comprising: a recognition module comprising a polynucleotide, wherein at least a portion of the polynucleotide recognizes at least a portion of a preselected pre-RNA; and an inhibition module comprising a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA. 2. The modular RNA regulator molecule of claim 1 wherein the recognition module comprises a morpholino, a locked nucleic acid (LNA), a peptide nucleic acid (PNA), a phosphorothioate (S-oligo), or a synthetic/natural molecule that specifically recognizes unique pre-RNA sequences. 3. The modular RNA regulator molecule of claim 1 wherein at least a portion of the recognition module forms a duplex with at least a portion of the preselected RNA. 4. The modular RNA regulator molecule of claim 1 wherein the recognition module polynucleotide comprises no more than 14 nucleotides. 5. The modular RNA regulator molecule of claim 1 wherein the inhibition module comprises a moiety that directly interferes with the nuclease. 6. The modular RNA regulator molecule of claim 1 wherein the nuclease comprises Dicer. 7. The modular RNA regulator molecule of claim 6 wherein the inhibition module comprises an N-hydroxyphthalimide moiety. 8. The modular RNA regulator molecule of claim 1 wherein the inhibition module comprises a moiety that indirectly interferes with the nuclease. 9. The modular RNA regulator molecule of claim 8 wherein the inhibition module comprises a ligand that selectively binds to a compound that directly interferes with the nuclease. 10. The modular RNA regulator molecule of claim 9 wherein the ligand comprises a synthetic ligand of FKBP (SLF), tacrolimus, a molecule that binds FKBP12 selectively, or a ligand that can selectively recruit a endogenous protein. 11. The modular RNA regulator molecule of claim 9 wherein the endogenous protein comprises FKBP12. 12. The modular RNA regulator molecule of claim 1 further comprising a linker module. 13. The modular RNA regulator molecule of claim 12 wherein the linker module is light-cleavable. 14. The modular RNA regulator molecule of claim 1 further comprising an accessory module. 15. The modular RNA regulator molecule of claim 1 wherein the preselected pre-RNA comprises a pre-miRNA. 16. A method of inhibiting processing of a pre-RNA to a mature RNA, the method comprising; contacting a modular RNA regulator molecule with a sample that comprises a nuclease capable of processing the pre-RNA to a mature RNA, wherein the modular RNA regulator molecule: is provided in an amount effective to inhibit the nuclease from processing the pre-RNA to a mature RNA, and comprises: a recognition module comprising a polynucleotide, wherein at least a portion of the polynucleotide forms a duplex with at least a portion of a preselected pre-RNA; and an inhibition module comprising a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA. 17. A method of inhibiting processing of a pre-RNA to a mature RNA in a cell, the method comprising: introducing into a cell a modular RNA regulator molecule in an amount effective to inhibit a nuclease from processing the pre-RNA to a mature RNA, the modular RNA regulator molecule comprising: a recognition module comprising a polynucleotide, wherein at least a portion of the polynucleotide forms a duplex with at least a portion of a preselected pre-RNA; and an inhibition module comprising a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA. 18. The method of claim 16 wherein the modular RNA regulator molecule comprises: a recognition module comprising a polynucleotide, wherein at least a portion of the polynucleotide recognizes at least a portion of a preselected pre-RNA; and an inhibition module comprising a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA. 19. The method of claim 17 wherein the modular RNA regulator molecule comprises: a recognition module comprising a polynucleotide, wherein at least a portion of the polynucleotide recognizes at least a portion of a preselected pre-RNA; and an inhibition module comprising a moiety that inhibits nuclease processing of the preselected pre-RNA to a mature RNA.

Disclosed herein are methods for decreasing A1AT mRNA and protein expression and treating, ameliorating, preventing, slowing progression, or stopping progression of fibrosis. Disclosed herein are methods for decreasing A1AT mRNA and protein expression and treating, ameliorating, preventing, slowing progression, or stopping progression of liver disease, such as, A1ATD associated liver disease, and pulmonary disease, such as, A1ATD associated pulmonary disease in an individual in need thereof. Methods for inhibiting A1AT mRNA and protein expression can also be used as a prophylactic treatment to prevent individuals at risk for developing a liver disease, such as, A1ATD associated liver disease and pulmonary disease, such as, A1ATD associated pulmonary disease.

