article
stringlengths 81
710k
| abstract
stringlengths 226
4.35k
| section_names
stringlengths 1
1.16k
|
|---|---|---|
in their january 2013 study , fang et al . reviewed almost 20 years of cases of scientific misconduct reported by the u.s .
fang et al . further found that 65% of those who committed misconduct were male and that of the 72 faculty members who committed misconduct , 88% were male .
these norms support the possibility that men are more likely than women to commit fraud in the scientific arena , but they also support a willingness to assume that men are more likely to commit scientific fraud in the face of incomplete data . being willing to take risks is more strongly associated with the male gender , while being timid is more strongly associated with the female gender ( 2 , 3 ) .
it is possible that lifelong reinforcement of these scripts of acceptable male and female behavior , or schemas ( 4 ) , could lower the bar for men to engage in the risky behavior of scientific misconduct .
department of justice , men are about 6 times more likely than women to be arrested for almost all crimes ( 5 ) .
it is also possible that men and women are equivalent in actually engaging in scientific misconduct but that , as acknowledged by fang et al .
this would be predicted from the operation of gender schemas affecting evaluative judgments in stereotype congruent activities .
when one gender is overrepresented in any role , it leads to an assumption that the activity requires traits stereotypically associated with that gender ( 6 ) .
the male gender schema includes being independent and directive , which has led to the assumption that effective leadership requires these behaviors ( 7 , 8) in spite of experimental and field evidence to the contrary ( 9 , 10 ) .
most criminals are men , making criminal activity a male - gendered activity and leading to the implicit assumption that stereotypically male qualities are required to commit a crime .
when assessing the ability of a woman to perform a task stereotypically associated with males , evaluators consistently require more proof to confirm her competence than they do for a man being evaluated for the same task ( 11 ) . extrapolating this body of research to scientific misconduct
, one would predict that it requires more evidence to conclude that a female scientist was competent at committing fraud than a male scientist .
fang et al . admit that they do not know how many cases were investigated by ori , but the gender distribution of this group might be revealing , although , even if men are overrepresented in the cases investigated by ori , the requirement for higher evidentiary proof of fraud for female scientists might have filtered out more women than men before reaching the level of an ori investigation .
social norms also lead women to apologize more often than men ( 12 ) and to the assumption that women are more likeable than men ( 13 , 14 ) .
apology alone can prevent legal action in some situations ( 15 ) , and greater likeability might prevent escalation of scientific errors to the level of an investigation ( 1618 ) . when presented with partial or ambiguous information ,
humans fill in cognitive gaps with knowledge from assumptions that may be based on implicit group stereotypes ( 4 , 19 ) . to conclude from the data of fang et al . that men are more likely than women to commit scientific fraud relies on these same cognitive biases because we do not have enough data to support this conclusion .
we can not conclude that , simply because risk taking aligns with male gender stereotypes , men are more likely to risk the consequences of committing scientific misconduct .
neither can we conclude that , because men are more likely than women to commit fraud in other contexts , men are also more likely than women to commit scientific fraud .
it is possible that men are overrepresented among ori scientific misconduct cases , but there are too many assumptions we need to make with the data presented by fang et al . to reach this conclusion even if these conclusions comfortably align with cultural stereotypes .
the numbers are small , and more certainty with respect to the percentages of males and females in the pool of potential perpetrators is needed .
nearly all instances of misconduct that they cite were in the life sciences , but if even a small percentage were from engineering , the probabilities of males versus females committing fraud might not be significantly different .
indicates that approximately 45% of graduate students in the life sciences are male ( and this aligns with the percentage of male graduate students receiving nih funding in either individual or institutional grants ) ( 20 ) , while about 70% of all science and engineering graduate students are male . using exact binomial probabilities ,
the 58% of male ori cases ( 16% of 228 cases = 36 students ; 58% of 36 = 21 males ) is significantly greater than the percentage of female cases if males comprise 45% of the pool ( p = 0.04 ) but not if they comprise 48% ( p = 0.06 ) or more .
shows that approximately 61% of life science postdoctoral students are male ( somewhat more than the 50 to 58% of nih - funded postdoctoral students ) ( 20 ) whereas approximately 67% of all science and engineering postdoctoral students are male .
exact binomial probabilities indicate that the 69% of male ori postdoctoral student cases ( 25% of 228 cases
= 57 postdoctoral students ; 69% of 57 = 39 males ) is significantly greater than the proportion of female cases if males comprise 50 to 58% of the pool ( p < 0.05 ) but not 61% or more . at the faculty level , fang et al . use as their denominator the proportion of men and women in the scientific workforce to conclude that male scientists are overrepresented among ori cases of fraud .
if we use nih research award dollars as a proxy for the opportunity to commit fraud in the life sciences , we find that men have substantially more opportunity to commit fraud than women .
compared to women , men are more likely to hold multiple simultaneous r01 awards , lead large center grants , and successfully compete when submitting renewals ( 2022 ) . on average , men s research awards are approximately $ 100,000 larger ( 20 ) .
while these gender differences in nih funding may lead to fewer cases of scientific misconduct by women , they may represent another way in which gender schemas can jeopardize scientific progress .
science , like fraud , is a strongly male - gendered domain ( 23 ) in which one would predict that peer reviewers of grant proposals would implicitly adjust evaluative standards to require a higher level of proof of competence from women than men .
there is no arguing with the conclusions by fang et al . that as a community we need to develop effective ways of ensuring that scientific research is conducted responsibly and ethically .
scientific misconduct , regardless of who commits it , diminishes all who contribute to the scientific enterprise .
we must also be wary that , regardless of our commitment to objectivity and meritocratic principles , gender schemas influence decision - making processes in subtle ways that put us all at risk of contributing to the perpetuation of gender bias in science . | abstract in their study published in january 2013 in mbio , fang et al . reviewed records from the office of research integrity ( ori ) and found more cases of scientific misconduct committed by men than women , particularly by faculty ( f. c. fang , j. w. bennett , and a. casadevall , mbio 4:13 , 2013 ) .
powerful social norms shape the way men and women behave , and implicit gender schemas can lead to different evaluation standards for men and women for tasks stereotypically linked to one gender .
it is possible that norms for acceptable male and female behavior could lead to a lower threshold for men than women to engage in the risky behavior of scientific misconduct .
it is also possible that women and men commit scientific fraud at the same rate but that , because crime is a male - gendered domain , evaluators require more proof of the criminal competence of women for an investigation to rise to the level of an ori case or that female gender norms for likeability and a lower apology threshold more often prevent escalation of women s fraud beyond a local level .
male scientists also have more opportunity to commit fraud than female scientists because they receive more nih research funding a finding that may also be influenced by gender schemas .
we can not conclude from the ori data that men are more likely than women to risk the consequences of committing scientific misconduct simply because risk taking aligns with male gender stereotypes .
neither can we conclude that because men are more likely than women to commit fraud in other contexts , men are also more likely than women to commit scientific fraud .
we can conclude , however , that scientific misconduct , regardless of who commits it , diminishes all who contribute to the scientific enterprise . | Commentary |
two patients experienced single events of violent psychosis after the tricyclic antidepressant nortriptyline was prescribed in low dosages . both patients
were female , one caucasian and the other asian . both were drug nave with no history of any prescription or illicit drug use prior to the initiation of treatment
both patients had neither history of antisocial behaviour nor any family history of psychosis .
patient afemale , 40 years old , caucasian , with no history of violent behaviour or psychotic disorders in her family .
her doctor recognised depression and prescribed nortriptyline , 10 mg 4 times / day . according to her husband , the next day she started to behave abnormally , complaining that she was hearing strange voices . on the third day , she experienced a sever psychotic episode .
as the patient herself described , she felt dizzy , disorientated and was suffering from delusions . since withdrawal of the drug , she has not experienced another episode .
female , 40 years old , caucasian , with no history of violent behaviour or psychotic disorders in her family .
her doctor recognised depression and prescribed nortriptyline , 10 mg 4 times / day . according to her husband , the next day she started to behave abnormally , complaining that she was hearing strange voices . on the third day , she experienced a sever psychotic episode .
as the patient herself described , she felt dizzy , disorientated and was suffering from delusions . since withdrawal of the drug , she has not experienced another episode .
patient bfemale , 17 years old , asian , with no history of violent behaviour or psychotic disorders in her family .
depression was recognised by her doctor and nortriptyline was prescribed , 10 mg 3 times / day .
after two weeks , she was admitted to the hospital with a severe psychotic episode . since withdrawal of the drug
female , 17 years old , asian , with no history of violent behaviour or psychotic disorders in her family .
depression was recognised by her doctor and nortriptyline was prescribed , 10 mg 3 times / day .
after two weeks , she was admitted to the hospital with a severe psychotic episode . since withdrawal of the drug
epidemiological studies suggest that depression is the second most significant cause of disability in the health care arena .
up to 10% of the population at any one point in time may be depressed and up to 45% of the population may , at some point during their lifetime , suffer from a depressive episode .
tricyclic antidepressants ( tcas ) are an older class of medication used for mood disorders and major depression .
the mechanism of action is through blocking of the neuronal uptake of norepinephrine , serotonin , and dopamine .
anti - cholinergic , adrenergic and alpha - blocking actions of tcas contribute to various side effects .
this can be problematic in a case of overdose because both forced diuresis and hemodialysis are not helpful in eliminating the drug from the system .
tcas are high - clearance drugs that are metabolised via multiple pathways involving both phase i ( p450 ) and phase ii ( glucuronidation ) processes .
elimination is dependent on hepatic hydroxylation via the cytochrome p450 mixed - function oxidase system , especially cyp2d6 [ 36 ] , and conjugation with glucuronic acid .
drugs which are the substrates for cyp2d6 are known to interfere with tca metabolism [ 811 ] , confirming the importance of cyp2d6 in nortriptyline metabolism . a significant correlation between amitriptyline clearance and
the debrisoquine metabolic ratio has been observed in non - smokers , supporting some cyp2d6 dependence .
tricyclic antidepressants have a moderate therapeutic index , as they produce significant adverse effects at therapeutic concentrations and are dangerous in overdose .
significant side effects of tcas are common and their prevalence is estimated as high as 5% , while acute poisoning with tcas is potentially life threatening .
central nervous system manifestations of toxicity include agitation , stupor , coma , seizure , and manic excitement .
the plasma level correlates poorly with the severity of symptoms , and peak blood levels over 1000 ng / ml have a higher risk of cardiac and cns toxicity [ 13 , 14 ] .
tcas exist as tertiary or secondary amines and the tertiary forms are metabolised to secondary amines .
both tertiary and secondary amines are active , as are some of the subsequent hydroxylated metabolites .
the tertiary amines are metabolised by many p450s , whereas the secondary amines are largely metabolised by cyp2d6 ( figure 1 ) .
the major metabolite produced by cyp2d6 , e-10-hydroxynortriptyline , has approximately half the potency of the parent drug in inhibiting noradrenaline reuptake and greatly reduced anticholinergic activity .
it is often present at comparable ( or higher ) concentrations to the parent drug and may contribute to the antidepressant effects .
it is now recognised that genetic polymorphism differences in the metabolism of drugs can have a great influence on the efficacy and toxicity of medications .
people with a particular genotype , or genetic characteristic , may suffer adverse responses to particular drugs , and such responses may be traced through families , ethnic groups , and geographic clusters .
all pharmacogenetic polymorphisms , or relatively stable variations of the genes involved in drug metabolism , have been found to differ in frequency among some ethnic and racial groups .
many of these drugs are antipsychotic or antidepressant drugs , making it an important metabolic enzyme for psychiatry .
racial and ethnic studies of drug metabolism have shown substantial interpopulation differences in cyp2d6 enzyme activity .
the activity of the cyp2d6 enzyme is extremely variable , due to the more than 50 recognised genetic variations , and it can be described as having four main levels of activity ( http://www.cypalleles.ki.se/ ) .
the most important phenotype is the loss - of - function polymorphism or in some nomenclatures poor metaboliser ( pm ) .
the prevalence of loss - of - function polymorphisms in different ethnic groups has been extensively studied . in caucasian populations ,
about 1% [ 2024 ] and 019% in the african population [ 2123 , 25 ] .
the prevalence of ultraextensive metabolisers is reported with a prevalence of 1.529% in different ethnic groups .
the ethnic variability in cyp2d6 activity can be attributed to genetic polymorphism of the cyp2d6 gene as a result of multiple mechanisms , including single point mutation , insertions or deletions , complete gene deletions , and gene duplication and multiplication .
the major genetic polymorphisms associated with the poor metabolism phenotype lead to the complete lack of a functional protein .
the most common allele associated with poor metabolism is cyp2d6 * 4 which accounts for more than 70% of cyp2d6 alleles in loss - of - function polymorphism subjects .
gough et al . identified a g - to - a transition at the first nucleotide of exon 4 in the cyp2d6 gene , resulting in a shift of the splice site and introduction of a premature termination codon .
the mutant protein had no residual activity . in dna from an individual who was deficient in debrisoquine metabolism , hanioka et al
. identified a 1934g - a transition ( cyp2d6 * 4 ) at the junction of the third intron and fourth exon , resulting in an aberrant 3-prime splice recognition site and an mrna with a single basepair deletion .
they showed that the cyp2d6 * 4 homozygote or heterozygote state produces nonfunctional proteins , which is the cause of poor drug metabolism .
cyp2d6 1934g > a ( also seen as 1846g > a in the literature ) is diagnostic for the nonfunctional cyp2d6 * 4 haplotype .
this variant is responsible for the majority of loss - of - function polymorphisms found in caucasian populations and is also found at much lower frequencies in other populations , such as koreans .
( also seen as 188c > t in the literature ) is part of both the nonfunctional cyp2d6 * 4 haplotype and the reduced function cyp2d6 * 10 haplotype . according to gaedigk
et al . , the presence of cyp2d6 100c > t ( 188c > t ) is diagnostic of cyp2d6 * 10 . in vitro studies in both
cos-1 and v79 cells have shown that cells transfected with cyp2d6 100c > t alone exhibit reduced function , suggesting that this mutation contributes to the reduced function of the cyp2d6 * 10 allele .
some attempts have been made to find an association of this polymorphism with generalised tonic clonic seizures , as seen in epilepsy and tardive dyskinesia , in chinese schizophrenic patients . in 1998
daln et al . reported 3.3- , 2.8- , and 0.7-fold differences in the mean nortriptyline clearance between the groups of different cyp2d6 genotypes in caucasians .
changes in clearance have also been seen with reduced activity alleles , including cyp2d6 * 10 , in asian subjects [ 39 , 40 ] .
. demonstrated that dysfunctional cyp2d6 alleles had a greater risk of side effects with amitriptyline , 150 mg daily , than those with two functional alleles ( 77% versus 12% ) , and this risk was associated with higher nortriptyline concentrations .
dizziness and sedation have been described with elevated nortriptyline concentrations in patients with a loss - of - function cyp2d6 genotype and individuals receiving cyp2d6 inhibitors [ 42 , 43 ] .
it was also shown that patients with ultrahigh activity of cyp2d6 showed treatment resistance .
it is not a surprise that clinical symptoms , like salivation , accommodation , sedation , blood pressure , and pulse rate did not vary between genotypes in a single - dose study in healthy subjects nor of patients with depression . also some results suggested that cyp2d6 polymorphisms did not influence the rate of adverse reactions to nortriptyline ; however , with only 10 poor metabolisers ( and the involvement of two drugs ) , the study was underpowered to detect moderate or small differences .
as the main nortriptyline metabolite is active , altered parent / metabolite ratios may be the reason that altered effects have been difficult to demonstrate ; that is , there is minimal change in overall molar activity .
it is notable that the major metabolite does not seem to have been measured in most of the assessments and is not considered clinically during therapeutic drug monitoring .
many factors can influence the efficacies and adverse reactions of medications , including age , gender , organ function ( in particular the liver and kidneys ) , drug interactions , the nature and severity of the disease intended to treat , and the presence of other diseases .
molecular genetics provides a practical approach to identifying biological predictors of psychotropic drug responses and drug - induced adverse events .
a medication that is safe and effective in one patient may be ineffective or even harmful in another .
the identification of relevant gene polymorphisms in patients prior to drug prescription will allow physicians to customise the selection of medication to meet individual patient needs .
as described earlier , several pharmacogenetic studies have focused on polymorphisms in liver cytochrome p450 isoenzymes which metabolise many antidepressant medications .
the most intensively investigated gene is cyp2d6 and the cyp2d6 genotype has been shown to predict tricyclics concentrations in blood .
the caucasian patient described in this publication , who had a cyp2d6 * 4/*41 polymorphism with loss - of - function enzyme activity , exhibited her psychotic episode on the third day after treatment initiation .
in contrast , the asian patient with cyp2d6 * 10 * 10 polymorphism , with partially decreased enzyme activity , developed neurotoxicity syndrome two weeks after treatment initiation . this is consistent with current pharmacogenetic knowledge of cyp2d6 loss - of function polymorphisms .
gender differences in the diagnosis and treatment of mental disorders are described in numerous publications .
it was shown that women appeared to have different plasma concentrations of antidepressants during treatment than men [ 4750 ] .
. pointed out , for example , that the monthly alterations in hormones in women may act on dopamine receptors in a protective manner , much like neuroleptics , and women require lower doses of psychotropics .
mcewan showed that antidepressants and neuroleptics have differing actions in men and women because of the effects of estrogen and testosterone in the brain .
furthermore , medications act differently in women before and after menopause and some researches suggest the effects of the menstrual cycle on pharmacokinetics [ 5255 ] .
it is also known that adipose tissue and body fluid quantities affect drug dosage and rate of metabolism and should be considered in the prescription of drug treatments .
pregnancy and menopause also affect the concentration of plasma proteins , and thus of protein - bound drugs .
overall , women may experience more side effects or toxicity from the same dosage of a drug than do men .
drug toxicology evidence is currently based on the drug to metabolite ratio in blood or urine . however , measurement of metabolites and their contribution to the validation of neurotoxicity remains uncertain due to the methodology of detection and lack of scientifically based evidence .
in addition , each person is unique in his / her susceptibility to toxic agents .
interactions between substances metabolised through the phase i cytochrome p450 system and an individual 's variation in enzyme activity should be included in the assessment of toxicity .
the described patient cases are illustrations of the value of individual interpretation of diminished phase 1 metabolism and its consequences .
however , pharmacogenetic testing will help to avoid adverse reactions by providing information about an individual 's drug metabolising capacity , thereby identifying the patients for whom a drug would be safe and effective .
phase 1 cytochrome p450 loss - of - function polymorphisms should be included in patient record warning labels , similar to allergies , as a warning that an individual patient is susceptible to particular adverse drug reactions . | the variation in individual responses to psychotropic drug treatment remains a critical problem in the management of psychotic disorders .
although most patients will experience remission , some patients may develop drug - induced adverse effects that may range from troublesome to life threatening .
antidepressants are freely prescribed by general practitioners , and there should be constant awareness in the medical community about possible serious side effects .
we describe two cases of adverse drug reactions on low dosage treatment that led to extreme psychotic episodes as examples of the potential for dangerous side effects .
the patients developed adverse reactions on the normal recommended dosage of nortriptyline , a tricyclics antidepressant ( tca ) .
both were females , with no history of antidepressant treatment , unsocial behaviour , nor any family history of psychosis , but both experienced severe psychiatric symptoms .
pharmacogenetic tests can easily be performed and interpreted according to the likelihood of adverse reactions and should be included in toxicity interpretation . | 1. Introduction
2. Method
3. Results
4. Discussion
5. Conclusion |
primary cardiac tumors are quite rare , especially in the pediatric age group,13 and their atypical presentations often prevent a timely diagnosis.4 most primary cardiac tumors in the pediatric age group are benign ; autopsy studies in children have reported incidence rates ranging from 0.027% to 0.08%.4 one echocardiography database has reported an incidence of 0.17% , which suggests that one or two new primary cardiac tumors will be detected for every 1000 first - time pediatric echocardiograms.4 fibromas are generally reported as the second most common primary cardiac tumor in the pediatric age group.3 , 5 however , in a more recent review of boston children s hospital database from 1980 to 2005 , fibromas were the third most common tumor . to date , no distinct genetic inheritance or familial predisposition has been associated with cardiac fibromas .
these neoplasms are often intramural and involve the left ventricular free wall or the interventricular septum .
less frequently , they can be multiple and invade the right ventricular free wall , the atrial septum , or its free wall .
although rare , intracavitary fibromas have also been reported.4 , 6 it is very rare for primary intracardiac tumors to occur in the supravalvular pulmonic or aortic positions.7 a case of a seven - year - old boy with an intraluminal pulmonary artery fibroma was reported in the pediatric cardiology journal ( 21 : 480482 2000 ) from southwest texas methodist hospital .
we herein present the case of a girl with an intraluminal fibroma in her ascending aorta .
we present a 23-month - old girl admitted for the evaluation of a cardiac murmur with a history of one episode of syncope two months before admission . she had no positive history for syncope and no positive family history for congenital heart diseases or any kind of cardiac tumors . on physical examination ,
her growth and development were within normal limits ( height = 85 cm , weight = 11 kg ) .
, there was a grade 3/6 systolic ejection murmur at the second right inter - costal space with radiation to the neck .
transthoracic echocardiography demonstrated mild left ventricular hypertrophy and a large intraluminal mass in the ascending aorta , but its borders were not obvious .
doppler interrogation of the ascending aorta showed a turbulent , high - velocity ante grade flow with a 66 mmhg peak pressure gradient and a 46 mmhg mean pressure gradient . by color mapping ,
turbulency began at the level of the aortic valve . in order to confirm the transthoracic echocardiography findings
, transesophageal echocardiography was performed , which confirmed the presence of a large intraluminal mass in the ascending aorta .
the mass was elongated and occupied about 60% of the ascending aorta s area ( 3 cm 1 cm 1 cm ) .
the turbulent antegrade flow around the margins of the mass was obvious and there was no more adherence .
the distal end of the mass juxtaposed the initiation of the transverse aorta ( figure 1 ) .
the high likelihood of the mass being tumoral and its hazardous location precluded catheterization , and the child underwent surgery for mass resection .
given the position of the mass , cannulation via the femoral artery , inferior vena cava , and superior vena cava was done . with cerebral protection during cardiopulmonary bypass , the arteriotomy of the ascending aorta was preformed .
the mass was found to be entirely within the ascending aorta with firm adherence to the anterior leaflet of the bicuspid aortic valve ( figure 2 ) .
the tumor was excised subtotaly because it could not be detached from the aortic valve leaflet .
the arteriotomy was closed , and the child was weaned from the cardiopulmonary bypass machine without any difficulty .
repeat transthoracic echocardiograms following the operation did not reveal any evidence of residual supravalvular aortic stenosis and there was no aortic insufficiency . in gross pathology description ,
the mass was solid , firm , and creamy with a nodular appearance ( 3 1 1 cm ) .
microscopic sections showed a benign neoplasm composed of fascicles of fibroblasts with variable amounts of collagen and a scanty number of lymphocytes arranged in a focally myxomatous stroma without any evidence of malignancy such as increased mitotic figures or areas of necrosis ( figures 3a & 3b ) .
the most common tumors in newborns and infants are rhabdomyomas , fibromas , and intrapericardial teratomas ; whereas in older children and adolescents , myxomas , rhabdomyomas , and fibromas are prominent .
rhabdomyomas constitute 45% to 80% of all primary cardiac tumors in the pediatric age group .
these tumors can be diagnosed in the prenatal period but are most frequently diagnosed in the newborn infant . although fibromas have recently been reported in utero and in patients younger than 1 month of age , they are found much less commonly than rhabdomyomas in this age group . in a recent review at boston children
s hospital , fibromas were the second most common tumors ( 17% ) in patients diagnosed between 1 month and 1 year of age .
these primary tumors are rarely seen in older children , adolescents , or young adults.4 no known sex predilection is recognized , although the rarity of different benign cardiac tumors prevents an accurate determination of a male - to - female ratio.6 on two - dimensional echocardiography , cardiac fibromas are seen as a single , bright , intramural , echogenic mass .
ct scanning is often performed and might provide clues regarding tissue characterization , with central calcification suggestive of a cardiac fibroma.6 this case has two interesting aspects : presenting symptom of the tumor and its location .
our patient was previously healthy with a normal development , and she sought medical attention after a syncopal event and a murmur was noted on the auscultation of the heart .
fibromas are predominantly intramural tumors , and extensive intramural fibromas can encroach and obliterate the intracavitary space .
a similar case has been previously reported with an intraluminal fibroma in the proximal main pulmonary artery.8 although benign , fibromas may become life - threatening by causing arrhythmias or obstruction to blood flow.8 , 9 acquired supravalvular aortic stenosis and syncope due to the tumor were the presenting features of our patient .
although complete resection is preferable , our patient s tumor was not amenable to complete resection due to its firm adherence to the anterior cusp of her bicuspid aortic valve .
syncope can be the presenting symptom of the tumors of the intraluminal ascending aorta as was the case in the patient described here with an unusual location of fibroma .
transesophageal echocardiography is useful for the evaluation of anatomic details and can be of assistance for surgical planning . | primary cardiac tumors are quite rare , especially in the pediatric age group , and their atypical presentations often prevent a timely diagnosis .
most primary cardiac tumors in the pediatric age group are benign .
fibromas are generally reported as the second most common primary cardiac tumors in the pediatric age group . these neoplasms are often intramural and involve the left ventricular free wall or the interventricular septum .
although benign , fibromas may become life - threatening by causing arrhythmias or obstruction to the blood flow . a case of supravalvular intraluminal ascending aorta fibroma in a 23-month - old girl , presenting with syncope ,
is described here ; the location is rare and the presentation atypical for this type of tumor .
transesophageal echocardiography helped us to evaluate the anatomic details of the tumor and plan surgery . | Introduction
Case Report
Discussion
Conclusion |
hemorrhage may occur due to chemotherapy or bone marrow transplantation in patients with acute leukemia .
leukocytosis , thrombocytopenia , sepsis , and coagulopathy increase the risk of bleeding.[13 ] disseminated intravascular coagulation also occurs in patients with leukemia due to hypofibrinogenemia .
hemorrhage is most common in acute leukemia and usually leads to death.[35 ] hemorrhage can be seen in patients with fulminant leukocytosis ( blast crisis ) , typically involving a white blood cell count above 300,000/mm and leukostasis .
platelet counts less than 10,000/mm and drugs such as l - asparaginase or prednisone may increase the risk of bleeding.[57 ]
the two - year - old patient , who was followed up by the hematology department with the diagnosis of acute myeloid leukemia , was referred because of seizure , vomiting , and agitation .
a chronic subdural hematoma extending from the left frontal region to the occipital subdural region , which was 4 cm at its thickest , was detected [ figure 1 ] .
the white blood cell count was 157.000/mm3 , and platelet count was 48.000/mm as determined by complete blood count .
the hematoma was evacuated with left parietal craniotomy and was observed to have high pressure . after the surgery , a dramatic improvement was seen in the patient 's neurological status .
the patient was transferred to the hematology department for the remainder of the leukemia treatment .
leukemic leukocytosis in a two - year - old boy who presented with vomiting and progressive lethargy .
hyperleukocytosis ( white blood cell count of 157,000/mm ) and thrombocytopenia ( platelet count of 48,000/mm ) were significant laboratory parameters .
the axial computed tomographic ( ct ) scan reveals a fronto - occipital subdural hematoma a postoperative axial ct shows adequate evacuation of the subdural hematoma
a significant number of patients with acute leukemia die due to severe complications that develop in early stages .
factors such as head trauma , chemotherapy , and coagulopathy increase the risk of bleeding .
hemorrhage can be seen due to occlusion of the blood brain barrier by tumor cells , chemotherapy - induced thrombocytopenia , disseminated intravascular coagulation , and leukocytosis
although hyperleukocytosis can be seen in all acute leukemias , it is more frequently seen in childhood acute lymphoblastic leukemia ( all ) , adult myelomonocytic ( m4 ) , and monoblastic leukemias ( m5 ) .
leukostasis is a clinical syndrome with a progressive and mortal course and generates 20% to 40% of the causes of early - stage mortality in acute leukemia patients .
the most common causes of death caused by leukostasis are intracranial hemorrhage and respiratory failure .
hydration , urine alkalinization , allopurinol treatment , and leukopheresis are applied to prevent or reduce hyperleukocytosis - associated metabolic and vascular complications .
leukopheresis can quickly reduce the number of leukocytes over a short period of time and manage the leukostasis - related clinical signs .
current treatment includes emergency intravenous fluids , administration of allopurinol and chemotherapy , and aggressive correction of coagulopathy and thrombocytopenia .
seizure , altered mental status , focal neurological deficits , irritability , lethargy , and bulging fontanel in children under 2 years of age are common .
a brain ct was taken following these complaints of our patient , and the chronic subdural hematoma was identified .
the patient , who also had respiratory distress and disorder , was diagnosed with leukostasis based on white blood cell count .
an mri is important in detecting parenchymal compression , and the amount and formation time of subdural hemorrhage .
the main treatment modalities for the irrigation of bleeding include the following : burr hole , subdural taps , subdural drainage , and subdural peritoneal shunt .
drainage of a chronic subdural hematoma was required in a child with acute leukemia where chronic subdural collection caused neurologic impairment while the patient was undergoing chemotherapy .
leukopheresis could not be applied to our patient , but steroids were applied following adequate hydration , and hydroxyurea and allopurinol were initiated . fresh - frozen plasma was administered to prevent coagulopathy , which frequently develops during the course of acute hyperleukocytic leukemia .
the pressure on parenchymal tissue was observed to be relieved after the evacuation of hematoma .
bleeding , leukostasis , and less likely , infections are responsible for for mortality at this early stage . | severe complications that develop in the early stages in patients with acute leukemia have a mortal course . bleeding , leukostasis , and less frequently , infections are responsible for early mortality .
hemorrhage is most common in acute leukemia and usually leads to death .
hemorrhage may occur due to chemotherapy or bone marrow transplantation in patients with acute leukemia .
leukocytosis , thrombocytopenia , sepsis , and coagulopathy increase the risk of bleeding
. there may be multiple etiologic factors .
subdural or subarachnoid hemorrhage is less common than an intra - axial hemorrhage .
the incidence of spontaneous subdural hematoma is higher in patients with leukemia . although advances in the treatment of platelet transfusion and disseminated intravascular coagulation have decreased the incidence of hemorrhagic complications in patients receiving chemotherapy for acute leukemia , intracranial hemorrhage - related deaths are a significant problem .
we discussed the etiology and management of chronic subdural hematoma detected in a two - year - old male patient with acute myeloid leukemia and hyperleukocytosis . | Introduction
Case Report
Discussion |
trace metal ions have important roles in our life because of involving a wide spectrum of activities .
iron , manganese , and zinc are essential trace elements , having several roles in many body functions .
sample preparation is a key procedure in modern chemical analysis because it is one of the most time consuming and error - prone portions of any analytical scheme . in spite of major advances in the instrumentation used in determinative steps ,
because most quantitative techniques require that samples are introduced in liquid form , thousands of sample dissolutions are performed every working day in analytical laboratories
. however , most conventional digestion procedures involving inorganic acids are tediously labor intensive , and a number of them are hazardous to laboratory workers and to the wider environment [ 24 ] . in order to avoid these drawbacks ,
however , the use of chemical modifiers is required for slurry analysis by electrothermal atomic absorption spectrometry to obtain interference - free determinations , which increases the analysis cost and can cause sample contamination . however , the main drawback of this technique is the nonhomogeneity of the suspensions formed [ 57 ] .
ultrasound - assisted sample pretreatments offer an alternative approach to sample preparation prior to analysis .
this energy facilitates and accelerates some analytical steps , decreasing the analysis time and the cost per analysis , increasing accuracy and precision ( above all in a continuous mode ) [ 812 ] .
these methodologies have been applied to water insoluble samples , using a diluted inorganic acid ( usually nitric acid ) as extraction solution .
nevertheless , only three works were found in the literature reporting the use of continuous ultrasound - assisted approaches for dissolution of water soluble samples .
these works were developed by our investigation team and are based on continuous milk powder water reconstitution for determination of zinc and iron , and on calcium and magnesium determination in soluble pharmaceutical tablets [ 1315 ] .
the food and pharmaceutical industry needs simple , accurate , and green analytical methods that can be routinely and safely used in the companies ' own quality control laboratories .
this work was focused on the study of the continuous ultrasound - assisted dissolution of water soluble foods and pharmaceutical samples .
the continuous ultrasound dissolution system used is connected to a flow - injection ( fi ) manifold , which allows the continuous determination of trace metals by flame atomic absorption spectrometry ( faas ) .
the proposed method is based on the use of nontoxic reagents that makes it friendly both for the operator and the environment .
the fi manifold used ( figure 1 ) has two sections : section 1 where the solid sample is continuously dissolved , and section 2 where the dissolved sample is led to the detector ( faas ) where the metals are continuously monitored .
this manifold comprises two gilson minipuls-3 peristaltic pumps ( gilson , villiers le bel , france ) fitted with pvc tubes , an ultrasonic bath with an ultrasound power of 40 khz ( selecta , barcelona , spain ) , and a glass minicolumn used as sample container ( 50 mm 3 mm i.d . , bed volume 350 l ) ( omnifit , cambridge , uk ) .
four rheodyne injection or switching valves models 5041 and 5301 ( rohnert park , usa ) .
a perkin elmer model 5000 atomic absorption spectrometer ( perkin elmer , shelton , ct - usa ) with a deuterium lamp as background correction system was used for iron , manganese , and zinc measurements .
the instrument was set at 248.3 , 279.5 , and 213.9 nm for fe , mn , and zn determination , respectively .
the spectrometer output was connected to a perkin elmer model 50 servograph recorder with a range of 5 mv .
numerical analyses of experimental designs were performed by means of the statistical package statgraphics plus 5.1 ( manugistic , inc .
iron , manganese , and zinc standard solutions , 1000 g ml , were supplied by merck ( darmstad , germany ) . nitric acid 65% and hydrochloric acid 30%
all glassware used were cleaned in aqueous 4 mol l nitric acid for four days and rinsed with ultrapure water before use .
ultrapure water with a resistivity of 18.2 m cm was obtained from a milli - q purification system ( millipore co. , bedford , ma , usa ) .
pharmaceutical samples were grinded to a fine powder in a mortar , blended and homogenized , and finally sieved through a 0.1 mm pore diameter plastic sieve .
solid soluble samples ( 530 mg ) were directly weighed into the glass minicolumn ( dissolution cell ) .
then , each minicolumn was assembled to the continuous ultrasound - assisted dissolution system , and immersed into the ultrasonic bath .
after , the dissolution circuit was loaded with the dissolving solution ( 1 ml of ultrapure water ) .
the dissolving solution is then circulated at 6 ml min through the dissolution cell under ultrasonic irradiation during 2 min at room temperature .
the direction of the flow was changed each 30 s to facilitate sample dissolution avoiding sample accumulation in the minicolumn ends .
once the sample is dissolved , the sv2 is switched to its other position , and the sample is led to the mixing coil where the solution is homogenized .
then , the loop of the injection valve ( iv ) is filled with a volume of 250 l of the sample solution , which is injected into an ultrapure water carrier stream that transport it at 3.5 ml min to the detector .
six variables , namely , nitric acid concentration , hydrochloric acid concentration , temperature of the ultrasonic water - bath ( dissolution temperature ) , ultrasound exposure time , dissolving solution volume , and flow - rate of the continuous dissolution manifold were selected to be examined . the studied variables as well as the values for each level ( low and high ) are shown in table 1 . the consequence of changing a variable from low to high level value was examined on a selected response such as percentage dissolution efficiency , according to the following equation :
( 1)% dissolution efficiency = ( ab ) 100 ,
where a is the concentration of the metal obtained with the proposed procedure and b the metal concentration obtained by a manual dissolution using a conventional digestion procedure with concentrated nitric acid and off - line faas detection . a plackett - burman 26 * 3/16 factorial design with a center point ( 13 nonrandomized runs )
this factorial design was applied to a soluble cocoa sample and to a pharmaceutical preparation ( soluble multivitamin tablet ) .
the conclusions of the screening studies reflected that only the ultrasound exposure time was a statistically influential factor , and it was affected by a positive sign .
the other variables were not statistically influential factors in the ranges studied at the 95% confidence level and all of them were affected by a positive sign . although the concentration of the acids used as dissolving solution ( nitric and hydrochloric acids ) had a positive influence on the dissolution efficiency , a run of the experimental design achieved a quantitative % dissolution efficiency with the minimum value of these variables ( 0
thus , this minimum value was selected for subsequent experiments for the both factors , and ultrapure water was selected as dissolving solution .
the dissolving solution volume and the ultrasonic water - bath temperature had a positive estimated effect , but these parameters yield small values for the main effects . aiming to increase the analytical sensitivity and to make easy and rapid the sample dissolution step , was chosen as optimum the minimum value of these variables ( 1 ml and room temperature , 20c ) .
likewise , as the flow rate of the continuous ultrasound dissolution system had a positive sign , the maximum value tested for this variable ( 6 ml min ) was chosen for subsequent experiments . according to the results ,
a new experimental design shifted in the direction of higher ultrasound exposure times would be desirable . however , this variable was fine tuning outside the framework of the design because a minor number of experiments were required .
then , several experiments were carried out in order to optimize the ultrasound exposure time , resulting in that the optimum value was 2 min for the two kinds of samples studied .
the results obtained indicated that this variable does not affect to the dissolution process within the range studied .
thus , it was verified that with a mixing coil length of 199 cm ( equivalent to 1.0 ml , which is the volume of the dissolving solution ) was obtained a complete homogenization of the sample solution .
the carrier flow rate was tested between 36 ml min , and the injected volume of the sample solution between 100300 l .
the aspiration flow rate of the nebulizer was adjusted to be the same as the flow rate of the carrier solution .
although the highest aspiration flow rate provides the best sensitivity , a high dispersion takes place because at the same time was increased the carrier flow rate .
therefore , a carrier flow rate of 3.5 ml min ( dispersion equal to 1.1 ) was chosen as a compromise to obtain the minimum dispersion in the flow system . with regard to the injected sample volume
, it was verified that when the volume was increased , the sensitivity was also increased .
therefore , a volume of 250 l was chosen as optimum , which in addition allows to inject several times the sample solution to verify its homogeneity .
as can be seen in table 1 , calibration curves were obtained by using a linear plot of the peak height as a function of the standard concentrations of each analyte ( n = 7 ) . in order to evaluate matrix interferences , the slopes obtained from analytical and analyte addition curves were compared . for this , a cocoa soluble sample and a pharmaceutical preparation ( soluble multivitamin tablet ) were spiked with several concentrations of the analytes , which were added as dissolving solution into the continuous ultrasound dissolution system .
the addition calibration graphs were run ( n = 7 ) under the optimal chemical and flow conditions for the whole process .
these equations and their corresponding calibration graphs have the same slope , demonstrating that the determination of iron , manganese , and zinc is free of matrix interferences . the limits of detection ( lod ) and quantification ( loq ) were calculated as the mass of analyte which gives a signal 3 or 10 , for lod and loq , respectively , above the mean blank signal ( where is the standard deviation of the blank signal , n = 30 ) .
the precision of the continuous analytical method was checked using a sample containing 21.42 g g fe , 5.74 g g mn , and 57.90 g g zn ( soluble cocoa ) , and the results expressed as relative standard deviation ( n = 11 ) are also shown in table 1 .
the sample throughput of the proposed methodology , taking into account the whole process , was ca .
the method was applied to the determination of iron , manganese , and zinc in water soluble food samples and pharmaceutical preparations ( soluble multivitamin tablets ) .
the results obtained expressed as g g dry weight and their standard deviation ( n = 3 ) are shown in table 2 . the results obtained for food samples
were compared with those obtained by employing a wet acid digestion method on same samples by using the paired t - test . as is reported in table 2
, both groups of results do not give significantly different values , thus the agreement between them is satisfactory at 95% confidence level .
the use of a continuous ultrasound - assisted dissolution system coupled to an fi manifold using ultrapure water as dissolving solution is confirmed to be an interesting tool for the automatic dissolution of soluble solid samples of different nature .
this continuous manifold allows the dissolution of a sample in a time shorter than that required by a batch sample dissolution procedure .
furthermore , this methodology provides accurate results with high precisions , because there are not sample losses as result of its manipulation , and does not present random errors associated to glassware calibration .
the proposed method can be considered as environmentally friendly at every step of the analytical procedure . | a simple and rapid analytical method was developed for the determination of iron , manganese , and zinc in soluble solid samples .
the method is based on continuous ultrasonic water dissolution of the sample ( 530 mg ) at room temperature followed by flow injection flame atomic absorption spectrometric determination . a good precision of the whole procedure ( 1.24.6% ) and a sample throughput of ca .
25 samples h1 were obtained .
the proposed green analytical method has been successfully applied for the determination of iron , manganese , and zinc in soluble solid food samples ( soluble cocoa and soluble coffee ) and pharmaceutical preparations ( multivitamin tablets ) .
the ranges of concentrations found were 21.425.61 g g1 for iron , 5.7418.30 g g1 for manganese , and 33.2757.90 g g1 for zinc in soluble solid food samples and 3.759.90 g g1 for iron , 0.475.05 g g1 for manganese , and 1.5515.12 g g1 for zinc in multivitamin tablets .
the accuracy of the proposed method was established by a comparison with the conventional wet acid digestion method using a paired t - test , indicating the absence of systematic errors . | 1. Introduction
2. Experimental
3. Results and Discussion
4. Conclusions |
the prevalence of type 2 diabetes continues to rise and currently affects over 25 million americans and is estimated to reach 439 million adults worldwide by 2030 [ 1 , 2 ] . along with this increase ,
adults aged 20 years ( an estimated 79 million individuals ) [ 3 , 4 ] .
furthermore , it is estimated that , among u.s . adults with undiagnosed diabetes or impaired fasting glucose , the proportion of adults with insulin resistance increased from 24.8% to 31.1% during the time periods of 19881994 to 19992002 .
prediabetes is indicated when blood glucose or hemoglobin a1c ( a1c ) levels are higher than normal , but not yet high enough to be classified as diabetes .
prediabetes raises the risk of type 2 diabetes by 3- to 10-fold and it is estimated that up to 70% of people with prediabetes may develop type 2 diabetes during their lifetime [ 3 , 6 , 7 ] . a study conducted by geiss et al .
estimates 30% of the u.s . adult population had prediabetes in 2005 - 2006 , but only 7% were aware that they had the condition .
insulin resistance ( ir ) is a condition in which the body produces insulin but does not use it effectively . when people have insulin resistance , glucose builds up in the blood instead of being absorbed by the cells , leading to type 2 diabetes or prediabetes .
the american diabetes association ( ada ) ( april 4 ) considers both prediabetes and insulin resistance precursors to type 2 diabetes .
both the ada and the national heart lung and blood institute 's national cholesterol education program ( ncep ) suggest the risk factors for type 2 diabetes , prediabetes , and ir are similar and include the following ( not comprehensive ) : obesity , physical inactivity , family history of diabetes , race / ethnicity , high blood pressure , large waist circumference , and high triglycerides .
notably , socioeconomic status is usually not included but is an important focus of this paper .
socioeconomic status is a complex construct , broadly based on relative income , education , and occupation all of which have been repeatedly associated with lifestyles and behavioral risk factors . in this analysis , we use income and education as indicators of ses , since occupation has been shown to be highly correlated with education [ 11 , 12 ] .
numerous studies have identified low physical activity [ 1315 ] , low diet quality [ 14 , 16 , 17 ] , and , more recently , poor sleep quality , as associated with diabetes [ 1822 ] .
however , it is uncertain whether these factors equally affect prediabetes and diabetes risk across the ses gradient .
that is , most previous studies statistically adjust for education , income , or some other marker of ses [ 2325 ] . but to develop well - targeted and likely effective primary and secondary interventions it is necessary to understand how modifiable risk factors influence risk of diabetes among the different ses groups .
studies have shown that while health programs and therapies exist to manage prevention of diabetes and its complications , these programs are underutilized among those in low socioeconomic groups [ 2628 ] . while there are many risk factors contributing to diabetes , this study seeks to identify those most likely to improve the effectiveness of primary and secondary prevention initiatives .
coupled with the under - utilization of diabetes prevention programs among those with low ses [ 2628 ] , there is a potential benefit to identifying modifiable diabetes risk factors that may contribute to prediabetes among those with low ses and to examine the different effects of diabetes risk factors operating among different ses levels .
therefore , the objectives of this analysis arewithin and across each level of ses , to examine the associations between known behavioral risk factors for diabetes ( low diet quality , poor sleep , low physical activity , and high waist circumference ) and both prediabetes and ir;to examine these modifiable factors collectively ( presence of two or more risk factors ) for their potential impact on the prevalence of prediabetes and ir within and across the ses gradient . within and across each level of ses , to examine the associations between known behavioral risk factors for diabetes ( low diet quality , poor sleep , low physical activity , and high waist circumference ) and both prediabetes and ir ; to examine these modifiable factors collectively ( presence of two or more risk factors ) for their potential impact on the prevalence of prediabetes and ir within and across the ses gradient .
the boston area community health ( bach ) survey is a longitudinal cohort study of residents of boston , ma , aged 3079 years at baseline ( march 2002june 2005 ) .
briefly , a stratified two - stage cluster sample was used to recruit an approximately equal number of participants by gender , race / ethnicity ( black , hispanic , white ) , and age group ( 3039 , 4049 , 5059 , 6079 ) .
5,502 adults participated in baseline bach i ( 1767 black , 1876 hispanic , 1859 white ; 2301 men , 3201 women ) .
follow - up surveys were collected at two time points approximately 5 ( bach ii 20062010 ) and 7 ( bach iii 20102012 ) years later . for bach iii ,
completed interviews were obtained for 3155 individuals ( 1184 men ; 1971 women ) . in all surveys ,
data were collected during a two - hour interview in english or spanish , after obtaining written informed consent .
analyses for this paper use data from the most recent interview , bach iii ( 20102012 ) .
education , based on years of education completed , is composed of four categories : < high school , high school or ged , some college , or college or advanced degree . income was collected as total annual income and categorized into three categories : < $ 20,000 , $ 20,000$49,999 , or $ 50,000 + .
physical activity was measured using the physical activity for the elderly ( pase ) scale and categorized into low , moderate , or high .
anthropometric measures - trained field interviewers directly measured the subject 's height ( cm ) , weight ( kg ) , from which bmi was calculated ( kg / m ) , and waist circumference ( cm ) .
waist circumference was further dichotomized into high waist circumference defined as 88 cm for women and 102 cm for men [ 32 , 33 ] .
bmi was dichotomized using the cut - off point of 25 kg / m that defines overweight in the current who classification .
diet was measured with the block food frequency questionnaire ( ffq ) administered in english or spanish .
the ffq has been validated to obtain data on usual dietary intake over the past year .
we calculated an overall healthy eating score using the usda and aha guidelines for healthy eating [ 35 , 36 ] .
the healthy eating score is composed of ffq data on average daily intake of sodium ( g ) , vegetables ( servings / day ) , fruits ( servings / day ) , meats / beans ( serving / day ) , grains ( servings / day ) , fiber ( g ) , and saturated fat ( g ) .
participants were classified into three possible diet score groupings : poor ( score 02 points ) , intermediate ( score 25 points ) , or high ( score 57 points ) .
the overall healthy eating index for this sample ranged from 0 to 5 indicating that no one met criteria for high ( healthiest ) healthy eating score .
therefore , for analyses , we created 3 groups ( low / medium / high ) based on off tertile cut - points .
sleep duration was measured using self - reported sleep patterns in the previous month with the question how many hours of actual sleep do you get during the night ? and grouped as follows : < 6.5 hours , 6.5<8 hours , and 8 hours to create low , intermediate , and high duration of sleep .
multiple risk factors measures were created by combining diet , sleep , and activity scores .
the presence of two factors is defined as having poor diet ( lowest tertile ) and low sleep duration ( < 6.5 hours ) .
the three - risk - factor measure is defined as the presence of low physical activity , poor diet , and low sleep duration .
lastly the four - risk - factor measure is defined as the presence of high bmi ( 25 ) or high waist circumference ( 88 cm women and 102 cm men ) and presence of the three risk factors mentioned above .
diagnosed type 2 diabetes was determined by self - report ( have you ever been told by a doctor or other health professional that you have type 2 diabetes ? ) .
insulin resistance was measured using the homeostasis model assessment ( homa ) index where the product of fasting glucose and fasting insulin was taken and then divided by 405 .
insulin resistance was calculated only in subjects that had fasting glucose collected and has an analytic sample size of 2359 .
prediabetes is defined among those subjects with no diabetes ( type 1 or type 2 ) and no undiagnosed diabetes defined as fasting glucose > 125 or hba1c 6.5 .
subjects with prediabetes are compared to diabetes unaffected subjects that is , those without diabetes ( self - reported type 1 or 2 or undiagnosed ) and with no prediabetes leaving an analytic sample size of 2175 . a third outcome combining prediabetes and insulin resistance
was created to capture the presence of prediabetes or insulin resistance among nondiabetic subjects ( n = 2175 ) . to define insulin resistance , we used the nhanes study cut - point of 2.73 .
bivariate associations between health factors and education were examined with wald f chi - square tests for categorical measures and wald f test p value from linear regression models for continuous measures .
logistic regression models were utilized to examine the association of lifestyle / behavioral health factors with prediabetes and the combined outcome of insulin resistance or prediabetes .
linear regression models were constructed to examine the association between lifestyle and behavioral factors on insulin resistance . due to
positive skew , insulin resistance was log transformed in final regressions . in all regression models we stratified by education level or income group and adjusted for age , gender , race / ethnicity , family history of diabetes , and smoking status .
regression models were examined for the overall healthy eating score as well as each of the 7 subscales but results are presented only for the overall score .
analyses of diet were adjusted for total caloric intake to minimize measurement error by over / underreporting .
separate unstratified regression models were examined to test for interactions between lifestyle and behavioral factors and ses measures income and education .
all analyses were performed with sas callable sudaan 11.0 using sampling weights and stratification measures to account the complex survey design of bach .
multiple imputation was used to reduce bias resulting from missing data for all exposure covariates using multivariate imputation by chained equations ( mice ) in r .
briefly , mice imputes missing values with estimated predictions from regression models that reflect the relationships observed in the data , while considering the complex survey sampling design .
age , race , and their interaction were included as predictors in each of the imputation models .
in addition , mice selected important predictors for each variable and these were also included in the model .
less than 5% of the covariates ( age , gender , education , race / ethnicity , and income ) were imputed .
28% had normal blood glucose levels ( without self - reported diabetes and not prediabetic ) . in the sample without diabetes ( n = 2379 )
the geometric mean of the homa - ir measure was 1.9 ( se 1.0 ) . among those with prediabetes , over half were white and
reported medium levels of physical activity and 46% reported a family history of diabetes . in subjects with prediabetes or ir ,
45% were male and reported a family history of diabetes . the mean waist circumference for those with prediabetes or ir is the highest at 96 cm compared to those unaffected or with prediabetes alone . in general ,
similar patterns were observed in the bivariate associations between study population characteristics with educational level and income ( data not shown ) .
males were more likely to have higher education ( postgraduate ) compared to female ( 51% versus 49% , p = 0.04 ) .
the < hs group also reported the highest rates of current smoking and family history of diabetes compared to all other education levels ( p 0.0001 in all comparisons ) . regarding diabetes outcomes , subjects in the highest education group had higher rates of being in the unaffected group ( 34% versus 12% , p 0.0001 ) and lower rates of reporting prediabetes ( 61% versus 80% , p 0.0001 ) and prediabetes or ir ( 65%
gender , current smoking , family history and diabetes , and the diabetes outcomes were associated with income with similar patterns . in unstratified models
there were no significant interactions seen between education and income with lifestyle / behavioral factors ( data not shown ) . table 2 displays the results of the insulin resistance regressions and figure 1 plots mean homa - ir for significant predictors .
insulin resistance is associated with bmi and waist circumference across all levels of education and income ( p ranges from 0.02 to 0.0001 , table 2 , models 2 and 3 ) .
the magnitudes of association with bmi and waist circumference on ir are similar across all levels of education and income .
those with bmi 25 have on average a higher mean log ir score of 0.20 compared to those with bmi < 25 .
similarly , those with a high waist circumference have higher mean ir scores anywhere between 0.22 and 0.33 points higher than those with a smaller waist circumference .
the healthy eating score , other diet components , physical activity , and sleep duration were not associated with insulin resistance .
the covariate adjusted geometric means for insulin resistance in the bmi 25 group are nearly twice as high compared to the bmi < 25 group within the lowest education level < hs or ged ( figure 1 ) . the same magnitude in mean differences between the bmi categories is also seen in the hs or ged and some college group .
geometric homa - ir means are also higher in those with bmi 25 compared to bmi < 25 within income levels . across both education and income groups ,
homa - ir geometric means are lower as one moves into higher educated or income groups . the geometric means for those with bmi 25 are 2.8 , 2.2 , and 1.8 for the income groups
regard to waist circumference , higher mean homa - ir values are observed among subjects with large waist cm compared to small waist cm within all levels of education and income ( p 0.0001 in all models ) .
few significant associations were seen in logistic regression models of prediabetes ( table 3 ) .
large waist circumference was significantly associated with increased odds of prediabetes in the college or advance degree group such that those with large waist circumference were 1.7 times as likely to develop prediabetes compared to those with lower waist circumference ( or 1.68 , 95% ci : 1.072.62 ) .
similarly for income , subjects with large waist cm were nearly twice as likely to have prediabetes compared to those of lower waist cm in the medium and high income strata with or 2.13 ( 95% ci : 1.104.10 ) , and or 1.88 ( 95% ci : 1.222.92 ) for medium and high income respectively . as with insulin resistance , diet , physical activity , sleep duration , and the presence of multiple risk factors
figures 2 and 3 display the results of the prediabetes or ir logistic regression models for strata of education and income , respectively .
subjects with a large waist circumference were nearly twice as likely to develop prediabetes or ir in the higher education strata ( some college and college+ ) and among the highest income group ( $ 50,000 + ) .
the odds ratios for large waist circumference are in the same positive direction and of similar magnitude across all education levels with a range of 1.55 to 1.88 , where a larger waist circumference nearly doubles the likelihood of prediabetes or ir . however the association in the < hs and hs or ged strata is nonsignificant . the same strength of association with waist circumference is seen between income strata , where the odds ratios range between 1.69 and 2.11 and reached significance only within the highest income strata .
our analysis shows that , after adjusting for ses indicators ( education and income ) , commonly known diabetes behavioral risk factors ( namely , diet quality , sleep duration , and physical activity ) are poor predictors of prediabetes and insulin resistance .
larger waist circumference was a consistent predictor of prediabetes and insulin resistance with large waist circumference increasing the probability of prediabetes or ir nearly twofold .
while this magnitude of effect is seen across all levels of ses , it reaches significance primarily within higher ses levels .
the examination of multiple risk factors revealed that the presence of two or more risk factors is not associated with prediabetes or ir . while many studies have shown significant associations between diet and diabetes risk [ 17 , 27 , 4345 ] , these results have been mixed .
for example , other studies have shown no association between diet quality , specifically total fat intake and red meat are not predictive of diabetes risk [ 46 , 47 ] .
other studies have shown that bmi adjustment attenuates the association between diet quality and type 2 diabetes [ 4850 ] which supports our findings of bmi being a significant predictor of insulin resistance across all levels of ses .
the significant findings between bmi and waist circumference indicate that , independent of education and income , increased bmi and waist circumference are important predictors of prediabetes and insulin resistance .
the strength of our waist circumference results is corroborated by a study which examined the interrelationships between demographic ( age , income , marital , race , and education ) and physical activity and poor diet on prediabetes in path models , concluding that large waist circumference had the strongest direct effect on prediabetes .
in addition , findings from the nhanes 2009 - 2010 survey indicated that the significance of sleep disorders on diabetes is attenuated when bmi is added to the model , where the odds ratio for diabetes drops from 2.04 ( 1.40,2.95 ) to 1.38 ( 0.95,2.00 ) .
they conclude that the effect of sleep disorders on diabetes may be explained through a subject 's obesity status . while they controlled for various factors such as age , gender , ethnicity , education , and income
, they did not examine other modifiable risk factors ( e.g. , diet and sleep ) .
the significant association of waist circumference with both prediabetes and insulin resistance may help guide future primary and secondary prevention programs where , in addition to socioeconomic factors , subjects with high bmi and large waist circumference are likely to produce the most beneficial outcomes .
the finding that waist circumference is not predictive across all education levels in prediabetes suggests that there may be different predictors of prediabetes among the lower ses groups providing new opportunities for more targeted intervention programs . on a broader level
this may be explained by the fact that prediabetes is considered an early precursor state indicating likely eventual development of diabetes , and not the eventual established diabetes state itself , by which time the associated risk factors are more evident and strongly associated . moreover , while the majority of prediabetic cases may end up being diagnosed with diabetes , not all cases will be ; therefore the expected relationship of known diabetes risk factors with prediabetes is diluted .
first , because it is cross - sectional ; the temporality of the relationships uncovered remains uncertain .
fasting insulin was also only measured at a single time point and maybe subject to measurement error .
the fact that measures are obtained at a single time point may reduce the likelihood of finding significant differences as research has shown that repeated measures of health behaviors may increase the significance and the effect size of such modifiable behaviors .
physical , direct measures such as bmi and waist circumference may serve as a lifetime proxy for diet quality and level of physical activity compared to self - reported measures of health behaviors , taken at a single time point .
while the reliability of self - reports of health conditions may be questioned , there is evidence that they are generally well - correlated with medical record review [ 5457 ] .
fortunately , medication data were available and over 80% of those self - reporting diabetes were taking a diabetes - related medication .
countervailing strengths of this study include use of a community - based random sample and the composition of the sample , which covers a broad age range , inclusion of both genders , and a racial / ethnic diversity , with roughly equal numbers of blacks , whites , and hispanic participants .
inclusion of a broad range of recognized behavioral risk factors permitted assessment of their independent and joint influences on prediabetic states .
finally , we examined a variety and combination of multiple risk factors , sleep duration , diet , and physical activity to test whether targeting multiple behaviors were predictive of prediabetes or ir .
we found that , among the behavioral risk factors considered , bmi and waist circumference were consistent predictors of prediabetes outcomes independent of ses .
our results have both clinical and public health significance : many different risk factors ( including bmi and waist circumference ) are variably associated with diabetes , prediabetes , and ir and offer variably effective opportunities for primary and secondary prevention . by identifying , among the broad range of risk factors , the most promising influences ,
future primary and secondary prevention initiatives can be more precisely targeted , resulting in more effective and cost efficient outcomes . | to examine whether behavioral risk factors associated with diabetes ( diet , bmi , waist circumference , physical activity , and sleep duration ) are also related to both prediabetes and insulin resistance ( ir ) , we used data from boston area community health ( bach ) survey ( 20102012 , n = 3155 ) .
logistic and linear regression models were used to test the association of lifestyle factors with prediabetes status , insulin resistance , and prediabetes or insulin resistance .
all regression models were stratified by education and income levels ( to examine whether risk factors had differential effects across socioeconomic factors ) and adjusted for age , gender , race / ethnicity , family history of diabetes , and smoking status .
we found that large waist circumference was consistently associated with higher levels of insulin resistance ( ir ) and increased odds of prediabetes .
while the association between large waist circumference and ir was consistent across all levels of ses ( p < 0.001 ) , the association between large waist circumference and prediabetes was only statistically significant in the highest socioeconomic strata with odds ratios of 1.68 ( 95% ci 1.072.62 ) and 1.88 ( 95% ci 1.222.92 ) for postgraduate degree and income strata , respectively .
there was no association between diet , physical activity , sleep duration , and the presence of multiple risk factors and prediabetes or ir within ses strata . | 1. Introduction
2. Materials and Methods
3. Results and Discussion
4. Conclusions |
copd is a common cause of disability , morbidity , and mortality worldwide and a major global health problem with enormous direct and indirect health care costs.1,2 the worst notice , however , is that the mortality rate ( number of deaths per 100,000 persons ) for copd in the last 50 years ( at least in usa ) has progressively increased in both men and women older than 60 years in every 5-year period.3 moreover , among the 20 leading causes of deaths in usa , the only one that has substantially increased the age - standardized relative rank of death in the last 20 years is copd.4 in europe , the situation seems better , and in many european countries , the mortality rate ( number of deaths for 100,000 persons ) for copd is decreasing , particularly in men.5 however , for 100,000 deaths , the percentage of mortality due to copd is increasing , suggesting that among chronic noncommunicable diseases copd is less effectively treated.5 therefore , according to this trend , it is estimated that copd will become the third worldwide cause of mortality in 2030.6 of course , there are many causes for this , but among them the possibility that the recommended diagnostic and therapeutic approaches to copd were less effective than what they could be should be seriously considered .
the most disseminated definition says that copd is a disease.1 in fact , d in the copd acronym stands for disease .
it must be acknowledged , however , that copd is recognized in the definition as an obstructive functional defect associated with a chronic immune inflammatory process , occurring in the lungs of susceptible individuals with known risk factors , in the absence of other causes .
since the 1960s , based on pathological findings , it has been clear that similar functional disorder could arise from different diseases , essentially two , one originating from small airways and the other from lung parenchyma.7 today , we know that chronic bronchiolitis , which is a progressive , proliferative , and fibrosing pathology of the membranous and terminal bronchioli due to persistent inflammatory , immune , and remodeling process , is by far the most common disease leading to copd.8 in contrast , panlobular emphysema , which is a destructive and hyporegenerative pathology of the alveolar walls with some autoimmune features , is a rare disease that may originate among individuals with severe alpha-1-antitrypsin deficiency and heavy smokers and also leads to copd.9,10 moreover , chronic bronchiolitis can be frequently associated with centrilobular emphysema , when the inflammatory process involves the respiratory bronchioli with subsequent destruction of the secondary lobule , from the center to periphery .
this may configure the presence of mild ( < 5% of the lung volume with low attenuation area [ laa ] < 950 hu , showing round- or oval - shaped laa with well - defined border ) , moderate ( > 5% of the lung volume with laa < 950 hu , showing polygonal- or irregular - shaped laa with ill - defined border ) , or confluent ( showing irregular - shaped laa with ill - defined border coalescent with each other ) centrilobular emphysema.11 actually , centrilobular emphysema does not occur without chronic bronchiolitis , and there is growing evidence that injury of terminal bronchioli would precede the enlargement of centrilobular spaces.12 in a cross - sectional high - resolution computed tomography analysis , it is often impossible to distinguish between panlobular emphysema and confluent centrilobular emphysema , the only distinctive clue being the prevalence of destructive lesions in the lower lobes in the former . at the stage of severe - to - very severe airflow obstruction ,
fibrosing chronic bronchiolitis with ( same degree of ) centrilobular emphysema is the pathological condition most frequently encountered .
although not definitely proved , isolated fibrosing chronic bronchiolitis should be the most common form of copd at earlier stages of airflow obstruction . in all circumstances , however , a progressive reduction in maximal expiratory and inspiratory flow rates may develop because of an increase in airway resistance and/or a decrease in pulmonary static elastance .
diminution of the elastic recoil pressure can augment the expiratory flow resistance by distortion and collapse of the small airways because of reduction in tethering forces .
this phenomenon is amplified by the loss of airway parenchyma interdependence due to progressive disappearance of alveolar attachments .
with the above - mentioned background , in a patient with copd , the priority should be to define the prevalent underlying disease . generally , clinical , radiological ( chest x - ray ) , and adequate functional assessments are sufficient to achieve this ( tables 1 and 2 ) , but sometimes this task requires a more extensive work - up including high - resolution computed tomography lung scan .
many lines of evidence suggest yes . based on different underlying disease , namely prevalent chronic bronchiolitis versus prevalent pulmonary emphysema , in patients with copd the effect of anti - inflammatory treatments ( inhaled corticosteroids and/or phosphodiesterase 4 inhibitors , for instance ) on top of long - acting bronchodilators is different in terms of improvement in function , symptoms , quality of life,13,14 and prevention of exacerbations.1517 in addition , the functional decline is differently affected by treatment,18,19 the all - cause and respiratory mortality is different in long - term follow - up,20 and finally , the clinical phenotypes and some comorbidities tend to cluster differently.21,22 after that it is mandatory to stage the copd severity , which can not rely only on forced expiratory volume in 1 second ( fev1 ) and , as recently suggested , on symptoms , requiring instead a multidimensional approach not only to have a prognostic evaluation but also to establish the level of initial treatment and timing of monitoring . presently , the updated bode ( body mass index , airflow obstruction , dyspnea and exercise capacity ) index appears the most suitable tool for such purpose,23 taking into account also the distribution of the symptoms during the day and the gas exchange abnormalities .
prospectively , determination of some plasma biomarkers , such as c - protein and fibrinogen , might be useful.24 all of this information must be weighted for the age of the patient .
subsequently , an annual history of copd exacerbations , as much as is possible to detail , must be performed because a high frequency of copd exacerbations is an undisputable marker of disease severity that needs to be aggressively controlled .
it is of limited utility to simply count the previous copd exacerbations , and every effort should be made to recognize the prevalent type , and so choose the best available strategy to prevent them.25 the various comorbidities should finally be investigated and graduated by severity in order to treat adequately those known to have a major impact on mortality in patients with copd.26
the pharmacological baseline treatment of stable copd has been widely based on the severity of airflow obstruction and recently also of chronic symptoms and on the number of exacerbations in the previous year.1 with the interesting but somehow confusing exception of the spanish guidelines,27 these recommendations do not take into account the underlying prevalent disease that should be treated and the future risk .
moreover , the exacerbations are just enumerated with no attempt to define their etiology , always suggesting the stereotyped use of inhaled corticosteroids ( ics ) on top of bronchodilators when they are two or more in the previous year ( or one severe , requiring hospitalization).1 in contrast , the therapy must be first tailored on the prevalent disease underlying copd , independent from the degree of fev1 reduction and chronic dyspnea score , and only after that , according to the severity of the disorder ( and age of the patient ) , to establish the level of the treatment in order to freeze , when possible , and not to follow the underlying pathological process , running after it ( figure 1 ) .
we do not need expensive randomized controlled trials ( rcts ) anymore where thousands of patients with copd having different underlying diseases and having different severity of airflow obstruction are enrolled all together , trying to understand the effect of a same treatment . on the contrary ,
more valuable information about any given targeted intervention might be collected , studying small numbers of well - selected patients with copd , with same underlying disease , similar clinical phenotypes , same degree of airflow obstruction and/or bode index , and similar age range , for an adequate span of time . it can be speculated , but it must be proved with well - designed prospective studies that this approach will be more effective in terms of lung function decline and patient - related outcomes , particularly if applied in the initial phases of copd , implying an early diagnosis of chronic airflow obstruction and a better characterization of the underlying disease . perhaps , we would learn that more aggressive treatments have to be implemented in the earlier stages of copd , instead of using them in the more advanced ones as recommended today , to obtain the best possible outcomes .
this has been suggested by the post hoc subgroups analysis in the previous interventional large studies on copd where improvement in symptoms , exacerbation frequency , fev1 annual decline , and all - cause mortality was demonstrated only for patients with copd stages ii and iii ( global initiative for chronic obstructive lung disease).28,29 the goal should be to have patients dying with copd ( when allowed by the underlying disease , essentially chronic bronchiolitis ) and not because of copd .
the prevention of copd exacerbations is a point of paramount importance in the management of copd that needs a completely different approach because it can not be addressed simply with the baseline pharmacological treatment .
we know a lot about copd exacerbations , even if their diagnosis , essentially based on worsening of chronic symptoms reported as relevant by the patients , is presently still based on the exclusion of other diseases . to suffer from two or more copd exacerbations or from one severe copd exacerbation leading to hospitalization in the previous year is without doubt a marker of copd severity , independent from the underlying disease , degree of airflow obstruction , and entity of symptoms or bode index , even if lower fev1 is associated with higher risk of frequent and more severe exacerbations .
although the probability of having a new copd exacerbation is greater in those patients with copd who previously experienced copd exacerbations ( so - called frequent exacerbators),30 such status , with few exceptions,3133 can not be identified as a distinct phenotype , rather as a condition requiring more strict social and medical attention .
in fact , it is quite easy to shift from a frequent exacerbator to a nonfrequent exacerbator and vice versa,34 sometimes without an obvious reason , but often clearly because of a more adequate and comprehensive treatment.35 given the prognostic importance of copd exacerbations,36 however , we can not be limited to simply counting exacerbations ; we must learn how to consistently recognize the prevalent type in a single patient .
such an approach is crucial to prevent more effectively the copd exacerbations using more tailored and specific therapies ( figure 2 ) .
some plasma , blood , or sputum biomarkers have been shown to be associated with high sensitivity and specificity to a prevalent clinical type of copd exacerbation : eosinophilic , infectious either virus or bacteria associated , or pauci - inflammatory , due to several possible causes that have to be identified.37 more interestingly , these specific biomarkers tend to be detectable also in stable conditions , at least in eosinophilia- and bacteria - associated exacerbations , allowing an easier identification of the most likely future pattern of copd exacerbations.37 thus , when possible , each prevalent type of copd exacerbation in a given patient who is a frequent exacerbator should be appropriately prevented by specific treatments that can not be invariably the use of high - dose ics , as presently recommended.1,27 long - acting bronchodilators and mainly ultralong - acting bronchodilators ( both beta-2 agonist and antimuscarinic drugs ) are able to prevent up to 30% of copd exacerbations when given alone38 and possibly more when given in combination.39 ics are very useful to prevent the eosinophilic exacerbations,1517 but it is difficult to see how ics can prevent infectious exacerbations , or even noneosinophilic and noninfectious exacerbations , apart from strengthening the action of bronchodilators such as long - acting beta-2 agonists ( laba ) in some circumstances.38 in patients with copd having bronchiectasis and chronic bronchitis , copd exacerbations are often infectious and bacterial in nature and must be prevented with antibiotic prophylaxis , at least in the winter season .
there is strong evidence that macrolides may significantly reduce copd exacerbations,4042 suggesting that this kind of exacerbation can be prevented in some clinical phenotypes of patients with copd having high risk of bacterial colonization or chronic infections .
presently , only adequate immunization against influenza virus can be offered for viral exacerbations in patients with copd , and we urgently need the same effective tools for rhinovirus infection , the most common cause of virus - associated copd exacerbation .
all other types of copd exacerbations ( noninfectious and noneosinophilic ) deserve accurate work - up and specific preventative treatment should be applied when the cause is recognized ( figure 2 ) .
many of these exacerbations , in fact , can be largely avoided with targeted approaches.38,4345 for instance , in the presence of patients with copd having presumable high oxidative stress ( those who continue smoking , those with chronic bronchitis , and those with high exposure to environment pollution ) , an adequate antioxidant support might significantly reduce copd exacerbations.46,47 finally , a strict adherence to baseline chronic therapy should be assured throughout a strong relationship between patients with copd and their physicians and caregivers because this aspect is crucial to obtain improved control of copd exacerbations and their consequences.48
in summary , in patients with copd , first treat as soon as possible the underlying disease , aiming to freeze the disease and halt progression , ready to implement treatment ( essentially with different bronchodilators , including theophylline ) to control symptoms and improve lung function , exercise tolerance , and quality of life , if necessary .
second , look at the exacerbations of copd , if they are frequent ( more than one in a year ) , define their prevalent phenotype ( eosinophilic , bacterial , or due to other causes ) and treat to prevent accordingly . | copd is a common cause of disability , morbidity and mortality worldwide and a major global health problem with enormous direct and indirect health care costs .
different reasons can be advanced to explain it , but among them the possibility that the recommended diagnostic and therapeutic approaches to copd were less effective than they could be , should be also considered . the pharmacological baseline treatment of stable copd has been widely based on the severity of airflow obstruction and recently , of chronic symptoms and on the annual number of previous exacerbations .
these recommendations do not take into account the underlying prevalent disease that should be treated and the future risk .
our suggestion is that the therapy must be firstly tailored on the prevalent disease leading to copd , independently from the degree of fev1 reduction and chronic dyspnea and only after that , according to the severity of the disorder ( and age of patient ) , to establish the level of the treatment in order to freeze , when possible , and not to follow the underlying pathological process , running after it .
moreover , given the relevance of exacerbations in the natural history of copd , greater effort should be placed on recognition of their prevalent type in frequent exacerbators and to prevent them using more tailored and specific treatment . | Introduction
Definition
Diagnostic and severity assessment
Therapeutic approach
Exacerbations
Conclusion |
the keratocystic odontogenic tumor ( kcot ) is defined as a benign , intraosseous tumor of odontogenic origin with a potential for aggressive , infiltrative behavior .
this tumor shows specific histopathological features and has a high recurrence rate . in 2005 in the revised world health organization classification , the odontogenic keratocysts ( okcs ) was recognized as a benign odontogenic tumor and the new terminology is kcot .
the range of occurrence is wide from the first to the ninth decade of life .
mandible is involved more frequently with a higher incidence in the posterior area of mandibular body and ramus . some of the patients are unaware of the lesion . but
symptoms such as swelling , pain and discharge are rather common . in the cases that patients are unaware of their pathological lesion
, pathological fractures can occur because of the tendency of the tumor to extend into the medullary cavity .
penetration of the tumor into the soft tissues , orbit , infratemporal fossa and skull base may occur in aggressive forms .
the effect on surrounding structures is displacement of unerupted teeth and displacement of the mandibular canal inferiorly or superiorly .
histopathologically , the kcot include a thin , uniform layer of epithelium with little or no evidence of rete ridges , a well - defined basal cell layer with palisading cuboidal or columnar cells , and a corrugated , keratinizing luminal surface that is primarily parakeratinized .
the tumors linings are thin and fragile , being difficult to enucleate in one piece .
the treatment of kcot is of controversy : some surgeons advocate conservative therapies , whereas others are in favor of an aggressive treatment .
choose of the best treatment modality to lower risk of possible recurrence and also the least morbidity is of importance .
this article presents a case of recurrence of kcot in the right mandibular body of a male patient after 5 years .
a 22-year - old male presented to the clinic of oral and maxillofacial radiology of isfahan dental school for evaluation of a gradually enlarging hard mass in the right mandible on january , 2013 .
he reported that the swelling had gradually increased in size over a period of 2 years .
he has not any other symptoms such as pain , drainage and neurosensory deficit associated with right inferior alveolar nerve .
he has a history of surgery on the right side of the mandible at molar region due to the kcot in this region 5 years ago with the size of 2.5 2.5 cm .
clinical evaluation showed a slight swelling along all the right mandibular body , second premolar and first molar teeth in this region were extracted .
the cone beam computed tomography was performed by gallileos unit ( sirona dental systems gmbh , germany , hessen , bensheim ) with slice thickness and slice interval of 2 mm .
evaluation of coronal , axial and cross - sectional views exhibits a large multilocular radiolucency from the angle of mandible to the symphysis [ figure 1 ] .
cone beam computed tomography , panoramic view , extension of a multilocular radiolucent lesion from the angle of the mandible to the symphysis the lesion expands the inferior border of the mandible and displaced the inferior alveolar canal inferiorly [ figure 2 ] .
cone beam computed tomography , tangential view , note to the expansion of the inferior border of the mandible and inferior displacement of the infrior alveolar canal nerve in the right parasymphis region , the buccal cortical plate of the mandible was perforated in some regions [ figure 3 ] . cone beam computed tomography , axial view , mandibular buccal cortex perforation finally , due to the patient 's past history and radiological findings , the temporary diagnosis was recurrence of kcot that was proved by incisional biopsy and the patient referred for surgical treatment . surgical resection of the right side of the mandible from an angle to the right parasymphis region
the most common site of occurrence of kcot is posterior mandibular body and angle as we see in this case .
characteristic thin and friable lining of the kcot that makes removal of the tumor as a single piece difficult .
the treatment of kcot remains controversial and various surgical modalities have developed to decrease the rate of recurrence , including enucleation , curettage , marsupialization , decompression , enucleation and treatment of the bony defect with carnoy 's solution ( a cauterizing mild penetrating agent that is used to the elimination of possible vital cells left behind in the defect ) , liquid nitrogen cryotherapy and resection ( with or without loss of jaw continuity ) .
patient characteristics are very important determinants , including the general health status , age , reliability for follow - up , and whether the patient has basal cell nevus syndrome .
resection has proved to be the most predictable treatment , but the morbidity associated with reconstructing continuity defects seems unwarranted in most instances for a disease with no real metastatic potential , although it is aggressive nature .
it is advised to use resection for the more aggressive cysts with perforation of buccal and lingual plates . in the presented case
we have a tumor of large size with buccal plate perforation so the surgery decision was resection . as long as more conservative treatment is used ,
the authors stated that for a routine kcot in a cooperated person who is likely to return for follow - up treatment , carnoy 's solution appeared to be the least invasive procedure with the lowest recurrence rate as was stated by the studies of stoelinga et al . and voorsmit et al .
for very large tumors , decompression followed by enucleation will also have a low recurrence rate . for patients who are unlikely to return for follow - up ,
recently for the voluminous kcot of the mandible , endoscopy has been used to assist the surgeon to explore accurately the operative field and areas of difficult access .
as was mentioned , choose of the best treatment modality extremely depends on the patient assistance for periodical follow - up .
recurrence can occur many years after treatment , so long - term follow - up is mandatory .
some authors suggest a lifelong follow - up schedule , regardless of the treatment given , every year for the first 5 years and every 2 years thereafter because the recurrence can occur after 40 years .
the present case did not refer for the periodical follow - up that allows the tumor to reach to the large size that makes the surgery more difficult and also increases the morbidity of the patient after surgical treatment . | the keratocystic odontogenic tumor ( kcot ) is a relatively common oral and maxillofacial lesion with specific characteristics such us rapid growth , extension into the surrounding tissues and high rates of recurrence .
various treatment modalities have been reported . due to the very thin and friable lining characteristic of the tumor , enucleation can be difficult undertaken and for this reason it is associated with the highest recurrence rates .
a 22-year - old male referred to our clinic due to a slight expansion in the right mandible from 2 years ago .
he has a history of occurrence of kcot in this region that was treated surgically by enucleation and curettage 5 years ago .
cone beam computed tomography showed a multilocular radiolucent lesion that extended from the angle of the mandible to the symphysis .
incisional biopsy showed a kcot recurrence that surgically treated with resection of the right mandible by continuity preservation .
selection of the best treatment modality and also a periodical lifelong follow - up is very important to reduce the rate of recurrence and morbidity of the patient . | INTRODUCTION
CASE REPORT
DISCUSSION |
there are different diagnostic methods but they have some drawbacks . to prepare mycobacterium culture , which is the golden standard for tb diagnosis , it may take 8 weeks .
finding acid - fast bacilli is the quick screening method for pulmonary tb diagnosis ; nevertheless , its sensitivity is low .
the polymerase chain reaction ( pcr ) test for tb diagnosis is expensive and it requires skilled personnel and lot of equipments .
therefore , in recent years , there has been a great demand for finding new microbiological , genetic , immunological , and biomedical diagnostic methods to diagnosis tb quickly and accurately .
ada is essential for proliferation and differentiation of lymphoid cells , especially t cells , and helps in the maturation of monocytes to macrophages .
it seems ada is an index for cellular immunity and previous studies have proved its value in tb diagnosis , even for assessing tb effusions .