1-3. (canceled) 4. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases complementary to an equal length portion of nucleobases 1349 to 1597 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1. 5. The compound of claim 4, wherein the nucleobase sequence comprises at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 1349-1597 of SEQ ID NO: 1. 6-8. (canceled) 9. The compound of claim 4, wherein the modified oligonucleotide consists of 18 to 24 linked nucleosides. 10. The compound of claim 4, wherein the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to SEQ ID NO: 1. 11. The compound of claim 4, consisting of a single-stranded modified oligonucleotide. 12. The compound of claim 11, wherein at least one internucleoside linkage is a modified internucleoside linkage. 13. The compound of claim 12, wherein at least one modified internucleoside linkage is a phosphorothioate linkage. 14. (canceled) 15. The compound of claim 11, wherein at least one nucleoside comprises a modified nucleobase. 16. The compound of claim 15, wherein the modified nucleobase is a 5-methylcytosine. 17. The compound of claim 11, wherein the modified oligonucleotide comprises at least one modified sugar. 18. The compound of claim 17, wherein the modified sugar is a 2′-O-methoxyethyl. 19. The compound of claim 11, comprising at least one 2′-O-methoxyethyl nucleoside. 20. The compound of claim 17, wherein the modified sugar is a bicyclic sugar. 21. The compound of claim 20, wherein the bicyclic sugar comprises a 4′-CH(CH3)—O-2′ bridge. 22. (canceled) 23. (canceled) 24. A composition comprising a compound of claim 4 or a salt thereof and a pharmaceutically acceptable carrier or diluent. 25-35. (canceled) 36. A method of reducing A1AT in an animal comprising administering to the animal the compound of claim 4, thereby reducing A 1AT in the animal. 37-49. (canceled) 50. A method of treating an alpha-1-antitrypsin deficiency (A1ATD)-associated liver disease in an animal comprising administering to the animal the compound of claim 4, thereby treating the A1ATD-associated liver disease in the animal. 51. The compound of claim 4, wherein the compound comprises a double-stranded RNA oligonucleotide, wherein one strand of the double-stranded RNA oligonucleotide is the RNA oligonucleotide comprising a nucleobase sequence comprising at least 12 contiguous nucleobases complementary to an equal portion of the nucleobases 1349 to 1597 of SEQ ID NO: 1.

Disclosed herein are methods for decreasing A1AT mRNA and protein expression and treating, ameliorating, preventing, slowing progression, or stopping progression of fibrosis. Disclosed herein are methods for decreasing A1AT mRNA and protein expression and treating, ameliorating, preventing, slowing progression, or stopping progression of liver disease, such as, A1ATD associated liver disease, and pulmonary disease, such as, A1ATD associated pulmonary disease in an individual in need thereof. Methods for inhibiting A1AT mRNA and protein expression can also be used as a prophylactic treatment to prevent individuals at risk for developing a liver disease, such as, A1ATD associated liver disease and pulmonary disease, such as, A1ATD associated pulmonary disease.1-3. (canceled) 4. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and comprising a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases complementary to an equal length portion of nucleobases 1349 to 1597 of SEQ ID NO: 1, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1. 5. The compound of claim 4, wherein the nucleobase sequence comprises at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 1349-1597 of SEQ ID NO: 1. 6-8. (canceled) 9. The compound of claim 4, wherein the modified oligonucleotide consists of 18 to 24 linked nucleosides. 10. The compound of claim 4, wherein the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to SEQ ID NO: 1. 11. The compound of claim 4, consisting of a single-stranded modified oligonucleotide. 12. The compound of claim 11, wherein at least one internucleoside linkage is a modified internucleoside linkage. 13. The compound of claim 12, wherein at least one modified internucleoside linkage is a phosphorothioate linkage. 14. (canceled) 15. The compound of claim 11, wherein at least one nucleoside comprises a modified nucleobase. 16. The compound of claim 15, wherein the modified nucleobase is a 5-methylcytosine. 17. The compound of claim 11, wherein the modified oligonucleotide comprises at least one modified sugar. 18. The compound of claim 17, wherein the modified sugar is a 2′-O-methoxyethyl. 19. The compound of claim 11, comprising at least one 2′-O-methoxyethyl nucleoside. 20. The compound of claim 17, wherein the modified sugar is a bicyclic sugar. 21. The compound of claim 20, wherein the bicyclic sugar comprises a 4′-CH(CH3)—O-2′ bridge. 22. (canceled) 23. (canceled) 24. A composition comprising a compound of claim 4 or a salt thereof and a pharmaceutically acceptable carrier or diluent. 25-35. (canceled) 36. A method of reducing A1AT in an animal comprising administering to the animal the compound of claim 4, thereby reducing A 1AT in the animal. 37-49. (canceled) 50. A method of treating an alpha-1-antitrypsin deficiency (A1ATD)-associated liver disease in an animal comprising administering to the animal the compound of claim 4, thereby treating the A1ATD-associated liver disease in the animal. 51. The compound of claim 4, wherein the compound comprises a double-stranded RNA oligonucleotide, wherein one strand of the double-stranded RNA oligonucleotide is the RNA oligonucleotide comprising a nucleobase sequence comprising at least 12 contiguous nucleobases complementary to an equal portion of the nucleobases 1349 to 1597 of SEQ ID NO: 1.

The present invention relates to a factor for reprogramming bone endothelial cells to promote bone angiogenesis and osteogenesis as well as to an ex vivo method for reprogramming a bone endothelial cell to achieve cells able to mediate bone angiogenesis and osteogenesis. The subtype of bone endothelial cells mediating bone angiogenesis and osteogenesis express CD31 and Endomucin as markers.