, the level of ada in sputum and serum was used for diagnosis of tb , and it was monitored during tb treatment . however , previous studies used effusion fluids and a very limited number of studies used patients serum .
it is not always possible to access effusion liquids everywhere in pulmonary and extra - pulmonary tb ; therefore , it would be helpful to take advantage of serum levels .
the goal of this study is to assess the diagnostic value and cut - off point of serum ada levels in pulmonary tb patients .
it was a cross - sectional study ( 2011 ) , which is conducted in tohid hospital ( university referral hospital ) in sanandaj in iran . in our study ,
case group included 40 sputum smear - positive tb patients who were admitted in infectious disease ward of the hospital .
inclusion criteria for tb patients were : having 2 or 3 sputum positive smears , or one sputum positive smear and one positive sputum culture , or
one positive tb microbe smear sputum and suspected chest radiography . in addition , 40 non - tb patients , referred to tohid hospital in sannandaj for surgeries , were selected as the control group .
inclusion criteria for control group were : not having any tb patient in their family , not having history of close contact with tb patients , not having any infectious disease ( according to the interview and their records ) , not having fever or any symptom of illness or of being toxic , normal cell blood count , and normal chest radiography .
after diagnosis of tb ( before initiation of treatment ) , blood samples and patients approval of consent form ( research project number : 1387/87 ) were taken from tb group ( at 7 am )
. then samples were centrifuged and serum ada levels were measured by ada kit manufactured by diazyme laboratories company . in the first step , adenosine was affected by ada and it becomes de - ammonized and shifted to inosine and then ammoniac was released . in the second reaction , because of glometat , released nh3 had become dehydrogenized and when it got close to allosteric activators , it combined with nicotinamide adenine dinucleotide phosphate hydrogen ( nadph ) and released nicotinamide adenine dinucleotide phosphate ( nadp ) . consequently
, there was a direct relationship between activity ( density ) of ada enzyme and speed reduction of radiation absorption in 340 nanometer wavelength ( as nadph changed to nadp+ ) ; it was measured by diazyme adenosine deaminase assay kitt ( diazyme laboratory ; usa ) .
then , data were analyzed using statistical package for the social sciences ( spss ) 11.5 ( chicago , usa ) software and roc curve was plotted .
from all 40 tb patients who participated in this study , 16 were males and 24 were females . from 42 participants in control group , 22 were males and 20 were females .
the most common age group for tb patients was 50s and for control group , it was 40s .
age average was 59 ( 13.5 ) in tb patients and it was 49 ( 15.6 ) for non - tb patients .
the average of serum ada in tb patients group and control group was 20.88 ( 5.97 ) and 10.69 ( 2.98 ) , respectively .
u / l in which sensitivity and specificity were 92.7% ( 95% ci , 84.7 - 100 ) and 88.1% ( 95% ci , 78.3 - 97.8 ) , respectively .
the positive and negative predicative values were 88.4% ( 95% ci , 75 - 95.1 ) and 92.5% ( 95% ci , 79.6 - 98.4 ) , respectively [ figure 1 ] .
the calculated area under the roc curve was 0.955 ( 95% ci , 0.914 - 0.995 ) ( p < 0.001 ) .
in this study , serum ada level was an appropriate index for diagnosing smear - positive tb .
therefore , serum ada could be also used for diagnosis of pulmonary tb . moreover , in this study , all tb patients had a serum level of more than 22.5 u / l . hence , for suspicious cases of tb , increased levels of ada could facilitate diagnosis .
diagnostic value of serum ada in pulmonary tb has been assessed only in few numbers of studies . pairs et al . reported an increase in ada level in tb pleural effusion ; other studies have also confirmed such an increase in tb pericardial effusions , peritoneum , and central nervous system ( cns ) .
the main reason for the increased ada levels in pleural effusion is the movement of t lymphocytes toward this area .
increase in ada level is the result of a tropical inflammatory reaction caused by monocytes and macrophages .
when alveolar macrophages are infected by mycobacterium , this enzyme could be found in serum during active pulmonary disease .
when tb infection is controlled , growth - markers of lymphocytes decrease ; leucocytes will decrease in serum ada levels concurrent with the decrease in lymphocytes .
because of this , serum ada level could be utilized as a treatment response index . in agarwal
's study , ada level was 15.3 ( 0.23 ) in healthy people , 19 ( 0.68 ) in non - pulmonary tb cases , and 38.48 ( 1.56 ) in pulmonary tb patients .
in jhamaria et al . 's study , the average of serum ada level was 19.9
u / l ( 2.99 ) in control group , 43.95 u / l ( 2.48 ) in sputum smear - positive people with typical or progressive disease , and 42.09 u / l ( 1.46 ) and 40.02 u / l ( 2.58 ) in negative sputum patients with mild or typical disease . in their study , in the cut - off point of 33
it seems that as the disease progresses , ada levels increase ; this subject was not considered in our study . in another study with an ada level of 26.2 u /
l , sensitivity , specificity , and positive predictive value were 95% , 83.3% , and 79.2% , respectively . in gupta
's study , sensitivity , specificity , positive predictive value , and negative predictive value were 92.8% , 90% , 92.8% , and 90% , respectively , for diagnosis of tb in pleural effusion with an ada level of more than 40 . in conde
's study , ada level of 14 u / l was chosen as cut - off point .
stevanovic et al . assessed serums of extra - pulmonary tb patients and in a cut - off point of 24 , sensitivity and specificity were 94.3% and 92.2% , respectively ; in their study , serum ada level decreased as treatment started . in dilmac
's study , serum ada level in pulmonary tb patients was reported as 27.5 ( 11 ) and it was 23.9 ( 24 ) in chronic obstructive pulmonary disease ( copd ) patients .
in rasolinejad 's study , serum ada level was 21.51 in pulmonary tb patients and 11.47 in healthy people ; in cut - off point of 14.5 u /
u / l in negative smear and negative tuberculin patients , 33.52 ( 15.22 ) in smear - positive and purified protein derivative ( ppd ) positive patients , and 16.5 ( 3.18 ) in volunteer healthy people . such differences may be due to tb severity , age groups , genetic differences , and dissimilarities in control groups .
therefore , further studies for identifying normal ada levels in different societies may be useful .
fortunately , in some autoimmune patients like rheumatoid arthritis , synovial ada level is normal and it is similar to control group .
thus , in autoimmune diseases that involve lung , ada level could be used for tb differentiation . in some studies , ada2 was also considered a useful tool for diagnosis ; it needs further studies .
according to this study , serum ada level is proposed as a proper index for tb diagnosis ; in a cut - off point of 14 , its sensitivity and specificity are calculated as 92.7% and 88.1% , respectively . | background : in some studies , the level of adenosine deaminase ( ada ) in sputum and effusion liquids was used for the diagnosis of tuberculosis ( tb ) .
but it is not always possible to access these materials .
the goal of this study is to assess the diagnostic value of serum ada levels in pulmonary tb patients.materials and methods : in this study , 40 sputum smear - positive tb patients who were hospitalized and 40 non - tb patients who referred for surgeries were selected .
a serum sample was collected and serum ada level was measured by ada kit.results:the average ( sd ) of serum ada in tb and non - tb patients were 20.88 ( 5.97 ) and 10.69 ( 2.98 )
u / l , respectively ( p value < 0.05 ) .
the best cut - off point was 14 u / l . the calculated area under the receiver operating characteristic ( roc ) curve was 0.955 ( 95% ci , 0.914 - 0.995 ) ; sensitivity was 92.7% ( 95% ci , 84.7 - 100 ) and specificity was 88.1% ( 95% ci , 78.3 - 97.8 ) ( p < 0.001).conclusion : serum ada level may be proposed as a proper index for tb diagnosis . | INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUSIONS |
the development of cancer is a complex process during which a normal cell undergoes a progressive series of alterations resulting in the acquisition of an altered proliferative capacity , invasiveness , and metastatic potential . for non - melanoma skin cancer ( nmsc ) , these changes are classically defined as occurring in stages : ( a ) initiation , involving dna damage leading to mutations , ( b ) promotion , which involves proliferation and inflammation , and ( c ) progression , involving additional genetic mutations or structural genomic changes that result in malignancy .
the mouse skin model has been extensively used to study molecular changes associated with the dysregulated signaling that occurs in the different stages of tumor development .
this model is relevant to other epithelial tissues and to humans and has been intensely studied for this reason .
one of the most common features of tumor promotion induced by chemicals or ultraviolet light ( uv ) in mouse skin is the induction of inflammation , which is characterized by the synthesis of cytokines , growth factors , and arachidonic acid metabolites as well as by the infiltration of inflammatory cells such as macrophages and lymphocytes .
of all the eicosanoids synthesized in the epidermis , the prostaglandins ( pgs ) are the most abundant .
the unstable intermediates of the arachidonic acid - derived pgs are synthesized by the cyclooxygenase ( cox ) enzymes , cox-1 and cox-2 , and further metabolized to pge2 , pgf2 and pgd2 by specific synthases .
cox-1 is constitutively expressed in most tissues , and its pg products , particularly pge2 , are involved in normal physiological functions such as maintenance of the gastric mucosa and regulation of renal blood flow . on the other hand ,
cox-2 expression is undetectable in most unperturbed adult epithelial tissues except kidney and brain , but is highly inducible by various endogenous inflammatory and mitogenic factors as well as exogenous agents such as phorbol esters and uv . as observed in many other epithelial tumors , cox-2 is constitutively upregulated in human and murine nmsc , which is accompanied by a high level of pg synthesis .
both pharmacological and genetic approaches have been used to demonstrate the contribution of the pgs to murine skin cancer .
nonsteroidal anti - inflammatory drugs ( nsaids ) that target both cox-1 and cox-2 , as well as selective cox-2 inhibitors have been shown to prevent tumor development elicited by either the chemical two - stage model or by uv [ 24 ] . to unequivocally show that cox-2 expression and activity is critical for skin carcinogenesis , cox-2 knockout mice were generated and shown to be significantly protected from tumor development in either the chemical two - stage model or uv model [ 5 , 6 ] . to further assess the contribution of the pg products of cox-2 , transgenic mice overexpressing cox-2
were generated using either the bovine keratin 5 ( k5.cox-2 mice ) or keratin 14 ( k14.cox-2 mice ) promoter [ 7 , 8 ] .
the k14.cox-2 mice on the skh-1 background developed many more tumors in response to uv than their wild - type counterparts .
treatment of the k14.cox-2 transgenic mice with the carcinogen dimethylbenz[a]anthracene ( dmba ) alone ( i.e. , in the absence of phorbol ester promotion ) also resulted in many more tumors than occurred in wild - type mice , suggesting that chronically high levels of pgs have intrinsic tumor promoting activity .
subsequent studies showed that application of pge2 to cultured murine keratinocytes or to murine skin caused the activation of multiple signaling pathways resulting in proliferation .
interestingly , these are the same signaling pathways activated by the phorbol ester tumor promoters , suggesting that phorbol ester promotion occurs via its enhancement of pge2 synthesis . now that it has become well - established that induction of cox-2 and its primary product , pge2 , are important mediators of tumor promotion
, attention has turned to the downstream effectors of pge2 , as well as the other pgs .
the pharmacological classification of the pg receptors is based on each receptor preferentially recognizing specific pgs , e.g. , pgd2 activates the d receptors , pgf2 the fp receptors and pge2 the ep receptors .
pge2 binds and activates four g - protein - coupled e receptors referred to as ep1 , ep2 , e3 , and ep4 [ 12 , 13 ] . like the other pg receptors , the ep receptors have seven transmembrane segments and each receptor is coupled to different g subunits of the heterotrimeric g proteins .
ligand binding of the different ep receptors leads to activation of distinct downstream signaling pathways ( fig . 1 ) .
it is generally accepted that the ep1 receptor activates phospholipase c ( plc ) , which mediates activation of protein kinase c ( pkc ) and elevation of cytosolic free calcium .
while ep2 and ep4 both activate adenylate cyclase and increase camp levels , ep4 , but not ep2 , is also coupled to the phosphatidylinositol 3-kinase ( pi3k ) pathway .
ep3 differs from the other ep receptors in that multiple variants can be generated by alternative splicing of the c - terminal tail , with several variants inhibiting adenylate cyclase .
the signaling pathways that are activated are also dependent in part on the level of pge2 that is present , due to differences in binding affinities between the receptors .
the ep1 receptor binds pge2 with a kd of 21 nm which is higher than the 11.2 nm kd for ep2 and the 2.9 nm kd for ep3 .fig .
ep1 activates phospholipase c ( plc ) , resulting in the production of 1,2-diacylglycerol ( dag ) and inositol 1,4,5-trisphosphate ( ip3 ) .
ep2 activates adenylate cyclase ( ac ) which results in elevated camp synthesis and protein kinase a ( pka ) activation .
the activation of these signaling pathways by the ep receptors in skin results in biological changes that are associated with the promotion and progression of nmsc canonical signaling pathways activated by the ep receptors for pge2 .
ep1 activates phospholipase c ( plc ) , resulting in the production of 1,2-diacylglycerol ( dag ) and inositol 1,4,5-trisphosphate ( ip3 ) .
ep2 activates adenylate cyclase ( ac ) which results in elevated camp synthesis and protein kinase a ( pka ) activation .
the activation of these signaling pathways by the ep receptors in skin results in biological changes that are associated with the promotion and progression of nmsc as will be discussed later , significant cross - talk can occur between the canonical signaling pathways described above and several additional pathways can be activated in some cells .
one of the most important of these is the recent demonstration that the ep1 , ep2 , and ep4 receptors can transactivate the epidermal growth factor receptor ( egfr ) ; egfr - mediated signaling has been implicated in proliferation , invasion , resistance to apoptosis , angiogenesis , and metastasis , all of which are associated with tumor development . in murine skin
in particular , application of diverse tumor promoters induce egfr ligands , and both egfr and its ligands are constitutively upregulated in papillomas and squamous cell carcinomas ( sccs ) .
this emphasizes the extensive and complex signaling networks that are activated by the ep receptors that has hindered an understanding of how each of the ep receptors elicit their multiple biological effects .
the mouse ep1 , ep2 , ep3 ( variant ) , and ep4 consists of 405 , 362 , 366 , and 513 amino acids , respectively .
the amino acid identity among the ep receptors is small , e.g. , the identity of ep1 to ep2 , ep3 , and ep4 is 30% , 33% , and 28% , respectively .
even ep2 and ep4 , which both activate adenylate cyclase , only have a 31% identity [ 12 , 15 ] .
ep1 has a long third loop as does ep4 , which also has the longest intracellular c - terminus [ 12 , 15 ] .
the long cytoplasmic domain of ep4 interacts with arrestins causing receptor internalization , something that is unique to the ep4 receptor . in general , the tissue distribution , cellular localization , and level of expression are variable among tissues . ep3 and ep4 are the most widely distributed , at least in mouse , with their mrnas expressed in almost all tissues .
ep1 appears to be restricted to several tissues , including kidney , lung , stomach , colon , and skin . in many tissues , ep2 is the least abundant of the receptors .
expression of the ep genes is regulated by various stimuli , both physiological and pathophysiological , resulting in variable levels of expression even in a given tissue . among the ep receptors ,
promoter analysis of the ep2 and ep4 genes identified several consensus sequences relevant to inflammatory stimuli inducing nf - il6 , nfb , and ap-2 in both genes , while the promoter region of ep2 also contains sp1 and myod sequences , as well as a putative glucocorticoid response element [ 20 , 21 ] . in this review
, the contribution of each of the ep receptors to nmsc will be discussed . because pge2 is a strong endogenous tumor promoter in murine skin , elucidating the signaling pathways that are activated by the ep receptors
should improve our understanding of the molecular basis for tumor promotion and also offer the possibility of improved prevention / intervention in the development of nmsc .
both human and mouse keratinocytes express all four ep receptors which has made our understanding of how pge2 functions as a tumor promoter difficult [ 2224 ] .
the ep1 and ep2 receptors are low affinity receptors , compared to ep3 and ep4 .
while the high affinity receptors would be expected to be activated at low levels of pge2 , such as would occur in unperturbed skin , the low affinity receptors are likely to be activated only in pathological conditions , suggesting that its signaling is more likely to be activated when cox-2 is induced and pge2 synthesis is high , conditions that are found early in skin tumor development .
initial studies on the role of ep1 in skin focused on its expression and localization .
were among the first to show that ep1 is expressed in human epidermis and that it occurs primarily in the cytoplasm of cells in the granular layer .
both plasma membrane and perinuclear / nuclear localization was observed in the basal layer and stratum spinosum .
also reported that ep1 was found in the more suprabasal layers of mouse skin , although neumann et al . reported that ep1 expression occurred predominantly in the basal compartment
the reason for the discrepancy between laboratories is unknown but may be due to non - specific antibody reactions . because the ep1 receptor is more likely to function under conditions of stress or irritation , there has been greater interest in understanding whether its expression levels change after exposure of skin to uv or to chemical tumor promoters .
. showed that in uv - irradiated hyperplastic skin ep1 remained predominantly suprabasal but was strongly increased .
[ 27 , 28 ] found no change in localization after either acute or chronic uv exposure , but found an increase in the mrna for ep1 only after chronic , but not acute , uv .
acute uv was shown , however , to upregulate ep1 mrna in cultured murine keratinocytes .
our laboratory showed that ep1 mrna was elevated after both acute and chronic uv irradiation , as well as after both single and multiple topical treatments with the tumor promoter 12-o - tetradecanoylphorbol 13-acetate ( tpa ) .
this upregulation of ep1 after uv or tpa is significant because both uv and tpa cause an upregulation of cox-2 with a concomitant increase in pge2 .
the increase in pge2 and in ep1 suggests that this receptor may function as a stress receptor .
ep1 receptor expression in murine and human nmscs has also been investigated . in uv - induced papillomas and sccs in mice ,
also reported that well - differentiated scc 's had significantly greater membrane staining while bcc 's and spindle cell carcinomas had notably reduced membrane staining . at the mrna level , ep1 was found to be upregulated significantly in murine papillomas and sccs generated either with a uv or initiation - promotion protocol by several laboratories including our own [ 27 , 30 ] .
a likely role for the ep1 receptor in skin carcinogenesis was suggested by the reports that ep1 null mice or use of selective ep1 antagonists resulted in reduced colon and breast cancer development [ 3234 ] .
tober et al . investigated the effects of topical application of the ep1 antagonist ono-8713 on uv - induced cutaneous inflammation and tumor development . using skin thickness ( vascular permeability ) and neutrophil infiltration as measures of an inflammatory response
, they found that the ep1 antagonist reduced these parameters as well as the level of pge2 .
more significantly , in a uv carcinogenesis experiment , the ep1 antagonist reduced tumor multiplicity by 50% relative to wild - type controls . in the same experiment , topical application of the selective cox-2 inhibitor celecoxib reduced tumor multiplicity somewhat more , 60% , but the combination of ono-8713 and celecoxib had no greater effect .
these data offer insight into the biochemical events needed for , or contributing to , skin carcinogenesis .
celecoxib is a potent cox-2 inhibitor but does not completely stop synthesis of pgs [ 2 , 4 ] , likely due to continued low level synthesis of pgs from cox-1 .
. observations also suggest that ep1 is responsible for a large part of the tumor promoting activity of pge2 .
the remainder of the activity is likely due to activation of the other ep receptors or possibly one or more of the peroxisome proliferator - activating receptors , which are known to be activated by eicosanoids . to more definitively determine the contribution of the ep1 receptor to skin tumor development , our laboratory generated transgenic mice ( bk5.ep1 ) that overexpress ep1 , under control of a bovine keratin 5 ( bk5 ) promoter , in the basal layer of murine epidermis .
skins of these mice were histologically indistinguishable from wild - type mice and had similar levels of epidermal cell proliferation after topical treatment with tpa . surprisingly , using a carcinogenesis protocol employing the carcinogen dmba and the tumor promoter tpa , the bk5.ep1 mice produced significantly fewer tumors compared to wild - type mice .
pkc , the receptor for tpa that mediates its tumor promoting activity , was found to be downregulated in the bk5.ep1 epidermis , which likely explains the refractoriness to tpa promotion .
however , even though tumor multiplicity was reduced in the transgenic mice , the percentage of tumors that were scc were very high compared to wild - type mice , i.e. , they had an approximately eightfold - higher papilloma to carcinoma conversion rate
. to circumvent the potential problem of pkc downregulation , another tumor promoter , anthralin , which generates free radicals and does not interact with pkc was used in place of tpa . with this protocol
, tumor multiplicity and tumor incidence were increased twofold in bk5.ep1 mice compared to wild type .
more significantly , however , was the observation that the transgenic mice had a ninefold increase in sccs .
overall , these tumor experiments indicate that the effect of ep1 overexpression is protocol- and agent - dependent with regard to papilloma development , but consistently contributed to progression of papillomas to sccs . in a recent study ,
our laboratory found that a single topical application of dmba or benzo[a]pyrene alone was sufficient to elicit sccs in the bk5.ep1 transgenic mice , but not in wild - type mice .
this difference was not due to alterations in carcinogen metabolism , dna adduct formation , or ras activity . because pge2 signaling has been shown to be important in maintaining hematopoietic stem cell homeostasis , the effects of ep1 receptor overexpression on keratinocyte stem cell numbers was investigated as a possible mechanism for the dramatic increase in scc 's seen in the bk5.ep1 model . using cd34 and 6 integrin as markers
however , ep1 transgene overexpression caused cox-2 expression in the epidermis , which is not normally seen in wild - type mice .
to determine the significance of this upregulated cox-2 , the selective cox-2 inhibitor celecoxib was administered in the diet before dmba application . while the dmba - treated bk5.ep1 control mice had significant hyperplasia and inflammatory cell infiltration for at least 2 weeks
, the celecoxib - fed mice had relatively normal skin architecture and very few inflammatory cells , and remained normal for the duration of the experiment . to verify that this was not an off - target effect of celecoxib
loss of one allele of cox-2 reduced tumor development by 50% while loss of both alleles completely prevented tumor development , demonstrating a requirement for the pgs generated from cox-2 in the development of skin tumors in the bk5.ep1 model .
it is clear from the above tumor studies employing genetic or pharmacological approaches to up- or downregulate ep1 activity , that the ep1 receptor plays a major role in the pro - tumorigenic action of pge2 .
what remains to be determined is the mechanisms and signaling pathways by which this occurs .
. showed that in human keratinocytes ep1 activation is coupled to intracellular calcium mobilization , as is found in many other cell types .
they further demonstrated that ep1 expression , particularly when localized to the membrane , is associated with keratinocyte differentiation , which is known to be induced by calcium mobilization and is usually associated with decreased tumorigenesis . in rat osteoblasts ,
the ep1 receptor was shown to signal through a plc / pkc / c - src signaling pathway .
plc activation hydrolyzes phosphatidyl inositol 4,5-bisphosphate into two second messengers , inositol 1,4,5-trisphosphate , which triggers calcium mobilization , and diacyglycerol ( dag ) which activates pkc .
2 ) is operative in keratinocytes based on the observations that activation of ep1 causes calcium mobilization and pkc is downregulated in the epidermis of bk5.ep1 transgenic mice .
because downregulation of pkc occurs as a result of its activation , which is also something the tumor promoter tpa causes , overexpression of ep1 may lead to autonomous tumor promotion . in support of this ,
thompson et al . reported that malignant murine keratinocytes are stimulated by pge2 to proliferate and that this was mediated by the ep1 receptor.fig .
ligand activation of the ep1 receptor causes conformation changes resulting in activation of the heterotrimeric g protein , gq .
activation causes release of gdp from the g subunit and the binding of gtp , which is associated with release of g and activation of phospholipase c beta ( plc ) .
activated plc hydrolyzes phosphatidyl inositol 4,5-bisphosphate to 1,2-diacylglycerol ( dag ) and inositol 1,4,5-trisphosphate ( ip3 ) .
ip3 raises cytoplasmic ca levels via movement from endoplasmic reticulum stores , leading to activation of calcium signaling pathways .
dag activates protein kinase c ( pkc ) , which subsequently activates the mapk pathway via raf-1 activation .
pkc can also be activated by the phorbol ester tumor promoters ; chronic activation of ep1 may confer tumor promoting / progression activity through pkc ep1 signaling in keratinocytes .
ligand activation of the ep1 receptor causes conformation changes resulting in activation of the heterotrimeric g protein , gq .
activation causes release of gdp from the g subunit and the binding of gtp , which is associated with release of g and activation of phospholipase c beta ( plc ) .
activated plc hydrolyzes phosphatidyl inositol 4,5-bisphosphate to 1,2-diacylglycerol ( dag ) and inositol 1,4,5-trisphosphate ( ip3 ) .
ip3 raises cytoplasmic ca levels via movement from endoplasmic reticulum stores , leading to activation of calcium signaling pathways .
dag activates protein kinase c ( pkc ) , which subsequently activates the mapk pathway via raf-1 activation .
pkc can also be activated by the phorbol ester tumor promoters ; chronic activation of ep1 may confer tumor promoting / progression activity through pkc in summary , the currently available data suggest that the ep1 receptor plays a role not only in keratinocyte differentiation , but more importantly it contributes significantly to the development of nmsc .
the extent to which these observations extend to other tissues is likely to be context and tissue specific .
ep1 receptor deficiency significantly reduced azoxymethane - induced colon cancer in mice , suggesting that the ep1 receptor is likely to be pro - tumorigenic in self - renewing epithelium such the epidermis and gastrointestinal tract . however , reduced ep1 expression increased the metastatic capacity of breast cancer cells , suggesting that ep1 may have anti - tumorigenic activity in certain contexts .
additional studies are needed to elucidate the mechanisms by which the ep1 receptor influences these neoplastic processes .
like the ep1 receptor , the ep2 receptor is a low affinity receptor and thus likely to be more important during disturbances of skin homeostasis and/or integrity . like ep1
, ep2 has also been shown to be localized to both the perinuclear and outer membrane of normal human keratinocytes in the basal and spinous layer .
the localization of ep2 ( and ep1 ) in the perinuclear membrane is of interest because cox-1 and cox-2 localize to the nuclear membrane as well as the endoplasmic reticulum , suggesting possible nuclear second messenger signaling . in mouse ,
the ep2 receptor was found by immunohistochemistry both on the plasma membrane and within the cytoplasm .
patchy expression throughout the epidermis has also been reported . however , because mice have a very thin epidermis that lacks the defined granulosa and spinous layers of differentiated human epidermis , it is difficult to assess whether the decreased expression in the more differentiated human keratinocytes also occurs in mouse .
investigations in our laboratory showed that the level of expression of the ep2 receptor can be modulated by tumor promoting stimuli .
topical application of the phorbol ester tpa upregulated ep2 mrna more than fivefold following single or repeated applications .
we also found that exposure of mouse skin to uv , either once or repeatedly , also significantly elevated ep2 ( unpublished data ) , although another study reported that ep2 was elevated only after chronic uv exposure , not after an acute exposure .
the expression levels and patterns of the ep2 receptor have also been examined in skin tumors resulting from either uv or chemical carcinogenesis protocols . in benign papillomas and sccs of skh-1 mice subjected to uv irradiation
interestingly , no expression of ep2 was observed in bccs . in a study by tober et al . on uv - induced tumors ,
ep2 protein was found only in the highly differentiated cells surrounding keratin pearls . while we found that uv significantly elevated ep2 mrna levels in both papillomas and sccs of skh-1 mice ( unpublished data ) , this
another study , using papillomas from nmri mice , also reported an elevation in ep2 mrna expression .
thus the majority of the studies indicate that the ep2 receptor mrna levels are elevated in squamous carcinomas , compared to uninvolved skin .
the increased expression of ep2 following tumor promoter treatment and in skin tumors resulting from these treatments led to the question of whether ep2 contributes to the development and/or progression of tumors . to address this , we subjected mice that were null for the ep2 receptor to a two - stage chemical carcinogenesis protocol .
the ep2 null mice had significantly fewer tumors ( 50% ) and reduced tumor incidence compared to their wild - type counterparts .
tumor size distribution for the ep2 knockout mice was similar for small to medium size tumors ( < 5 mm diameters ) , however , the ep2 null mice produced fewer large tumors , compared to wild - type mice .
significantly , no sccs were produced in the ep null mice whereas 20% of the wild - type mice developed sccs . to further understand the contribution of ep2 to skin tumor development ,
a number of parameters associated with cancer were assessed in the ep2 null mice . in untreated
ep2 null mice , the extent of basal cell proliferation was slightly reduced compared to wild - type mice . following a single treatment with tpa at a dose known to cause marked proliferation and hyperplasia ,
this suggested that the ep2 receptor may play an important role in mediating tpa - induced proliferation and that the increased pge2 synthesis elicited by tpa may be responsible for this . while cultures of primary keratinocytes from wild - type mice showed a large proliferative response to exogenous pge2 , the ep2 null keratinocytes had a reduced proliferative response .
this suggested that pge2 mediates an autonomous proliferative response in keratinocytes , i.e. , pge2 from dermal stromal cells are not necessary .
this study also corroborated an early study showing that the ep2/ep4 receptors mediate pge2-induced proliferation in primary human keratinocytes .
the effect of ep2 deletion on tpa - induced inflammation and angiogenesis were also assessed .
there was a significant reduction in the infiltration of macrophages into the dermis of ep2 null mice , as well as markedly reduced expression of interleukin-1 in the epidermis and a significantly reduced angiogenesis .
additionally , deficiency in ep2 receptor expression reduced the level of camp elicited by topical application of pge2 to basal levels .
use of ep2 null mice , on the skh-1 background , in uv carcinogenesis experiments produced different results than observed in the two - stage model described above .
reported that acute low - dose uv exposure produced a markedly reduced proliferative response compared to wild - type mice , while with higher doses the proliferative response was the same , although the hypertrophy response remained depressed .
the ep2 null skh-1 mice produced 50% fewer tumors than the wild - type mice , similar to the two - stage chemical protocol , but their tumors were larger in size , with a more aggressive phenotype as indicated by their poor differentiation .
these less keratinized tumors were also more deeply invasive than the well - differentiated tumors . to understand how deletion of the ep2 receptors could lead to a more invasive phenotype
matrix metalloproteinase ( mmp)-2 and mmp-9 activity were dramatically increased in uv - irradiated ep2 null skh-1 mice , which likely contributed to the enhanced scc invasion .
although the number of skin tumors was reduced in ep2 null mice in both the two - stage and uv carcinogenesis protocols , the issue that remains unanswered is why a decreased tumor aggressiveness was seen in the two - stage chemical protocol while increased aggressiveness was seen in the uv study .
the carcinogen dmba causes mutations in the h - ras gene , while uv primarily causes mutations in the p53 gene .
second , the strain background of the mice used in these two studies is different .
the skh-1 mice carry a mutation in the hairless gene , which has been shown to be a tumor suppressor gene that is responsible for the uv susceptibility of these mice .
the relationship of this mutation to chemical carcinogenesis or to human nmsc is not known .
thus , targeting the ep2 receptor for prevention of skin cancer may be premature and clearly requires additional study .
while the ep2 knockout study suggests that ep2 expression is needed for a full tumorigenic response , it was unknown whether increasing ep2 above normal levels would enhance tumor development . to address this question
, we generated ep2 transgenic mice in which the ep2 transgene was under the control of the bk5 promoter ( bk5.ep2 mice ) .
the ep2 receptor was primarily expressed in the basal layer of the epidermis where the keratin 5 promoter is most active . when subjected to a two - stage carcinogenesis protocol , the bk5.ep2 mice developed more papillomas than wild - type mice .
more notable , however , was the marked increase ( threefold ) in the number of sccs in the bk5.ep2 mice .
additionally , the bk5.ep2 mice produced much larger tumors than their wild - type counterparts . in both papillomas and scc from the ep2 transgenic mice , the level of ep2 expression was higher than that in wild - type tumors ,
this was interpreted as suggesting that the ep2 receptor significantly contributes to the development of , and perhaps more importantly , to the progression of benign to malignant tumors .
as was expected , the epidermis of bk5.ep2 mice produced a greater proliferative and inflammatory response to tpa .
overexpression of the ep2 receptor also caused an increase in angiogenesis , even in untreated mice , where macroscopic inspection of the dermis showed an increase in the number and size of the vessels .
as opposed to the reduction in camp seen in ep2 receptor knockout mice , ep2 receptor overexpression significantly elevated pge2-induced camp in the epidermis above the level of wild - type mice , which is in agreement with a model in which pge2 elevates camp levels through ep2 activation , which in turn induces genes involved in proliferation , inflammation , and angiogenesis [ 44 , 49 ] . a proliferative response to ep2 activation
. showed that proliferation of primary adult human keratinocytes is increased following activation of ep2 and subsequent production of camp .
they later showed that in immortalized human keratinocytes ( hacat cells ) loss of ep2 receptor expression was associated with increased invasiveness and decreased expression of paxillin , a component of focal adhesion complexes .
several possible explanations were offered for this observation , including defects in post - translational modification , much reduced expression of cox-2 and reduced synthesis of pge2 .
as the authors suggested , the normally reduced pg production may contribute to the normally non - invasive phenotype of hacat cells .
given the generally pro - tumorigenic function of the ep2 receptor , there is considerable interest in elucidating the mechanisms and signaling pathways involved .
reported that the stimulation of camp in ep4-expressing cells is significantly less than in ep2-expressing cells at equal levels of receptor expression .
additionally , ep4 receptors , but not ep2 , undergo rapid agonist - induced desensitization and internalization .
ep4 , but not ep2 , was also found to activate the pi3k / akt pathway . in a later study , fujino et al .
reported that pge2 stimulation of cells expressing either the ep2 or ep4 receptor results in phosphorylation of creb .
however , inhibition of pka reduced this phosphorylation in ep2 expressing cells , but not in ep4 expressing cells .
they provided evidence that activation of the ep4 receptor , but not ep2 , results in activation of a pi3k pathway that inhibits the activity of pka .
it was concluded that although both ep2 and ep4 cause phosphorylation / activation of creb , they do so through different signaling mechanisms . on the other hand , castellone et al .
reported that ep2 receptor stimulation of proliferation in colon cancer cells involved both the pi3k / akt and axin/-catenin pathways .
they showed that the free g protein / subunit activated pi3k / akt while the gs subunit associated with the regulator of g protein domain of axin , leading to activation of -catenin and proliferation of dld-1 cells that carry a mutation in the apc gene .
thus , it appears that the signaling pathways activated by the ep2 receptor that lead to proliferation are likely to be cell - type and/or context specific with regard to other signaling alterations or mutations . with regard to keratinocytes ,
the langenbach laboratory has been particularly interested in understanding how cox-2-generated pgs protect the skin from uv - induced apoptosis and the relationship between the reduced apoptosis and tumor development [ 5456 ] .
they compared the protein levels of all the ep receptors following uv exposure of cox-2 null and wild - type mice and found that although ep1 , ep2 , and ep4 were induced in wild - type mice , ep2 and ep4 levels were 50% lower in the cox-2 null mice .
the levels of activated pka and akt were also reduced in the cox-2 nulls , as were the phosphorylated forms of the anti - apoptotic protein bad , pbad and pbad , which are downstream products of activated akt and pka , respectively .
these findings suggested that both ep2 and ep4 are responsible for the anti - apoptotic effects of pge2 in the setting of uv - induced cox-2 . to confirm this suggestion ,
cox-2 null mice were exposed to uv to induce apoptosis , followed by topical application of ep2 and ep4 agonists , each of which reduced epidermal apoptosis by 50% in the cox-2 null mice .
it was proposed that the remaining apoptosis was independent of ep2/ep4 and likely occurred through a pg - independent pathway .
our laboratory has also been interested in a possible feedback relationship between cox-2 , pge2 , and ep2 .
maldve and fischer showed that in primary cultures of murine keratinocytes , pge2 could induce cox-2 .
subsequently , we reported that ep2 null mice had a reduced induction of cox-2 following tpa treatment . conversely , primary keratinocyte cultures from ep2 transgenic mice had increased cox-2 expression after either tpa or pge2 treatment which was blocked by an adenylate cyclase inhibitor .
pge2 treatment also caused greater phosphorylation of creb in keratinocytes from ep2 transgenic mice , compared to wild - type mice ; phosphorylation was reduced when a pka inhibitor was included .
conversely , there was no creb phosphorylation in ep2 null mice following pge2 treatment and this correlated with a lack of a proliferative response to pge2 .
these events are indicative of a positive feedback loop between cox-2 and ep2 and it has been suggested that this could result in the continuous overexpression of cox-2 that is observed in many epithelial tumors . to further elucidate the contribution of ep2 to papilloma development in the mouse skin initiation - promotion model , langenbach 's laboratory looked at the effects of inhibiting pka and egfr , each of which reduced tumor multiplicity by 50% .
to assess ep2 's contributions to the activation of these pathways , mice were treated with an ep2 agonist concomitantly with the nsaid indomethacin to inhibit tpa induction of endogenous pge2 synthesis .
the agonist restored tumor development that was inhibited by indomethacin and increased camp and pka activity .
this suggests that signaling from ep2 is more complex than a linear camp - pka - pcreb pathway , which was described earlier .
in fact found that ep2 could be immunoprecipitated as a complex with -arrestin1 and p - src .
thus , the contribution of ep2 to skin tumor development is likely via activation of both the camp / pka and egfr pathways .
what remains unclear , however , is the mechanism by which the ep2 receptor activates egfr .
while c - src mediated activation has been reported in murine keratinocytes , a study on human epidermoid a431 and scc-9 cells showed that ep2-mediated egfr transactivation can also occur via pka activation , again indicating cell or context specificity .
the langenbach lab has also explored the possibility that the -arrestin1-src complex contributes to ep2-mediated signaling in murine keratinocytes .
the ep2 agonist butaprost induced complex formation with subsequent c - src and egfr activation , which was dependent on the presence of -arrestin1 ( fig .
butaprost also induced the activation of akt , erk1/2 , and stat3 , all of which were inhibited by -arrestin deficiency or egfr inhibition .
butaprost also increased pka activation leading to phosphorylation of creb , as expected , but inhibition of pka did not affect butaprost - induced activation of egfr .
this observation , plus the finding that -arrestin1 deficiency did not affect butaprost - induced pka activation , indicated that there are independent ep2-mediated signaling pathways , both of which contribute to murine keratinocyte proliferation .fig .
ligand activation of the ep2 receptor causes the activation of at least several signaling pathways .
receptor activation results in conformational changes causing a loss of gdp from the subunit of the gs protein and binding of gtp , which leads to activation of membrane bound adenylate cyclase ( ac ) .
activation of ac results in the conversion of adenosine triphosphate into cyclic adenosine monophosphate ( camp ) , which activates protein kinase a ( pka ) .
pka is responsible for activating , via phosphorylation , the transcription factor creb and the signaling factor erk1/2 .
activation of ep2 can also lead to the formation of a -arrestin1-src complex , with subsequent activation of the epidermal growth factor receptor ( egfr ) .
activation of egfr causes activation of both the erk1/2 ( mapk ) and akt pathways .
the activation of downstream components of these 3 pathways leads to increased survival ( p - bad ) , increased proliferation ( cyclin d1 ) , angiogenesis ( vegf ) and inflammation ( cox-2 ) , all of which contribute to tumorigenesis ep2 signaling in keratinocytes .
ligand activation of the ep2 receptor causes the activation of at least several signaling pathways .
receptor activation results in conformational changes causing a loss of gdp from the subunit of the gs protein and binding of gtp , which leads to activation of membrane bound adenylate cyclase ( ac ) .
activation of ac results in the conversion of adenosine triphosphate into cyclic adenosine monophosphate ( camp ) , which activates protein kinase a ( pka ) .
pka is responsible for activating , via phosphorylation , the transcription factor creb and the signaling factor erk1/2 .
activation of ep2 can also lead to the formation of a -arrestin1-src complex , with subsequent activation of the epidermal growth factor receptor ( egfr ) .
activation of egfr causes activation of both the erk1/2 ( mapk ) and akt pathways .
the activation of downstream components of these 3 pathways leads to increased survival ( p - bad ) , increased proliferation ( cyclin d1 ) , angiogenesis ( vegf ) and inflammation ( cox-2 ) , all of which contribute to tumorigenesis to further investigate the mechanism by which ep2 mediates keratinocyte survival , chun and langenbach explored the possible role of survivin , a regulator of cell survival .
they reported that exposure to uv upregulated survivin and pstat3 , a transcription factor that regulates survivin expression .
mice deficient in either cox-2 or ep2 had a reduced ability to increase the expression of survivin or pstat3 after uv irradiation . when wild - type mice were treated with indomethacin , survivin levels were also reduced but could be restored by treatment with pge2 or butaprost , the ep2 agonist .
additionally , inhibition of egfr activity blocked the effect of butaprost , indicating that cox-2 synthesis of pge2 regulates survivin expression in keratinocytes , in part , through an ep2-mediated egfr / stat3 pathway .
this in turn suggests that ep2/survivin may be an efficacious target for chemoprevention or therapy of skin cancer .
however , as discussed earlier , the observation by brouxhon et al . that while ep2 null mice develop fewer tumors than wild - type mice , the tumors that do arise are more aggressive .
the ep2 receptor has also been implicated in the progression of epidermal lesions from dysplastic to sccs .
. showed a sequential loss of e - cadherin - mediated cell - cell contact with tumor progression due to decreased e - cadherin levels .
use of ep2 agonists or ep2 deletion indicated that ep2 mediates the mobilization of e - cadherin for proteosomal degradation , although the molecular mechanisms by which this occurs are currently unknown .
thus a clear picture is emerging that ep2 receptor activation results in altered keratinocyte behavior that is associated with malignancy , including survival , proliferation , angiogenesis and invasion .
similar findings with other epithelial tissues suggest that this may be a ubiquitous phenomenon for most , if not all , epithelial tissues .
for example , in the apc mouse model of intestinal polyps , ep2 receptor activation results in induction of vascular epithelial growth factor ( vegf ) that causes tumor angiogenesis .
similarly , in mouse mammary tumor cells , activation of the ep2 receptor by pge2 induced vegf though a camp / pka pathway that did not involve hypoxia inducible factor ( hif)-1 , mapk or pi3k / akt .
the ep2 receptor also stimulates proliferation of colon cancer cells , albeit through pathways involving pi3k / akt and -catenin .
the common theme appears to be that ep2 mediates proliferation in many cells ; the confounder is that the signaling pathways and mechanisms are cell - type dependent .
future work may show that at least some of these pathways are interconnected , which would provide a more universal picture of the mechanism of action of the ep2 receptor .
of the four ep receptors , ep3 is the most complex and also the least studied receptor .
ep3 differs from the other ep receptors in that multiple variants can be generated by alternative splicing of the c - terminal tail . in mouse , there are three splice isoforms of ep3 , , , and , containing c - terminal tails of 2630 amino acids that do not have structural motifs or hydrophobic features in common .
the isoform has a hydrophilic tail while the beta isoform has a hydrophobic tail .
although they both have the same ligand binding properties , because of differences in their c - terminal tails the different isoforms couple to different g proteins , resulting in differences in signaling [ 19 , 64 ] . the ep3 and ep4 receptor have binding constants in the sub - nanomolar - range , with ep3 having the highest affinity for pge2 of all the ep receptors .
this suggests that ep3 likely has a maintenance function in the epidermis where it would respond primarily to cox-1 elicited pge2 due to the lack of expression of cox-2 in naive skin .
however , determining the function of ep3 is complicated by the fact that the splice variants encode different functional proteins , which elicit numerous intracellular signaling pathways . depending on the cell type
, ep3 has been shown to inhibit adenylate cyclase , stimulate adenylate cyclase , activate plc , activate nitric - oxide - cyclic gmp pathways and activate rho - dependent pathways .
although human keratinocytes express all four ep receptors , the level of expression of ep2 and ep3 is considerably higher than expression of ep1 or ep4 . in naive mouse skin , however ,
the ep3 receptor has been reported to be expressed at moderate levels throughout the epidermis , although tober et al . found that , unlike the ep1 or ep2 receptor , ep3 localized to the proliferative basal compartment of the epidermis .
ep3 receptor expression was reported to be localized to the cytoplasm and perinuclear region of keratinocytes , although it was localized to plasma membrane in dermal sebocytes .
perinuclear localization of ep3 has been noted in other tissues as well , including human kidney , porcine brain endothelial cells , and rat liver , suggesting the ubiquitous nature of this localization . in chronically uv - irradiated skin of skh-1 mice , ep3 receptor expression was undetectable by immunohistochemistry , although in another study using a single exposure to uv , ep3 receptor expression was observed throughout all layers of the epidermis by 48 h .
interestingly , inhibition of the ep1 receptor with ono-8713 prevented uv - induced ep3 expression in the suprabasal keratinocytes , suggesting a regulatory interaction between the ep1 and ep3 receptors .
our laboratory measured ep3 mrna levels in fvb mice and found that they were upregulated by both single and multiple treatments with tpa ( unpublished data ) .
however , tober et al . found that acute uv exposure reduced expression of ep3 and ep3 , compared to unirradiated skin , although in chronically irradiated skin only ep3 was significantly downregulated . with regard to human keratinocytes ,
konger et al . showed that three splice variants , ep3a1 , ep3c , and ep3d mrnas , were expressed in primary cultures .
analysis of protein expression by western blotting ( the three isoforms have similar molecular weights ) showed that expression of the ep3 receptor was not affected by the extent of confluency or state of calcium - induced differentiation .
immunohistochemical localization in intact human skin showed positive staining throughout the epidermis , with staining most prominent in the basal layer where cytoplasmic , plasma membrane , and perinuclear staining patterns were observed .
it was postulated that the perinuclear / nuclear localization is related to an autocrine function of ep3 because cyclooxygenases and microsomal pge synthase are also localized there . on the other hand , the plasma membrane localization is consistent with a role for ep3 in responding to paracrine signaling .
overall , these studies indicate the inducible nature of this receptor . in tumors arising from chronic uv exposure , very little expression of ep3 protein or mrna
reported that in tumors from chronically uv - irradiated mice , ep3 and were significantly repressed while ep remained unchanged .
neumann et al . also reported that in papillomas from a two - stage experiment in nmri mice that the mrna for ep3 ( splice variants were not measured ) appeared to decrease , although this was not rigorously evaluated .
it is difficult to compare the results of the above studies because different tumor - inducing protocols were used and only one study assessed expression at the isoform level .
however , there appears to be some , if variable , decrease in ep3 expression in murine skin tumors . in an early study focused on understanding the contribution of each ep receptor to the proliferation of human keratinocytes , konger et al .
reported that growth stimulation occurs via ep2/ep4 receptor adenylate cyclase - mediated responses while activation of ep3 by sulprostone , which lacks ep2 or ep4 agonist activity , inhibited proliferation .
there was no measurable effect of ep3 activation on camp levels , indicating that growth inhibition was independent of adenylate cyclase pathway signaling .
the growth inhibitory affect of ep3 is not restricted to the epidermis as this has been observed in colonic epithelium as well , and ep3 expression is downregulated in colon cancer . a subsequent study by konger et al .
explored the relationship between the lipid second messengers dag and ceramide , which are known to inhibit growth , and the activity of ep3 .
they found that the ep3 agonist sulprostone , which inhibits growth , quickly induces dag and ceramide production and this was completely blocked by an antagonist of the ep1 - 3 receptors .
the growth - promoting activity of ep2 and growth inhibitory activity of ep3 suggests that their overall effect on keratinocyte proliferation depends on ligand concentration as well as the level of receptor expression .
, the low - affinity ep4 receptor requires a 100-fold greater concentration of pge2 for maximal activation than the ep3 receptor .
stimuli that induce cox-2 and thus raise pge2 levels , or exogenous pge2 , have been reported to increase keratinocyte proliferation above that of basal conditions where pge2 levels are low [ 9 , 49 ] .
additionally , stimuli such as tumor promoters or wounding can increase ep2 expression , thus shifting the homeostatic balance between proliferation and differentiation that occurs in the normal epidermis , to a more proliferative state .
this may be the reason for our finding that the ep3 receptor does not appear to play a significant role in skin tumor development .
our laboratory subjected ep3 null mice to the two - stage dmba / tpa protocol and observed no differences in either tumor multiplicity or tumor incidence , compared to wild - type mice .
in which they observed an enhanced latency in skin tumor development in the ep3 null mice early in the experiment , although by the end of the study tumor multiplicity and incidence were identical .
interestingly , they found no scc in the ep3 null mice while 12% of the wild - type mice developed sccs .
the overall lack of a role for the ep3 receptor in skin cancer is consistent with similar observations in other epithelial cancers , including colon and breast [ 71 , 72 ] . a possible role for ep3 in cutaneous inflammation
has also been studied , based on the known pro - inflammatory effects of pge2 , however , the outcomes of these studies are not consistent .
a study by goulet et al . showed that ep3 mediated the pro - inflammatory action of pge2 , measured by the edema response to topical arachidonic acid . using mice that were deficient in each of the ep receptors , only the absence of the ep3 receptor resulted in a significant reduction in edema and vascular permeability compared to wild - type mice .
the second messenger systems to which ep3 is linked would be expected to result in vasoconstriction instead of vasodilatation and this was previously observed by others .
other studies showed that pharmacological agents that preferentially activate ep3 receptors potentiated bradykinin - induced inflammation in rabbit skin .
additionally , in atopic dermatitis , pge2 promotes the innervation of skin lesions through the activation of the ep3 receptor in keratinocytes , which subsequently induces neurotrophin-4 .
the signaling pathway utilized in this case is the phosphoinositol - specific plc / pkc/erk pathway .
thus , there are several examples of a pro - inflammatory role for the ep3 receptor in skin , although the signaling pathways utilized may depend on the etiological agent and/or isoforms that are activated .
there are other studies , however , in which ep3 receptor activation has anti - inflammatory activity . using selective ep receptor agonists , ahluwalia and
perretti reported that ep3 has anti - inflammatory effects against edema elicited by exogenous agents .
kanda et al . analyzed the contribution of each ep receptor to pge2-induced inhibition of nfb activity and expression of the skin - homing t cell chemokine ccl27 .
antagonists for ep3 or ep1/ep2 each partially blocked the pge2-induced inhibition of ccl27 , while together they completely blocked the response . in another study on the role of ep3 in allergic skin inflammation in mice , use of an ep3 agonist , but not agonists of the other ep receptors , reduced the extent of edema and inflammatory cell infiltration .
microarray analysis of keratinocytes from mice treated with the ep3 agonist ono - ae-248 showed that expression of neutrophil - recruiting chemokines , especially cxcl1 and cxcl2 , were suppressed , compared to control mice , which correlated with reduced neutrophil infiltration .
additionally , in cultured keratinocytes , the ep3 agonist suppressed cxcl1 expression and production induced by tnf , indicating that ep3 is anti - inflammatory through altering the expression of genes in keratinocytes that are responsible for the dermal infiltration of inflammatory cells .
conversely , a deficiency in ep3 expression enhanced the edema associated with allergic inflammation in skin .
the anti - inflammatory effect of ep3 in allergic skin reactions was postulated to be due to ep3 coupled with gi because the camp decrease mediated by gi occurs at lower agonist concentrations than gs or gq signaling . in general ,
gi activation by the murine ep3 receptor isoforms are the most investigated and likely the most common .
there are , however , several novel associations of ep3 other than in gi / gs signaling , although the extent to which this occurs in epidermal cells has not been well studied . in cho cells , activation of the three mouse ep3 isoforms causes intracellular ca mobilization through the g subunit of the gi protein .
this may augment camp synthesis resulting from activation of gs by other receptors , including ep2 .
the reason for the discrepancy between the various studies on the role of the ep3 receptor in inflammation is not clear although differences in models ( pharmacological vs. genetic ) , isoform expression and methods of eliciting inflammation likely play a role .
the lack of a role for the ep3 receptor in skin tumorigenesis [ 24 , 70 ] , in which inflammation is generally a driving force , suggests that ep3 is not strongly enough anti - inflammatory or anti - tumorigenic to counteract the pro - tumorigenic activity of the other ep receptors .
the ep4 receptor has several structurally unique features that suggest that its activation may result in distinctive biological responses .
this receptor has a much longer cytoplasmic tail and has an insertion of 25 amino acids in the third intracellular loop , both of which are involved in coupling to g proteins . additionally , unlike the other ep receptors
the deduced transcription initiation site contains motifs usually associated with activation by proinflammatory cytokines such as ccaat boxes , sp1 , and ap-2 . understanding the mechanisms and outcomes of ep4 activation
are thus of interest in a number of tissues , including skin , and physiological processes . in localization studies on the ep receptors in mouse skin , although lee et al . found that the ep4 receptor was virtually undetectable by immunohistochemistry , tober et al
. found ep4 protein expression in the majority of murine epidermal keratinocytes and dermal leukocytes in naive skin .
. also found low but detectable ep4 protein by western blotting . in uv - irradiated skin
ep4 protein expression was reported to be undetectable in one report , but tober et al . found acute and chronic uv induced relocalization to the plasma membrane in the more highly differentiated cells of the stratum granulosum , although diffuse cytoplasmic staining was observed throughout the rest of the epidermis . with regard to a role for ep4 in nmsc , in human sccs ,
ep4 mrna was reported to be significantly upregulated , although it was downregulated in bccs , compared to normal skin . in murine skin tumors resulting from chronic uv exposure , lee et al
. also observed increased levels of ep4 protein in both papillomas and scc , although the mrna levels were not significantly increased .
this was corroborated by tober et al . in uv - elicited murine tumors and by neumann
when our laboratory evaluated ep receptor expression in mice , we found that both in tpa - treated skin and in papillomas and sccs , ep4 mrna was reduced , compared to wild - type skin [ 79 , 80 ] .
it is not clear at this time whether the differences in ep4 mrna expression reported by others [ 23 , 27 ] and our laboratory [ 79 , 80 ] are due to differential activities of uv and tpa .
as described in section 3 above , the langenbach laboratory has been interested in elucidating the involvement of specific ep receptors in uv - induced apoptosis and tumor development [ 5456 ] .
they found that both ep2 and ep4 were responsible for the anti - apoptotic effects of pge2 via regulating pbad levels , following uv irradiation .
ep2 receptor activation was found to upregulate survivin expression via an egfr / stat3 pathway that likely contributes to , or is responsible for , the anti - apoptotic activity of ep2 .
although the mechanism / pathway by which ep4 exerts its anti - apoptotic activity has not yet been elucidated in keratinocytes , the ep4 receptor has strong anti - apoptotic effects in glomerular epithelial cells via activation of akt ; it is likely that the akt survival pathway is operative in the epidermis as well .
studies in other organ systems led to the suggestion that ep4 may actively contribute to skin cancer .
reported that ep4 null mice treated with the carcinogen azoxymethane reduced the development of aberrant crypt foci to 56% of the wild - type level .
additionally , administration of the ep4 receptor antagonist ono - ae2 - 227 also reduced formation of aberrant crypts as well as intestinal polyps in the min mouse .
ep4 receptor antagonists have also been used to show that ep4 inhibits experimental metastasis of murine mammary tumor cells . based on these reports
, our laboratory has been investigating the effect of ep4 overexpression on murine skin tumor development .
transgenic mice that overexpress ep4 under the control of the bk5 promoter ( bk5.ep4 mice ) were generated on the fvb background . at the macroscopic level ,
the skins of these mice are essentially identical to wild - type skin , although the hair cycles are slightly different .
when subjected to the two - stage dmba / tpa protocol , the bk5.ep4 mice develop many more tumors than wild - type mice .
additionally most of the tumors in the transgenic mice were scc while in wild - type mice the majority were benign papillomas .
this pattern of tumor development resembles that seen in the ep1 transgenic mice except that there was a greater latency to tumor development . because tpa treatment of the bk5.ep4 and wild - type mice did not produce pronounced differences in epidermal proliferation or apoptosis , which are events usually associated with tumor promotion , the effect of dmba alone was investigated . using a single application of dmba , a significant number of sccs developed in the bk5.ep4 mice but not wild - type mice .
macroscopically , it was apparent that dmba caused sloughing of the epidermis of the transgenic but not wild - type mice , and this was associated with an increase in apoptosis .
this was followed by a significant increase in keratinocyte proliferation in the transgenic skin as well as a robust angiogenic response , consistent with regenerative hyperplasia .
studies on expression of enzymes involved in metabolizing dmba , cyp1a1 and cyp1b1 , and stem cell numbers ( cd34 and 6 integrin positive cells ) showed no difference in these parameters .
additionally , ongoing studies are showing that uv exposure also produces a sloughing and angiogenic response in the transgenic , but not wild - type , mice ( unpublished data ) , suggesting that the ep4 transgenic epidermis has a much lower apoptosis threshold than wild - type mice .
it is clear , however , that the ep4 receptor contributes to skin tumor development and appears to be particularly important in the development of malignant ( scc ) rather than benign ( papillomas ) tumors [ 79 , 80 ] ( and unpublished data ) .
the involvement of ep4 in uv - induced dermal inflammation has also been studied using genetic and pharmacological approaches .
kabashima et al . reported that edema , inflammatory cell infiltration , and local blood flow were reduced in both ep2 and ep4 null mice .
interestingly , ep4 mediates an anti - inflammatory response in macrophages and does so through an ep4 ( but not ep2 ) interacting protein , ep4 receptor - associated protein ( eprap ) ; the complex also interacts with nfb . whether eprap is expressed in other cell types
recently , however , ep4 receptor activity in skin was shown to mediate uv - induced systemic immunosuppression ; ep4 antagonist treatment downregulated uv - induced expression of receptor - activator - of - nfb - ligand in keratinocytes which elevates the number of regulatory t cells .
it is of interest that of the events elicited by the ep2 and ep4 receptors , some are the same while others are significantly different .
both ep2 and ep4 have anti - apoptotic activity against uv exposure and overexpression of each promotes skin tumor development [ 44 , 79 , 80 ] . in human adipocytes and breast cancer cells , both ep2 and ep4 upregulate aromatase expression and do so through activation of the camp / pka / creb pathway
it is likely that the similarities between ep2 and ep4 are due to both receptors signaling via the camp - pka pathway ; the differences are likely due to observations that ep4 , but not ep2 , also activates the pi3k pathway that can lead to akt activation as well as erk activation ( fig .
it has also been shown that under equal expression levels , ep4 activation results in significantly less camp production than ep2 activation .
both the ep2 and ep4 receptors couple to the stimulatory guanine tripeptide gs and via this linkage activate adenylate cyclase .
the weaker stimulation of camp production by the ep4 receptor could also be due to its rapid desensitization , but signaling via pi3k is robust , suggesting that other factors are involved . in this
regard , ep4 , but not ep2 , can couple with a pertussis toxin - sensitive inhibitory g - protein ( gi ) that leads to activation of pi3k signaling .
furthermore , ep4 activation of pi3k results in inhibition of pka , which is activated by ep2 .
additionally , although the transcription factor creb is phosphorylated on serine 133 following either ep2 or ep4 activation , this phosphorylation is mediated through different signaling pathways , i.e. , via pka for ep2 and via akt for ep4 . the extent to which these signaling pathways are differentially activated
will also depend on the level of pge2 because the affinity of ep2 for pge2 is considerably lower than that of ep4 .
clearly , the biological outcomes of ep2 and ep4 activation are very context dependent , involving levels of expression of the ep ( and other interacting ) receptors , ligand , as well as cross - talk among the ep and other receptors.fig .
similar to the ep2 receptor , ligand activation of ep4 also leads to activation of adenylate cyclase ( ac ) with subsequent formation of camp and activation of the transcription factor creb , although the extent of camp formation is significantly less than that resulting from ep2 activation .
although the mechanisms are not understood , activation of the ep4 receptor causes activation of the pi3k and akt pathway .
thus , the biological outcomes of ep2 vs. ep4 activation are somewhat different , although both contribute to the development of skin cancer ep4 signaling in keratinocytes .
similar to the ep2 receptor , ligand activation of ep4 also leads to activation of adenylate cyclase ( ac ) with subsequent formation of camp and activation of the transcription factor creb , although the extent of camp formation is significantly less than that resulting from ep2 activation .
although the mechanisms are not understood , activation of the ep4 receptor causes activation of the pi3k and akt pathway .
thus , the biological outcomes of ep2 vs. ep4 activation are somewhat different , although both contribute to the development of skin cancer as described in section 3 , we showed that the ep2 receptor induces cox-2 in murine keratinocytes in a camp dependent manner .
regan reported that ep4 activation could also induce cox-2 , in this case through a pi3k / akt pathway leading to an inhibitory phosphorylation of gsk-3 which is also inhibited when pka is activated , followed by translocation of cytosolic -catenin into the nucleus . in the nucleus , -catenin interacts with the tcf / lef family of transcription factors that results in induction of cox-2 .
thus , both ep2 and ep4 signaling induce cox-2 , although different mechanisms are involved ; as has been previously mentioned , it is possible that the constitutive upregulation of cox-2 observed in many epithelial tumors is due to a positive feedback loop involving cox-2 and the ep2/ep4 receptors [ 49 , 56 ] .
pi3k activation by ep4 also leads to the phosphorylation ( activation ) of erk1/2 , which induces early growth response factor-1 ( egr-1 ) .
egr-1 regulates at least several genes involved in proliferation and inflammation , including tnf- , pge2 synthase and cyclin d1 , supporting a role for the ep4 receptor in neoplastic processes .
interestingly , ep4 receptor expression was shown to be downregulated by a number of cancer chemopreventive agents , including troglitazone , sulindac sulfide and indomethacin in human glioblastoma cell lines . in melanoma cells ,
the anti - carcinogenic alkaloid berberine was reported to repress expression of ep2 , ep4 , and cox-2 through inhibition of nfb activation .
these recent studies indicate that new mechanisms of action may be ascribed to a number of chemopreventive agents .
future studies in this area may identify additional agents that are effective in either repressing ep4 expression or blocking its activity . given the pro - tumorigenic role for ep4 , this could offer new approaches to the prevention of nmsc .
in this review , we provide evidence from several laboratories that the ep1 , ep2 , and ep4 receptors mediate the tumor promoting activity of pge2 in nmsc .
this information offers possibilities for preventing nmsc development and for potentially intervening in the progression of these tumors .
elucidation of the signaling pathways activated by these receptors also illuminates possible targets for prevention / intervention .
further studies are needed to validate this approach because these signaling pathways are utilized in normal keratinocyte proliferation , differentiation and cell - cell interactions .
however , it has been well - demonstrated that inhibiting pi3k / akt , mapk or c - src signaling pathways early in epithelial neoplasia results in reduced keratinocyte proliferation and survival , leading to decreased tumor formation . the interaction of the ep1 , ep2 and ep4 receptors with egfr raises some interesting questions and options , and is very significant
because egfr - mediated signaling has also been implicated in proliferation , survival , invasion , angiogenesis and metastases , all of which are associated with tumor development . because of similarities between egfr and other growth factor receptor tyrosine kinases ( rtks ) , one or more of the ep receptors may interact with other rtks .
while this muddies our understanding of the pathways by which the ep receptors carry out their function , it also supports the hypothesis that tumor promotion is characterized by , and is due to , a chronic state of aberrant signaling through numerous pathways [ 10 , 49 ] .
the approaches taken so far in inhibiting ep receptor activity have lacked cell - type specificity , i.e. , whole animal knockouts or treatment of skin with inhibitors have been used .
because this is likely to affect other cell types such as stromal , immune , or inflammatory cells , it confounds our understanding of the role of the ep receptors in keratinocytes , in terms of both normal function and nmsc development .
studies using targeted ablation in vivo are needed to definitively establish the function of each ep receptor in keratinocyte behavior .
as previously described , tumor promoting agents such as phorbol esters and uv can upregulate several of the ep receptors .
elucidating the signaling pathways and transcription factors involved in this upregulation would be potentially useful in designing approaches to regulating keratinocyte behavior and in understanding how important the level of expression of each ep receptor is to normal and pathological keratinocyte physiology .
the significance of elucidating the regulation and function of the ep receptors in nmsc lies in the recognition that nmsc is the most common cancer affecting humans nmsc accounts for 40% of all newly diagnosed cancers and the incidence is rising .
new strategies and targets are needed to prevent or intervene in nmsc ; inhibition of the ep receptors has great potential as an effective new approach to prevention of nmsc as well as other epithelial cancers . | one of the most common features of exposure of skin to ultraviolet ( uv ) light is the induction of inflammation , a contributor to tumorigenesis , which is characterized by the synthesis of cytokines , growth factors and arachidonic acid metabolites , including the prostaglandins ( pgs ) .
studies on the role of the pgs in non - melanoma skin cancer ( nmsc ) have shown that the cyclooxygenase-2 ( cox-2 ) isoform of the cyclooxygenases is responsible for the majority of the pathological effects of pge2 . in mouse skin models ,
cox-2 deficiency significantly protects against chemical carcinogen- or uv - induced nmsc while overexpression confers endogenous tumor promoting activity .
current studies are focused on identifying which of the g protein - coupled ep receptors mediate the tumor promotion / progression activities of pge2 and the signaling pathways involved . as reviewed here
, the ep1 , ep2 , and ep4 receptors , but not the ep3 receptor , contribute to nmsc development , albeit through different signaling pathways and with somewhat different outcomes .
the signaling pathways activated by the specific ep receptors are context specific and likely depend on the level of pge2 synthesis , the differential levels of expression of the different ep receptors , as well as the levels of expression of other interacting receptors . understanding the role and mechanisms of action of the ep receptors potentially offers new targets for the prevention or therapy of nmscs . | Prostaglandins and skin cancer
The EP1 receptor
The EP2 receptor
The EP3 receptor
The EP4 receptor
Conclusions |
it is an anticancer chemotherapy drug and naturally occurring chemical which is particularly toxic to the insulin - producing beta cells of the pancreas in mammals .
in particular , it is used in medicine for treating certain cancers of the islets of langerhans and used in medical research to produce an animal model for type 1 diabetes in large dose as well as type 2 diabetes in multiple low doses .
streptozotocin was originally identified in the late 1950s as an antibiotic . in the mid- of 1960s , it was found to be selectively toxic to the beta cells of the pancreatic islets , the cells which normally regulate blood glucose levels by producing the hormone insulin .
it suggested the drug 's use as an animal model of diabetes [ 2 , 3 ] and as a medical treatment for cancers of the beta cells .
however , the national cancer institute investigated the use of streptozotocin in cancer chemotherapy in the 1960s and the 1970s .
streptozotocin was approved by the us food and drug administration ( fda ) for treating metastatic cancer of the pancreatic islet cells .
since it carries a substantial risk of toxicity and rarely cures the cancer , its use is generally limited to patients whose cancer can not be removed by surgery . in these patients , streptozotocin can reduce the tumour size and reduce symptoms .
a typical dose is 500 mg / m / day by intravenous injection for 5 days , repeated every 46 weeks . owing to its high toxicity to beta cells , in scientific studies
, streptozotocin has also been long used for inducing insulitis and diabetes in experimental animals [ 6 , 7 ] .
a review of the literature reveals that most of the methods are used for analysis of streptozotocin by hplc [ 813 ] . in the recent years
, the electrochemical techniques have led to the advancement in the field of analysis because of their sensitivity , low cost , and relatively short analysis time when compared with other techniques .
redox properties of a drug can give insights into it 's metabolic fate or its in vivo redox processes or pharmaceutical activity [ 1418 ] .
nevertheless , the critical literature survey revealed that no attempt has been made to investigate the electrochemical behaviour of the zanosar in pharmaceutical formulation and human urine samples .
therefore , this work attempted to establish experimental conditions for the study of the electrochemical behavior of zanosar by direct current polarography , cyclic voltammetry , differential pulse polarography , controlled potential electrolysis and millicoulometry .
another the aim of the present work is to develop and validate a rapid , simple , selective differential pulse polarography method for the determination of zanosar in pharmaceutical formulation and human urine samples .
the measurements were performed by an elico model cl-362 polarographic analyzer , a conventional three - electrode system consisting of an hmde ( area 0.02323 cm ) as the working electrode , an ag / agcl reference electrode and platinum counter electrode was used in all experiments .
cyclic voltammetric measurements were carried on metrohm 757 va computrace model afrde4 potentiostat and msrx speed control unit coupled with digital electronics 200x - y / t recorder .
the effect of ph on the half - wave potentials and diffusion - limited current for zanosar at a concentration of 1.0 10 m was studied over the ph range of 2.012.0 .
the corresponding voltammograms were recorded under identical conditions and all the experiments were performed at an ambient temperature ( 25 1c ) .
the limit of detection ( lod ) was calculated by using equation dl = 3(sd / m ) , where dl = detection limit , sd = standard deviation , and m = slope of the calibration plot .
all chemicals were analytical reagent grade chemicals and doubly distilled water was used in preparation of all solutions .
stock solution ( 1.0 10 m ) was prepared by dissolving zanosar in dimethylformamide ( dmf ) .
britton - robinson ( br ) buffer solutions ranging from ph 2.0 to 12.0 were prepared using 0.2 m , 0.01 m citric acid and 0.1 m trisodium orthophosphate .
the recommended solution of zanosar ( 1.0 10 m ) was prepared by dilution of stock solution with a suitable amount of dmf .
1.0 ml of the standard solution was transferred into the voltammetric cell and made up 9.0 ml with the supporting electrolyte for achieving the required concentration and then deoxygenated by bubbling oxygen free nitrogen gas for 10 min .
after recording the voltammogram , small increments of the standard solutions are added and then voltammograms were recorded for each addition under similar conditions .
the optimum conditions for the analytical determination of zanosar at ph 4.0 were found to be a drop time of 2 sec , pulse amplitude of 40 mv and reduction potential of 0.28 v versus saturated ag / agcl electrode .
the well - defined reduction peak has been observed for the zanosar in br buffer ( ph ranging from 2.0 to 12.0 ) .
a typical dc polarogram was presented in figure 1 . from tomes ' criterion , log - plot analysis , and dependence of half - wave potentials on drop time ,
the obtained linear plots of i d versus h passing through the origin in the supporting electrolyte indicate that the reduction process was adsorption free in the br buffer supporting electrolyte at the ph 4.0 , where weak adsorption of the reactant was observed .
the results observed have been used for evaluation of kinetic parameters such as diffusion coefficient , transfer coefficient and heterogeneous forward rate constants for the reduction process of > c = o group which have been reported in table 1 .
the linear plot of ip versus v passing through origin indicates the electrode process to be mainly diffusion controlled adsorption on the electrode surface in all the ph ranges studied .
the peak current ( ip ) was dependent on scan rate ( v ) and ph of the supporting electrolyte .
the reduction process was found to be irreversible and presence of anodic peak on the reverse scans in cyclic voltammetry as well as evidence of tomes ' criterion confirms the electrode process to be reversible .
one proton has participated in the rate determining step for the reduction of > c = o group .
the typical cyclic voltammogram is shown in figure 2 and cyclicevoltammtric data of zanosar has been reported in table 2 .
the differential pulse polarography measurements have been carried out in the present investigation for the analysis of zanosar in pharmaceutical formulation and spiked human urine samples with supporting electrolyte of br buffer as shown in figure 3 .
no more than one well defined peak has been observed in the supporting electrolyte at ph 4.0 .
the variation of peak potential with concentration indicates the irreversible nature of the electrode process .
the plots of i m versus t ( figure 4 ) being linear and not passing through origin in all the ph ranges , show that adsorption complication was involved .
kinetic parameters have been evaluated and presented in table 3 . under the experimental conditions described above
, the polarographic reduction of zanosar gave a single well - defined two - electron reduction peak at ph 2.012.0 with all the techniques , corresponding to the reduction of carbonyl groups .
the diffusion coefficient values have been seen to gradually decrease which account for the decrease in diffusion current with an increase in ph due to the less availability of protons .
the heterogeneous forward rate constant values of the compound under investigation have been seen to gradually decrease with an increase in ph of the supporting electrolyte .
it may account for the shift of reduction potentials towards more negative values with an increase in ph .
the e1/2 versus ph plot and using the number of protons participated in the rate determining step of > c = o group reduction are shown in figure 6 .
this peak was attributed to the reduction of > c = o group of which one was at position involving one - proton and two - electrons which are the most useful for analytical purposes .
an increase in ph increases the dissociation constant of the protonated species and these factors affect the protonation rate and consequently the reduction potentials are shifted to more negative values . on the basis of the experimental results obtained , the mechanism could be suggested for the voltammetric reduction of zanosar , which corresponds to the usual reduction mechanism for the > c = o group .
the total number of electrons involved during the electrode reduction of zanosar was determined by millicoulometry .
the number of protons and electrons involved in the overall reduction process of zanosar was found to be two and four , respectively .
controlled potential electrolysis experiments were conducted at 0.28 v versus ag / agcl electrode at ph 4.0 and the corresponding decay was noted using a galvanometer .
the electrolyzed sample was dried and the product was separetad from supporting electrolyte by extraction with diethyl ether ; the product was identified as the hydroxy derivative , and identity was confirmed by infrared spectral studies in which the characteristic peak of the hydroxyl derivative was observed in the frequency range of 35503350 cm .
zanosar in pharmaceutical formulation namely streptozotocin should be administered intravenously by rapid injection or short / prolonged infusion .
it 's not active orally containing a 500 mg / m of compound in a total injection mass of approximately 1000 mg / m which has been analysed in order to examine the applicability of the method .
a portion equivalent amount of the compound was weighed accurately and dissolved in dimethylformamide and transferred into 10 ml calibrated flasks where it was described in the general procedure . with the help of calibrated graph , the amount of zanosar in portion of the sample was calculated . from the recovery studies ; formulations containing zanosar at ph 4.0
the obtained recoveries are in the range from 99.40% to 99.93% for streptozotocin samples with relative standard deviation 0.220.38% for five replicates .
the applicability of the method for the estimation of zanosar in urine was checked by using different spiked human urine samples coupled with a standard addition method .
direct determinations of undigested urine may yield for certain probands unreliable data due to trace metal trapping by natural chelating substances .
an aliquot of 2.0 ml of urine without treatment was diluted with water to 25 ml in a volumetric flask and 0.1 ml aliquot of this solution was transferred into a 25 ml calibrated flask ; 6 ml or br buffer ( ph : 4.0 ) was added and diluted to the mark with water .
the voltammograms of samples without zanosar do not show any signal which can interfere with direct determination .
the urine samples were used not only to study various possibilities to overcome a biomatrix effect and to find the best solution but also to explore the way for simple , reliable , fast determination of zanosar in urine by its dilution on employing differential pulse polarography .
the potential interference of some urine ingredients both organic and inorganic salts was checked without adding depolarizer .
the recoveries are in the range from 99.00% to 99.73% with relative standard deviation 0.090.50% for five replicates .
the differential pulse polarography well - defined wave / peak obtained at ph 4.0 is used in the analytical estimation of zanosar .
both standard addition and calibration methods are used for the analysis of zanosar in pharmaceutical formulations and urine samples .
the peak current is found to vary linearly with the concentration of zanosar over the range from 1.0 10 m to 1.0 10 m with the lower detection limit of 7.42 10 m ( figure 7 ) .
the calibration curve has been found to be linear with the equation y = 0.4041x + 0.012 , with a correlation coefficient of 0.992 ( r ) , and relative standard deviation values are found to be 0.315% , respectively , for five replicates .
the electrochemical behaviour of zanosar at hanging mercury drop electrode was examined in br buffer over a ph range from 2.0 to 12.0 by d.c polarography , differential pulse polarography , and cyclic voltammetric methods .
the diffusion coefficient , transfer coefficient and heterogeneous forward rate constant values were noticed to be in good agreement in all the techniques .
a fully validated , simple , sensitive , selective , fast and low - cost differential pulse polarography methods were developed for the determination of zanosar in pharmaceutical formulations and in spiked human urine samples .
the described method could be recommended for use in trace analysis , quality control , and clinical laboratories . | the electrochemical reduction of zanosar was investigated systematically by direct current polarography , cyclic voltammetry , and differential pulse polarography ( dpp ) .
a simple dpp technique was proposed for the direct quantitative determination of anticancer drug zanosar in pharmaceutical formulation and spiked human urine samples for the first time .
the reduction potential was 0.28 v versus ag / agcl with a hanging mercury drop electrode in britton - robinson buffer as supporting electrolyte .
the dependence of the intensities of currents and potentials on ph , concentration , scan rate , deposition time , and nature of the supporting electrolyte was investigated .
the calibration curve was found to be linear with the following equation : y = 0.4041x + 0.012 , with a correlation coefficient of 0.992 ( r2 ) over a concentration range from 1.0 107 m to 1.0 103 m. in the present investigation , the achieved limit of detection ( lod ) and limit of quantization ( lqd ) were 7.42 108 m and 2.47 108 m ; respectively .
excipients did not interfere with the determination of zanosar in pharmaceutical formulation and spiked urine samples .
precision and accuracy of the developed method were checked by recovery studies in pharmaceutical formulation and spiked human urine samples . | 1. Introduction
2. Experimental
3. Results and Discussion
4. Conclusion |
gangrene of limbs developing after injecting diclofenac intramuscularly may be a rare complication that has not been reported earlier .
i have attended to a patient who developed gangrene of the left hand and forearm following diclofenac injection given intramuscularly in the left deltoid region .
a 56-year - old male patient presented to the emergency department of this hospital with the complaint of severe pain and blackish discolouration of the left hand and forearm .
the patient gave history of attending one local hospital 2 days before coming to our hospital , with the complaint of mild pain on the left side of the abdomen for which an injection of diclofenac was given intramuscuarly in the left deltoid region .
soon after getting the injection , the patient developed severe pain in his left hand .
gradually the whole of the left hand and part of the forearm turned blackish in colour ( fig . 1 ) .
the patient had a known case of left renal calculi and had earlier undergone ureteroscopic retrieval of the calculi .
the patient also had a double j stent placed in situ , following stone retrieval .
urgent doppler scanning of the upper limb vessels was done , which revealed complete occlussion of both the radial and ulnar arteries on the injected side .
injection of heparin was started immediately , but the patient 's limb could not be salvaged .
there were no signs of arteriopathy in any other parts of the body as evidenced by clinical and doppler study .
all routine blood investigations , including lipid profile and serum ck levels , were found to be within normal limits .
antinuclear antibodies , c - reactive proteins and rheumatoid factors were all within normal ranges .
non - steroidal anti - inflammatory drugs ( nsaids ) are frequently prescribed as analgesics . known side - effects include peptic ulcer , bronchspasm , liver and renal toxicities .
the development of skin , subcutaneous and even muscle tissue necrosis are rare but serious complications of intramuscular injections .
tissue necrosis as a serious complication of intramuscular drug injection was first discovered in the 1920 's by freudenthal and nicolau after administration of bismuth salts for syphilis treatment and has been referred to since then as nicolau 's syndrome , livedo - like dermatitis or embolia cutis medicamentosa .
the necrosis may involve the skin , subcutaneous tissue and muscular layer . recovery usually occurs over a few months , often leaving an atrophic scar .
complications , such as neurological injury , extensive necrosis , limb ischaemia , sepsis due to superimposed infection and even death in children , have been reported .
in addition to bismuth salts , injection of several other drugs has been reported to cause necrosis including nsaids , local anesthetics , corticosteroids , antihistamines , penicillin and other types of antibiotics , interferon , vitamin b complexes , iodine and several vaccine preparations [ 2 , 3 ] .
the pathogenesis of post - injection necrosis is not completely understood ; however , damage to an end artery by massive inflammatory reaction induced by intra - arterial or para - arterial drug injection seems to be the leading hypothesis .
allergic , immunologic and mechanical vascular occlusion theories have been disproved [ 4 , 5 ] . in our patient , according to the patient 's version , injection was given in the lower part of his arm and the injection might have been accidentally pushed into the brachial artery causing simultaneous occlusion of both radial and ulnar arteries leading to the gangrene of his hand and part of the forearm . | diclofenac is a very commonly used analgesic medication .
diclofenac is a non - steroidal anti - inflammatory drug and acts by inhibiting cox ( cyclo - oxygenase ) 1 and 2 .
it has both analgesic and anti - pyretic effects .
it can be administered both orally and parentarelly . among the many side effects of diclofencac , extensive ganrene of the extremities
is never reported as one of the probable complications .
extensive pubmed and other literature searches did not reveal any previously reported case reports , hence the reporting of this case . | INTRODUCTION
CASE REPORT
DISCUSSION |
the pedant genome database was first announced in a short note entitled pedantic genome analysis which appeared in trends in genetics in 1997 ( 1 ) and reported computational analysis of seven completely sequenced and two partial genomes available at that time . from the very
beginning the main mission of pedant was defined as filling the gap between manually curated high quality protein sequence databases , such as uniprot / swiss - prot ( 2 ) , and the enormous amounts of other protein sequences produced by genome sequencing projects at an ever increasing pace . over the past decade
the pedant genome database was produced by systematically applying an automatic annotation pipeline to genome data released in the public domain .
these efforts resulted in one of the most comprehensive currently available genome databases which includes 468 organisms from all three domains of life .
we report on three new features of the pedant web server : ( i ) an all - new graphical user interface ( gui ) , ( ii ) availability of web services and ( iii ) rule - based detection of annotation errors .
the current version of the pedant software familiar to most users was introduced several years ago and is known as version 2 ( 3 ) . in 2006 we were deploying and testing the all - new version 3 which represents a complete re - implementation of the pedant software in the java programing language .
server application for enterprise - scale molecular sequence analysis with advanced features such as highly dynamic workflow - based process management , direct interface to computing grids , support for essentially all existing sql database management systems , open architecture for easy integration of additional algorithms , and powerful scripting interfaces ( d. frishman et al . , manuscript in preparation ) .
migration of pedant genomes to the new version 3 is currently in progress and will be accomplished by mid-2007 .
so far we have completed a pilot study to annotate 40 genomes to demonstrate the advantages of pedant3 .
the new version of the pedant gui can be viewed by selecting any genome with a
the pedant gui has been made user - configurable and supports four main types of windows : ( i ) sequence analysis : information about the complete analysis with links to orf lists of the individual algorithms , ( ii ) gene report : information about a selected gene , ( iii ) contig report : information about a selected contig and ( iv ) genetic element report ( where available ) : information about a selected nonprotein coding genetic element .
on selection of a pedant3 genome , the analysis window is opened displaying a list of genes and their best - blast hits .
the left - hand panel contains a context - dependent navigation tree that makes available different choices dependent on the particular view the user is working with .
the report page ( figure 1 ) is split into different sections ( overview , protein function , protein structure , protein location , general properties and export ) and lists the analysis results for a particular gene product , which are also available for download in different formats .
the protein viewer displays several panels for various types of evidence that can be configured by selecting
the dna viewer allows for easy navigation along the chromosomes and is capable of displaying an unlimited number of features at different zoom levels .
navigation tree and report page for the hypothetical secreted protein of helicobacter pylori ( gi_15645712 ) .
this figure also illustrates the application of association rule mining for finding potential annotation errors ( see text ) .
the interpro domain ipr001440 and pfam domain pf00515 were erroneously assigned to this gene product based on a weak similarity hit to a single tpr_1 repeat whereas the domain definition requires at least three repeat copies .
note that all other features marked as suspicious are in fact annotated correctly ; the method does not detect annotation errors as such , but rather incompatible feature combinations which might include annotation errors .
any pedant3 dataset can be searched using sequence ids , sequences , prosite - like patterns or free text as the query option .
web services technology is becoming increasingly popular within the bioinformatics community as a means to exploit the large amounts of data , software programs and computing power available at various institutions ( 4,5 ) . according to the world wide web consortium ( w3c )
a web service is a software system designed to support interoperable machine - to - machine interactions over a network ( ) .
this technology is based on the extensible markup language ( xml ) and open standards , and is platform and programing language independent .
this enables clients for a particular service to be written in many languages , such as java or perl , irrespective of the language the service was written in .
a web service has an interface that is described in a machine processable format using the xml based web services description language ( wsdl ) .
wsdl provides a format for the description of a web service interface , including parameters and data types in sufficient detail for a programer to write a client application for that service .
tools are available for various programing languages to generate the required client classes , such as apache axis 's wsdl2java ( ) .
the client programs interact with the web service using messages based on the simple object access protocol ( soap ) . as with wsdl ,
soap messages are xml based , permitting the interoperability of web services . for the transport layer itself
, web services typically use the hypertext transfer protocol ( http ) , preventing problems sending the soap messages through firewalls .
bioinformatics users can avoid keeping local copies of databases and software and use a client program instead to access remote databases and software via web services .
the pedant web service allows the user to query the database in an automated way from client programs and workflows .
we provide a number of data retrieval methods in our data retrieval service ( table 1 ) .
for example , to fetch the functional and structural annotations of a particular protein , the client program can call the getreportbydbcodeandcontig method .
methods available in the data retrieval service currently this web service only retrieves data from pedant2 analyses ; the pedant3 web service is in preparation . the raw ( unparsed ) output from various bioinformatics methods
a protein can be uniquely identified with just the database name and protein code . for unfinished genomes , where the proteins were predicted using orpheus ( 6 ) ,
it is necessary to provide the database name , protein code and contig name to uniquely identify a protein .
a list of the bioinformatics methods available for each genome can be obtained by calling the getmethodsbydb method .
we have generated a java client program using the apache axis software ( wsdl2java ) which has an example class demonstrating how to make calls to the dataretrievalservice .
we have also included pedant web service client functionality in our prompt workbench as a use case to demonstrate the various advantages of the web services .
prompt is a standalone application which enables a user to compare protein sequence sets , revealing statistically significant differences in their annotation features ( 7 ) ; ( ) .
genome annotation produced by automatic pipelines such as pedant is notoriously prone to various kinds of errors ( 8) . while every effort is being made to select the most reliable , carefully benchmarked bioinformatics tools and to avoid spurious similarity hits by setting conservative similarity thresholds , automatically produced function predictions are still not on a par with the results of manual curation of sequence data in high - quality databases such as uniprot ( 2 ) .
we estimate that only 5% of all known proteins have been manually annotated and , given the progress in superfast sequencing technologies ( 9 ) , it is becoming increasingly clear that the overwhelming majority of sequence data will not be processed by human experts .
we have recently developed a technology to improve the quality of automatically generated annotation using data mining techniques ( 10 ) .
the entire body of annotation available in the pedant database can be considered as a collection of records of variable length , one for each gene product , containing functional and structural attributes , such as predicted functional categories , domain assignments and the like . using a large collection of pedant records as input , we apply an unsupervised learning algorithm called association rule mining ( 11 ) to derive protein features that occur frequently together .
specifically , implications in the form a&b c are derived which mean that the majority of proteins possessing features a and b also possess c. some rules have the strength 1.0 which means that they are always fulfilled , while other rules may be true only in a certain percentage of cases .
an exception from a reasonably strong rule will have features a and b , but not c , which may be caused either by over - annotation ( features a or b ascribed erroneously ) , or by under - annotation ( feature c missed ) .
we have shown that 70% of exceptions from strong association rules found in pedant data point to incompatible or missing annotation and thus may be instrumental in identifying annotation errors . however , since strong association rules detect not annotation errors as such but only incompatible feature combinations , it is not possible to automatically correct errors .
instead , we highlight suspicious features and add the features which were putatively missed in a separate section at the bottom of the report page ( figure 1 ) . in a recent pilot project we applied this approach to analyze the pedant annotation of 10 model genomes arabidopsis thaliana , aeropyrum pernix , bacillus subtilis , escherichia coli , helicobacter pylori , mycobacterium tuberculosis , parachlamydia , saccharomyces cerevisiae , synechocystis and thermoplasma acidophilum containing a total of 55 123 protein entries . in the course of 2007 we intend on providing rule - based correction for all pedant genomes .
the current version of the pedant software familiar to most users was introduced several years ago and is known as version 2 ( 3 ) . in 2006
we were deploying and testing the all - new version 3 which represents a complete re - implementation of the pedant software in the java programing language .
server application for enterprise - scale molecular sequence analysis with advanced features such as highly dynamic workflow - based process management , direct interface to computing grids , support for essentially all existing sql database management systems , open architecture for easy integration of additional algorithms , and powerful scripting interfaces ( d. frishman et al . , manuscript in preparation ) .
migration of pedant genomes to the new version 3 is currently in progress and will be accomplished by mid-2007 .
so far we have completed a pilot study to annotate 40 genomes to demonstrate the advantages of pedant3 .
the new version of the pedant gui can be viewed by selecting any genome with a
the pedant gui has been made user - configurable and supports four main types of windows : ( i ) sequence analysis : information about the complete analysis with links to orf lists of the individual algorithms , ( ii ) gene report : information about a selected gene , ( iii ) contig report : information about a selected contig and ( iv ) genetic element report ( where available ) : information about a selected nonprotein coding genetic element .
on selection of a pedant3 genome , the analysis window is opened displaying a list of genes and their best - blast hits .
the left - hand panel contains a context - dependent navigation tree that makes available different choices dependent on the particular view the user is working with .
the report page ( figure 1 ) is split into different sections ( overview , protein function , protein structure , protein location , general properties and export ) and lists the analysis results for a particular gene product , which are also available for download in different formats .
the protein viewer displays several panels for various types of evidence that can be configured by selecting
for example certain panels can be hidden , resized and the color scheme can be changed .
the dna viewer allows for easy navigation along the chromosomes and is capable of displaying an unlimited number of features at different zoom levels . navigation tree and report page for the hypothetical secreted protein of helicobacter pylori ( gi_15645712 ) .
this figure also illustrates the application of association rule mining for finding potential annotation errors ( see text ) .
the interpro domain ipr001440 and pfam domain pf00515 were erroneously assigned to this gene product based on a weak similarity hit to a single tpr_1 repeat whereas the domain definition requires at least three repeat copies .
note that all other features marked as suspicious are in fact annotated correctly ; the method does not detect annotation errors as such , but rather incompatible feature combinations which might include annotation errors .
any pedant3 dataset can be searched using sequence ids , sequences , prosite - like patterns or free text as the query option .
web services technology is becoming increasingly popular within the bioinformatics community as a means to exploit the large amounts of data , software programs and computing power available at various institutions ( 4,5 ) . according to the world wide web consortium ( w3c )
a web service is a software system designed to support interoperable machine - to - machine interactions over a network ( ) .
this technology is based on the extensible markup language ( xml ) and open standards , and is platform and programing language independent .
this enables clients for a particular service to be written in many languages , such as java or perl , irrespective of the language the service was written in .
a web service has an interface that is described in a machine processable format using the xml based web services description language ( wsdl ) .
wsdl provides a format for the description of a web service interface , including parameters and data types in sufficient detail for a programer to write a client application for that service .
tools are available for various programing languages to generate the required client classes , such as apache axis 's wsdl2java ( ) .
the client programs interact with the web service using messages based on the simple object access protocol ( soap ) . as with wsdl ,
soap messages are xml based , permitting the interoperability of web services . for the transport layer itself
, web services typically use the hypertext transfer protocol ( http ) , preventing problems sending the soap messages through firewalls .
bioinformatics users can avoid keeping local copies of databases and software and use a client program instead to access remote databases and software via web services .
the pedant web service allows the user to query the database in an automated way from client programs and workflows .
we provide a number of data retrieval methods in our data retrieval service ( table 1 ) .
for example , to fetch the functional and structural annotations of a particular protein , the client program can call the getreportbydbcodeandcontig method .
methods available in the data retrieval service currently this web service only retrieves data from pedant2 analyses ; the pedant3 web service is in preparation .
the raw ( unparsed ) output from various bioinformatics methods can be obtained using the methods getrawhitsbydbcodeandmethod and getrawhitsbydbcodecontigandmethod . for completely sequenced genomes ,
a protein can be uniquely identified with just the database name and protein code . for unfinished genomes ,
where the proteins were predicted using orpheus ( 6 ) , it is necessary to provide the database name , protein code and contig name to uniquely identify a protein .
a list of the bioinformatics methods available for each genome can be obtained by calling the getmethodsbydb method .
we have generated a java client program using the apache axis software ( wsdl2java ) which has an example class demonstrating how to make calls to the dataretrievalservice .
we have also included pedant web service client functionality in our prompt workbench as a use case to demonstrate the various advantages of the web services .
prompt is a standalone application which enables a user to compare protein sequence sets , revealing statistically significant differences in their annotation features ( 7 ) ; ( ) .
genome annotation produced by automatic pipelines such as pedant is notoriously prone to various kinds of errors ( 8) .
while every effort is being made to select the most reliable , carefully benchmarked bioinformatics tools and to avoid spurious similarity hits by setting conservative similarity thresholds , automatically produced function predictions are still not on a par with the results of manual curation of sequence data in high - quality databases such as uniprot ( 2 ) .
we estimate that only 5% of all known proteins have been manually annotated and , given the progress in superfast sequencing technologies ( 9 ) , it is becoming increasingly clear that the overwhelming majority of sequence data will not be processed by human experts .
we have recently developed a technology to improve the quality of automatically generated annotation using data mining techniques ( 10 ) .
the entire body of annotation available in the pedant database can be considered as a collection of records of variable length , one for each gene product , containing functional and structural attributes , such as predicted functional categories , domain assignments and the like . using a large collection of pedant records as input , we apply an unsupervised learning algorithm called association rule mining ( 11 ) to derive protein features that occur frequently together .
specifically , implications in the form a&b c are derived which mean that the majority of proteins possessing features a and b also possess c. some rules have the strength 1.0 which means that they are always fulfilled , while other rules may be true only in a certain percentage of cases .
an exception from a reasonably strong rule will have features a and b , but not c , which may be caused either by over - annotation ( features a or b ascribed erroneously ) , or by under - annotation ( feature c missed ) .
we have shown that 70% of exceptions from strong association rules found in pedant data point to incompatible or missing annotation and thus may be instrumental in identifying annotation errors . however , since strong association rules detect not annotation errors as such but only incompatible feature combinations , it is not possible to automatically correct errors . instead , we highlight suspicious features and add the features which were putatively missed in a separate section at the bottom of the report page ( figure 1 ) . in a recent pilot project we applied this approach to analyze the pedant annotation of 10 model genomes arabidopsis thaliana , aeropyrum pernix , bacillus subtilis , escherichia coli , helicobacter pylori , mycobacterium tuberculosis , parachlamydia , saccharomyces cerevisiae , synechocystis and thermoplasma acidophilum containing a total of 55 123 protein entries .
in the course of 2007 we intend on providing rule - based correction for all pedant genomes . | the pedant genome database provides exhaustive annotation of 468 genomes by a broad set of bioinformatics algorithms .
we describe recent developments of the pedant web server .
the all - new graphical user interface ( gui ) implemented in java allows for more efficient navigation of the genome data , extended search capabilities , user customization and export facilities .
the dna and protein viewers have been made highly dynamic and customizable .
we also provide web services to access the entire body of pedant data programmatically .
finally , we report on the application of association rule mining for automatic detection of potential annotation errors .
pedant is freely accessible to academic users at . | INTRODUCTION
New Graphical User Interface (GUI)
PEDANT Web Services
Improving PEDANT annotation quality by data mining |
a 49-year - old male visited jinjiang hospital of quanzhou medical college with the complaint of a painless mass in the right parietal - occipital region of the skull .
the mass was found incidentally 1 month earlier by the patient himself and it had grown rapidly .
he denied any head traumas or any significant medical problems , including prior history of hepatic disease or chronic alcoholism .
bony window of cranial nonenhanced computed tomography ( ct ) scan showed a 5 5 cm soft tissue mass with irregular destruction ( figure 1a ) , and contrast - enhanced ct scan showed a hypervascular enhancement with osteolytic pathological change in the parietal - occipital region of the skull ( figure 1b ) . on admission , neurological and physical examinations revealed no neurological deficits , hepatomegaly , or obvious abnormalities except a painless non - movable mass about 5 5 cm in size over the right parietal - occipital region .
laboratory data showed no liver dysfunction while hbsag ( hepatitis b surface antigen ) was positive , and afp ( alpha fetal protein ) level was high ( table 1 ) . on cranial magnetic resonance imaging ,
the tumor was a homogeneous well - defined mass with involvement of the inner and outer skull table .
it revealed isosignal intensity on t2-weighted ( figure 2a ) and t1-weighted imaging ( figure 2b ) , with significant enhancement by gadolinium ( figure 2c ) .
abdominal b ultrasound showed a large mass in the right lobe of the liver ( figure 3 ) ; therefore , a contrast - enhanced ct of the abdomen and a nonenhanced ct of the breast were taken .
contrast - enhanced ct of the abdomen showed a huge enhanced carcinoma in the right lobe of the liver ( figure 4a c ) .
a single - photon emission computed tomography of total skeletal bones showed no metastases ( figure 6 ) .
our diagnosis was hepatocellular carcinoma ( hcc ) with skull metastasis and chronic hepatitis b. the carcinoma was radically resected with surrounding normal bone via right parietal - occipital craniectomy under general anesthesia . during the operation , a large and well - demarcated
reddish - brown mass was found to have penetrated both tables of the skull through the diploic space .
the carcinoma looked like cauliflower , and the underlying dura was intact and did not show any evidence of gross carcinoma invasion .
the dural surface attached to the carcinoma was curetted and the rough surface of the dura was cauterized by bipolar forceps .
histopathological examination of the carcinoma revealed pleomorphic tumor cells with eosinophilic cytoplasm , and prominent nucleoli and mitosis arranged in trabecular and solid pattern .
the pathological findings confirmed the diagnosis of metastasic hcc ( figure 7a and b ) .
transcatheter arterial chemoembolization with pirarubicin ( 40 mg ) , carboplatin ( 200 mg ) , floxuridine ( 250 mg ) , lipiodol , and gelatin sponge particles was performed after selecting a feeding artery of the tumor on aortography .
the patient survived after half a year of follow up and did not show any evidence of recurrence in the skull .
however , because of the recurrence of hepatocellular carcinomas , the patient died from liver failure in the 18 months since he received transcatheter arterial chemoembolization .
hepatocellular carcinoma is the fifth most common cancer in the world and is especially prevalent in africa and east asia.1 the incidence of hcc in developing countries is third most common of the various types of cancer.2 intrahepatic metastasis is the most common metastasis of hcc .
extrahepatic metastases of hcc usually occurs in the regional lymph nodes ( 16%40% ) and lungs ( 34%70% ) , but less commonly in the skeleton ( 1.6%16%).36 in skeleton metastasis , hcc usually metastasizes preferentially to the vertebral column , pelvis , femora , and ribs , but rarely to the skull .
the incidence of skull metastases from hcc is 0.4%1.6%,35,7,8 and 9% of patients with calvarial metastases have other skeletal deposits.9 after a thorough search of the literature , we found 48 articles in total describing patients who were identified with calvaria , skull base , or facial skeleton metastasis from hcc , which formed the basis of this review . in our review of published literature ,
a total of 59 patients with skull metastasis from hcc were found.1,3,7,8,1053 the incidence of skull metastasis from hcc in the period between 1990 and 2011 was significantly increased compared to incidence in the period between 1966 and 1989 ( 45:14 , respectively ) because of the prolonged survival rate of hcc patients due to the recent progress in both the diagnosis and treatment of the primary lesion after 1990 .
metastases occurring in the calvarial site were more frequent than those occurring in the skull base and facial skeleton ( 31:16:12 , respectively ) ( table 2 ) .
this may be because of the fact that calvarial metastasis are more easily found and hcc cells have more affinity to calvaria . in our review , 24 cases with the skull metastases as the first symptom from hcc ( 24/59 , 41% ) and 14 cases with the solitary skull metastases from hcc ( 14/59 , 24% ) were identified ( table 3 ) . in all 24 cases of the skull metastasis as the first symptom from hcc ,
the reason for the high rate of misdiagnosis is that the incidence of skull metastasis of hcc is low and doctors lack a full understanding of this disease .
we must pay more attention to such cases in order to reduce the misdiagnosis rate , diagnose as early as possible , and give the patients best treatment to improve their prognosis and quality of life .
molecular imaging by positron emission tomography is , therefore , set to probe the molecular abnormalities that are the basis of disease and provide different additional biochemical or molecular information about primary brain tumors.54,55 in all , it is necessary to give each patient with a scalp mass that has invaded the skull molecular neuroimaging , such as positron emission tomography , to reduce the misdiagnosis rate and to rule out the possibility of skull metastasis from hcc . | skull metastasis from hepatocellular carcinoma ( hcc ) is reported rarely . in addition
, solitary skull metastasis as the first symptom of hcc is reported even less . here , we reported a case of solitary skull metastasis as the first symptom of hcc and reviewed the literature on skull metastasis .
a 49-year - old male patient was admitted to jinjiang hospital of quanzhou medical college with a painless parietal - occipital scalp mass , and he denied any history of hepatic disease .
a cranial computed tomography demonstrated a hypervascular enhancement with osteolytic change in the right parietal - occipital region , cranial magnetic resonance imaging indicated a highly enhanced and osteolytic skull tumor , and abdominal computed tomography showed a huge tumor in the liver .
the other examinations showed no other metastases .
laboratory data showed no liver dysfunction while hepatitis b surface antigen was positive , and alpha fetal protein level was high .
a craniectomy was performed and the mass was totally removed .
the histological diagnosis was skull metastasis from hcc .
the patient was subsequently treated by transcatheter arterial chemoembolization . in a review of published literature
, the incidence of skull metastasis from hcc in the period between 1990 and 2011 has significantly increased . the misdiagnosis rate of skull metastases as the first symptom from hcc was high .
therefore , it is necessary to give each patient with a scalp mass that has invaded the skull a liver ultrasound or computed tomography scan . on the other hand , we found that metastases that occurred in the calvaria site were more frequent than those that occurred in the skull base and facial skeleton .
this may be worthy of further investigation in the future . | Case report
Discussion |
osteonecrosis of the jaw ( onj ) emerged as a well - known devastating side effect of parenteral bisphosphonate therapy since the widespread use of biphosphonates to reduce skeletal related events ( sre ) .
biphosphonates are commonly used every three to four weeks with around 1448% reduction of sre occurrence and onj occurrence in 1.23.8% despite preventive measures , , , .
although the positive results of 4 different trials , the use of biyearly biphosphonates regimens to reduce aibl is not approved , , , . this spaced interval of six months achieved an increase in median bone mineral density of 2.74.3% in the lumbar spine and 1.61.7% in the hip when used in post - menopausal women receiving adjuvant hormonal aromatase inhibitor , . however , the risk of developing onj with the bi - annually regimen of zoledronic acid is not well recognized .
a review of literature in women having breast cancer receiving zoledronate biannually to prevent aibl was conducted . reported cases of onj are collected from the selected studies and an estimation of the onj risk in this category of patients is reported .
electronic searches of the literature published until september 2014 were conducted using pubmed and the cochrane collaboration database to identify articles evaluating the onj as a side effect in women receiving zoledronic acid every six months for the prevention of aromatase inhibitor associated bone loss ( aibl ) in patients with early stage breast cancer . only randomized and non - randomized controlled clinical trials were included .
zoledronic acid , early breast cancer and aromatase inhibitors. this search was augmented by a hand search of the reference lists of relevant articles included in the literature review .
two different investigators performed the search and the abstracts were independently reviewed for possible inclusion .
types of participants : included studies were limited to post - menopausal women receiving zoledronic acid every six months with aromatase inhibitors to prevent aibl .
selection of studies : the articles were first selected individually on the basis of their titles by two of the authors .
electronic searches of the literature published until september 2014 were conducted using pubmed and the cochrane collaboration database to identify articles evaluating the onj as a side effect in women receiving zoledronic acid every six months for the prevention of aromatase inhibitor associated bone loss ( aibl ) in patients with early stage breast cancer . only randomized and non - randomized controlled clinical trials were included .
zoledronic acid , early breast cancer and aromatase inhibitors. this search was augmented by a hand search of the reference lists of relevant articles included in the literature review .
two different investigators performed the search and the abstracts were independently reviewed for possible inclusion .
types of participants : included studies were limited to post - menopausal women receiving zoledronic acid every six months with aromatase inhibitors to prevent aibl .
selection of studies : the articles were first selected individually on the basis of their titles by two of the authors .
the upfront biyearly regimen of zoledronic acid significantly increased bone mineral density ( bmd ) in postmenopausal women receiving aromatase inhibitors for early breast cancer , , , .
the z - fast trial enrolled 602 postmenopausal women with early hormone receptor - positive breast cancer receiving adjuvant letrozole .
patients were randomized equally to receive upfront or delayed zoledronic acid with a 4 mg intravenous regimen every 6 months for 5 years .
the investigators reported two cases of onj in the upfront group during the 60 months follow - up .
however , an onj adjudication committee deemed one of the cases inconsistent with onj and the other one indeterminate because of insufficient information .
the zo - fast trial recruited 1065 postmenopausal women receiving adjuvant letrozole that were randomly assigned to immediate zoledronic acid with a regimen of 4 mg every 6 months for 5 years , or delayed administration initiated at fracture occurrence or on - study bmd decrease .
a total of nine potential onj events from seven patients were reported in this study after 60 months follow up .
each event was independently adjudicated by an external panel that confirmed onj occurrence in three cases , deemed possible for insufficient data in two cases , and excluded the remaining cases .
therefore , in the zo - fast trial , onj occurred in 0.280.47% . in the e - zo - fast trial , 527 postmenopausal women receiving aromatase inhibitors were randomized to either immediate or delayed zoledronic acid treatment , at 4 mg every 6 months .
two reported cases of onj of the immediate zoledronic acid group were confirmed by the adjudication committee . at diagnosis
finally , the abcsg-12 trial is the largest study recruiting 1803 patients with early breast cancer receiving zoledronic acid 4 mg intravenously every 6 months .
all these studies are summarized in the table 1 . keeping in mind the limitation of these studies by the absence of long - term follow - up , the mean risk of developing onj varies between 0.230.41% in patients receiving immediate or late zoledronic acid .
zoledronic acid has been approved for prevention and treatment of osteoporosis and glucocorticoids - induced osteoporosis , treatment of paget 's disease , hypercalcemia , multiple myeloma and bone metastasis . in the particular case of breast cancer , it is recommended as a monthly administration in breast cancer patients with bone metastasis and as a biyearly administration in early breast cancer patients receiving adjuvant aromatase inhibitors for aibl prevention .
it is incorporated into the skeleton without being degraded and consequently decreases bone turnover and inhibits of the bone 's reparative ability , .
reports of the side effects of zoledronic acid most commonly describe bone pain , nausea , fever , fatigue and constipation .
onj is an uncommon , but severe , adverse event that has been reported with prolonged zoledronic acid therapy . in women with advanced breast cancer and bone metastases ,
the use of bisphosphonates in adjunction to hormone therapy or chemotherapy reduces the sre occurrence and the sre rate , as well as increases the time to skeletal event occurrence .
effectively , breast cancer patients receiving bisphophonates represent more than 20% of patients developing onj .
metastatic breast cancer patients treated by zoledronic acid monthly develop onj in 1.23.8% with the long - term treatment , . on the other hand ,
biyearly zoledronic acid for aibl prevention in early breast cancer is complicated with onj in less than 0.7% according to our literature review . unfortunately , these trials did not report the time of occurrence of the onj , , .
however , the azure trial used a regimen that consisted of monthly zoledronic acid for six doses then every three to six months to compete the 5 years treatment and reported a comparable prevalence of onj .
this comparison allows a safe administration of the loading dose of zoledronic acid .
effectively , the pharmacology of the zoledronic acid characterized by a long half - life correlates well with this finding . a recently published abstract , swog 0307 compared three different bisphosphonates clodronate , ibandronate and zoledronic acid administred in a specific schedules in the adjuvant setting of early breast cancer .
no evidence of differences in efficacy by type of bisphosphonate either in the intent to treat analysis or based on age and menopausal status was detected between the three arms . at 5 years
follow - up , the rate of onj was 1.2% in zoledronic acid arm administered monthly for six months then every 3 months for 2.5 years .
denosumab , a fully monoclonal antibody rankl inhibitor , was also evaluated at 60 mg every six months instead of zoledronic acid in patients presenting aromatase inhibitor associated bone loss in early breast cancer . in abcsg
18 trial comparing denosumab 60 mg every six months to placebo , 3425 patients were included ; overall lower number of fractures was demonstrated in the denosumab arm versus the placebo arm .
35 dental problems were identified by proactive monitoring of onj during the trial , 31 suspected cases of onj were detected but no case was eventually judged to meet the diagnosis criteria of onj .
denosumab seems to be safer concerning onj in the indication compared to zoledronic acid ; a randomized trial comparing these two agents can only confirm this hypothesis .
osteonecrosis of the jaw is a major complication of monthly biphosphonate regiments that seems to be encountered also in biyearly administration .
the literature review on zoledronic acid given every six months to prevent aibl , showed a relatively low risk for onj not exceeding 0.7% . despite this low prevalence , avoidance of dental manipulation and recommendations of oral hygiene | osteonecrosis of the jaw ( onj ) is one of the most relevant and specific complication of biphosphonates .
onj in patients receiving zoledronic acid every 3 to 4 weeks is frequently described , but the onj biyearly regimen used to reduce aromatase inhibitor associated bone loss ( aibl ) , is rarely reported . a literature review , focusing on the important trials using zoledronic acid to reduce aibl , found that the mean risk of developing onj when zoledronic acid is used biyearly varies between 0.12% and 0.7% . | Introduction
Material and methods
Search strategy for the identification of studies
Selection criteria
Results
Discussion
Conclusions |
psychogenic nonepileptic spells ( pnes ) or pseudoseizures are paroxysmal episodes of behaviors , such as altered movement , sensation , or cognition , that , unlike epileptic seizures , occur without evidence of seizure activity determined by video - eeg .
pseudohypacusis or nonorganic hearing loss ( nohl ) is a condition of subjective hearing loss in the absence of any organic disease as determined by examinations , electrophysiologic tests , and neuroimaging , .
although pnes is well - known among neurologists and epileptologists , nohl is usually presented to hearing specialists such as otolaryngologists and audiologists .
the case represents a juxtaposition of factitious symptoms that , in studies of patients with pnes and other comorbid , nonphysiologic complaints , implies poor acceptance of the diagnosis and poor psychological prognosis .
a 28-year - old woman presented with a two - year history of seizures consisting of warning symptoms of a metallic taste and scintillating scotoma in bilateral visual fields , staring , occasional left arm posturing , and , ultimately , loss of consciousness and generalized shaking .
weekly seizures ( typically lasting about 110 min ) sometimes clustered in waxing and waning episodes lasting about 3 h. postictal symptoms included amnesia , fatigue , and diffuse headache .
urinary incontinence , tongue biting , and mild injuries or contusions occurred intermittently during or as a result of seizures . at their worst
, seizures led to emergency room and inpatient admissions for which she was sometimes sedated and intubated .
her family history was significant for a younger sibling who had congenital deafness , and the patient learned american sign language ( asl ) at a young age .
she used these skills , once professionally trained , in a career as a hearing interpreter .
about two years before presentation about the time that the seizures began she complained of complete deafness , and she was outfitted with bilateral hearing aids .
her psychiatric history was significant for history of physical and sexual abuse by her stepfather from the age of 818 .
she had four pregnancies as a result of sexual abuse , all resulting in miscarriages .
she had been seen by a psychiatrist since the age of 16 and was diagnosed with posttraumatic stress disorder .
she reported mild head trauma when she was sixteen following which she had a brief episode of loss of consciousness .
she had a previous history of abdominal pain and intermittent diarrhea since the age of 13 , for which she underwent inconclusive evaluation including normal abdominal ct ; upper and lower gi endoscopy ; and colorectal , ileal , duodenal , and stomach biopsies .
she was diagnosed with possible irritable bowel syndrome versus anorexia nervosa , and gi symptoms improved over time .
she denied any history of exposure to toxins , loud noises , recent head or neck trauma , cns infection , or febrile convulsions .
she also denied medication use except for phenytoin ; however , review of her prescription records was significant for clonazepam from multiple prescribers .
admission to the university of virginia epilepsy monitoring unit revealed the patient 's apparent skill at lip reading .
physical and neurological examinations were normal including the lack of dysarthria save for inability to hear spoken directions with or without the use of hearing aids .
she had no evidence of vestibular dysfunction . during four days of continuous video - eeg ,
she had multiple episodes of her typical spells convulsions with asynchronous , migratory movements of the extremities and loss of responsiveness with no evidence of seizure activity and preservation of waking alpha rhythm during unresponsiveness .
video recordings during video - eeg demonstrated that the patient displayed behaviors that were unlikely to occur in the setting of complete deafness : she had brief conversations with nonmedical hospital staff that continued when the staff turned their backs and when hearing aids were not worn .
she was startled by abrupt noises occurring behind the drawn curtain of the next bed in her nonprivate room .
finally , we noted that her cell phone was set to normal ringtones and not to vibration , and pointedly , we noted that she used a cell phone in the first place .
her evaluation for hearing loss included audiometry consultation at the university of virginia . despite profound hearing loss in audiograms [ ad speech reception threshold ( srt ) = 110 db ( normal < 25 db , profound hearing loss > 90 db ) ; as srt = not reported ] , she had normal tympanograms , normal otoacoustic emission , intact acoustic reflexes bilaterally on contralateral and ipsilateral testing , and intact auditory brain stem reflexes down to the level of 15 db from both ears .
repeat brain stem auditory - evoked potentials with square - wave stimuli at 75 db demonstrated intact short latency potentials ( fig . 1 ) .
education pertaining to pnes was provided . despite multiple sessions discussing normal test results in both realms of epilepsy and hearing both by neuropsychology consultants and by the primary team
, she and her family remained unwilling to accept the diagnosis , requesting more evaluations to be performed .
first , the case is unique in its combination of features , mimicking epilepsy and profound hearing loss .
second , the details aiding diagnosis the history of sexual abuse , an eating disorder , and accumulated somatoform complaints in combination with objective ,
physiologic testing were only discoverable during an extended inpatient setting ; the value of inpatient video - eeg with its opportunity for in - depth history and investigation goes beyond extended monitoring , especially when patients may initially present with self - selected or incomplete histories .
third , because many findings in the evaluation of hearing loss are subjective , direct observation of patient behavior inconsistent with deafness was an important aid to the diagnosis of nohl .
finally , patients with multiple psychogenic complaints experienced over a long period may not respond as desired to the usual recommendations in informing and treating patients with pnes . a factor that may have contributed to delayed diagnosis was that the patient 's main symptoms early , progressive hearing loss and pnes spanned different subspecialties .
in fact , in the thirty years of accumulated experience of the uva epilepsy monitoring unit , this patient is the only one with pseudohypacusis in our records .
the simultaneous presentation of nohl with pnes is unique , but past occurrences of nohl ( reported to occur in 13% ) , as well as other pseudoneurological complaints [ such as blindness ( 18% ) , numbness ( 58% ) , weakness ( 49% ) , and paralysis ( 42% ) ] , are reported in studies of pnes .
pseudohypacusis is well - described in audiology and otolaryngology literature , a condition with a prevalence ranging between 29% in adults and 27% in children , .
nonorganic hearing loss has been reported to be more common in young women and children .
in contrast to described patients , the present patient had a chronic , progressive course of hearing loss of prolonged duration .
deafness in a sibling as well as skills with asl perhaps biased past evaluations as well as provided ample templates of deaf behavior . despite the unusual presence of pseudohypacusis , the present patient shared some characteristics and risk factors with other patients with pnes : female gender ; age group ; history of eating disorder , drug abuse or seeking ; head trauma ; and physical and sexual abuse , , .
given her gi complaints and pseudoneurological findings ( but with the absence of reproductive system and pain complaints ) , she fell short of dsm-4r criteria for somatoform disorder but qualified for somatic symptom disorder under the dsm-5 criteria .
conversion reaction , body dysmorphia , and malingering were possibilities as well . given that nohl as a conversion disorder has rarely been described to persist longer than two weeks , factitious disorder and malingering remain as distinct possibilities .
treatment of pnes begins with a forthright and clear presentation of the physiological findings backed by offers for psychological and psychiatric consultation , , . in this case , the patient and her family were reluctant to accept the diagnoses .
longer duration of symptoms , denial of psychosocial problems , and a diagnosis of somatoform disorder are all associated with poor outcomes , , , . in summary ,
the patient 's poor acceptance of the diagnosis , refusal of psychological evaluation and treatment , and loss to follow - up all suggest that she will continue to manifest symptoms and not enjoy improvements in quality of life , employment , and independence that patients with successfully treated pnes achieve . | a twenty - eight - year - old woman with an eight - year history of partial hearing loss presented with a two - year history of worsening deafness and new - onset seizures .
evaluations of tympanic membranes , cochlea , and auditory brain stem reflexes demonstrated no physiologic basis for deafness .
video - eeg monitoring demonstrated that the patient responded normally to spontaneous auditory stimuli and that typical spells were nonepileptic in origin .
although pseudohypacusis is reported in audiology literature , and psychogenic nonepileptic spells are well - studied phenomena in neurology literature , the present case is an unusual case of dual psychogenic symptoms , a relationship that indicates poorer prognosis . | Introduction
Case report
Results
Discussion
Conflict of interest |
beauty lies in the eyes of the beholder - keeping this old adage in mind , smile corrections can be done in patients with cosmetic concerns .
what constitutes a pleasant smile varies from person to person , but usually depends on the extent of gingival exposure .
when a person smiles , the entire crowns of maxillary central incisors and 1 mm of pink attached gingival is visible .
a gummy smile is seen usually when more than 3 mm of gingival is visible .
the form of the lips and the position of lips during speech and smiling can not be changed easily , but the dentist can modify / control the form of the teeth , interdental papilla , and position of the gingival margin and incisal edges of the teeth . while correcting the position of the marginal gingiva , one should be cautious in preserving the biologic width . often , osseous recontouring becomes essential to maintain the integrity of the biologic width and enable proper margin placement .
various methods have been documented including gingivectomy , flap surgery with osseous contouring , apically displaced flaps , and orthodontic therapy
. excessive display of the gingiva is sometimes caused by vertical maxillary excess and a long mid - face .
surgical crown lengthening does not suffice in such cases and the maxilla has to be surgically treated with maxillofacial surgery .
an interdisciplinary approach is vital in such cases when the patient is unwilling for a major surgery . a combination of soft and hard tissue contouring with appropriate prosthetic restoration to alter the shape of the teeth achieves an aesthetic result , at least partially . a classification system for aesthetic crown lengthening procedures has been proposed by lee
type i - sufficient soft tissue present allowing gingival exposure of the alveolar crest or violation of the biologic width .
type ii - sufficient soft tissue allows gingival excision without exposure of the alveolar crest , but in violation of the biologic width .
type iii - gingival excision to the desired clinical crown length will expose the alveolar crest .
staging of the procedures and alternative treatment sequence may minimize display of exposed subgingival structures .
prior to developing a suitable treatment plan , it is essential to establish a complete and accurate assessement of the conditions with which the patient presents .
reasons for seeking treatment;assessment of systemic health and habits;height and symmetry of face;thickness , length , and profile of lips;smile line;condition and dimensions of teeth;width of keratinized gingiva;gingival biotype ; andfacial and lingual bone levels , thickness of alveolar .
reasons for seeking treatment ; assessment of systemic health and habits ; height and symmetry of face ; thickness , length , and profile of lips ; condition and dimensions of teeth ;
width of keratinized gingiva ; gingival biotype ; and facial and lingual bone levels , thickness of alveolar .
prior to developing a suitable treatment plan , it is essential to establish a complete and accurate assessement of the conditions with which the patient presents .
reasons for seeking treatment;assessment of systemic health and habits;height and symmetry of face;thickness , length , and profile of lips;smile line;condition and dimensions of teeth;width of keratinized gingiva;gingival biotype ; andfacial and lingual bone levels , thickness of alveolar .
reasons for seeking treatment ; assessment of systemic health and habits ; height and symmetry of face ; thickness , length , and profile of lips ; condition and dimensions of teeth ; width of keratinized gingiva ; gingival biotype ; and facial and lingual bone levels , thickness of alveolar .
surgical crown lengthening without osseous correction : a 33-year - old female patient with unaesthetic crowns on the maxillary anteriors , with localized periodontitis , and maxillary gingival excess resulting in a gummy smile reported to a consultant prosthodontist for replacement of crowns [ figure 1 ] .
a treatment plan involving surgical crown lengthening without osseous correction on account of the existing bone loss and consequent pockets , followed by replacement of the crowns was drawn up and presented to the patient . after obtaining approval of the treatment plan and informed consent , phase 1 periodontal therapy
bone sounding was done [ figure 2 ] under anesthesia , before starting the excision , to clearly establish the position of the bone .
inverse bevel gingivectomy [ figure 3 ] was done , and the flap rose for debridement and curettage .
inverse - bevel gingivectomy the flap was sutured back [ figure 4 ] and the original bridge was cemented in place , temporarily [ figure 5 ] .
the patient was recalled after four weeks , and a new temporary bridge was cemented [ figure 6 ] .
crown lengthening complete original bridge cemented new provisional bridge surgical crown lengthening with osseous correction for gummy smile : a 30-year - old female patient reported to the clinic with a chief complaint of a gummy smile that was not acceptable aesthetically . on clinical examination , she was found to have a vertical maxillary excess , and was a candidate for orthognathic surgery . however , the patient was unwilling to go through a complicated surgical procedure involving hospitalization , and yet wanted her smile to be altered .
hence , she was given an option of compromised correction by doing surgical crown lengthening involving soft tissue as well as osseous correction along with prosthetic placement of venners .
in [ figure 7 ] , the preoperative view can be seen with a severe maxillary excess causing a gummy smile .
a crevicular incision was made from distal of tooth number , 14 to 24 , and mucoperiosteal flap was raised [ figure 8 ] .
osseous correction was then performed , keeping in mind the biologic width requirements using a large round diamond bur on an airotor [ figure 9 ] .
after six weeks of healing and allowing complete shrinkage , gingivectomy was performed with aesthetic contouring [ figure 10 ] .
after eight weeks of healing , composite veneers were placed as provisional restorations [ figure 11 ] .
flap raised and bony crests revealed osseous recontouring complete gingival recontouring after six weeks composite veneers placed
surgical crown lengthening without osseous correction : a 33-year - old female patient with unaesthetic crowns on the maxillary anteriors , with localized periodontitis , and maxillary gingival excess resulting in a gummy smile reported to a consultant prosthodontist for replacement of crowns [ figure 1 ] .
a treatment plan involving surgical crown lengthening without osseous correction on account of the existing bone loss and consequent pockets , followed by replacement of the crowns was drawn up and presented to the patient . after obtaining approval of the treatment plan and informed consent , phase 1 periodontal therapy
bone sounding was done [ figure 2 ] under anesthesia , before starting the excision , to clearly establish the position of the bone .
inverse bevel gingivectomy [ figure 3 ] was done , and the flap rose for debridement and curettage .
inverse - bevel gingivectomy the flap was sutured back [ figure 4 ] and the original bridge was cemented in place , temporarily [ figure 5 ] .
the patient was recalled after four weeks , and a new temporary bridge was cemented [ figure 6 ] .
surgical crown lengthening with osseous correction for gummy smile : a 30-year - old female patient reported to the clinic with a chief complaint of a gummy smile that was not acceptable aesthetically . on clinical examination , she was found to have a vertical maxillary excess , and was a candidate for orthognathic surgery . however , the patient was unwilling to go through a complicated surgical procedure involving hospitalization , and yet wanted her smile to be altered .
hence , she was given an option of compromised correction by doing surgical crown lengthening involving soft tissue as well as osseous correction along with prosthetic placement of venners .
in [ figure 7 ] , the preoperative view can be seen with a severe maxillary excess causing a gummy smile .
a crevicular incision was made from distal of tooth number , 14 to 24 , and mucoperiosteal flap was raised [ figure 8 ] .
osseous correction was then performed , keeping in mind the biologic width requirements using a large round diamond bur on an airotor [ figure 9 ] .
the flap was sutured back in the same position . after six weeks of healing and
after eight weeks of healing , composite veneers were placed as provisional restorations [ figure 11 ] .
flap raised and bony crests revealed osseous recontouring complete gingival recontouring after six weeks composite veneers placed
there are two aspects to the crown lengthening procedure : aesthetic and functional . in both cases
, the surgical procedure is aimed at re - establishing the biological width , apically , while exposing more tooth structure .
the average space occupied by the sum of the junctional epithelium and the supracrestal connective tissue fibers was found to be 2.04 mm .
violation of biological width has been associated with gingival inflammation , discomfort , gingival recession , alveolar bone loss , and pocket formation . to have a harmonious and successful long - term restoration ,
a 3 mm sound supracrestal tooth structure between bone and prosthetic margins , which allows for the reformation of the biological width plus sulcus depth is advocated .
this can be achieved surgically ( crown lengthening ) , orthodontically ( forced eruption ) , or by a combination of both .
patients that require aesthetic crown lengthening , however , frequently exhibit a high smile line . as a result
, pressure is often placed on the restorative dentist to correct aesthetic deficiencies as early as possible , and maintain certain aesthetic standards throughout the treatment .
however , conventional protocols require a waiting period of four to six weeks for sufficient healing of the attachment apparatus , prior to initiating restorative procedures .
the surfaces exposed due to crown lengthening will be displayed through the healing period until the provisional prosthesis can be fabricated or relined .
the exposed areas may be limited to cemento - enamel junctions and varying amounts of root surface , but may also include the margins of previous restorations .
crown lengthening can be limited to the soft tissues when there is enough gingiva coronal to the alveolar bone , allowing for surgical modification of the gingival margins , without the need for osseous recontouring ( that is , pseudopockets in cases of gingival hyperplasia ) , as seen in case 1 , which presented with periodontitis and bone loss .
an external or internal bevel gingivectomy ( gingivoplasty ) is the procedure of choice in these cases .
the biological width has not been compromised , and , as a result , the soft tissue pocket is eliminated and the teeth exposed without the need for osseous resection .
unfortunately , the majority of cases will involve bone recontouring as well as gingival resection to accommodate aesthetics and function .
this is a more delicate procedure that requires exposing root surface , positioning gingival margins at the desired height , and apically reestablishing the biological width .
the level of the alveolar crest must be determined prior to any considerations regarding aesthetic crown lengthening .
bone sounding is utilized to determine the thickness of the soft tissue layer and height and thickness of the alveolar bone .
bone sounding assists in determining the level of the alveolar crest , and thus , the need for osseous contouring .
the crown - lengthening procedure enables restorative dentists to develop an adequate zone for crown retention without extending the crown margins deep into periodontal tissues . after the procedure , it is customary to wait six to eight weeks before cementing the final restoration . in the aesthetic zone ,
this reduces the chances of gingival recession following prosthetic crown insertion , specifically if there is a thin biotype .
it may be beneficial in these scenarios to compartmentalize the soft and hard tissue components of the crown lengthening procedure and stage them individually for treatment .
as with any procedure , the patient needs to be informed of any potential complications . for crown lengthening
these include :
possible poor aesthetics due to black triangles;root sensitivity;root resorption ; andtransient mobility of the teeth .
possible poor aesthetics due to black triangles ; transient mobility of the teeth .
as with any procedure , the patient needs to be informed of any potential complications . for crown lengthening
these include :
possible poor aesthetics due to black triangles;root sensitivity;root resorption ; andtransient mobility of the teeth .
possible poor aesthetics due to black triangles ; transient mobility of the teeth .
gingival topography is a complex interplay of the underlying bony architecture and the size , form and position of teeth .
the concept of modern day dental aesthetics places equal impetus on the white and pink components , and a balance of the two is an essential ingredient in smile designing . | cosmetically acceptable smiles show a gingival display of up to 3 mm .
gingival display of greater than 3 mm results in a gummy smile which is often unsightly for the individual and correction is sought .
there are a variety of procedures used for surgical crown lengthening . here , we describe two such cases requiring two different approaches for surgical crown lengthening . | INTRODUCTION
Pre-procedural assessment
CASE REPORTS
Case 1
Case 2
DISCUSSION
Complications
CONCLUSION |
the cervical spine is surrounded by complex muscles that control the mobility and stability
of the head and neck1 . among them , the
deep cervical flexors ( longus colli , longus capitis ) are known to provide the cervical
spine s segmental stability , and postural stability is realized through neuromuscular
control in the cervical region due to the distribution of multiple position
proprioceptors2 .
therefore , for
providing the cervical region s functional motions and stability , the deep cervical flexors
should first be contracted , thereby creating cervical stability ; then , the functional
motions should be realized .
however , patients with chronic neck pain show a weakening of their deep cervical flexors ,
as well as compensatory hypertension of the superficial flexors3 .
this weakening of the deep cervical flexors causes a
reduction in the intrinsic proprioceptors of the postural senses in the muscles , and it
lowers the ability to control posture through interactions between the vestibular and visual
systems4 .
therefore , exercises that can help strengthen the deep cervical flexors have been applied
in various manners5 , 6 ) . in particular
, deep cervical flexor training ( dcft ) , which retrains the deep
cervical flexors , is drawing attention . in a previous study ,
the test group that performed
dcft showed increases in the range of motion and the cross - section of the longus colli when
compared to the control group7 .
another
study applied dcft in patients with chronic neck pain for six weeks and observed an overall
statistically significant decrease in the neck disability index ( ndi)8 . in dcft , each patient is instructed to flatten the cervical
spine in the supine position without moving the head and to pull in the chin9 .
however , no specific instructions were
given regarding the direction of the patient s gaze or regarding whether to open or close
the mouth .
in addition , the coordination of the head , neck , and eye increases the level of
sensitivity to postural changes , thereby enhancing postural stability and enabling selective
exercises10 .
therefore , during dcft ,
the activation of the cervical muscles and changes in the thicknesses of the muscles are
likely to show differences according to an individual s eye direction
giannakopoulos11 and
other researchers measured the activation of the longus colli using electromyography ( emg ) .
however , as the longus colli is located in the deep part of the anterior cervical region ,
activation can not easily be measured using surface emg . moreover
therefore , the purpose of this study was to
compare changes in the thicknesses of the cervical flexors according to eye coordination
during dcft using ultrasonic waves .
after the purpose of this study was explained , the subjects agreed to participate and
submitted a written consent form .
the
selection criterion included those who had not experienced cervical pain , headache , or
dizziness within the last six months .
the study was approved by the institutional review
board ( irb ) of the catholic university of busan .
the researcher taught the subjects how to perform dcft and then provided them with a
five - minute break . in the experiment ,
the subjects were instructed to lie down on the bed in the supine
position and then bend their hip and knee joints at 90. the researcher placed a pressure
biofeedback unit ( pbu ) between the surface and the curve formed in the back of the subject s
neck and maintained 20 mmhg of pressure while performed dcft to prevent excessive
contractions of the sternocleidomastoid and anterior scalenus .
the subjects were asked to
look straight ahead and to pull in the chin . in this position , the researcher measured the
thicknesses of the longus colli and the sternocleidomastoid located in the subject s
anterior cervical region using ultrasonic waves ( sonoace x4 , medison , korea ) .
after this
process , while the subject performed dcft in the same manner , he or she was instructed to
look straight ahead at the start and , following a verbal comment signaling the start of the
training , to look at the end of the jaw and follow the direction in which the jaw was moving
( inferior medial portion ) . during this process
regarding the location that was measured using
ultrasonic waves , the researcher perceived the thyroid cartilage by touch , which was located
in the anterior cervical region , indicated the area was 2 cm down from the cartilage using a
marker , and measured the right side of the area using a 7.5 mh linear transducer in b - mode .
after measuring
cross - sectional images , the longest among the anterior and posterior lengths was selected
for use12 .
the subjects had to maintain
the chin - in motion for 10 seconds , and they were provided with a one - minute break after each
motion to prevent muscle fatigue7 . each measurement was taken three times alternately and the average was used for statistical
analysis .
spss 19.0 was used for data processing , and the general characteristics of the
subjects were obtained by applying descriptive statistics .
paired t - tests were performed to
identify differences in the thicknesses of the longus colli and the sternocleidomastoid
depending on the application of eye coordination .
general characteristics of the subjects are shown in table 1table 1.characteristics of the subjects ( n=20)variablesvaluegender ( m / f)16/4age ( yrs)21.51.7height ( cm)174.25.5weight ( kg ) 69.77.8 .
changes in the thicknesses of the longus colli and sternocleidomastoid were compared when
eye coordination was applied and not applied during dcft . when eye coordination was applied ,
the thickness of the longus colli statistically significantly increased ( p<0.05 ) , whereas
that of the sternocleidomastoid did not show statistically significant changes after the
application of eye coordination ( table
2table 2.differences in longus colli and sternocleidomastoid thickness according to
training maneuver ( units : cm)musclemaneuvermeansdlcdcft0.500.15dcft with eye coordination0.600.14*scmdcft0.710.19dcft with eye coordination0.740.21lc : longus colli ; scm : sternocleidomastoid ; dcft : deep cervical flexor training .
*
lc : longus colli ; scm : sternocleidomastoid ; dcft : deep cervical flexor training .
this study measured the thicknesses of the deep cervical flexors during dcft and eye
coordination .
the longus colli showed a statistically significant increase in its thickness when dcft was
combined with eye coordination ; however , the sternocleidomastoid did not exhibit a
statistically significant difference according to eye coordination .
the coordination of head
and eye movements delivers information on vision and posture regarding the tecleus
reticularis gigantocellularis ( nrg ) in the subcortical region , and it delivers postural
information from the nrg to motorneurons in the cervical spinal cord . in doing so , the
coordination derives postural stability by properly controlling the level of tension in the
cervical muscles13 .
in particular ,
proprioceptors in the deep cervical flexors and eye movement muscles keep the head position
in the space , and they control postural balance through real - time sensitive responses to
postural changes . for this reason ,
the coordination of the eye and of the neck muscles is
likely to have strong correlations .
in addition , during eye tracking , in which the eye
follows the direction in which the head moves , the central mesencephalic reticular formation
( cmrf ) within the subcortical region is first activated , and then information is again
delivered from the cmrf to the brain stem s eye movement control part , the occulari system ,
and the nrg s head movement center .
therefore , the cmrf s preceding activation was reported
to play an essential role in eye - head movement coordination14 . in the present study , therefore , eye tracking during dcft
simultaneously delivered postural information to the nrg and cmrf through the vestibular and
visual systems .
this may have induced increases in the contraction of the longus colli by
intensifying eye cognition .
however , the sternocleidomastoid did not show statistically significant differences after
the application of eye coordination . by nature
, dcft selectively strengthens the deep
cervical flexors while minimizing the activation of the superficial cervical flexors .
therefore , the thickness of this muscle may not have shown differences according to eye
coordination .
bolton15 reported in his
study that complicated reflexive activities occur as the vestibular and visual systems and
the cervical spine interact to process afferent postural information for postural
control .
moreover , treleaven16 stated that
patients with neck pain have trouble in sensory - motor control , and they need head eye
movement control to resolve this problem .
given that the results of the present study also showed correlations between the eyes and
the cervical flexors , dcft combined with eye coordination is likely to be effective in
enhancing the contraction of the deep cervical flexors . | [ purpose ] the purpose of this study was to identify changes in the thicknesses of the
cervical flexors according to eye coordination during deep cervical flexor training .
[ subjects and methods ] twenty normal adults were randomly selected , and during their deep
cervical flexor training and eye tracking , the thicknesses of the longus colli and the
sternocleidomastoid were measured using ultrasonic waves .
[ results ] the thickness of the
longus colli statistically significantly increased when deep cervical flexor training and
eye coordination were performed simultaneously .
however , the thickness of the
sternocleidomastoid did not show statistically significant differences according to eye
coordination .
[ conclusion ] eye coordination during deep cervical flexor training is likely
to increase the thickness of the longus colli selectively . | INTRODUCTION
SUBJECTS AND METHODS
RESULTS
DISCUSSION |
in a resource - constrained society , economic evaluations particularly cost utility analyses ( cua ) are increasingly used as important tools to support efficient health resource allocation . for the cua to become a practical tool for systematic , transparent , and consistent policy decision making , a ceiling threshold is needed .
concerning such a threshold , health technology with an incremental cost - effectiveness ratio ( icer ) below the accepted ceiling threshold is considered to be cost - effective
sloan acknowledges an arbitrary threshold of us$50,000 per quality - adjusted life year ( qaly),1 and the commission on macroeconomics and health ( 2001 ) recommends an equally arbitrary threshold of 13 times the gdp per capita per disability - adjusted life year ( daly).2 several arguments have frequently cited these numbers.35 however , rather than relying on such an arbitrary ceiling threshold , the value of a qaly estimated in terms of a society s willingness to pay ( wtp ) per qaly should be adopted as the ceiling threshold.6 this calculation simultaneously combines the wtp and the measured utility value . estimating the wtp / qaly value involves both theoretical and methodological challenges.5,79 existing evidence reveals that the wtp / qaly is not a single value.3,7,8,10,11 it depends on several factors , including context and the type of health gain .
a great deal of evidence indicates that a qaly gained by improving the quality of life or extending a life is worth less than a qaly gained by saving a life.3,6,8,11 a qaly gained from treatment is also theoretically different from a qaly gained from prevention.12,13 in addition , wtp / qaly values vary widely depending on socioeconomic status,8,14 duration of health gained,6,8,15,16 and the elicitation method used for estimating utility12,13,1720 and wtp.6,19 in spite of these challenges , a ceiling threshold is clearly needed.7,9 in fact , determining the threshold should be a research priority .
johnson even insisted that , although an empirical study of this topic involves some methodological flaws , it is still preferable to using an arbitrary threshold value.9 thus , scholars have proposed that a disease - specific and context - specific threshold should also be considered when assessing the value of a qaly.7,10,14,17 over the past few years , many attempts have been made to estimate an appropriate wtp / qaly value for the ceiling threshold.10,12,17,19,21 however , it is worth noting that almost all of these studies were confined to industrialized nations .
this includes the recent european value of a quality - adjusted life year ( eurovaq ) study,22 which was conducted to determine the monetary value of a qaly across a number of european member states , including the netherlands , uk , france , spain , sweden , norway , denmark , poland , and hungary .
although developing countries in asia and other parts of the world have recently begun adopting reimbursement policies based on economic evaluations , only two studies exist that examine the wtp / qaly in these settings.14,23 we consequently offer the first study aimed at estimating the wtp / qaly values and examining the factors associated with the wtp / qaly values in thailand , where , since 2008 , cost - effectiveness evidence has been required for medication reimbursement.24 in this study , we examine the value of a qaly derived from the treatment of the three selected health conditions blindness , paralysis , and allergies .
it should also be noted that this is the first study to compare the wtp / qaly values obtained from prevention with those obtained from treatment interventions .
the sample size was calculated according to the following formula:25
n=[z/2v]2d , where n is the required sample size , z/2 is the ( 1 )% confidence interval statistic , v is the coefficient of variation , d is the design effect , and is the desired maximum fractional error in the mean .
when v is estimated at 2 and is set at 0.15 and d is equal to 1.5 , the required sample size is 1025 . in order to cover the incomplete interviews that might occur , the sample size was inflated to 1200 .
the samples were then allocated to each province based on the total population of each province .
all provinces were classified into five regions based on their geographic locations ( four regions and bangkok ) .
all provinces in each region were then stratified by income levels based on the average income per household obtained from the national statistical office of thailand .
the levels were high ( average monthly household income per monthly household the 50th percentile ) and low ( average monthly household income the 50th percentile ) , resulting in nine strata .
for each stratum , one province was purposely selected . in each selected province ( bangkok , ang thong , chon buri , chaing mai , phayao , khon kaen , surin , trang , and chumphon ) , members of the general thai population who met the eligibility criteria were randomly chosen with the co - operation of the national statistical office .
inclusion criteria were as follows : ( 1 ) being between 1565 years of age , ( 2 ) having a monthly household income > 5000 baht , and ( 3 ) being able to read and write thai .
exclusion criteria were as follows : ( 1 ) the presence of a disability , ( 2 ) the inability to answer a series of complex theoretical questions , and ( 3 ) the refusal to participate in the study .
the first version focused on a scenario of blindness , while the second and third versions were centered on scenarios of paralysis and allergies , respectively .
for each version , two levels of severity were specified for each health condition : the first version , unilateral and bilateral blindness ; the second version , paraplegia and quadriplegia ; and third version , mild and moderate allergies .
the three scenarios were selected for the following reasons : ( 1 ) they represent a qaly gained from a wide range of severities , ie , mild , moderate , and severe health states ; ( 2 ) the conditions can be easily imagined by most of the general population ; and ( 3 ) the level of severity associated with the conditions can be clearly differentiated . as the questionnaires were complex , to reduce the respondent s burden ,
the study was conducted in accordance with the helsinki declaration of the world medical association .
the data collection process began after the conduction of three pilot tests on 145 respondents to ensure the clarity and understanding of the questionnaires and to determine the range of wtp values .
based on the pilot testing and actual treatment costs for the hypothetical health states , two different 12-starting - price ranges for the treatment situations were used ( 5000 , 10,000 , 20,000 , 30,000 , 50,000 , 75,000 , 100,000 , 125,000 , 150,000 , 200,000 , 250,000 , and 300,000 baht for the blindness and paralysis scenarios , and 1000 , 3000 , 5000 , 7500 , 10,000 , 12,000 , 15,000 , 20,000 , 30,000 , 50,000 , 75,000 , and 100,000 baht for the allergen scenario ) .
furthermore , for all health scenarios in the prevention situations , a different 12-starting - price range was used ( 500 , 1000 , 2000 , 3000 , 5000 , 7500 , 10,000 , 15,000 , 20,000 , 30,000 , 40,000 , 50,000 baht ) . face - to - face interviews were performed between march and may 2008 . for international comparison , 16.49 baht is equal to us$1 ( us$ purchasing power parity [ ppp]).26 each respondent was asked to imagine being in the two hypothetical health states that were presented in his / her version of the questionnaire .
descriptions of each hypothetical health state were also provided to the respondents during the interview . a visual analog scale ( vas ) and time trade off ( tto ) technique
were employed to measure utilities associated with the current health state and the two hypothetical health states of each respondent . in this study , va s and tto were used to measure utility for various reasons .
tto is based on a solid theory , while va s is a short , simple , and appropriate method to use as a warm - up exercise .
second , in our pre - test , the respondents seemed to understand these two methods better than the standard gamble ( sg ) method .
lastly , although the indirect methods of multi - attribute utility measure ( maum ) , such as eq-5d , might seem appropriate , no value set for thailand s population existed during our study period . for vas , the respondents were asked to look at the 20 cm , 0100 unit thermometer scale , where 100 was labeled the best health state or perfect health , and 0 was labeled the worst health state or dead .
then , they were asked to rate their current health state and the two corresponding hypothetical health states on the scale . for tto
, subjects were offered a choice between continuing to live in their current health state for 10 years or trading years of life in exchange for becoming in perfect health .
moreover , they were offered a choice between continuing to live in the given hypothetical health state for 10 years or trading years of life in exchange for returning to their current health state . for each respondent ,
a wtp amount was determined by using a bidding - game technique . for the treatment situation ,
each respondent was asked to imagine being in the hypothetical scenario for 5 years then returning to his / her current health state without any treatment .
then he / she was told that there was a new treatment that could help him / her recover immediately and fully return to his / her current state of health .
however , the treatment was not covered by any health insurance , so he / she had to pay out of pocket for the whole cost of the treatment .
then , he / she was asked to indicate his / her wtp for treatment of the given hypothetical scenario . in the prevention situation ,
the questions were used to arrive at a wtp amount associated with the percentile elimination of the risk ( from 10% to 50% ) of being in the hypothetical health states . in this study , each respondent was required to make a one - time out - of - pocket payment within the next 6 months . each respondent was asked to think carefully before making his / her decision and to be sure that he / she could actually pay that amount of money .
if he / she paid too little , he / she might not get the treatment , as it was not financially worthwhile for the provider .
however , if he / she paid too much , it would impact his / her family s finances . to avoid a starting point bias , each respondent
the yes / no answer to the first price offered to the respondent provided the criteria for the next price offered .
if the answer was yes , the bid amount would increase to the next step until the respondent said no .
if the initial answer was no , the bid amount would decrease one step , and this process would continue until the respondent said yes .
the maximum wtp from this bidding method was determined as the midpoint between the lower acceptance bid and the higher rejection bid . however ,
if the respondents were willing to pay less than the minimum offered bid or higher than the maximum offered bid their wtp amount was determined using open - ended questions . if the respondent indicated that he / she would not pay for treatment , his / her reason for not doing so was asked .
all statistical methods were performed using spss version 13.0 for windows ( spss inc , chicago , il , usa ) and stata 8.0 ( statacorp lp , college station , tx , usa ) .
the wtp / qaly value was calculated using the following formula :
wtp / qaly = wtp amountt=15(utility of current state utility of hypothetical state)/(1+r)(t1)where the time horizon ( t ) is 15 years and the discounting rate ( r ) is 0.03.27 for each scenario , the wtp / qaly values obtained from the two levels of severity were compared using a wilcoxon signed - rank test . a kruskal - wallis test was also performed to examine the differences across the three scenarios .
a generalized linear mixed model was used to evaluate the effects of the following factors on the wtp / qaly value : gender , household income , education level , and health scenario .
these factors were chosen because they are significantly associated with wtp / qaly in bivariate analysis .
finally , since there are theoretical arguments associated with the validity of vas,28,29 the wtp / qaly values estimated from the tto method were emphasized in this study .
the sample size was calculated according to the following formula:25
n=[z/2v]2d , where n is the required sample size , z/2 is the ( 1 )% confidence interval statistic , v is the coefficient of variation , d is the design effect , and is the desired maximum fractional error in the mean .
when v is estimated at 2 and is set at 0.15 and d is equal to 1.5 , the required sample size is 1025 . in order to cover the incomplete interviews that might occur , the sample size was inflated to 1200 .
the samples were then allocated to each province based on the total population of each province .
all provinces were classified into five regions based on their geographic locations ( four regions and bangkok ) .
all provinces in each region were then stratified by income levels based on the average income per household obtained from the national statistical office of thailand .
the levels were high ( average monthly household income per monthly household the 50th percentile ) and low ( average monthly household income the 50th percentile ) , resulting in nine strata .
for each stratum , one province was purposely selected . in each selected province ( bangkok , ang thong , chon buri , chaing mai , phayao , khon kaen , surin , trang , and chumphon ) , members of the general thai population who met the eligibility criteria were randomly chosen with the co - operation of the national statistical office .
inclusion criteria were as follows : ( 1 ) being between 1565 years of age , ( 2 ) having a monthly household income > 5000 baht , and ( 3 ) being able to read and write thai .
exclusion criteria were as follows : ( 1 ) the presence of a disability , ( 2 ) the inability to answer a series of complex theoretical questions , and ( 3 ) the refusal to participate in the study .
the first version focused on a scenario of blindness , while the second and third versions were centered on scenarios of paralysis and allergies , respectively .
for each version , two levels of severity were specified for each health condition : the first version , unilateral and bilateral blindness ; the second version , paraplegia and quadriplegia ; and third version , mild and moderate allergies .
the three scenarios were selected for the following reasons : ( 1 ) they represent a qaly gained from a wide range of severities , ie , mild , moderate , and severe health states ; ( 2 ) the conditions can be easily imagined by most of the general population ; and ( 3 ) the level of severity associated with the conditions can be clearly differentiated . as the questionnaires were complex , to reduce the respondent s burden , each respondent answered only one version of the questionnaire .
the study was conducted in accordance with the helsinki declaration of the world medical association .
the data collection process began after the conduction of three pilot tests on 145 respondents to ensure the clarity and understanding of the questionnaires and to determine the range of wtp values .
based on the pilot testing and actual treatment costs for the hypothetical health states , two different 12-starting - price ranges for the treatment situations were used ( 5000 , 10,000 , 20,000 , 30,000 , 50,000 , 75,000 , 100,000 , 125,000 , 150,000 , 200,000 , 250,000 , and 300,000 baht for the blindness and paralysis scenarios , and 1000 , 3000 , 5000 , 7500 , 10,000 , 12,000 , 15,000 , 20,000 , 30,000 , 50,000 , 75,000 , and 100,000 baht for the allergen scenario ) . furthermore , for all health scenarios in the prevention situations , a different 12-starting - price range was used ( 500 , 1000 , 2000 , 3000 , 5000 , 7500 , 10,000 , 15,000 , 20,000 , 30,000 , 40,000 , 50,000 baht ) .
for international comparison , 16.49 baht is equal to us$1 ( us$ purchasing power parity [ ppp]).26
each respondent was asked to imagine being in the two hypothetical health states that were presented in his / her version of the questionnaire .
descriptions of each hypothetical health state were also provided to the respondents during the interview . a visual analog scale ( vas ) and time trade off ( tto ) technique
were employed to measure utilities associated with the current health state and the two hypothetical health states of each respondent . in this study , va s and tto were used to measure utility for various reasons .
tto is based on a solid theory , while va s is a short , simple , and appropriate method to use as a warm - up exercise .
second , in our pre - test , the respondents seemed to understand these two methods better than the standard gamble ( sg ) method .
lastly , although the indirect methods of multi - attribute utility measure ( maum ) , such as eq-5d , might seem appropriate , no value set for thailand s population existed during our study period . for vas , the respondents were asked to look at the 20 cm , 0100 unit thermometer scale , where 100 was labeled the best health state or perfect health , and 0 was labeled the worst health state or dead .
then , they were asked to rate their current health state and the two corresponding hypothetical health states on the scale . for tto
, subjects were offered a choice between continuing to live in their current health state for 10 years or trading years of life in exchange for becoming in perfect health .
moreover , they were offered a choice between continuing to live in the given hypothetical health state for 10 years or trading years of life in exchange for returning to their current health state .
for each respondent , a wtp amount was determined by using a bidding - game technique . for the treatment situation ,
each respondent was asked to imagine being in the hypothetical scenario for 5 years then returning to his / her current health state without any treatment .
then he / she was told that there was a new treatment that could help him / her recover immediately and fully return to his / her current state of health .
however , the treatment was not covered by any health insurance , so he / she had to pay out of pocket for the whole cost of the treatment .
then , he / she was asked to indicate his / her wtp for treatment of the given hypothetical scenario . in the prevention situation ,
the questions were used to arrive at a wtp amount associated with the percentile elimination of the risk ( from 10% to 50% ) of being in the hypothetical health states . in this study , each respondent was required to make a one - time out - of - pocket payment within the next 6 months . each respondent was asked to think carefully before making his / her decision and to be sure that he / she could actually pay that amount of money .
if he / she paid too little , he / she might not get the treatment , as it was not financially worthwhile for the provider . however , if he / she paid too much , it would impact his / her family s finances . to avoid a starting point bias , each respondent
the yes / no answer to the first price offered to the respondent provided the criteria for the next price offered .
if the answer was yes , the bid amount would increase to the next step until the respondent said no .
if the initial answer was no , the bid amount would decrease one step , and this process would continue until the respondent said yes .
the maximum wtp from this bidding method was determined as the midpoint between the lower acceptance bid and the higher rejection bid . however ,
if the respondents were willing to pay less than the minimum offered bid or higher than the maximum offered bid their wtp amount was determined using open - ended questions . if the respondent indicated that he / she would not pay for treatment , his / her reason for not doing so was asked .
all statistical methods were performed using spss version 13.0 for windows ( spss inc , chicago , il , usa ) and stata 8.0 ( statacorp lp , college station , tx , usa ) .
the wtp / qaly value was calculated using the following formula :
wtp / qaly = wtp amountt=15(utility of current state utility of hypothetical state)/(1+r)(t1)where the time horizon ( t ) is 15 years and the discounting rate ( r ) is 0.03.27 for each scenario , the wtp / qaly values obtained from the two levels of severity were compared using a wilcoxon signed - rank test . a kruskal - wallis test was also performed to examine the differences across the three scenarios .
a generalized linear mixed model was used to evaluate the effects of the following factors on the wtp / qaly value : gender , household income , education level , and health scenario .
these factors were chosen because they are significantly associated with wtp / qaly in bivariate analysis .
finally , since there are theoretical arguments associated with the validity of vas,28,29 the wtp / qaly values estimated from the tto method were emphasized in this study .
were randomly selected for the blindness scenario , while 399 and 393 were randomly selected for the paralysis and allergen scenarios , respectively . except for gender
, there was no significant difference in the respondents characteristics across the three health scenarios .
table 2 displays the number of discounted qalys gained for each health condition scenario . by using the tto method ,
the mean discounted qaly gained ranged from 0.96 ( for the mild allergen scenario ) to 4.07 ( for the quadriplegia scenario ) .
similarly , the mean qaly gained using the vas method ranged from 1.08 ( for the mild allergen scenario ) to 3.00 ( for the quadriplegia scenario ) . for each scenario ,
the number of discounted qalys gained from more severe health states was higher than the number gained from mild and moderate health states .
the wtp values for treatment ( wtptreatment ) were significantly higher than those for prevention ( wtpprevention ) .
in general , the wtp value was highest in the paralysis scenario , followed sequentially by blindness and allergies .
the mean wtptreatment ranged from 31,000 baht for mild allergies to 165,600 baht for quadriplegia .
for each scenario , the mean wtptreatment for the severe health states was higher than that for the mild and moderate health states .
the mean wtpprevention ranged from 12,000 baht for mild allergies to 31,000 baht for bilateral blindness .
furthermore , the percentage of unwillingness to pay ranged from 0.8% to 2.3% in the treatment situation , while it ranged from 1.5% to 5.6% in the prevention situation . table 4 displays the wtp / qaly values estimated from different health state scenarios and utility elicitation methods .
the estimates of wtp / qaly varied considerably , depending on the health state scenario .
for the tto , the wtp / qalytreatment derived from the blindness scenario was the highest , followed sequentially by paralysis and allergies .
the mean wtp / qalytreatment values estimated from tto ranged from 59,000 baht ( quadriplegia ) to 285,000 baht ( unilateral blindness ) . the same pattern occurred with wtp / qalyprevention , but the mean wtp / qalyprevention values were significantly lower than those of the wtp / qalytreatment ( except for the allergen scenario ) , ranging from 26,000 baht ( quadriplegia ) to 137,000 baht ( unilateral blindness ) .
table 5 shows the variables significantly related to wtp / qaly values in the multivariate model . for the treatment situation ,
ln wtp / qaly was associated with gender , household income , education level , and health scenarios .
in that situation , the mean wtp / qaly was significantly higher for male respondents , for those with a higher income , for those with a higher education level , and for the blindness scenario .
for the treatment situation , the mean wtp / qaly value ranged from approximately 59,000 to 285,000 baht ( 357817,283 us$ ppp ) . with a gdp per capita ( in 2008 ) of approximately 138,000 baht , our values ranged between 0.42 times the gdp per capita , which albeit slightly lower is still in line with the range of 13 times the gdp per capita that the commission on macroeconomics and health recommends .
when comparing our estimate in terms of the gdp per capita with those of previous studies , our results are generally consistent with the other studies.10,12,14,19,21 in addition , the findings from this study are consistent with the past allocation decisions of the national list of essential medicines ( nlem ) committee in thailand , which set a ceiling threshold of 1 gdp per capita / qaly.24 similar to a previous study,10 we found that male respondents with a high income and high level of education typically offered high wtp / qaly values . in line with prior knowledge , we also found that the value of a qaly varied depending on the specific health condition under consideration.7,30,31 in our study , the wtp / qaly values were significantly higher in the blindness scenario than in the allergen and paralysis scenarios .
this may be due to the fact that respondents had different perceptions and attitudes toward each health condition scenario .
our findings clearly confirmed that qaly values are context - specific and may not be comparable across health conditions.30 freemantle notes , for example , that the qalys gained from the treatment of erectile dysfunction were not comparable to the qalys gained from the prevention of potentially fatal infections in infants.31 in fact , the source and nature of health conditions ( such as self - inflicted conditions vs those that are unavoidably imposed upon the individual ) can influence a qaly value.7 nevertheless , it is arguable that the use of a condition s specific threshold would discriminate against marginalized or stigmatized conditions . at present
, we know little about the impact of incorporating conditional health preferences on societal decisions and how to implement their incorporation.7 this issue clearly deserves more attention , and future research is essential .
we found that , in blindness and paralysis scenarios , wtp / qaly values obtained from the more severe health states were lower than those obtained from the less severe states ( ie , bilateral blindness < unilateral blindness ; quadriplegia < paraplegia ) .
the ceiling effect can explain these findings , as described in a previous study.8 the ceiling effect occurs when respondents are faced with a large qaly gain ; however , because of the respondents limited budget , the wtp amount increased less than proportionately with respect to the increase in qalys . in determining the wtp values in this study , the method of payment offered to the respondents was a lump sum payable within 6 months , which may also have contributed to this limitation .
one unique aspect of our study was our ability to compare the wtp / qaly estimates from both prevention and treatment situations . according to our findings
however , in line with a previous study,32 we revealed that the wtp amount for prevention is less than the wtp amount for treatment . as a result , wtp / qalyprevention values were lower than wtp / qalytreatment values
. the fact that prevention and treatment situations involve different contexts ( in which people have varying reference points and expectations ) can explain this result . according to kahneman and tversky s prospect theory,33 the preference of an individual is related to a reference point . for patients , the preference point for his
/ her health is a key factor in determining the preference of his / her treatment option .
a recent study clearly found that a patient may become a risk seeker as his / her health declines.34 in the treatment scenario of our study , the qaly value was measured in terms of gaining health value while being in a declined health state .
however , for prevention , we measured the qaly value in terms of avoiding the loss of health value while still being in a good health state .
consequently , it should be noted that the range of wtp offered for prevention was lower than the range of wtp offered for treatment .
given a situation in which societal values for wtp / qalyprevention are lower than wtp / qalytreatment , it is necessary that policy makers and other stakeholders pay closer attention to knowledge provisions and the employment of an effective strategy for increasing prevention awareness among the population .
our findings support the opinion that one universal ceiling threshold should not be applied for the resource allocation of all types of intervention.7,10,14,21 as in previous studies,10,12,14,19,21 the questionnaires used in this study were rather complex , involving hypothetical decision - making scenarios . as a result
, we were concerned about the respondents comprehension of the scenarios , which would affect the validity of their responses . nevertheless , based on our preliminary testing
, this did not become a major problem in our study . during the development of the questionnaire for each hypothetical health scenario , we included two levels of severity to permit a preliminary test of each respondent s comprehension .
furthermore , according to our findings , the responses from the utility measure and the wtp measure were consistent with prior expectations . for each scenario ,
the utility associated with the more severe health states was lower than that of the less severe health states .
similarly , the wtp associated with the treatment / prevention of the more severe health states was higher than that of the less severe health states . while societal wtp / qalys are needed to make informed resource allocation decisions , it should be noted that the methods used in this and other studies12,14,17,19,21 to derive the monetary value of a qaly often seek to measure an individual s perspective .
however , smith ( 2005 ) indicates that an individual s wtp may not be relevant for the societal decisions.35 it is likely that an individual s personal wtp , which reflects the benefits that he / she receives from the goods / services paid for , is different from his / her social wtp , which reflects how much an individual is willing to pay for others in a group that possibly includes him / herself.35 future research focused on measuring the societal wtp / qaly is definitely needed . by asking
how much an individual is willing to pay through taxation for the addition of a service to the national health insurance scheme might be another way to measure societal wtp value.35 however , this alternative method seems to be inappropriate in thailand , where only 2.3 million people from the total population of 67 million actually paid tax in 2009 . alternatively , using the person trade - off method,36 which requires respondents to take a societal rather than an individual perspective , may also be appropriate to measure societal wtp / qaly values in future studies .
finally , it should be noted that there are other identifiable limitations in this study .
for one , the standard deviation around the wtp values and wtp / qaly values were considerable , indicating a large variation in preferences .
furthermore , the sample in our study only reflected the population from the nine selected provinces .
future studies could employ a more rigorous method of random sampling from the general population .
in addition , the applicability of our results to other types of health conditions should be made with caution .
the wtp / qaly values derived from this study were based on only three specific conditions .
as health technology assessments are widely used to inform coverage decision making in thailand , an empirical study examining the value of the qaly is essential for policy decision makers .