1. A factor generating type H bone endothelial cells for use in promoting bone angiogenesis and osteogenesis. 2. The factor according to claim 1 for reprogramming type L bone endothelial cells to type H bone endothelial cells for use in promoting bone angiogenesis and osteogenesis. 3. The factor according to claim 1 or 2 for the use in the treatment of osteoporoses or promotion of bone fracture healing. 4. The factor according to claim 1 or 2 or 3, wherein the factor increases the stability or biological activity of HIF-1α. 5. The factor according to any one of claims 1-4, wherein the factor is a Prolyl-4-hydroxylase inhibitor. 6. The factor according to claim 1 or 2 or 3, wherein the factor activates Notch-signaling. 7. The factor according to any one of claims 1-5, wherein the factor is selected from the group consisting of active HIF-1alpha, factors inhibiting VHL, factors inhibiting E3 ubiquitin protein ligase, cobalt chloride, ciclopirox olamine, L-mimosine, dimethyloxalylglycine, 3,4-dihydoxybenzoate and (N′-{5-[Acetyl(hydroxy)amino]pentyl]-N-[5-({4-[(5-aminopentyl)(hydroxy)amino]-4-oxobutanoyl}amino)pentyl]-N-hydroxysuccin amide). 8. The factor according to any one of claim 1-3 or 6, wherein the factor is selected from the group consisting of immobilized Dll4/Fc fusion protein, a soluble Jagged1 peptide activating Dll4-Notch signaling, activated intracellular domaine of Notch, and a factor inactivating an enzyme able to destruct active Notch. 9. An ex vivo method for generating a type H bone endothelial cell comprising the step of: contacting an isolated cell with a factor according to any one of claims 1-8. 10. An ex vivo method for reprogramming a type L bone endothelial cell to a type H endothelial cell comprising the step of: contacting an isolated cell with a factor according to any one of claims 1-8. 11. An ex vivo method for reprogramming a type L bone endothelial cell to a type H endothelial cell comprising the step of: increasing the stability or biological activity of HIF-1α in an isolated cell or activating Notch-signaling in said isolated cell. 12. Method for isolating bone endothelial cells able to mediate bone angiogenesis and osteogenesis. 13. A bone endothelial cell obtained by the method according to any one of claims 9-12. 14. Use of CD31 and Endomucin as marker for a type H bone endothelial cells which mediate growth of bone vasculature. 15. A method of determining a subtype of bone endothelial cells mediating growth of bone vasculature, comprising: measuring the expression level CD31 and Endomucin in a bone endothelial cell, wherein an increased CD31 and Endomucin expression level is indicative for the subtype of bone endothelial cells mediating growth of bone vasculature.

The present invention relates to a factor for reprogramming bone endothelial cells to promote bone angiogenesis and osteogenesis as well as to an ex vivo method for reprogramming a bone endothelial cell to achieve cells able to mediate bone angiogenesis and osteogenesis. The subtype of bone endothelial cells mediating bone angiogenesis and osteogenesis express CD31 and Endomucin as markers.1. A factor generating type H bone endothelial cells for use in promoting bone angiogenesis and osteogenesis. 2. The factor according to claim 1 for reprogramming type L bone endothelial cells to type H bone endothelial cells for use in promoting bone angiogenesis and osteogenesis. 3. The factor according to claim 1 or 2 for the use in the treatment of osteoporoses or promotion of bone fracture healing. 4. The factor according to claim 1 or 2 or 3, wherein the factor increases the stability or biological activity of HIF-1α. 5. The factor according to any one of claims 1-4, wherein the factor is a Prolyl-4-hydroxylase inhibitor. 6. The factor according to claim 1 or 2 or 3, wherein the factor activates Notch-signaling. 7. The factor according to any one of claims 1-5, wherein the factor is selected from the group consisting of active HIF-1alpha, factors inhibiting VHL, factors inhibiting E3 ubiquitin protein ligase, cobalt chloride, ciclopirox olamine, L-mimosine, dimethyloxalylglycine, 3,4-dihydoxybenzoate and (N′-{5-[Acetyl(hydroxy)amino]pentyl]-N-[5-({4-[(5-aminopentyl)(hydroxy)amino]-4-oxobutanoyl}amino)pentyl]-N-hydroxysuccin amide). 8. The factor according to any one of claim 1-3 or 6, wherein the factor is selected from the group consisting of immobilized Dll4/Fc fusion protein, a soluble Jagged1 peptide activating Dll4-Notch signaling, activated intracellular domaine of Notch, and a factor inactivating an enzyme able to destruct active Notch. 9. An ex vivo method for generating a type H bone endothelial cell comprising the step of: contacting an isolated cell with a factor according to any one of claims 1-8. 10. An ex vivo method for reprogramming a type L bone endothelial cell to a type H endothelial cell comprising the step of: contacting an isolated cell with a factor according to any one of claims 1-8. 11. An ex vivo method for reprogramming a type L bone endothelial cell to a type H endothelial cell comprising the step of: increasing the stability or biological activity of HIF-1α in an isolated cell or activating Notch-signaling in said isolated cell. 12. Method for isolating bone endothelial cells able to mediate bone angiogenesis and osteogenesis. 13. A bone endothelial cell obtained by the method according to any one of claims 9-12. 14. Use of CD31 and Endomucin as marker for a type H bone endothelial cells which mediate growth of bone vasculature. 15. A method of determining a subtype of bone endothelial cells mediating growth of bone vasculature, comprising: measuring the expression level CD31 and Endomucin in a bone endothelial cell, wherein an increased CD31 and Endomucin expression level is indicative for the subtype of bone endothelial cells mediating growth of bone vasculature.

Disclosed herein are methods for reducing expression of C90RF72 antisense transcript in an animal with C90RF72 antisense transcript specific inhibitors. Such methods are useful to treat, prevent, or ameliorate neurodegenerative diseases in an individual in need thereof. Such C90RF72 antisense transcript specific inhibitors include antisense compounds.

1. A method, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor. 2. A method, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor and a C9ORF72 sense transcript specific inhibitor. 3. A method, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor; and thereby reducing the level or expression of C9ORF72 antisense transcript in the cell. 4. A method, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor and a C9ORF72 sense transcript specific inhibitor; and thereby reducing the level or expression of both C9ORF72 antisense transcript and C9ORF72 sense transcript in the cell. 5. The method of any of claim 1-4, wherein the C9ORF72 antisense specific inhibitor is an antisense compound. 6. The method of any of claim 4 or 5, wherein the C9ORF72 antisense transcript specific inhibitor is an antisense compound. 7. The method of any of claims 1-6, wherein the cell is in vitro. 8. The method of any of claims 1-6, wherein the cell is in an animal. 9. A method, comprising administering to an animal in need thereof a therapeutically effective amount of a C9ORF72 antisense transcript specific inhibitor. 10. The method of claim 9, wherein said amount is effective to reduce the level or expression of the C9ORF72 antisense transcript. 11. A method, comprising coadministering to an animal in need thereof a therapeutically effective amount of a C9ORF72 antisense transcript inhibitor and a therapeutically effective amount of a C9ORF72 sense transcript inhibitor. 12. The method of claim 11, wherein said amount is effective to reduce the level or expression of the C9ORF72 antisense transcript and the C9ORF72 sense transcript. 13. The method of claim 9-12, wherein the C9ORF72 antisense transcript inhibitor is a C9ORF72 antisense transcript specific antisense compound. 14. The method of claims 11-13, wherein the C9ORF72 sense transcript inhibitor is a C9ORF72 sense transcript specific antisense compound. 15. A method, comprising: identifying an animal having a C9ORF72 associated disease; and administering to the animal a therapeutically effective amount of a C9ORF72 antisense transcript specific inhibitor. 16. The method of claim 15, wherein the amount is effective to reduce the level or expression of the C9OR72 antisense transcript. 17. A method, comprising: identifying an animal having a C9ORF72 associated disease; and coadministering to the animal a therapeutically effective amount of a C9ORF72 antisense transcript specific inhibitor and a therapeutically effective amount of a C9ORF72 sense transcript inhibitor. 18. The method of claim 17, wherein said amount is effective to reduce the level or expression of the C9ORF72 antisense transcript and the C9ORF72 sense transcript. 19. The method of claims 15-18, wherein the C9ORF72 antisense transcript specific inhibitor is a C9ORF72 antisense transcript specific antisense compound. 20. The method of claims 17-19, wherein the C9ORF72 sense transcript inhibitor is a C9ORF72 sense transcript specific antisense compound. 21. The method of any preceding claim, wherein the C9ORF72 antisense transcript specific antisense compound is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C9ORF72 antisense transcript. 22. The method of any preceding claim, wherein the C9ORF72 sense transcript specific antisense compound is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C9ORF72 sense transcript. 23. The method of any preceding claim, wherein the C9ORF72 antisense transcript is SEQ ID NO: 11. 24. The method of any preceding claim, wherein the C9ORF72 sense transcript is any of SEQ ID NO: 1-10. 25. The method of claims 15-24, wherein the C9ORF72 associated disease is a C9ORF72 hexanucleotide repeat expansion associated disease. 26. The method of claims 19-25, wherein the C9ORF72 associated disease or C9ORF72 hexanucleotide repeat expansion associated disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticalbasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, or olivopontocerellar degeneration (OPCD). 27. The method of claim 26, wherein the amyotrophic lateral sclerosis (ALS) is familial ALS or sporadic ALS. 28. The method of any preceding claim, wherein the contacting or administering reduces C9ORF72 foci. 29. The method of claim 28, wherein the C9ORF72 foci are C9ORF72 sense foci. 30. The method of claim 28, wherein the C9ORF72 foci are C9ORF72antisense foci. 31. The method of claim 28, wherein the C9ORF72 foci are both C9ORF72 sense foci and C9ORF72 antisense foci. 32. The method of any preceding claim, wherein the contacting or administering reduces C9ORF72 antisense transcript associated RAN translation products. 33. The method of claim 33, wherein the C9ORF72 antisense transcript associated RAN translation products are any of poly-(proline-alanine), poly-(proline-arginine), and poly-(proline-glycine). 34. The method of claims 15-33, wherein the administering and coadministering is parenteral administration. 35. The method of claim 35, wherein the parental administration is any of injection or infusion. 