, we believe that our empirical study also adds another missing component to studies determining the value of a qaly , especially in prevention situations . according to our findings ,
the value of a qaly varies widely , depending on the context of health gain .
thus , there should be more than one ceiling threshold for all situations.7,8,10,14 the value of other types of qalys , especially in situations of life extension during terminal illness , deserves further investigation . | backgroundthis study aims to elicit the value of the willingness to pay ( wtp ) for a quality - adjusted life year ( qaly ) and to examine the factors associated with the wtp for a qaly ( wtp / qaly ) value under the thai health care setting.methodsa community - based survey was conducted among 1191 randomly selected respondents .
each respondent was interviewed face - to - face to elicit his / her health state preference in each of three pairs of health conditions : ( 1 ) unilateral and bilateral blindness , ( 2 ) paraplegia and quadriplegia , and ( 3 ) mild and moderate allergies .
a visual analog scale ( vas ) and time trade off ( tto ) were used as the eliciting methods .
subsequently , the respondents were asked about their wtp for the treatment and prevention of each pair of health conditions by using a bidding - game technique.resultswith regards to treatment , the mean wtp for a qaly value ( wtp / qalytreatment ) estimated by the tto method ranged from 59,000 to 285,000 baht ( 16.49 baht = us$1 purchasing power parity [ ppp ] ) .
in contrast , the mean wtp for a qaly value in terms of prevention ( wtp / qalyprevention ) was significantly lower , ranging from 26,000 to 137,000 baht .
gender , household income , and hypothetical scenarios were also significant factors associated with the wtp / qaly values.conclusionthe wtp / qaly values elicited in this study were approximately 0.4 to 2 times thailand s 2008 gdp per capita .
these values were in line with previous studies conducted in several different settings .
this study s findings clearly support the opinion that a single ceiling threshold should not be used for the resource allocation of all types of interventions . | Introduction
Materials and methods
Samples
Study instrument
Utility measure
WTP measure
Data analysis
Results
Discussion
Conclusion |
fatigue is the most common side effect of chemotherapy in children with acute lymphoblastic leukemia ( all ) .
acupressure is one of the most popular non - pharmacologic methods used to reduce fatigue in other settings .
the aim of the study was to evaluate the effect of acupressure on reducing fatigue among children with all compared with a placebo treatment .
in a single - blind , randomized , placebo - controlled clinical trial of 120 hospitalized school - aged children with all , 24 h after chemotherapy , they were randomly divided into experimental ( n = 60 ) and placebo groups ( n = 60 ) .
the intervention ( finger acupressure ) was applied on st36 ( true points ) in the experimental group and on li12 ( sham points ) in the placebo group .
fatigue was also measured 24 h after intervention by fatigue scale - child ( fs - c ) .
data were analyzed by spss version 16.0 using descriptive statistics , independent t - test , and chi - square and fisher exact tests .
significant differences were observed between the two groups in the intensity of fatigue 1 h after intervention ( p < 0.001 ) .
applying one time acupressure may reduce the intensity of fatigue at 1 h post - treatment .
therefore , acupressure could be recommended as an effective , non - pharmacologic method for some crf control .
acute lymphoblastic leukemia ( all ) is one of the most common cancers in children and adolescents and accounts for 7580% of childhood leukemia . according to a research done in 2011 ,
there were 1.9 billion children forming 27% of the world population , and about 2050 million children and adolescents are diagnosed with leukemia every year . with the improvement in cancer treatment ,
however , this has increased the number and severity of side effects and unpleasant symptoms , for instance , fatigue , pain , mucositis , nutritional concerns , nausea , and vomiting .
fatigue is a pervasive , distressing , and weakening symptom that has an extreme negative impact on daily activity , involvement in social activities , maintenance of interpersonal relationships , quality of life , and personal well - being . unlike other cancer symptoms that may disappear when the treatment is completed
, fatigue has a persistent and lasting effect on children and adolescents undergoing cancer treatment .
pediatric patients with all who require chemotherapy often report the symptom of fatigue as one of the most prevalent illness - related effects that they experience during treatment .
fatigue is a side effect of chemotherapy and is experienced by the affected children , so it has to be managed by pharmacologic and non - pharmacologic approaches . in studies on adults ,
fatigue has been reported as a multidimensional symptom including physical , psychological , and emotional aspects . in two longitudinal studies in which pediatric oncology patients rated 10 treatment - related symptoms for symptom distress , fatigue was rated as the most distressing and a common clinical problem during cancer treatment .
fatigue is reported to be more upsetting and troublesome for performing daily activities than , for example , cancer - related pain .
various complementary and alternative therapies are often used to manage the side effects and symptoms from cancer treatments , including fatigue .
some preliminary evidence indicates that acupressure ( the non - invasive form of acupuncture ) was helpful in relieving fatigue in chronic obstructive pulmonary disease ( copd ) patients attending a pulmonary rehabilitation program .
moreover , acupressure and transcutaneous electrical acupoint stimulation were found effective in relieving fatigue , sleep problems , and depression in a sample of 106 patients undergoing hemodialysis .
however , a strong placebo effect was noted in the study , as the sham acupressure group also improved significantly .
recently , a phase ii uncontrolled trial ( n = 37 ) of acupuncture treatment in cancer patients at least 3 weeks after chemotherapy found that acupuncture improved fatigue by 31.1% . in another study , one cohort received twice - weekly acupuncture treatment for 4 weeks ( n = 25 ) and another cohort received treatment once a week for 6 weeks ( n = 12 ) , but the difference in the two schedules of treatment was minimal .
however , the non - invasive form of acupuncture , acupressure , has received little attention in oncology , although it has been in use in some places for more than 2000 years .
acupressure involves using pressure instead of needles applied to the same points , but is safer , less expensive , and patients can easily learn to apply pressure on their own .
acupressure is a technique derived from acupuncture , a component of traditional chinese medicine ( tcm ) .
acupressure involves pressure with fingers or bands on the body 's acupoints and is simple to perform , painless , inexpensive , and effective .
the practice of acupressure is derived from a philosophy of balance and unity between the universe , living beings , and energy flow .
chernyak and sessler reported that any imbalance , disruption , or energy flow blockage within the body can cause disease or pain .
the aim of acupoint stimulation is to return the body to a harmonized , balanced condition . during acupressure ,
physical force is applied to acupuncture points by hand , elbow , or with various devices , in an attempt to treat disease and reduce symptoms .
acupressure has demonstrated optimistic effects on sleep quality , sleep quantity , and depression in cancer patients and other chronically ill populations .
pilot clinical trials have also demonstrated that acupressure and acupuncture can significantly reduce persistent cancer fatigue by as much as 38% . the joksamly or st36 located at 4-finger breadths below the knee depression lateral to the tibia [ figure 1 ] .
although in many western countries cancer - related fatigue in both adults and children has received attention as an important issue and has been studied widely , unfortunately , it has not received enough attention in comparison with pain , nausea , and vomiting management by healthcare professionals and researchers in iran .
no studies could be identified on whether cancer - related fatigue is a common tolerable or distressing symptom among iranian pediatric oncology patients nor have the coping mechanisms for dealing with the unique fatigue syndrome among these children been methodically studied .
patients with cancer and their families may not report fatigue to clinicians because they might think fatigue or being tired is a predictable cancer - related symptom , and that they must tolerate and deal with fatigue and reduce their expectations for symptom relief . consequently , cancer - related fatigue is persistently ignored , under - diagnosed , and not treated in iran .
the aim of the study was to examine the effectiveness of acupressure in the relief of cancer related fatigue ( crf ) in pediatric cancer patients after they undergo chemotherapy .
therefore , this study was carried out to investigate the effect of acupressure on crf in school - aged children being treated for all .
this is a single - blind , randomized controlled clinical trial , wherein 120 children with all between the ages of 8 and 12 were recruited , and they were randomly divided into experimental and placebo groups . after completing a demographic form , baseline intensity of fatigue was measured using the visual analog scale ( vas ) before the intervention .
ethical considerations , such as informed consent and confidentiality , were adequately addressed , and approval of a research and ethics committee was obtained . also , providing the research results for both experimental and placebo groups was considered and the researcher 's email address was available for both groups to be informed of the results . on the second day of chemotherapy , the intervention ( finger acupressure ) was applied for 3 min on st36 ( true points ) in the experimental group and on li12 ( sham points ) in the placebo group . given that in the present study patients with leukemia undergoing chemotherapy were selected , who also suffered from cancer - related fatigue , applying acupressure on various acupoints could be frustrating for the patients . regarding ethical considerations in this research and according to the results of a previous study that was performed to relieve cancer - related fatigue ,
li12 is not associated with energy in the tcm and was also used as the sham point in a previous study .
in addition , applying acupressure on one point is easy to learn for patients and their family members .
thus , patients and their family members can do this intervention at home to get relieved of cancer - related fatigue .
fatigue was again measured 24 h after the intervention by the instrument of fatigue scale - child ( fs - c ) .
inclusion criteria were all diagnosis , willing to participate in the study and to be randomized in one of the two groups , age 812 years , no prior experience of chemotherapy , no prior experience of acupressure , and anticipated survival more than 3 months .
patients were excluded if they had low platelet count ( < 50,000 ) , suffered from a bleeding disorder ( e.g. hemophilia ) , had hemoglobin levels less than 9 g / dl and hematocrit less than 30 , or were on active treatment for anemia ( i.e. , erythropoietin ( epo ) or blood transfusions ) .
patients were matched by age and sex and then randomized to the experimental and placebo groups .
the vas uses a 100-mm device ( 010 ) with the extreme left side indicating zero fatigue and the extreme right side indicating maximal fatigue ( worst imaginable fatigue ) .
the patient indicates fatigue intensity by moving a pointer on the device , yielding a score measured by the pointer location .
the fs - c is a 10-item , self - report instrument that measures cancer - related fatigue and provides a fatigue intensity score .
each item has a 5-point likert - type format ; total scale intensity ratings range from 0 ( no fatigue symptoms ) to 50 ( highest possible fatigue score ) .
the 10-item version of the fs - c achieved a cronbach alpha of 0.76 , whereas the standard fs - c achieved a cronbach alpha of 0.81 .
the 10-item fs - c consists of items that discriminate between children who have high cancer - related fatigue and those who do not . on the second day of chemotherapy
, patients in the experimental group received 3 min finger acupressure on point st36 , a point traditionally used for energy , located below the knee in the anterior border of tibia .
the control group instead received pressure on a point not associated with energy in tcm , i.e. li12 located on the lateral side of the upper arm , with the elbow flexed , on the tile border of humerus [ figure 2 ] .
patients in both acupressure groups were told that the effects of two sets of points were tested , but they were not aware that one set was a sham technique .
the study was reviewed and approved by the research and ethics committee of tehran university of medical sciences and health services ( code : 1744263 ) .
participants and their parents were given verbal and written information about the aim and procedure of the study , the right to withdraw at any time , and the promise to maintain confidentiality by the researchers .
they also promised to keep the confidentiality for other participants . verbal assent from children and adolescents
was required for study participation , while the consent forms were signed by their parents . at the end of the study and for ethical reasons ,
all patients in the sham acupressure group were contacted , presented with the findings of the study , and taught how to locate and press the more effective points .
chi - square and fisher exact tests were also used to test any differences in demographic data between the two groups .
repeated measures analysis of variance ( r - anova ) was used to identify any differences in fatigue intensity between the three different time periods ( before , immediately , and 1 h after intervention ) .
ninety - five percent confidence intervals were obtained from t - tests between the two groups .
no differences between the two groups were found in any of the demographic or other baseline variables .
mean age of the children in both experimental and placebo groups was 9.98 1.55 years .
the mean and standard deviation of the ages of both groups was identical . to ensure homogeneity between the groups , subjects in the experimental and placebo groups
the children 's companion in the hospital was their mother in 63.3% of the experimental group and 65% of the placebo group ; there was no significant difference between the two groups in this regard ( p = 0.27 ) .
parents education and job was not significantly different between the two groups ( p < 0.05 ) .
fatigue intensity before intervention was measured in both groups ( 3.73 2.26 in the experimental group and 4.25 2.44 in the placebo group ) ; the results showed that they were not significantly different ( p = 0.23 ) .
fatigue intensity of the two groups was compared immediately after intervention , but indicated no significant difference between them ( p = 0.07 ) [ table 1 ] .
most subjects in both groups experienced mild fatigue ( score 13 ) ; so , it would be expected that applying one time acupressure would not reduce fatigue intensity immediately after intervention .
there was also significant difference regarding fatigue between the two groups 1 h after intervention ( p 0.001 ) [ table 2 ] , but not after 24 h ( p = 0.82 ) [ table 3 ] .
fatigue intensity before intervention was measured in both groups ; the results showed that they were not significantly different ( p = 0.23 ) [ table 4 ] . regarding fatigue intensity
, there was significant difference between before and immediately after intervention and also between before and 1 h after intervention in the experimental group ( p < 0.001 ) . in the placebo group ,
there were significant differences of fatigue intensity between before and immediately after intervention and also between immediately and 1 h after intervention ( p < 0.001 ) .
finally , no significant differences were found between the two groups regarding the variables of fatigue 24 h post - intervention .
so , in the present study , applying one time acupressure through one point was not found to be effective after 24 h. comparison of fatigue intensity in all children of the two groups immediately after intervention comparison of fatigue intensity in all children of the two groups 1 h after intervention comparison of fatigue in all children of the two groups 24 h after intervention the compression of fatigue intensity in all children before intervention in tow groups
acupressure caused greater reduction in fatigue when compared to the placebo group . regarding the severity of fatigue in subjects 1 h after intervention [ table 3 ] , the independent t - test indicated that it was significantly different between the experimental and placebo groups ( p 0.0001 ) .
therefore , it may be inferred that applying pressure on the right points at the right time can determine the efficacy of acupressure .
stimulation of st36 may improve the flow of chi or increase the release of neurotransmitters and neurohormone , and thus reduces the perception of fatigue .
acupressure has a positive effect of sleep quality , sleep quantity , and depression in cancer patients and those with other chronic diseases .
studies show that acupressure and acupuncture reduce up to 38% of cancer - related fatigue .
they can be easily taught to patients so that they themselves can manage fatigue and reduce the adverse health outcome to improve their quality of life .
the case group had 19% improvement in fatigue while the control group had 0.6% improvement .
the present study used point st36 to apply acupressure , similar to that in the study of molassiotis . on comparing the severity of fatigue in subjects before , immediately after , and
1 h after acupressure , paired t - tests showed significant differences in the experimental group before and immediately after , and before and 1 h after intervention ( p < 0.001 ) .
the mean severity of fatigue in the experimental group before intervention was 3.73 , but dropped to 2.95 and 2.61 immediately after and 1 h after intervention , respectively .
this reduction in severity of fatigue before and immediately after the intervention , and before and 1 h after intervention was significantly different in the experimental group ( p 0.001 ) [ table 5 ] .
fatigue intensity over time in acupuncture group however , as can be seen in table 6 , 1 h after intervention , mean severity of fatigue increased in the placebo group , which shows that the placebo effect did not work and patients perception of fatigue increased .
the results show that children 's severity of fatigue was 4.25 before intervention , but decreased to 3.68 immediately after intervention and increased to 4.06 at 1 h after intervention .
a repeated measure anova for the placebo group shows that there was significant difference between before and immediately after intervention and also between immediately after and 1 h after intervention ( p 0.001 ) ; although there was some improvement in the sham acupressure group , the improvement was greater in the acupressure group .
apparently , patients are aware that they are receiving treatment on acupoints or non - acupoint and are more likely to experience positive outcomes because of their expectations .
fatigue intensity over time in sham acupuncture group subjects in the sham acupressure group and acupressure group showed improvement in the vas fatigue score immediately after intervention . massaging the acupoint or non - acupoint itself may produce various levels of relaxation on the body and , thus , produce different effects on fatigue .
no evidence has been published regarding the effect of acupressure on fatigue caused due to treatment of cancer patients at time intervals before , immediately after , and 1 h after intervention , to be compared with our findings .
however , tsay evaluated the efficacy of acupressure on fatigue among end - stage renal disease patients in which 3-min treatments , real and sham acupressure , were applied to the case and control groups , and they found that fatigue significantly improved in those receiving the real treatment . considering these results , we can infer that the effect of acupressure in reducing fatigue immediately after intervention can be attributed to the placebo effect in this group .
( 2005 ) reported that anxiety before surgery reduced significantly immediately after applying acupressure on a sham point in the placebo group ( p < 0.001 ) .
they mentioned the effect of massaging , and that the feeling of patients that some special intervention is being used to their benefit is the reason for this effect .
second , subjects expectation about the efficacy of intervention may be affected simply by the presence of the researcher as a member of therapy team ( hawthorn effect ) .
on comparing the severity of fatigue in subjects 24 h post - intervention , most subjects in both the experimental group ( 68.3% ) and the placebo group ( 73.3% ) had fatigue scores of 1023 , making it difficult to evaluate the residual effects after 24 h. to determine whether acupressure at shorter intervals and more frequently would reduce fatigue , more extensive study needs to be performed .
although vickers et al . reported the efficiency of acupuncture on chemotherapy - related fatigue , the study design and treatment type ( acupuncture vs. acupressure ) may explain the differences in results . | background : fatigue is the most common side effect of chemotherapy in children with acute lymphoblastic leukemia ( all ) .
acupressure is one of the most popular non - pharmacologic methods used to reduce fatigue in other settings .
the aim of the study was to evaluate the effect of acupressure on reducing fatigue among children with all compared with a placebo treatment.materials and methods : in a single - blind , randomized , placebo - controlled clinical trial of 120 hospitalized school - aged children with all , 24 h after chemotherapy , they were randomly divided into experimental ( n = 60 ) and placebo groups ( n = 60 ) .
intensity of fatigue was rated using the visual analog scale .
the intervention ( finger acupressure ) was applied on st36 ( true points ) in the experimental group and on li12 ( sham points ) in the placebo group .
we evaluated the symptoms of fatigue intensity immediately and 1 h after intervention .
fatigue was also measured 24 h after intervention by fatigue scale - child ( fs - c ) .
data were analyzed by spss version 16.0 using descriptive statistics , independent t - test , and chi - square and fisher exact tests.results:significant differences were observed between the two groups in the intensity of fatigue 1 h after intervention ( p < 0.001 ) .
but there was no significant difference between them regarding fatigue 24 h after intervention.conclusions:applying one time acupressure may reduce the intensity of fatigue at 1 h post - treatment .
therefore , acupressure could be recommended as an effective , non - pharmacologic method for some crf control .
applying one time acupressure did not have a long - term effect . | Background:
Materials and Methods:
Results:
Conclusions:
I
M
R
D |
intoxication due to carbon monoxide ( co ) is one of the most common types of poisoning , and one of the most important toxicological global causes of morbidity and mortality ( 1 ) .
a weak association between carboxyhemoglobin ( cohb ) level and patients clinical picture is documented ( 2 ) .
co binds rapidly to hemoglobin with greater affinity than oxygen ( o2 ) and forms cohb , which leads to a decrease in the o2 carrying capacity of the blood resulting in tissue hypoxia .
therefore , organs with high oxygen demand , such as heart , brain and lungs are most sensitive to hypoxia ( 3 - 6 ) .
cardiac effects of cohb range from simple arrhythmias to myocardial infarction ( 7 - 9 ) . cardiac troponins ( ctn )
the release of ctn into the circulation occurs as a consequence of cardiomyocyte injury ( 10 ) .
highly sensitive - ctn ( hs - ctnt ) assays are developed recently , enabling measurements of concentrations that are 100-fold lower than those of the ones previously measurable ( 11 ) .
the current study aimed to assess whether or not myocardial damage occurs in patients with co poisoning . the study investigated the relationship between blood carboxyhemoglobin and hs - ctnt level with a highly sensitive assay in patients with acute co poisoning .
the current retrospective study was conducted at the sevket yilmaz training and research hospital that is a state tertiary hospital with 1050 beds , located in the eastern bursa , turkey .
the study used the data available in the hospital clinical data warehouse , a centralized data repository integrating information in several databases including the order entry database and the laboratory results database of the hospital .
patients diagnosed with co poisoning were included in the study and their corresponding electronic charts were reviewed for data collection .
prescription data were linked to detailed clinical information including patient demographics , diagnosis , clinical characteristics ( including past medical history , smoking status ) , co source ( charcoal or fire ) , vital signs at presentation , physical examination characteristics , cohb levels , treatment therapy , complications in erectile dysfunction ( ed ) , and laboratory data ; the latter included specimen collection date , time , and location ( for example : intensive care unit ) . two - hundred - seventeen cases admitted to the emergency medicine unit of the hospital in 2012 , ( january 2012 - january 2013 ) with the diagnosis of acute co intoxication
seventy - six patients whose additional diagnoses indicated chronic ischaemic heart disease , heart failure , myocarditis , muscular dystrophy , polymyositis , implanted cardiac resynchronization device , chronic inflammatory disease , and chronic renal failure were excluded .
the overall study population included 141 subjects ( 87 females ( 62% ) and 54 males ( 38% ) ; 70% of the poisonings occurred in the winter , 24% in spring and 6% in autumn .
the study was approved by the sevket yilmaz research and education hospital ethics committee ( no .
2013/7 - 4 ) and was in compliance with the helsinki declaration ; informed consent was not assumed necessary because of the retrospective observational nature of the study and all steps were taken to ensure the anonymity of the data .
blood samples were first collected ( on admission ) in the emergency department and four hours later in the intensive care unit ( icu ) .
routine laboratory data ( cohb , creatine kinase - myocardial band ( ck - mb ) and high - sensitivity cardiac troponin t ( hs - tnt ) were recorded .
cohb levels were measured by a blood gas analyzer ( omni s , roche diagnostics penzberg , germany ) supported by a co - oximetry panel .
hs - ctnt and ck - mb levels were determined by an elecsys 2010 autoanalyzer ( roche diagnostics , penzberg , germany ) using commercial assays . according to the manufacturer of the hs - ctnt stat assay ,
ng / l , and the 99th percentile in healthy volunteers was 14 ng / l . for quality assurance purposes ,
the laboratory participates in an external quality assessment scheme run by labquality , helsinki , finland . at the time of the present study , the qc program reported average values
as part of the treatment , all the patients inhaled high flow normobaric oxygen and were monitored and followed up in icu .
treatment continued until clinical findings stabilized and serum cohb levels decreased to target levels of 5% .
the patients intoxicated with co were divided into three groups depending on cohb levels : group i , mild cohb level < 15% ; group ii , cohb levels < 25% and > 15% ; group iii , severe acute co intoxication cohb levels > 25%
. samples with hs - ctnt below the limit of blank ( i e , 3 ng / l ) were assigned a value of 1 ng / l .
the comparisons between the medians of three groups were performed by the kruskal - wallis test and the post - hoc dunnett tests were used to examine the significance levels between groups .
spearman rank analysis was used to assess associations between cohb , ck - mb and hs - tnt levels
( spss , chicago , il ) and p values of < 0.05 were considered significant .
the patients intoxicated with co were divided into three groups depending on cohb levels : group i , mild cohb level < 15% ; group ii , cohb levels < 25% and > 15% ; group iii , severe acute co intoxication cohb levels > 25%
. samples with hs - ctnt below the limit of blank ( i e , 3 ng / l ) were assigned a value of 1 ng / l .
the comparisons between the medians of three groups were performed by the kruskal - wallis test and the post - hoc dunnett tests were used to examine the significance levels between groups .
spearman rank analysis was used to assess associations between cohb , ck - mb and hs - tnt levels .
( spss , chicago , il ) and p values of < 0.05 were considered significant .
one - hundred - forty of the patients were poisoned at home and only one of the patients was poisoned at work and they used coal or wood for heating .
the predominating symptoms were nausea ( n = 89 ) , headache ( n = 86 ) , dizziness ( n = 47 ) and vomiting ( n = 28 ) .
cohb levels ranged from 8 to 35 ( median 23 , mean 22.0 6.6% ) on admission .
the patients intoxicated with co were divided into three groups depending on their cohb levels : group i , mild cohb level < 15% ( n = 29 ) ; group ii , cohb between 15% and 25% ( n = 67 ) ; group iii , severe acute co intoxication cohb levels > 25% ( n = 45 ) ( table 1 ) ( 12 ) .
abbreviations : ck - mb , creatine kinase - myocardial band ; cohb , carboxyhemoglobin ; hs - tnt , high - sensitivity cardiac troponin t. values are expressed as median ( interquartile range ) or mean sd .
median hs - ctnt increased with increasing cohb level ( kruskal - wallis p = 0.05 ; table 1 ) .
when the post - hoc dunnett test was performed , hs - ctnt levels were not statistically different between the groups .
ck - mb levels did not differ between the three groups ( kruskal - wallis ; p = 0.48 ) .
cohb levels with hs - tnt values were weakly correlated ( r = 0.173 , p = 0.041 ) ; on the other hand , ck - mb levels were not correlated with those of the cohb ( r = 0.013 , p = 0.883 ) ( table 2 ) . abbreviations :
ck - mb , creatine kinase - myocardial band ; hs - tnt , high - sensitivity cardiac troponin t. on admission , 5 of the 141 patients had elevated serum ck - mb levels and 20 had elevated serum hstnt levels ( > 14 ng / l ) , only three of the patients with cardiac markers were elevated on the follow - up period .
the findings of the cohort current study of patients with cohb intoxication hs - ctnt levels were slightly higher in severe toxicated patients than in mild toxicated patients without significant correlation between cohb and hs - ctnt levels .
cardiac troponins are components of the contractile apparatus of cardiomyocytes and are released during myocardial necrosis .
serum troponin elevation is a specific and well established myocardial necrosis biomarker , and can detect extremely small amounts of myocardial necrosis ( < 1.0 g ) ( 12 , 13 ) . very low , but
detectable amounts of hs - ctnt levels may reflect a normal biological process of myocyte turnover and it may also be associated with an increased cell turnover ( 14 , 15 ) .
the proposed mechanisms of cardiac troponin release include apoptosis , cellular release of proteolytic degradation products , increased cell wall permeability , and formation and release of membranous blebs ( 11 ) .
many acute diseases are associated with elevated ctn in the absence of acute ischemic heart disease that can occur for many reasons ( 16 ) .
direct toxic effects of circulating cytokines and chemotherapies can cause severe myocardial toxicity as severe sepsis and septic shock ( 12 , 16 ) .
recent data showed that one can detect the effects of some toxic chemotherapy by monitoring ctn ( 16 ) .
low levels of co activate soluble guanylate cyclase which in turn exerts beneficial effects such as vasodilatation and inhibition of platelet aggregation ( 7 ) . in the current study ,
hs - ctnt levels were higher in patients with severe co toxicity compared to the ones with mild co intoxication .
although ultramicroscopic changes are reported in cases of co toxicity , its relative effects need to be documented ( 17 ) .
a direct toxic effect of cohb is discussed as a consequence of experimental studies on cytochrome oxidase ( 17 ) .
co binds with cardiac myoglobin causes a rapid decrease in myocardial oxygen reserves ( 18 ) .
when the energy source is blocked , then the function of the myoglobin is diminished ( 19 , 20 ) .
myocardial fiber necrosis and other changes observed with electron microscopy are associated with impaired energy metabolism ( 22 , 23 ) . however
, cardiac troponins are released without electron microscopic changes ( 24 , 25 ) . in this study
ck - mb levels did not differ between the three groups and did not correlate with cohb .
patients with detectable troponin , but no ck - mb , in the blood may exhibit microscopic zones of myocardial necrosis ( microinfarction ) ( 13 ) .
( 26 ) showed that in co poisoning , patients without known underlying significant coronary artery disease with cohb levels of up to 60% do not develop myocardial damage but they used only cardiac biomarkers ck - mb and ctnt .
the current study did not find any significant elevation in ck - mb levels , but in contrast a significant increase in hs - ctnt levels was found , which might be because of the microscopic myocardial necrosis ( 26 ) .
myocardial injury , documented with elevations in cardiac biomarkers , could be present in about one - third of the patients with serious co poisoning and it was associated with mortality ( 7 ) . the severity of myocardial injury depended on the duration and amount of co exposure ( 27 ) . moreover
, the level of co in the tissues may have an equal or greater impact on the clinical status of the patient than does the blood level of co ( 28 ) .
the primary limitation of the current small study group was the method of data collection .
there was no information on the length of co exposure and the timing of the blood cohb levels in relation to the co exposures .
further studies are necessary in this regard . another limitation was the retrospective nature of the study .
the data were reviewed by one researcher who avoided the selection bias ; however , misclassification , may still exist , which can not be verified or validated .
these results apply only to the elecsys hs - ctnt and ck - mb ( roche diagnostics ) assays , and may not be generalized to other high sensitivity assays by other manufacturers . finally , the study design was based on the data available in one hospital , and the obtained results may not necessarily be generalized . in conclusion , in patients without clear signs of myocardial infarction ,
even mild co poisoning is associated with quantifiable circulating levels of hs - ctnt when tnt is measured using a highly sensitive assay and cardiac complications should be considered in such patients .
plasma levels of the hs - tnt and ck - mb assays were not correlated with the cohb levels .
in conclusion , in patients without clear signs of myocardial infarction , even mild co poisoning is associated with quantifiable circulating levels of hs - ctnt when tnt is measured using a highly sensitive assay and cardiac complications should be considered in such patients .
plasma levels of the hs - tnt and ck - mb assays were not correlated with the cohb levels . | backgroundintoxication due to carbon monoxide ( co ) is one of the most common types of poisoning .
cardiac effects of carboxyhemoglobin ( cohb ) range from simple arrhythmias to myocardial infarction.objectivesthe current study aimed to investigate the relationship between blood carboxyhemoglobin and high - sensitivity cardiac troponin t ( hs - ctnt ) level with a highly sensitive assay in patients with acute carbon monoxide poisoning.patients and methodsthis retrospective study was conducted on 141 ( 54 males and 87 females ) patients , with acute co intoxication , admitted to the sevket yilmaz research and education hospital emergency unit during a one - year period ( january 2012 - january 2013 ) .
the patients were divided into three groups based on cohb levels : group i , mild cohb level < 15% ; group ii , cohb between 15% and 25% ; group iii , severe acute co intoxication cohb levels > 25% .
cohb , hs - ctnt ( stat ) , creatine kinase ( ck ) and creatine kinase - myocardial band ( ck - mb ) levels were measured on admission.resultsthe mean age of the patients was 38 16 years .
cohb levels ranged from 8 to 35 .
hs - ctnt levels on inclusion in this study were slightly different between the groups ( p = 0.05 ) .
cohb levels with hs - ctnt values were weakly correlated ( r = 0.173 , p = 0.041 ) ; on the other hand , ck - mb levels were not correlated with cohb ( r = 0.013 , p = 0.883).conclusionsin patients without clear signs of myocardial infarction , even mild co poisoning was associated with quantifiable circulating levels of hs - ctnt when tnt was measured using a highly sensitive assay in the current study patients .
plasma levels of the hs - tnt and ck - mb assays were not correlated with the cohb levels in the current study patients . | 1. Background
2. Objectives
3. Patients and Methods
3.1. Statistics
4. Results
5. Discussion
5.1. Conclusion |
access to accurate and reliable data is an important prerequisite for exploring the cost - effectiveness of healthcare interventions .
in particular , information about the numbers , rates and average costs of common invasive procedures , might help policy makers in resource allocation and payment system .
in addition there are currently significant debates about different aspects of hospital management , including granting autonomy to public hospitals ( 1 , 2 ) , medical fee and tariff ( 3 ) , and budget and payment system ( 4 ) .
there are also arguments about the amount of fees that should be paid to the physicians for the care they provide at hospitals ( 57 ) .
to make appropriate and proper decisions for tackling these issues , it is so important to have precise and reliable information .
an invaluable type of data that is very crucial to inform appropriate decision making is the number and rate of invasive procedures and surgical operations . estimating the number of invasive procedures can assist the policy makers in exploring the possible effects of any possible changes ( i.e. changes in tariff ) in healthcare and to adjust the income and refining policies of different disciplines in health system ( 7 ) . in other words ,
studying the rate and type of procedures is an important method for monitoring the provider s behavior .
this type of studies has been conducted in other countries ( 8) however these data have not yet been well documented in iran .
the aim of this study was to identify the first 50 common types of invasive procedures and to estimate the number and proportion of each procedure in iran .
data about the total number of all invasive procedures and frequency of each type of procedure that were conducted in iran in 2010 were collected using the main insurance organizations databases . because some procedures are conducted under different titles , similar titles related to each procedures were combined and the total number of each procedure was estimated ( table 1 ) .
for example different types of appendectomy was considered and calculated under appendectomy name ( table 1 ) .
detailed information about how similar procedures were combined is presented elsewhere ( 6 , 9 )
. then the number of all types of invasive procedures that were conducted in 2010 , were sorted in an excel database , and the first 50 procedures that had the most common frequency were selected . finally , according to the population that were covered by the insurance organizations from where we collected the data ( about 4 millions ) and the total population of iran in 2011 ( 75 million ) , we estimated the number of each invasive procedure for the selected procedures .
for example , if the number of appendectomy in the sample database was 8,051 and the population that were covered by the insurance organizations were about 4 millions the number of this invasive procedure in iran was estimated as follows :
frequency of each invasive procedure in the country = nipstpts
nips : number of invasive procedure in sampletp : total population of countryts : total sample nips : number of invasive procedure in sample tp : total population of country then the rate of each procedure was estimated by the following formula :
percentage of each procedure = number of each proceduretotal number of all procedures100 finally number per 100,000 populations of each procedure was estimated as follows :
number of each procedure in 100,000 population = number of each proceduretp100,000
it was estimated that a total of 4,894,884 invasive procedures were performed in iran in 2011 and 3,486,528 ( 71.32% ) of them were related to these 50 common invasive procedures .
these procedures included 769,500 natural vaginal delivery ( nvd ) ( 15.72% of all invasive procedures , 1,026 procedure per 100,000 population ) that were performed in iran in 2011 , followed by 416,790 cataract operation ( 8.51% , 556 per 100,000 population ) , 401,436 cesarean delivery ( 8.20% , 535 per 100,000 population ) , 260,514 coronary angiography disease ( 5.32% , 347 per 100,000 population ) , 181,836 varicocele ( 3.71% , 242 per 100,000 population ) , 144,918 appendectomy ( 2.96% , 193 per 100,000 population ) , 134,766 rhinoplasty ( 2.75% , 180 per 100,000 population ) and 105,912 pilonidal cyst ( 2.16% , 141 per100,000 population ) ( table 2 ) .
the natural vaginal delivery is the most common invasive procedure in iran followed by cataract , cesarean section , coronary angiography , varicocele , appendectomy and rhinoplasty .
the total number of these invasive procedures performed in 2011 were 4,894,884 and 3,486,528 ( 71.32% ) of them were related to these 50 common procedures .
the number of nvd and cesarean delivery is comparable with the total number of birth in 2011 and the assumption that over 30% of births are performed by cesarean section in iran ( 1012 ) .
data about the number of other procedures have not been yet well documented in iran according to our knowledge .
a recent study has reported that around 250,000 appedendectomy ( 400 per 100,000 population ) are performed per year in the usa in people under the age of 18 years , compared to 193 per 100,000 population that we found in this study ( 13 ) .
cataract had the greatest frequency ( 13.56% of all operations ) in people who are covered by iranian medical services fund ( 14 ) .
about 35% of children had inguinal hernia , about 72.09% of which underwent operation ( 15 ) .
coronary angiography ( 4.2% ) , cataract ( 3.4% ) , nvd ( 2.9% ) and cesarean ( 2.4% ) were the most prevalent procedures in people covered by medical services fund in sari city which is comparable with our results ( 16 ) .
our study is very similar to a usa study ( 8) , however we have reported the costs of selected procedures elsewhere ( 17 ) .
the number and rate of invasive procedures in this study was estimated according to the assumption that the population covered by the insurance organizations is representative of the total population of iran and the fact that all the invasive procedures that were performed for the sample population have been reported and registered in the insurance organizations database , therefore these results should be used by caution .
the findings of this study have the potential to be used in studies of economic evaluations that may be conducted in the future .
the results have also potential to be used for quality assurance purposes and also for policy making particularly regarding the implementation of the new tariff and payment system ( 18 ) and the possible effects that the new changes might have on the hospital budgets and experts .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . | background : the aim of this study was to estimate the frequency and rate of the first 50 common types of invasive procedures in iran.methods:data about the number of all invasive procedures and each type of procedure that were conducted in iran in 2010 were collected using the main insurance organizations database .
these numbers were sorted in an excel database , and the first 50 invasive procedures with the most common frequency were selected . then according to the population covered by the given insurance organizations , and based on the total population of iran in 2011
, we estimated the number and rate of each invasive procedure for the selective procedures.results:it was estimated that a total of 769,500 ( 1,026 per 100,000 population ) natural vaginal delivery ( nvd ) was performed in iran in 2011 , followed by 416,790 cataract operation ( 556 per 100,000 population ) , 401,436 cesarean delivery ( 535 per 100,000 population ) , 260,514 coronary angiography disease ( 347 per 100,000 population ) , 181,836 varicocele ( 242 per 100,000 population ) , 144,918 appendectomy ( 193 per 100,000 population ) , 134,766 rhinoplasty ( 180 per 100,000 population ) and 105,912 pilonidal cyst ( 141 per 100,000 population).conclusion : the result could be used to identify and select the most frequent invasive procedures in iran , to calculate the average cost of each procedure and to use these costs to estimate hospital budget and improve policy - making . | Introduction
Material and Methods
Results
Discussion
Conclusion
Ethical considerations |
the neurogenic urinary bladder is defined as a dysfunctional bladder associated with a known neurological injury , which can be spinal cord injury ( sci ) , multiple sclerosis ( ms ) , spina bifida , etc . .
although the term has been known for at least 30 years now and the concepts behind it are continuously evolving , there is actually not much work that has been done to accumulate solid clinical evidence in this field .
the choices of treatment for the patients with a neurogenic bladder include surgery , electrical stimulation , or physical exercise , many of them being still in an experimental phase .
while drugs are the single most used element that is found , at least temporarily , in the therapeutic approach of all these patients , surgery gets the role of salvaging the situation when all other treatments failed or are considered inappropriate . whether it is indicated to improve storage capacity , relieve outlet obstruction , cure incontinence or treat complications such as stones or tumors , surgery is a strong weapon in the armamentarium of the urologist that deals with neurogenic bladders . in the era of evidence
based medicine , it is quite often realized that there simply is n't enough data to support a particular technique or indication , and the surgical field of the neurogenic bladder is one of the best possible examples .
everyone knows that bladder augmentation is a good option to improve storage or that bulking agents are a reasonable option for stress urinary incontinence , but is there enough evidence out there to support what we sometimes tend to take for granted ?
the aim of our work is to review the clinical trials looking at surgical treatments , devices and experimental techniques for urinary related conditions in patients that have a neurogenic bladder , to outline the general results of major techniques used and to consider the principles of management that are most commonly used , as reported in the literature .
we consider that every device , technique or new approach that is reported for the first time in the literature should be considered as experimental until it is validated by multiple clinical trials of good quality .
the accepted methods of validation nowadays are the prospective clinical trials , which start with a very clear protocol that covers diagnosis , treatment and follow up .
to achieve our goal of reviewing as many relevant papers as possible we performed searches on both pubmed and ovid databases , using the same search string : urinary bladder , neurogenic [ mesh ] .
the option for the medical subject heading ( mesh ) vocabulary was based on the idea of standardization of terminology and reporting , supported by the international continence society ( ics ) and many other scientific organizations . in each case , the search was limited to clinical trials , subjects were limited to human and the language of the paper had to be english .
there was no year limit for our search , so even older papers were considered .
the search on pubmed returned 478 results in total , while from ovid we were able to get only 425 papers .
the results of the two searches were saved into two different files , containing title , abstract , authors , keywords , and the relevant data on the journal that published the paper .
the next step was duplicate removal , which led to a final number of 580 papers that needed to be considered for the purpose of our work .
the entire reference was exported to a microsoft access database , which allowed for greater flexibility in sorting and indexing the data by different criteria .
the inclusion criteria a paper had to meet simultaneously to be evaluated by our research were : clinical trial using at least one surgical technique , device or experimental technique for a urinary related conditionprimarily looking at the management / treatment of neurogenic bladder ( papers were not excluded if also dealing with non neurogenic conditions)main paper ( not abstract ) in englishuse surgery as main therapyresults clearly stated ( numbers , statistics , etc )
clinical trial using at least one surgical technique , device or experimental technique for a urinary related condition primarily looking at the management / treatment of neurogenic bladder ( papers were not excluded if also dealing with non neurogenic conditions ) main paper ( not abstract ) in english use surgery as main therapy results clearly stated ( numbers , statistics , etc ) if the abstract was not enough to clearly identify all the inclusion criteria , the full text paper was retrieved and analyzed . after applying these criteria , a total number of 73 papers were selected for in depth analysis .
data was extracted from each paper into a database file , where we recorded the main subject of the paper , its objectives , the total number of subjects and the number of males and females that were enrolled .
other headers included results , conclusions , personal remarks , main technique used , source of funds for study and year of publication .
we did not consider it important to sort the papers according to their country of origin , since the results are published in internationally recognized journals .
however , there could be some differences in the approach to the patient , or even in the results of similar procedures , that are region or race related , but we think that this is not the main topic of our work . the final step of the analysis consisted of grouping together all studies looking at similar procedures ( bladder augmentation , outlet obstruction treatment , stress incontinence , etc ) , pointing out the main causative neurological condition and then , according to the source of funds used , sorting into four groups : government , pharmaceutical industry , private sources or not stated .
we documented the adherence of each journal to the uniform requirements for manuscripts ( ums ) issued by the international committee of medical journal editors ( icmje ) in 2001 .
a total of 73 full text papers were reviewed and analyzed according to the previously mentioned algorithm .
the first prospective , randomized surgical trials were published less than 20 years ago , starting with 1994 , and the number of papers published each year since then has remained in the range of one to three . the oldest prospective clinical trial looking at medical devices for this indication dates back to 1975 . the total number of patients included in surgical trials is 3453 , out of which there are 2037 male patients ( 59% ) .
there are two papers that do not state the sex of the patients and a third paper that , although it does not clearly state this , seems to include only males as it looks at a urethral stent for relieving outlet obstruction .
the papers include a total of 369 children ( 21.2% ) , essentially looking at all the techniques that are also used in adults .
in fact , four trials are based on mixed populations , with patients ages ranging between 3 months and 62 years old . the oldest randomized trial for a pediatric population
was published in 1995 , and there is a mean value of one paper published every 1.5 years since then .
the male : female ratio in the pediatric trials is about 1.4:1 , although some trials do not describe the series from this point of view .
the largest series of patients included in one trial is 183 cases for adults and 107 for children , while the smallest trials included only 4 adults or 11 children .
the median size of the series is of 30 and 19 cases respectively ( figure 1 ) .
about half of the trials included patients with various neurological conditions considered responsible for the urinary disorder , while most of the trials including only sci patients were looking at the treatment of bladder outlet obstruction ( boo ) .
the main conditions being looked at are ( figure 2):spinal cord injury 14 trialsspina bifida 3 trialsmyelomeningocele 1 trial ( pediatric)myelodysplasia 1 trials ( pediatric)mixed conditions 17 trials
spinal cord injury 14 trials spina bifida 3 trials myelomeningocele 1 trial ( pediatric ) myelodysplasia 1 trials ( pediatric ) mixed conditions 17 trials main conditions behind the neurogenic bladder .
only nine trial authors ( 24.3% ) declare having received financial help for their work .
one third of them were funded by governmental institutions , three artificial sphincter trials were supported by the company that manufactures the device , and the other three were supported by non governmental funds .
there is an obvious lack of implication of governmental institutions in a field where spending some money now may reduce health care cost while improving health related quality of life in the long run .
at the same time , we appreciate that ultimately the health care system is actually paying for the surgeries , depending on the way the system is organized in each country , and , with the same budget but more implication towards a systematic approach , more valuable data could be obtained ( table 1 ) .
number of trials by main source of funding we identified 11 surgical trials looking at various types of urinary diversion aiming to treat storage symptoms , seven of them evaluating the ileovesicostomy and four assessing the results of bladder augmentation .
stress urinary incontinence was the subject of six clinical trials , three of them evaluating the artificial urinary sphincter produced by ams .
other trials are aimed toward sacral rhizotomies , stones treatment , sphincterotomy or nerve rerouting .
the ileovesicostomy trials included a total number of 180 cases , about 10% being children .
the follow up time ranges from one month to 3 years . in all series ,
the reported continence per urethra rate ranges between 0 and 100% depending on the particular aspects of the technique , and the continence procedure seems to associate a higher incidence of complications .
the most common complication reported is stomal stenosis , occurring in about 12% of cases after 6 to 32 months .
stones are reported in less than 5% of the cases and about 20% of the patients require another procedure in the first two years .
one author reports a 100% re intervention rate after two years and complications in all cases .
the bladder augmentation using bowel segments was evaluated in 275 patients , out of which more than 40 where children .
the results demonstrate an average of 3 times increase of bladder capacity and more than 7 times increase in bladder compliance on urodynamics .
overall , the technique proved safe , with a complication rate ranging from 1 to 10%
. one study on the pediatric population demonstrates no metabolic consequences of the procedures during a follow up period of up to 13 years .
augmentation seems to offer good results , but it may take one year before any improvement is seen .
bladder outlet obstruction is a serious condition in neurogenic patients , but none of the trials we reviewed actually deal with differentiating functional dsd from mechanical obstruction ( enlarged prostate , bladder neck obstruction , strictures , etc ) .
there are seven trials evaluating different aspects of stents for dsd , including patients aged between 16 and 79 years old .
data proves that urethral stents are safe to use and lead to an overall improvement in voiding and storage parameters in up to 95% of the patients , while significant improvement is seen only in about 76% of cases .
spontaneous voiding is reported in up to 100% of the patients which were unable to void before the intervention , with a decrease of the pvr with a mean value of 225 ml .
the number of episodes of autonomic dysreflexia decreases by 50% and the rate of dramatic episodes decreases even more .
there is no impact on erectile or renal function , and the effects are completely reversible if the stent is no longer needed . when the stent is not efficient , it is usually not necessary to take it out as it is well tolerated .
the overall complication rate is in the rage of 17% , the most common situation being migration of the device and a subsequent need for repositioning .
other complications include incrustation ( 0 to 16% incidence reported ) , urethral erosion with fistula ( one case reported ) or urethritis ( two cases reported ) .
all the studies are evaluating only one type of stent , so there is no actual comparison between various models that are available and which have very different shapes or composition .
the longest follow up is less than three years , which might be inconclusive in the aspect of long term safety and efficacy .
sphincterotomy offers improvements regarding voiding parameters , with a significant reduction of the pvr in 69% of the cases , important decrease of the rate and intensity of autonomic dysreflexia episodes .
vur is improved in about 60% of cases and disappears completely in 40% , while recurrent utis are cured or have a significantly lower incidence in 74% of the patients .
stress urinary incontinence is another condition in which all the trials we reviewed fail to make a clear connection with the neurological disease .
bulking agents trials offer contrasting data , depending on the actual agent used and the time of follow up .
there is no trial comparing two or more bulking agents or a bulking agent versus another procedure aimed to improve continence .
one trial evaluates a bulking agent for the treatment of vur , and the results show improvement in all cases and cure in 63% , with no complications and a follow up of 5 years .
the artificial urinary sphincter offers continence in about two thirds of the cases , and the number can be improved by further fine tuning of the device .
the mean period of life for the sphincter is about 56 months , but up to 20% of them need to be removed earlier due to patient related situations .
a good capacity and no previous surgery in the area seem to be key factors in improving success rates for the artificial sphincter .
there are reports of de novo vur in up to 10% of the patients , with chances of renal failure .
the results look similar in adult and pediatric populations , although no comparative study exists .
front about the high rate of mechanical and surgical complications associated with the implantation of an artificial sphincter
. electrical stimulation of the sacral roots , with or without rhizotomies is a hot subject , with many techniques and a couple of devices that aim to improve both storage and voiding , and even other conditions possibly related to the neurological injury .
neuromodulation has been evaluated in both adult and pediatric populations , on series ranging from 5 to 33 patients , with follow up periods of up to 5 years .
the main benefit of neuromodulation seems to be the increase in bladder capacity , with actual values that vary in a very wide range .
urinary continence is obtained by about 40% of the responsive patients , while a significant reduction is observed in all the others .
autonomic dysreflexia decreases both as incidence and as amplitude of signs and the other urodynamic parameters are improved overall , but reported data is inconsistent between trials .
there are no safety concerns related to neuromodulation , the only major reported issue being the poor overall response rate due to the many cases that fail to respond to testing or final implantation .
the neurostimulation device is evaluated by studies that only included adult patients , mainly with sci . in all papers ,
the results underline the beneficial effects including bladder function but also extend to improve erection and bowel function .
the longest follow up data available extends to two years , showing an increase in bladder capacity of at least 340 ml , with significant decrease in the pvr and improvement or cure of vur .
autonomic dysreflexia episodes are still present in all cases , but with decreased values of blood pressure and lower incidence .
the high initial cost of the procedure is reportedly balanced by the improved health status after 8 years , although one author reports that overall quality of life is unchanged by this procedure .
nerve rerouting aimed to restore both bladder and bowel function proved effective in 78% of the cases of a mixed adult and pediatric series of nine patients . the novel reflex may take up to one year to become active and the surgical technique is not yet standardized .
the results show that continence can not be achieved by this technique , but the improvement in storage and voiding parameters may be sufficient to completely replace antimuscarinics or other treatments .
the treatment of detrusor overactivity continues to be a hot area for research , and the papers we reviewed report the use of electrical stimulation ( 5 papers ) , different drugs ( 4 papers ) or a particular technique of rhizotomy in children .
electrical or magnetic stimulation of the bladder did not prove effective , and for many authors , the targeted pathways were unclear .
there are two papers reporting improvement of enuresis episodes and an increase of bladder capacity with subsequent decrease in pressure in two thirds of the population .
driven stimulation of the dorsal penile or clitoral nerve was able to suppress urgency and increase bladder capacity in two thirds of the cases , with no adverse events , but the author concludes that the technique is not suitable in a chronic setting .
a selective rhizotomy technique was able to resolve ndo in all cases and to improve other urodynamic parameters subsequently , with results lasting for the entire follow
there are no adverse effects reported , and the efficacy data ranges from ineffective to very good .
one recent study suggests that a better renal function improves the chances of preventing symptomatic utis .
although good quality studies are available and the evidence offered is relevant for the subject in discussion , there is actually no trial looking at the very core of the management of the neurogenic bladder .
we all seem to accept that by reducing storage pressure and treating vur our patient will be better , but in fact we can not describe the improvement in the long run . in many cases , the reported positive evolution of one parameter
is considered as a step forward in the management of the patient , although the implication on other parameters of storage and voiding are not known .
the implication of the industry in financing surgical trials is beneficial as it allows for more data to come out as support for a specific device or technique . on the other hand ,
these studies usually extend over short periods of time and generally evaluate the device itself , not comparing it to other similar devices that might be available .
such an approach is leading to results that are looking good overall , without clearly stating pros and cons over similar procedures .
the number of trials financed by governmental institutions is surprisingly low and we were unable to find a comprehensive explanation for the situation .
although in some countries the governments are not paying for health care , this is not the case for the vast majority of countries , where governmental institutions pay for the care of neurogenic bladder patients , if not in full at least for a significant part of the total cost .
since the health care system , public or private , ultimately covers the expenses related to surgical interventions for the management of the neurogenic bladder patients , it seems obvious that only little effort is required in the direction of proper standardization of the approach , procedure and reporting so that all data in the system could be eventually used in the direction of obtaining good clinical evidence , on large series of patients and techniques , spanned over long periods of time .
such an approach would offer data on what really happens with the patient after his surgery and the true benefits could be evaluated not only as improved storage or voiding parameters , but as the evolution of the health status of the urinary tract over time .
when speaking about clinical trials looking at the surgical management of the neurogenic bladder , the general perception is that there is a lot of data available , covering every possible aspect of this field .
our research demonstrates the opposite , by pointing out a very low total number of trials , many of which have design issues that might alter the final results .
for example , many studies include patients with different neurological conditions , or mix adult and pediatric populations but analyze the results all together .
the size of the series is another important issue for many trials , as a low number of patients is known to alter significantly the statistical analysis .
finally , there are studies that lack a power calculation , offering only basic information about the outcomes of the proposed treatment . summarizing what we know so far from the literature
, we can state that bladder augmentation is a safe and effective procedure , both in adult and pediatric populations , with an associated complication rate of about 10% .
ileovesicostomy , considered less invasive , associates higher re intervention rates , low continence rate per urethra and an overall higher complication rate compared to augmentation techniques
. the treatment of boo caused by dsd can be either by sphincterotomy or by using a stent .
sphincterotomy has the advantage of the lower cost while the main disadvantage is the irreversible character of the intervention .
taking into account the significant failure rate , it seems that the stents will completely replace this procedure , at least in those systems that can afford this change .
there are many stents available today , and there is no comparative data to help .
we know that a stent is safe , effective and can be removed without any subsequent implication .
there is no clear data concerning the treatment of sui in the neurogenic bladder patient , as there is no clear etiology of the condition defined in the available trials .
the artificial urinary sphincter offers continence for at least two thirds of the patients and the life expectancy of the device is less than 6 years .
electrical stimulation of the neural pathways involved in the micturition cycle looks very promising , with a great deal of studies already available or in progress .
the cost of the procedure remains high and the success rate still needs to be improved .
we notice that , with only one exception , all trials report positive results of the therapy for most of the included patients . all trials sponsored by the industry show significant benefits of using the device produced by the sponsor and none is offering comparative data with a similar technique or device . in the end
, this type of data might lead to confusion and indecision when choosing the most appropriate treatment for a particular patient , since the literature supports every single technique possible in that case .
there is still a lot of work to be done in order to obtain a significant level of evidence in the field of surgical procedures used in neurogenic bladder patients .
available data is more of the expert opinion type , and the results are often confusing or contrasting , so a meta analysis can not lead to the development of guidelines for management .
surgeries for different urinary conditions related to a neurological injury are a common practice in centers all over the world , and the first step toward acquiring reliable data is to standardize some methods and procedures , which will eventually lead to results that can be put together and analyzed on large number of patients . a greater implication and support from the health care systems would contribute to studies on a larger , national scale and the patients could be followed longer and more comprehensively .
although the ultimate benefit of a better knowledge and understanding of the procedures is for the patient , the financial implications might be of great importance for the medical system that has an increased awareness of the real problems associated with the neurogenic bladder . | introductionthe neurogenic urinary bladder has been known for at least 30 years now and the concepts behind it are continuously evolving , but there is actually not much work that has been done to accumulate solid clinical evidence in this field .
we review the surgical and experimental techniques used in the management of this condition.material and methodsto achieve our goal , we performed internet searches using the same search string : urinary bladder , neurogenic . in each case , the search was limited to clinical trial , subjects were human and the language was english .
after duplicate removal , we obtained a final number of 580 papers .
data was extracted from each paper into a database file and was analyzed separately for adult and pediatric populations.resultsa total of 70 full text papers were reviewed and analyzed according to the previously mentioned algorithm .
the first prospective , randomized surgical trials were published less than 20 years ago , starting with 1994 , and the number of papers published each year since then has remained in the range of 13 . the oldest prospective clinical trial for this indication dates back to 1975 .
the total number of patients included in surgical trials is 3453 , out of which 59% are males .
the papers include a total of 369 children ( 21.2% ) , essentially looking at all the techniques that are also used in adults.conclusionsthere is still a lot of work to be done in order to obtain a significant level of evidence in the field of surgical procedures used in neurogenic bladder patients . | INTRODUCTION
METHODS
RESULTS
DISCUSSION
CONCLUSIONS |
it is well known that there is an increased burden of cardiovascular disease and its risk factors among patients with lower socioeconomic status ( ses ) . in the last decade , eliminating disparities in healthcare delivery in the united states has been governed largely by the healthy people 2010 initiative , which has aimed to improve cardiovascular health among all citizens .
the ultimate goal of stelevation myocardial infarction ( stemi ) care should be to achieve optimal and equitable outcomes for one and all , regardless of their residential status . in this context , a number of cultural , clinical , economic , geographic , and accessrelated issues could influence the time from symptom onset to first medical contact . while these variables are difficult to individually quantify ,
residential zipcodebased classification of ses may reflect the aggregate characteristics of its residents and the prevailing healthy and unhealthy habits , which serves to provide an insight into environmental attributes ( like available healthcare resources ) that may have a direct or indirect impact on its residents ' health .
although there has been research demonstrating the negative impact of low ses upon outcomes following acute coronary syndromes , most of these studies belong to the era where primary percutaneous intervention ( pci ) was not the mainstay of treatment of stemi and the emphasis on doortoballoon time optimization was just beginning . to that end , we aimed to evaluate the disparities and outcomes in patients presenting with stemi according to the ses , in the contemporary era where expeditious reperfusion forms the mainstay of stemi management .
data were obtained from the nationwide inpatient sample ( nis ) database from 2003 to 2011 . the nis is sponsored by the agency for healthcare research and quality as a part of healthcare cost and utilization projection .
the nis contains discharge level data from 8 million hospitalizations annually from about 1000 hospitals across the united states .
this database is designed to represent a 20% stratified sample of all hospitals in the country .
criteria used for stratified sampling of hospitals into the nis include location ( urban or rural ) , teaching status , geographic region , patient volume , and hospital ownership .
the nis database provides up to 15 diagnoses and 15 procedures for each hospitalization record for the years 20032009 .
the number of diagnoses coded in the database was expanded to 25 for the years 20102011 .
all these have been coded using the standard international classification of diseases , ninth edition , clinical modification ( icd9 cm ) codes . the first diagnosis in the database is referred to as the principal diagnosis and is considered the primary reason for admission to the hospital .
these were identified using icd9 cm codes of 410.0x , 410.1x , 410.2x , 410.3x , 410.4x , 410.5x , 410.6x , and 410.8x .
we used the healthcare cost and utilization projection clinical classification software to identify patient comorbidities and procedures .
clinical classification software has been developed by the agency for healthcare research and quality for clustering patient diagnoses and procedures into a manageable number of clinically meaningful categories .
we identified patients undergoing diagnostic coronary angiography with the clinical classification software code of 47 that corresponds to icd9 cm codes of 37.21 to 37.23 and 88.52 to 88.57 . patients undergoing pci were identified using the clinical classification software code of 45 ( corresponding to icd9 cm codes of 00.66 , 36.01 , 36.02 , and 36.05 ) along with icd9 cm codes of 36.06 and 36.07 .
baseline characteristics available for analysis included age , gender , race , primary source of payment , weekday versus weekend admission , elixhauser comorbidities defined by agency for healthcare research and quality along with other clinically relevant comorbidities ( smoking , family history of coronary artery disease , prior mi , and dyslipidemia ) .
hospital characteristics such as region ( northeast , midwest , south , west ) , bed size ( small , medium , large ) , location ( rural , urban ) , and teaching status were also included .
the primary variable of interest was the ses assessed using patient 's residential zip code .
the nis has classified each zip code into quartiles based on median household income of each zip code .
these quartiles are the following : quartile 1 : $ 1 to $ 37 999 , quartile 2 : $ 38 000 to $ 47 999 , quartile 3 : $ 48 000 to $ 62 999 , quartile 4 : $ 63 000 or more .
residential zipcodebased classification of ses is known to reflect aggregate characteristics of its residents and an insight into environmental attributes ( such as available healthcare resources ) that may have a direct or indirect impact on its residents ' health .
although a composite measure of ses that includes several variables such as directly measured household income , education , race , and residential zip code might provide incremental information regarding individual ses , we chose to utilize the residential zipcodebased classification .
this is because of its successful validation in prior studies along with the fact that it reflects aggregate characteristics over individual characteristics , which often govern healthcare delivery . besides this , several characteristics that may be useful in defining composite measures of ses such as education and household income were not available in the administrative database of nis .
since the time to pci or thrombolysis was available in calendar days only , all patients who underwent pci or thrombolysis on day 0 of the hospitalization were assumed to have undergone timely reperfusion .
in addition to these primary outcomes , several secondary outcomes were analyzed including utilization of an intraaortic balloon pump ( iabp ) ( icd9 cm code : 37.61 ) , percutaneous assist devices ( icd9 cm code : 37.68 ) , and swan ganz catheterization ( icd9 cm codes : 89.64 , 37.21 , 37.23 ) .
besides these outcomes , we also analyzed the differences in cost of hospitalization stratified by residential zip code quartile .
the nis database provides the total charges associated with each hospital stay that were claimed by the respective hospital .
the total charges of each hospital stay were converted to cost estimates using the group average allpayer inhospital cost and charge information from the detailed reports by hospitals to the centers of medicare and medicaid services .
all costs and charges were converted to projected estimates for the year 2011 , after accounting for annual inflation rates based on consumer price index data available from the bureau of labor statistics .
we conducted a sensitivity analysis by comparing the primary outcomes between the study groups after removing all patients who presented as a transfer from another healthcare facility .
in addition , we compared the primary outcomes between several patient strata including males versus females , whites versus nonwhites , and elderly ( age 75 years ) versus nonelderly ( age < 75 years ) patients .
continuous variables are presented as meansd , and categorical variables are presented as proportions . for comparing the means of continuous variables between 3 or more categories
survey statistics traditionally used to analyze complex semirandom survey designs were employed to analyze these data . since the data from nis represent a collection of scattered hospital clusters , analysis was structured to account for a complex , multistage , probability sampling .
nis recommends the use of strata for constructing analysis clusters , which include geographic census region , hospital ownership , teaching status , urban / rural location , and bed size .
furthermore , the analysis is further stratified into individual hospitals , which serve as primary sampling units for the analysis . in the nis database ,
discharge weight that can be utilized to calculate projected national estimates for all hospitalrelated outcomes , after accounting for the hierarchical structure of the dataset .
multivariable hierarchical logistic regression analysis was utilized to compare outcomes between the zipcode quartiles . for this analysis
nis_straum as the strata , variable hospid as the primary sampling unit ( clustering variable ) , and the variable discwt as the sampling weight .
the analysis of all primary outcomes has been presented after adjusting for age , gender , race , 29 elixhauser comorbidities , other relevant comorbidities including smoking , prior mi , dyslipidemia , family history of coronary artery disease , and hospital characteristics . the highest zipcode quartile ( quartile 4 ) has been used as the reference category for all comparisons .
adjusted logistic regression analysis of secondary outcomes of intraaortic balloon pump / percutaneous assist device use and swan ganz catheterization was further adjusted for presence of cardiogenic shock , cardiac arrest , and ventricular fibrillation . furthermore ,
multivariable logistic regression analysis for comparing cost between the study groups was further adjusted for primary payment source and inhospital mortality .
all statistical analyses were performed using the statistical software stata v 13.0 ( statacorp , college station , tx ) .
due to the deidentified nature of this publicly available administrative database , an institutional review board review was not necessary for the conduct of this study .
data were obtained from the nationwide inpatient sample ( nis ) database from 2003 to 2011 . the nis is sponsored by the agency for healthcare research and quality as a part of healthcare cost and utilization projection .
the nis contains discharge level data from 8 million hospitalizations annually from about 1000 hospitals across the united states .
this database is designed to represent a 20% stratified sample of all hospitals in the country .
criteria used for stratified sampling of hospitals into the nis include location ( urban or rural ) , teaching status , geographic region , patient volume , and hospital ownership .
the nis database provides up to 15 diagnoses and 15 procedures for each hospitalization record for the years 20032009 .
the number of diagnoses coded in the database was expanded to 25 for the years 20102011 .
all these have been coded using the standard international classification of diseases , ninth edition , clinical modification ( icd9 cm ) codes . the first diagnosis in the database is referred to as the principal diagnosis and is considered the primary reason for admission to the hospital .
these were identified using icd9 cm codes of 410.0x , 410.1x , 410.2x , 410.3x , 410.4x , 410.5x , 410.6x , and 410.8x .
we used the healthcare cost and utilization projection clinical classification software to identify patient comorbidities and procedures .
clinical classification software has been developed by the agency for healthcare research and quality for clustering patient diagnoses and procedures into a manageable number of clinically meaningful categories .
we identified patients undergoing diagnostic coronary angiography with the clinical classification software code of 47 that corresponds to icd9 cm codes of 37.21 to 37.23 and 88.52 to 88.57 . patients undergoing pci
were identified using the clinical classification software code of 45 ( corresponding to icd9 cm codes of 00.66 , 36.01 , 36.02 , and 36.05 ) along with icd9 cm codes of 36.06 and 36.07 .
baseline characteristics available for analysis included age , gender , race , primary source of payment , weekday versus weekend admission , elixhauser comorbidities defined by agency for healthcare research and quality along with other clinically relevant comorbidities ( smoking , family history of coronary artery disease , prior mi , and dyslipidemia ) .
hospital characteristics such as region ( northeast , midwest , south , west ) , bed size ( small , medium , large ) , location ( rural , urban ) , and teaching status were also included .
the primary variable of interest was the ses assessed using patient 's residential zip code .
the nis has classified each zip code into quartiles based on median household income of each zip code .
these quartiles are the following : quartile 1 : $ 1 to $ 37 999 , quartile 2 : $ 38 000 to $ 47 999 , quartile 3 : $ 48 000 to $ 62 999 , quartile 4 : $ 63 000 or more .
residential zipcodebased classification of ses is known to reflect aggregate characteristics of its residents and an insight into environmental attributes ( such as available healthcare resources ) that may have a direct or indirect impact on its residents ' health .
although a composite measure of ses that includes several variables such as directly measured household income , education , race , and residential zip code might provide incremental information regarding individual ses , we chose to utilize the residential zipcodebased classification .
this is because of its successful validation in prior studies along with the fact that it reflects aggregate characteristics over individual characteristics , which often govern healthcare delivery .
besides this , several characteristics that may be useful in defining composite measures of ses such as education and household income were not available in the administrative database of nis .
inhospital mortality and timely reperfusion therapy were treated as coprimary outcomes . since the time to pci or thrombolysis was available in calendar days only ,
all patients who underwent pci or thrombolysis on day 0 of the hospitalization were assumed to have undergone timely reperfusion . in addition to these primary outcomes , several secondary outcomes were analyzed including utilization of an intraaortic balloon pump ( iabp ) ( icd9 cm code : 37.61 ) , percutaneous assist devices ( icd9 cm code : 37.68 ) , and swan ganz catheterization ( icd9 cm codes : 89.64 , 37.21 , 37.23 ) .
besides these outcomes , we also analyzed the differences in cost of hospitalization stratified by residential zip code quartile .
the nis database provides the total charges associated with each hospital stay that were claimed by the respective hospital .
the total charges of each hospital stay were converted to cost estimates using the group average allpayer inhospital cost and charge information from the detailed reports by hospitals to the centers of medicare and medicaid services . all costs and charges
were converted to projected estimates for the year 2011 , after accounting for annual inflation rates based on consumer price index data available from the bureau of labor statistics .
we conducted a sensitivity analysis by comparing the primary outcomes between the study groups after removing all patients who presented as a transfer from another healthcare facility .
in addition , we compared the primary outcomes between several patient strata including males versus females , whites versus nonwhites , and elderly ( age 75 years ) versus nonelderly ( age < 75 years ) patients .
continuous variables are presented as meansd , and categorical variables are presented as proportions . for comparing the means of continuous variables between 3 or more categories , we utilized 1way anova . in cases of significant differences detected using anova
survey statistics traditionally used to analyze complex semirandom survey designs were employed to analyze these data . since the data from nis represent a collection of scattered hospital clusters , analysis was structured to account for a complex , multistage , probability sampling .
nis recommends the use of strata for constructing analysis clusters , which include geographic census region , hospital ownership , teaching status , urban / rural location , and bed size .
furthermore , the analysis is further stratified into individual hospitals , which serve as primary sampling units for the analysis . in the nis database ,
discharge weight that can be utilized to calculate projected national estimates for all hospitalrelated outcomes , after accounting for the hierarchical structure of the dataset .
multivariable hierarchical logistic regression analysis was utilized to compare outcomes between the zipcode quartiles . for this analysis
nis_straum as the strata , variable hospid as the primary sampling unit ( clustering variable ) , and the variable discwt as the sampling weight .
the analysis of all primary outcomes has been presented after adjusting for age , gender , race , 29 elixhauser comorbidities , other relevant comorbidities including smoking , prior mi , dyslipidemia , family history of coronary artery disease , and hospital characteristics . the highest zipcode quartile ( quartile 4 ) has been used as the reference category for all comparisons .
adjusted logistic regression analysis of secondary outcomes of intraaortic balloon pump / percutaneous assist device use and swan ganz catheterization was further adjusted for presence of cardiogenic shock , cardiac arrest , and ventricular fibrillation . furthermore ,
multivariable logistic regression analysis for comparing cost between the study groups was further adjusted for primary payment source and inhospital mortality .
all statistical analyses were performed using the statistical software stata v 13.0 ( statacorp , college station , tx ) .
all statistical tests were 2tailed ; a p<0.05 was considered significant . due to the deidentified nature of this publicly available administrative database ,
over a 9year period ( 20032011 ) , a total of 372 984 discharges with a principal diagnosis of stemi were analyzed .
table 1 demonstrates the baseline characteristics of the entire study population , stratified by the ses quartiles .
there was a progressive reduction in the proportion of females when moving from the lowest to the highest quartile ( p<0.001 ) .
similarly , 70.6% of all stemi patients residing in the lowest ses quartile were whites as compared to 82.8% of patients in the highest ses quartile ( p<0.001 ) .
in addition , patients in the highest ses quartile were more likely to have private insurance as the primary payment source as compared to the lower quartiles ( p<0.001 ) .
baseline characteristics stratified by zipcodebased socioeconomic status quartile all quartiles were based on median household income of the respective zip code .
cad indicates coronary artery disease ; ses , socioeconomic status ; usd , us dollars .
the differences in the distribution of traditional cardiovascular risk factors between the different ses quartiles are also illustrated in table 1 .
there were small but statistically significant decreases in the prevalence of diabetes , hypertension , smoking , peripheral vascular disease , and chronic renal failure when moving up the ses quartile ( p<0.001 for all comparisons ) .
in addition , we noted that there was a significantly higher prevalence of alcohol abuse and drug abuse among residents of lower ses quartiles as compared to higher quartiles ( p<0.001 for both comparisons ) .
figure 1 demonstrates the incidence and adjusted odds ratio for the primary outcomes across the ses quartiles .
the incidence of inhospital mortality was 7.8% , 7.5% , 7.0% , and 7.1% across quartiles 1 to 4 , respectively ( ptrend<0.001 ) .
on adjusted analysis , there were significantly higher odds of inhospital mortality among the lowest ses quartile as compared to the highest quartile ( odds ratio [ 95% ci ] : 1.11 [ 1.06 to 1.17 ] ) .
similarly , there was a highly significant trend indicating a progressively reduced timely reperfusion among patients from lower ses quartiles , as compared to those from higher quartiles .
the utilization of thrombolysis across the 4 ses quartiles was 3.4% , 3.7% , 3.7% , and 3.6% , respectively ( ptrend=0.44 ) .
although the utilization of thrombolysis was similar across the ses quartiles , there was a significantly greater utilization of pci in the higher ses quartiles as compared to the lower ses quartiles .
the prevalence of timely pci across the 4 ses quartiles was 47.0% , 49.6% , 53.6% , and 56.1% , respectively ( ptrend<0.001 ) .
the figure demonstrates the percent incidence and adjusted odds ratio ( or ) for inhospital mortality , timely reperfusion , use of percutaneous assist devices / intraaortic balloon pump ( iabp ) , and swan ganz catheterization , stratified by zipcodebased socioeconomic quartiles .
quartile 1 : $ 1 to $ 37 999 , quartile 2 : $ 38 000 to $ 47 999 , quartile 3 : $ 48 000 to $ 62 999 , quartile 4 : $ 63 000 or more .
sensitivity analysis was performed by comparing the primary outcomes between the study groups after removing all patients who presented as a transfer from another healthcare facility .
there was no significant change in the trend of the incidence of the primary outcomes across the ses quartiles with this sensitivity analysis ( figure 2 ) .
figure 1 also demonstrates the utilization of percutaneous assist / intraaortic balloon pump and swan ganz catheterization , stratified by ses quartiles . as seen in this figure
, there was a progressively reduced utilization of both modalities among patients from lower ses quartiles as compared to higher quartiles .
the incidence of cardiogenic shock accompanying stemi in ses quartiles 1 to 4 was similar at 8.4% , 8.3% , 8.4% , and 8.8% , respectively ( ptrend : 0.08 ) .
the percent incidence and adjusted odds ratio ( or ) for inhospital death and timely reperfusion , stratified by zipcodebased socioeconomic quartiles after eliminating all patients who were transferred from an outside healthcare facility .
quartile 1 : $ 1 to $ 37 999 , quartile 2 : $ 38 000 to $ 47 999 , quartile 3 : $ 48 000 to $ 62 999 , quartile 4 : $ 63 000 or more .
the impact of timely reperfusion on inhospital mortality and long hospital stay was investigated by stratifying these outcomes according to the timeliness of the reperfusion therapy .
figure 3 demonstrates the incidence and adjusted odds ratio for inhospital mortality across the ses quartiles , stratified by timeliness of reperfusion .
the incidence of inhospital mortality was significantly higher among patients who had delayed or no reperfusion therapy as compared to those who underwent timely reperfusion ( p<0.001 ) .
however , there was no significant difference in the incidence of inhospital mortality across the ses quartiles among those who did not undergo timely reperfusion . on the contrary , among those who underwent timely reperfusion , the incidence of inhospital death was significantly higher for the lower ses quartiles as compared to the higher quartiles .
the percent incidence and adjusted odds ratio ( or ) for inhospital death for various socioeconomic quartiles stratified by the timing of reperfusion therapy .
patients undergoing delayed / no reperfusion are shown in the top panel and those undergoing timely reperfusion are shown in the bottom panel .
quartile 1 : $ 1 to $ 37 999 , quartile 2 : $ 38 000 to $ 47 999 , quartile 3 : $ 48 000 to $ 62 999 , quartile 4 : $ 63 000 or more .
the mean ( sd ) cost of hospitalization was $ 23 529 ( $ 22 983 ) , $ 23 999 ( $ 23 625 ) , $ 25 800 ( $ 25 391 ) , and $ 28 060 ( $ 28 657 ) among ses quartiles 1 to 4 , respectively .
after adjustment for baseline demographic and clinical characteristics including primary payment source , the adjusted costs of hospitalization of patients from ses quartiles 2 , 3 , and 4 were significantly higher when compared to the cost of hospitalization of patients from ses quartile 1 ( p0.001 for all comparisons ) .
as compared to quartile 1 , mean adjusted cost of hospitalization for patients from quartile 4 was higher by $ 4070 ( 95% ci : $ 2877 to $ 5263 ) .
similarly , the mean adjusted cost of hospitalization for patients from quartiles 2 and 3 were higher by $ 913 ( 95% ci : $ 380 to $ 1447 ) and $ 2140 ( 95% ci : $ 1391 to $ 2888 ) as compared to the costs of hospitalization of patients from ses quartile 1 .
subgroup analyses demonstrating the differential impact of gender , race , and age on inhospital death and timely reperfusion have been demonstrated in tables 2 and 3 , respectively .
the inhospital mortality rates were noted to be significantly higher among females as compared to males for all ses quartiles ( p<0.001 for all comparisons ) .
in addition , the inhospital mortality among females as well as males from the lowest ses was significantly higher than their counterparts in the higher ses quartiles . furthermore , males and females from the lower ses quartiles were significantly less likely to undergo timely reperfusion as compared to their counterparts from the higher ses quartiles .
percent incidence and odds ratio for inhospital death according to zipcodebased socioeconomic quartiles stratified by gender , race , or age all quartiles were based on the median household income of the respective zip code .
quartile 1 : $ 1 to $ 38 999 ; quartile 2 : $ 39 000 to $ 47 999 ; quartile 3 : $ 48 000 to 63 000 ; quartile 4 : $ 63 000 or more . percent incidence and odds ratio for timely reperfusion therapy according to zipcodebased socioeconomic quartiles stratified by gender , race , or age
quartile 1 : $ 1 to $ 38 999 ; quartile 2 : $ 39 000 to $ 47 999 ; quartile 3 : $ 48 000 to 63 000 ; quartile 4 : $ 63 000 or more .
on stratification of the study population into whites and nonwhites , we did not observe any significant differences in the incidence of inhospital mortality and timely reperfusion between these 2 racial groups . in both racial strata
, we observed a statistically significant trend of an increase in inhospital mortality and a reduction in timely reperfusion among patients belonging to lower ses quartiles as compared to higher ses quartiles .
furthermore , the incidence of inhospital mortality and delayed / no reperfusion therapy was significantly higher among elderly patients ( 75 years ) as compared to their younger counterparts ( p<0.001 for all comparisons ) .
although inhospital mortality among the elderly did not seem to be affected by the ses quartile , elderly from the 2 lowest ses quartiles were less likely to undergo a timely reperfusion ( table 3 ) . in the younger cohort , there was a significantly higher incidence of inhospital mortality and a reduced incidence of timely reperfusion among patients from lower ses as compared to those from higher ses quartiles .
there were several differences in the baseline characteristics between the elderly patients and their younger counterparts , which could potentially explain these differences ( table 4 ) .
comparison of baseline characteristics of young ( < 75 y ) and old ( 75 y ) patients from the lowest socioeconomic status data are expressed as number ( percentage ) except where specified .
we have evaluated the impact of residential zipcodebased classification of ses upon adverse events following stemi utilizing a large representative nationwide sample in the united states . we observed a progressive increase in the absolute and adjusted inhospital mortality after stemi with a progressive decline in the median household income of a patient 's residential zip code .
besides this , there was a highly significant trend indicating a progressively reduced timely reperfusion among patients from lower ses quartiles , as compared to those from higher quartiles .
we did not observe any significant difference in the inhospital mortality among patients who did not undergo timely reperfusion therapy .
however , the mortality among these patients was significantly higher than those who underwent timely reperfusion in all ses strata . despite a higher occurrence of inhospital mortality among patients from a lower ses quartile , there was a progressively reduced utilization of mechanical circulatory support among patients from lower ses quartiles as compared to higher quartiles .
in addition , the cost of hospitalization of patients from the lower ses quartiles was less as compared to those from higher ses quartiles . whether this represents an underutilization of resources for patients from lower ses zip codes or this represents an overutilization of resources for patients from higher ses zip codes is not completely clear from this analysis .
however , our analysis has demonstrated a significant disparity in both inhospital outcomes as well as resource utilization for stemi patients , depending on residential zip code .
the differences in ses have been consistently associated with variations in cardiovascularrelated morbidity and mortality .
individuals residing in neighborhoods with a lower ses have a higher prevalence of cardiovascular risk factors such as hypertension , diabetes , obesity , and smoking accounting for the observed association between the contextual factors and outcomes following stemi .
however , these statistically significant yet clinically underwhelming differences in cardiovascular risk factors are unlikely to be a sole explanation for differences in clinical outcomes . in addition , the differences in clinical outcomes between the ses quartiles persist despite adjustment for baseline cardiovascular risk factors , suggesting that other factors in healthcare access and delivery likely play a role .
lower ses has been demonstrated to limit access to medical care and to bias these patients to present to smaller , lowvolume hospitals without invasive cardiac procedures and with lower utilization of evidencebased therapies .
the differences in outcome in our analysis , however , persisted despite adjustment for hospital characteristics .
it is possible that an unmeasured prehospital variable clustered by ses may account for the mortality differences noted .
these include timely activation and performance characteristics of the local emergency medical services systems , inappropriate triage , and transport to nonreperfusion hospitals .
other novel variables including functional capacity and autonomic functions such as heart rate recovery have been previously shown to differentially impact outcomes according to ses .
there is a large body of literature that has evaluated the existence and impact of racial disparities on outcomes following acute mi .
although we found a significant higher proportion of nonwhites in the lower socioeconomic strata , socioeconomic disparity and racial disparity are hardly interchangeable terms .
it has been demonstrated that if all patients with stemi were treated with an identical protocol for primary pci , there would be no racial disparity in clinical outcomes .
hence , although it is convenient to label patients by race , factors that relate to ses such as income , education , housing , and social awareness are probably more important in healthrelated outcomes .
socioeconomic position has been speculated to be a greater impediment to optimal cardiovascular health rather than biologically implausible surrogates of race and sex . despite a breadth of evidence spanning the relationship of racial disparities with adverse cardiovascular outcomes , relatively fewer studies have exclusively evaluated the role of ses on cardiovascular outcomes following stemi . using administrative data from canada ,
alter et al demonstrated that a progressive improvement in the ses , measured using neighborhood median income level , predicted a greater use of coronary angiography , shorter waiting times for heart catheterization , and lower shortterm mortality following acute mi .
these findings from this seminal study published 15 years ago are likely not easily extrapolated to the current us population , where there may be greater disparities in the distribution and the utilization of healthcare resources along with a greater degree of economic segregation as compared to canada .
furthermore , these studies belong to an era when primary pci was not the mainstay of treatment of stemi and the emphasis on doortoballoon time optimization was just beginning . over the last decade
, we have made remarkable progress in the delivery of optimal reperfusion for patients with stemi .
there is ample evidence to demonstrate a major reduction in doortoneedle times and doortoballoon times over the past few years .
however , the time between the symptom onset and the first medical contact among stemi patients has hardly changed .
we believe that socioeconomic parameters have a small impact on the doortoballoon times after a patient presents to a healthcare facility .
however , a greater degree of impact of ses probably occurs on the duration between symptom onset and first medical contact .
several socioeconomic and sociocultural factors including education , access to healthcare resources , income , and awareness might play important roles in determining the overall total ischemic time following stemi , thereby directly impacting the outcome .
further , one could argue that the impact of environment , substituted by an aggregate zip code income , might provide a greater degree of insight into society health dynamics and interactions than individual household income .
in addition to detailed perspective on relationship of ses with adverse outcomes after stemi , our study also provides some additional data that might form the basis of future studies .
this is in keeping with earlier findings from multiple studies . whether these genderbased outcome differences reflect true biological differences or are more indicative of differing socioeconomic profiles that render female gender a surrogate for poor outcome is a matter of speculation at this time
similarly , elderly patients with stemi have been traditionally believed to possess a guarded prognosis due to multiple comorbidities , more delay in seeking care , atypical presentations , and a higher degree of hemodynamic compromise compared to younger patients .
we observed that the ses mortality association was stronger for the younger population than the elderly .
this is in conjunction with earlier findings where the association between ses and cardiovascular mortality appeared to be less marked among older patients .
although the mechanisms underlying these associations are not completely clear , potential hypotheses include improved coping skills among elderly , perhaps attributable to having lived longer under adverse socioeconomic circumstances along with an increased access to healthcare resources due to public insurance programs available to older individuals .
first , nis is an administrative database , which may be subject to errors in coding of diseases or procedures .
however , in administrative databases , the diagnosis of acute mi using icd9 cm coding has been demonstrated to possess a specificity of 99.5% , sensitivity of 72.4% , negative predictive value of 96.1% , and a positive predictive value of 95.9% .
second , this is a retrospective observational study , which may be subject to traditional biases of observational studies such as selection bias .
however , these limitations might be partially compensated for , due to a large size of nis database and a uniform representation of all regions of the united states .
third , the definition of timely reperfusion included all patients who underwent reperfusion on day 0 of admission to the hospital , due to lack of availability of hourly data .
this definition might lend itself to slight overinclusion of patients who may not have undergone timely reperfusion by strict stemi standards .
a further limitation might result from the fact that we utilized median household income of the entire zip code to
the capability of an individual measure like the median household income of the residential zip code , rather than a composite measure , to directly relate to the ses of each patient may be somewhat limited .
however , the inaccuracy resulting from the misclassification of personal ses based on ses of the surrounding neighborhood ( so called ecologic fallacy ) may be completely offset by the lack of occurrence of an
individualistic fallacy , whereby there is an incorrect assumption that the health of an individual subject is not affected by the neighborhood that they reside in . in addition , inhospital mortality may be affected by numerous variables including availability of pci facilities with relevant expertise , provider volume , hospital infrastructure , and surgical backup , which are not always available consistently in the nis database .
first , nis is an administrative database , which may be subject to errors in coding of diseases or procedures .
however , in administrative databases , the diagnosis of acute mi using icd9 cm coding has been demonstrated to possess a specificity of 99.5% , sensitivity of 72.4% , negative predictive value of 96.1% , and a positive predictive value of 95.9% .
second , this is a retrospective observational study , which may be subject to traditional biases of observational studies such as selection bias .
however , these limitations might be partially compensated for , due to a large size of nis database and a uniform representation of all regions of the united states .
third , the definition of timely reperfusion included all patients who underwent reperfusion on day 0 of admission to the hospital , due to lack of availability of hourly data .
this definition might lend itself to slight overinclusion of patients who may not have undergone timely reperfusion by strict stemi standards .
a further limitation might result from the fact that we utilized median household income of the entire zip code to
the capability of an individual measure like the median household income of the residential zip code , rather than a composite measure , to directly relate to the ses of each patient may be somewhat limited .
however , the inaccuracy resulting from the misclassification of personal ses based on ses of the surrounding neighborhood ( so called ecologic fallacy ) may be completely offset by the lack of occurrence of an
individualistic fallacy , whereby there is an incorrect assumption that the health of an individual subject is not affected by the neighborhood that they reside in . in addition , inhospital mortality may be affected by numerous variables including availability of pci facilities with relevant expertise , provider volume , hospital infrastructure , and surgical backup , which are not always available consistently in the nis database .
there was a higher incidence of inhospital death among patients residing in low ses zip codes , as compared to those who live in high ses zip codes .
besides this , there was a reduced prevalence of timely reperfusion among patients from low ses zip codes .
the use of mechanical circulatory support devices was paradoxically lower among those who belonged to the low ses zip codes as compared to the higher ses zip codes , despite a higher mortality in the low ses quartiles .
furthermore , the absolute as well as adjusted cost of hospitalization was significantly higher for those who belonged to a high ses zip code as compared to those who belonged to low ses zip code .
these data suggest that there are widespread differences in timely access and provision of optimal stemi care based on socioeconomic differences , which may be responsible for adverse health outcomes in those that reside in low ses areas . | backgroundsocioeconomic status ( ses ) as reflected by residential zip code status may detrimentally influence a number of prehospital clinical , accessrelated , and transport variables that influence outcome for patients with stelevation myocardial infarction ( stemi ) undergoing reperfusion .
we sought to analyze the impact of ses on inhospital mortality , timely reperfusion , and cost of hospitalization following stemi.methods and resultswe used the 20032011 nationwide inpatient sample database for this analysis .
all hospital admissions with a principal diagnosis of stemi were identified using icd9 codes .
ses was assessed using median household income of the residential zip code for each patient .
there was a significantly higher mortality among the lowest ses quartile as compared to the highest quartile ( or [ 95% ci ] : 1.11 [ 1.06 to 1.17 ] ) .
similarly , there was a highly significant trend indicating a progressively reduced timely reperfusion among patients from lower quartiles ( or [ 95% ci ] : 0.80 [ 0.74 to 0.88 ] ) .
in addition , there was a lower utilization of circulatory support devices among patients from lower as compared to higher zip code quartiles ( or [ 95% ci ] : 0.85 [ 0.75 to 0.97 ] ) .
furthermore , the mean adjusted cost of hospitalization among quartiles 2 , 3 , and 4 , as compared to quartile 1 was significantly higher by $ 913 , $ 2140 , and $ 4070 , respectively.conclusionspatients residing in zip codes with lower ses had increased inhospital mortality and decreased timely reperfusion following stemi as compared to patients residing in higher ses zip codes .
the cost of hospitalization of patients from higher ses quartiles was significantly higher than those from lower quartiles . | Introduction
Methods
Data Source
Study Population
Study Outcomes
Sensitivity and Subgroup Analyses
Statistical Analysis
Results
Discussion
Limitations
Conclusions |
congenital hypertrophy of the upper extremity is a rare , nonprogressive phenomenon , involving the hand and forearm and sometimes the whole extremity .
we report a 28-year - old male with hypertrophy of both hands to illustrate this unusual clinical syndrome .
a 28-year - old , right - handed , healthy male had been suffering from pain and cramping sensations in both his hands for years since working as a crane driver .
his work involved operating a crane with a joystick in each hand . as long as he could remember
, he had had big hands compared to those of his peers of the same age .
physical examination revealed an increased muscle bulk of both hands and the right forearm , with the right hand being slightly bigger than the left hand .
in particular , both abductor pollicis muscles , the dorsal intrinsic hand muscles , and the abductor digiti quinti showed an increased muscle belly volume ( fig .
1 ) . motor and sensory functions of the hands were normal , as was the rest of the neurological examination .
laboratory tests , including sedimentation rate and creatine phosphokinase revealed no abnormalities . t1- and t2-weighted mri showed diffuse enlargement of the muscle mass , in particular of both abductor pollicis muscles , the intrinsic muscles , the abductor digiti quinti , and the right forearm flexor compartment ( fig .
the maximal axial diameters of the muscle belly of the first dorsal interosseus muscles were 24 16 mm ( right ) and 25 18 mm ( left ) .
the only normal values we could find in the literature were from 5 healthy males who had a muscle belly width of 9.6 0.5 mm on ultrasound ( mean of radial and ulnar muscle proportion ) .
there are no normal values known for the abductor pollicis muscle [ 1 , 2 ] .
the right forearm axial diameter measured at maximum ( 10 cm from the elbow ) 54.75 53.12 mm , compared to 50.04 50.58 mm for the left arm .
the muscles had a normal density without signs of architectural change , fatty infiltration , tumors , or fluid accumulation .
visual ultrasound assessment also showed a normal echogenicity ( i.e. heckmatt grade i ) of the muscles .
needle electromyography examination of the right abductor pollicis brevis , biceps brachii , left extensor digitorum communis , abductor pollicis brevis , and abductor digiti minimi showed sporadic polyphasic , large motor unit potentials with a normal interference pattern . because of the mild enlargement , its nonprogressive nature , and the absence of other abnormalities , no further workup ( such as muscle biopsy or search for a somatic mutation in pik3ca ) was performed . on the basis of the patients history , physical examination , and imaging ,
given the work - related nature of the symptoms , he was referred to a rehabilitation physician who successfully instructed him how to avoid cramps and pain .
the condition varies in severity and has been reported under different names , such as aberrant muscle syndrome and congenital monomelic hypertrophy [ 2 , 3 , 4 , 5 , 6 , 7 , 8 ] . on mri and ultrasound , muscle tissue is characterized by normal signal intensity and architecture .
the condition is most likely not due to selective hypertrophy ( i.e. a training effect ) but to a local increase in muscle mass because of a local genetic variation or mosaicism affecting the growth rate .
the etiology of this focal muscle bulk increase is unknown and does not seem to be confined to a peripheral nerve , part of the plexus , or nerve root territory , i.e. neurogenic hypertrophy .
previous ( unilateral ) cases told a similar story with old photos as evidence [ 4 , 5 ] .
cases of bilateral involvement have been described four times so far ( table 1 ) [ 1 , 6 , 9 , 10 ] . in the 3 adult cases ,
only the first dorsal interosseus muscles were involved , whereas our patient had diffuse involvement of all hand muscles , with prominence of the abductor pollicis muscles . to our knowledge , this is the first adult case in which a bilateral diffuse involvement of muscles of the hand is described
. biopsies ( from unilateral cases ) showed only a slightly more - than - normal variation in fiber size , without signs of inflammation , pathological blood vessels , fibrosis , or loss of muscle fibers .
the syndrome is distinctly different from other causes of hand or upper - limb hypertrophy such as proteus syndrome or freeman - sheldon syndrome .
other possible causes such as nerve hamartomas are progressive in nature , and were excluded by imaging .
muscle hypertrophy due to nerve damage , so - called neurogenic pseudohypertrophy , is electromyographically characterized by early recruitment of large motor unit potentials at a high firing rate .
only muscles innervated by the specific damaged nerve are enlarged in those cases [ 7 , 12 ] . in adults
decreasing the muscle volume ( including the excision of possible aberrant muscles ) is therefore only recommended for cosmetic purposes .
instructions and avoidance of heavy manual labor are usually enough to alleviate the symptoms . although rare , congenital monomelic hypertrophy should be considered in the differential diagnosis of the hypertrophied hand . | congenital hypertrophy of the hand is a rare phenomenon .
the condition is characterized by hypertrophy of muscles , varies in severity and has been reported under different names .
some patients also have aberrant muscles .
electromyography is unremarkable , and the signal intensity on mri and ultrasound is normal .
the etiology is unknown and does not seem to be confined to a peripheral nerve , part of the plexus or nerve root .
the condition is assumed to be congenital .
we report a 28-year - old male with asymmetric hypertrophy of both hands and give a review of the 4 other cases known so far . | Introduction
Case Presentation
Discussion
Statement of Ethics
Disclosure Statement |
rhizoma corydalis ( rc ) , belonging to corydalis species and the family of papaveraceae , is a perennial herbaceous plant and grows mostly in northeastern china .
the tubers of rc have been employed as analgesic , sedative , and hypnagogue for long times [ 1 , 2 ] , which is a well - known traditional chinese herbal medicine , corydalis yanhusuo w.t .
wang and acts against myocardial ischemia , gastric ulcer , and tumour in the medical field .
the bioactive constituents , corydaline , have analgesic efficacy but little toxicity [ 36 ] .
the crude rc were used as samples in all phytochemical analysis , but the rc as traditional chinese medicine often underwent processing .
there is an old saying in china : as a medicine , it is somewhat toxic , so the folk pharmacists always make the natural herbal medicine a processing handcraft to enhance efficiency and reduce toxicity .
it has been reported that more than 20 kinds of alkaloids are identified in rc [ 79 ] , which have the similar biosynthetic route and backbone to berberine [ 10 , 11 ] .
the tyrosines bioassemble the benzylisoquinolines , while the more immediate , pose the berberine basic structure .
thin - layer chromatography ( tlc ) , high performance liquid chromatography ( hplc ) [ 1315 ] , high performance capillary electrophoresis ( hple ) , and supercritical fluid chromatography were often employed in the analysis of these alkaloids .
liquid chromatography - mass spectrometry ( lc / ms ) and multistage spectrometry ( ms ) were also reported in some literatures [ 1820 ] . however , identified alkaloids are uneasy using lc / ms due to no available mass spectral database on electrospray ionization ( esi ) .
gc / ms is one of the highest sensitivity analysis techniques , whose limit of detection can easily reach picogram ( 10 ) and provide available standard mass spectral data library [ 2123 ] . in this paper ,
the processed rc was employed as sample to investigate whether the alkaloids content and composition were changed .
the crude rc was processed according to the standard method of chinese pharmacopoeia compiled by pharmacopoeia commission of ministry of the health of china as processed rc sample .
the processed rc samples were extracted in soxhlet extractor with methanol , and the crude rc sample , as control , was extracted with two different solvents , methanol and acetone .
a comparison of the differences and similarities between the processed rc and the crude rc on the alkaloids was performed for both qualitative and semiquantitative analyses .
the plant materials were provided from traditional chinese medicine institute of heibei university and authenticated by pharmacist xianmao liang .
the chemicals purchased from a local chemical company ( hua xin , baoding , china ) were of analytical reagent grade and included methanol ( meoh ) , acetone ( ac ) , dichloromethane , and sodium hydroxide .
acetic acid and hydrochloric acid ( 12 mol / l ) were also purchased from the local chemical company .
briefly , 10 g of rc was immersed in a beaker ( 50 ml ) with acetic acid solution ( 30 ml , 36% ) .
then the processed rc was extracted in soxhlet extractor with 150 ml of meoh / h2o ( 4/1 ; v / v ) until the extracting solution was colorless . after getting rid of the methanol by water bathing , the residual extracting solution ( 30 ml ) was added to isopycnic hcl solution ( 12 mol / l ) .
the mixture ( 60 ml ) was refluxed for 1 h and extracted with dichloromethane ( 20 ml 3 ) in a separatory funnel to be degreased after cooling to room temperature . the degreased solution ( 60 ml )
the filtrate ( 60 ml ) was extracted with dichloromethane ( 20 ml 3 ) .
10 ml of the organic phase was transferred to a tube ( 10 ml ) and evaporated to dryness under a n2 stream .
the residue was dissolved with 1.0 ml of acetone , marked s1 , and then stored in 20c for further gc / ms analysis .
the extractions of the crude rc with methanol and acetone were the same as described above except that the drug had not undergone processing .
the methanol and acetone extracts of rc were marked s2 and s3 , respectively , and stored in 20c for further gc / ms analysis .
gc / ms was performed on an agilent 7890a gc plus equipped with an 5975c mass / selective detector ( agilent technologies ) . a fuse silica capillary column , hp-5-ms , with 5%-phenyl methylpolysiloxane as no - polar stationary phase ( 30 m 0.25 mm i.d .
0.25 mm film thickness , agilent technologies ) was utilized for analysis of alkaloids obtained from the processed rc and the crude rc .
the temperature was increased at a rate of 40c / min to 110c and then at a rate of 8c / min to 260c and held there for 10 min . purified helium gas at a flow rate of 1 ml / min was used as the gc carrier gas in constant flow fashion . each sample ( 1 l )
was injected into the column using a 60 : 1 split injection and solvent delay time was 3 min .
the mass spectrometer was operated in the electron impact ( ei ) mode with an electron energy of 70 ev ; ion source temperature , 230c ; quadrupole temperature , 150c ; mass range , m / z 38550 ; scan rate , 0.25 s / scan ; em voltage , 1423 v ; and the gc / ms transfer line was set to 280c .
the processed rc sample was claybank via extraction in soxhlet extractor and the crude rc samples were faint yellow .
an important feature is the cleanup of samples prior to gc / ms analysis because the presence of matrix interference leads to ion suppression or enhancement in many cases [ 25 , 26 ] .
the chromatographic distillate components before 19 min ( not shown in figure 1 ) are the constituents with low boiling point like alkane , ester , alcohol , ketone , and fatty acid , which are the residual in the degreased process .
the alkaloids , however , with higher boiling points and lower vapor pressures were eluted after 19 min . as figure 1 showed , the components of s1 eluted after 19 min are less than those of s2 and s3 obviously .
more than ten peaks were eluted after 19 min from the crude samples s2 and s3 .
the retention times of the peaks were the same but the heights of peaks were not equal due to the different concentration between s2 and s3 , whereas there were only a few peaks eluted from s1 .
the processed sample s1 had obvious differences to the crude samples s2 and s3 , which indicated that the constituents with high boiling point eluted after 19 min were related more to the processing of the sample rather than to the extraction solvent , which led to content changes and chemical rearrangements of alkaloid components .
the identifications of the alkaloid components were based on computer matching of their mass spectral fragmentation patterns with those stored in the spectrometer database using the national institute of standards and technology mass spectral database ( nist - ms , 2008 ) and artificial interpreting of their fragmentation patterns .
table 1 showed that a total of 13 kinds of alkaloids including corydaline , glaucine , canadine , and protopine were identified from the crude and processed rc samples .
they have two backbone structures to constitute two series of alkaloids ( figure 2 ) . among them , there were two chromatographic peaks ( retention times 20.288 and 28.257 ) with extremely similar mass spectral fragmentation , hence with the same searching result . the latter peak ( 28.257 ) with higher match degree
was identified as the search result isoquino [ 2.1-b ] isoquinoline , 4b,5,10,10a,11,12-hexahydro-2-hydroxy-3,8,9-trismethoxy- , and the former peak was identified as isomer of the latter .
there was no matching with corydaline in mass spectral database ( nist - ms , 2008 ) .
the mass spectral data of corydaline were mostly carried out using esi model due to the poor volatilization of corydaline . with rare fragment ion ,
hence , esi mass spectral data was not identified through mass spectral library search . fortunately , rueffer et al .
had performed the study to probe into a biosynthesis path of these alkaloids using c13 markers , in which themass spectrum ofthalictricavine , very similar to corydaline , was provided using ei model ( figure 3(a ) ) .
it indicated that the based fragment ion was m / z 178 ( base peak ) which was cleaved from piperidine ( figure 3(b ) ) .
figure 4 was the mass spectrum ( ei ) of chromatographic peak p4 ( 26.426 ) and p5 ( 26.485 ) .
as figure 4 showed that the base peak of mass spectrum for both p4 and p5 is m / z 178 and the second base peaks are different , p4 is m / z 355 , not the molecule ion , and p5 is m / z 369 , the molecule ion .
the compound of p4 was identified as corydaline according to the research by rueffer et al . . and the p5 was identified as conformational isomer of corydaline .
this outcome was backed not only by mass spectral data but also by the retention time .
the difference of retention time between two peaks was about 3.6 s. it indicated that conformational change happened with corydaline when the rc was processed .
a simple acid bath of rc was capable of the conformation conversion of corydaline , which illustrated that the threshold battery of conformation conversion for corydaline was low ; and the traditional processing herbal medicine procedure was efficient in reducing their toxicity .
although gc / ms total ion chromatograms ( after 19 min ) of crude cr samples s2 and s3 were similar to each other , the relative content of component was different .
table 2 was the relative contents of alkaloids in the crude rc samples s2 and s3 .
the contents of eluted alkaloids in s2 were higher than those in s3 except 4 , 6 , and 11 # peaks .
the most relative content component in s2 and s3 was 10 # peak , which was not fully separated and contained two components .
the different oven programs were performed to improve their separation , but the outcome was not as expected .
the crude rc and processed rc were qualitatively and semiquantitatively analyzed using gas chromatography - mass spectrometry ( gc / ms ) method .
the totals of 13 kinds of alkaloids were identified , in which 11 kinds of alkaloids were from the crude rc sample and two were from the processed rc sample .
the 13 kinds of alkaloids are all from two backbone structures forming two series of alkaloids .
most of the alkaloids in crude rc were not detected and the corydaline had been changed in conformation after the rc had undergone processing , which provided support for the conclusion of reducing toxicity in the traditional drugs treatment process . | the alkaloids in the processed rhizoma corydalis and the crude rhizoma corydalis were qualitatively and semiquantitatively analyzed using gas chromatography - mass spectrometry ( gc / ms ) method .
the processing herb drug procedure was carried out according to the standard method of chinese pharmacopoeia .
the samples were extracted using soxhlet extractor with different solvents : methanol and acetone . the extraction effect on different solvents was investigated .
the results showed that 11 kinds of alkaloids were identified from the crude rhizoma corydalis and only two were from the processed rhizoma corydalis .
a total of 13 kinds of alkaloids were all based on two backbones .
the alkaloids in the processed sample were less than those in the crude rhizoma corydalis significantly , while almost the corydaline has been changed in conformation after the sample had undergone processing , which provided support for the conclusion of reducing toxicity when the herbal medicine having been undergone a traditional drugs treatment process . | 1. Introduction
2. Experiment
3. Results and Discussion
4. Conclusion |
thallus grayish green to whitish , sometimes dark to olive green when wet , continuous , slightly cracked when dry , 0.3~1.2 mm thick , surface even , marginal part usually thinner than the thallus center .
apothecia abundant , clustered and sessile , but sunken in thallus when young , 0.5~1.5 mm in diameter when mature , disk black , covered with white pruina .
hymenium 70~110 m high , epithecium brown to dark brown , subhymenium 20~40 m high , exciple dark brown to blackish in marginal part , lighter brown within .
stictic acid ( main ) , cryptostictic acid , constictic acid , and norstictic acid . habitat .
rather common , widely distributed all over south korea , found in altitudes from sea level up to 1,600 m. world distribution .
eastern to southeastern asia , europe , and north america [ 5 , 9 , 10 ] . remarks .
it is the only pruinose porpidia species in south korea . by having a thick and smooth thallus , as well as large apothecia and thick whitish pruina
this species was not found during our study , but it has been reported by moon on mt .
the species is characterized by having thin thallus ( less than 0.5 mm ) , short hymenium ( 60~90 m high ) , small spores ( 10~17 m long ) , small and numerous apothecia ( less than 1 mm in diameter ) , and non - pruinose black disk .
it is similar with p. macrocarpa but differs in having smaller spore size , hymenium height , and apothecia size .
it has been reported all over the world , from temperate to alpine or arctic climates .
thallus greenish gray to whitish gray , sometimes partly orange , epilithic or less frequently endolithic , smooth or rugulose in some old parts , rather thin , 0.1 to 0.5 mm in diameter .
apothecia abundant and clustered , sessile in mature thallus , sunken when young , 0.5~ 2.0 ( ~3.0 ) mm in diameter , black or dark brown , disk non - pruinose , usually flat .
hymenium 70~100 m high , epithecium usually olive brown , subhymenium 20~40 m high , exciple composed of elongated cells radiating from hypothecium , dark brown to blackish in margin and paler within . spores ellipsoid , 18~23 6~9 m . chemistry .
rare , it is found only in gangwon province at an altitude around 800~1,200 m. world distribution .
asia , europe , and north america [ 9 , 10 , 12 ] . remarks .
the species might be confused with p. crutulata when its apothecia are small , but it has a higher hymenium and larger spores ( usually around 20 m long ) , whereas p. crustulata has spores always shorter than 17 m .
some p. albocaerulescens specimens with unclear pruina on disk might be confusing , but p. macrocarpa has much thinner thallus , smaller spores , and darker exciple .
eungbok , hongcheon - gun , gangwon prov . , 3751'359 " n , 12830'974 " e , alt . | taxonomic study of the crustose lichen porpidia was performed in this paper .
three species are described , including two recorded species and one new record : porpidia macrocarpa ( dc . ) hertel & a. j. schwab . a description of each species is presented along with morphological , anatomic , and chemical characteristics .
a key to the identification of species of porpidia is also presented . | Taxonomic Treatment of the Species
The Species |
acute viral bronchiolitis is one of the most frequent causes of hospitalization in infants worldwide.1 aside from the significant financial burden it causes in developed countries,2 the condition is responsible for many deaths attributed to respiratory infections in developing nations.3 respiratory syncytial virus ( rsv ) is the major etiological agent responsible for bronchiolitis and is identified in 70% of bronchiolitis cases during the fall and winter.1 parainfluenza ( piv ) , adenovirus , and influenza are frequently described as occurring year - round.4 the recent widespread use of molecular - based methods has yielded new insights about the etiology of bronchiolitis and has suggested a significant role for other viruses , such as human metapneumovirus,5 rhinovirus,6 and coronaviruses , in bronchiolitis.7 currently , controversy exists regarding whether the presence of these viruses increases the severity of rsv .
either way , the impact of coinfections , in general , is still unclear.8 - 10 recent studies examining the etiology of bronchiolitis in infants have reported high rates of viral detection.10 - 12 however , these studies have been limited to hospital - admitted patients , which may lead them to over- or underestimate the true significance of the roles that different viral etiologies may play in determining the severity of bronchiolitis . in this study , we investigated which viruses and risk factors are associated with hospital admission and admission to the intensive care unit ( icu ) in infants with acute bronchiolitis .
this study involved a prospective cohort of 77 infants seeking medical attention on business days between 7:00 am and 5:00 pm at the emergency unit of hospital israelita albert einstein in so paulo , brazil , between march 1 , 2006 , and july 30 , 2007 .
the hospital israelita albert einstein is a private institution that mostly treats people of a high socioeconomic status . to be included in the study ,
patients had to be under two years of age and have exhibited symptoms of acute bronchiolitis for no longer than five days .
bronchiolitis was defined as the first episode of wheezing associated with signs of an upper respiratory tract infection .
a structured questionnaire was given to parents or caregivers to obtain information regarding atopy in the family ( i.e. , asthma , allergic rhinitis , or atopic dermatitis ) , day care attendance , exposure to environmental tobacco smoke or pets , existence of siblings , and pre - existing conditions such as prematurity , cardiopathy , or gastroesophageal reflux .
vital signs , including pulse oximetry ( nellcor oximax n-65 , covidien , mansfield , ma , usa ) and respiratory rate , were obtained from all patients by an attending nurse .
a detailed clinical examination was performed by the pediatrician , who then filled out the respiratory distress assessing instrument ( rdai)13 and made all treatment decisions .
the rdai assesses wheezing and respiratory distress on a scale from 0 to 17 , with higher scores indicating more severe illness , and has good interobserver reliability .
nasopharyngeal aspirates were obtained by a respiratory therapist by the instillation of 1 ml of saline in each nostril and gentle suction with a silicone catheter .
nasopharyngeal aspirate samples were volume - adjusted with saline to 3 ml , and six different aliquots were stored at -70c .
nucleic acid extraction was performed with a qiamp viral rna mini kit ( qiagen , hamburg , germany ) according to the manufacturer 's instructions .
reverse transcription was performed with a high capacity cdna archive kit ( applied biosystems , foster city , ca , usa ) according to the manufacturer 's instructions using 20 l of the previously extracted rna .
the beta - actin gene was amplified from cdna for all samples14 for quality assurance of the sample collection and rna extraction / cdna synthesis .
detection of adenovirus,15 human bocavirus,16 human coronavirus ( including hcov - nl63 and hcov - hku1),17 and human metapneumovirus18 was performed by conventional pcr or rt - pcr according to previously published protocols .
identification of rsv,19 influenza a and b,20 parainfluenza 1 , 2 , and 3,20 rhinovirus , and enterovirus 21 was performed by real - time rt - pcr as previously described.19 - 21 all assays included positive ( either wild - type virus or a plasmid carrying the target sequence ) and negative controls ( no dna or cdna added ) .
conventional pcr and rt - pcr were performed in a ptc-200 ( mj research , waltham , ma , usa ) or mastercycler gradient ( eppendorf , hamburg , germany ) thermocycler ; bands were visualized via 1.5% agarose gel electrophoresis and stained with ethidium bromide 0.5 mg / ml .
real - time rt - pcr was performed in an abi 7300 ( applied biosystems , foster city , ca , usa ) .
a hospital admission was counted when the patient remained in the hospital for longer than 12 hours .
patients were hospitalized if their oxygen saturation on room air remained lower than 93% or if significant respiratory distress persisted after initial treatment in the emergency unit .
admission to the intensive care unit ( icu ) was determined by clinical criteria , such as the need for assisted ventilation or close cardiorespiratory monitoring .
descriptive analysis calculation of percentages , averages , standard deviations , medians , and ranges for demographic variables and virological results .
univariate and multivariate logistic regression models were used to identify clinical and virological variables associated with the main endpoints ( hospital admission and admission to the icu ) .
differences between means of continuous variables were calculated using anova for normally distributed data and a kruskal - wallis test otherwise .
approval for the study was obtained from the ethics committee of hospital israelita albert einstein .
the beta - actin gene was amplified from cdna for all samples14 for quality assurance of the sample collection and rna extraction / cdna synthesis .
detection of adenovirus,15 human bocavirus,16 human coronavirus ( including hcov - nl63 and hcov - hku1),17 and human metapneumovirus18 was performed by conventional pcr or rt - pcr according to previously published protocols .
identification of rsv,19 influenza a and b,20 parainfluenza 1 , 2 , and 3,20 rhinovirus , and enterovirus 21 was performed by real - time rt - pcr as previously described.19 - 21 all assays included positive ( either wild - type virus or a plasmid carrying the target sequence ) and negative controls ( no dna or cdna added ) . conventional pcr and rt - pcr
were performed in a ptc-200 ( mj research , waltham , ma , usa ) or mastercycler gradient ( eppendorf , hamburg , germany ) thermocycler ; bands were visualized via 1.5% agarose gel electrophoresis and stained with ethidium bromide 0.5 mg / ml .
real - time rt - pcr was performed in an abi 7300 ( applied biosystems , foster city , ca , usa ) .
a hospital admission was counted when the patient remained in the hospital for longer than 12 hours .
patients were hospitalized if their oxygen saturation on room air remained lower than 93% or if significant respiratory distress persisted after initial treatment in the emergency unit .
admission to the intensive care unit ( icu ) was determined by clinical criteria , such as the need for assisted ventilation or close cardiorespiratory monitoring .
data were analyzed using spss version 15.0 ( spss inc . , chicago , il , usa ) .
descriptive analysis calculation of percentages , averages , standard deviations , medians , and ranges for demographic variables and virological results .
univariate and multivariate logistic regression models were used to identify clinical and virological variables associated with the main endpoints ( hospital admission and admission to the icu ) . only variables with p<0.25 in the univariate analysis
differences between means of continuous variables were calculated using anova for normally distributed data and a kruskal - wallis test otherwise .
approval for the study was obtained from the ethics committee of hospital israelita albert einstein .
all patients lived in an urban area , 65% were male , and the median age was 64 months ; nearly half of the infants were younger than six months .
almost 3/4 of the patients had at least one close relative ( mother , father , or brother ) with reported atopy .
twelve patients were preterm ( less than 37 weeks of gestation ) , most of whom ( 8 out of 12 ) were near - term ( 35 to 37 weeks ) infants . on admission , most patients had bronchiolitis of moderate severity , with a median rdai score of six , but no significant difference in the severity score was observed between age groups ( 0 - 6 months , 6 - 12 months , and > 12 months ) .
treatment included nebulized beta - agonists in 83% and systemic steroids in 46% of the patients ; 32 patents ( 41.5% ) required hospital admission , and 8 were admitted to the icu .
the overall mean length of stay in the hospital was 3.9 days , but a significantly increased length of stay was observed among patients admitted to the icu ( 6.4 days , p = 0.012 , kruskal wallis test ) .
at least one viral agent was identified in 72 samples ( 93.5% ) ; rsv was the most frequently detected agent , followed by rhinovirus , enterovirus , and human metapneumovirus ( table 2 ) .
single agents ( mostly rsv ) were identified in 38 samples , whereas coinfections were observed in 34 cases ( 44% ) and primarily involved rhinovirus and enterovirus .
up to four different agents were identified in some samples ( table 2 and figure 1 ) . after adjusting the multivariate model ,
the main variables associated with hospital admission were age , atopy in a first - degree relative , and the identification of enterovirus ( table 3 ) .
identification of rsv showed a significant association in the univariate analysis , but this effect was not detected after including other variables in the model .
age had an odds ratio of 0.838 , meaning that an older age led to a decrease in hospital admissions ; atopy in the family showed a similar protective effect .
identification of enterovirus in the samples was associated with an increased hospital admission rate ( table 3 ) .
gender , lack of siblings , prematurity , day care attendance , having relatives with asthma , tobacco exposure , and the identification of any other viruses were also investigated for possible associations with hospital admission rates . with regard to admission to the icu , we investigated the same variables described above and found prematurity to be a significant risk factor , with an odds ratio of 24.512 ( 95% ci : [ 3.214 186.925 ] , p = 0.002 ) .
an assessment of the impact of coinfections on hospital admissions for each viral agent was feasible only for rsv due to the high number of single infections ; we did not find an association between coinfections and hospital or icu admissions .
when considering all viral infections , we found that coinfections did not result in an increase in hospital admissions .
we identified a high rate of viruses and coinfections among patients presenting to our emergency department with bronchiolitis .
we identified at least one virus in 93.5% of patients , and coinfections were found in nearly 40% of patients .
these findings indicate that molecular - based approaches result in high rates of viral identification but do not change the significant role of rsv in this condition . a high rate of hospital admission was found ( 40% ) , and younger age and the presence of enterovirus were associated with an increased risk of admission .
conversely , reported atopy in a close relative showed a protective effect for this same endpoint .
this high rate of hospital admissions may be related to the study design because all patients were seen in the emergency department and not as outpatients .
recently published studies regarding the etiology of bronchiolitis have reported high detection rates of respiratory viruses ranging from 90% to 96%,9,10,12 but these studies have included only hospitalized patients .
previous studies performed using different combinations of techniques have reported lower frequencies of coinfection.8 the high frequency of coinfections found in our study is probably related to the higher sensitivity of the molecular approach adopted in this study . this hypothesis is supported by miron et al.,10 who used the same method for rhinovirus detection21 and reported a coinfection rate of nearly 30%.10 another advantage of the rt - pcr approach employed in this study is its ability to identify the recently described genotype of human rhinovirus , namely rhinovirus c , which has been associated with a greater clinical impact.22,23 rsv was the most common virus found in single - virus infections , whereas rhinovirus , the second most frequently identified virus , was mainly found in coinfections ; these results are in agreement with previous findings.10,12 due to the large number of coinfections and the small number of children in each viral category of our study , a comprehensive analysis of the impact of each virus identified in coinfections was not feasible .
however , we observed that the detection of rsv in either a single - virus infection or a coinfection did not differ between hospital and icu admissions .
richard et al . 9 reported an increased risk of admission to the icu when a dual viral infection was found , but the population in their study included many premature infants and children with underlying chronic illnesses .
marguet et al.12 did not find a difference in bronchiolitis severity in patients infected with single - virus rsv infections compared to those with rsv - rhinovirus coinfections .
the only differences identified were a reduction in the length of stay when an associated rhinovirus infection was present and that patients with a single - virus rhinovirus infection had milder presentations.12 interestingly , the identification of enterovirus , but not rsv , showed a significant association with hospital admissions in the multivariate model even though an enterovirus single - virus infection was found in only one patient .
jacques et al.24 reported a high rate of hospitalization among infants infected with enterovirus with a clinical diagnosis of bronchiolitis , but this finding may be biased by an etiological criterion in the inclusion criteria for the study .
the associations of younger age with an increased risk of hospital admissions and of prematurity with admission to the icu were expected .
the former partially justifies our high rate of hospital admissions because nearly half of our patients were younger than six months of age .
airflow resistance critically depends on airway caliber , so very young children are more prone to respiratory failure .
prematurity is a well - known risk factor for severe bronchiolitis in this population and is the main reason for administering prophylaxis with monoclonal anti - rsv antibodies.25 besides the risk of apnea and the need for cardiorespiratory monitoring of these children , it has been shown that a significant reduction in expiratory flow is present in prematurely born children , and this flow limitation remains for at least the first two years of life.26 however , the prematurity risk we found ( or = 24 ) for icu admissions is most likely overestimated due to the small number of infants admitted to the icu during the course of our study .
the protective risk of familial atopy for hospital admissions , although also reported by others,27 may be related to the high socioeconomic level of the population studied . in conclusion
, we identified at least one virus in 93.5% of infants with bronchiolitis as well as a high rate of coinfections , mainly due to rhinovirus and enterovirus .
major risk factors for hospital admission included younger age and enterovirus infection , whereas familial atopy had a protective effect , and prematurity was a significant risk factor for icu admission .
the increasing recognition of coinfections in acute bronchiolitis may impact the design and sample size of future studies in this field .
we thank all of the pediatricians , nurses , physiotherapists , and technicians of the emergency unit of hospital israelita albert einstein for their kind assistance during data collection .
we also thank angela tavares paes for assistance with statistics and marcia triunfol of publicase for manuscript suggestions and review .
funding : this work was fully supported by the sociedade beneficiente israelita brasileira hospital israelita albert einstein . | objectives : to determine the viruses and risk factors associated with hospital and intensive care unit ( icu ) admissions in infants with acute bronchiolitis.introduction:bronchiolitis is a major cause of morbidity in infants .
widespread use of molecular - based methods has yielded new insights about its etiology , but the impact of viral etiologies on early outcomes is still unclear.methods:seventy-seven infants with bronchiolitis who were under two years of age and visited an emergency unit were included . using molecular - based methods ,
samples were tested for 12 different respiratory viruses .
logistic regression models were used to identify clinical and virological variables associated with the main endpoints : hospital admission and icu admission.results:we identified at least one virus in 93.5% of patients , and coinfections were found in nearly 40% of patients .
rsv was the most common pathogen ( 63.6% ) , followed by rhinovirus ( 39% ) .
identification of rsv was only associated with an increased risk of hospital admission in the univariate model .
younger age and enterovirus infection were associated with an increased risk of hospital admission , while atopy of a first - degree relative showed a protective effect .
prematurity was associated with an increased risk of admission to the icu .
coinfections were not associated with worse outcomes.conclusions:molecular-based methods resulted in high rates of viral identification but did not change the significant role of rsv in acute bronchiolitis .
younger age and enterovirus infection were risk factors for hospital admission , while prematurity appeared to be a significant risk factor for admission to the icu in acute viral bronchiolitis . | INTRODUCTION
PATIENTS AND METHODS
Identification of respiratory viruses
Study endpoints
Statistics
RESULTS
DISCUSSION
ACKNOWLEDGEMENTS
FUNDING |
bladder cancer is one of the most common malignancies in humans , with an estimated 72 570 new cases and 15 210 deaths in the united states in 2013 , and is a common disease in china . of newly diagnosed bladder cancer cases ,
more then 90% are transitional cell carcinoma on histology , and over 70% of new cases are non - muscle - invasive tumors .
these non - muscle - invasive tumors can be treated by transurethral resection ; unfortunately , most of these will relapse after initial curative treatment , and 1020% will progress to muscle - invasive disease .
recurrence and progression are the main characteristics of bladder cancer , and it is a serious challenge to identify patients with high risk of recurrence and progression who need more aggressive treatment , and those with low risk needing less intensive surveillance after initial adequate therapy . because bladder cancer is a heterogeneous disease , pathologically similar tumors can behave differently .
bladder cancer arises from the accumulation of genetic and epigenetic changes that lead to the activation of proto - oncogenes , or silencing of tumor suppressor genes .
dna methylation , the most common and best - characterized epigenetic change , mainly occurs in cytosine guanine dinucleotide - rich areas , known as cpg islands , in the promoter regions .
aberrant dna methylation is a crucial mechanism of silencing tumor suppressor genes , and plays an important role in the initiation and progression of human tumors [ 911 ] . for these reasons
, aberrant dna methylation can be used as useful biomarkers in human tumors , especially when the methylation silences tumor suppressor genes . in recent years
, the association of cdh13 with human tumors has been proposed , including bladder cancer .
cdh13 , a novel tumor suppressor gene , belongs to the cadherin family and is frequently inactivated by aberrant promoter methylation in human tumors . in previous studies , we reported that cdh13 is frequently inactivated by promoter methylation in bladder cancer , and cdh13 methylation is a potential biomarker for the malignancy of bladder cancer and independently predicting the worse outcomes of patients with bladder cancer [ 1316 ] .
our previous findings led us to investigate the clinical significance of cdh13 methylation in nmibc . in the current study ,
in addition , we also assessed the relationship between cdh13 methylation and recurrence and progression in nmibc .
a total of 178 consecutive patients with nmibc who received transurethral resection were included in the current study , from september 2004 to september 2007 , at the department of urology , third hospital of hebei medical university .
the criteria for the enrollment of patients with nmibc were histopathological diagnosis of bladder transitional cell carcinoma for the first time , no history of other malignant tumors , and not receiving any form of anti - cancer treatment prior to surgery .
patients with incomplete follow - up data were excluded to make the study more robust .
all tumors were graded and staged according to the 1973 who grading system and the 7 edition of the tumor lymph node metastasis ( tnm ) classification by experienced pathologists in our department [ 1719 ] .
the nmibc includes ta , t1 , and tis ; and muscle - invasive bladder cancer includes t2 , t3 , and t4 .
the tumor treatment and follow - up strategies were performed according to international guidelines on bladder cancer [ 1720 ] .
patients with intermediate - risk or high - risk disease received 1 cycle of intravesical treatment using mitomycin - c , and no patients received a maintenance schedule .
recurrence was defined as a new tumor observed in the bladder after initial curative resection , and progression was defined as a disease with a higher tnm stage when relapsed within 5 years [ 2125 ] .
recurrence - free survival was defined as the time form the initial surgery to the date of the first documented bladder cancer relapse , and progression - free survival was defined as the time form the initial surgery to the date of the first documented bladder cancer progression .
the samples of normal bladder epithelium were obtained from 38 in - patients with bladder stones ; these samples were examined pathologically to exclude the possibility of incidental tumors .
all of the samples were quickly frozen in liquid nitrogen and stored at 80c until used .
this study was approved by the ethics committee of the third hospital of hebei medical university . written informed consent was obtained from each participant .
genomic dna was extracted from frozen tissues using the dneasy tissue kit ( qiagen , valencia , ca ) following the manufacturer s instructions .
the genomic dna was treated with bisulfite using the epitect bisulfite kit ( qiagen , valencia , ca ) according to the manufacture s protocol .
the methylation status of cdh13 was examined using primers specific for unmethylated and methylated cdh13 sequences , as we previously reported .
the following primers were used : unmethylated : forward 5-ttgtggggttgttttttgt-3 and reverse 5-aacttttcattcatacacaca-3 ; methylated : forward 5-tcgcggggttcgtttttcgc-3 and reverse 5-gacgttttcattcatacacgcg-3. the cycling program involved preliminary denaturation at 95c for 5 min , followed by 33 cycles at 95c for 30 s , annealing at 60c for 1 min , and elongation at 72c for 1 min for the unmethylated reaction ; or 29 cycles at 95c for 30 s , annealing at 70c for 1 min , and elongation at 72c for 1 min for the methylated reaction , followed by a final step at 72c for 5 min , as we reported previously .
normal lymphocyte dna methylated in vitro with sssi methylase ( new england biolabs , beverly , ma , usa ) was used as a methylation positive control , and normal lymphocyte dna as an unmethylated positive control .
pcr products were separated in 2% agarose gel , stained with ethidium bromide , and visualized under ultraviolet illumination .
samples were scored as methylation - positive when methylated alleles were present in the methylated dna lane and methylation negative when bands were present only in the unmethylated dna lane .
fisher s exact test was used to assess the difference in cdh13 methylation status between bladder cancer patients and controls .
the chi - square test was used to assess the relationship between cdh13 methylation and clinicopathologic features .
kaplan - meier survival analysis and log - rank test were used to assess the differences in recurrence - free , progression - free , and 5-year overall survival between patients with cdh13 methylated and unmethylated .
the multivariate cox proportional hazard model analysis was used to assess the independent prognostic effect of cdh13 methylation .
statistical analysis was performed using sas version 8.0 ( sas institute , cary , n.c .
a total of 178 consecutive patients with nmibc who received transurethral resection were included in the current study , from september 2004 to september 2007 , at the department of urology , third hospital of hebei medical university .
the criteria for the enrollment of patients with nmibc were histopathological diagnosis of bladder transitional cell carcinoma for the first time , no history of other malignant tumors , and not receiving any form of anti - cancer treatment prior to surgery .
patients with incomplete follow - up data were excluded to make the study more robust .
all tumors were graded and staged according to the 1973 who grading system and the 7 edition of the tumor lymph node metastasis ( tnm ) classification by experienced pathologists in our department [ 1719 ] .
the nmibc includes ta , t1 , and tis ; and muscle - invasive bladder cancer includes t2 , t3 , and t4 .
the tumor treatment and follow - up strategies were performed according to international guidelines on bladder cancer [ 1720 ] .
patients with intermediate - risk or high - risk disease received 1 cycle of intravesical treatment using mitomycin - c , and no patients received a maintenance schedule .
recurrence was defined as a new tumor observed in the bladder after initial curative resection , and progression was defined as a disease with a higher tnm stage when relapsed within 5 years [ 2125 ] .
recurrence - free survival was defined as the time form the initial surgery to the date of the first documented bladder cancer relapse , and progression - free survival was defined as the time form the initial surgery to the date of the first documented bladder cancer progression .
the samples of normal bladder epithelium were obtained from 38 in - patients with bladder stones ; these samples were examined pathologically to exclude the possibility of incidental tumors .
all of the samples were quickly frozen in liquid nitrogen and stored at 80c until used .
this study was approved by the ethics committee of the third hospital of hebei medical university . written informed consent was obtained from each participant .
genomic dna was extracted from frozen tissues using the dneasy tissue kit ( qiagen , valencia , ca ) following the manufacturer s instructions .
the genomic dna was treated with bisulfite using the epitect bisulfite kit ( qiagen , valencia , ca ) according to the manufacture s protocol .
the methylation status of cdh13 was examined using primers specific for unmethylated and methylated cdh13 sequences , as we previously reported .
the following primers were used : unmethylated : forward 5-ttgtggggttgttttttgt-3 and reverse 5-aacttttcattcatacacaca-3 ; methylated : forward 5-tcgcggggttcgtttttcgc-3 and reverse 5-gacgttttcattcatacacgcg-3. the cycling program involved preliminary denaturation at 95c for 5 min , followed by 33 cycles at 95c for 30 s , annealing at 60c for 1 min , and elongation at 72c for 1 min for the unmethylated reaction ; or 29 cycles at 95c for 30 s , annealing at 70c for 1 min , and elongation at 72c for 1 min for the methylated reaction , followed by a final step at 72c for 5 min , as we reported previously .
normal lymphocyte dna methylated in vitro with sssi methylase ( new england biolabs , beverly , ma , usa ) was used as a methylation positive control , and normal lymphocyte dna as an unmethylated positive control .
pcr products were separated in 2% agarose gel , stained with ethidium bromide , and visualized under ultraviolet illumination .
samples were scored as methylation - positive when methylated alleles were present in the methylated dna lane and methylation negative when bands were present only in the unmethylated dna lane .
fisher s exact test was used to assess the difference in cdh13 methylation status between bladder cancer patients and controls .
the chi - square test was used to assess the relationship between cdh13 methylation and clinicopathologic features .
kaplan - meier survival analysis and log - rank test were used to assess the differences in recurrence - free , progression - free , and 5-year overall survival between patients with cdh13 methylated and unmethylated .
the multivariate cox proportional hazard model analysis was used to assess the independent prognostic effect of cdh13 methylation .
statistical analysis was performed using sas version 8.0 ( sas institute , cary , n.c .
in the current study , the methylation status of cdh13 in bladder cancer tissues and normal bladder epithelial tissues was measured by msp , cdh13 methylation was detected in 44.9% ( 80/178 ) bladder cancer patients , but no methylation was detected in controls , and the difference between these 2 groups was statistically significant ( p<0.0001 ) .
then we linked the methylation status of cdh13 to clinicopathologic characteristics of patients with bladder cancer , and found that cdh13 methylation was correlated with high grade ( p=0.0186 ) , advanced stage ( p=0.0001 ) , larger tumor size ( p=0.0002 ) , tumor recurrence ( p<0.0001 ) , and progression ( p=0.0077 ) ; but no association was found between cdh13 methylation and age , sex , or tumor number ( table 1 ) .
moreover , patients with cdh13 methylation in tumor tissues exhibited significantly shorter recurrence - free survival ( log - rank test , p<0.0001 , figure 1 ) and progression- free survival ( log - rank test , p=0.0060 , figure 2 ) than patients with cdh13 unmethylated .
multivariate cox proportional hazard model analysis was performed to examine the predictive value of cdh13 for tumor recurrence and progression .
surprisingly , cdh13 methylation in bladder cancer tissues independently predicted nmibc recurrence ( p=0.0043 ) and progression ( p=0.0016 ) ( tables 2 and 3 ) .
bladder cancer is a common human malignancy and is notorious for its high frequency of recurrence and progression after initial curative treatment . in nmibc ,
tumors with similar morphology may behave differently , and it is difficult to predict which tumor will relapse and/or progress after initial therapy , which is a serious problem for clinical decision - making , and new biomarkers are needed beyond the conventional clinicopathologic parameters . in recent years , there is increasing interest in the utilization of methylation markers , as aberrant dna methylation is a major characteristic of bladder cancer and plays a crucial role in tumor initiation and progression . to identify these methylation markers , we focused on the aberrant methylation of cdh13 .
cdh13 , a novel tumor suppressor gene belonging to the cadherin family , plays a crucial role in processes such as cell - cell adhesion , tumor proliferation , and invasion .
the human cdh13 gene is mapped to the 16q24 chromosome , which is often inactivated by aberrant promoter hypermethylation in human cancers , including bladder cancer . in our previous studies
, we reported that aberrant cdh13 methylation contributed to its silencing in bladder cancer and associated unfavorable tumor features , including advanced stage , higher grade , larger tumor size , and worse outcomes [ 1316 ] .
however , the sample populations in these studies included both nmibc and muscle - invasive bladder cancer patients , and the clinical significance of cdh13 methylation in nmibc needs to be further elucidated . in the current study
, we examined the methylation status of cdh13 using msp , in tissue samples collected from nmibc patients and controls , and then correlated with clinicopathologic features and outcomes of bladder cancer cases .
msp is a useful method for methylation detection ; it is rapid , simple , sensitive , specific , cost - effective , and allows rapid examination of multiple samples , which is convenient for routine clinical practice .
cdh13 methylation was detected in 80 ( 44.9% ) bladder cancer patients , but no methylation was found in controls , indicating that cdh13 methylation is tumor - specific , is an early event in bladder tumorigenesis , and may be involved in the recurrence and/or progression of bladder cancer .
subsequently , we grouped the patients into 2 categories according to the methylation status of cdh13 , and we found that cdh13 methylation was significantly correlated with advanced stage , high grade , larger tumor size , and tumor recurrence and progression ; these are all unfavorable features of bladder cancer and are commonly used to predict the outcomes of patients clinically . to investigate the value of cdh13 methylation in predictive the recurrence and progression of nmibc , kaplan - meier survival analysis and log - rank test were performed , respectively . to our surprise , patients with cdh13 methylated showed shorter recurrence - free survival and progression - free survival than patients with cdh13 unmethylated .
moreover , multivariate cox proportional hazard model analysis suggests that cdh13 methylation independently predicts the recurrence and progression of nmibc after initial curative treatment .
our result is similar with that of a previous report on cdh13 methylation in primary lung cancer . in this
regard , cdh13 methylation in tumor samples after the initial transurethral resection is a reliable predictor of tumor recurrence and progression in nmibc .
it can be used to separate patients with high risk of recurrence and progression who require more aggressive adjuvant therapy from those with low risk of recurrence and progression who need less intensive surveillance ; this is very important for clinical decision - making . to the best of our knowledge ,
one of the strengths of the present study is the relatively large study population ; another is that this work was performed within a homogenous study population that included only nmibc patients .
the major limitation of the current study is that this was a single - center study , and future studies are needed to confirm our findings before being used routinely in clinical practice .
in conclusion , our data demonstrate that cdh13 methylation occurs frequently in nmibc , is associated with unfavorable tumor features , should be used as an independent predictor for the recurrence and progression of nmibc , and may facilitate the design of personalized therapeutic modalities . | backgroundcdh13 is a novel tumor suppressor gene often inactivated by aberrant promoter methylation in human cancers .
previous studies have shown that cdh13 methylation correlated with advanced disease and poor prognosis in non - muscle invasive bladder cancer ( nmibc ) .
the aim of the current study was to investigate the correlations between cdh13 methylation and disease recurrence as well as progression of nmibc.material/methodsthe methylation status of cdh13 in 178 nmibc samples and 38 normal bladder epithelial tissues was examined by methylation - specific pcr ( msp ) , and then correlated with clinicopathological features.resultswe found that cdh13 methylation occurs frequently in nmibc , and significantly correlates with high grade , advanced stage , larger tumor size , and tumor recurrence and progression .
moreover , patients with methylated cdh13 exhibited significantly shorter recurrence - free survival ( p<0.0001 ) and progression - free survival ( p=0.0060 ) than patients with unmethylated cdh13 .
in addition , a multivariate cox proportional hazard model analysis suggests that cdh13 methylation is an independent predictor for the recurrence ( p=0.0043 ) and progression ( p=0.0016 ) of nmibc after initial transurethral resection.conclusionsour findings demonstrate that cdh13 methylation is a frequent event in nmibc , and is associated with unfavorable tumor features .
it should be used as an independent predictor for the recurrence and progression of nmibc , and may be useful for the design of individualized therapeutic modalities . | Background
Material and Methods
Patients and samples
DNA extraction, Bisulfite modification, and MSP
Statistical analysis
Results
Discussion
Conclusions |
impaired neurosteroid biosynthesis has been associated with numerous behavioral dysfunctions , which range from anxiety- and depressive - like behaviors to aggressive behavior and changes in responses to contextual fear conditioning in rodent models of emotional dysfunction ( pinna et al . , 2003 , 2004 , 2006 , 2008 ; uzunova et al . , 2004 , 2006 ; jain et al . , 2005 ; martin - garcia and pallares , 2005 ; kita and furukawa , 2008 ; daquila et al . , 2010 ; pinna , 2010 ) . in clinical studies , decreases in the serum , plasma , and cerebrospinal fluid ( csf ) content of neuroactive steroids , including the progesterone metabolite , allopregnanolone , which is a potent positive allosteric modulator of the action of -aminobutyric acid ( gaba ) at gabaa receptors ( puia et al . , 1990 , 2003 ;
, 2003 , 2009 ; belelli and lambert , 2005 ) , are associated with several psychiatric disorders such as depression , anxiety spectrum disorders , posttraumatic stress disorders ( ptsd ) , premenstrual dysphoric disorder , schizophrenia , and impulsive aggression ( rapkin et al .
, 1997 ; romeo et al . , 1998 ; uzunova et al . , 1998 ;
bloch et al . , 2000 ; nappi et al . , 2001 ; strhle et al . , 2002 ;
, 2006 ; rasmusson et al . , 2006 ; amin et al . , 2007 ; marx et al . , 2009
thus , endogenous allopregnanolone exerts the physiological role of regulating emotional behavior by a potentiation of the inhibitory signal of the neurotransmitter gaba at gabaa receptors that are widely distributed in the glutamatergic neurons of the cortex and limbic areas , such as the hippocampus and the amygdala .
allopregnanolone levels in the csf of patients with ptsd and unipolar major depression were approximately half of those measured in the csf of non - psychiatric patients ( uzunova et al . , 1998 ; rasmusson et al .
post - mortem studies confirmed that in depressed patients , the decrease of allopregnanolone is likely induced by a decrease in the expression of 5-reductase type i mrna in the prefrontal - cortex ( area ba9 ) compared with age- and sex - matched non - psychiatric subjects ( agis - balboa et al .
, 2010 ; for a biosynthetic representation of allopregnanolone from progesterone by the action of 5-reductase , please see figure 1 ) .
our clinical studies support the hypothesis of a block in the synthesis of allopregnanolone in some individuals with ptsd and depression .
this is also shown by the finding that allopregnanolone levels were the lowest among patients with comorbid ptsd and depression ( rasmusson et al . , 2006 ) .
interestingly , ptsd and major depressive disorder ( mdd ) are often comorbid and share multiple symptoms . whereas ptsd is defined as a type of anxiety disorder that can occur as a result of experiencing a traumatic event that involved the threat of injury or death ,
several epidemiological studies show that depression diagnosed after trauma exposure is almost always comorbid with ptsd , which suggests that comorbid ptsd / mdd may likely be considered as a more severe ptsd ( breslau et al . , 2002 ) .
in the brain , allopregnanolone is synthesized from progesterone by the sequential action of : ( i ) 5-reductase type i ( 5-ri ) , which reduces progesterone into 5-dihydroprogesterone ( 5-dhp ) and functions as the rate - limiting step enzyme in allopregnanolone biosynthesis ; and ( ii ) 3-hydroxysteroid dehydrogenase ( 3-hsd ) , which either converts 5-dhp into allopregnanolone ( reductive reaction ) or allopregnanolone into 5-dhp ( oxidative reaction ) .
17-(n , n - diisopropylcarbamoyl)-androstan-3,5-diene-3-carboxylic acid ( skf 105,111 ) is a potent competitive 5-ri inhibitor ( cheney et al . , 1995 ) .
s - norfluoxetine stimulates the accumulation of allopregnanolone likely by targeting 3-hsd ( griffin and mellon , 1999 ) .
p450 scc , p450 cholesterol side - chain cleavage ; 3-hsd , 3-hydroxysteroid dehydrogenase . in depressed patients , treatment with selective serotonin reuptake inhibitors ( ssris ) including fluoxetine and fluvoxamine normalized csf allopregnanolone content , which significantly correlated with the improvement in depressive symptoms ( uzunova et al . , 1998 )
these data suggested that a deficit of gabaergic neurotransmission , likely caused by a downregulation of brain allopregnanolone biosynthesis in corticolimbic glutamatergic neurons , should be among the molecular mechanisms considered in the etiology of depression and ptsd .
upregulation of allopregnanolone biosynthesis appears to be a novel mechanism for the therapeutic effects of ssris ( pinna et al . , 2009 ) ,
at least for the anxiolytic , antidysphoric , and antiaggressive effects of these drugs . likewise ,
neurosteroidogenic molecules that are unrelated to the ssri class of drugs , including the ligands of the 18 kda translocase protein ( tspo ) , which is involved in the transport of cholesterol across the inner mitochondrial membrane and activation of neurosteroidogenesis ( rupprecht et al . , 2010 ; schle et al . ,
these drugs exert their anxiolytic effects by increasing the brain levels of allopregnanolone but unlike benzodiazepines , are devoid of unwanted side effects , including sedation , tolerance , and withdrawal symptoms ( serra et al . , 1999 ;
the advantage of a new generation of non - benzodiazepine anxiolytics for the treatment of ptsd patients lies in the finding that ptsd patients fail to respond to the pharmacological effects of anxiolytic benzodiazepines ( gelpin et al .
interestingly , parallel investigations by several other laboratories have observed that in clinical studies , the brain - derived neurotrophic factor ( bdnf ) appears to play an important role in several psychiatric disorders , including ptsd and depression .
bdnf plays a pivotal physiological role by maintaining trophism in the adult brain , affecting dendritic spine morphology , branching and synaptic plasticity , and long - term potentiation ( ltp ) with important implications for learning and memory and emotional behavior ( egan et al . , 2003 ; nagahara and tuszynski , 2011 ) .
bdnf expressed in cortical and hippocampal pyramidal neurons can be released in the surrounding neuropil around cell bodies and dendrites and thus , becomes available for local utilization ( wetmore et al . ,
the synthesis and release of bdnf by these pyramidal neurons provides evidence for both a paracrine and an autocrine role for bdnf and establishes a local source of trophic support for the maintenance of synaptic plasticity in the mature brain ( wetmore et al . , 1994 ; waterhouse and xu , 2009 ; cowansage et al . , 2010 ) .
because of these characteristics , bdnf may play an important role in the adaptation of corticolimbic areas to stress and to the action of antidepressants . in psychiatric patients ,
bdnf expression was indeed decreased in both the post - mortem brain and in the blood cells of depressed patients .
further , the extent of bdnf downregulation positively correlated with the severity of depressive symptoms ( karege et al . , 2002 , 2005 ; gonul et al . , 2005 ; piccinni et al . ,
the levels of bdnf in the post - mortem brain of depressed patients were elevated in antidepressant - treated subjects ( chen et al . , 2001 ; aydemir et al . , 2005 ; gonul et al . , 2005 ;
, 2008 ; piccinni et al . , 2008 ; sen et al . , 2008 ; matrisciano et al . ,
bdnf expression was also increased when patients were subjected to transcranial magnetic stimulation , vagus nerve stimulation , or electroconvulsive therapy ( bocchio - chiavetto et al . , 2006 ; lang et al . , 2006 ) . in protracted stress rodent studies ,
neurotrophins including bdnf have been identified as neuroendocrine effectors involved in the response to stress and in the behavioral dysfunction associated with anxiety and depression .
protracted stress in rodents induces morphological changes , such as decreased neurogenesis and neuronal atrophy ( sapolsky , 2000 ; mcewen et al . , 2002 ;
social deprivation , a condition lacking social stimuli , for instance might represent a stressful condition triggering the emergence of dysfunctional emotional behavior characterized by increased emotionality and hypothalamic pituitary adrenal ( hpa ) axis reactivity in addition to reduced bdnf levels ( berry et al . , 2011 ) .
interestingly , antidepressant normalization of the stress - induced decrease of bdnf in mouse models appeared to be associated with long - term treatment with antidepressants ( nibuya et al .
, 1995 ; shirayama et al . , 2002 ; russo - neustadt et al .
bdnf infusion into the hippocampus induces antidepressant - like effects in animal models of depression ( shirayama et al . , 2002 ) .
on the other hand , mice lacking bdnf fail to respond to antidepressants ( monteggia et al .
meanwhile , several preclinical studies observed that fluoxetine , paroxetine , sertraline , and other ssris increase the content of allopregnanolone in various rodent brain areas ( uzunov et al . , 1996 ) . using the socially isolated mouse model of behavioral deficits that resemble symptoms of human anxiety disorders and ptsd ( pinna et al .
, 2003 , 2004 ; reviewed in pinna et al . , 2006 ; pinna , 2010 and pinna et al . , 2009 ) , we have shown that corticolimbic allopregnanolone levels are decreased in association with the development of anxiety - like behaviors , resistance to sedation , and heightened aggression ( pinna et al . , 2003 , 2006 ;
several reports on the mechanisms by which ssris increase allopregnanolone biosynthesis confirmed the hypothesis that the behavioral effects of fluoxetine were unrelated to the serotonin reuptake inhibitory activity of these drugs ( pinna et al .
this review will examine whether neurosteroidogenesis and bdnf expression are interrelated and whether by elevating allopregnanolone biosynthesis , antidepressant therapy regulates bdnf expression .
independent of peripherally - derived progestins , allopregnanolone may be synthesized in the brain ( baulieu , 1981 ; cheney et al . , 1995 ; baulieu et al . , 2001 ; guidotti et al . , 2001
; stoffel - wagner , 2001 ) from progesterone by the sequential action of two enzymes : 5-reductase type i , which reduces progesterone to 5-dihydroprogesterone ( 5-dhp ) , and is the rate - limiting step enzyme in allopregnanolone biosynthesis ( figure 1 ) ; and 3-hydroxysteroid dehydrogenase ( 3-hsd ) , which either converts 5-dhp into allopregnanolone ( reductive reaction ) or allopregnanolone into 5-dhp ( oxidative reaction ; figure 1 ) .
, 1990 , 1991 , 2003 ; majewska , 1992 ; pinna et al . , 2000 ;
allopregnanolone potently ( nm affinity ) induces a positive allosteric modulation of the action of gaba at gabaa receptors ( puia et al . , 1990 , 1991 ;
the physiological relevance of endogenous allopregnanolone is underlined by its facilitation and fine - tuning of the efficacy of direct gabaa receptor activators and positive allosteric modulators of gaba effects at gabaa receptors ( pinna et al . , 2000 ; guidotti et al .
allopregnanolone potentiates gaba responses via two binding sites in the gabaa receptor that , respectively , mediate the potentiation and direct activation effects of allopregnanolone .
direct gabaa receptor activation is initiated by the binding of allopregnanolone at a site formed by interfacial residues between the and subunits ( hosie et al . , 2006 ) .
binding of allopregnanolone at the potentiation site located in a cavity within the -subunit results in a marked enhancement of gabaa receptor activation ( hosie et al . , 2006 ) .
the localization of enzymes involved in allopregnanolone biosynthesis in the brain remained unclear until recent investigations in the mouse ( agis - balboa et al .
in our studies , 5-reductase and 3-hsd were shown to be highly expressed and colocalized in a region - specific way in primary gabaergic and glutamatergic neurons ( pyramidal neurons , granular cells , reticulo - thalamic neurons , medium spiny neurons of the striatum and nucleus accumbens , and purkinje cells ) , and were virtually unexpressed in gabaergic interneurons and glial cells ( agis - balboa et al . , 2006 , 2007 ) .
allopregnanolone synthesized in glutamatergic cortical or hippocampal pyramidal neurons or in granular cells of the dentate gyrus may be secreted in a paracrine manner by which allopregnanolone may reach gabaa receptors located in the synaptic membranes of other cortical or hippocampal pyramidal neurons ( figure 2 , arrow 1 ) .
it could also occur in an autocrine fashion , which would allow allopregnanolone to act locally by binding post - synaptic or extra - synaptic gabaa receptors located on the same dendrites or cell bodies of the cortical or hippocampal pyramidal neuron in which allopregnanolone was synthesized ( agis - balboa et al .
allopregnanolone might also diffuse laterally into synaptosome membranes of the cell bodies or dendritic arborization of glutamatergic neurons in which it is produced to attain intracellular access to specific neurosteroid binding sites of gabaa receptors ( akk et al . , 2005 ; agis - balboa et al .
allopregnanolone and 5-dihydroprogesterone ( 5-dhp ) may also affect intracellular signaling regulating gene expression , including bdnf expression ( figure 2 , arrow 4 ) .
allopregnanolone biosynthesis and action on gabaa receptors located on synaptic membranes of cortical pyramidal neurons .
gaba , after been released from gabaergic interneurons , binds to and activates post - synaptic and extra - synaptic gabaa receptors .
allopregnanolone facilitates the synaptic inhibitory action of gaba at post - synaptic and extra - synaptic gabaa receptors by a paracrine ( arrow 1 ) or autocrine ( arrow 2 ) mechanism or may access gabaa receptors by acting at the intracellular sites ( arrow 3 ) of the gabaa receptors .
finally , allopregnanolone may affect the expression of target genes , including bdnf , directly ( arrow 4 ) or indirectly ( arrow 5 ) by acting at gabaa receptors .
bdnf may be released and induce rapid effects at synapses via altering ion channels , or may exert intracellular genomic actions . modified from pinna et al .
the pro- and mature - forms of bdnf are synthesized and can be released from neurons by either a constitutive secretion or activity - dependent release ( mowla et al . , 1999 ) .
mature bdnf appears to be the most abundant form and that of highest physiological significance in the adult brain ( matsumoto et al .
also , it is widely distributed in the forebrain and in most of cortical and limbic regions , including the cortex and hippocampus ( reviewed in nagahara and tuszynski , 2011 ) .
upon release , bdnf binds to two different receptors , the tropomyosin - related kinase receptor type b ( trkb ) , and the p75 receptor ( soppet et al . , 1991 ) .
the most widely expressed bdnf receptor across various brain areas , trkb is considered highly significant for bdnf functional actions in adulthood due to its higher binding affinity with bdnf and brain regional distribution ( reviewed in nagahara and tuszynski , 2011 ) . on the other hand , in the adult brain the bdnf low - affinity p75 receptor is expressed in basal forebrain cholinergic neurons and in a few cortical neurons ( lu et al . , 1989 ) .
interestingly , while mature bdnf binds with higher affinity to trkb receptors , pro - bdnf has a higher affinity binding for p75 receptors .
this difference in the binding of the two forms of bdnf is pivotal in terms of function .
in fact , whereas the mature form of bdnf , by binding to trkb , induces important physiological roles , including neuronal survival and the activation of several genes such as the cyclic amp - response element - binding protein ( creb ) , the binding of pro - bdnf to p75 receptors has opposite effects , supporting apoptotic signaling ( koshimizu et al . , 2010 ) .
the local release of bdnf in corticolimbic neurons may also regulate behavior by a rapid action on neurotransmitter systems ( see also figure 2 ) .
exposure of mice or rats to protracted social isolation stress for 48 weeks induces a decrease in allopregnanolone levels in several corticolimbic structures as a result of a downregulation of the mrna and protein expression of 5-reductase type i ( matsumoto et al . , 1999 ; serra et al . , 2000 ; pinna et al . , 2003 ;
bortolato et al . , 2011 ; reviewed in matsumoto et al . , 2007 ; pinna , 2010 ) .
5-reductase is specifically decreased in cortical pyramidal neurons of layers v vi , in hippocampal ca3 pyramidal neurons and glutamatergic granular cells of the dentate gyrus , and in the pyramidal - like neurons of the basolateral amygdala ( agis - balboa et al . , 2007 ) .
however , 5-reductase fails to change in gabaergic neurons of the reticular thalamic nucleus , central amygdala , cerebellum , or in the medium spiny neurons of the caudatus and putamen ( agis - balboa et al . , 2007 ) .
the decrease of 5-reductase in the above - mentioned brain areas resulted in a reduction of allopregnanolone levels ( pibiri et al . ,
allopregnanolone biosynthesis appears to be a pivotal biomarker of behavioral deficits , including aggression , anxiety - like behavior , and changes in fear expression induced in rodent models of depression and anxiety spectrum disorders ( dong et al .
, 2001 ; pinna et al . , 2003 , 2006 , 2009 ; uzunova et al . , 2004 , 2006 ; pinna , 2010 ) . in our laboratory
, we have used socially isolated mice to establish an association between allopregnanolone biosynthesis and behavioral deficits as well as their reversal following pharmacological treatment ( matsumoto et al . , 2003 ; pinna et al . , 2006 , 2009 ;
, 2008 ; nelson and pinna , 2011 ) . in mice socially isolated for a period of up to
8 weeks , we have demonstrated a time - dependent increase in aggressive behavior over the first 4 weeks of isolation accompanied by a time - dependent decrease of corticolimbic allopregnanolone levels ( pinna et al . , 2003 , 2004 , 2006 , 2008 ;
similarly , socially isolated mice exposed to a classical fear conditioning paradigm showed enhanced conditioned contextual but not explicitly cued fear responses compared with group - housed mice ( pibiri et al .
the time - related increase of contextual fear responses correlated with the downregulation of 5-reductase mrna and protein expression observed in several corticolimbic areas , such as the frontal cortex , the hippocampus , and the amygdala ( pibiri et al . , 2008 ) .
likewise , social isolation in mice results in anxiety - like behavior ( pinna et al . , 2006 ; nin et al . ,
pharmacological treatment with allopregnanolone dose - dependently decreased aggression in a manner that correlated with an increase in corticolimbic allopregnanolone content ( pinna et al . , 2003 ) .
these antiaggressive effects of allopregnanolone were confirmed by experiments in which allopregnanolone was directly infused into the basolateral amygdala , which increased the levels of basolateral amygdala and hippocampus allopregnanolone ( nelson and pinna , 2011 ) .
allopregnanolone also normalized the exaggerated contextual fear responses and anxiety of socially isolated mice ( pibiri et al . , 2008 ) .
administration of the potent 5-reductase competitive inhibitor skf 105,111 to normal group - housed mice ( cheney et al .
2008 ) rapidly ( 1 h ) decreased levels of allopregnanolone in the olfactory bulb , frontal cortex , hippocampus , and amygdala by 8090% ( pibiri et al .
, 2008 ; pinna et al . , 2008 ) in association with a dose - dependent increase of conditioned contextual fear responses ( pibiri et al . , 2008 ) .
the effects of skf 105,111 on conditioned contextual fear responses were reversed by administering allopregnanolone doses that normalized hippocampus allopregnanolone levels ( pibiri et al . , 2008 ) .
the anxiolytic and antidepressant properties of allopregnanolone have been extensively documented by several other laboratories using various rodent models of abnormal behavior ( bitran et al . , 1991 ; wieland et al . , 1991 ; rodgers and johnson , 1998 ; frye and rhodes , 2006 ; engin and treit , 2007 ; nin et al . , 2008 ; frye et al . , 2009
results obtained in our laboratory have suggested that administration of a racemic mixture of the r- and s - isomers of fluoxetine induced increases in corticolimbic allopregnanolone levels and normalized the righting reflex loss induced by pentobarbital in mice ( pinna et al . , 2003 , 2004 , 2009 ) .
importantly , at the doses used , fluoxetine failed to change the behavior and allopregnanolone levels of group - housed mice ( pinna et al .
thus , we hypothesized that fluoxetine could ameliorate the behavioral deficits of socially isolated mice by upregulating corticolimbic allopregnanolone levels rather than by inhibiting serotonin reuptake .
this hypothesis was investigated using the r- and s - stereoisomers of fluoxetine and norfluoxetine as pharmacological tools .
we expected that these drugs would stereospecifically upregulate corticolimbic allopregnanolone content but have no stereoselectivity with regard to inhibition of 5-ht reuptake .
fluoxetine dose - dependently and stereospecifically normalized the duration of pentobarbital - induced sedation and reduced aggressiveness , fear responses , and anxiety - like behavior at the same submicromolar doses that normalized the downregulation of brain allopregnanolone content in socially isolated mice ( pinna et al . ,
interestingly , the s - stereoisomers of fluoxetine or norfluoxetine appeared to be three - to - sevenfold more potent than their respective r - stereoisomers and s - norfluoxetine was about fivefold more potent than s - fluoxetine .
importantly , the effective concentrations ( ec50s ) of s - fluoxetine and s - norfluoxetine that normalize brain allopregnanolone content are 10- ( s - fluoxetine ) and 50-fold ( s - norfluoxetine ) lower than their respective ec50s needed to inhibit 5-ht reuptake ( pinna et al . , 2003 , 2004 , 2009 ; pinna , 2010 ) . of note ,
the ssri activity of s or r - fluoxetine and of s or r - norfluoxetine was devoid of stereospecificity ( pinna et al .
these studies have clearly demonstrated that in socially isolated mice the pharmacological actions of ssris are induced by their ability to act as selective brain steroidogenic stimulants ( sbsss ) , which suggests a novel and more selective mechanism for the behavioral action of this class of drugs .
adult neurogenesis in the hippocampus begins by dividing precursor cells originating in the subgranular zone ( sgz ) .
the differentiation and integration of new neurons to the adult dentate gyrus plays an important role in plasticity and represents a fundamental step in hippocampus - dependent learning / memory processes and possibly affects emotional behavior ( deng et al . , 2010 ) .
a growing number of studies support a role for steroid hormones [ progesterone , allopregnanolone , dehydroepiandrosterone ( dhea ) and its sulfated form dheas , estradiol , and androgens ] in neurogenesis and cellular survival .
stem cells with multi differentiation potential for neuronal phenotypes are influenced by steroid hormones , such as regulating gene expression by binding to intracellular steroid receptors , activation of intracellular pathways involving kinases or intracellular calcium signaling , and modulation of receptors for neurotransmitters ( reviewed in velasco , 2011 ) .
interestingly , steroid hormones can even substitute for modulate the action of growth factors and also directly influence self - renewal , proliferation , differentiation , or cell death of neurogenic stem cells .
several environmental or internal factors affect neurogenesis in the hippocampus , among them social stress , including protracted social isolation , potently decreases neurogenesis ( dranovsky et al . , 2011 ) .
likewise , several stress - induced rodent models of depression show impaired neurogenesis ( coyle and duman , 2003 ; kempermann and kronenberg , 2003 ) . on the other hand , environmental enrichment , exercise , learning , and
antidepressant treatments are able to increase the number , differentiation , and survival of newborn hippocampal neurons ( kempermann and gage , 1998 ; van praag et al . , 1999 ; leuner et al . ,
interestingly , the pharmacological effects of neurosteroidogenic antidepressants can be abolished by reducing dentate gyrus neurogenesis ( santarelli et al . , 2003 ; david et al . , 2009 )
, suggesting that the pharmacological effects of antidepressants may include the stimulation of neuronal progenitor cells , which has been reported in studies with rodent , human , and non - human primate hippocampus ( kempermann and kronenberg , 2003 ; boldrini et al . , 2009 ) .
the adult amygdala shows signs of mixed activity - dependent plasticity with reduced numbers of microglia and a low level of proliferation and limited changes over time in neuronal and glial immunocytochemical properties ( ehninger et al . , 2011 ) .
however , the basolateral amygdala seems to play a role in antidepressant - mediated hippocampal cell proliferation and survival as demonstrated by studies in rodents in which only when the basolateral amygdala was lesioned , did fluoxetine have a positive effect on hippocampal cell survival and antidepressant action ( castro et al . , 2010 ) .
glucocorticoids have been shown to exert a primary and permissive regulatory role in hippocampal neurogenesis .
whereas stress - induced increased glucocorticoid levels reduce the proliferation of progenitor cells in the dentate gyrus , the reduction of their levels following adrenalectomy enhances neurogenesis ( wong and herbert , 2004 ) .
given to rats , dhea stimulated progenitor cell division and counteracted the suppressive effects of corticosterone ( karishma and herbert , 2002 ) .
in another study , dhea and dheas increased neurogenesis in the dentate gyrus , likely by increasing the concentrations of bdnf .
a single administration of dhea or dheas changed regional brain concentrations of bdnf within 5 h ( naert et al . , 2007 ) .
dhea decreased bdnf content in the hippocampus but not in the amygdala and increased bdnf in the hypothalamus .
dheas first decreased bdnf after 30 min post - injection and increased bdnf after 3 h in the hippocampus . a biphasic increase in bdnf in the amygdala and decreased bdnf in the hypothalamus was also reported ( naert et al . , 2007 ) .
this work suggests that dhea and dheas affect bdnf levels by different mechanisms with unclear effects on neurogenesis and neuronal survival .
dheas promoted survival of adult human cortical brain tissue in vitro ( brewer et al . , 2001 ) .
dheas was as effective as the human recombinant fibroblast growth factor ( fgf2 ) in promoting survival of neuron - like cells .
dheas and fgf2 were synergistic in increasing cell survival ( brewer et al . , 2001 ) .
interestingly , dhea showed a synergistic effect with antidepressants , in fact , it can render an otherwise ineffective dose of fluoxetine capable of increasing progenitor cell proliferation to the same extent as doses four times higher , which supports a role for dhea as a useful adjunct therapy for depression ( pinnock et al . , 2009 ) .
progesterone and progesterone metabolites , including allopregnanolone , also play a pivotal role on neurogenesis and neuronal survival . in the dentate gyrus of adult male mice , administration of progesterone increased the number of cells by twofold , likely by enhancing cell survival of newborn neurons ( zhang et al . ,
the effects of progesterone appeared to be partially mediated by binding to progesterone receptors , as suggested by the fact that the 5-reductase inhibitor finasteride failed to prevent this effect , which was instead partially blocked by the progesterone antagonist ru486 ( zhang et al . , 2010 ) .
in an in vitro study , both progesterone and allopregnanolone promoted human and rat neural progenitor cell proliferation .
allopregnanolone showed greater efficacy at the same concentration ( wang et al . , 2005 ) .
in in vivo studies , allopregnanolone increased brdu incorporation in the 3-month - old mouse hippocampal sgz as well as in the svz ( brinton and wang , 2006 ; wang et al . , 2010 ) .
these data suggested that for both neuroprotection and also likely for neurogenesis , allopregnanolone is the preliminary active agent .
allopregnanolone increased the proliferation of immature cerebellar granular cells taken from 6- to 8-day - old pups .
this effect was abolished by bicuculline and picrotoxin ( antagonists of gabaa receptors ) and by nifedipine ( dihydropyridine l - type - calcium channel blocker ) , which suggested that allopregnanolone increases dna synthesis through a gabaa receptor - mediated activation ( keller et al . , 2004 ) .
progesterone synthesized in schwann cells also exerts important effects in the peripheral nervous system by promoting myelination , likely by an action mediated through progesterone receptors , although allopregnanolone also plays a role .
interestingly , progesterone stimulated myelin - specific proteins [ e.g. , protein 0 ( p0 ) and the peripheral myelin protein-22 ( pmp-22 ) ] ( dsarnaud et al .
notterpek et al . , 1999 ) and increased the expression of krox-20 , a transcription factor crucially involved in myelination in the peripheral nervous system ( guennoun et al .
as mentioned above , some effects on the expression of the myelin basic protein were likely mediated through allopregnanolone , as demonstrated by a study in which the use of finansteride to inhibit 5-reductase also partially inhibited the effects of progesterone .
the involvement of allopregnanolone in myelination was further demonstrated by the finding that bicuculline inhibited the effect of allopregnanolone , providing evidence that allopregnanolone was involved in the increased expression of myelin basic proteins .
hence , allopregnanolone has pronounced neuroprotective actions , increases myelination , and enhances neurogenesis and cell survival .
evidence suggests that allopregnanolone dysregulation may play a role in the pathophysiology of alzheimer s disease and other neurodegenerative disorders , as demonstrated by data that allopregnanolone is reduced in the prefrontal and temporal cortex of patients with alzheimer s disease compared to cognitively intact male control subjects and inversely correlated with the neuropathological disease stages .
thus , the normal age - related decline of allopregnanolone or its decline and that of other neurosteroids in psychiatric or neurological disorders ( e.g. , alzheimer s disease ) may trigger the subsequent decrease of neurogenesis and decreased expression of growth factors ( wang et al . , 2008 ) .
alternatively , the restored brain content of allopregnanolone following treatment with a steroidogenic drugs reverses neurogenesis downregulation and improves emotional and cognitive function ( santarelli et al .
decreased levels of bdnf have been implicated in the mechanisms underlying the clinical manifestations of ptsd and depression and also in an impairment of cognitive function in neurologic and psychiatric disorders following protracted stressful events . a hyperactive hpa axis and higher levels of circulating glucocorticoids
have been associated with dysfunctional emotional behavior that can be normalized by antidepressant treatment ( holsboer and barden , 1996 ; mason and pariante , 2006 ) .
it has been well established that protracted stressful events affecting emotional behaviors also decrease the levels of neurotrophins , including bdnf . both ptsd and depressed patients express decreased levels of bdnf in the hippocampus and plasma ( sen et al . , 2008 ) . of note ,
ptsd and depression have consistently been associated with decreased hippocampal volume with no differences in total cerebral volume or functional impairment ( sheline et al . , 1996 , 2002 ;
studies aimed at identifying the functional significance of hippocampal volume loss demonstrated an association between hippocampal volume decrease and memory loss ( nagahara and tuszynski , 2011 ) .
therapy using neurosteroidogenic antidepressants resulted in an improvement of ptsd and depressive symptoms and in a significant improvement in mean hippocampal volume ( vermetten et al .
these neurosteroidogenic antidepressants have been reported to upregulate serum and hippocampal bdnf levels in post - mortem brains , which correlated with improved symptoms ( chen et al .
similar results were reported in individuals who received electroconvulsive therapy ( altar et al . , 2003 ) .
thus , these results suggest that antidepressant - mediated bdnf upregulation may counteract hippocampal atrophy by stimulating dendritic spine arborization and morphology and neurogenesis .
several stress models in rodents , including acute or protracted restrain stress , resulted in decreased expression levels of hippocampal bdnf ( reviewed in smith et al . , 1995 ; ueyama et al . , 1997 ;
protracted social isolation is also a powerful stressful condition that would account for several dysfunctional emotional phenotypes associated with reduced expression of bdnf .
for instance , social isolation in mice increased emotionality and hpa axis levels while reducing expression of bdnf levels ( berry et al . ,
isolation of rats at weaning reduced immobility time in the forced swim test , decreased sucrose intake and preference , and downregulated both bdnf and activity - regulated cytoskeletal associated protein ( arc ) in the hippocampus ( pisu et al . , 2011 ) .
likewise , a prolonged period of partial social isolation can modify bdnf protein concentrations selectively in the hippocampus with no changes in prefrontal cortices and striata . in this study ,
housing condition had no effect on basal plasma corticosterone ( scaccianoce et al . , 2006 ) .
interestingly , plasticity in corticolimbic circuits is a prerequisite for triggering extinction of fear conditioning responses ( egan et al . , 2003 ; quirk and milad , 2010 ) . in these circuits , bdnf mediates plasticity and
can be epigenetically regulated in a manner that correlates with fear extinction ( bredy et al . , 2007 ) .
accordingly , mice with a global deletion of one bdnf allele or with a forebrain - restricted deletion of both alleles show deficits in cognition , anxiety - like behavior , and elevated aggressive behavior ( rios et al . , 2001 ) .
bdnf - restricted knockout mice instead exhibited elevated aggression and social dominance but did not show changes in anxiety - like behaviors ( ito et al . , 2011 ) .
relying on these reports and on clinical and preclinical studies from our own group , we hypothesized that in ptsd and depressed patients who show a decrease of csf allopregnanolone levels , antidepressant - induced allopregnanolone level upregulation was involved in the antidepressant mechanisms underlying the elevation of bdnf levels .
studies conducted in our laboratory in socially isolated mice have shown that a decrease of corticolimbic allopregnanolone levels is associated with decreased levels of corticolimbic bdnf mrna expression ( nelson et al . , 2010 ) .
we found that allopregnanolone levels and bdnf mrna expression are downregulated in the same brain areas , namely the medial frontal cortex , hippocampus , and bla and fail to change in the cerebellum and striatum ( pibiri et al .
, 2008 ; nelson et al . , 2010 ) . to test whether these neurochemical deficits were associated with behavioral dysfunctions ( exaggerated contextual fear conditioning and impaired extinction ) , mice were exposed to a novel environment ( i.e. , context , a training chamber ) and were allowed to explore it for 2 min .
after this time , they received an acoustic tone ( i.e. , conditioned stimulus , cs ; 30 s , 85 db ) co - terminated with an unconditioned stimulus ( us ; electric footshock , 2 s , 0.5 ma ) .
after the last tone + shock delivery , mice were allowed to explore the context for an additional minute prior to removal from the training chamber ( total of 8 min ) . on re - exposure to the context 24 h later , the mice displayed a conditioned fear response , including sustained freezing behaviors .
freezing behavior , defined by the absence of any movement except for those related to respiration while the animal is in a stereotyped crouching posture ( pibiri et al . , 2008 ) , was measured for 5 min without tone or footshock presentation .
socially isolated mice also exhibited delayed and incomplete extinction of fear responses , which was assessed by exposing mice to the conditioning chamber on five consecutive days .
the decrease of corticolimbic allopregnanolone levels and bdnf mrna expression were also associated with changes in anxiety - like behavior and aggressiveness , which were assessed by using an elevated plus maze and the resident intruder test , respectively ( pinna et al .