36. The method of claims 34 and 35, wherein the parenteral administration is any of intrathecal administration or intracerebroventricular administration. 37. The method of claims 19-24, wherein at least one symptom of a C9ORF72 associated disease or a C9ORF72 hexanucleotide repeat expansion associated disease is slowed, ameliorated, or prevented. 38. The method of claim 37, wherein at least one symptom is any of motor function, respiration, muscle weakness, fasciculation and cramping of muscles, difficulty in projecting the voice, shortness of breath, difficulty in breathing and swallowing, inappropriate social behavior, lack of empathy, distractibility, changes in food preferences, agitation, blunted emotions, neglect of personal hygiene, repetitive or compulsive behavior, and decreased energy and motivation. 39. The method of any preceding claim, wherein the C9ORF72 antisense transcript specific antisense compound is an antisense oligonucleotide. 40. The method of any preceding claim, wherein the C9ORF72 sense transcript specific antisense compound is an antisense oligonucleotide. 41. The method of claim 39 or 40, wherein the antisense oligonucleotide is a modified antisense oligonucleotide. 42. The method of claim 41, wherein at least one internucleoside linkage of the antisense oligonucleotide is a modified internucleoside linkage. 43. The method of claim 42, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. 44. The method of claim 43, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage. 45. The method of claims 39-44, wherein at least one nucleoside of the modified antisense oligonucleotide comprises a modified nucleobase. 46. The method of claim 45, wherein the modified nucleobase is a 5-methylcytosine. 47. The method of claims 39-46, wherein at least one nucleoside of the modified antisense oligonucleotide comprises a modified sugar. 48. The method of claim 47, wherein the at least one modified sugar is a bicyclic sugar. 49. The method of claim 48, wherein the bicyclic sugar comprises a chemical bridge between the 2′ and 4′ position of the sugar, wherein the chemical bridge is selected from: 4′-CH2—O-2′; 4′-CH(CH3)—O-2′; 4′-(CH2)2—O-2′; and 4′-CH2—N(R)—O-2′ wherein R is, independently, H, C1-C12 alkyl, or a protecting group. 50. The method of claim 47, wherein at least one modified sugar comprises a 2′-O-methoxyethyl group. 51. The method of any preceding claim, wherein the antisense oligonucleotide is a gapmer.

Disclosed herein are methods for reducing expression of C90RF72 antisense transcript in an animal with C90RF72 antisense transcript specific inhibitors. Such methods are useful to treat, prevent, or ameliorate neurodegenerative diseases in an individual in need thereof. Such C90RF72 antisense transcript specific inhibitors include antisense compounds.1. A method, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor. 2. A method, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor and a C9ORF72 sense transcript specific inhibitor. 3. A method, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor; and thereby reducing the level or expression of C9ORF72 antisense transcript in the cell. 4. A method, comprising contacting a cell with a C9ORF72 antisense transcript specific inhibitor and a C9ORF72 sense transcript specific inhibitor; and thereby reducing the level or expression of both C9ORF72 antisense transcript and C9ORF72 sense transcript in the cell. 5. The method of any of claim 1-4, wherein the C9ORF72 antisense specific inhibitor is an antisense compound. 6. The method of any of claim 4 or 5, wherein the C9ORF72 antisense transcript specific inhibitor is an antisense compound. 7. The method of any of claims 1-6, wherein the cell is in vitro. 8. The method of any of claims 1-6, wherein the cell is in an animal. 9. A method, comprising administering to an animal in need thereof a therapeutically effective amount of a C9ORF72 antisense transcript specific inhibitor. 10. The method of claim 9, wherein said amount is effective to reduce the level or expression of the C9ORF72 antisense transcript. 11. A method, comprising coadministering to an animal in need thereof a therapeutically effective amount of a C9ORF72 antisense transcript inhibitor and a therapeutically effective amount of a C9ORF72 sense transcript inhibitor. 12. The method of claim 11, wherein said amount is effective to reduce the level or expression of the C9ORF72 antisense transcript and the C9ORF72 sense transcript. 13. The method of claim 9-12, wherein the C9ORF72 antisense transcript inhibitor is a C9ORF72 antisense transcript specific antisense compound. 14. The method of claims 11-13, wherein the C9ORF72 sense transcript inhibitor is a C9ORF72 sense transcript specific antisense compound. 15. A method, comprising: identifying an animal having a C9ORF72 associated disease; and administering to the animal a therapeutically effective amount of a C9ORF72 antisense transcript specific inhibitor. 16. The method of claim 15, wherein the amount is effective to reduce the level or expression of the C9OR72 antisense transcript. 17. A method, comprising: identifying an animal having a C9ORF72 associated disease; and coadministering to the animal a therapeutically effective amount of a C9ORF72 antisense transcript specific inhibitor and a therapeutically effective amount of a C9ORF72 sense transcript inhibitor. 