, 2003 , 2006 ; nin et al . , 2011 ) . of note ,
in socially isolated mice we further studied the mean of spine density and the percentage of mature spines in layer iii of the frontal cortex .
spine density was lower for socially isolated mice along the entire extent of the apical and basilar dendrites .
socially isolated mice also had a lower percentage of mature spines on both the apical and basilar dendrites .
for the apical dendrite , the greatest decrease in percentage of mature spines for isolated mice was in the proximal portion of the dendrite , while for the basilar dendrite , the greatest decrease in percentage of mature spines was in the mid and distal portion of the dendrite ( tueting and pinna , 2002 and manuscript in preparation ) .
allopregnanolone treatment or s - norfluoxetine at concentrations sufficient to increase the levels of allopregnanolone in corticolimbic areas normalized bdnf mrna expression in corticolimbic areas of socially isolated mice ( martinez et al . ,
s - norfluoxetine and allopregnanolone treatment induced a reduction of conditioned fear and facilitated fear extinction ( pibiri et al .
these treatments also prevented the reinstatement of fear memory following extinction , suggesting that allopregnanolone- or s - norfluoxetine - induced bdnf upregulation in corticolimbic areas strengthens extinction processing .
importantly , s - norfluoxetine and allopregnanolone actions on conditioned fear responses were mimicked by a single bdnf bilateral microinfusion into the bla , which dose - dependently facilitated fear extinction and abolished the reinstatement of fear responses in the absence of locomotion impairment ( martinez et al . , 2011 ) .
these observations support the hypothesis that by increasing allopregnanolone levels , sbss drugs such as s - norfluoxetine may be involved in the regulation of corticolimbic bdnf expression and may induce long - term improvement in the behavioral dysfunctions that relate to ptsd .
these results originated in our laboratory are in accord with recent investigations suggesting that progesterone regulates bdnf expression .
a study conducted with cerebral cortical explants has demonstrated that progesterone induces an upregulation of bdnf mrna and protein expression ( kaur et al . , 2007 ) .
, the content of bdnf following an injection of allopregnanolone was first decreased after 30 min following the injection and significantly increased after 3 h. in the amygdala , bdnf content was increased after 1560 min from allopregnanolone , returned normal , and increased again after 5 h. finally , in the hypothalamus , bdnf levels were decreased ( naert et al . , 2007 ) .
collectively these studies suggest that part of the immediate or the long - term behavioral effects exerted by steroidogenic antidepressants may be explained by the effects of these drugs on allopregnanolone neosynthesis , which in turn may upregulate bdnf content and expression in corticolimbic neurons .
the incidence and prevalence of posttraumatic stress disorders and anxiety disorders are predicted to continue to increase , while current medications remain difficult due to the inefficacy of some antidepressants and benzodiazepines in the treatment of ptsd patients ( gelpin et al . , 1996 ; viola et al . , 1997
we have observed that socially isolated mice , in addition to expressing a neurosteroidogenic deficit , which results in decreased levels of allopregnanolone , the most potent physiological positive modulator of gabaa receptor neurotransmission , also express a bdnf level downregulation in corticolimbic neurons .
treatment with allopregnanolone or with non - serotonergic doses of fluoxetine and norfluoxetine normalized both the levels of corticolimbic allopregnanolone and the mrna expression of bdnf , which is associated with antianxiety and antiaggressive action as well as improvement of fear conditioning responses . a new class of drugs , the sbsss , which include molecules that share the ability to increase the brain levels of allopregnanolone , may have therapeutic potential for the treatment of ptsd and depression , which have been associated with a downregulation of brain allopregnanolone biosynthesis and bdnf expression .
direct bdnf application to pharmacotherapy for psychiatric disorders is highly promising in the treatment of ptsd ( peters et al . , 2010 ) .
however , the use of bdnf is difficult , particularly concerning the delivery of bdnf to the brain ( nagahara and tuszynski , 2011 ) .
thus , molecules that are able to endogenously stimulate bdnf levels , including sbsss , may overcome the delivery challenge represented by administering bdnf directly .
therefore , novel sbss drugs that specifically increase corticolimbic allopregnanolone biosynthesis and stimulate bdnf expression in corticolimbic neurons appear to be highly promising as a new pharmacological class of future drugs for the treatment of depression , anxiety , and ptsd .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | the pharmacological action of selective serotonin reuptake inhibitor antidepressants may include a normalization of the decreased brain levels of the brain - derived neurotrophic factor ( bdnf ) and of neurosteroids such as the progesterone metabolite allopregnanolone , which are decreased in patients with depression and posttraumatic stress disorders ( ptsd ) .
the allopregnanolone and bdnf level decrease in ptsd and depressed patients is associated with behavioral symptom severity .
antidepressant treatment upregulates both allopregnanolone levels and the expression of bdnf in a manner that significantly correlates with improved symptomatology , which suggests that neurosteroid biosynthesis and bdnf expression may be interrelated .
preclinical studies using the socially isolated mouse as an animal model of behavioral deficits , which resemble some of the symptoms observed in ptsd patients , have shown that fluoxetine and derivatives improve anxiety - like behavior , fear responses and aggressive behavior by elevating the corticolimbic levels of allopregnanolone and bdnf mrna expression .
these actions appeared to be independent and more selective than the action of these drugs on serotonin reuptake inhibition .
hence , this review addresses the hypothesis that in ptsd or depressed patients , brain allopregnanolone levels , and bdnf expression upregulation may be mechanisms at least partially involved in the beneficial actions of antidepressants or other selective brain steroidogenic stimulant molecules . | Introduction
Allopregnanolone and BDNF Biosynthesis and Action in Corticolimbic Neurons
Behavioral Dysfunctions Associated with Social Isolation
SSRIs Act as Selective Brain Steroidogenic Stimulants and Abolish Behavioral Abnormalities
Neurosteroids and Neurosteroidogenic Antidepressants Regulate Neurogenesis and Neuronal Survival
Relationship between BDNF and Allopregnanolone in Corticolimbic Neurons
Conclusion
Conflict of Interest Statement |
immunometabolism is an emerging field of investigation including immunology and biochemical pathways that govern metabolism
. accelerating interest in this area is being fuelled by increased lifespan and the relatively recent knowledge that aging affects the immune system and promotes inflammation that is associated with metabolic dysfunctions .
ageing is associated with an increase in visceral obesity in men and women , which has been claimed as the prominent cause of systemic metabolic perturbations and chronic inflammation . in particular , with ageing , vat expands and becomes hypovascularized and resident adipocytes quickly release proinflammatory cytokines as response to such stressful condition [ 35 ] . among the produced proinflammatory molecules , tumour necrosis factor ( tnf ) and interleukin 6 ( il-6 ) have been most intensively studied for their involvement in inducing systemic metabolic perturbations .
polyphenols are the most promising natural compounds to combat metabolic syndromes including age - related inflammatory states .
many polyphenols are efficient antioxidants and anti - inflammatory molecules by virtue of their ability to directly scavenge inflammation - derived radicals , to increase antioxidants expression , and to block inflammatory cytokines production by modulating the activity of specific transcription factors . in adipose tissue
, the polyphenol resveratrol ( rsv ) suppresses both systemic and adipose tissue inflammation and has the potential to improve age - associated metabolic disorders and to increase insulin sensitivity [ 7 , 8 ] .
moreover , rsv inhibits triglycerides accumulation by suppressing adipocytes differentiation and by stimulating lipid catabolism via the induction of the adipose triglyceride lipase ( atgl ) .
it has been firstly identified in white adipose tissue and represents the rate - limiting enzyme of triglycerides lipolysis . moreover ,
fatty acids ( fas ) liberated by atgl have been implicated in lipid signalling mediated by the family of peroxisome proliferator activated receptors ( ppars ) .
ppars are ligand - activated nuclear receptors , which can be activated by fas and have been mainly studied in the transcriptional regulation of genes involved in glucose and lipid metabolism .
atgl - mediated fa / ppar signalling was demonstrated to be essential to maintain mitochondrial oxidative metabolism and in vat orchestrates stress resistance adaptation of adipocytes to limited nutrient delivery , thus counteracting cell death and the onset of the inflammatory response .
atgl activity changes during aging , and it has been suggested that its expression levels are directly related to the inflammatory status [ 5 , 14 , 15 ] .
more precisely , atgl downregulation is described in several age - related metabolic disorders ( i.e. , insulin resistance - related states ) characterized by an increased level of inflammatory mediators [ 16 , 17 ] .
importantly , ppars , including ppar , play a very important role in the regulation of inflammatory responses .
however , even though cell metabolism and inflammation are known to be tightly regulated by lipid signalling , the mechanism by which atgl modulates the production of inflammatory mediators is unclear . in particular , whether fa / ppar is involved in the anti - inflammatory effect of atgl has not been fully addressed yet . in the present work we have investigated whether atgl has a role in orchestrating pro - inflammatory cytokines production in aged adipocytes and whether the anti - inflammatory activity of rsv is associated with modulation of atgl .
we housed and sacrificed all mice in accordance with accepted standard of humane animal care and with the approval by relevant national ( ministry of welfare ) and local ( institutional animal care and use committee , tor vergata university ) committees .
c57bl/6 male mice were purchased from harlan laboratories srl ( urbino , italy ) . for the experiments , 1- , 7- , 14- , and
mice were killed by cervical dislocation ; vat was explanted immediately , frozen on dry ice , and stored at 80c .
3t3-l1 murine preadipocytes and c2c12 murine myoblasts were purchased from american type cell culture ( atcc ) and grown in dmem supplemented with 10% newborn serum or 10% fetal bovine serum and 1% pen / strep mix ( lonza sales , basel , switzerland ) . 3t3-l1 and
c2c12 cells were seeded at density of 2 10 cells per well in 6-well plates and differentiated in adipocytes and myotubes , respectively , as previously reported [ 9 , 19 ] .
louis , mo , usa ) was solubilized in dmso and added at concentration of 100 m for up to 48 h , a condition that was demonstrated to be effective in selectively inducing atgl expression in adipocytes .
atgl and scramble sirnas ( santa cruz biotechnology , dallas , texas , usa ) were transfected by using the deliverx plus kit ( affymetrix , santa clara , ca , usa ) as previously described .
3 g of rna was used for retrotranscription with m - mlv ( promega , madison , wi , usa ) .
qpcr was performed in triplicates by using validated qpcr primers ( blast ) , ex taq qpcr premix ( lonza sales ) , and the real time pcr lightcycler ii ( roche diagnostics , indianapolis , in , usa ) .
mrna levels were normalized to -actin mrna , and the relative mrna levels were determined by using the 2 method .
cells and vat were lysed in ripa buffer ( 50 mm tris hcl ph 8.0 , 150 mm nacl , 0.1% sds , 0.5% sodium deoxycholate , and 1% np-40 ) supplemented with protease inhibitors cocktail ( merck millipore , darmstadt , germany ) .
western blotting analysis was performed as previously described by using the following polyclonal antibodies : atgl , -actin , gapdh , i , tnf ( santa cruz biotechnologies ) , and phosphoactive forms of nf ( pnfb ) ( cell signalling technologies , danvers , ma , usa ) .
statistical evaluation was conducted by anova , followed by the post - student - newman - keuls .
during aging vat expands and undergoes hypovascularization concomitantly with immunometabolic perturbations [ 3 , 5 ] .
in particular , vat peaks at middle age or early old age and then declines substantially in advanced old age [ 24 , 25 ] .
the inflammatory state that commonly accompanies aging , also called inflammaging , has been proposed to be causative of a systemic metabolic perturbation .
vat has been proposed at the nexus of the mechanisms and pathways involved in the genesis of age - related inflammatory disorders .
atgl upregulation represents a stress adaptive response of adipocytes to hypovascularization that is crucial to buffer energetic catastrophe and to prevent cell death and tissue inflammation .
the present study was designed to investigate whether the dramatic inflammatory picture typically observed during late ageing could be triggered by the failure of the atgl - mediated adaptive response . as showed in figure 1(a ) , and in line with what we previously reported , vat of 7- and 14-month - old mice displayed higher levels of atgl protein with respect to 1-month - old mice . however ,
a decline of atgl was observed at later stage of ageing ( figure 1(a ) ) . in particular , the oldest mice ( 24-months - old )
had atgl protein level comparable to that of 1-month - old mice ( figure 1(a ) , bottom panel ) .
moreover , rt - qpcr analysis demonstrated a significant reduction of atgl mrna in the oldest mice with respect to young ones , suggesting an impaired atgl expression ( figure 1(b ) ) .
we then attempted to reveal the degree of inflammation in vat of the oldest mice with respect to the youngest and we found a stronger production of il-6 mrna .
notwithstanding , we did not reveal any changes in macrophages marker cd-14 ( figure 1(c ) ) , suggesting that the production of inflammatory cytokines was independent of cellular - mediated immune response .
this data is supported by our previous evidence showing that macrophages were not infiltrated in vat of old mice . to confirm the ability of adipose cells residing in vat of 24-month - old mice to produce inflammatory cytokines independently of cell immunity
, we have set up an in vitro aging model of adipocytes by culturing differentiated 3t3-l1 adipocytes for 21 days and compared the mrna levels of atgl , tnf , and il-6 to those of 3t3-l1 adipocytes after 8 days of differentiation . as shown in figure 2(a ) , we detected reduced mrna level of atgl and its downstream target ppar. this event was associated with an upregulation of tnf and il-6 expression in 21-day - old adipocytes compared with the 8-day - old adipocytes , thus nicely recapitulating the in vivo results obtained with 24-month - old mice ( figure 1(b ) ) .
therefore , on the basis of these data we can postulate that the failure of atgl - mediated stress response observed in 24-month - old and 21-day - old adipocytes triggers the production of proinflammatory cytokines . in agreement with this idea , higher levels of inflammatory markers
the modulatory action of atgl on tissue inflammation has been reported recently also in cardiac muscle . in particular , a prominent upregulation of different inflammatory markers ( e.g. , tnf and il-6 ) was observed in steatotic hearts of atgl ko mice .
thus , we asked whether downregulation of atgl in cultured skeletal muscle myotubes could result in enhanced inflammation markers as well . to this end , we downregulated atgl in fully differentiated c2c12 myotubes [ atgl( ) ] through rnai .
coherently , atgl( ) myotubes displayed decreased ppar and a greater mrna expression level of tnf than controls ( figure 2(b ) ) .
fas are liberated by atgl function as lipid signalling molecules leading to activation of ppar , which favours the expression of lipid oxidative genes .
an impaired fa / ppar signalling was observed during atgl deficiency in vat and adipocytes and this may initiate sequelae of events that eventually lead to the induction of proinflammatory genes . in support of this assumption ppar ko mice show a prolonged inflammatory response .
the involved mechanism is that ppar is a strong repressor of nfb transcription factor and of its downstream inflammatory cytokines in different cell types including adipocytes .
moreover , ppar is able to inhibit inflammation in several pathological conditions including hepatic steatosis and obesity [ 2931 ] .
the anti - inflammatory role of ppar in our system is strongly supported by the analysis of ppar mrna in 21-day - old adipocytes and in vat of the 24-month - old mice , which evidenced a significant reduction of ppar concomitant with production of inflammatory mediators .
several studies have suggested that the health benefits of rsv are mediated by its antioxidant capacity . in the context of adipocytes physiology
, rsv strongly inhibits adipogenesis by inducing the synthesis of the main nonenzymatic intracellular antioxidant , that is , glutathione . in doing so
, rsv buffers the onset of a prooxidant milieu , which is mandatory for adipocytes differentiation . other findings support rsv efficacy also in reducing the inflammatory response in several tissues such as brain during neurodegenerative processes and adipose tissue upon high fat and sugar diet .
the main anti - inflammatory mechanism of rsv seems to be related to the inhibitory action of nfb - mediated pathways including the transcription of tnf and il-6 . according to lasa et al .
, we found that treatment of 8-day - old adipocytes with rsv efficiently impinged upon a strong atgl protein accumulation at 24 h , which was accompanied by the decrease of phosphoactive nfb ( figure 2(c ) ) . to dissect whether atgl / fa / ppar axis
could be involved in the anti - inflammaging action of rsv , we analysed the level of atgl and ppar after rsv administration in 21-day - old adipocytes .
we found a significant upregulation of both atgl and ppar expression ( figure 2(a ) ) .
coherently , a simultaneous decrease of tnf and il-6 mrna expression was observed after rsv treatment ( figure 2(a ) ) .
as reported in the literature , stress stimuli such as lps or nutrient starvation upregulate atgl [ 5 , 37 ] . moreover , atgl ko mice challenged with lps display enhanced inflammation in liver compared to wt and show increased mortality and torpor , and these events have been attributed to impaired ppar activity .
next , given that rsv has an anti - inflammaging action and this nicely correlates with the upregulation of atgl and ppar , we asked whether rsv could also restrain the increase of tnf and il-6 caused by atgl downregulation through rnai , in 8-day - old adipocytes .
as reported in figure 3(a ) , atgl lacking cells [ atgl( ) ] displayed impaired ppar expression and higher expression of tnf and il-6 than controls , in line with what we observed in c2c12 myotubes ( figure 2(b ) ) and previously revealed on primary adipocytes and mouse embryonic fibroblasts .
however , contrary to what we observed in 21-day - old adipocytes , rsv was unable to revert the induction of tnf and il-6 in atgl( ) adipocytes ; but rather it unexpectedly further upregulated their mrna expression , indicating an enhancement of nfb activity ( figure 3(a ) ) . to confirm the proinflammatory role of rsv in atgl( ) adipocytes , we carried out an immunoblotting analysis of the transcriptional phosphoactive form of nfb ( pnfb ) and its inhibitory partner ib .
figure 3(b ) shows an increased pnfb level in atgl( ) adipocytes treated with rsv that was paralleled by the decrease of ib ( figure 3(b ) ) .
rsv has been proposed as a plausible gerosuppressant natural compound to overcome age - related metabolic perturbations and chronic inflammatory states [ 8 , 38 , 39 ] .
interestingly , in rhesus monkeys , rsv administration reduces nfb activation in high fat diet fed animals , suppressing inflammation in vat with beneficial action on metabolic profile . our data point out that , in condition of irreversible atgl inhibition ( silenced atgl expression ) , rsv would not function as anti - inflammatory agent , the atgl - mediated fa / ppar signalling axis being strongly affected .
thus , we can speculate that the anti - inflammatory potential of rsv is strongly dependent on atgl / fa / ppar pathway ( figure 4 ) .
overall these findings further support the anti - inflammatory role of atgl in adipocytes and suggest that rsv , being a powerful enhancer of atgl expression / activity , is able to reinforce the anti - inflammatory fa / ppar signalling [ 5 , 15 ] .
given that rsv is ineffective in inhibiting nfb when atgl is lacking , we can suggest that this lipase also efficiently modulates nfb activity by ( i ) restraining its phosphorylation and ( ii ) stabilizing the inhibitory partner ib .
these hypotheses remain to be elucidated yet and are currently under investigation in our laboratory .
importantly , recent papers demonstrate that rsv worsens the clinical symptoms in mice models of multiple sclerosis , exacerbating inflammation and neuronal demyelization .
moreover , rsv has been found to activate nfb and to increase inflammatory cytokines in cardiac cells .
these findings and our data collectively indicate that caution should be exercised in using rsv against inflammatory states .
here we give additional effort to the authentic role of atgl as a stress responsive protein , having the capacity to suppress the production of age - related proinflammatory cytokines in adipocytes .
atgl being an important node in the promotion of lipid signalling , the anti - inflammaging effect of atgl seems to proceed via the induction of fa / ppar-mediated pathway in that ppar functions as a valid suppressor of inflammatory cytokines at the level of gene transcription .
importantly , we have also pointed out that rsv can act as a powerful anti - inflammatory agent thanks to its ability to restore atgl expression , which is hardly compromised by ageing , thus allowing fa / ppar signalling to proceed towards the repression of cytokines production .
therefore , on the basis of our findings we can state that rsv could act as a powerful enhancer of atgl / fa / ppar pathway , thus representing a valid natural tool to limit the onset and/or the exacerbation of the age - related metabolic disorders and inflammatory states . | ageing is characterized by the expansion and the decreased vascularization of visceral adipose tissue ( vat ) , disruption of metabolic activities , and decline of the function of the immune system , leading to chronic inflammatory states .
we previously demonstrated that , in vat of mice at early state of ageing , adipocytes mount a stress resistance response consisting in the upregulation of atgl , which is functional in restraining the production of inflammatory cytokines . here , we found that , in the late phase of ageing , such an adaptive response is impaired .
in particular , 24-months - old mice and aged 3t3-l1 adipocytes display affected expression of atgl and its downstream ppar-mediated lipid signalling pathway , leading to upregulation of tnf and il-6 production . we show that the natural polyphenol compound resveratrol ( rsv ) efficiently suppresses the expression of tnf and il-6 in an atgl / ppar dependent manner .
actually , adipocytes downregulating atgl do not show a restored ppar expression and display elevated cytokines production .
overall the results obtained highlight a crucial function of atgl in inhibiting age - related inflammation and reinforce the idea that rsv could represent a valid natural compound to limit the onset and/or the exacerbation of the age - related inflammatory states . | 1. Introduction
2. Materials and Methods
3. Results and Discussion
4. Conclusions |
periodontitis is a multifactorial chronic inflammatory disease characterized by destruction of tooth - supporting tissues .
the progression of periodontal destruction involves complex interaction between periodontal bacteria and cells of immune system .
the complex cytokine network that mediates the immune response includes proinflammatory cytokines , anti - inflammatory cytokines , and specific cytokine receptors .
cytokines play an important role in the initiation , progression , and the host modulation of periodontal disease .
statins , 3-hydroxy 3-methylglutaryl coenzyme a ( hmg - coa ) reductase inhibitors , prescribed to prevent cardiovascular and cerebrovascular diseases .
the effectiveness of statin medication is based on their capacity to reduce serum cholesterol levels , primarily low - density lipoprotein ( ldl ) cholesterol .
statins inhibit hmg - coa reductase and decrease the production of mevalonate , geranyl pyrophosphate , and farnesyl pyrophosphate , and subsequent products on the way to construction of the cholesterol molecule .
thus , statins could inhibit inflammation , by inhibition of the cholesterol pathway and intracellularly interfering with ras superfamily protein function .
interleukin ( il)-1 is found in two active forms , il-1 and il-1 encoded by separate genes
. both are potent proinflammatory molecules and are the main constituents of what was once called osteoclast - activating factor .
the proinflammatory effects of il-1 include stimulation of endothelial cells to express selectins that facilitate recruitment of leukocytes and induction of prostaglandin e2 by macrophages and gingival fibroblasts .
gingival crevicular fluid ( gcf ) provides a noninvasive means of studying the host response factor by change of constituents in the fluid .
the inflammatory exudate from gingival microcirculation crosses inflamed periodontal tissue and en route collects molecules of potential interest from the local inflammatory reaction .
therefore , the fluid offers a great potential source of factors like inflammatory mediators , tissue break down products , and host derived enzymes that may be associated with tissue destruction .
increase in the levels of inflammatory mediators in gcf may be of diagnostic value in evaluating periodontal disease status .
although gcf il-1 levels in periodontal disease have been studied extensively , ours could be the first study carried out to know the influence of statin medication on the inflammatory mediator especially il-1. statins also have shown to have anti - inflammatory effect .
the aim of our study was to know the effect of statin medication on the inflammatory mediator gcf il-1 levels in chronic periodontitis subjects .
all the volunteers were informed about the aim and the methods of the present study and gave written consent to participate .
thirty patients of age group between 40 and 60 years were selected from the outpatient pool of department of periodontics , thaimoogambigai dental college and hospital , chennai .
the selected subjects were grouped into two ; group - i consists of subjects with generalized chronic periodontitis and on statin medication and group - ii consists of subjects with generalized chronic periodontitis .
generalized chronic periodontitis is defined by having the following criteria , subjects with clinical attachment loss of 35 mms in more than 30% of sites .
other inclusion criteria were subjects with minimum number of 15 teeth , plaque index and gingival index scores of 23 for both the groups .
group - i subjects were on atorvastatin medication with the dosage of 20 mg / day for a minimum period of 6 months .
exclusion criteria included diabetes mellitus , smokers , and subjects on long - term steroid medications and underwent periodontal treatment in the past 6 months .
a full mouth periodontal examination was carried out which included plaque index , gingival index , and clinical attachment level ( cal ) .
all gcf samples were collected from the site with maximum cal in the forenoon at the same time of the day , to allow for circadian variation seen in gcf volume .
a calibrated volumetric pipette of 5 l capacity was placed extracellularly for collection of gcf [ figure 1 ] .
the collected sample was then transferred to a sterilized plastic vial with the help of air spray .
micropipette for collecting gcf gcf samples were analyzed for il-1 using commercially available enzyme - linked immunosorbent assay ( elisa ) ( avibion human il- elisa kit , ani biotech ) .
the total amount of cytokines in gcf was expressed as pictogram ( pg / ml ) .
independent sample t - test was done for intergroup comparison of clinical parameters and gcf il-1 levels .
all gcf samples were collected from the site with maximum cal in the forenoon at the same time of the day , to allow for circadian variation seen in gcf volume .
a calibrated volumetric pipette of 5 l capacity was placed extracellularly for collection of gcf [ figure 1 ] .
the collected sample was then transferred to a sterilized plastic vial with the help of air spray .
micropipette for collecting gcf gcf samples were analyzed for il-1 using commercially available enzyme - linked immunosorbent assay ( elisa ) ( avibion human il- elisa kit , ani biotech ) .
the total amount of cytokines in gcf was expressed as pictogram ( pg / ml ) . data were expressed as mean and standard deviations . data analysis was carried out using spss as software for statistics . independent sample t - test was done for intergroup comparison of clinical parameters and gcf il-1 levels .
all gcf samples were collected from the site with maximum cal in the forenoon at the same time of the day , to allow for circadian variation seen in gcf volume .
a calibrated volumetric pipette of 5 l capacity was placed extracellularly for collection of gcf [ figure 1 ] .
the collected sample was then transferred to a sterilized plastic vial with the help of air spray .
gcf samples were analyzed for il-1 using commercially available enzyme - linked immunosorbent assay ( elisa ) ( avibion human il- elisa kit , ani biotech ) .
the total amount of cytokines in gcf was expressed as pictogram ( pg / ml ) .
independent sample t - test was done for intergroup comparison of clinical parameters and gcf il-1 levels .
independent sample t - test was done for intergroup comparison of clinical parameters and gcf il-1 levels .
the mean scores of gcf il-1 levels in group - i and group - ii were 180.73 32.15 and 308.20 27.73 pg / ml , respectively .
on comparison of mean gcf il-1 levels of groups i and ii , gcf il-1 levels in generalized chronic periodontitis subjects who were on statin medication ( group - i ) were lower ( 180.73 32.15 ) than the generalized chronic periodontitis subjects ( 308.20 27.73 ) without statin medication ( group - ii ) .
the difference was statistically significant ( p < 0.001 ) [ table 1 and figure 4 ] .
the mean values of plaque index and gingival index scores of group - i and group - ii were 2.6 and 2.6 and 2.5 and 2.6 , respectively .
the mean values of cals of group - i and group - ii were 4.1 and 3.9 mms , respectively .
on comparison of mean values of plaque index score , gingival index score and cals of group - i and group - ii , the difference was statistically non significant , [ tables 2 and 3 ] .
group - i and group - ii subjects were selected in such a way that both groups have similar amount of clinical parameters like gingival inflammatory status , plaque score , and clinical attachment loss .
mean gcf interleukin-1 levels in patients of chronic periodontitis mean gcf il-1b levels in groups - i and ii mean plaque index scores in patients of chronic periodontitis mean gingival index scores of patients of chronic periodontitis
periodontal disease process is site - specific and has multifactorial origin where periodontal pathogens , host response , genetic , systemic , and behavioral risk factors interplay to develop the disease process .
hence , various measures have been taken to include microbial , immunologic , systemic , and genetic factors , in addition to traditional clinical and radiographic parameters , for assessing patient 's periodontal status .
inflammatory mediator levels within the gcf have been considered as subclinical marker of progression and severity of periodontitis . in our study , we used micropipette of known internal diameter for collection of gcf .
gcf in the crevice migrates into the tube by capillary action and because the internal diameter is known the volume of fluid collected can be accurately determined by measuring the distance the gcf has migrated .
advantage of this technique is that it provides undiluted sample of native gcf whose volume can be accurately assessed as given by griffiths . in our study ,
group - i and group - ii subjects were selected in such a way that both groups have similar amount of clinical parameters like gingival inflammatory status , plaque score , and clinical attachment loss , and their mean values between two groups were statistically nonsignificant . in this study ,
the mean gcf il-1 levels were lower in chronic periodontitis patients on statin medication than chronic periodontitis patients without statin medication which is similar to study reported by sakoda et al . , who found that simvastatin reduces il-1-mediated production of inflammatory mediators il-6 and il-8 in cultured human epithelial cell lines .
our study could be the first study to assess the gcf il-1 levels in chronic periodontitis patients who are on statin medication .
one reason could be that statins deplete the isoprenoids , which inhibit the signalling pathway for il-1- and il-6-mediated inflammation as stated by omoigui et al .
isoprenoid precursors are necessary for the posttranslational lipid modification ( prenylation ) and are needed for the function of ras and guanosine triphosphatases ( gtpases ) .
these gtpase proteins such as ras , rho , rac , and rab ( particularly rho ) are intracellular signalling proteins which , when activated , are involved in receptor coupled transduction of signals from extracellular stimuli to cytoplasm and the nucleus .
another reason for the anti - inflammatory effect of statins could be due to the beneficial effects of statins which is mediated through the lowered ldl cholesterol levels , which has been suggested to have anti - inflammatory properties as given by matsuura et al .
sangwan et al . , in his study found that hyperlipidemic patients are more prone to periodontal disease and statins have positive impact on periodontal health .
periodontitis is widely accepted as a risk factor for cardiovascular disease due to elevated inflammatory mediators in periodontal lesions and consequently increased serum levels .
the administration of statins to cardiovascular patients may have additional benefits through inhibition of inflammation in oral tissues .
meisel et al . , described statins as effect modifiers in the relationship between periodontitis and its inflammatory counterparts in the systemic circulation .
lindy et al . , reported that patients on statin medication exhibited fewer signs of periodontal injury than subjects without statin regimen and cunha - cruz et al .
, showed the association of statin use with reduced tooth loss rate in chronic periodontitis patients .
these finding indicate that statins might have beneficial effect not only in periodontal disease but also in cardiovascular disease .
simvastatin and atorvastatin , as a local drug delivery , have shown to have several advantages in the treatment of periodontal diseases .
the antioxidant and anti - inflammatory properties of locally delivered statins could further facilitate healing of periodontal intrabony defects
. however , long - term clinical studies in human subjects are required to evaluate the potential benefits of statins in periodontal regenerative therapy .
statins are now among the frequently prescribed medication and are currently used by about 25 million people worldwide . the safety and tolerability of statins
myopathy and its serious complication rhabdomyolysis are the potential effect of therapy with the available statins , but occur very rarely .
the population treated with statins is likely to increase dramatically in near future , because they are now recommended also for people with low or normal cholesterol level , especially as a secondary prevention .
the results of our study proved the anti - inflammatory effect of statins on chronic periodontitis .
patients of chronic periodontitis receiving statins would have additional benefits , if the anti - inflammatory effect of statins is confirmed through longitudinal further studies . | objectives : statins are the group of lipid - lowering drugs commonly used to control cardiovascular and cerebrovascular diseases .
statins have potential anti - inflammatory effect by blocking the intermediate metabolites of the mevalonate pathway .
the objective of this study was to evaluate the anti - inflammatory effect of statin medication in chronic periodontitis patients.materials and methods : thirty patients of age group between 40 and 60 years were selected from the outpatient pool of department of periodontics , thaimoogambigai dental college and hospital , chennai .
thirty patients selected were grouped into two groups , group - i consists of patients with generalized chronic periodontitis and on statin medication and group - ii consists of patients with generalized chronic periodontitis .
clinical parameters were recorded and gingival crevicular fluid ( gcf ) samples were analyzed for interleukin ( il)-1 using commercially available enzyme - linked immunosorbent assay.results:the mean gcf il-1 levels in generalized chronic periodontitis patients who are on statin medication ( group - i ) were lower than the generalized chronic periodontitis patients without statin medication ( group - ii).conclusion : reduction of gcf il-1 levels in statin users indicate that statins have anti - inflammatory effect on periodontal disease . | Introduction
Materials and Methods
None
GCF Collection
Biochemical Analysis
Statistical Analysis
Results
Discussion
Conclusion |
micrornas ( mirnas ) are approximately 22-nucleotide - long non - coding rna molecules that were first discovered in caenorhabditis elegans but are now known to be expressed in all metazoans .
mirna genes are present singly or in clusters , often with their individual promoters and regulatory elements , while some mirna genes are also present within the introns of other protein coding genes .
mirnas are transcribed as long primary transcripts and are processed first in the nucleus by the microprocessor drsh-1/drosha and then in the cytoplasm by the dcr-1/dicer complex to generate the active 21 to 23-nucleotide rna molecules .
these are recruited by the rna - induced silencing complex ( risc ) and guided to the 3 ' untranslated regions of target messenger rnas ( mrnas ) with complete or incomplete sequence complementarity , resulting in either degradation of the target mrna or inhibition of its translation .
a single mirna can target multiple mrnas and this ability to control the expression of numerous genes makes mirnas pivotal in regulating various life processes , from development through metabolism to senescence , aging and death ( reviewed in ) . while animals like c. elegans contain hundreds of mirnas , little is known about their functions .
moreover , with the advent of deep sequencing technology , novel mirnas are being discovered in different model organisms , requiring faster and more convenient methodologies to study their functional importance through inhibiting their activity in vivo .
a recent report by zheng and colleagues now demonstrates the efficient and specific inhibition of mirnas in c. elegans by dextran - conjugated modified antisense oligonucleotides .
mirnas were first identified in c. elegans in 1993 and since then this elegant model system has been extensively utilized for functional analysis of mirnas .
c. elegans is so useful for these analyses because of its easy genetics , completely sequenced genome and simple anatomy . to study the role of individual mirnas in different cellular pathways ,
forward genetics approaches have yielded many ' loss of function ' ( lf ) mutant strains for various mirnas .
although such mutant strains have been extensively used for functional studies of the target mirnas , their generation is both time consuming and labor intensive .
further , it is tedious to generate knockout alleles for mirnas that are essential for survival and development , and in cases where the mirnas are located in the intronic sequences of protein coding genes , it is possible that their knockout will perturb expression of the protein coding gene .
it is also difficult to specifically knock out a single mirna from a mirna gene cluster without affecting the expression of the remaining mirnas in the cluster .
many groups have tried using reverse genetics approaches to inhibit specific mirna function transiently in different model systems .
the most popular tool of choice is differently modified antisense oligonucleotides , which are easy to synthesize and deliver .
several research groups have demonstrated inhibition of mirna function with limited success using antisense oligonucleotides such as locked nucleic acids ( modified rna nucleotides ) or morpholinos ( nucleic acid analogs ) in drosophila , zebrafish , and mice [ 8 - 10 ] . c. elegans has been widely used as the model system to study the biological role of small non - coding rnas and yet , to date , no standard techniques or protocols are available to effectively and conveniently knockdown mirna function transiently .
to inhibit mirna expression in c. elegans , zamore 's group injected 2'-oxy - methyl oligonucleotides into developing embryos .
their embryo injection technique is technically difficult and , therefore , has not been used extensively .
furthermore , the primary drawback of using these modified oligonucleotides is the incumbent toxicity caused by poor solubility and inadequate cytoplasmic retention and tissue distribution . to address these issues , zheng and colleagues conjugated 2'-oxy - methyl antisense oligonucleotides complementary to the target mirnas with the polysaccharide dextran , which has high solubility in water and shows increased cellular uptake and availability .
the authors also modified these oligonucleotides by conjugating one to three molecules of rhodamine per molecule of dextran .
these modified antisense oligonucleotides were injected into the syncytial gonads of adult worms and embryos were selected based on the presence of rhodamine ( figure 1 ) .
schematic representation of the technique elaborated in the study by zheng and colleagues . in this technique , a dextran - conjugated rhodamine - labeled antisense oligonucleotide complementary to the target microrna
are selected by the presence of rhodamine . in these progeny the antisense oligonucleotides bind to and deplete the available pool of target mirna , thus inhibiting mirna function in the animal .
zheng and colleagues used antisense oligonucleotides complementary to lin-4 and let-7 and comprehensively demonstrated robust knockout phenotypes similar to those seen in the respective loss of function mutant strains of lin-4 and let-7 .
for example , progeny of animals injected with antisense oligonucleotides against lin-4 show delayed exit in differentiation of seam cells and lack of vulva formation , known phenotypes for lin-4(lf ) .
the progeny of worms injected with antisense oligonucleotides complementary to let-7 demonstrated a bursting vulva phenotype with lack of alae ( longitudinal ridge ) formation in 100% of animals , consistent with the phenotype shown by let-7 knockout mutant animals .
by contrast , progeny of animals treated with antisense oligonucleotides complementary to mir-84 , a let-7 family member , exhibited no visible phenotype , consistent with the known phenotype of mir-84(lf ) mutants .
mir-84 has a sequence that is highly homologous to let-7 sequence , yet the phenotype observed in the mir-84 knockdown animals was completely unlike the let-7 knockdown phenotype therefore confirming the specificity of inhibition . using a similar strategy
, the authors could demonstrate specific inhibition of lys-6 mirna in the asel neurons , where it functions to maintain left - right symmetry .
this technique also successfully demonstrated the inhibition in activity of mir-42 , which is active only during embryonic development .
in addition , the authors demonstrate that this new class of antisense oligonucleotides could be utilized for specific and simultaneous inhibition of two mirnas , in this case lin-4 and lys-6 . as with all antisense techniques ,
the dextran - conjugated antisense 2'-oxy - methyl oligonucleotides have a limitation , in this case with respect to the period of efficacy of inhibition against target mirnas in the animal .
the inhibition was robust until 15 - 20 hours after the l4 molt with higher doses of injection , after which the effect diminished , most probably due to the dilution of the antisense oligonucleotides inside the animal .
for this reason this method of mirna inhibition might not be the most effective for long - term functional assays , such as aging assays , where the mirna in question needs to be inhibited throughout the life span of the animal .
overall , the data presented in the report by zheng and colleagues convincingly suggest that this new class of antisense oligonucleotides could prove to be a very powerful and effective tool for the robust and specific inhibition of mirna function in vivo
. this technique would be very useful for studying the different biological functions of essential and novel mirnas in c. elegans . while it remains to be tested
, this technology does not appear to be limited to just c. elegans , and could be applicable in other organisms as well . | micrornas ( mirnas ) are small non - coding rnas that regulate the expression of numerous target genes . yet , while hundreds of mirnas have been identified , little is known about their functions . in a recent report published in silence , zheng and colleagues
demonstrate a technique for robust and specific knockdown of mirna expression in caenorhabditis elegans using modified antisense oligonucleotides , which could be utilized as a powerful tool for the study of regulation and function of mirnas in vivo.see research article http://www.silencejournal.com/content/1/1/9 | None |
infections are a major cause of hospitalization and death in immunocompromised patients , representing 20.9% and 3.6% of all death causes among renal transplant recipients and systemic lupus erythematous ( sle ) patients , respectively .
though most are due to bacterial infections , invasive fungal infection prevalence is increasing in these populations .
the mainstay of host defense against this pathogen is innate and t - cell - mediated immunity , likely explaining its high incidence among immunosuppressed patients .
approximately 2060% of cryptococcosis in hiv - negative patients occurs in solid organ transplant recipients .
kidney transplant recipients infection most often occurs after the first year , while in sle patients it occurs at a median of 33months post - diagnosis .
a 34 year - old male with chronic renal failure due to renal malformation , was admitted due to persistent headaches .
he was on hemodialysis since 1998 ( day 4783 ) and submitted to deceased - donor renal transplant in april 2001 ( day 3780 ) .
immunosuppressive therapy consisted of cyclosporine a ( csa ) and mycophenolate mofetil ( mmf ) , with posterior conversion to sirolimus .
high dose methylprednisolone ( mp ) , plasmapheresis , monthly high - dose immunoglobulin infusions , and rituximab were administered due to acute humoral rejection in april 2010 ( day 548 ) . on november 2011 ( day 0 )
he was presented to the emergency department with a 5 day frontal headache , nausea and vomiting , photo- and phonophobia .
hematologic and biochemical analysis demonstrated normal white blood cells count , no anemia nor thrombocytopenia , and a normal c - reactive protein ( c - rp ) level .
cerebral mri presented asymmetric cortical lesions , with hyperintensity on t2-weighted and hipointensity on t1-weighted images .
cerebral spinal fluid ( csf ) analysis revealed 138 white blood cells ( 137 lymphocytes ) , glucose 0.69 g / l , and proteins 0.69
csf was india - ink and culture positive for c. neoformans , and polymerase chain reaction ( pcr)-positive for cytomegalovirus ( cmv ) .
treatment with liposomal amphotericin b associated to fluconazole was initiated , along with valganciclovir and anti - cmv immunoglobulins .
transition to fluconazole ( 400 mg per day , oral ) for 12 months and valganciclovir ( 450 mg every other day ) for 6 months was performed .
a 56 year - old caucasian male was admitted due to fever of unknown origin .
he had end stage renal disease due to a rapidly progressive iga nephropathy treated with cyclophosphamide for 6 months ( cumulative dose 21.6 g ) plus prednisone .
he also had a prior history of polycythemia vera diagnosed in 2001 ( day 3566 ) , arterial hypertension , rickettsiosis diagnosed and treated on may 2010 ( day 441 ) , and pulmonary tuberculosis infection , with clinical response to treatment .
patient was submitted to deceased - donor renal transplant on 1st of september 2011 ( day 0 ) .
post - surgery was complicated with infected retroperitoneal hematoma ( treated with meropenem and vancomycin ) , surgical wound infection by pseudomonas aeruginosa ( treated with ciprofloxacin plus ceftazidime ) , and candida albicans oropharyngitis ( resolved with fluconazole ) .
allograft presented delayed graft function and later , acute vascular rejection ( banff iia ) for which ten doses of anti - thymocyte globulin ( atg ) were administered ( day 35 ) . due to persistent fever and sepsis with negative blood cultures , and failure to recover renal function ,
cultured fluid collected from the abdominal drain placed in the area of the removed allograft was positive for c. neoformans .
normal opening pressure was found on lumbar puncture , with negative india - ink csf . on day 89
patient was started on liposomal amphotericin b ( 1.0 mg / kg per day iv ) for four weeks , with complete resolution of symptoms .
he progressively recovered and was discharged under fluconazole ( 200 mg per day , oral ) .
an 18 year - old male with unremarkable history until july 2011 ( day 173 ) , was diagnosed with sle due to anemia , thrombocytopenia , malar rash , and positive anti - nuclear ( ana ) and double - strand dna antibodies ( dsdna ) .
he was prescribed high dose methylprednisolone ( total 1.5 g ) followed by oral prednisone ( 1 mg / kg ) , along with twice monthly administrations of intravenous ( iv ) 500 mg of cyclophosphamide ( total 3 doses ) .
six weeks later patient presented to the emergency department ( day 0 ) due to fever ( 39 c ) and diarrhea .
empirical prescription with ciprofloxacin to an infectious diarrhea was performed and was admitted to the ward .
pneumonia was diagnosed on day 2 due to hypoxemic respiratory failure and a lower right lung condensation on the x - ray .
antibiotherapy spectrum was broadened to meropenem . c. neoformans was isolated on blood cultures retrieved at admission ( day 6 ) .
lumbar puncture presented an opening pressure of 26 cm / h2o . though clear and colorless , csf fluid was india - ink and culture positive for c. neoformans .
immunosuppression was reduced and iposomal amphotericin b ( 1 mg / kg per day , iv ) plus flucytosine ( 100 mg / kg per day , iv ) was prescribed .
patient presented good clinical outcome and was discharged on day 41 prescribed with fluconazole ( 200 mg per day , oral ) for 12 months .
a 34 year - old male with chronic renal failure due to renal malformation , was admitted due to persistent headaches .
he was on hemodialysis since 1998 ( day 4783 ) and submitted to deceased - donor renal transplant in april 2001 ( day 3780 ) .
immunosuppressive therapy consisted of cyclosporine a ( csa ) and mycophenolate mofetil ( mmf ) , with posterior conversion to sirolimus .
high dose methylprednisolone ( mp ) , plasmapheresis , monthly high - dose immunoglobulin infusions , and rituximab were administered due to acute humoral rejection in april 2010 ( day 548 ) . on november 2011 ( day 0 )
he was presented to the emergency department with a 5 day frontal headache , nausea and vomiting , photo- and phonophobia .
hematologic and biochemical analysis demonstrated normal white blood cells count , no anemia nor thrombocytopenia , and a normal c - reactive protein ( c - rp ) level .
cerebral mri presented asymmetric cortical lesions , with hyperintensity on t2-weighted and hipointensity on t1-weighted images .
cerebral spinal fluid ( csf ) analysis revealed 138 white blood cells ( 137 lymphocytes ) , glucose 0.69 g / l , and proteins 0.69
csf was india - ink and culture positive for c. neoformans , and polymerase chain reaction ( pcr)-positive for cytomegalovirus ( cmv ) .
treatment with liposomal amphotericin b associated to fluconazole was initiated , along with valganciclovir and anti - cmv immunoglobulins .
transition to fluconazole ( 400 mg per day , oral ) for 12 months and valganciclovir ( 450 mg every other day ) for 6 months was performed .
a 56 year - old caucasian male was admitted due to fever of unknown origin .
he had end stage renal disease due to a rapidly progressive iga nephropathy treated with cyclophosphamide for 6 months ( cumulative dose 21.6 g ) plus prednisone .
he also had a prior history of polycythemia vera diagnosed in 2001 ( day 3566 ) , arterial hypertension , rickettsiosis diagnosed and treated on may 2010 ( day 441 ) , and pulmonary tuberculosis infection , with clinical response to treatment .
patient was submitted to deceased - donor renal transplant on 1st of september 2011 ( day 0 ) .
post - surgery was complicated with infected retroperitoneal hematoma ( treated with meropenem and vancomycin ) , surgical wound infection by pseudomonas aeruginosa ( treated with ciprofloxacin plus ceftazidime ) , and candida albicans oropharyngitis ( resolved with fluconazole ) .
allograft presented delayed graft function and later , acute vascular rejection ( banff iia ) for which ten doses of anti - thymocyte globulin ( atg ) were administered ( day 35 ) . due to persistent fever and sepsis with negative blood cultures , and failure to recover renal function ,
cultured fluid collected from the abdominal drain placed in the area of the removed allograft was positive for c. neoformans .
normal opening pressure was found on lumbar puncture , with negative india - ink csf . on day 89
patient was started on liposomal amphotericin b ( 1.0 mg / kg per day iv ) for four weeks , with complete resolution of symptoms .
he progressively recovered and was discharged under fluconazole ( 200 mg per day , oral ) .
an 18 year - old male with unremarkable history until july 2011 ( day 173 ) , was diagnosed with sle due to anemia , thrombocytopenia , malar rash , and positive anti - nuclear ( ana ) and double - strand dna antibodies ( dsdna ) .
he was prescribed high dose methylprednisolone ( total 1.5 g ) followed by oral prednisone ( 1 mg / kg ) , along with twice monthly administrations of intravenous ( iv ) 500 mg of cyclophosphamide ( total 3 doses ) . patient was discharged on the 08th of january 2012 ( day 42 ) .
six weeks later patient presented to the emergency department ( day 0 ) due to fever ( 39 c ) and diarrhea .
empirical prescription with ciprofloxacin to an infectious diarrhea was performed and was admitted to the ward .
pneumonia was diagnosed on day 2 due to hypoxemic respiratory failure and a lower right lung condensation on the x - ray .
antibiotherapy spectrum was broadened to meropenem . c. neoformans was isolated on blood cultures retrieved at admission ( day 6 ) .
lumbar puncture presented an opening pressure of 26 cm / h2o . though clear and colorless , csf fluid was india - ink and culture positive for c. neoformans .
immunosuppression was reduced and iposomal amphotericin b ( 1 mg / kg per day , iv ) plus flucytosine ( 100 mg / kg per day , iv ) was prescribed .
patient presented good clinical outcome and was discharged on day 41 prescribed with fluconazole ( 200 mg per day , oral ) for 12 months .
herein we report three cases of different clinical settings and presentations of invasive cryptococcal infections in non - hiv immunocompromised patients .
c. neoformans is an encapsulated yeast , that has been isolated in pigeons ' and chickens ' droppings . in humans it can colonize the upper airway system .
nevertheless , no animal - to - human nor person - to - person respiratory transmission has been documented .
pappas pg et al . , from the transplant - associated infection surveillance network ( transnet ) , reported a cryptococcal infection incidence of 3.7% in renal transplant recipients , with a 12 month death rate of 73% . among 8672 kidney recipients , the median time to diagnosis was 575 days , with the lower quartile just over the 6 month period , and with only 22 patients presenting after the 3rd year post - transplant .
the first case reported here presents a patient with 10 year transplant vintage , whose immunosuppression was previously converted from cyclosporine to sirolimus . both calcineurin inhibitors ( cyclosporine and tacrolimus ) , the mainstay of immunosuppression in solid organ transplant , have been shown to suppress the growth of the c. neoformans in vitro
.
it has been proposed that cyclosporine 's lower concentration in csf , when compared to tacrolimus , explains the higher incidence of central nervous system ( cns ) cryptococcal infection in patients under csa .
though there was no time - relation to the development of symptoms , two events might have positively influenced the risk to fungal infection .
first the cyclosporine - to - sirolimus conversion , and additionally a probable state of over - immunosuppression due to the previously administered methylprednisolone and rituximab . primary infection is the main form of cryptococcus transmission , but donor - derived and unrecognized pre - transplant latent disease have also been described .
a donor - derived transmission is suggested by a more localized form of disease found in these patients , often restricted to the transplanted organ or drainage fluid .
the second case reports a cryptococcal infection less than 3 months post - transplant , with cryptococcus isolated solely on the removed allograft and post - transplantectomy drainage fluid .
immune response to cryptococcal infection is mainly mediated through innate ( macrophages and natural killer cells ) and adaptive immune system .
it has been proposed that the decreased production of pro - inflammatory cytokines , and consequent reduction on the development of t helper cells ( th-1 ) , increases the risk for early post - transplant cryptococcal infection . to the author 's comprehension
, there was likely a conjunction of factors that lead to infection in the second patient .
a latent undiagnosed cryptococcal infection in the donor may have been delivered to an uremic patient , with innate immune depression due to corticosteroid therapy , and a restrained t - cell response due to cyclosporine and mmf therapy .
autoimmune diseases , like transplant recipients , require high doses of immunosuppression to control disease symptoms and reduce organ damage .
kdigo and acr / eular guidelines recommend high doses of corticosteroids and either intravenous cyclophosphamide or oral mmf for the treatment of lupus nephritis classes iii and iv . even though , only a few hundred cases of fungal invasive infections in sle patients can be found in literature . in the largest report ( n=15 ) from chen et al .
the median time from sle diagnosis to disease was 33months , and mortality rate 46.6% .
the early presentation of infection post - immunosuppression is more suggestive of a reactivation of latent infection .
even though the patient with lupus reported here lived in a suburban area , with low social - economic and hygiene status , he denied contact with pigeons . in the presented cases culture
the later frequently presents as outbreaks , but has mainly been described in north america .
even though it has been previously described in portugal a single case of c. gattii infection , to the authors ' comprehension the clinical presentation and response to therapy makes it likely that the presented cases correspond to c. neoformans infection .
guidelines for cryptococcus treatment recommend a combined therapy of flucytosine plus amphotericin . though the combination was only administered to one patient , a favorable outcome was achieved in the 3 cases . a mainstay of the treatment relies on the management of immunosuppression , which must be individualized to each patient .
caution must be taken when reducing immunosuppression , since a rapid reduction can result in the development of organ rejection and/or immune reconstitution inflammatory syndrome ( iris ) an inflammatory tissue response due to improvement in cellular immunity , presenting as lymphadenitis , cellulites , aseptic meningitis , pulmonary nodes , or allograft loss in kidney transplant recipients .
the three cases presented highlight the vital importance for early recognition and microbiological diagnosis of cryptococcal infection among non - hiv immunocompromised patients .
clinicians ' awareness in transplanted and auto - immune disease patients is recommended . a good communication and collaboration between the laboratory and the clinic is essential to achieve the best results . | cryptococcal infection has been increasing among immunosuppressed population .
we report three cases of cryptococcus neoformans infection in immunosuppressed patients two renal transplanted and one with lupus nephritis . early infection ( < 3months ) was diagnosed in two an allograft cryptococcus infection and a central nervous system involvement .
the third , a 10-year transplant vintage patient , presented with cryptococcal meningitis .
amphotericin b provided good clinical outcomes .
we outline the importance of suspicion for cryptococcal infection in immunosuppressed patients . | Introduction
Case
Case 1
Case 2
Case 3
Discussion
Conflict of interest |
a 15-year - old boy presented with complaints of complete loss of vision in the right eye of 1-week duration .
he gave a history of having undergone surgery in a multidisciplinary hospital a week back for removal of cervical spinal osteoblastoma .
following surgery , he developed visual complains on regaining consciousness and was given intravenous antibiotics after a presumptive diagnosis of orbital cellulitis .
fundus examination showed gross retinal vascular attenuation with optic atrophy , suggestive of crao [ fig .
anterior and posterior segment examination of the left eye did not reveal any abnormality .
external face photograph showing right eye ptosis and proptosis extraocular movements in nine cardinal positions of gaze showing complete ophthalmoplegia of the right globe fundus photograph of the right eye showing gross retinal vascular attenuation with optic atrophy both computerized tomography scan and magnetic resonance imaging ( mri ) were suggestive of an inflammatory process with peri and retrobulbar soft tissue involving the lacrimal gland , extraocular muscles , and optic nerve sheath extending up to the orbital apex [ fig .
interventions such as ocular - digital massage , anterior chamber paracentesis , intravascular thrombolysis , and medications like vasodilators or acetazolamide to lower the iop may help to relieve compression on the vasculature and restore blood flow to the retina .
we did not attempt any surgical or medical therapy in this patient as he presented to us after a week of onset of his symptoms .
for any treatment to be effective ; it had to be initiated within 6 h.
( a ) axial computerized tomography scan , ( b ) postcontrast magnetic resonance imaging scan showing right periorbital and retrobulbar soft tissue swelling involving the lacrimal gland , extraocular muscles , and optic nerve sheath extending up to the orbital apex
the american society of anesthesiologists ( asa ) povl registry established in 1999 by the asa committee on professional liability provides an in - depth analysis of 93 cases associated with spine surgery . according to their data ,
ion was the most common cause of visual loss ( 89% ) , and crao accounted for the rest .
pion is more common as its vascular supply is derived from small pial vessels which are incapable of autoregulatory control .
the risk factors for the development of ion include male sex , prolonged surgery in the prone position , anemia , hypotension , and raised iop .
the mechanisms which explain iop rise in a patient undergoing spinal surgery could be direct pressure on the globe , raised central venous pressure , and prone positioning .
raised iop superimposed with intraoperative anemia and hypotension can lead to ischemia of the optic nerve .
central retinal artery occlusion may result from extrinsic ocular pressure caused by head rest or anesthetic mask malposition in the presence of hypotension , shock , or prolonged anesthesia .
vision loss ( either due to ion or crao ) following nonocular surgeries has been rarely reported in the literature , and visual loss with ophthalmoplegia is even rarer . till date 13 , cases of vision loss along with ophthalmoplegia following nonocular surgeries have been described in the literature [ table 1 ] .
there is only one case report which mentions mri abnormalities in extraocular muscles following nonocular surgery .
reported cases of postoperative visual loss with ophthalmoplegia an ischemic orbital compartment syndrome like condition due to periorbital edema may also result in ophthalmoplegia as described by leibovitch et al .
reproduced visual loss and ophthalmoplegia experimentally in seven rhesus monkeys using orbital compression for 60 min in the presence of hypovolumia and hypotension .
the suggested mechanism was that the collapsed arterial and venous channels of the orbit dilated on the subsequent release of the external pressure which led to the transudation of fluid through the permeable walls into the tissue spaces .
this accumulation of fluid resulted in orbital edema , proptosis , paresis of ocular movement , and retinal edema .
we believe that the visual loss and ophthalmoplegia in our patient were caused by the prolonged spinal surgery in the prone position , due to a similar mechanism .
both the anesthetist and surgeon need to be aware of the positioning of the patient , time taken during surgery , and any external ocular compression during surgery should be avoided .
bradyarrhythmias during surgery should be carefully monitored as these episodes may indicate vagal stimulation induced by increased intraorbital pressure .
each patient , with or without preexisting risk factors or intraoperative complications , should undergo ophthalmic examination including vision , pupillary reaction , extraocular movements , iop , and fundus in the immediate postoperative period .
a timely lateral canthotomy with cantholysis may have helped to prevent such a devastating complication in this young man .
all patients should be counseled about this unlikely peril well before the surgical procedure is undertaken .
both the anesthetist and the surgeon need to be vigilant regarding development of such a situation and aware of the possible risk factors . early diagnosis and prompt intervention by an ophthalmologist may prevent this devastating complication . | we report a case of a 15-year - old boy who presented with profound visual loss and complete ophthalmoplegia after an uneventful spinal surgery for removal of cervical osteoblastoma .
postoperative visual loss following nonocular surgery is , fortunately rare , yet a devastating complication .
the most common cause is ischemic optic neuropathy , but it can also be due to central retinal occlusion or cortical blindness .
visual loss in conjunction with ophthalmoplegia is rarely seen , and there are very few reports in the literature .
we also review the related literature and highlight the mechanism and preventive measures . | Case Report
Discussion
Conclusion |
foot orthoses is often used to correct the foot alignment for the treatment or prevention
of the injuries and for performance enhancement .
clinically , patients who have foot as well
as knee and hip joint problems use foot orthoses to alleviate symptoms . in sports ,
foot
orthoses is sometimes prescribed for improving propulsion force transmission , absorbing
ground reaction force , and increasing or decreasing muscle activity level .
the effect of
orthoses has been researched and recent systematic review regarding orthoses reported that
kinematic , shock attenuation , and neuromuscular paradigms are the main effects of
orthoses1 .
specifically , kinematic
changes led by orthotic use have been reported in numerous studies .
these studies described
that foot eversion angle and moment are reduced by orthoses2 , 3 . in recent years
, the
number of studies reporting the effect of orthoses on neuromuscular paradigms has been
increasing .
tibiails posterior ( tp ) , peroneus longus ( pl ) and flexor digitorum longus ( fdl ) produce a
torque toward plantar flexion , which functions as propulsion force during walking . in
addition to this
, these muscles control foot pronation or supination and maintain the arches
of the foot4,5,6 .
these functions can change
the foot rigidity and flexibility that adapt the mechanical demands on the foot .
orthoses
are considered to compensate the function of the calf muscles and alter the muscle activity
pattern .
several studies researched the effect of the orthoses on the tp , pl , and
gastrocnemius muscle7,8,9 .
the results of those
studies showed that the muscle activity level of tp decreased , while the pl demonstrated
increased muscle activity level during walking .
however , no study has researched the effect
of orthoses on the muscle activity level of the tp , pl , and fdl simultaneously .
therefore , the purpose of this study was to determine the tp , fdl , and pl muscle activity
change resulting from orthotic insertion during the walking stance phase by using a
fine - wire and a surface electromyography ( emg ) .
moreover , stance phase was divided into
three phases and muscle activity alteration of each muscle was analyzed in each phase .
sixteen healthy male students ( age : 24 4.9 years , height : 168.4 5.1 cm , and weight :
60.9 7.8 kg ) participated in this study .
participants who had injuries or surgical
intervention for the lower extremities in the past year or had a neurological problem were
excluded .
the
ethical committee of waseda university approved this experiment in accordance with the
helsinki declaration ( ethics i d : 2015 - 010 ) .
the fine - wire intramuscular electrodes were inserted into
the right tp muscle belly . during insertion , the tip of the needle and muscles were observed
by using an ultrasound system ( logiqe , ge , usa ) .
,
the fine - wire intramuscular electrodes were also inserted into the right fdl .
accurate
insertion into tp and fdl was checked with the muscle activity level during active foot
pronation , adduction , and plantar flexion for the tp and toe flexion for the fdl . if the emg
amplitude did not appear for each motion , it was defined as failed insertion and excluded
from the data . for the pl measurement ,
surface electrodes ( bluesensor n-00-s , mets co. ,
japan ) were placed on the muscle belly of the right pl . the skin was rubbed with an abrasive
and alcohol to decrease skin impedance . a wireless emg telemeter system ( biolog dl-5000 ,
s&me co. , japan )
gait tasks were performed under three conditions : ( 1 ) barefoot , ( 2 ) with footwear , and ( 3 )
with footwear plus orthoses ( orthoses ) .
all participants wore the same type of footwear
( calcetto le3 , asics , japan ) and prefabricated orthoses ( athlete grip7 , winning one inc .
prefabricated orthoses was employed in this study because it is more clinically
meaningful if easy and low cost prefabricated orthoses can change the muscle activity
pattern of the calf muscles .
the upper layer of the prefabricated insole was made of poly
microsuede and the base material was ethyl vinyl acetate .
the orthoses had three arch
supports for the medial longitudinal , lateral longitudinal , and transverse arches .
a force plate ( kistler instrument ag , switzerland ) was placed on the middle of the walkway .
the force plate and emg system were synchronized for simultaneous data collection . in each
condition , participants were instructed to walk at comfortable speed on the walkway and step
on the force plate with the right foot during gait trials . prior to measurement , sufficient
practice was allowed for the participants to become familiarized with the task .
maximum voluntary
isometric contractions ( mvics ) for tp , pl , and fdl were measured after completing the gait
tasks in each condition .
all mvic measurements were performed in a sitting position . over
five seconds of mvics
were measured for each muscle . one - second periods of time , including
the maximum root mean square ( rms ) from the entire mvics data , were recorded and used as the
mvic values for each muscle .
one stance phase per gait trial , which was defined from the force plate data , was selected
to analyze the muscle activity level of each muscle . when the vertical ground force exceeded
more than 10 n
when the
vertical ground reaction force decreased less than 10 n , the time frame was defined as toe
off .
in addition , the stance phase was further divided into contact , midstance , and
propulsion phases .
the anterior - posterior force value from the force plate data was used to
define these phases ( fig .
1.definition of the phases based on the anterior - posterior force data during stance
phasethe contact phase was defined from the beginning of the stance phase to the
negative peak value .
the midstance phase was defined from the negative peak value to
the zero value .
the propulsion phase was defined from the zero value to the end of the
stance phase . ) .
the contact phase was defined from heel contact to the negative peak value of the
anterior - posterior force .
the midstance was defined from the negative peak value to the time
frame when the anterior - posterior force value reached zero .
the propulsion phase extended
from zero value of the anterior - posterior force to toe off .
the sampling rate of emg and the
force plate data was 1,000 hz .
raw emg signals were analyzed with software ( bimutas - video ,
kissei comtec co. , ltd .
the emg data were rectified , high - pass filtered at 20 hz ,
and low - pass filtered at 500 hz to remove motion artifacts .
data from the gait tasks was
normalized with mvic values , using a rms value presenting as % mvic .
the % mvic values from
one stance phase from each trial and task were averaged and used for statistical
analysis .
definition of the phases based on the anterior - posterior force data during stance
phasethe contact phase was defined from the beginning of the stance phase to the
negative peak value .
the midstance phase was defined from the negative peak value to
the zero value .
the propulsion phase was defined from the zero value to the end of the
stance phase . in order to confirm the normal distribution of emg data ,
kolmogorov - smirnov test was
employed . because all data had a normal distribution , one - way
repeated measure anovas was
conducted to compare the muscle activity level of each muscle in the three conditions during
each phase . if mauchley s test detected a violation of the assumption for sphericity , the
f - ratio was determined from the greenhouse - geisser epsilon .
bonferroni
post hoc analysis was used if one - way repeated measures anovas detected significant
differences .
because of the emg measurement failure for tp and fdl , the total number of participants
decreased to ten ( age : 25 5.0 years , height : 167.9 5.7 cm , weight : 61.5 7.8 kg ) .
four
participants were excluded because of failed electrode insertion into the tp and two for
inaccurate placement in the fdl .
the results of the % mvics for each muscle in each condition and phase are presented in
table 1table 1.% mvic comparison among three conditions in each phasemusclephaseconditionsbarefootfootwearorthosestptotal32.4 15.226.1 17.621.5 13.0contact24.6 20.923.3 20.619.7 14.2midstance*21.8 13.416.3 10.012.3 7.5propulsion*39.4 21.029.8 22.124.5 16.6**pltotal31.7 16.430.2 13.630.7 15.4contact14.4 6.316.7 8.014.5 8.4midstance22.3 15.922.3 13.821.2 13.6propulsion38.2 22.136.9 16.938.1 17.9fdltotal35.4 16.339.4 18.540.0 18.5contact19.7 11.517.5 7.513.7 5.5midstance26.3 19.523.3 12.720.4 14.0propulsion47.8 22.052.0 26.053.0 26.4tp : tibialis posterior , pl : peroneus longus , fdl : flexor digitorum longus .
* one - way
repeated measures anova showed a significant difference ( p<0.05 ) . *
* post hoc
analysis showed a significant difference between barefoot and orthoses ( p<0.05 ) .
the tp showed a significant difference in the % mvic among three conditions
in midstance ( f(2,18)=4.66 , p=0.023 , es = 0.34 ) and propulsion
phase ( f(2,18)=3.64 , p=0.047 , es=0.29 ) .
there was no significant
difference in the total stance and contact phase ( p>0.05 ) .
bonferroni post hoc analysis
revealed that the orthoses condition showed significantly less % mvic value of tp compared
to barefoot condition in the propulsion phase alone ( p<0.036 ) .
although a significant
difference was detected by one - way repeated measures anovas in midstance phase , post hoc
analysis did not show a significant difference among three conditions ( p>0.05 ) .
the
average waveform of tp during the stance phase of walking is shown in fig .
the % mvic of the fdl and pl showed that there were no statistical differences
between the three conditions in each phase ( p>0.05 ) ( table 1 ) .
tp : tibialis posterior , pl : peroneus longus , fdl : flexor digitorum longus .
* one - way
repeated measures anova showed a significant difference ( p<0.05 ) . * * post hoc
analysis showed a significant difference between barefoot and orthoses ( p<0.05 ) waveform of tp muscle activity in each condition during gait
the current study is the first study that assessed the effect of the orthoses on emg
amplitude change of tp , pl , and fdl simultaneously during gait .
the current study revealed
that the orthoses significantly reduced muscle activity level of tp in midstance and
propulsion phases during gait .
in contrast , muscle activity level of the pl and fdl remained
the same for all conditions in each phase .
the function of tp during gait is to prevent excessive foot
pronation during the contact phase and to increase the stiffness of foot during the
propulsion phase4 , 11 .
in addition , the medial longitudinal arch is maintained by tp
during weight bearing activities12 .
owing
to the relative distance between the axes of the subtalar joint and tp tendon , tp functions
as the strongest supinator muscle of the hindfoot5 ,
13 .
foot supination in the propulsion
phase is fundamental in increasing rigidity of the foot , a function known as midtarsal
locking mechanism that has an advantage of improving force transmission efficiency14 . considering this reduction of the muscle
activity level of tp in the propulsion phase with orthoses ,
the rearfoot might be
stabilized , and the function of tp , which increase the stiffness of the foot , can be
compensated by the orthoses .
however , this result is inconsistent with a previous study . the
results of the previous study reported that a significant reduction in the rms amplitude of
tp was found during the contact phase of gait with prefabricated and customized foot
orthoses compared to shoes only condition7 . in the previous study , there were no significant differences in rms
amplitude during midstance / propulsion phase among the conditions . because the previous study
divided the contact phase into 2 phases ; contact phase and midstance / propulsion phase based
on the emg pattern , number of phases and hence the definition of phases are different from
the current study .
these differences might have led to the inconsistent results . although
the phase where the reduction of tp muscle activity found was different , orthoses can
decrease the muscle activity level of tp while walking .
contraction of pl during gait results in decreased foot rigidity
and increased energy dissipation rate4 .
these mechanisms are antagonistic in function with tp and are important for shock
attenuation .
the effect of orthoses on pl activity has been described by several
studies8 , 15 ,
16 .
two studies showed that significantly higher muscle activity level was
observed with orthoses8 , 15 .
however , a previous study reported that muscle activity
level of the pl did not alter15 .
significant increase of the pl muscle activity level was considered due to laterally
unstable conditions caused by posting . in order to stabilize the subtalar joint against the
tilting
this may influence the result that orthoses did not affect the muscle activity
level of pl .
the muscle activity of fdl also showed no difference in the three conditions in all phases .
because no previous study assessed the fdl activity change with orthoses , the results can not
be compared to those of other researches . in normal gait , the fdl contracts from midstance
to toe off during gait17 .
similar to tp ,
fdl isometrically contracts to maintain the height of the longitudinal arch of the foot
thereby improving the propulsion force transmission efficacy6 .
although orthoses might be able to support medial and lateral
longitudinal arches as well as transverse arch , it might not be sufficient to support arches
and compensate for the activity of fdl .
clinically , the reduction of the muscle activity level of tp might be beneficial for some
injuries .
the traction force applied to the medial distal tibia is one of the mechanisms
resulting in medial tibial stress syndrome ( mtss ) .
recent studies demonstrated that tp does
not have direct insertion into the symptomatic location of the medial distal tibia18 , the tp , fdl , and soleus muscles are
responsible for generating the traction force on the medial distal tibia via the crural
fascia19 .
consequently , the reduction
of tp muscle activity with orthoses can be beneficial for patients who have mtss .
the sample size decreased due
to technical errors in measuring the fine - wire emg .
precise insertion of the electrodes into
the muscle belly of tp and fdl is technically challenging and must be carefully performed to
avoid damaging these structures10 .
additionally , muscle contraction of the calf muscles pulls out the wires even when the tips
are properly inserted .
more stable and accurate insertion technique should be considered for
future studies . in summary ,
the current study assessed the muscle activity change of the tp , fdl , and pl in
three conditions , barefoot , footwear , and orthoses , during gait . gait with orthoses
exhibited significantly less tp muscle activity than that in the barefoot condition .
pl and fdl had no
significant muscle activity changes in the three conditions in all phases .
reduction of tp
muscle activity might be beneficial for patients who have excessive tp contraction related
injuries , such as mtss . further research is required to clarify the clinical effect of
orthoses in patients with mtss . | [ purpose ] the purpose of the study was to assess the muscle activity change of the
tibialis posterior , flexor digitorum longus , and peroneus longus during gait with
orthoses .
[ subjects and methods ] sixteen healthy males participated in this study .
activity of each muscle was measured by using fine - wire and surface electromyography .
gait
task was performed by the participants barefoot , with footwear and with orthoses .
the
electromyography data from a stance phase of each gait trial were used for analysis .
the
stance phase was divided into contact , midstance , and propulsion phases .
the data from ten
participants were extracted for final analysis , as electromyography measurements were
unsuccessful for the other six .
[ results ] the results demonstrated that orthoses
significantly reduced the tibialis posterior muscle activity in the propulsion phase
compared to that in the barefoot condition .
although there was a significant difference in
the midstance phase , post hoc analysis did not indicate significant differences among the
phases .
no significant electromyography amplitude change was detected in flexor digitorum
longus and peroneus longus . [
conclusion ] orthothes reduced the tibialis posterior activity
level during gait . this result may be beneficial for patients with injuries related to
excessive activity of tibialis posterior . | INTRODUCTION
SUBJECTS AND METHODS
RESULTS
DISCUSSION |
pcos is one of the most common endocrine disorders in women of reproductive age with a prevalence of 5%7% [ 13].pcos is associated with a broad range of adverse sequelae , including hypertension , dyslipidemia , insulin resistance , hyperandrogenaemia , gestational and type 2 diabetes , which ultimately increase the risk of cardiovascular morbidity [ 412 ] .
obesity is present in varying degrees in women with pcos and is associated with hyperandrogenaemia and insulin resistance .
obesity is associated with a state of chronic systemic inflammation manifested by increased serum levels of inflammatory cytokines as well as alterations in peripheral blood lymphocyte frequencies and function [ 1416 ] .
these changes are present not only at the tissue level but also in adipose , liver , and other tissue beds [ 17 , 18 ]
. this inflammatory process could be the underlying cause of obesity - related comorbidities , including atherosclerosis , diabetes and steatohepatosis [ 1923 ] .
however , there is a significant crosstalk between innate and adaptive immune systems , and indeed disorders of both innate and adaptive immunity have been implicated in obesity - related inflammation [ 17 , 24 , 25 ] .
inflammation is not only an acute response to trauma or infection , it is also a response to the ongoing processes of cell turnover associated with aging . in this regard ,
the inflammatory response regulates fundamental processes intrinsic to cellular homeostasis , including proliferation , necrosis , and apoptosis . in keeping with the task of regulating tissue turnover ,
inflammatory responses are triggered not only by exogenous stimuli , but also by endogenous stimuli , such as the by - products of cell necrosis and apoptosis .
for example , free fatty acids , systemic levels of which are elevated in obesity , are primary ligands for toll - like receptors , central regulators of the innate immune response [ 27 , 28 ] .
free fatty acids and toll - like receptors therefore act as a direct link between the systems that regulate obesity and inflammation . at the molecular level ,
the intracellular signalling pathways that govern inflammation and glucose homeostasis demonstrate significant crosstalk and share multiple signalling mediators . at the cellular level ,
adipocytes and macrophages are closely related and likely evolved from a common primordial precursor cell , further evidence of the parallel evolution of inflammation and metabolic systems .
approximately 60%70% of pcos patients are obese , with a central body fat distribution pattern described as visceral obesity that is well known to be highly associated with insulin resistance .
however , pcos patients have evidence of insulin resistance independent of obesity [ 3133 ] .
insulin sensitivity is decreased by 35%40% in women with pcos , independent of obesity , a decrease similar in magnitude to that seen in t2 dm mellitus ; however , any degree of obesity further impairs insulin action . about 50%70% of all women with pcos have some degree of insulin resistance .
it is now evident that pcos has major metabolic consequences related to insulin resistance .
insulin resistance is associated with an increased risk for several disorders , including type 2 diabetes , hypertension , dyslipidemia ( low high - density lipoprotein cholesterol and high triglycerides ) , elevated plasminogen activator inhibitor type 1 ( pai-1 ) , elevated endothelin-1 , endothelial dysfunction , and heart disease .
data have demonstrated a correlative as well as causative relationship between insulin resistance and inflammation .
furthermore , in light of the role of insulin resistance in pcos and of the increased cardiovascular risk of affected women , a relationship between inflammation and hormonal - metabolic features of women with pcos has been demonstrated .
according to rotterdam consensus criteria commonly used in clinical practice , two of the following three must be fulfilled for the diagnosis of pcos : polycystic ovaries ( 12 or more follicles in each ovary , each follicle measuring 29 mm in diameter and/or ovarian volume > 10 ml , one polycystic ovary is sufficient for the diagnosis ) , oligo-/anovulation ; clinically diagnosed as oligo-/amenorrhea ( menstrual cycles longer than 35 days or less than 10 menstruations per year ) and hyperandrogenism ( clinical or biochemical ) . in this consensus insulin resistance , metabolic syndrome , and obesity
however it is possible that some phenotypes of pcos ( i.e. , those characterised by polycystic ovaries and oligo - menorrhea as per rotterdam consensus criteria ) may simply reflect abnormal androgen and/or lh production without having metabolic implications .
it has been reported that women with pcos have significantly increased hs - c - reactive protein ( hs - crp ) concentrations , suggesting crp a marker of low - grade inflammation , as a predictor of coronary heart disease and cardiovascular events in pcos that is also independently related to insulin resistance .
the leukocyte count was found to be significantly higher in women with pcos compared with healthy women , although no case of leukocytosis was found in either group . regarding the leukocyte differential , significant increases in lymphocytes and monocytes
were observed in women with pcos compared with controls , which might have been expected considering that they play a key role in the pathophysiological mechanism of atherosclerosis .
inflammation has been recognised to play a central role in both initiation and progression of the atherosclerotic process ; therefore , an elevated leukocyte count should be directly associated with increased incidence of coronary heart disease , ischemic stroke , and mortality from cardiovascular disease . in patients with pcos circulating levels of tumour necrosis factor ( tnf ) , interleukin ( il)-6 , hs - crp , as well as white blood count ( wbc ) and neutrophil count
have been found to be elevated compared with age- and /body mass index- ( bmi- ) matched controls [ 40 , 42 , 43 ] .
in contrast , it has been shown that obesity , and not pcos status per se , was a major determinants of the circulating inflammatory markers tnf , soluble type 2 tnf receptor , il-6 , and hs - crp [ 44 , 45 ] .
increase in both low - grade chronic inflammation and insulin resistance in women with pcos is associated with increased central fat excess rather than pcos status .
furthermore , tnf is over expressed in adipose tissue and induces insulin resistance through acute and chronic effects on insulin - sensitive tissues .
the source of excess circulating tnf in pcos is likely to be adipose tissue in the obese but remains unknown in lean women with the disorder .
however , increased visceral obesity could be a source of excess tnf in lean women with pcos .
another proinflammatory cytokine is il-18 , which was reported to be increased in pcos .
il-18 induces the production of tnf which promotes the synthesis of il-6 , which is also considered a strong risk marker for cardiovascular disease .
collectively , the above findings indicate that low - grade chronic inflammation could be a novel mechanism contributing to increased risk of coronary heart disease in pcos .