18. The method of claim 17, wherein said amount is effective to reduce the level or expression of the C9ORF72 antisense transcript and the C9ORF72 sense transcript. 19. The method of claims 15-18, wherein the C9ORF72 antisense transcript specific inhibitor is a C9ORF72 antisense transcript specific antisense compound. 20. The method of claims 17-19, wherein the C9ORF72 sense transcript inhibitor is a C9ORF72 sense transcript specific antisense compound. 21. The method of any preceding claim, wherein the C9ORF72 antisense transcript specific antisense compound is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C9ORF72 antisense transcript. 22. The method of any preceding claim, wherein the C9ORF72 sense transcript specific antisense compound is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C9ORF72 sense transcript. 23. The method of any preceding claim, wherein the C9ORF72 antisense transcript is SEQ ID NO: 11. 24. The method of any preceding claim, wherein the C9ORF72 sense transcript is any of SEQ ID NO: 1-10. 25. The method of claims 15-24, wherein the C9ORF72 associated disease is a C9ORF72 hexanucleotide repeat expansion associated disease. 26. The method of claims 19-25, wherein the C9ORF72 associated disease or C9ORF72 hexanucleotide repeat expansion associated disease is amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), corticalbasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, or olivopontocerellar degeneration (OPCD). 27. The method of claim 26, wherein the amyotrophic lateral sclerosis (ALS) is familial ALS or sporadic ALS. 28. The method of any preceding claim, wherein the contacting or administering reduces C9ORF72 foci. 29. The method of claim 28, wherein the C9ORF72 foci are C9ORF72 sense foci. 30. The method of claim 28, wherein the C9ORF72 foci are C9ORF72antisense foci. 31. The method of claim 28, wherein the C9ORF72 foci are both C9ORF72 sense foci and C9ORF72 antisense foci. 32. The method of any preceding claim, wherein the contacting or administering reduces C9ORF72 antisense transcript associated RAN translation products. 33. The method of claim 33, wherein the C9ORF72 antisense transcript associated RAN translation products are any of poly-(proline-alanine), poly-(proline-arginine), and poly-(proline-glycine). 34. The method of claims 15-33, wherein the administering and coadministering is parenteral administration. 35. The method of claim 35, wherein the parental administration is any of injection or infusion. 36. The method of claims 34 and 35, wherein the parenteral administration is any of intrathecal administration or intracerebroventricular administration. 37. The method of claims 19-24, wherein at least one symptom of a C9ORF72 associated disease or a C9ORF72 hexanucleotide repeat expansion associated disease is slowed, ameliorated, or prevented. 38. The method of claim 37, wherein at least one symptom is any of motor function, respiration, muscle weakness, fasciculation and cramping of muscles, difficulty in projecting the voice, shortness of breath, difficulty in breathing and swallowing, inappropriate social behavior, lack of empathy, distractibility, changes in food preferences, agitation, blunted emotions, neglect of personal hygiene, repetitive or compulsive behavior, and decreased energy and motivation. 39. The method of any preceding claim, wherein the C9ORF72 antisense transcript specific antisense compound is an antisense oligonucleotide. 40. The method of any preceding claim, wherein the C9ORF72 sense transcript specific antisense compound is an antisense oligonucleotide. 41. The method of claim 39 or 40, wherein the antisense oligonucleotide is a modified antisense oligonucleotide. 42. The method of claim 41, wherein at least one internucleoside linkage of the antisense oligonucleotide is a modified internucleoside linkage. 43. The method of claim 42, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. 44. The method of claim 43, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage. 45. The method of claims 39-44, wherein at least one nucleoside of the modified antisense oligonucleotide comprises a modified nucleobase. 46. The method of claim 45, wherein the modified nucleobase is a 5-methylcytosine. 47. The method of claims 39-46, wherein at least one nucleoside of the modified antisense oligonucleotide comprises a modified sugar. 48. The method of claim 47, wherein the at least one modified sugar is a bicyclic sugar. 49. The method of claim 48, wherein the bicyclic sugar comprises a chemical bridge between the 2′ and 4′ position of the sugar, wherein the chemical bridge is selected from: 4′-CH2—O-2′; 4′-CH(CH3)—O-2′; 4′-(CH2)2—O-2′; and 4′-CH2—N(R)—O-2′ wherein R is, independently, H, C1-C12 alkyl, or a protecting group. 50. The method of claim 47, wherein at least one modified sugar comprises a 2′-O-methoxyethyl group. 51. The method of any preceding claim, wherein the antisense oligonucleotide is a gapmer.

Disclosed herein are compositions and methods for reducing expression of C90RF72 antisense transcript in an animal with C90RF72 antisense transcript specific inhibitors. Such methods are useful to treat, prevent, or ameliorate neurodegenerative diseases in an individual in need thereof. Such C90RF72 antisense transcript specific inhibitors include antisense compounds.