, it is not surprising that the same alterations of abdominal obesity have been found in obese women with pcos .
in fact , compared with normal weight controls , obese women with pcos present lower levels of adiponectin , increased levels of pai-1 , increased activity of the angiotensin - renin system [ 53 , 54 ] , and increased cytokines and inflammatory markers .
however , obese patients with pcos have more severe insulin resistance and higher androgen levels in comparison with non - pcos women with abdominal obesity .
since both of these factors may affect adipocyte function , it is important to understand whether there are differences in production of adipose factors between obese women with pcos and non - pcos women with abdominal obesity .
there were no differences in levels of leptin , resistin , and adiponectin between obese women with pcos and obese controls .
there were also no differences in levels of tnf , il-6 , and markers of inflammation between obese women with pcos and obese controls [ 41 , 44 ] .
a significant increase in pai-1 levels between obese women with pcos and obese controls has been reported . however , comparing normal - weight patients with pcos with controls of similar bmi , normoweight women with pcos have higher serum levels of pai-1 , tnf and lower adiponectin than normoweight controls [ 41 , 53 , 55 ] .
all these data suggest that normoweight women with pcos have an increased production of adipokines that is similar to that found in abdominal obesity . since these patients present a mild hyperinsulinemia and insulin resistance , it is possible that it is sufficient to alter the adipocyte function .
consistent with this hypothesis , serum pai-1 correlates with serum insulin in normoweight women with pcos [ 58 , 59 ] .
however , in the same group of patients , no correlation was found between serum adiponectin or serum tnf and serum insulin levels or indices of insulin resistance . even in overweight patients with pcos
no correlation between serum adiponectin and serum insulin or indices of insulin resistance was found .
abundant leptin receptors have been detected in ovarian granulosa and theca cells ; furthermore , leptin treatment of these cells in vitro caused significant reduction in their steroid output .
it is possible that leptin has a dual effect on reproduction and that the major site of action differs according to the circulating levels .
initial reports suggested that a substantial proportion of women with pcos have leptin levels that are higher than expected for their bmi .
however subsequent studies have provided evidence that circulating leptin levels are fully accounted for by the degree of adiposity and bmi compared to matching control subjects [ 6467 ] . on the other hand ,
it has also been reported that , for any given body weight , circulating leptin concentrations are lower in women with pcos than those without , suggesting that neuroendocrine recognition of obesity may be impaired in such women .
hyperinsulinemia alone is likely not sufficient to explain adipocyte dysfunction of normoweight women with pcos .
theoretically , normoweight and overweight women with pcos may have some degree of visceral obesity that is insufficient to effect an increase in body weight per se , but that may be sufficient to determine increased production of some adipokines . on the other hand , visceral obesity and hyperinsulinemia are generally strictly related , and it is difficult to separate the two phenomena .
it has been shown that normoweight patients with pcos have higher fat accumulation in visceral deposit and lower subcutaneous fat in gluteofemoral area .
although greater experiences and studies on the correlation between fat distribution and adipose products in normo - weight and overweight women with pcos are needed , the available data suggest that in these patients , increased abdominal fat participates in the increased cardiovascular risk .
of course , insulin resistance is linked to the increase of visceral fat , and it may contribute to the adipocyte dysfunction of normoweight women with pcos . in conclusion ,
patients with pcos present excessive fat accumulation in visceral deposits , and it plays an important role in their increased cardiovascular disease .
this altered fat distribution is present not only in the obese , but also in normoweight patients with pcos .
altered fat distribution and adipocyte dysfunction along with chronic lowgrade inflammation could be a novel mechanism contributing to increase in cardiovascular risk in pcos . | polycystic ovary syndrome ( pcos ) is a common endocrine disorder in women of reproductive age group and is associated with a higher cardiovascular risk .
obesity , mainly visceral adiposity , is prevalent in patients with pcos .
obesity is associated with low - grade inflammation and raised inflammatory cytokines , both of which are also described in patients with pcos . in this paper , the potential relationships between fat distribution , adipocyte dysfunction and , altered inflammatory markers in patients with pcos have been discussed . | 1. Obesity in Polycystic Ovary Syndrome (PCOS)
2. Inflammatory Mediators in Obesity
3. Inflammation and Insulin Resistance in Polycystic Ovary Syndrome |
the dscpd performed 384 autopsies on patients with suspected creutzfeldt - jakob disease ( cjd ) over a 14-year period ( 19982011 ) . at brain autopsy , definite cjd
was diagnosed in 203 patients based on the presence of spongiosis and positive prion staining . in 181 patients ,
neuropathology showed a variety of other conditions , mainly neurodegenerative disorders ( table e-1 at neurology.org/nn ) . in 22 patients ,
of these 22 patients , we collected clinical information from treating physicians , including discharge notes , laboratory , neurophysiology , and radiology results .
based on the clinical information , the 21 patients with pathologically proven autoimmune encephalitis were retrospectively classified as probable , possible , or no cjd according to the cdc diagnostic criteria for creutzfeldt - jakob disease , 2010 ( http://www.cdc.gov/ncidod/dvrd/cjd/resources/cdcs_diagnostic_criteria_for_cjd-2010.pdf ) .
local ethical committee approval was obtained for research on retained tissues after written informed consent was given by the patients during life or their next of kin after death ( medical ethics committee of the university medical centre utrecht 11 - 531/c ) .
all csf samples were tested for autoimmune encephalitis associated antineuronal antibodies in several assays at a dilution of 1:2 .
csf samples were tested on fresh frozen rat brain sections for autoantibodies against neuronal cell surface antigens , as previously described .
antibodies against the onconeural antigens hud , cdr62 ( yo ) , tr ( dner ) , amphiphysin , crmp-5 ( cv2 ) , nova-1 ( ri ) , ma1/2 , and zic4 were assayed , using another immunohistochemistry protocol combined with a recently described multiplex bead - based assay .
in addition , csf samples were tested on cultured hippocampal neurons and on hela cells overexpressing nmdar1 , gababr1/2 , gabaar , glur1/2 , and dppx as previously described .
finally , samples were tested in a commercial assay ( euroimmun , lbeck , germany ) for anti - lgi1 and anti - caspr2 antibodies ( previously tested as voltage - gated potassium channel complex antibodies ) .
the sensitive assays on frozen rat brain sections and cultured hippocampal neurons detect clinically relevant ( high serum titer ) gad65 and lgi1 antibodies in csf , rendering underreporting of antibodies by the lack of serum availability unlikely .
brains were removed at autopsy and selected tissue samples were immediately frozen and stored at 80c while the rest of the brain was fixed in formalin and used for histologic and immunologic purposes .
relevant sections were stained for -synuclein , ubiquitin , amyloid- , and tau in all patients . in a subset of patients ,
additional immune stainings were carried out for b cells ( cd20 ) , t cells ( cd3 , cd4 , and cd8 ) , and macrophages ( cd68 ) .
the dscpd performed 384 autopsies on patients with suspected creutzfeldt - jakob disease ( cjd ) over a 14-year period ( 19982011 ) . at brain autopsy , definite cjd
was diagnosed in 203 patients based on the presence of spongiosis and positive prion staining . in 181 patients ,
neuropathology showed a variety of other conditions , mainly neurodegenerative disorders ( table e-1 at neurology.org/nn ) . in 22 patients ,
of these 22 patients , we collected clinical information from treating physicians , including discharge notes , laboratory , neurophysiology , and radiology results .
based on the clinical information , the 21 patients with pathologically proven autoimmune encephalitis were retrospectively classified as probable , possible , or no cjd according to the cdc diagnostic criteria for creutzfeldt - jakob disease , 2010 ( http://www.cdc.gov/ncidod/dvrd/cjd/resources/cdcs_diagnostic_criteria_for_cjd-2010.pdf ) .
local ethical committee approval was obtained for research on retained tissues after written informed consent was given by the patients during life or their next of kin after death ( medical ethics committee of the university medical centre utrecht 11 - 531/c ) .
postmortem derived csf samples from all cases were stored at 80c until testing . as sampling was done postmortem ,
all csf samples were tested for autoimmune encephalitis associated antineuronal antibodies in several assays at a dilution of 1:2 .
csf samples were tested on fresh frozen rat brain sections for autoantibodies against neuronal cell surface antigens , as previously described .
antibodies against the onconeural antigens hud , cdr62 ( yo ) , tr ( dner ) , amphiphysin , crmp-5 ( cv2 ) , nova-1 ( ri ) , ma1/2 , and zic4 were assayed , using another immunohistochemistry protocol combined with a recently described multiplex bead - based assay .
in addition , csf samples were tested on cultured hippocampal neurons and on hela cells overexpressing nmdar1 , gababr1/2 , gabaar , glur1/2 , and dppx as previously described .
finally , samples were tested in a commercial assay ( euroimmun , lbeck , germany ) for anti - lgi1 and anti - caspr2 antibodies ( previously tested as voltage - gated potassium channel complex antibodies ) .
the sensitive assays on frozen rat brain sections and cultured hippocampal neurons detect clinically relevant ( high serum titer ) gad65 and lgi1 antibodies in csf , rendering underreporting of antibodies by the lack of serum availability unlikely .
brains were removed at autopsy and selected tissue samples were immediately frozen and stored at 80c while the rest of the brain was fixed in formalin and used for histologic and immunologic purposes .
relevant sections were stained for -synuclein , ubiquitin , amyloid- , and tau in all patients . in a subset of patients ,
additional immune stainings were carried out for b cells ( cd20 ) , t cells ( cd3 , cd4 , and cd8 ) , and macrophages ( cd68 ) .
pathology consistent with autoimmune encephalitis was found at autopsy in 22 out of 384 ( 6% ) patients with clinically suspected cjd , constituting 12% ( 22/181 ) of the patients who turned out at autopsy not to have had cjd .
because one patient lacked sufficient clinical information , we present the clinical , pathologic , and serologic findings in 21 patients with pathologically confirmed autoimmune encephalitis .
detailed information on the patients is summarized in tables e-2 and e-3 . in all 21 patients ,
gliosis was observed in 10 ( 48% ) patients while vasculitis was seen in none .
the infiltrates were predominantly perivascular in 15 ( 71% ) , predominantly parenchymal in 5 ( 24% ) , and both perivascular and parenchymal in 1 ( 5% ) patient .
cd8-positive cells were observed in 7/8 ( 88% ) and cd4-positive cells in 4/5 ( 80% ) patients examined . in 8/12 ( 67% ) patients , cd20-positive b cells were present , mainly in the perivascular infiltrates .
infiltrates were mainly located in the basal ganglia and thalamus in 19 ( 90% ) , temporal lobes and hippocampus in 17 ( 81% ) , cerebellum in 12 ( 57% ) , frontal lobes in 11 ( 52% ) , other cortical areas in 12 ( 57% ) , brainstem in 7 ( 33% ) , and periventricular white matter in 4 ( 19% ) .
antineuronal antibodies were detected in 6/21 ( 29% ) of the postmortem collected csf samples .
one each was directed against gabab1/b2 , nmdar , and caspr2 , while 2 csf samples harbored antibodies against an unidentified synaptic antigen ( figure 1 ) .
of the 4 known antibodies detected in csf , the hu antibody had been described long before the time of the patient 's illness , while gabab1/b2 , nmdar , and caspr2 antibodies were first reported after the death of the respective patients .
three of the 6 patients with antineuronal antibodies presented with limbic encephalitis , 2 with encephalomyelitis , and 1 with morvan syndrome ( associated with anti - caspr2 antibodies ) .
further clinical findings in the 6 patients with pathologically confirmed autoimmune encephalitis and antineuronal antibodies are summarized in table 1 and supplementary information ( 1 ) .
the localization and cellular composition of the inflammatory infiltrates found at autopsy did not differ between the antibody - positive and antibody - negative patients ( table e-4 ) . in 2 patients , a synaptic staining pattern in the hippocampus
one patient was a 73-year - old man with limbic encephalitis ( a , b ; patient 11 ) and the other a 77-year - old man with encephalomyelitis ( c , d ; patient 18 ) .
immunohistochemistry was performed as described in the methods ( a , c ) . to confirm the synaptic staining pattern in these 2 patients , csf samples were incubated ( 1:2 dilution ) live with primary hippocampal cultures ( b , d ) as previously described .
clinical summary of 6 patients with pathologically confirmed autoimmune encephalitis and associated antineuronal autoantibodies summarizing , 5/21 ( 24% ) patients with pathologically confirmed autoimmune encephalitis had csf autoantibodies directed against nsa ( 3 against well - defined and 2 against unknown antigens ) .
all 21 patients with autoimmune encephalitis had a rapidly progressive illness with a median duration of 3.3 months and died within 13 months of first symptoms ( table 2 , tables e-2 and e-3 ) .
in retrospect , 14 of the 21 ( 67% ) patients with autoimmune encephalitis fulfilled the clinical 2010 cdc criteria for possible or probable scjd while 7 ( 33% ) did not . in the subgroup of 6 patients with antineuronal antibody associated autoimmune encephalitis , 67% ( 4 patients ) also fulfilled cdc criteria for possible or probable scjd ( table 2 ) .
the most frequent main symptoms included dementia ( 90% ) , cerebellar signs ( 67% ) , myoclonus ( 48% ) , and extrapyramidal signs ( 33% ) ( table 3 ) .
other symptoms that were frequently present included gait disturbance ( 86% ) , neuropsychiatric symptoms ( 67% ) , and frontal lobe symptoms ( 62% ) .
there were no clear differences in clinical presentation of autoimmune encephalitis with or without detectable antineuronal antibodies in csf ( tables 2 and 3 ) .
only 4 patients received immunotherapy , consisting of steroids in 2 , iv immunoglobulins ( ivig ) in 1 , and both ivig and steroids in 1 .
clinical characteristics in 21 patients with autoimmune encephalitis and suspected cjd symptoms in 21 patients with autoimmune encephalitis and suspected cjd the csf had been examined in 18 of the 21 patients and was abnormal in 14/18 ( 78% ) , showing increased protein in 14 ( 78% ) , pleiocytosis in 10 ( 56% ) , and positive 14 - 3 - 3 protein in 9 ( 50% ) ( table 4 ) .
csf , eeg , and mri findings in patients with autoimmune encephalitis eeg was performed at least once in 19 of the patients and was abnormal in 18/19 ( 95% ) with an increase of slow wave activities in 15/19 ( 79% ) .
seven of the patients showed triphasic periodic complexes that were considered compatible with cjd in 6 ( 32% ) .
epileptiform abnormalities were registered in 7 ( 37% ) of the patients ( table 4 ) .
mri was abnormal in 10/17 ( 59% ) patients , showing increased signal on t2-weighted or fluid - attenuated inversion recovery images ( table 4 ) .
imaging abnormalities were located in the medial temporal lobes in 3 , periventricular in 5 ( most likely vascular lesions in 3 ) , basal ganglia and thalamus in 2 , and brainstem in 1 .
none of the patients had mri changes typical of scjd , according to 2010 cdc criteria , although most investigations lacked diffusion - weighted imaging ( dwi ) sequences .
the patients with autoimmune encephalitis with antineuronal autoantibodies in their csf did not clearly differ from the antibody - negative patients in csf , eeg , or mri findings ( table 4 ) . in 9 patients ( 43% ) , a tumor was present .
based on criteria published by an eu consortium , the etiology of the neurologic syndrome could be classified as definitely paraneoplastic in 5 and possibly paraneoplastic in 2 .
the tumor was probably unrelated in 2 of the patients , precluding a paraneoplastic etiology .
detailed clinical and oncologic findings are presented in table e-3 and supplementary information ( 2 ) .
gliosis was observed in 10 ( 48% ) patients while vasculitis was seen in none .
the infiltrates were predominantly perivascular in 15 ( 71% ) , predominantly parenchymal in 5 ( 24% ) , and both perivascular and parenchymal in 1 ( 5% ) patient .
cd8-positive cells were observed in 7/8 ( 88% ) and cd4-positive cells in 4/5 ( 80% ) patients examined . in 8/12 ( 67% )
infiltrates were mainly located in the basal ganglia and thalamus in 19 ( 90% ) , temporal lobes and hippocampus in 17 ( 81% ) , cerebellum in 12 ( 57% ) , frontal lobes in 11 ( 52% ) , other cortical areas in 12 ( 57% ) , brainstem in 7 ( 33% ) , and periventricular white matter in 4 ( 19% ) .
antineuronal antibodies were detected in 6/21 ( 29% ) of the postmortem collected csf samples .
one each was directed against gabab1/b2 , nmdar , and caspr2 , while 2 csf samples harbored antibodies against an unidentified synaptic antigen ( figure 1 ) .
of the 4 known antibodies detected in csf , the hu antibody had been described long before the time of the patient 's illness , while gabab1/b2 , nmdar , and caspr2 antibodies were first reported after the death of the respective patients .
three of the 6 patients with antineuronal antibodies presented with limbic encephalitis , 2 with encephalomyelitis , and 1 with morvan syndrome ( associated with anti - caspr2 antibodies ) .
further clinical findings in the 6 patients with pathologically confirmed autoimmune encephalitis and antineuronal antibodies are summarized in table 1 and supplementary information ( 1 ) .
the localization and cellular composition of the inflammatory infiltrates found at autopsy did not differ between the antibody - positive and antibody - negative patients ( table e-4 ) . in 2 patients , a synaptic staining pattern in the hippocampus
one patient was a 73-year - old man with limbic encephalitis ( a , b ; patient 11 ) and the other a 77-year - old man with encephalomyelitis ( c , d ; patient 18 ) .
immunohistochemistry was performed as described in the methods ( a , c ) . to confirm the synaptic staining pattern in these 2 patients , csf samples were incubated ( 1:2 dilution ) live with primary hippocampal cultures ( b , d ) as previously described .
clinical summary of 6 patients with pathologically confirmed autoimmune encephalitis and associated antineuronal autoantibodies summarizing , 5/21 ( 24% ) patients with pathologically confirmed autoimmune encephalitis had csf autoantibodies directed against nsa ( 3 against well - defined and 2 against unknown antigens ) .
all 21 patients with autoimmune encephalitis had a rapidly progressive illness with a median duration of 3.3 months and died within 13 months of first symptoms ( table 2 , tables e-2 and e-3 ) .
in retrospect , 14 of the 21 ( 67% ) patients with autoimmune encephalitis fulfilled the clinical 2010 cdc criteria for possible or probable scjd while 7 ( 33% ) did not . in the subgroup of 6 patients with antineuronal antibody associated autoimmune encephalitis , 67% ( 4 patients ) also fulfilled cdc criteria for possible or probable scjd ( table 2 ) .
the most frequent main symptoms included dementia ( 90% ) , cerebellar signs ( 67% ) , myoclonus ( 48% ) , and extrapyramidal signs ( 33% ) ( table 3 ) .
other symptoms that were frequently present included gait disturbance ( 86% ) , neuropsychiatric symptoms ( 67% ) , and frontal lobe symptoms ( 62% ) .
there were no clear differences in clinical presentation of autoimmune encephalitis with or without detectable antineuronal antibodies in csf ( tables 2 and 3 ) .
only 4 patients received immunotherapy , consisting of steroids in 2 , iv immunoglobulins ( ivig ) in 1 , and both ivig and steroids in 1 .
clinical characteristics in 21 patients with autoimmune encephalitis and suspected cjd symptoms in 21 patients with autoimmune encephalitis and suspected cjd
the csf had been examined in 18 of the 21 patients and was abnormal in 14/18 ( 78% ) , showing increased protein in 14 ( 78% ) , pleiocytosis in 10 ( 56% ) , and positive 14 - 3 - 3 protein in 9 ( 50% ) ( table 4 ) .
csf , eeg , and mri findings in patients with autoimmune encephalitis eeg was performed at least once in 19 of the patients and was abnormal in 18/19 ( 95% ) with an increase of slow wave activities in 15/19 ( 79% ) .
seven of the patients showed triphasic periodic complexes that were considered compatible with cjd in 6 ( 32% ) .
epileptiform abnormalities were registered in 7 ( 37% ) of the patients ( table 4 ) .
mri was abnormal in 10/17 ( 59% ) patients , showing increased signal on t2-weighted or fluid - attenuated inversion recovery images ( table 4 ) .
imaging abnormalities were located in the medial temporal lobes in 3 , periventricular in 5 ( most likely vascular lesions in 3 ) , basal ganglia and thalamus in 2 , and brainstem in 1 .
none of the patients had mri changes typical of scjd , according to 2010 cdc criteria , although most investigations lacked diffusion - weighted imaging ( dwi ) sequences .
the patients with autoimmune encephalitis with antineuronal autoantibodies in their csf did not clearly differ from the antibody - negative patients in csf , eeg , or mri findings ( table 4 ) .
in 9 patients ( 43% ) , a tumor was present . based on criteria published by an eu consortium
, the etiology of the neurologic syndrome could be classified as definitely paraneoplastic in 5 and possibly paraneoplastic in 2 .
the tumor was probably unrelated in 2 of the patients , precluding a paraneoplastic etiology .
detailed clinical and oncologic findings are presented in table e-3 and supplementary information ( 2 ) .
the first finding of our study is that approximately 7% of patients with suspected cjd have autoimmune encephalitis at autopsy .
secondly , antineuronal autoantibodies could be demonstrated in the csf from 6 of 21 ( 29% ) patients with pathologically confirmed autoimmune encephalitis .
one case each of anti - hu , gabab1/b2 , nmdar , and caspr2 was detected , while 2 csf samples had antibodies against an unidentified nsa .
third , in retrospect , 67% of the patients met the 2010 cdc criteria for possible or probable cjd , both in the antibody - positive and antibody - negative group .
studied prion - negative brain autopsy cases referred to the us national prion disease pathology surveillance center .
neuropathology diagnosed an immune - mediated disorder in 26/304 ( 8.5% ) of the prion - negative cases with histology , including primary angiitis of the cns ( 7 ) , acute disseminated encephalomyelitis ( 6 ) , limbic encephalitis ( 6 ) , neurosarcoidosis ( 4 ) , paraneoplastic cerebellar degeneration ( 2 ) , and granulomatosis with polyangiitis ( wegener ) ( 1 ) .
in contrast to our study , most of the misdiagnosed patients did not meet the who criteria for cjd .
examined the presence of nsa - abs in the csf of patients with suspected or pathologically confirmed cjd .
nsa - abs were found in 6 of 346 patients ( 1.7% ) with a rapidly progressive neurologic disorder suggestive of cjd during life .
in contrast to our study , none of these 6 patients met the diagnostic criteria for probable or possible cjd .
the target antigens included nmdar , lgi1 , caspr2 , aquaporin 4 , tr ( dner ) , and an unknown protein .
another study reported serum nsa - abs in < 5% of patients with scjd , all at very low titers . in this study , we tested csf of all patients identified with autoimmune encephalitis at autopsy .
csf is proven more sensitive and specific to detect nsa - abs as shown for nmdr , ampar , and gababr . in 50% of our patients with autoimmune encephalitis
tested , 14 - 3 - 3 protein was elevated in csf ( part of the cdc 's 2010 diagnostic criteria ) , casting further doubt on the usefulness of this test in diagnosing cjd .
eeg was also not useful as triphasic waves were present in 32% of our autoimmune patients .
none of our patients with autoimmune encephalitis showed scjd - specific mri abnormalities , supporting the higher specificity of scjd mri criteria over 14 - 3 - 3 .
however , dwi was not performed in most of our patients , and we do not know whether dwi would have retained its specificity in this series . on the other hand , 56% of patients had an increased leukocyte count ( > 5 10e9/l ) in their csf .
although the pleiocytosis was usually mild , it provides a clue to an inflammatory etiology .
other studies describing clinical overlap between prion and autoimmune disorders focused primarily on rapidly progressive dementia , detecting a 2%9% prevalence of immune - mediated disorders . in a series of patients with suspected autoimmune dementia and good response to immunotherapy ,
almost 9% of the disorders had initially been diagnosed as scjd . in particular , patients with encephalitis associated with lgi1-abs may present with myoclonus - like movements and other symptoms that can be mistaken for cjd .
in general , the prognosis of autoimmune encephalitis appears to be determined by the involved immunopathogenic mechanisms .
disorders accompanied by antibodies directed against intracellular antigens are probably t - cell - mediated and generally respond poorly to immunotherapy .
most paraneoplastic neurologic disorders with onconeural antibodies belong to this category . on the other hand , in disorders associated with nsa - abs
, the antibodies are probably pathogenic and these disorders respond favorably to first- and second - line immunotherapy .
the immunopathology of nsa - abs - associated encephalitis shows mild to moderate , mainly perivascular , lymphocytic infiltrations containing both b and t cells , antibody - producing cells , and immunoglobulin g deposits .
it is possible that we missed some cases with burned out or with bland neuropathology and that the 22 cases that we identified represent an underestimation .
the encephalitis associated with hu or ma2 antibodies is characterized by extensive b and t cell lymphocytic infiltrations , containing t cells with a cytotoxic phenotype . in our series , immunopathologic findings did not differ between autoantibody - negative patients and the patients with nsa - ab ( table e-4 ) , nor did clinical , csf , radiologic , or electrophysiologic characteristics ( tables 24 ) .
the immunopathologic mechanism in the 15 patients with autoimmune encephalitis without detectable autoantibodies remains unclear .
it can not be excluded that some of these patients harbored nsa - abs that were degraded by postmortem interval or during storage at 80c in low protein csf .
the lack of serum availability may also have contributed to underreporting of nsa - abs .
in addition , bias was introduced by the fact that all patients had suspected cjd and had come to autopsy . in particular ,
the poor outcome with a median survival of 3.3 months ( range 1.012.3 months ) in this study of autoimmune encephalitis was largely determined by this inclusion bias .
it is important to consider both prion and immune - mediated disorders in the differential diagnosis of rapidly progressive neurologic deficits , knowing that eeg and 14 - 3 - 3 in csf do not discriminate sufficiently to distinguish the two .
detection in serum or csf of specific antineuronal antibodies can establish a diagnosis of autoimmune encephalitis and guide appropriate treatment .
p. maat , j. de beukelaar , c. jansen , m. schuur , c. van duijn , and m. van coevorden report no disclosures .
m. titulaer served on the scientific advisory board for medimmne llc , received travel funding from sun pharma , is on the editorial board for neurology : neuroimmunology & neuroinflammation , and received research support from netherlands organiszation for scientific research , erasmusmc , and dutch epilepsy foundations .
a. rozemuller is on the scientific advisory board for netherlands brain bank and received research support from neuroscience campus amsterdam , erasmus mundo .
smitt holds a patent for the detection of anti - dner and received research support from euroimmun . | objective : to determine the clinical features and presence in csf of antineuronal antibodies in patients with pathologically proven autoimmune encephalitis derived from a cohort of patients with suspected creutzfeldt - jakob disease ( cjd).methods : the dutch surveillance centre for prion diseases performed 384 autopsies on patients with suspected cjd over a 14-year period ( 19982011 ) . clinical information was collected from treating physicians .
antineuronal antibodies were tested in csf obtained postmortem by immunohistochemistry on fresh frozen rat brain sections , by luminex assay for the presence of well - characterized onconeural antibodies , and by cell - based assays for antibodies against nmdar , gababr1/2 , gabaar glur1/2 , lgi1 , caspr2 , and dppx.results:in 203 patients , a diagnosis of definite cjd was made , while in 181 a variety of other conditions were diagnosed , mainly neurodegenerative . in 22 of these 181 , the neuropathologist diagnosed autoimmune encephalitis .
one patient was excluded because of lack of clinical information .
inflammatory infiltrates were predominantly perivascular and consisted mainly of t cells .
the predominant locations were basal ganglia and thalamus ( 90% ) and temporal lobes and hippocampus ( 81% ) . in 6 patients ( 29% ) ,
antineuronal antibodies were detected in postmortem csf , directed against hu , nmdar , gababr1/2 , caspr2 , and an unidentified synaptic antigen in 2 .
the most frequent symptoms were dementia ( 90% ) , gait disturbance ( 86% ) , cerebellar signs ( 67% ) , and neuropsychiatric symptoms ( 67% ) .
immunopathologic and clinical findings did not differ between autoantibody - negative patients and patients with antineuronal antibodies.conclusions:it is important to consider immune - mediated disorders in the differential diagnosis of rapidly progressive neurologic deficits . | METHODS
Patients.
Standard protocol approvals, registrations, and patient consents.
Antineuronal antibody testing.
Neuropathology.
RESULTS
Neuropathology.
Postmortem CSF testing for antineuronal antibodies.
Clinical characteristics.
Additional investigations.
Associated tumors.
DISCUSSION
Supplementary Material
AUTHOR CONTRIBUTIONS
STUDY FUNDING
DISCLOSURE |
agenesis or severe atrophy of right lobe of liver were rare condition with reported several cases [ 1 - 5 ] . among them , most were revealed occasionally by radiologic evaluation such as computed tomography ( ct ) and ultrasonography .
the imaging showed absence of the right hepatic lobe , various degrees of enlargement of the medial and lateral segments of the left lobe and caudate lobe of the liver , and retrohepatic or suprahepatic position of the gallbladder ( gb ) , absence of the right hepatic artery and portal vein on angiography , and absence of the right intrahepatic ducts on percutaneous cholangiography . recently the first case of biliary injury after cholecystectomy in agenesis of right liver was reported .
herein , we reported similar clinical appearances with severe right liver atrophy combined biliary injury .
a 76-year - old man visited emergency room with right upper quadrant and flank pain .
he showed mild fever and normal limit of blood chemistry except leukocystosis with white blood cell count was 13,000 .
we decided the cholecystostomy for initial treatment of cholecsytitis , after making patient stable and afebrile .
initial ct scan showed small mass - like lesion of severely shrunken right hepatic lobe and hypertrophy of the left hepatic lobe ( fig .
gb was identified in a retrohepatic position , and located in beneath the diaphragm with wall thickening demonstrating cholecystitis ( fig .
we tried laparoscopic approach with routine 4 port methods , however we could not approach the gb without liver mobilization and position change . because of severe adhesion of gb with omentum and mesocolon , we decided the open conversion procedure . during the cholecystectomy , excessive bleeding and bile leakage occurred in gb bed requiring two pint of packed red blood cell transfusion .
we did not perform liver resection due to absence of pathologic condition of liver parenchyma , and perform bleeding and leakage control by suture ligation .
a drain was left in gb fossa and liver dome . on 3rd day after operation ,
50 to 100 ml / day of bile drainage was detected in jackson - pratt drain .
ten day after surgery , the amount of bile drainage increased up to 200 ml / day , and so we decided to perform endoscopic retrograde cholangiopancreatography for therapeutic biliary drainage .
the suspicious leakage point was right posterior duct root or branch of segment 4 ( fig .
amount of bile drainage was markedly decreased after procedure and enbd was removed on 29 day after surgery .
because most patients with agenesis of the right hepatic lobe or severe atrophy usually remain clinically asymptomatic , the vast majority of cases are found incidentally . rarely , some patients have had symptoms due to atypical cholecystitis , choledocholithiasis , or portal hypertension .
chou et al . described the criteria for diagnosis of agenesis of the right hepatic lobe on a ct as the absence of the right hepatic vein , right portal vein and its branches , as well as dilated right intrahepatic ducts .
moreover , the diagnosis of agenesis of the right hepatic lobe of the liver is easily established with cross - sectional imaging when no liver parenchyma is found to the right of the gb fossa ; however , the differential diagnosis includes severe right hepatic lobe atrophy secondary to liver cirrhosis , cholangiocarcinoma , choledocholithiasis , idiopathic portal hypertension , prior fulminant hepatitis , caroli 's disease , and prior surgical resection .
anomaly may be associated with biliary tract disease , hepatic calcification and other congenital anomalies such as agenesis of right hemidiaphragm , intestinal malrotation , intrathoracic kidney .
our patient had not any history of above mentioned medical condition , and right hepatic vein was intact .
however , right portal vein and dilated right duct were not detectable in ct or cholangiography .
the pathogenesis of this congenital anomaly is not fully explained ; however , the abnormal development and thrombosis of the supplying portal venous segment during embryologic growth have been suggested as possible pathogenic mechanisms .
the procedure was characterized by significant inflammation and bleeding requiring conversion to an open procedure .
he was referred to tertial institution and found to have complete transection of his common bile duct .
incidentally , he was noted on imaging studies to have absence of his right liver with associated left liver hypertrophy .
this was characterized by complete absence of the right portal vein and right bile duct .
bile duct injury during cholecystectomy could be happened , moreover it is likely to be occurred in the setting of anomalous bile duct with severe inflammation of gb .
surgeon makes effort to recognize the anatomy of biliary tract , when he is faced with difficult cholecsytectomy .
we recognized the right lobe atrophy preoperatively by ct , during operation massive bleeding and difficulty of laparoscopic approach due to gb inflammation had led to conversion .
we are always awaking to importance of liver atrophy can induce the biliary injury during operation . | we report a case of bile fistula after cholecystectomy in a patient with severe right liver atrophy , which was managed by endoscopic nasobiliary drainage and conservative treatment .
the patient was a 76-year - old man with a sudden onset in the right flank and abdominal pain .
computed tomography revealed calculous cholecystitis and severely atrophied right lobe of the liver .
gallbladder was located in the superior - posterior portion of the liver as opposed to the normal position .
the patient underwent cholecystectomy and showed massive bleeding and bile leakage at the gallbladder bed during operation .
a bile fistula was detected three days after surgery , which was managed by interventional bile drainage .
right liver agenesis or severe atrophy is rare .
additionally , the report of combined bile duct injury after cholecystectomy in these settings is extremely rare . | INTRODUCTION
CASE REPORT
DISCUSSION |
cushing 's syndrome ( cs ) is a general term for a cluster of endocrine abnormalities characterized by chronic cortisol overproduction .
characteristic clinical comorbidities include metabolic complications ( e.g. , visceral obesity , diabetes mellitus , and dyslipidemia ) , cardiovascular complications ( e.g. , systemic arterial hypertension , atherosclerosis , and thromboembolism ) , bone complications ( e.g. , osteoporosis and osteoarthritis ) infective complications , and neuropsychiatric disorders ( e.g. , major depression , mania , anxiety , and cognitive impairment ) .
cs may be exogenous and iatrogenic due to corticosteroid administration or endogenous due to excessive acth secretion , most commonly from a pituitary adenoma , referred to , somewhat confusingly , as cushing 's disease , or less commonly from a nonpituitary tumor ( ectopic cs ) and primary adrenal neoplasms .
this report describes the case of a 60-year - old carcinoid patient with cognitive impairment due to hypercortisolism from cs who developed bacteremia ; his condition deteriorated , and he died after a decision was made to withdraw care .
a 60-year - old male with metastatic bronchopulmonary neuroendocrine tumor treated on a clinical trial for over 5 months was admitted to the hospital with complaints of fever , agitation , and weakness .
his medical history was significant for newly diagnosed cs secondary to acth secretion ; he had been hospitalized 2 weeks earlier for cs - induced hyperglycemic crisis . on admission ,
the patient presented with classic cushingoid habitus of facial plethora , moon facies , muscle atrophy , abdominal striae , and truncal obesity .
the arterial blood gas analysis on room air was ph 7.497 , paco2 29 mm hg , pao2 71 mm hg , and oxygen saturation 95% .
as respiratory failure was imminent , he was transferred to the intensive care unit and mechanically ventilated .
the highest positive end - expiratory pressure and fio2 required to maintain oxygenation were 5 cm h2o and 50% , respectively .
cultures were taken from bronchial secretions directly after endotracheal intubation and from urine and blood .
the patient was diagnosed with staphylococcus aureus bacteremia , and based on susceptibility testing , he was started on vancomycin and zosyn .
in addition to antibiotics , the patient received lisinopril for cs - induced hypertension and insulin sliding scale to control hyperglycemia . since high circulating levels of glucocorticoids due to ectopic acth secretion
predispose to infection and impair immune function and clearance of bacteria , the immediate plan was to start him on mifepristone ( 600 mg daily ) as a glucocorticoid receptor antagonist to counteract the immunosuppressive and cognitive effects of the endogenous hypercortisolism .
as soon as the patient 's condition improved ( which would have been expected given the known reversibility of hypercortisolism ) , cytoreductive chemotherapy would have been restarted to reduce the paraneoplastic stimulus . however , the patient 's family with medical power of attorney refused consent and withdrew him from the ventilator .
advance directives are written to guarantee autonomy in the event that individual decision - making capacity is lost due to disease severity or treatment . however , as a blanket statement that may contain overly broad ( or overly specific ) prewritten blocks of text , especially for cancer patients , the content of advance directives may or may not necessarily apply to and/or the patient 's wishes may or may not be correctly interpreted during acute , temporary and potentially reversible conditions that occur during cancer treatment such as infection due to ectopic cs .
given the potential for cognitive impairment and other acute sequelae such as difficult - to - treat infections from the development of ectopic cs , this case illustrates the importance of revisiting the advance directive when a medical diagnosis associated with temporary cognitive impairment such as cs is made . | glucocorticoids are associated with immunosuppression and neuropsychiatric complications .
we describe the case of a carcinoid patient with cushing 's syndrome ( cs ) and neurocognitive impairment due to ectopic acth production who developed sepsis and died because of his family 's decision to withdraw antibiotic treatment .
this report is presented to illustrate the importance of advanced - care planning in patients with cs . | Introduction
Case Presentation
Discussion
Statement of Ethics
Disclosure Statement |
with an incidence of 1 out of 3,500 live births , cystic fibrosis ( cf ) is the most common life - threatening autosomal recessive genetic disease in caucasian children .
half of the affected patients show a deletion of a specific phenylalanine residue ( f508 ) , but the genotype - phenotype relationship is complex .
it has been proposed that the strikingly high prevalence of this deleterious mutation could be due to a higher resistance to toxin - induced diarrhea or tuberculosis among heterozygotes .
cf affects the gut and the pancreas ( exocrine pancreas insufficiency leads to malabsorption and failure to thrive ) , but for most cf patients , life expectancy is determined by the development of lung disease .
the failure to clear thick and abundant mucous secretions from the lung leads to chronic coughing at a young age , followed by frequent lung infections , including repetitive episodes of pneumonia .
however , for most cf patients , recurring lung infections finally lead to end - stage lung disease , which can be treated only with lung transplantation . the median survival age for cf patients
small , slow - growing colony variants displaying antibiotic resistance , including methicillin - resistant s. aureus ( mrsa ) strains , are characteristically found . in early adolescence ,
the lungs typically become chronically infected with pseudomonas aeruginosa ; up to 80% of adult cf patients are colonized with this pathogen .
nonmotile , anaerobic , mucoid variants of p. aeruginosa grow in a biofilm within the lungs , a structure that confers resistance to antimicrobials .
since today s cf patients reach adulthood , still other facultative pathogens have a chance to enter the lung . bacteria of the burkholderia cepacia complex , for instance , are now recovered from 10% of the lungs in adult cf patients .
burkholderia infections can transform a mild pulmonary case into a rapidly deteriorating lung infection associated with bacteremia and death within 6 months . even among patients with a less dramatic course , some surgeons consider burkholderia infections to be a contraindication for lung transplantation . in hospital settings
, burkholderia - infected patients should be segregated from other cf patients to prevent nosocomial spread of the pathogen .
since lung infections are the life - limiting factor for cf patients and since the major cf pathogens are increasingly difficult to treat with antibiotics , alternatives or adjuncts to antibiotics are urgently needed .
the mbio article by colin hill and his colleagues ( 1 ) provides an encouraging outlook in this regard .
the authors explored the possibility of treating p. aeruginosa infections with bacteriophages , an attractive potential therapeutic option for several reasons .
first , s. aureus and p. aeruginosa are classical targets of the soviet phage therapy approach .
the russian company microgen currently sells phage preparations against both pathogens , either singly or in combination , for treatment of pyogenic infections .
second , it is relatively easy to isolate virulent ( as opposed to temperate ) phages against the three major pathogens of cf patients .
large collections of phages of s. aureus , p. aeruginosa , and b. cepacia exist , many of which are fully sequenced .
this is not a trivial statement , since phages are not isolated easily against any bacterial species .
third , the aforementioned phages have a broad host range . unlike antibiotics , most phages are strain specific , making them targeted to the pathogen of interest and preventing collateral damage to commensal bacteria .
however , this specificity can be a problem for treatment , and often a cocktail of different phages is needed to achieve a reasonable coverage of a given pathogenic species .
fortunately , phages against cf pathogens have a good , if not an excellent , pathogen coverage .
phage k , for instance , infects nearly half of s. aureus isolates from large collections , and phage stau2 infects 80% ( 2 ) .
fourth , the efficacy of phage therapy approaches has been demonstrated in animal infection models with cf pathogens .
for example , b. cenocepacia bacterial density in the lung was reduced after intraperitoneal but not intranasal phage application to mice .
the lytic effect was specific to the replication - competent phages , since no lytic effect was seen with uv - inactivated phages or a phage that had no in vitro lytic activity against the infecting burkholderia strain .
phages showed amplification in the lung and reduced pathogen - induced inflammation signs . in treated mice
, phages were colocalized with degraded bacteria in perivascular lung areas and alveolar septa ( 3 ) .
( 1 ) provides suggestive evidence that bacteriophages might also be of use against p. aeruginosa infection .
they showed that suitable phages can be isolated from sewage , a common starting material for phage isolation . by sequencing the phage
, they demonstrated the absence of undesired genes in their therapeutic phages , an essential condition for later phage application in human subjects .
finally , the authors demonstrated the efficacy of intranasally applied phages in a p. aeruginosa lung infection model using state - of - the - art imaging techniques ( although it should be noted that mice do not get chronically infected with p. aeruginosa , so biofilms are thus not formed in this transient infection model ) .
mice treated with intranasal phage at a phage - to - bacterium ratio of 1:1 , but not with lower ratios , survived a lethal p. aeruginosa infection .
( 1 ) confirm previous observations from other groups and therefore represent important steps toward developing effective cf phage therapy .
fittingly , work on phage therapy for p. aeruginosa infection continues at the pasteur institute in paris , where phages and phage therapy were first described by felix dherelle nearly 100 years ago . using bioluminescent p. aeruginosa , debarbieux et al .
( 4 ) demonstrated a rapid killing of bacteria in phage - treated animals and a reduction in inflammatory markers .
the researchers selected phages which grew well on clinical p. aeruginosa isolates from cf patients and showed that they achieved dose - dependent protection in a mouse lung infection model ( 5 ) .
phages showed in vivo replication , decreased the alveolar pathogen load , and prevented histopathologic lesions .
phage treatment could be delayed for a few hours with the same results , and administering the phages a day before pathogen challenge also prevented the infection .
when phages were administered to uninfected mice , they persisted for 5 days in the lung , suggesting the potential for preventive phage use .
british researchers found that phages had bacteriocidal effects on pseudomonas in biofilms ( 6 ) . when using excess phages , a 100-fold bacterial titer decrease was observed .
pseudomonas phages could also diffuse through 8% alginate gels , which mimic the conditions in pseudomonas biofilms .
phage researchers from the republic of georgia and structural biologists subsequently showed that the depolymerizing enzyme is part of the phage particles ( 7 , 8) .
researchers at the centers for disease control and prevention ( cdc ) in atlanta , ga , demonstrated that pretreating catheters with a cocktail of pseudomonas phages prevented biofilm formation .
intact but not heat - killed phages achieved a 1,000-fold titer reduction of the bacteria in the biofilm grown on a catheter in the presence of human serum ( 9 ) . the latter observation is important , since in the transition from bench to bed , the devil is in the details .
the lead authors of the alemayehu article observed this for themselves in earlier work , in which they explored the potential of s. aureus phages for treating bovine mastitis . in that study , they found that milk contained an inhibitory activity that inactivated the broad - host - range s. aureus phage k ( 10 ) , a fact that explains the observations from canadian researchers who failed to detect an in vivo inhibitory effect of phages on bovine mastitis . despite the setbacks with s. aureus phage use in farm animals
three clinical trials that address pseudomonas infections in venous leg ulcers ( intralytix ) , burn patients ( belgian military ) ( 11 ) , and the outer ear canal ( causing diseases ranging from mild swimmer s ear to necrotizing otitis externa in diabetics and aids ) ( biocontrol , united kingdom ) have been registered .
so far , no adverse effects of phage treatment have been observed . in a controlled phase ii clinical trial ,
24 otitis externa patients received either a single small dose of pseudomonas phage cocktail or a placebo .
the researchers found evidence for in vivo phage replication , a decrease in pseudomonas counts in some patients , and symptom amelioration in most of the treated patients ( 12 ) .
one might criticize the study for its small size and for the fact that only patients with pseudomonas ear infection susceptible to the applied phage were enrolled , but the study set a standard for a detailed combined clinical , microbiological , and statistical evaluation of phage therapy approaches .
the three senior authors of the mbio article ( 1 ) are members of phageworks , a phage solution company recently founded in cork , ireland , by scientists working in two important research organizations of the irish government : the teagasc food research centre and the alimentary pharmabiotic centre .
the current study relies on years of research in the dairy field , but one hopes that the knowledge acquired in the food sector on practical aspects of phage research can eventually serve the biomedical research community and the development of therapeutic applications for phages as well .
this reminds me of the words of louis pasteur , who wrote , there are similarities between the diseases of animals and humans and the diseases of beer and wine .
looking beyond the fences of one s own professional specialization can lead to important cross - fertilization . | abstractin contrast to usual laboratory conditions , most bacteria in the human body grow in biofilms . encased in a structured matrix ,
many pathogens display heightened resistance to antibiotics .
pseudomonas aeruginosa lung infections in cystic fibrosis patients represent a prime example of the clinical challenges that antibiotic resistance in biofilms can represent . in the march 6 , 2012 issue of mbio , colin hill and his colleagues report on experiments that add to the evidence that pseudomonas phages are a potential treatment option for these infections . | Commentary |
a 42-year - old woman presented for evaluation of a slow - growing , painless , palpable mass on the left upper eyelid , which initially developed several years earlier .
no history of orbital trauma or filler injection was reported . at the time of her first visit ,
slight conjunctival injection of the left eye was noted , but the cornea was clear .
the left eyelid was slightly elevated , and a hard , palpable mass was detected in the upper eyelid .
everting the upper eyelid revealed a large papillomatous mass attached to the upper margin of the tarsus ( fig .
as the patient did not want to risk possible disfigurement with a complete excision , the protruding mass above the tarsal border was partially debulked at the conjunctival side under local anesthesia , and was sent to the pathology department where it was identified as calcinosis cutis .
2 shows a massive amorphous calcium material beneath the epithelial lining and basophilic - stained crystallized calcification deposits .
calcinosis cutis is pathologically defined as the deposition of calcium material beneath the epithelial lining .
it mostly affects patients with connective tissue disorders , such as dermatomyositis , systemic lupus erythematosis , or systemic sclerosis .
other types of calcifications , such as band keratopathy , bulbar calcification , or palpebral , conjunctival , or eyelid calcification , have been reported in patients with ocular inflammation , systemic hyperparathyroidism , or hyperphosphatemia . however , in this case , the patient had normal serum levels of calcium and phosphate , and no previous systemic or trauma history . based upon this information , this case represents the first incidence of idiopathic calcinosis cutis affecting the tarsus of the eyelid .
no standard treatment has been recommended for the removal or reduction of the lesion in cases of calcinosis cutis .
colchicine , warfarin , bisphosphonates , probenecid , and diltiazem have been used with varying degrees of success .
carbon dioxide laser therapy , minocycline , salicylates , and aluminum hydroxide could also be used .
the aforementioned treatments were only used for skin lesions , demonstrating limited efficiency . therefore , surgical excision for a large protruding mass of calcinosis cutis might be the best option . in this case
, we performed partial debulking of the lesion , and more follow - up is required to monitor for regrowth .
if the regrowth occurs rapidly , complete excision with free margin control will be necessary .
however , such a decision would not be easy , as the base of the lesion is quite broad , including the normal tissue of the tarsus , and more importantly , the patient does not feel much irritation from this lesion .
clinicians should consider calcinosis cutis in the differential diagnosis of papillomatous mass lesions involving the tarsus . | calcinosis cutis involves the inappropriate deposition of calcium within the dermis layer of the skin , and is often associated with rheumatoid disease . a 42-year - old woman presented for evaluation of a hard palpable mass on the left upper eyelid .
after everting the eyelid , a large papillomatous mass with a broad base was identified on the superior area of the tarsus .
the lesion was partially excised posteriorly under local anesthesia , and pathologists identified the mass as calcinosis cutis .
the patient had no systemic or trauma history , and the serum levels of calcium and phosphorous were normal .
idiopathic calcinosis cutis should be included in the differential diagnosis for a protruding papillomatous mass of the tarsal plate , and surgical debulking could be a viable option for large protruding lesions , although more follow - up is necessary to monitor regrowth . | Case Report
Discussion |
left main coronary artery stenosis is a serious condition and can result in patient death . early recognition and
symptoms are often clear and patient can develop chest pain during exercise or at rest .
patient can also present with pulmonary edema and acute left ventricular dysfunction . in this report
, we describe a case of mitral and aortic valve replacement in a young patient complicated by symptomatic critical left main coronary artery stenosis .
a 37-year - old female patient with past history of rheumatic heart disease involving mitral and the aortic valves was diagnosed with streptococcus viridans bacterial endocarditis causing both moderate mitral and severe aortic regurgitation with multiple embolic events and abscess formation .
the aortic valve showed redundant vegetations attached to the non - coronary cusp with erosion and abscess formation between the right and the non - coronary commisures in the area of the perimembranous septum .
there was also abscess formation below the none and left coronary commisures , almost penetrating the aortic root .
the mitral valve also showed vegetations in both commisures and excess fibrosis and thickening of both cusps .
postoperative course and hospital stay was uneventful and she was discharged home on aspirin , atorvastatin , metoprolol , and warfarin .
one month following surgery , she started to have central- and left - sided chest pain , progressively worsening over few months .
her symptoms were atypical for angina as they were mostly non - exertional and associated with palpitations and flushing .
her resting electrocardiography ( ecg ) showed no evidence for ischemia and her echocardiography revealed normal left ventricular function with normally functioning prostheses .
a 24-hour holter monitor for st segment changes was done 6 months later and revealed marked st segment depression whenever she had chest pain .
she underwent cardiac catheterization and coronary angiography [ figures 1 and 2 ] which showed short left main coronary artery with 90% concentric stenosis and significant pressure damping upon cannulation of the left main stem .
coronary angiogram in the left anterior oblique caudal view showing significant ostial left main stem coronary stenosis ( arrows ) .
aortic and mitral prosthetic valves are shown as well coronary angiogram in the anteroposterior ( ap ) view showing significant ostial left main stem coronary stenosis ( arrows ) .
aortic and mitral prosthetic valves are shown as well the patient was referred for surgery and she underwent coronary artery bypass surgery consisting of left internal mammary artery to the left anterior descending artery and a saphenous vein graft to the diagonal branch and left circumflex . there were no postoperative complications .
this may result from mechanical injury or direct trauma to the vessels usually from the use of coronary perfusion cannulae producing immediate dissection and myocardial infarction during the intra - operative period .
the usual complication of coronary ostial stenosis associated with intimal hyperplasia has been infrequently recognized clinically .
the use of balloon tip perfusion catheter presumably provides the initial insult with local vessel wall hypoxia through compression of vasa vasora perhaps in the conjunction with a relatively high perfusion pressure .
but the appearance of ostial narrowing in the right coronary artery argues against perfusion as the only etiologic factor .
intimal - medial separation related to direct trauma from manipulation with subsequent hyperplasia is also a consideration .
turbulent flow around the prosthetic valve has been conjectured to produce intimal hyperplasia in the aorta .
intimal thickening in the aortic root including the area of the coronary ostia in patients who died late after surgery has been described .
symptoms are often clear and overwhelming : chest pain during exercise or at rest , sudden onset of left ventricular failure without clear cause , and acute pulmonary edema . in our case , the patient symptoms were atypical ( short episodes of non - exertional chest pains with palpitations ) and that was the major cause in delaying the diagnosis .
the rapid appearance of angina postoperatively presumably correlated with the anatomic narrowing of the coronary ostia by intimal proliferation . in our case ,
the most likely cause of her left main stenosis post surgery was direct injury during left main cannulation using ante grade cardioplegia .
it is important to recognize that valve prosthesis may obscure the ostium of either coronary artery and coronary angiographic multiple injections in various positions may be required to demonstrate the lesion . once the diagnosis of coronary ostial stenosis is established the procedure of choice is oartocoronary anastomosis .
coronary artery stenosis after prosthetic valvular replacement can be avoided by not cannulating the coronary ostia for antegrade cardioplegia , but instead using retrograde delivery as an alternative method for myocardial perfusion during open heart surgery . in the same paper they suggested that there might be a genetic predisposition for developing such lesion , as 70% of the affected population in their series had an epsilon 4 allele apolipoprotein e genotype compared to 10 - 15% in control group .
the etiology of such condition is most likely related to ostial injury during cannulation for antegrade cardioplegia . | iatrogenic coronary artery disease following prosthetic valve implantation is a rare complication .
this may result from mechanical injury in the intraoperative period .
the use of balloon tip perfusion catheter presumably provides the initial insult with local vessel wall hypoxia . once the diagnosis of coronary ostial stenosis is established , the procedure of choice is coronary artery bypass surgery .
we report a case of a young lady who underwent aortic and mitral valves replacement for infective endocarditis .
she was then diagnosed with ostial left main stem coronary stenosis after presenting with atypical symptoms .
the patient eventually underwent coronary artery bypass surgery . | INTRODUCTION
CASE REPORT
DISCUSSION
CONCLUSION |
it results in better control of files during apical preparation and also facilitates the working length ( wl ) determination and apical enlargement .
preflaring allows a deeper penetration of irrigation needles and thereby permits more effective debridement . on the other hand , over - preparing the coronal third of the root canal
furthermore , preflaring results in thinning of the canal walls and increase the risk of tooth fracture .
gates - glidden ( gg ) drills are the most common instruments used in coronal flaring .
the low cost , high cutting potential , and easy use of gg drills , have made them widely - used instruments for coronal preparation of root canals .
gg drills # 1 and # 2 used in the coronal third of mesio - buccal ( mb ) canals of mandibular molars do not significantly decrease the residual dentin thickness . on the other hand
, it was reported that regardless of the size of the gg drill and the depth of penetration , it weakens the furcation area of mandibular molars .
nickel - titanium ( ni - ti ) instruments effectively improve the funnel shape of canals and have the least risk of root canal transportation .
rotary files not only make facilitate and hasten preparations , but also produce a predictable and reproducible root canal shape with less iatrogenic damage . different ni - ti file systems with specific coronal shapers have been introduced to the market .
the protaper rotary file system has three coronal shapers ( s1 , s2 and sx ) , and the race rotary system has two coronal shapers ( # 35.08 and # 40.10 ) .
numerous studies have compared the ni - ti files , but few have evaluated coronal enlargers .
the aim of this study was to evaluate the minimum residual root thickness ( mrrt ) of danger zone after canal preparation using gg drills , protaper and race rotary files in mb canals of mandibular first molars by cone beam computerized tomography ( cbct ) .
a total of 135 mandibular first molars , extracted from the patients aged 35 to 55 years due to periodontal disease , were collected and disinfected by immersion in a 5.25% naocl solution for 1 h , then stored in saline until further use .
all teeth with external or internal root resorption , open apices , visible cracks , fractures , caries , and previous root canal treatment were excluded .
the root canals with lengths of 912 mm ( from furcation level to the apex ) were used in this study .
access cavities were prepared and distal roots were cut from 1 mm below the furcation level using diamond discs .
the presence of two separate mesial canals was confirmed by simultaneous placement of two k - files # 10 ( maillefer , ballaigus , switzerland ) in the canals .
canal patency was checked by visualizing the tip of the k - files # 10 from the apical foramen of the mb canal .
root canals with apical stops up to file # 15 were included , and those beyond # 15 were excluded . to determine the canal curvature ,
a k - file # 10 was placed in the mb canal and parallel radiographs were provided in bucco - lingual and mesio - distal directions . using schneider 's technique ,
the teeth were placed halfway into acrylic resin molds with their buccal surface facing upwards . to facilitate the orientation of canal in the cbct sections ( somatom sensation 16 computerized tomography [ ct ] scanner , siemens , berlin , germany ) ,
a copper filament was inserted into the resin , parallel to the long axis of the tooth , near the mesio - lingual line angle .
the samples were then randomly stabilized on a fiber board , on which all furcations were aligned and tooth codes were recorded . due to the slice thickness of the cbct scan ( 0.8 mm ) and the slice distance of 0.2 mm , sections were obtained of 1 , 2 , 3 and 4 mm from the furcation level .
teeth were then fixed and placed in the cbct scanner and the initial images were provided .
the minimum initial root thickness ( mirt ) of the furcation area in the mb canal was evaluated in the mentioned sections by syngo cbct software vb20 ( siemens ag , erlangen , germany ) ; siemens program [ figure 1 ] .
then the samples were randomly divided into three groups by the table of random numbers ( group g , group r and group pt ) .
the average mirt was assessed in the three groups and hence that no significant difference would be present .
the cone beam computerized tomography scans of the pre and postpreparation images of the mesio - buccal canals of mandibular first molars in group g , based on the passive step - back technique , the coronal shaping was done using gg drills # 2 , 3 and 4 ( dentsply , maillefer , switzerland ) respectively by a conventional motor at low speed of 2500 rpm .
the penetration depth of gg drills was as follow : # 2 maximum to the coronal half of the canal , # 3 to the coronal third , and # 4 to the canal orifice .
canal preparation of the middle and apical thirds was done using k - flexofiles # 1525 ( maillefer , ballaigus , switzerland ) .
file # 25 was considered as master apical file ( maf ) . in group r ,
the canals were prepared with race rotary files ( fkg - dentaire ) as follows : file # 40.10 , # 35.08 , # 25.06 for the coronal two - thirds and # 25.04 to the wl as maf . in group
pt , canal preparation was done by protaper ( dentsply , maillefer , switzerland ) files sx , s1 , s2 , f1 , and f2 respectively as instructed by the manufacturer and f2 was selected as maf . a motor controller ( x - smart , maillefer / dentsply , ballaigus , switzerland ) with the recommended torque and speed
the canals were irrigated with 2 ml of regular saline and 1 ml of 2.5% naocl , while file # 10 was used to ensure patency .
an endodontist ( nma ) prepared all the canals and each instrument was used for the preparation of 5 canals .
after canal preparation , the samples were placed again in the initial molds and cbct scans were obtained in a similar fashion to the initial imaging .
the amount of the dentin removal ( dr ) was calculated by subtracting the amount of the residual root thickness ( rrt ) from the initial root thickness ( irt ) . in this study ,
the relative percentage of dr was calculated by dividing the amount of dr to irt ( dr / irt ) 100 . to compare the thicknesses of pre and postpreparation in each group and in each section
, the paired t - test was used . for comparison of the mirt , mrrt , and the amount of dr in each group ,
furthermore , to compare the mentioned values among the groups , the anova test was applied .
the teeth were placed halfway into acrylic resin molds with their buccal surface facing upwards . to facilitate the orientation of canal in the cbct sections ( somatom sensation 16 computerized tomography [ ct ] scanner , siemens , berlin , germany ) ,
a copper filament was inserted into the resin , parallel to the long axis of the tooth , near the mesio - lingual line angle .
the samples were then randomly stabilized on a fiber board , on which all furcations were aligned and tooth codes were recorded . due to the slice thickness of the cbct scan ( 0.8 mm ) and the slice distance of 0.2 mm , sections were obtained of 1 , 2 , 3 and 4 mm from the furcation level .
teeth were then fixed and placed in the cbct scanner and the initial images were provided .
the minimum initial root thickness ( mirt ) of the furcation area in the mb canal was evaluated in the mentioned sections by syngo cbct software vb20 ( siemens ag , erlangen , germany ) ; siemens program [ figure 1 ] . then the samples were randomly divided into three groups by the table of random numbers ( group g , group r and group pt ) .
the average mirt was assessed in the three groups and hence that no significant difference would be present .
the cone beam computerized tomography scans of the pre and postpreparation images of the mesio - buccal canals of mandibular first molars
in group g , based on the passive step - back technique , the coronal shaping was done using gg drills # 2 , 3 and 4 ( dentsply , maillefer , switzerland ) respectively by a conventional motor at low speed of 2500 rpm .
the penetration depth of gg drills was as follow : # 2 maximum to the coronal half of the canal , # 3 to the coronal third , and # 4 to the canal orifice .
canal preparation of the middle and apical thirds was done using k - flexofiles # 1525 ( maillefer , ballaigus , switzerland ) .
file # 25 was considered as master apical file ( maf ) . in group r ,
the canals were prepared with race rotary files ( fkg - dentaire ) as follows : file # 40.10 , # 35.08 , # 25.06 for the coronal two - thirds and # 25.04 to the wl as maf . in group
pt , canal preparation was done by protaper ( dentsply , maillefer , switzerland ) files sx , s1 , s2 , f1 , and f2 respectively as instructed by the manufacturer and f2 was selected as maf . a motor controller ( x - smart , maillefer / dentsply , ballaigus , switzerland ) with
the recommended torque and speed was used for each rotary file . in order to avoid perforations ,
the canals were irrigated with 2 ml of regular saline and 1 ml of 2.5% naocl , while file # 10 was used to ensure patency .
an endodontist ( nma ) prepared all the canals and each instrument was used for the preparation of 5 canals .
after canal preparation , the samples were placed again in the initial molds and cbct scans were obtained in a similar fashion to the initial imaging .
the amount of the dentin removal ( dr ) was calculated by subtracting the amount of the residual root thickness ( rrt ) from the initial root thickness ( irt ) . in this study ,
the relative percentage of dr was calculated by dividing the amount of dr to irt ( dr / irt ) 100 .
to compare the thicknesses of pre and postpreparation in each group and in each section , the paired t - test was used . for comparison of the mirt , mrrt , and the amount of dr in each group ,
furthermore , to compare the mentioned values among the groups , the anova test was applied .
the mirt in the furcation area of the mb canals in all the groups and for all the sections was determined [ figure 2 and table 1 ] .
the minimum initial root thickness of the furcation area in different sections of the mesio - buccal canals of mandibular first molars in millimeter the meansd of the mirt at different sections of the mb canals of mandibular first molars in the three groups ( in mm ) in intra - group comparison , there was a statistically significant difference among the sections in each group ( p < 0.001 ) . in inter - group comparison of each section , no significant difference could be detected ( p > 0.05 ) . in intra - group comparison of the root thickness of pre and postcanal preparation
there was a significant difference in each of the groups ( p < 0.05 ) [ figure 3 and table 2 ] .
the minimum residual root thickness of the furcation area in different sections of the mesio - buccal canals of mandibular first molars ( in mm ) the meansd of the mrrt at different sections of the mb canals of mandibular first molars in the three groups ( in mm ) in inter - group comparisons , there was no significant difference between the groups ( p > 0.05 ) . in intra - group assessments ,
no significant difference was detected in any of the groups ( p > 0.05 ) . in inter - group comparisons
the amount of dr by gg drills was significantly greater in all the sections than the r group , whereas compared with pt group ; it was only greater in sections that were 3 mm from the furcation .
groups r and pt had no significant difference for the amount of dr in any of the sections [ table 3 ] .
the meansd of the dr at different sections of the mb canals of mandibular first molars in the three groups ( in mm ) the lowest relative percentages ( lrp ) of dr / irt and the greatest relative percentages ( grp ) of dr / irt in the three groups were as follows :
the lrp of dr / irt was 19% at the section 2 and the grp of dr / irt was 23% at the section 4 mm from the furcation .
the lrp of dr / irt was 19% at the section 2 and the grp of dr / irt was 23% at the section 4 mm from the furcation .
the lrp of dr / irt was 14% at the section 1 and the grp of dr / irt was 20% at the section 4 mm from the furcation .
the lrp of dr / irt was 14% at the section 1 and the grp of dr / irt was 20% at the section 4 mm from the furcation .
the lrp of dr / irt was 25% at the section 1 and the grp of dr was 29% at the section 3 mm from the furcation .
the lrp of dr / irt was 25% at the section 1 and the grp of dr was 29% at the section 3 mm from the furcation .
the mirt in the furcation area of the mb canals in all the groups and for all the sections was determined [ figure 2 and table 1 ] .
the minimum initial root thickness of the furcation area in different sections of the mesio - buccal canals of mandibular first molars in millimeter the meansd of the mirt at different sections of the mb canals of mandibular first molars in the three groups ( in mm ) in intra - group comparison , there was a statistically significant difference among the sections in each group ( p < 0.001 ) . in inter - group comparison of each section , no significant difference could be detected ( p > 0.05 ) .
in intra - group comparison of the root thickness of pre and postcanal preparation there was a significant difference in each of the groups ( p < 0.05 ) [ figure 3 and table 2 ] .
the minimum residual root thickness of the furcation area in different sections of the mesio - buccal canals of mandibular first molars ( in mm ) the meansd of the mrrt at different sections of the mb canals of mandibular first molars in the three groups ( in mm ) in inter - group comparisons , there was no significant difference between the groups ( p > 0.05 ) .
in intra - group assessments , no significant difference was detected in any of the groups ( p > 0.05 ) . in inter - group comparisons
the amount of dr by gg drills was significantly greater in all the sections than the r group , whereas compared with pt group ; it was only greater in sections that were 3 mm from the furcation .
groups r and pt had no significant difference for the amount of dr in any of the sections [ table 3 ] .
the meansd of the dr at different sections of the mb canals of mandibular first molars in the three groups ( in mm ) the lowest relative percentages ( lrp ) of dr / irt and the greatest relative percentages ( grp ) of dr / irt in the three groups were as follows :
the lrp of dr / irt was 19% at the section 2 and the grp of dr / irt was 23% at the section 4 mm from the furcation .
the lrp of dr / irt was 19% at the section 2 and the grp of dr / irt was 23% at the section 4 mm from the furcation .
the lrp of dr / irt was 14% at the section 1 and the grp of dr / irt was 20% at the section 4 mm from the furcation .
the lrp of dr / irt was 14% at the section 1 and the grp of dr / irt was 20% at the section 4 mm from the furcation .
the lrp of dr / irt was 25% at the section 1 and the grp of dr was 29% at the section 3 mm from the furcation .
the lrp of dr / irt was 25% at the section 1 and the grp of dr was 29% at the section 3 mm from the furcation .
the lrp of dr / irt was 19% at the section 2 and the grp of dr / irt was 23% at the section 4 mm from the furcation .
the lrp of dr / irt was 19% at the section 2 and the grp of dr / irt was 23% at the section 4 mm from the furcation .
the lrp of dr / irt was 14% at the section 1 and the grp of dr / irt was 20% at the section 4 mm from the furcation .
the lrp of dr / irt was 14% at the section 1 and the grp of dr / irt was 20% at the section 4 mm from the furcation .
the lrp of dr / irt was 25% at the section 1 and the grp of dr was 29% at the section 3 mm from the furcation .
the lrp of dr / irt was 25% at the section 1 and the grp of dr was 29% at the section 3 mm from the furcation .
this study compared the mrrt of the furcation area of mb canals of mandibular first molars using race , protaper and gg drills by cbct method .
when measuring the amount of dr , there was no significant difference in intra - group comparisons .
this suggests that the dr was uniform in all the groups . in this study , in inter - group comparisons , race and
protaper systems removed similar amounts of dentin with no significant difference , whereas gg drills significantly removed more when compared with race system . in comparing different techniques and instruments or anatomical evaluations , among the different techniques ,
the cbct method has the capability of three - dimensional description of the root canal .
this was especially evident in the coronal and middle thirds , which are the major areas altered by enlarging endodontic instruments . in this study ,
a cbct method with slice thickness of 0.8 and slice distance of 0.2 was used .
the samples used in this study had 2035 root canal curvature in bucco - lingual or mesio - distal radiographs .
such a limited range for curvature can not be seen in many studies . considering that age is an influential factor in the irt , for better comparison , teeth from the patients aged 3555 years were selected .
some previous researchers have mentioned that the area within 34 mm below the root canal orifice is the most sensitive area during rotary preparation of mesial canals of molar teeth .
therefore , similarly to previous studies , this evaluation was conducted regarding the danger zones of furcation area . in the present study ,
mirt of mb canal of mandibular first molars in the danger zones was more than 1 mm in all the sections except in the 4 mm from the furcation . in all groups ,
the amount of mirt gradually decreased from 1 mm to 4 mm from the furcation .
berutti and fedon reported that the root thickness of the mesial canal of mandibular first molars was smallest ( 1.21.3 mm ) within 1.5 mm of the furcation .
mahran and aboel - fotouh evaluated the effect of heroshaper , protaper system , and gg drills in the coronal portion ( within 3 mm from the furcation ) of mb canals of the mandibular first molars and similar to the present study , reported that the mean irt was more than 1 mm . in a study conducted by coutinho - filho et al . , the average irt at a 3 mm distance from the furcation area in the mesial canal of mandibular first molars was 0.8 mm 0.17 mm .
stated that , at the coronal level ( 12 mm from the furcation ) , the mean of irt of distal and distolingual walls of mb canal in mandibular first molars were < 1 mm ( 0.94 and 0.78 mm respectively ) .
reported the irt is the most important factor in determining the rrt after the root canal preparation . in a study by uyanik et al . , the amount of dr in the coronal third was not significantly different between race and protaper systems , as seen in the present study .
mahran and aboel - fotouh showed that protaper files removed less dentin compared to gg drills in the furcation area of the mb canal of mandibular first molars . considering that the mean mrrt in all the groups of this study had no significant difference and were > 0.75 mm ,
the results of the current study showed that , if rotary instruments are used in brushing movements and in an anti - curvature style , a proper and safe root thickness would be maintained .
lim and stock showed that the mrrt after preparation should be no < 0.3 mm to resist against the forces during root canal obturation . according to their results , mb canals of mandibular first molars after rotary instrumentation have sufficient resistance to root canal obturation . unlike this study , wu et al . reported that using gg drills in mandibular molars weakens the furcation area , regardless of the size of the instrument or the penetration depth
they mentioned that using the anti - curvature method does not lower the risk of strip perforation .
zuckerman et al . evaluated the rrt of mesial canals of mandibular molars with curvatures < 30 using the light speed system and gg drills and similar to this study , reported no significant difference between the irt and rrt . in the present study ,
have shown that at least 1 mm of root thickness must be maintained around the post , to resist against vertical fracture .
indicated that the rrt of the mb canal of mandibular first molars in the distal and disto - lingual walls of the furcation area after canal preparation was < 1 mm ( 0.72 and 0.53 mm respectively ) .
therefore , it seems that the mesial canals of mandibular first molars are not sufficiently resistant to vertical fractures when posts are inserted in them .
based on the results of this study , gg drills removed significantly more dentin than race rotary files in furcation area . however , the mrrt was not significantly different among the groups .
considering the limitations , when optimum irt are present , gg drills , race and protaper systems may safely be used for preflaring the mb canals of mandibular first molars without weakening the furcation area . | objective : the aim of this study was to evaluate the minimum residual root thickness ( mrrt ) of the danger zone after preflaring of the mesio - buccal ( mb ) canal of mandibular first molars using protaper , race and gates - glidden ( gg ) drills as coronal shapers by cone beam computerized tomography ( cbct).materials and methods : in this experimental study , the initial cbct scans of 75 mb canals of mandibular first molars were provided within 1 , 2 , 3 and 4 mm of the furcation level .
the samples were divided into three groups .
the samples of protaper and race groups were prepared up to f2 and # 25.04 as the master apical file ( maf ) , respectively .
the coronal preparation of the samples in the gg group was done using gg drills # 2 , # 3 and # 4 and canals were prepared till maf # 25 . after obtaining the postinstrumentation images , the mrrt and the amount of removed dentin were analyzed by t - test and anova statistical analyses.results:the gg drills removed significantly more dentin than race at all the sections ( p < 0.05 ) and more than protaper at 3 mm from the furcation .
statistically there was no significant difference between protaper and race groups ( p > 0.05 ) .
there was no significant difference in mrrt between the groups ( p > 0.05 ) .
the mean mrrt was not < 0.75 mm at all sections.conclusion:based on the results of this study , when an appropriate root thickness is initially present , all of the instruments that were investigated may safely be used as coronal shapers in mb canals of mandibular first molars . | INTRODUCTION
MATERIALS AND METHODS
Prepreparation images
Canal preparation procedures
Postpreparation images
Statistical tests
RESULTS
Evaluation of the minimum initial root thickness
Evaluation of the minimum residual root thickness
The amount of dentin removal
Group PT
Group R
Group G
Mishaps
DISCUSSION
CONCLUSIONS |
lumbar arthrodesis has many advantages such as high fusion rate , preservation of the original disc height , and maintained stability of lumbar spine2 ) .
the pedicle screw fixation system implemented by posterior lumbar interbody fusion ( plif ) method has been widely used and regarded as gold standard for lumbar arthrodesis9 ) .
although pedicle screw fixation system is a popular surgical treatment for degenerative disc disease , high complication rates have been reported .
it is reported that the surgical procedure to implement the pedicle screw fixation system is technically demanding and many complications have been observed11 ) .
besides complications related to screw insertion , large blood loss and wound infection have also been identified48 ) . for these reasons
, the use of pedicle screw fixation system may need to be limited by considering patient 's age and bone condition . in order to minimize such complications , interspinous spacers such as x - stop and
the coflex system has been widely investigated through finite element analysis and clinical studies . as a dynamic stabilization system
, coflex preserves the motion range compared to pedicle screw fixation system and is less invasively inserted with convenient surgical process17 ) .
the complications including fracture of spinous process or implant after inserting coflex were also investigated in previous studies37 ) .
recently , one of interspinous devices , interspinous process compressor ( ipc ) , has been introduced , approved by korean food and drug administration ( kfda ) , and commercially released as tieger ( ant technology , yongin , south korea ) .
the ipc has a unique geometry that is different from other interspinous process spacers as shown in fig .
it consists of a bone block that is inserted between spinous processes and hooks that are fixed on each spinous process , in order to completely fuse the lumbar segments .
although this new spinal fusion implant is expected to have advantages such as reduced damages to ligaments , muscles and vertebrae as the implant is laterally inserted less invasively and screws are not used to fix with vertebrae , the biomechanical effects after the fusion of lumbar segments with the ipc have not been investigated . the purpose of this study is to investigate the biomechanical effects of the proposed ipc system using finite element analysis before clinical studies .
the biomechanical effects such as range of motion ( rom ) , intervertebral disc stress , and facet contact force of ipc system were investigated and compared with conventional pedicle screw fixation system .
the computed tomographic scan data of a healthy 24-years - old male was taken and reconstructed to three dimensional geometry using mimics software ( materialise inc . , leuven , belgium ) .
the element types , number of nodes and elements of each component are shown in table 1 .
the cortical bone was constructed from the surface of cancellous bone with a thickness of 1 mm and cartilage endplate was extracted from the surface of intervertebral disc with a thickness of 0.5 mm . the final finite element ( fe )
model had five vertebras ( l15 ) , four intervertebral discs , cartilage endplates , and ligaments .
the material properties of each component were obtained from the literature , as shown in table 2 .
the fe model was exported to abaqus software ( abaqus 6.13 ; hibbitt , karlsson & sorenson , inc . ,
providence , ri , usa ) after the material properties were applied to each component of lumbar spine in the model .
the frictionless sliding contact condition was applied to the surface of facet joints . the developed 3-dimensional fe model as shown in fig .
2a was validated by comparing rom at each intervertebral segment in extension , flexion , lateral bending and axial torsion based on the study by yamamoto et al.28 ) . in order to compare the biomechanical changes after spine fusion , two types of surgical models , plif and ipc models ,
the plif model consisted of polyether ether ketone ( peek ) cages , pedicle screws , and rods as shown in fig .
the length and diameter of the pedicle screw were 45 mm and 6 mm , respectively .
the geometry of pedicle screws was approximated as cylinder in order to simplify the simulations . following the standard surgical method , supraspinous ligament , interspinous ligament , and posterior longitudinal ligament at surgical level
the peek cage was inserted between l3 and l4 after intervertebral disc was totally resected .
after the cage was inserted , the pedicle screw fixation system was implanted at l34 level .
next , the ipc model consisted of peek cage , bone block , inferior hook , superior hook , and screw that combines superior hook with inferior hook , as shown in fig .
the size of bone block and length of the hooks were adjusted to fit the developed fe model .
the hooks were connected with screw and tied so that hooks can not be separated .
the tie interaction was applied to all spinal implants and vertebral bodies for the complete fusion condition .
the first loading condition was for validation of the intact fe model , following the same protocol used in the study of yamamoto et al.28 ) .
the pure moment of 10 nm was applied to the superior surface of l1 while the inferior surface of l5 was fixed in all directions .
the second loading condition was applied to both intact and surgical models to analyze the biomechanical changes caused by the surgical implants .
the follower load of 280 n that represents partial body weight along the curvature of lumbar spine was applied21 ) .
the truss elements were attached bilaterally along the curvature of lumbar spine as previous studies1215 ) . for surgical models ,
adjusted moments were applied to superior surface of l1 to obtain same lordosis ( l15 ) that was calculated with the intact model where the moment of 10 nm was applied .
the moment that causes the same lordosis with intact spine was investigated in each loading condition5 ) . the identified moments to apply to both surgical models under extension , flexion , bending , and torsion were 16 nm , 12.6 nm , 11 nm , and 13.5 nm , respectively .
the validation of intact fe model and biomechanical changes caused by the surgical implants were investigated in flexion , extension , lateral bending and axial torsion conditions .
to validate the constructed intact spine model , the rom of finite element model of intact spine was compared with the results of the study by yamamoto et al.28 ) the results were within 1 degree of the rom values reported in yamamoto et al .
's study in extension , flexion , bending , and torsion , as shown in fig .
4 , the rom at adjacent levels ( l2/3 , l4/5 ) and surgical level ( l3/4 ) was compared among intact and surgical models in extension , flexion , lateral bending , and axial torsion .
the rom of both surgical models remarkably decreased at surgical level ( l3/4 ) compared to the intact model in all motions .
the rom at surgical level was changed by -96% and -94% in extension , -96% and -95% in flexion , -92% and -89% in bending , and -87% and -88% in torsion in plif and ipc models , respectively , compared to the intact model .
the plif and ipc models resulted in similar rom at surgical level , with a difference of less than 0.1 degree . on the other hand
, the rom increased in all motions at adjacent levels ( l2/3 , l4/5 ) .
the rom at l23 level was changed by + 10% and + 14% in extension , + 29% and + 30% in flexion , + 6% and + 8% in bending , and + 61% and + 61% in torsion in plif and ipc models , respectively , compared to the intact model .
the rom at l45 level was changed by + 90% and + 85% in extension , + 30% and + 30% in flexion , + 9% and + 9% in bending , and + 54% and + 50% in torsion in plif and ipc models , respectively , compared to the intact model .
the rom was more increased at l4/5 level than l2/3 level in both surgical models and the surgical models had similar rom , with a difference within 0.1 degree at adjacent levels .
5 , among intact and surgical models at adjacent levels ( l2/3 , l4/5 ) , which are represented as d2 and d4 .
the stress in d2 was changed by -3% and + 3% in extension , + 20% and + 20% in flexion , -0.4% and + 3% in bending , and + 12% and + 10% in torsion in plif and ipc models compared to the intact model , respectively .
the stress in d2 increased with the plif model in flexion and torsion while it increased in all motions with the ipc model .
the stress in d4 was changed by + 13% and + 11% in extension , + 12% and + 12% in flexion , + 4% and + 4% in bending , and -22.1% and -22.5% in torsion in plif and ipc models , respectively , compared to the intact model .
the stress in d4 increased in both surgical models except torsion condition , compared to the intact model .
the difference in intervertebral disc stress of ipc and plif models was 5.8% in d2 and 1.8% in d4 .
the facet contact force at adjacent levels ( l2/3 , l4/5 ) was compared in fig .
the facet contact force at surgical level was zero in all motions while it tended to increase at adjacent levels ( l2/3 , l4/5 ) in all motions for both plif and ipc models .
the facet contact force at l2/3 level was changed by + 34% and + 46% in extension , + 42% and + 20% in bending , and + 364% and + 432% in torsion , in plif and ipc models , respectively . in flexion ,
the facet contact force was zero in intact model while it increased in both surgical models .
the facet contact force at l4/5 level was changed by + 39% and + 43% in extension , + 29% and + 24% in flexion , -2% and -4% in bending , and + 24% and + 11% in torsion , in plif and ipc models , respectively .
the maximum difference in facet contact force of plif and ipc models was 15.4% in bending condition .
in this study , the biomechanical changes after inserting the ipc were investigated and compared with pedicle screw fixation system using finite element analysis .
we used ct images of a healthy , young male to reconstruct three dimensional geometry of lumbar spine .
the characteristic of fe model of lumbar spine was represented by applying material properties of each component , based on the previous fe studies as shown in table 2 .
a number of previous studies also used ct images of young patient and normal condition of lumbar spine to construct the fe models3141527 ) . in our fe model , only one level of intervertebral disc ( l3/4 )
was assumed to be degenerative condition , and more importantly , the whole degenerative portion of intervertebral disc was removed following the standard surgical procedure as in previous studies121415 ) .
therefore , the used fe model could be concluded to be appropriate to represent surgical model of degenerative disc disease . as a spinal fusion device ,
the ipc model showed comparable biomechanical effects with the conventional plif model . at surgical level ( l3/4 ) , the intersegmental rotation was remarkably decreased .
the results predicted by fea in the current study were similar to the previous results525 ) .
the rom values were similar between the ipc and plif models with a maximum difference of 0.1 degree and no facet contact force occurred in all motions for both surgical models . at adjacent level
, on the other hand , the rom and facet contact force increased according to fusion effect .
these adjacent effects had been previously reported and considered as major complications of spinal fusion121415 ) .
the facet contact force of the ipc model was slightly higher than that of the plif model in extension , while that of the plif model was slightly higher than the ipc model in other motions .
in addition , stress in intervertebral discs slightly increased after spinal fusion at l2/3 or l4/5 level as previous study5 ) .
the stress in adjacent intervertebral discs of the ipc model was slightly higher than that of the plif model with the difference of 5.8% . in summary ,
the fea results show that the adjacent effects of using the ipc model were similar to those of using conventional pedicle screw fixation system , based on the assumption that the implants were perfectly fused with the bones .
the anterior bone was fused with peek cage and posterior bone was also fixed with screws for plif model , and with bone block and interspinous compressor for ipc model .
accordingly , biomechanical effects of using plif and ipc methods were not essentially different in all motions .
as limitations of the current study , the spinous process and hooks were modeled to be fused as one body although the hooks were fixed with spinous process using keel in reality .
accordingly , the stress on spinous process was not analyzed , which however should be investigated in future clinical studies as complications such as fracture of spinous process can occur .
the actual fusion effect between spinous process and hooks , duration of fusion , and influence on spinous process need to be investigated through clinical study .
in addition , interspinous devices such as coflex and diam were analyzed using finite element method in previous studies13 ) . in those studies ,
the posterior parts were fused with interspinous device and the intervertebral disc was preserved . on the other hand , in our study ,
the intervertebral disc was entirely removed and peek cages were inserted instead . as a result , the biomechanical effects of the ipc system could not be directly compared to other types of interspinous devices reported in previous studies .
a new type of spinal fusion device , ipc , was analyzed biomechanically through fem . based on the simulated results
, it exhibited similar fusion effect at surgical level and similar biomechanical effects at adjacent levels compared to pedicle screw fixation system .
the ipc with less invasive local incision and without screw insertion , resulting in reduced damages to ligaments , muscles , and vertebrae of the patient and eliminated complications associated with screws , may extensively be used regardless of patient 's age and bone conditions after clinical validations for fusion rates and long term stability . | objectiveto investigate the biomechanical effects of a newly proposed interspinous process compressor ( ipc ) and compare with pedicle screw fixation at surgical and adjacent levels of lumbar spine.methodsa three dimensional finite element model of intact lumbar spine was constructed and two spinal fusion models using pedicle screw fixation system and a new type of interspinous devices , ipc , were developed .
the biomechanical effects such as range of motion ( rom ) and facet contact force were analyzed at surgical level ( l3/4 ) and adjacent levels ( l2/3 , l4/5 ) .
in addition , the stress in adjacent intervertebral discs ( d2 , d4 ) was investigated.resultsthe entire results show biomechanical parameters such as rom , facet contact force , and stress in adjacent intervertebral discs were similar between plif and ipc models in all motions based on the assumption that the implants were perfectly fused with the spine.conclusionthe newly proposed fusion device , ipc , had similar fusion effect at surgical level , and biomechanical effects at adjacent levels were also similar with those of pedicle screw fixation system
. however , for clinical applications , real fusion effect between spinous process and hooks , duration of fusion , and influence on spinous process need to be investigated through clinical study . | INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUSION |
woolly hair nevus is a rare abnormality of the scalp hair that appears since birth or during first 2 years , characterized by the patch of hair , which is curlier and light colored than the rest of the scalp hair . here ,
we present a case of woolly hair nevus with ipsilateral pigmented demarcation lines and heterochromia iridis .
a 5-year - old girl with a patch of kinky hair in the right parietal region , which had been present since the age of 4 months and different colored eyes since birth referred to our clinic [ figure 1 ] .
the affected hair appeared smaller in diameter and lighter than the normal hair color and no structural hair abnormalities were detected under the light microscope .
she had slightly hyperpigmented linear lesions mostly marked on the anterolateral of the right arm with midline pectoral and abdominal extension [ figure 2 ] .
the right eye was diffusely brown , and the left was green [ figure 3 ] .
the patient was diagnosed with a woolly hair nevus of the right parietal scalp associated pigmented demarcation lines and heterochromia iridis .