1. A compound comprising a C9ORF72 antisense transcript specific inhibitor. 2. The compound of claim 1 wherein the C9ORF72 antisense transcript specific inhibitor is a C9ORF72 antisense transcript specific antisense compound. 3. The compound of claim 2, wherein the C9ORF72 antisense transcript specific antisense compound comprises an antisense oligonucleotide. 4. The compound of claim 3, wherein the antisense oligonucleotide consists of 12-30 linked nucleosides. 5. The compound of claim 3, wherein the antisense oligonucleotide consists of 16-25 linked nucleosides. 6. The compound of claim 3, wherein the antisense oligonucleotide consists of 18-22 linked nucleosides 7. The compound of any of claims 3-6, wherein the antisense oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C9ORF72 antisense transcript. 8. The compound of any of claims 3-6, wherein the antisense oligonucleotide has a nucleobase sequence that is at least 90% complementary to a C9ORF72 antisense transcript. 9. The compound of any of claims 3-6, wherein the antisense oligonucleotide has a nucleobase sequence that is at least 95% complementary to a C9ORF72 antisense transcript. 10. The compound of any of claims 3-6, wherein the antisense oligonucleotide has a nucleobase sequence that is 100% complementary to a C9ORF72 antisense transcript. 11. The compound of any of claims 10-13, wherein the C9ORF72 antisense transcript is SEQ ID NO: 11. 12. The compound of any of claims 3-10, wherein the antisense oligonucleotide has a nucleobase sequence comprising least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of a sequence selected from among SEQ ID NO: 19-20, 22-26, 28-32, 34-42, 44, 46-55, 58-59, and 61. 13. The compound of claim 3-11, wherein the antisense oligonucleotide is a modified antisense oligonucleotide. 14. The compound of claim 12, wherein the modified antisense oligonucleotide comprises at least one modified internucleoside linkage. 15. The compound of claim 13, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. 16. The compound of claim 14, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage. 17. The compound of any of claims 12-15 wherein the modified antisense oligonucleotide comprises at least one phosphodiester internucleoside linkage. 18. The compound of claims 12-15, wherein at least one nucleoside of the modified antisense oligonucleotide comprises a modified nucleobase. 19. The compound of claim 16, wherein the modified nucleobase is a 5-methylcytosine. 20. The compound of claims 12-17, wherein at least one nucleoside of the modified antisense oligonucleotide comprises a modified sugar. 21. The compound of claim 18, wherein the at least one modified sugar is a bicyclic sugar. 22. The compound of claim 19, wherein the bicyclic sugar comprises a chemical bridge between the 2′ and 4′ position of the sugar, wherein the chemical bridge is selected from: 4′-CH2—O-2′; 4′-CH(CH3)—O-2′; 4′-(CH2)2—O-2′; and 4′-CH2—N(R)—O-2′ wherein R is, independently, H, C1-C12 alkyl, or a protecting group. 23. The compound of claim 18, wherein at least one modified sugar comprises a 2′-O-methoxyethyl group. 24. The compound of any of claims 12-22, wherein the antisense oligonucleotide is a gapmer. 25. The compound of any of claims 12-23, wherein the antisense oligonucleotide is single-stranded. 26. The compound of any of claims 2-24, wherein the C9ORF72 antisense transcript specific antisense compound comprises at least one conjugate. 27. The compound of any of claims 2-24, wherein the C9ORF72 antisense transcript specific antisense compound consists of an antisense oligonucleotide. 28. A pharmaceutical composition comprising the compound of any of claims 1-26 and a pharmaceutically acceptable diluent or carrier. 29. A pharmaceutical composition of claim 27 further comprising a C9ORF72 sense transcript specific inhibitior. 30. The pharmaceutical composition of claim 28, wherein the C9ORF72 sense transcript specific inhibitor is a C9ORF72 sense transcript specific antisense compound. 31. The pharmaceutical composition of claim 29, wherein the C9ORF72 sense transcript specific antisense compound is an antisense oligonucleotide. 32. A pharmaceutical composition comprising a C9ORF72 antisense transcript specific inhibitor and a C9ORF sense transcript specific inhibitior. 33. The pharmaceutical composition of claim 32, wherein the C9ORF72 sense transcript specific inhibitor is a C9ORF72 sense transcript specific antisense compound. 34. The pharmaceutical composition of claim 32, wherein the C9ORF72 antisense transcript specific inhibitor is a C9ORF72 antisense transcript specific antisense compound. 35. The pharmaceutical composition of claim 33, wherein the C9ORF72 sense transcript specific antisense compound is an antisense oligonucleotide 36. The pharmaceutical composition of claim 34, wherein the C9ORF72 antisense transcript specific antisense compound is an antisense oligonucleotide. 37. The pharmaceutical composition of claims 29-36, wherein the antisense transcript is SEQ ID NO: 11. 38. The pharmaceutical composition of claims 29-36, wherein the antisense transcript is any of SEQ ID NOs: 1-10. 39. Use of the compound of any preceding claim for the manufacture of a medicament for treating a neurodegenerative disease.

Disclosed herein are compositions and methods for reducing expression of C90RF72 antisense transcript in an animal with C90RF72 antisense transcript specific inhibitors. Such methods are useful to treat, prevent, or ameliorate neurodegenerative diseases in an individual in need thereof. Such C90RF72 antisense transcript specific inhibitors include antisense compounds.1. A compound comprising a C9ORF72 antisense transcript specific inhibitor. 2. The compound of claim 1 wherein the C9ORF72 antisense transcript specific inhibitor is a C9ORF72 antisense transcript specific antisense compound. 3. The compound of claim 2, wherein the C9ORF72 antisense transcript specific antisense compound comprises an antisense oligonucleotide. 4. The compound of claim 3, wherein the antisense oligonucleotide consists of 12-30 linked nucleosides. 5. The compound of claim 3, wherein the antisense oligonucleotide consists of 16-25 linked nucleosides. 6. The compound of claim 3, wherein the antisense oligonucleotide consists of 18-22 linked nucleosides 7. The compound of any of claims 3-6, wherein the antisense oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a C9ORF72 antisense transcript. 8. The compound of any of claims 3-6, wherein the antisense oligonucleotide has a nucleobase sequence that is at least 90% complementary to a C9ORF72 antisense transcript. 9. The compound of any of claims 3-6, wherein the antisense oligonucleotide has a nucleobase sequence that is at least 95% complementary to a C9ORF72 antisense transcript. 10. The compound of any of claims 3-6, wherein the antisense oligonucleotide has a nucleobase sequence that is 100% complementary to a C9ORF72 antisense transcript. 11. The compound of any of claims 10-13, wherein the C9ORF72 antisense transcript is SEQ ID NO: 11. 12. The compound of any of claims 3-10, wherein the antisense oligonucleotide has a nucleobase sequence comprising least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of a sequence selected from among SEQ ID NO: 19-20, 22-26, 28-32, 34-42, 44, 46-55, 58-59, and 61. 13. The compound of claim 3-11, wherein the antisense oligonucleotide is a modified antisense oligonucleotide. 14. The compound of claim 12, wherein the modified antisense oligonucleotide comprises at least one modified internucleoside linkage. 15. The compound of claim 13, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. 16. The compound of claim 14, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage. 17. The compound of any of claims 12-15 wherein the modified antisense oligonucleotide comprises at least one phosphodiester internucleoside linkage. 18. The compound of claims 12-15, wherein at least one nucleoside of the modified antisense oligonucleotide comprises a modified nucleobase. 19. The compound of claim 16, wherein the modified nucleobase is a 5-methylcytosine. 20. The compound of claims 12-17, wherein at least one nucleoside of the modified antisense oligonucleotide comprises a modified sugar. 21. The compound of claim 18, wherein the at least one modified sugar is a bicyclic sugar. 22. The compound of claim 19, wherein the bicyclic sugar comprises a chemical bridge between the 2′ and 4′ position of the sugar, wherein the chemical bridge is selected from: 4′-CH2—O-2′; 4′-CH(CH3)—O-2′; 4′-(CH2)2—O-2′; and 4′-CH2—N(R)—O-2′ wherein R is, independently, H, C1-C12 alkyl, or a protecting group. 23. The compound of claim 18, wherein at least one modified sugar comprises a 2′-O-methoxyethyl group. 24. The compound of any of claims 12-22, wherein the antisense oligonucleotide is a gapmer. 25. The compound of any of claims 12-23, wherein the antisense oligonucleotide is single-stranded. 26. The compound of any of claims 2-24, wherein the C9ORF72 antisense transcript specific antisense compound comprises at least one conjugate. 27. The compound of any of claims 2-24, wherein the C9ORF72 antisense transcript specific antisense compound consists of an antisense oligonucleotide. 28. A pharmaceutical composition comprising the compound of any of claims 1-26 and a pharmaceutically acceptable diluent or carrier. 29. A pharmaceutical composition of claim 27 further comprising a C9ORF72 sense transcript specific inhibitior. 30. The pharmaceutical composition of claim 28, wherein the C9ORF72 sense transcript specific inhibitor is a C9ORF72 sense transcript specific antisense compound. 31. The pharmaceutical composition of claim 29, wherein the C9ORF72 sense transcript specific antisense compound is an antisense oligonucleotide. 32. A pharmaceutical composition comprising a C9ORF72 antisense transcript specific inhibitor and a C9ORF sense transcript specific inhibitior. 33. The pharmaceutical composition of claim 32, wherein the C9ORF72 sense transcript specific inhibitor is a C9ORF72 sense transcript specific antisense compound. 34. The pharmaceutical composition of claim 32, wherein the C9ORF72 antisense transcript specific inhibitor is a C9ORF72 antisense transcript specific antisense compound. 35. The pharmaceutical composition of claim 33, wherein the C9ORF72 sense transcript specific antisense compound is an antisense oligonucleotide 36. The pharmaceutical composition of claim 34, wherein the C9ORF72 antisense transcript specific antisense compound is an antisense oligonucleotide. 37. The pharmaceutical composition of claims 29-36, wherein the antisense transcript is SEQ ID NO: 11. 38. The pharmaceutical composition of claims 29-36, wherein the antisense transcript is any of SEQ ID NOs: 1-10. 39. Use of the compound of any preceding claim for the manufacture of a medicament for treating a neurodegenerative disease.