. curled woolly hair on the left parietal region pigmentary demarcation lines on the right anterolateral arm extending to the right pectoral and abdominal region heterochromia iridis , right eye has brown eye color and left eye has green
hutchinson et al . classified woolly hair into three categories as hereditary woolly hair , familial woolly hair , and woolly hair nevus .
woolly hair nevus was divided into three groups by post which is ( 1 ) with no associated scalp disorders or hairless skin , ( 2 ) with associated linear verrucous epidermal nevus , ( 3 ) acquired , which has been termed acquired progressive kinking of scalp hair .
pigmentary demarcation lines ( pdl ) are transition lines between the areas of darker and lighter or normal pigmentation with eight different types described ( a h ) .
type a is an anterolateral aspect of upper arm with variable transpectoral extension and the type c is in median or paramedian vertical lines on the chest with midline abdominal extension . in our subject ,
heterochromia iridis is usually a sporadic and benign condition and may be affected by genetic and multiple physiological factors .
melanin is the main chromophore of the human iris and is the most important factor that determines the color of the irides .
heterochromia iridis is related with some dermatologic diseases such as waardenburg syndrome , hypomelanosis of ito , and linear scleroderma .
circumscribed hypopigmentation along with waardenburg syndrome , caf au lait macule , and also hyperpigmented patch without any systemic disease are other mentioned pigmentary anomalies associated with heterochromia iridis .
the association of woolly hair nevus with some other ectodermal defects has been reported before suggesting the term woolly hair nevus syndrome .
whether the coexistence of heterochromia iridis with woolly hair nevus and demarcation lines is just coincidental or a true association remains unclear .
the patients with the woolly hair nevus are suggested to be evaluated for the other systemic or ectodermal defects that may accompany this lesion and long - term follow - up is needed .
the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s )
has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal .
the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .
the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s )
has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal .
the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed . | we report a case of woolly hair nevus with pigmentary demarcation lines and heterochromia iridis .
woolly hair nevus is a rare abnormality of the scalp hair characterized by the patch of hair , which is curlier and light colored than the rest of the scalp hair .
association of woolly hair nevus with some other ectodermal defects effecting skin and eyes has been reported before . here ,
woolly hair nevus associated with demarcation lines and heterochromia iridis , to our knowledge , have not been previously reported . | INTRODUCTION
CASE REPORT
DISCUSSION
Financial support and sponsorship
Conflicts of interest |
itch ( pruritus ) is a common symptom of many dermatological and systemic diseases . although very common , itch is very hard to describe . according to bernhard : itching is a sensation that , if sufficently strong , will provoke either conscious or reflex scratching or the desire to scratch.1 it consists of multidimensional phenomena with sensory discriminative , cognitive , evaluative and motivational components .
itch has similarities with pain , but in contrast to pain itch induces scratch cycles , which combine elements of pleasure with pain.2 severe itch can severely affect quality of life ( eg , sleep deprivation ) and can have serious psychological implications ( including temptation to suicide ) .
mild to severe pruritus is a common symptom in numerous inflammatory skin disorders , including atopic dermatitis , eczema or lichen planus .
pruritus is an important symptom also in psoriasis vulgaris , but published data on both its prevalence and characteristics are limited .
its prevalence in different parts of the world ranges fromm 64% to 84%.3,4 according to reich et al pruritus intensity in psoriatic patients is significantly correlated with quality of life impairment , level of stigmatization and severity of depressive symptoms.5 the objective of our study was to characterize the prevalence of the itch in psoriatic patients and the effect of treatment modalities by using a comprehensive itch questionnaire .
this study was conducted between october 2007 and march 2008 in the department of dermatology of the university of florence .
a structured itch questionnaire of our own design ( table 1 ) was given to 90 patients with moderate to severe chronic - plaque psoriasis .
all patients who had other dermatological or general illnesses ( such as renal or hepatic diseases ) causing pruritus were excluded from the study .
the 90 study patients ( 45 females and 45 males ; age range 2184 years ) were divided into 3 groups according to the treatment .
thirty patients were on narrow - band ultraviolet b ( nb - uvb ) treatment , 30 on topical or systemic traditional treatments , and 30 underwent biological treatment with anti - tumor necrosis factor- ( anti - tnf- ) or anti - cd11a monoclonal antibody .
after a brief explanation of the research project , patients were invited to fill in a questionnaire on pruritus and psoriasis ; the questionnaire took approximately 10 minutes to complete .
the questionnaire asked about age , sex , height and weight , job category , and marital status .
it concerned the areas affected by psoriasis and pruritus , pruritus characteristics , worsening and relieving factors , and treatment modalities .
a visual analog scale ( vas ) of 0 to 10 was used to score pruritus as mild ( 13 ) , moderate ( 47 ) and severe ( 810 ) .
associations between factors were determined using a chi - square test with odds ratio ( or ) with 95% confidence interval ( 95% ci ) whenever appropriate .
pearson s correlation test was used to show the correlation of different variables with pruritus intensity .
in our survey 83% of psoriatic patients suffered from itching ( table 2b ) . in 45% of these patients pruritus appeared daily ( in 32% often and in 13% always ) ( table 2d ) .
most patients described pruritus as a sensation of stinging ( 20% ) and burning ( 15% ) ; the intensity reflected by vas scale was scored as mild only in 13% , moderate in 37% and severe in 33% of patients .
seventy - five percent of itch patients had to scratch until bleeding ( table 2c ) .
itch was most frequent at night , and 50% of patients reported difficulty in falling asleep .
pruritus presence and severity was not correlated significantly with patient age , sex , marital status , alcohol and smoking habits , and duration and severity of psoriasis according to psoriasis area and severity index scores ( pasi).6 pruritus intensity and body mass index ( bmi ) were correlated : 40% of patients with pruritus were overweight ( bmi > 25 < 30 ) and 10% obese ( bmi > 30 ) ( table 2e ) .
patients reported regional variations in the sites of pruritus ; the most affected anatomical sites were the scalp ( 50% ) , the lower legs and the back .
itching was otherwise limited to psoriatic lesions ( 70% of cases ) , whereas in 30% it involved also non - lesional skin .
all patients who experienced severe punctual stress before psoriasis onset and exacerbations suffered from pruritus , significantly different compared with subjects in which psoriasis was apparently non - stress - related.7 the factors found to reduce itch intensity differed among patients : behavior ( such as sunbathing and cold showers ) , special diets ( without nuts , strawberries , red wine , chocolate , blue cheese , milk and sweet products ) , and specific antipruritic and antipsoriatic treatments . among the pruritus treatment modalities , topical therapies such as moisturizers and steroid creams
were effective in 24% and 17% of patients , respectively , for control of itch in the acute phase but they showed limited long - term effects .
thirty - six percent of patients did not use any treatment or could not find any effective treatment . among the specific antipsoriatic therapies , nb - uvb
( 311 nm ; 2j / cm ) was shown to be of benefit after a 2 weeks treatment ( 2 or 3 times a week ) in 15% of cases .
biological therapies with a standard dosage of both anti - tnf- and anti - cd11a relieved pruritus symptoms in the same percentage of patients ( table 2f ) . in most cases ( 45% )
all patients enjoyed filling in the questionnaire with the help of a medical doctor , and welcomed the opportunity to talk about their symptoms . we found a high pruritus prevalence in chronic - plaque type psoriasis vulgaris ( 85% of patients ) . despite a high frequency of this symptom ,
cutaneous innervation is high in psoriatic skin with pruritus compared with non - pruritic skin .
sprouting of nerves could accelerate the intensity of itching in inflamed skin of psoriasis patients,8 which could be the reason why patients felt more pruritus when the phases of the disease were more active .
almost all patients agreed that stress is an important enhancing factor for psoriasis and also for pruritus in psoriasis .
the patients who did not remember a stress event before the disease onset did not have pruritus.9 the mechanism by which stress provokes pruritus in psoriasis is not understood yet ; psychological stress causes alterations in levels of certain neuropeptides , such as substance p , either in the central nervous system or in tissues .
various mediators as neuropeptides , in addition to histamine released from unmyelinated nerve endings , might have a role.10 it is also known that an increase in substance p potentiates mast cell degranulation in stress condition .
interaction between nerve , neuropeptides and mast cells leads to pruritic inflammation.11 overweight or obese patients experienced more intense pruritus , which could explain the tendency for anatomical folds ( some of our psoriatic patients have also previously had inverse psoriasis ) to rub together .
sensation can be inhibited by substituting the temperature of skin with another sensation to interfere with the steps in the evolution of scratching .
such a substitution may be achieved by cooling the skin by using cold compresses , ice cubes and so forth .
currently available drugs to relieve pruritus are not effective and almost all patients were unsatisfied with the available treatment modalities .
various emollients , topical steroids and calcipotriol cream could relieve the pruritus but their effect is temporary.12 it is generally accepted that the histamine blockade does not prevent pruritus in psoriasis:13 less than 15% of psoriatic patients claimed that oral antihistamines were effective in reducing pruritus .
the ineffective action of antihistamines for pruritus in psoriasis might be explained by the fact that various pruritic mediators , separately or combined with histamine , play a role in the mechanism of pruritus in psoriasis vulgaris.9,14 pruritus intensity and histamine plasma level in psoriasis were not correlated , and no difference was observed in histamine plasma levels between pruritic and nonpruritic patients with psoriasis.15 among the antipsoriatic therapies , phototherapy was the most effective treatment effective in reducing pruritus ( 15% of patients on uvb treatment ) ; phototherapy down - regulates substance p - positive nerve fibers , reducing pruritus not only in psoriasis , but also in other inflammatory skin disease.16 both biological therapies , etanercept and efalizumab , were useful in relieving pruritus , in contrast to published data .
however , we were not able to establish which of the biologics is more effective , because the number of patients was insufficient to demonstrate statistical significance .
the questionnaire was a useful tool for characterizing itch , and the results might help us to better understand pruritus in psoriasis .
the results confirmed the need for a global study of psoriasis with regard to both cutaneous manifestations and the itch symptom . | backgroundpruritus is an important symptom in psoriasis vulgaris , may be severe and seriously affect the quality of life of patients , but published data on its frequency and characteristics are limited.objectivethe study objective was to characterize the prevalence of itch in psoriatic patients and the effect of treatment modalities by using a comprehensive itch questionnaire of own design.methodsa structured itch questionnaire was given to 90 patients with moderate to severe chronic - plaque psoriasis selected consecutively from the patients visiting the department of dermatology of the university of florence .
the questionnaire concerned the areas involved psoriasis and pruritus , the pruritus characteristics , the worsening and relieving factors and treatment modalities .
itch intensity was reflected by a 10 point visual analog scale ( vas ) and the degree of symptoms discriminated between mild ( 13 ) , moderate ( 47 ) and severe ( 810).resultsalmost 85% of psoriatic patients suffered from itching ; the frequency of pruritus was daily and mean intensity by vas scale was moderate .
presence and intensity of pruritus and body mass index ( bmi ) were correlated .
40% of patients with pruritus were overweight ( bmi > 25 < 30 ) and 10% obese ( bmi > 30 ) .
almost all patients appeared unsatisfied with the available treatment modalities for pruritus in psoriasis .
emollients , topical steroids and calcipotriol cream could relieve pruritus but their effect was temporary . among the antipsoriatic therapies ,
phototherapy with narrow band ultraviolet b ( nb - uvb ) was the most effective treatment in reducing pruritus .
biological therapies , mainly etanercept and efalizumab , proved useful in its control.conclusionsthe questionnaire was a useful tool to characterize itch , and the results might help us to better understand pruritus in psoriasis .
the results confirmed the need for a global study of psoriasis with regard to both the cutaneous manifestations and the itch symptom . | Introduction
Methods
Results
Conclusions |
neovascular age - related macular degeneration ( namd ) is a leading cause of visual loss among elderly population [ 1 , 2 ] . before the introduction of intravitreal antivascular endothelial growth factor ( anti - vegf ) agents for the treatment of namd , only prevention from visual acuity loss
might have been achieved in a limited number of patients with different treatment options like laser photocoagulation , photodynamic therapy , and vitreoretinal surgery [ 39 ] .
intravitreal treatments with bevacizumab ( full length antibody against vegf - a ) and ranibizumab ( fab part of antibody against vegf - a ) have led the majority of the patients to prevent the baseline visual acuity ( va ) and even to achieve visual improvement in some of the patients [ 10 , 11 ] .
the multicenter studies with ranibizumab , like marina , anchor , pronto , and excite , and the comparative study of ranibizumab and bevacizumab , the catt study , showed that ranibizumab and bevacizumab were effective to prevent va loss up to 95% of the patients and is effective to make an improvement in va up to 40% of the patients [ 1115 ] .
today , the catt trial answered the questions about the efficacy of bevacizumab versus ranibizumab and showed that both drugs had similar effects in the treatment of namd .
however , the safety of the drugs still remains unclear , and there is an ongoing debate about this issue . in this study , we aimed to compare the functional and anatomical outcomes of bevacizumab therapy to ranibizumab therapy on as - needed treatment regimen for namd in turkish patients .
the clinical data of the patients who were treated with either bevacizumab or ranibizumab between 2009 and 2011 were retrospectively evaluated for this study .
inclusion criteria were age of 50 years or more , newly diagnosed namd , no treatments received other than bevacizumab alone or ranibizumab alone , and a minimum follow - up period of 12 months .
patients were not included if they had any of the following criteria : retinal diseases other than namd , previous intravitreal injections , or a history of photodynamic therapy or laser photocoagulation .
the tenets of the declaration of helsinki were followed throughout the study , and written informed consent was obtained from all patients before the treatments were started .
data collected from the patients ' records included age , gender , type of choroidal neovascularization ( cnv ) ( predominantly or minimally classic or occult ) , bcva , and central retinal thickness ( crt ) before treatment , at months 3 , 6 , 9 , and 12 during treatment , and at the most recent follow - up examination .
all patients underwent a standardized examination including measurement of bcva via the early treatment diabetic retinopathy study ( etdrs ) chart at 4 meters , slit - lamp biomicroscopy and fundus examination and measurement of intraocular pressure ( iop ) via applanation tonometry .
fundus photography , fluorescein angiography ( hra-2 , heidelberg engineering , heidelberg , germany ) , and optical coherence tomography ( oct ) imaging ( stratus oct tm , carl zeiss meditec inc . ,
all examinations were repeated monthly , except fluorescein angiography , which was repeated only when the cause of visual acuity deterioration could not be clarified with the clinical examination and other imaging methods .
oct was used for detecting subretinal fluid and measurement of crt , the latter being defined as the mean thickness of the neurosensory retina in the central 1 mm diameter region , computed via oct mapping software provided with the device .
all injections were performed under sterile conditions after topical anesthesia , and 10% povidone - iodine scrub ( betadine , purdue pharma , stamford , ct , usa ) was used on the lids and lashes , and then 5% povidone - iodine was administered on the conjunctival sac .
intravitreal bevacizumab ( avastin , genentech , south san francisco , ca , usa ) or ranibizumab ( lucentis , novartis , basel , switzerland ) was injected with a 30-gauge needle through the pars plana at 3.5 mm to 4 mm posterior to the limbus .
patients were then instructed to consult the hospital if they experienced decreased vision , eye pain , or any new symptoms . for the first three months of treatment ,
all patients received monthly doses of bevacizumab , or ranibizumab ( 1.25 mg/0.05 ml for bevacizumab , 0.5 mg/0.05 ml for ranibizumab ) .
the patients were then examined monthly and were retreated if they met any of the following criteria : visual loss of 1 or more lines , newly developed macular hemorrhage , evidence of cnv enlargement on examination or fluorescein angiography , any amount of persistent subretinal fluid one month after an injection .
visual loss of 1 or more lines , newly developed macular hemorrhage , evidence of cnv enlargement on examination or fluorescein angiography , any amount of persistent subretinal fluid one month after an injection .
visual acuity was converted to logarithm of minimum angle of resolution ( logmar ) for statistical analysis .
the changes in bcva and crt over time were analyzed with paired sample t - test .
chi - square test was used to compare nominal parameters between the groups , and independent sample t - test was used for continuous parameters .
the statistical analysis was performed using spss version ( version 15.0 , spss inc . ,
the bevacizumab group consisted of 79 patients , and the ranibizumab group consisted of 74 patients .
the general characteristics of the patients were similar between the two groups ( table 1 ) .
the mean bcva of the patients in the bevacizumab group at baseline , months 3 , 6 , 9 , 12 , and at the most recent followup was 1.02 0.46 logmar ( range 0.12.1 logmar ) , 0.86 0.46 logmar ( range 0.22.1 logmar ) , 0.83 0.43 logmar ( range 0.22.1 logmar ) , 0.82 0.43 logmar ( range 0.22.1 logmar ) , 0.82 0.42 ( range 0.22.1 logmar ) , and 0.83 0.43 ( range 0.22.1 logmar ) , respectively .
the mean bcva of the patients in the ranibizumab group at baseline , months 3 , 6 , 9 , 12 , and at the most recent followup was 0.97 0.46 logmar ( range 0.12.1 logmar ) , 0.83 0.47 logmar ( range 0.11.8 logmar ) , 0.81 0.47 logmar ( range 0.01.8 logmar ) , 0.81 0.42 logmar ( range 0.11.8 logmar ) , 0.82 0.43 ( range 0.01.8 logmar ) , and 0.82 0.47 ( range 0.02.1 logmar ) , respectively ( figure 1 ) .
the change in mean bcva from baseline to months 3 , 6 , 9 , 12 , and the most recent followup was statistically better in both of the groups ( p < 0.05 , for all ) .
however , there was not a statistically significant difference between the two groups in regards of change in bcva at all of the time points ( p = 0.7 for month 3 , p = 0.6 for month 6 , p = 0.5 for month 9 , p = 0.5 for month 12 , and p = 0.6 for the most recent followup ) ( table 2 ) . at the most recent followup , 34 of the 79 patients ( 43.0% ) in the bevacizumab group and 30 of the 74 patients ( 40.5% ) in the ranibizumab group gained va 3 lines ( p = 0.4 ) .
sixty - eight of the 79 patients ( 86.1% ) in the bevacizumab group and 64 of the 74 patients ( 86.5% ) in the ranibizumab group had stable or improved vision ( loss of < 3 lines , remained stable , or gained 1 lines ) ( p = 0.5 ) .
eleven of the 79 patients ( 13.9% ) in the bevacizumab group and 10 of the 74 patients ( 13.5% ) in the ranibizumab group had va loss 3 lines ( p = 0.5 ) .
the mean crt in the bevacizumab group at baseline , and at months 3 , 6 , 9 , and 12 , and at the most recent followup was 335 120 m ( range 180758 m ) , 289 118 m ( range 106796 m ) , 266 79 m ( range 140558 m ) , 260 93 m ( range 148713 m ) , 266 100 ( range 150789 m ) , and 262 124 ( range 103979 m ) , respectively .
the mean crt in the ranibizumab group at the baseline , and at months 3 , 6 , 9 , and 12 , and at the most recent followup was 315 88 ( range 139681 m ) , 250 68 m ( range 133487 m ) , 243 63 m ( range 135410 m ) , 254 72 m ( range 135540 m ) , 247 60 ( range 140415 m ) , and 256 73 ( range 130483 m ) , respectively ( figure 2 ) .
the mean crt at months 3 , 6 , 9 , and 12 , and at the most recent followup was statistically different compared to baseline in both of the groups ( p < 0.05 for all ) .
however , the change in mean crt from the baseline to months 3 , 6 , 9 , and 12 , and at the most recent follow - up was not statistically different between the two groups ( p = 0.2 , p = 0.8 , p = 0.3 , p = 0.9 , and p = 0.2 , resp . ) ( table 3 ) .
the mean number of injections at month 12 was 4.8 1.2 ( range 37 ) in the bevacizumab group and 4.7 1.4 ( range 38 ) in the ranibizumab group , and the difference was not statistically significant between the two groups ( p = 0.8 ) .
the mean baseline intraocular pressure ( iop ) was 15.5 2.3 mm hg ( range 919 mm hg ) and 15.4 1.7 ( range 1220 mm hg ) in the bevacizumab and ranibizumab groups , respectively ( p = 0.7 ) .
the mean iop at the most recent followup was 15.3 2.4 mm hg ( range 1022 mm hg ) and 15.6 2.1 ( range 1122 mm hg ) , in the bevacizumab and ranibizumab groups , respectively ( p = 0.4 ) .
no serious ocular or systemic complications were observed in any of the patients . only mild complications like punctate keratitis , subconjunctival hemorrhage , and transient mild anterior uveitis
functional and anatomical outcomes of namd patients treated with bevacizumab and ranibizumab in a population of turkish patients were reported in this study . in both of the groups ,
the mean bcva and crt were significantly better than that in baseline at every time point .
the two groups were parallel to each other with respect to change in bcva and crt , injection numbers , and complications . in previous clinical studies , these two drugs , bevacizumab or ranibizumab ,
have been found to provide similar improvements in visual and anatomical outcomes to our study [ 13 , 1620 ] . a short term efficacy and safety study by landa et al .
reported that bevacizumab and ranibizumab treatments resulted in similar improvements in visual and anatomical outcomes one month after an intravitreal injection in patients with namd .
they also stated that bevacizumab was as safe as ranibizumab . in a retrospective study by feng et al .
, 371 namd patients who were treated with intravitreal bevacizumab or ranibizumab on an as - needed treatment regimen were evaluated .
they reported that , after a median follow - up time of 12 months , 24.5% of patients in the bevacizumab group and 25.8% of patients in the ranibizumab group had a gain of 15 or more letters ; in addition , 79.5% of the patients in the bevacizumab group , and 84.9% of the patients in the ranibizumab group lost fewer than 15 letters in visual acuity .
they stated that there was not a statistical difference in regards of visual acuity changes between the two groups .
we also did not find any difference in visual acuity change at different time points between the bevacizumab and ranibizumab groups .
and the rate of the patients who were stable in regards of visual acuity results was very similar to the study by feng et al .
reported that bevacizumab and ranibizumab were both effective in stabilizing visual acuity in namd patients after 12 months of followup . in the aforementioned study
, it was reported that visual acuity outcomes were similar between the two drugs ; 27.3% of the patients in the bevacizumab and 20.2% of the patients in the ranibizumab group were reported to have an improvement of three or more lines in visual acuity , and the difference between the groups was not found to be statistically significant .
the mean injection numbers at month 12 were 4.4 in the bevacizumab group and 6.2 in the ranibizumab group which were statistically different between the groups .
the mean injection numbers at month 12 were similar to our study ; however , we did not find a difference between the two groups . in a retrospective study concerning the efficacy of bevacizumab and ranibizumab in namd by bellerive et al .
, the mean visual acuity improvement at month 12 was greater in the ranibizumab group than the bevacizumab group .
they stated that the proportion of occult lesions were greater in the bevacizumab group than the ranibizumab group and postulated that this trend might be explained by this variability .
also the proportion of the patients who lost fewer than 0.3 logmar was reported to be 83% in the bevacizumab group and 92 in the ranibizumab group , with a mean number of injections of 4.7 in the bevacizumab group and 4.9 in the ranibizumab group at month 12 .
the visual acuity outcomes and the mean injection numbers of the study were comparable with our study .
however , the visual and anatomical outcomes were similar between the groups in our study .
the catt study was designed as a multicenter , noninferiority trial to compare the efficacy and safety of bevacizumab and ranibizumab . in the study ,
both monthly and as - needed treatment regimens were evaluated within and between the two drugs . at first year , it was reported that there was not a significant difference between the two drugs in regards of visual acuity and anatomical outcomes and the mean injection numbers . at month 12
, as - needed bevacizumab was found to be equivalent to as - needed ranibizumab with a gain of 5.9 etdrs letters and 6.8 etdrs letters in visual acuity , respectively . at month 12 , the eyes treated with as - needed bevacizumab and ranibizumab showed a significant decrease in crt , and the difference was not statistically significant between the bevacizumab groups and ranibizumab groups .
the mean injection numbers of as - needed bevacizumab group and as - needed ranibizumab group were 7.7 and 6.9 at month 12 , respectively .
the two - year results of the study were similar to the first - year results ; however the mean gain in visual acuity was found to be greater in monthly groups than as - needed groups .
the study also addressed the safety issue and adverse events between the two drugs . at 2 years , it was reported that 6.1% of the patients in the bevacizumab group and 5.3% of the patients in the ranibizumab group had died .
the proportion of the patients with atherothrombotic events and venous thrombotic events were similar between the two groups .
the rate of serious adverse events was found to be greater in the bevacizumab groups than the ranibizumab groups with a cumulative risk ratio of 1.30 ; however , this difference was not found to be statistically significant .
in addition , the studies which addressed the safety issues of bevacizumab and ranibizumab showed that this issue still remains as a debate [ 2123 ] .
strengths of the study include the fact that patients in the bevacizumab and ranibizumab groups had received no other forms of treatment and similar baseline characteristics of the two groups . in summary , in the present study we found that 86.1% of the patients in the bevacizumab group and 86.5% of the patients in the ranibizumab group had a stable or improved visual acuity after a mean follow - up time of approximately 18 months .
the visual and anatomical outcomes and the number of injections were similar between the two drugs .
the patients with namd treated with as - needed bevacizumab or as - needed ranibizumab showed significant improvements in visual acuity throughout at least 1.5 years compared to baseline visual acuity . |
purpose . to compare the efficacy of intravitreal bevacizumab versus ranibizumab in the treatment of neovascular age - related macular degeneration ( namd )
.
methods .
retrospective , comparative study .
the newly diagnosed namd patients who were treated with intravitreal bevacizumab or ranibizumab on an as - needed treatment regimen were included in the study .
main outcome measures were the change in best corrected visual acuity ( bcva ) , and central retinal thickness ( crt ) .
secondary outcome measures were the number of injections , and complications .
results .
a total of 154 patients were included in the study .
bevacizumab group consisted of 79 patients , and ranibizumab group consisted of 74 patients .
mean follow - up time was 18.9 months , and 18.3 months in the bevacizumab and ranibizumab groups , respectively .
there was not a significant difference between the two groups regarding the change in bcva and crt at all time points ( p > 0.05 for all ) .
the mean number of injections at month 12 was 4.8 and 4.7 in bevacizumab and ranibizumab groups , respectively ( p > 0.05 ) .
no serious complications were detected in any of the groups .
conclusion . both of the bevacizumab and ranibizumab found to be effective in the treatment of namd in regards of functional and anatomical outcomes with similar number of treatments and similar side effects .
| 1. Introduction
2. Material and Methods
3. Results
4. Discussion |
during the iraq - iran war ( 19801988 ) , the iranian troops and some ordinary people were attacked 387 times , by more than 1800 tons of sulfur mustard ( sm ) gas by the iraqi armies .
consequently , over 100,000 military or civilian people were exposed to sm , and thus a considerable proportion of exposed people are still suffering from the long - term consequences of exposure such as respiratory , ocular , and dermatology problems . as well , sm was used as a chemical weapon by the iraqi armies against indigenous iraqi kurds .
the carcinogenic effect of sm has already been evaluated in laboratory and human being studies .
sm is a nucleophilic and lipophilic agent and due to this property , it can diffuse through the body and can change dna structure .
these dna changes are involved in producing acute toxicity as well as long - term carcinogenicity of sm .
alkylation reaction disrupts dna replication and protein synthesis by replacing hydrogen by an alkyl group which is the equivalent of an alkyl anion ( carbanion ) .
the changes created by sm in the dna base explain the mutagenic and carcinogenic of sm . according to the international agency for research on cancer report in 1975 ,
although sm has been considered as a carcinogen in the laboratory studies , its carcinogenic effects , particularly on acute situations , have not been well discussed yet .
the aim of this study was to review the published articles discussing on human cancers in relation to sm acute and/or chronic exposures .
during a systematic search , we used pubmed , scopus , web of science , iranmedex , and irandoc to evaluate the international and national medical databases . two hundred and ninety - six records were extracted , and their contents were subsequently reviewed .
the inclusion criteria were published the original articles in valued journals indexed in the above - mentioned databases .
all of the original papers which studied acute or chronic carcinogenic consequences of sm were included .
most of the studies had focused on respiratory , dermatological , and ophthalmological complications . after title and abstract screening , 11 articles were found relevant to the aim of this study and their full - texts were subsequently evaluated .
the study was carried out in accordance with the principles of the ethics review board of tehran university of medical sciences .
the studies which considered the associations between various cancers and occupational chronic exposure of mustard gas are summarized in table 1 .
the results of some studies evaluated the carcinogenicity of sulfur mustard in occupational condition among sulfur mustard factory workers there was an increased mortality resulted from oral cavity cancers in the workers who had chronic exposure to mustard gas .
easton et al . , in a cohort study , conducted on 2498 men and 1032 women , found a strong relationship between exposure to sm and cancers of the lip , tongue , salivary glands , and mouth .
the association between laryngeal and tracheal cancers was reported by manning et al . among sm
doi et al . compared 480 exposed with 969 unexposed workers in an sm factory in japan from 1929 to 1945 .
they concluded that the workers were at risk of developing lung cancer . as well , mortality of lung cancer in exposed workers significantly increased in comparison to unexposed ones .
moreover , easton et al . in their study found a strong relationship between sm exposure and lung cancer .
bowen 's carcinoma ( squamous cell carcinoma in situ ) was reported due to occupational exposure to mustard gas by inada et al . the studies which evaluated the relationship between acute sm exposure and various cancers are summarized in table 2 .
the results of some studies evaluated the carcinogenicity of sulfur mustard in iranian veterans after iraq - iran war zafarghandi et al . conducted a cohort study and compared the incidence rates of malignancies in 7570 veterans who exposed to sm and 7595 unexposed people in a 25-year follow - up period .
although they found an increased age - specific incidence rate of cancer in the exposed rather than unexposed population , no evidence of increased age - adjusted incidence rate of specific cancer types was found .
conducted a molecular study on 20 iranian male patients with lung cancer who had a history of single high - dose exposure to sm during iraq - iran war . considering dna sequence analysis , some of the patients showed mutations related to sm .
their study showed that single high - dose exposure to this agent could relate to lung cancer .
zakeri nia et al . studied 3000 veterans from the fars province in iran more than 15 years post their exposure to mustard gas .
they evaluated relative risks ( rrs ) of aplastic anemia and hematologic malignancies and reported that exposure to mustard gas caused aplastic anemia ( rr = 19 ) and blood malignancies including acute nonlymphocytic leukemia ( rr = 8) , acute lymphocytic leukemia ( rr = 11 ) , chronic myeloid leukemia ( cml ) ( rr = 8) , hairy cell leukemia ( rr = 11 ) , hodgkin 's lymphoma ( rr = 5 ) , non - hodgkin 's lymphoma ( rr = 2 ) , and intestinal mediterranean lymphoma ( rr = 13 ) .
ghanei and vosoghi evaluated the leukocyte alkaline phosphatase ( lap ) activity of 665 chemically injured veterans and performed further cytochemical studies on the positive cases . among the victims , nine cases had a decreased lap , and two of them suffered from a cml .
they reported a higher incidence of cml among the veterans exposed to mustard gas rather than normal population .
davoudi et al . evaluated 9,605 chemically injured veterans 1015 years after their exposure to sm from 17 provinces of iran in 2006 .
although they found four cases of basal cell carcinoma ( bcc ) among the victims , there was no statistically significant difference between the patients and the general population . in another study , mortazavi et al .
they found only one case of bcc and one case of squamous cell carcinoma among the veterans .
the studies which considered the associations between various cancers and occupational chronic exposure of mustard gas are summarized in table 1 .
the results of some studies evaluated the carcinogenicity of sulfur mustard in occupational condition among sulfur mustard factory workers
there was an increased mortality resulted from oral cavity cancers in the workers who had chronic exposure to mustard gas .
easton et al . , in a cohort study , conducted on 2498 men and 1032 women , found a strong relationship between exposure to sm and cancers of the lip , tongue , salivary glands , and mouth .
the association between laryngeal and tracheal cancers was reported by manning et al . among sm
doi et al . compared 480 exposed with 969 unexposed workers in an sm factory in japan from 1929 to 1945 .
they concluded that the workers were at risk of developing lung cancer . as well , mortality of lung cancer in exposed workers significantly increased in comparison to unexposed ones .
moreover , easton et al . in their study found a strong relationship between sm exposure and lung cancer .
bowen 's carcinoma ( squamous cell carcinoma in situ ) was reported due to occupational exposure to mustard gas by inada et al .
the studies which evaluated the relationship between acute sm exposure and various cancers are summarized in table 2 .
the results of some studies evaluated the carcinogenicity of sulfur mustard in iranian veterans after iraq - iran war zafarghandi et al . conducted a cohort study and compared the incidence rates of malignancies in 7570 veterans who exposed to sm and 7595 unexposed people in a 25-year follow - up period .
although they found an increased age - specific incidence rate of cancer in the exposed rather than unexposed population , no evidence of increased age - adjusted incidence rate of specific cancer types was found .
conducted a molecular study on 20 iranian male patients with lung cancer who had a history of single high - dose exposure to sm during iraq - iran war . considering dna sequence analysis , some of the patients showed mutations related to sm .
their study showed that single high - dose exposure to this agent could relate to lung cancer .
zakeri nia et al . studied 3000 veterans from the fars province in iran more than 15 years post their exposure to mustard gas .
they evaluated relative risks ( rrs ) of aplastic anemia and hematologic malignancies and reported that exposure to mustard gas caused aplastic anemia ( rr = 19 ) and blood malignancies including acute nonlymphocytic leukemia ( rr = 8) , acute lymphocytic leukemia ( rr = 11 ) , chronic myeloid leukemia ( cml ) ( rr = 8) , hairy cell leukemia ( rr = 11 ) , hodgkin 's lymphoma ( rr = 5 ) , non - hodgkin 's lymphoma ( rr = 2 ) , and intestinal mediterranean lymphoma ( rr = 13 ) .
ghanei and vosoghi evaluated the leukocyte alkaline phosphatase ( lap ) activity of 665 chemically injured veterans and performed further cytochemical studies on the positive cases . among the victims , nine cases had a decreased lap , and two of them suffered from a cml .
they reported a higher incidence of cml among the veterans exposed to mustard gas rather than normal population .
davoudi et al . evaluated 9,605 chemically injured veterans 1015 years after their exposure to sm from 17 provinces of iran in 2006 .
although they found four cases of basal cell carcinoma ( bcc ) among the victims , there was no statistically significant difference between the patients and the general population . in another study ,
mortazavi et al . assessed 800 chemically injured veterans 1430 years after exposure in 2005 .
they found only one case of bcc and one case of squamous cell carcinoma among the veterans .
sm can increase the cytotoxic t - cells and reduce natural killer cells ( nkcs ) .
animal studies have shown a critical role for nkcs in controlling tumor growth and metastasis providing new insights into the treatment of human cancers .
shaker et al . showed that the immune system of the chemically injured people was still impaired 10 years after exposure to sm . regarding the reviewed studies and existing evidence , the relationship between chronic exposure to sm and incidence of various cancers can not be ignored .
ghanei and harandi have confirmed this idea for lung cancers and mentioned that sm is an alkylating agent with potentially carcinogenic property in the respiratory tract .
balali - mood and hefazi also mentioned bronchogenic carcinoma as a late complication of sm .
likewise , they reported bcc , bowen 's carcinoma , and spinocellular skin cancer due to chronic exposure to mustard gas .
we believe that when we are going to justify the relationship between acute exposure to sm and various cancers , one should be more cautious . indeed , only a few original studies found such a relationship .
for instance , although zafarghandi et al . found the increased age - specific incidence rates of cancer , their results showed no evidence of increased age - adjusted incidence rate for specific cancer types .
similarly , hosseini - khalili et al . conducted a molecular study on only 20 veterans .
they also mentioned that their results should be cautiously interpreted due to some confounding factors within their study .
accordingly , davoudi et al . did not find any statistically significant difference between 9605 chemically injured veterans and general population according to bcc prevalence .
furthermore , mortazavi et al . found only one case of scc and one case of bcc among 800 veterans .
one follow - up study conducted in 1955 on soldiers who were exposed to sm during the world war i showed that mustard gas had no effect on the development of lung cancer .
they compared some variables between the two groups such as the history of attending in chemical war by the patients fathers .
seven patients in the case group and three patients in the control group had such a history .
they showed a significant odds ratio ( 4.9 ) of acute leukemia among the cases compared to the controls .
furthermore , nik siyar et al . compared 237 chemically injured and 202 healthy individuals showed that two hematologic indicators , hypogranulated neutrophils ( the g - score ) and percentage of polaroid cells , were significantly more among exposed people to sm than healthy individuals .
they suggested that the exposed people should be followed up for myelodysplastic syndromes in future .
reported a case of merkel cell carcinoma ( mcc ) in the place of mustard scar , 21 years after the exposure .
considering our results although mustard gas is a proven carcinogenic agent in chronic situations , there are conflicting views in relation to the carcinogenicity of acute exposure to this substance .
this review pulls together a broad array of data in an attempt to address whether acute sm exposure enhances long - term cancer risk among the survivors or not .
however , confirming this idea is very difficult because cancer takes years / decades to develop , complicating the ability to directly link cancer onset with sm exposure .
in addition , to prove any causal inference , we need vigorous evidence based on principles such as bradford hill 's criteria . at present , there is no sufficient evidence to substantiate such a relationship to underlying an increased cancer risk among sm survivors with a history of acute exposure to sm .
the relationship between chronic exposures to mustard gas and some types of cancers are well- documented so far .
the cancers occur through long - term and continuous exposure rather than an acute single - dose exposure . | background : sulfur mustard ( sm ) has been considered as a carcinogen in the laboratory studies . however , its carcinogenic effects on human beings were not well discussed .
the main purpose of our study is to assess carcinogenesis of sm following acute and/or chronic exposures in human beings.methods:the valid scientific english and persian databases including pubmed , web of science , scopus , iranmedex , and irandoc were searched and the collected papers reviewed .
the used keywords were in two languages : english and persian .
the inclusion criteria were the published original articles indexed in above - mentioned databases .
eleven full - texts out of 296 articles were found relevant and then assessed.results:studies on the workers of the sm factories during the world wars showed that the long - term chronic exposure to mustards can cause a variety of cancers in the organs such as oral cavity , larynx , lung , and skin .
respiratory system was the most important affected system .
acute single exposure to sm was assumed as the carcinogenic inducer in the lung and blood and for few cancers including basal cell carcinoma and squamous cell carcinoma.conclusions:sm is a proven carcinogen in chronic situations although data are not enough to strongly conclude in acute exposure . | INTRODUCTION
METHODS
RESULTS
Chronic exposure
Oral cavity
Lung cancers
Skin cancers
Acute exposure
Lung cancers
Hematologic malignancies
Skin cancers
DISCUSSION
CONCLUSIONS
Financial support and sponsorship
Conflicts of interest |
asthma is a complex and heterogenous disease characterized by various immunopathologic and clinical phenotypes , based on different patterns of airway inflammation involving immune / inflammatory cell types , such as t and b lymphocytes , mast cells , eosinophils , basophils , neutrophils , monocytes / macrophages , and dendritic cells , as well as structural cellular elements , including both epithelial and mesenchymal cells.1,2 this widespread respiratory disease , which originates from multiple interactions between genetic factors and environmental agents , such as allergens , respiratory viruses , and airborne pollutants , is characterized by recurrent episodes of dyspnea , wheezing , chest tightness , and cough , usually associated with reversible airflow limitation and an exaggerated bronchoconstrictive response to several different stimuli ( airway hyper - responsiveness ) .
asthma constitutes a heavy medical , social , and economic burden , and its prevalence is steadily increasing worldwide.3 indeed , asthma affects over 300 million people around the world , and some epidemiologic projections estimate that this number will increase further during the next few decades.4 although good control of asthma symptoms can be achieved in a large proportion of patients by current standard therapies , mainly based on combinations of inhaled corticosteroids and 2-adrenoceptor agonists,5,6 a small percentage ( about 5%10% ) of asthmatic subjects who are affected by the most severe forms of the disease , although receiving the best available inhaled treatments , remain symptomatic and inadequately controlled , thus having a poor quality of life . in these patients ,
asthma symptoms can be further worsened by concomitant comorbidities , including rhinitis , sinusitis , gastroesophageal reflux , obesity , and obstructive sleep apnea.7 patients with uncontrolled asthma have a high risk of serious morbidity and mortality , thereby representing the most severe sector of the overall phenotypic asthma spectrum , characterized by the greatest unmet medical needs.8 therefore , although being a minority of the global asthmatic population , patients with severe asthma are those who use the largest share of economic resources and health care services , including emergency visits , hospitalizations , and additional consumption of drugs utilized for recurrent exacerbations .
a further social and economic impact of difficult - to - treat asthma arises from the frequent loss of school and work days due to such a disabling condition .
moreover , patients with severe asthma often show a tendency to anxiety and depression , which can further impair disease control by reducing their compliance with prescribed medications .
ige antibodies are crucially involved in mediating , maintaining , and amplifying the allergic cascade.9 similar to the other antibody classes , the ige structure consists of two variable antigen - binding fragments and a receptor - binding constant portion ( fc ) . in particular , the ige molecule ( molecular weight 190 kd ) comprises two identical light chains , each made of a variable ( vl ) and a constant domain ( cl ) , as well as two identical heavy chains , each including a single - domain variable region ( vh ) and a constant region containing four domains ( c1 , c2 , c3 , c4 ) .
ige binds to its high affinity fcri receptor , expressed as an 2 tetramer on mast cells and basophils , and as an 2 trimer on human antigen - presenting cells , monocytes , eosinophils , platelets , and smooth muscle cells.10 the ige - binding function of fcri is located within the two extracellular domains of its chain , which interact with the two c3 domains of ige , whereas the intracellular -chains and -chains are involved in signal transduction . at the level of the mast cell surface ,
adjacent allergenic epitopes induce the aggregation of two or more fcri - bound ige molecules ( cross - linking ) , thus triggering mast cell degranulation .
it is well - known that the propensity to develop exaggerated ige responses to common environmental allergens , referred to as atopy , plays a dominant role in the pathologic features and clinical manifestations of allergic asthma .
therefore , given the key importance of ige in the immunoinflammatory mechanisms underlying atopic asthma , such a condition can greatly benefit from ige - targeted therapies.1014 in particular , according to various studies ige - mediated positive reactions to skin prick tests for common aeroallergens are detectable in a percentage of severe asthmatics , ranging from about 50%80%.8,15,16 for all these reasons , anti - ige therapy was included in 2006 within step 5 of the global initiative for asthma guidelines17 as add - on treatment to inhaled and eventually oral corticosteroids , long - acting 2-agonists , and other controller medications , such as leukotriene - modifiers and theophylline . after being introduced in australia in 2002 and us in 2003 , utilization of omalizumab , an anti - ige monoclonal antibody ,
was also approved in 2005 by the european medicines agency as add - on therapy to improve asthma control in adult and adolescent patients ( 12 years of age and above ) with severe persistent allergic asthma , who have an impaired lung function ( forced expiratory volume in 1 second [ fev1 ] < 80% predicted ) and experience frequent daytime symptoms and/or nocturnal awakenings , associated with multiple severe exacerbations despite daily high doses of inhaled corticosteroids and long - acting 2-adrenoceptor agonists .
more recently , the use of omalizumab has also been approved by european medicines agency for children aged 6 years and older.18 on the basis of such considerations , the aim of this review is to discuss the basic pharmacology and clinical use of omalizumab .
omalizumab ( molecular weight 150 kd ) is a recombinant humanized antibody comprising a human igg framework which embeds the complementarity - determining region obtained from an anti - ige antibody raised in mice.19 consequently , only about 5% of the humanized monoclonal anti - ige antibody includes residues of murine origin , and these structural features of course minimize the risk of developing an immune response towards the nonself protein .
in particular , one ige molecule has two antigenic sites for omalizumab , and can thus be bound by two drug molecules at the same time ; similarly , one omalizumab molecule has two antigen - binding loci ( vh vl domains of igg ) , and can thereby interact with two ige molecules at the same time.21 therefore , binding of omalizumab to free ige results in the formation of ige / anti - ige complexes , which can exist as trimers ( molecular weight of about 500 kd ) or , less frequently , as examers ( molecular weight about 1000 kd).22 the small dimensions of these biologically inert ige / anti - ige immune complexes contribute significantly to their safety .
indeed , ige / omalizumab aggregates are soluble , do not bind complement , and do not precipitate in the kidney , thus they do not cause immune complex - related diseases.23 these ige / anti - ige complexes are easily cleared from the circulation by the reticuloendothelial system , through the interaction of their igg component with the fc receptors of the hepatic sinusoidal endothelial cells.22 ige , as well as the igg omalizumab , can freely cross capillaries , thereby distributing between the vascular and the extravascular compartments . on the contrary , the ige / omalizumab aggregates do not diffuse through capillary walls and are also characterized by a marked stability , due to the high affinity of omalizumab for ige . because of these features , ige / omalizumab immune complexes remain and accumulate where they are generated , namely in either the blood circulation or local tissues , such as the airways and nasal mucosa.21 the c3 domain of ige is the binding site shared by both fcri and fcrii / cd23 receptors.24 the latter , expressed by b lymphocytes , monocytes , eosinophils , and epithelial cells , are structurally characterized by an extracellular trimeric -helical coiled - coil stalk , three c - type lectin head domains , and the c - terminal tails.10
the head domain interacts with the outer side of an ige c3 domain in a ca- dependent manner.21 the main consequences of fcrii / cd23 activation include upregulation of ige synthesis and facilitation of b cell - operated antigen presentation to t lymphocytes .
therefore , the interaction of omalizumab with ige will prevent the latter from binding to both fcri and fcrii / cd23 expressed by several different cell types ( figure 1 ) , thus interrupting the allergic cascade.21 this implies that omalizumab can interfere with biological functions mediated by the stimulation of both high - affinity and low- affinity ige receptors .
blocking ige binding to fcri on mast cells and basophils inhibits allergen - induced degranulation , thus preventing histamine and tryptase release , and also affects lipid mediator production and cytokine / chemokine gene expression .
moreover , blocking ige binding to fcri receptors also reduces fcri expression on basophils by approximately 97% , which correlates with a decrease in responsiveness of basophils and mast cells to antigen challenge.20 it can thus be inferred that ige is able to upregulate the synthesis of its own high - affinity receptors .
furthermore , binding of omalizumab to circulating ige reduces free serum ige levels by 96%99%.25 omalizumab may also be able to suppress new ige production , probably by inhibiting ige interactions with the fcrii / cd23 receptors expressed on ige - switched b cells .
a further mechanism contributing to the reduction of ige synthesis may be secondary to an omalizumab - dependent decrease in the production of ige - switching cytokines , such as interleukin-4 and interleukin-13 .
in addition to binding omalizumab , ige molecules within the immune complexes formed by this drug can still bind allergens ( at the vl vh domains ) , thereby neutralizing some of the antigenic stimuli.20 in fact , omalizumab - linked ige antibodies can not interact further with their receptors , thus potentially acting as protective agents against incoming allergens , which in this way will be trapped and prevented from reaching residual fcri - bound ige on mast cells . furthermore , by inhibiting ige binding to fcri receptors expressed on dendritic cells , omalizumab can reduce the efficiency of antigen presentation to t lymphocytes .
omalizumab can not bind to receptor - bound ige and , consequently , does not mimic the ige cross - linking induced by allergens , thus being largely nonanaphylactogenic in clinical use .
the dosage of omalizumab can be determined by taking into consideration serum baseline levels of total ige and the patient s body weight.26 indeed , by matching these two parameters according to the currently available dosing tables , it is possible to achieve , with regard to the omalizumab / ige ratio , the large molar excess ( ranging from about 7:1 to approximately 15:1 ) required to optimize the efficacy of anti - ige therapies .
utilization of omalizumab is currently approved only for allergic asthmatic patients with total plasma ige levels ranging from 30 to 1500 ( european union ) or from 30 to 700 ( us ) iu / ml , and dosing tables approximately reflect the use of the following formula : 0.016 mg / kg per iu / ml of ige per 4 weeks .
after subcutaneous administration , omalizumab achieves a bioavailability of 62% , then reaches its peak serum concentration within 78 days and has a half - life of 1922 days.27 omalizumab binds circulating free ige regardless of antigen specificity , thereby being potentially useful for atopic disorders caused by either perennial or seasonal allergens , as well as by multiple sensitizations.28 unlike ige , which has a half - life of 12 days in humans , omalizumab circulates similarly to human igg1 antibodies , with a half - life of about 21 days even when it binds ige thus forming trimeric or exameric complexes.29 due to these pharmacokinetic properties , omalizumab is usually administered subcutaneously every 4 weeks .
shorter intervals are chosen only for practical reasons when patients require relatively high drug doses .
in fact , because each vial of omalizumab contains 150 mg , in order to avoid multiple subcutaneous injections at the same time , subjects needing more than 300 mg monthly are treated every 2 weeks . after a single subcutaneous injection ,
omalizumab induces an 84%99% reversible reduction of unbound serum ige , low levels of which last for 46 weeks.30 clinical responses to omalizumab treatment are variable and strictly individual .
currently , an overall physician s evaluation of the effects of omalizumab is recommended after 16 weeks of therapy.31 in this regard , bousquet et al have recently shown , basing their observations on physicians global evaluation of treatment effectiveness , that patient responsiveness to omalizumab detected at week 16 persisted at week 32.32 however , among 71 allergic asthmatics who did not exhibit a clinical response within the first 16 weeks of treatment with omalizumab added to optimized asthma therapy , 27 responded to omalizumab after a further 16 weeks of treatment .
this suggests that , by prolonging the initial observational time , it could be possible to extend the therapeutic benefits of omalizumab also to a subgroup of potential late responders ,
the first clinical studies showed that , after 9 weeks of treatment , omalizumab was able to inhibit both early and late asthmatic responses triggered by allergen inhalation.33 since then , several multicenter , randomized , double - blind , placebo - controlled phase iii trials have been carried out in adolescents and adults with moderate - to - severe asthma.3439 omalizumab has been given in addition to stable treatment with inhaled corticosteroids and other anti - asthma drugs .
taking together the results of these studies , fewer asthma exacerbations , improvements in asthma symptoms and quality of life , and decreased requirements for both inhaled corticosteroids and rescue bronchodilators were observed in patients treated with omalizumab compared with placebo.4042 moreover , in comparison with placebo - treated asthmatics , omalizumab - treated patients had fewer hospitalizations , unscheduled outpatient visits , and emergency room visits .
overall , patients who benefited most from omalizumab treatment were those with the poorest lung function , and receiving the highest inhaled corticosteroid doses .
therefore , omalizumab exerted its greatest effects in severe asthma , thus being particularly useful as an add - on treatment option for patients whose disease was not well controlled . in particular , the busse trial included patients with severe allergic asthma , whose disease exacerbations were significantly decreased by omalizumab during two study phases , including inhaled corticosteroid treatments with stable or reduced doses , respectively.34 in addition , a higher percentage of patients receiving omalizumab than those on placebo were able to reduce their inhaled corticosteroid intake .
these findings were also confirmed by solr et al and holgate et al , who enrolled subjects with moderate - to - severe allergic asthma whose symptoms were not well controlled by regular therapy with inhaled corticosteroids.35,36 the solar ( study of omalizumab in comorbid asthma and rhinitis ) study was designed to test the effects of omalizumab in concomitant allergic asthma and rhinitis.37 during a 28-week treatment with omalizumab , both adolescents and adults with moderate - to - severe asthma and moderate - to - severe persistent rhinitis were investigated .
omalizumab elicited significant improvements in quality of life related to both asthma and rhinitis , assessed by the asthma quality - of - life questionnaire and rhinitis quality - of - life questionnaire .
these results are very interesting because of the frequent association between asthma and rhinitis , two allergic diseases linked by reciprocal pathogenic connections .
one of the most important studies to evaluate the clinical effects of omalizumab was innovate ( investigation of omalizumab in severe asthma treatment).39 this study included 419 allergic patients aged 1275 years with severe persistent asthma , from 108 centers in 14 countries .
participating subjects had decreased lung function ( fev1 41%80% predicted at randomization ) , associated with a recent history of clinically significant exacerbations . in particular , patients had experienced an average of 2.1 exacerbations per year , and 67% were considered to be at risk of asthma - related mortality , assessed on the basis of emergency room visits , hospitalizations , or intubations in the previous year .
symptom control was not satisfactory , despite stable inhaled therapy with relatively high doses of corticosteroids and long - acting 2-agonists . in addition , an average of 31 school / work days had been missed in the previous year . following an 8-week run - in phase
, patients were randomized in a double - blind manner to receive 28 weeks of treatment with either omalizumab or placebo as add - on treatment to 2002 global initiative for asthma step 4 therapy .
the results of innovate show that , when compared with placebo ( 210 patients ) , omalizumab ( 209 patients ) significantly decreased the numbers of emergency visits , as well as severe asthma exacerbations requiring unscheduled systemic corticosteroids .
omalizumab also elicited a clinically meaningful improvement in quality of life , evaluated by the asthma quality - of - life questionnaire ( > 0.5 points ) .
furthermore , with respect to placebo , omalizumab produced significant improvements in both asthma symptom score and peak expiratory flow .
treatment with omalizumab was considered to be globally more effective than placebo by both the patients and the investigating physicians .
the efficacy of omalizumab in adults , adolescents , and children with moderate - to - severe asthma has been further confirmed by a recent meta - analysis of eight placebo - controlled studies in at least 3000 patients and published between 2001 and 2009.43 this systematic review considered reductions of steroid use and of asthma exacerbations as the primary outcomes ; secondary outcome measures included lung function , use of rescue medication , asthma symptoms , and health - related quality of life .
two further recent placebo - controlled trials have confirmed the efficacy of omalizumab . in the first one , including 850 patients aged 1275 years , hanania et al showed that , when compared with placebo , 48 weeks of treatment with omalizumab significantly decreased asthma symptoms and exacerbations , as well as the mean daily number of albuterol puffs.44 moreover , busse et al have recently shown in 419 inner city children , adolescents , and young adults with persistent allergic , moderate - to - severe asthma , that addition of omalizumab to guideline - based therapy for 60 weeks further improved asthma control , nearly eliminated seasonal peaks in exacerbations , and also reduced the need for inhaled corticosteroids.45 furthermore , the globally favorable pharmacodynamic pattern of omalizumab has also been corroborated by several phase iv postmarketing surveillance trials in patients affected by severe persistent allergic asthma treated with omalizumab for 512 months in real - life practice in france , germany , belgium , and italy.4650 one of the most important questions related to omalizumab therapy refers to its duration , ie , how long should this treatment last ?
given the unusual mechanism of action of omalizumab , a tentative answer could be forever .
indeed , after a few months of treatment , discontinuation of omalizumab in atopic subjects resulted in a return to the pretreatment clinical state , due to a relatively rapid ( within months ) rise in free serum ige levels , associated with repopulation of basophil surfaces with both ige and fcri receptors.51 more recently , it has also been shown that either a dose reduction of omalizumab therapy or its complete cessation leads to increases towards baseline levels of both free serum ige concentrations and allergen - specific skin prick test reactivity , evaluated as wheal - and - flare reactions.52 medical practice also suggests that if omalizumab treatment is interrupted for whatever reason , asthma symptoms and exacerbations relapse within a few months .
however , it has been reported that 6 years of treatment with omalizumab induce durable improvement in asthma symptoms and lung function , which was maintained in 14 of 18 patients for periods of 1214 months after drug withdrawal.53 this persistent asthma control was paralleled by a downregulation in basophil activity , still detectable 1 year after interruption of omalizumab administration .
this report suggests that anti - ige therapy can induce long - term remission of the allergic state , possibly by inhibiting ige production and depleting ige - committed b memory cells.21 of course , further studies are required to verify whether omalizumab should be prescribed lifelong or as a relatively long - term course .
although the optimal duration of omalizumab treatment remains unclear , there is no doubt that the injections need to be continued for very long periods of time .
however , if omalizumab treatment is restricted to selected patients with severe persistent and uncontrolled allergic asthma , who respond within 16 weeks with a marked improvement in disease control , this therapy could be cost - effective.40 this inference from clinical practice has been confirmed by an analysis of the incremental cost - effectiveness ratio of adding omalizumab to standard therapy,54 based on data obtained from the real - life , 1-year randomized etopa trial.38 to determine the incremental cost - effectiveness ratio for omalizumab , the cost / quality - adjusted life year ratio was calculated .
canada was used as the reference country , and only subjects receiving high doses of inhaled corticosteroids plus long - acting 2-agonists were considered . based on these reliable criteria , the authors of this analysis concluded that omalizumab add - on therapy in patients with severe persistent asthma results in a cost - per - qaly ratio that compares favorably with other uses of scarce healthcare resources that are recommended by national reimbursement bodies and could be considered cost - effective.54 however , this analysis referred to a small open - label study , and was limited to asthmatic subjects who were responsive to omalizumab .
the results obtained from the multinational innovate study appear to be more reliable , and show that the cost of omalizumab was offset by improved quality of life and had an attractive incremental cost - effectiveness ratio in patients with severe allergic asthma who remained symptomatic and had an increased risk of acute exacerbations despite best available standard care.55,56 on the other hand , further comparative economic evaluations of the cost - effectiveness of omalizumab have confirmed that , in patients with severe persistent allergic asthma , add - on therapy is comparable with or more favorable than other biologic treatments for chronic disorders , such as rheumatoid arthritis , crohn s disease , and multiple sclerosis.57 these considerations are consistent with the conclusions of a more recent study , the results of which suggest that , from the us payer perspective , the cost - effectiveness of omalizumab may be similar to other biologics .
moreover , cost - effectiveness improves when a 16-week assessment of response is used to guide decisions regarding long - term treatment.58 this economically advantageous utilization of omalizumab is thus linked to its sparing effect on the heavy burden of resources depleted by patients with the most severe forms of asthma . with regard to the effects of omalizumab on lung function ,
inconsistent data have been reported by various clinical trials.40 indeed , a decrease in free ige does not necessarily affect fev1 and fev1/forced vital capacity ratio.59 therefore , the effects of omalizumab on fev1 are quite controversial , and many studies have shown no significant change in this functional parameter.40 however , some increases in fev1 have been occasionally recorded after several weeks of treatment with omalizumab.29,38 furthermore , according to a recent open - label study performed in patients with severe uncontrolled allergic asthma randomized to receive best standard anti - asthma therapy with or without omalizumab , a significant increase in percentage predicted fev1 has been observed throughout a 1-year period of anti - ige treatment in comparison with control values.60 moreover , there may be an association between the reduction in exacerbation frequency elicited by omalizumab and the recorded improvement of airflow limitation .
this observation is consistent with the reported relationship between recurrence of asthma exacerbations and deterioration of lung function.61 in particular , the exacerbation - prone phenotype of asthma may be characterized by a vicious pathophysiologic circuit sustained by exacerbation - driven inflammation leading to bronchial narrowing , which in turn predisposes to repetitive exacerbation cycles .
controversial findings have also been reported with regard to the effects of omalizumab on bronchial hyper - responsiveness .
in particular , omalizumab does not seem to affect the airway response to methacholine.62,63 however , bronchoconstrictive effectors that act directly on airway smooth muscle are not the most suitable stimuli for testing the effects of omalizumab on bronchial hyper - responsiveness .
indeed , after 4 weeks of treatment , omalizumab significantly attenuated the airway response to inhaled adenosine 5monophosphate ( amp ) in subjects with mild - to - moderate allergic asthma.63 amp - induced bronchoconstriction is due to stimulation of adenosine a2b receptors located on mast cells , so the bronchoprotection against amp afforded by omalizumab is probably dependent on its ability to inhibit mast cell activation synergistically triggered by allergens and other degranulating agents like amp .
very interesting also are the effects of omalizumab on various markers of airway inflammation . during the steroid reduction phase of a pediatric study carried out in allergic asthmatic children , when compared with placebo , omalizumab was able to maintain the fractional concentration of exhaled nitric oxide ( a reliable noninvasive biomarker of bronchial inflammation ) at significantly lower levels.64 these findings
have also been recently confirmed by another study which demonstrated that , compared with placebo , omalizumab reduced fractional concentration of exhaled nitric oxide levels during an observation period of 48 weeks.44 moreover , omalizumab was also shown to be capable of decreasing eosinophil numbers in peripheral blood,65 as well as in induced sputum and bronchial biopsies.62 this effect of omalizumab is likely due to the induction of apoptosis in eosinophils .
in fact , omalizumab can increase the numbers of eosinophils stained by the apoptotic marker annexin v , and this effect is paralleled by an omalizumab - dependent decreased synthesis of eosinophil survival factors , such as granulocyte - macrophage colony - stimulating factor.66 in particular , peripheral blood eosinophils are currently believed to be reliable inflammatory biomarkers , and useful for monitoring the anti - inflammatory effects of omalizumab . in this regard , it is remarkable that a recent pooled analysis of data from several trials and involving patients with moderate - to - severe persistent allergic asthma treated with omalizumab , has found some degree of correlation between an omalizumab - induced decrease in peripheral blood eosinophils and various clinical and functional outcomes ; the latter included a reduced requirement for management of exacerbations with oral steroid bursts , an increased fev1 , and a positive global evaluation of treatment effectiveness by the investigators.67
overall , omalizumab is well - tolerated , and the most frequent adverse events are local injection site reactions , usually manifesting as warmth , erythema , swelling , bruising , and occasional urticaria - like eruptions .
the pivotal phase iii clinical trials have shown that the frequencies of adverse events were similar between the omalizumab and control groups ; the majority of unwanted side effects were of short duration and mildly to moderately severe.68 this side effect profile has been confirmed by real - life studies which have made it possible to monitor omalizumab - treated patients for up to 3 years.46 although omalizumab is considered to be a nonanaphylactogenic antibody , anaphylactic and anaphylactoid reactions have been sporadically reported . indeed ,
ige- or igg - mediated hypersensitivity reactions against the small murine portion of the omalizumab molecule can occur .
moreover , although the excipients ( sucrose , l - histidine hydrochloride monohydrate , l - histidine , polysorbate 20 ) present in omalizumab preparations are generally considered to be safe , remote reactions to these components can occur.69 in particular , both in vitro and in vivo immunologic evaluations of two patients who experienced anaphylaxis after 1 year of omalizumab treatment concluded that the likely cause was the excipient polysorbate.70 in order to address these problems , the omalizumab joint task force was formed at the 2007 annual meeting of the american academy of allergy , asthma and immunology , to review the data on anaphylaxis and anaphylactoid reactions reported by phase iii clinical trials and postmarketing surveillance studies .
omalizumab joint task force members inferred that , among 39,510 patients receiving omalizumab between june 1 , 2003 and december 31 , 2005 , 35 manifested 41 episodes of anaphylaxis associated with omalizumab , corresponding to an anaphylaxis reporting rate of 0.09%.69 these episodes included increased asthma symptoms and urticaria , shortness of breath , tongue swelling , watery itchy eyes , and subjective sensations of throat closing .
all patients responded to anti - anaphylactic treatment , and there were no fatalities or respiratory failures requiring intubation .
among the 41 reported anaphylactic events , timing information was available for only 36 episodes .
considering the latter , 22 ( 61% ) reactions occurred in the first 2 hours after one of the first three doses , whereas five of the episodes occurring after the fourth or later doses took place within 30 minutes .
therefore , an observation period of 2 hours for the first three injections , and of 30 minutes for the following doses would have made it possible to detect 75% of these anaphylactic reactions . moreover ,
advising patients to be equipped with an epinephrine autoinjector will probably allow management of anaphylactic events occurring outside the recommended observation period.69 given the role played by ige in immune defense against parasitic infestation , the risk of developing such infections could be associated with the use of anti - ige therapies . however , evolutionary theories suggest that although ige is very important in protecting animals and even humans living in primitive habitats , these antibodies seem to have become nonessential in many regions of the world characterized by relatively clean household and community environments . on the other hand , according to the results of a study carried out in allergic subjects resident in poor urban areas of brazil and at high risk of helminthic infections , omalizumab appeared to be effective and safe , although its use was associated with a slightly increased risk of parasitic infections.71 therefore , caution should be recommended in the use of omalizumab by patients at high risk of helminthic infections , particularly when living in or travelling to areas where these infections are endemic . in the event of unsatisfactory responses to conventional antihelminthic treatments , discontinuation of omalizumab
a major concern arises from the small increase in the numbers of malignancies , including tumors of the breast , prostate , and parotid gland , as well as a case of lymphoma detected in initial studies of omalizumab - treated patients compared with control groups.30 however , no difference in cancer incidence was found between subjects undergoing omalizumab therapy and the general population .
furthermore , most cancers occurred within 1 year from the beginning of omalizumab therapy , thus suggesting that they were likely pre - existing , because drug - induced malignancies usually develop after longer exposures .
therefore , on the basis of these considerations , also including the diversity in the types of neoplasms observed , panels of blinded and independent oncologists concluded that no causal relationship between omalizumab administration and cancer development can be hypothesized . some sporadic cases of churg
strauss syndrome possibly related to omalizumab treatment have been reported.7274 similar to previous observations regarding the use of leukotriene receptor antagonists,75 it is not yet clear whether these drugs , including omalizumab , may cause churg strauss syndrome , or simply unmask pre - existing latent disease because they facilitate corticosteroid tapering and withdrawal
. however , at least one report refers to a patient who had only received two short courses of oral corticosteroids in the year before omalizumab administration was initiated.73 this patient experienced a paradoxical increase in blood eosinophil count during treatment with omalizumab , even though this drug is a potential inducer of eosinophil apoptosis .
further pharmacovigilance studies are of course needed to ascertain if the development of churg strauss syndrome can be induced by omalizumab . caution is recommended when considering use of omalizumab in patients affected by this relatively rare vasculitis . more recently ,
some concerns have been raised by the us food and drug administration about the potential occurrence of cardiovascular and cerebrovascular side effects in patients treated with omalizumab , when compared with subjects not receiving this drug.76 however , the food and drug administration is not recommending any changes to the prescribing information for omalizumab , and is not advising patients to stop taking this drug .
in particular , because it has been hypothesized that omalizumab could induce an increase in ischemic heart disease , arrhythmias , cardiac failure , pulmonary hypertension , and thrombotic events , an ongoing observational study ( excels , evaluating clinical effectiveness and long - term safety in patients with moderate to severe asthma ) is evaluating the long - term safety profile of omalizumab in patients followed for 5 years . however , a recent systematic analysis of eight placebo - controlled trials in 3429 participants has not detected increased cardiovascular risk due to the use of omalizumab.43 on the contrary , four cases of adverse cardiovascular effects , including angina pectoris , tachyarrhythmia , and atrial fibrillation were reported in the placebo groups .
preliminary studies including small numbers of women who have received omalizumab during pregnancy have not detected any significant difference in comparison with control groups with regard to normal deliveries and spontaneous abortion rates.77 therefore , the current consensus among clinicians is that the use of omalizumab is safe . however , as with any relatively new class of drugs , continued surveillance is needed as its utilization in real life practice continues to grow , thus involving progressively increasing numbers of patients.78
although omalizumab is very effective in reducing allergic bronchial inflammation , its potential effects on airway remodeling , which is a key feature of severe asthma , are still not well understood.79 however , it is noteworthy that high - affinity ige receptors are also expressed on the surface of structural airway cells , such as bronchial epithelial cells .
the latter are indeed actively involved in the production of growth factors playing a central role in remodeling events in the airways of patients with asthma,80 especially those with the most severe disease phenotypes .
therefore , omalizumab could potentially interfere with the synthetic activity of bronchial epithelium , which contributes remarkably to the airway remodeling process . in this regard
, it has been reported that omalizumab was able to decrease significantly the production of transforming growth factor beta by bronchial epithelial cells cultured in a medium containing atopic serum from a dust mite - sensitive patient and exposed to the stimulatory actions of interleukin-1 or ragweed allergen.81 omalizumab could thus inhibit the fibrotic effects exerted by transforming growth factor beta in asthmatic airways via this mechanism .
furthermore , it has recently been reported that omalizumab can significantly decrease the concentration of endothelin-1 in the exhaled breath condensate of patients with severe persistent allergic asthma.82 endothelin-1 is a peptide mediator produced by vascular endothelial cells , bronchial epithelial cells , and mast cells , and is actively involved in the pathogenesis of airway structural changes , such as subepithelial fibrosis and proliferation of bronchial smooth muscle cells . on the other hand , in experimental murine models of allergic asthma , omalizumab has been shown to reduce airway wall thickness , mucous gland metaplasia , and subepithelial fibrosis .
on the basis of these findings , an ongoing study ( explore ) is investigating if omalizumab may be effective in preventing airway structural changes in asthmatic patients , in bronchial biopsies performed at different time points over 78 weeks .
availability of omalizumab in medical practice represents a remarkable advance in the management of severe persistent allergic asthma .
omalizumab makes it possible to improve disease control in many atopic patients who , although receiving optimized standard therapy , still experience a persistence of respiratory symptoms and a high frequency of asthma exacerbations .
the efficacy of omalizumab in reducing allergic airway inflammation and its clinical manifestations have been demonstrated in several trials , including real - life investigations . with the exception of a few sporadically reported relevant side effects
however , future investigations are needed in order to evaluate further the long - term actions of omalizumab . moreover , given the wide expression of ige receptors on cross - talking immune / inflammatory and airway resident cells , it will be very interesting to explore whether anti - ige therapy may eventually prevent and/or attenuate the development of immune - mediated airway remodeling and progressive functional decline , thus possibly affecting the natural history of severe asthma . | omalizumab is a humanized monoclonal anti - ige antibody recently approved for the treatment of severe allergic asthma .
this drug inhibits allergic responses by binding to serum ige , thus preventing interaction with cellular ige receptors .
omalizumab is also capable of downregulating the expression of high affinity ige receptors on inflammatory cells , as well as the numbers of eosinophils in both blood and induced sputum .
the clinical effects of omalizumab include improvements in respiratory symptoms and quality of life , paralleled by a reduction of asthma exacerbations , emergency room visits , and use of systemic corticosteroids and rescue bronchodilators .
omalizumab is relatively well - tolerated , and only rarely induces anaphylactic reactions .
therefore , this drug represents a valid option as add - on therapy for patients with severe persistent allergic asthma inadequately controlled by high doses of standard inhaled treatments . | Introduction
Mechanism of action and basic pharmacology
Practical use and overview of clinical studies
Safety
Future perspectives
Conclusion |
akt , also called protein kinase b ( pkb / akt ) , is a pleckstrin homology domain - containing
serine / threonine kinase which is activated by various stimuli , such as growth factors and
agonists1,2,3,4 .
akt has also been widely reported to have key roles in muscle
hypertrophy and the prevention of atrophy1 , 3 , 5 .
our previous study demonstrated that the phosphorylation of pkb / akt in atrophied muscle
tissues significantly diminishes in a time - dependent manner in cast - immobilized rats1 .
starvation in culture induces loss of
muscle mass6,7,8 . to study the signal
transduction of atrophy ,
the elevated degradation of proteins in skeletal muscle atrophy and serum - free starvation is
coupled with the activation of atrophy markers such as muscle - specific ring finger-1
( murf-1 ) and the muscle atrophy f - box protein ( mafbx , also called atrogin-1 ) , and these are
greatly upregulated in the initiation and development of skeletal muscle atrophy6,7,8 .
however , changes in the phosphorylation of
pkb / akt in starvation - induced atrophy and its temporal characteristics are not fully
understood .
therefore , we investigated the changes in the phosphorylation of pkb / akt in l6
myoblasts grown under serum - free starvation conditions with low glucose .
the l6 myoblasts were purchased from the american type culture collection ( rockville , md ,
usa ) and cultured in dulbecco s modified eagle s medium containing 10% fetal bovine serum
( fbs ) , 100 u / ml penicillin , 100 g / ml streptomycin , 200 mm glutamine and 4,500 mg / l
d - glucose ( high concentration ) . to induce serum - free starvation , groups of cells were grown
to 6070% confluence with undernourishment in dmem containing 1,000 mg / l d - glucose ( low
concentration ) without fbs for 6 , 12 , 24 , 36 , 48 , 72 , 96 , and 120 h , respectively7 .
groups of starved l6 myoblasts were also
treated with sb203580 ( 10 m , an inhibitor of p38mapk ) , sp600125 ( 10 m , an inhibitor of
sapk / jnk ) , and ly294002 ( 10 m , an inhibitor of pi3 k ) for 6 hours .
after each experimental
treatment , cells were lysed with an extraction buffer . to measure the phosphorylation of
pkb / akt
proteins , 3045 g / lane , were separated on
12% polyacrylamide sodium dodecylsulfate gels and then transferred electrophoretically to a
polyvinylidene fluoride membrane ( millipore ; bedford , ma , usa)1 .
anti - pkb / akt antibody was purchased from santa cruz ( santa cruz ,
ca , usa ) .
sb203580 , sp600125 , and ly294002 were purchased from tocris bioscience ( bristol ,
uk ) .
the statistical evaluation of data was performed using graphpad
prism ( graphpad software , san diego , ca , usa ) , and student s t - test for group comparisons
and anova for multiple comparisons
the protocol for the study was approved by the committee of ethics in research
of the university of yongin , in accordance with the terms of resolution 5 - 1 - 20 , december
2006 .
the phosphorylation of pkb / akt was significantly lower in l6 myoblasts grown under
starvation conditions with low glucose and 0% fbs than that in the control group cultured
with high glucose and 10% fbs ( n=4 ; table
1table 1.changes in the expression and phosphorylation of pkb / akt in l6 myoblasts grown
under serum - free starvation with low glucoseexperimentalperiodpkb / akt(%)p - pkb / akt(%)variablepkb / akt(%)p - pkb / akt(%)0 hour100.00.0100.00.0hg+10% fbs100.00.0100.00.06 hours100.74.118.76.6*lg+2% fbs99.31.889.38.412 hours99.31.211.34.5*lg+0% fbs98.70.97.72.4 * 24 hours98.72.610.33.5*hg+10% fbs100.00.0100.00.036 hours101.04.910.73.8*lg+0% fbs103.35.85.72.9 * 48 hours99.33.513.34.3*sb203580 10 m102.72.37.03.8 * 72 hours100.75.811.34.1*sp600125 10 m102.32.469.77.9 * 96 hours101.03.510.36.0*ly294002 10 m103.32.34.32.4 * 120 hours102.34.110.75.9*data are presented as the mean sem .
hg , glucose of high concentration ; lg , glucose
of low concentration ; p , phosphorylated protein ; pkb / akt , protein kinase b / akt ;
sb203580 , an inhibitor of p38mapk ; sp600125 , an inhibitor of sapk / jnk ; ly294002 , an
inhibitor of phosphatidylinositol 3-kinase .
the basal levels of abundance and
phosphorylation in the control ( 0 hour ) were considered to be 100% . * : vs. 0 hour
control , p<0.05 , fig .
1afig . 1.change of phosphorylation of pkb / akt and a schematic representation of the cellular
response induced by serum - free starvation with low glucose in l6 myoblasts pkb / akt ,
protein kinase b / akt ; fbs , fetal bovine serum ; h , hours ; experimental p , experimental
period ; hg , glucose of high concentration ; lg , glucose of low concentration ; sapk / jnk ,
stress - activated protein kinase / c - jun nh2-terminal kinase ;
sb203580 , an inhibitor of p38mapk ; sp600125 , an inhibitor of sapk / jnk ; ly294002 , an
inhibitor of phosphatidylinositol 3-kinase ; murf-1 , muscle specific ring finger-1 ;
foxo , forkhead box o transcription factors ; mtor , mammalian target of rapamycin ;
frap , fkbp12-rapamycin - associated protein ; gsk3 , glycogen - synthase kinase 3 ; pi3k ,
phosphatidylinositol 3-kinase ; pip2 , phosphatidylinositol
( 4,5)-bisphosphate [ ptdins(4,5)p2 ] ; pip3 , phosphatidylinositol
( 3,4,5)-triphosphate [ ptdins(3,4,5)p3 ] ; p - pkb / akt , phosphorylated pkb / akt ;
4ebp-1 , 4e - binding protein 1 ; phas-1 , phosphorylated heat- and acid - stable protein 1 ;
eif2b , eukaryotic initiation factor 2b ; p70 , p70 s6 kinase ) . serum - free starvation with low glucose for 6 , 12 , 24 , 36 , 48 , 72 , 96 , and 120 hours
significantly decreased the phosphorylation of pkb / akt ( n=5 ; table 1 , fig .
furthermore , the decrease of pkb / akt phosphorylation in serum - free starvation with low
glucose was partially restored by 10 m sp600125 , an inhibitor of sapk / jnk ( n=4 ; table 1 , fig .
however , the starvation did not influence the abundance of pkb / akt expression
in any group ( n=45 ; table 1 , fig .
hg , glucose of high concentration ; lg , glucose
of low concentration ; p , phosphorylated protein ; pkb / akt , protein kinase b / akt ;
sb203580 , an inhibitor of p38mapk ; sp600125 , an inhibitor of sapk / jnk ; ly294002 , an
inhibitor of phosphatidylinositol 3-kinase .
the basal levels of abundance and
phosphorylation in the control ( 0 hour ) were considered to be 100% . * : vs. 0 hour
control , p<0.05 change of phosphorylation of pkb / akt and a schematic representation of the cellular
response induced by serum - free starvation with low glucose in l6 myoblasts pkb / akt ,
protein kinase b / akt ; fbs , fetal bovine serum ; h , hours ; experimental p , experimental
period ; hg , glucose of high concentration ; lg , glucose of low concentration ; sapk / jnk ,
stress - activated protein kinase / c - jun nh2-terminal kinase ;
sb203580 , an inhibitor of p38mapk ; sp600125 , an inhibitor of sapk / jnk ; ly294002 , an
inhibitor of phosphatidylinositol 3-kinase ; murf-1 , muscle specific ring finger-1 ;
foxo , forkhead box o transcription factors ; mtor , mammalian target of rapamycin ;
frap , fkbp12-rapamycin - associated protein ; gsk3 , glycogen - synthase kinase 3 ; pi3k ,
phosphatidylinositol 3-kinase ; pip2 , phosphatidylinositol
( 4,5)-bisphosphate [ ptdins(4,5)p2 ] ; pip3 , phosphatidylinositol
( 3,4,5)-triphosphate [ ptdins(3,4,5)p3 ] ; p - pkb / akt , phosphorylated pkb / akt ;
4ebp-1 , 4e - binding protein 1 ; phas-1 , phosphorylated heat- and acid - stable protein 1 ;
eif2b , eukaryotic initiation factor 2b ; p70 , p70 s6 kinase
maintenance of muscle mass and of muscle function are important for healthy life , and is
important in the rehabilitation of musculoskeletal disease in the field of physical
therapy1 , 7 ,
13 , 14 . the maintenance mechanisms of muscle mass include anabolic and
catabolic signal transductions via pkb / akt , a protein with a critical role1 , 5 , 10 , 11 .
pkb / akt intermediates the signaling pathways that regulate cellular
processes controlling growth , proliferation , and differentiation2 , 3 , 11 , 12 , and
supplementation with growth factors and nutrients increases the activity of pkb / akt10,11,12 .
supplementation encompasses intake of
food , quality of diet , and the ability to optimally use ingested nutrients in the
maintenance of muscle mass15 , 16 .
in contrast , as muscle mass decreases , there is an
accompanying loss in muscle strength and use of the nutrients that contributes to reduced
muscle function and quality of activities of daily living ( adl ) .
malnutrition and chronic
diseases such as diabetes mellitus , heart failure , and chronic obstructive pulmonary disease
are also directly associated with a dramatic reduction in the phosphorylation of pkb / akt
with decrease of muscle mass15 , 17 , 18 .
our previous
study reported that increases in atrophy markers and a decrease in pkb / akt phosphorylation
occur in gastrocnemius muscle strips atrophied by cast - immobilization , and pkb / akt
phosphorylation is involved in the development of serum - free starvation - induced murf-1
expression in l6 myoblasts1 , 7 .
extracellular signal - regulated kinase 1/2 ( erk1/2 ) ,
stress - activated protein kinase / c - jun nh2-terminal kinase
( sapk / jnk ) , and p38 mitogen - activated protein kinase ( p38mapk ) are concurrently involved in
atrophy induced by cast - immobilization and the starvation of skeletal muscle cells1 , 7 .
furthermore , our previous report demonstrated that cast - immobilization of rat gastrocnemius
muscles increases the expression of muscle myoglobin19 .
it has recently been reported that cofilin in eukaryotic cells
binds to actin and plays a role in actin dynamics and reorganization in cast immobilization-
and starvation - induced atrophy in rat gastrocnemius muscles and l6 myoblasts20,21,22 . however , further systematic and
scientific studies in the fields of electrotherapy , neurotherapy , hydrotherapy and others
are needed to confirm the mechanisms of pkb / akt in atrophied muscle strips and cells23,24,25,26,27 ( fig .
the present results suggest that serum - free starvation - induced atrophy is
partially mediated by pkb / akt via the sapk / jnk pathway in l6 myoblasts . | [ purpose ] studies have been using cell cultures of muscle cells to mimic atrophy in
in vivo and in vitro tests .
however , changes in the
activation of atrophy - related pkb / akt is not fully understood in serum - free starved
skeletal muscle cells .
the purpose of the present study was to determine the change of
pkb / akt phosphorylation in l6 myoblasts under serum - free starvation conditions .
[ methods ]
we used western blotting to examine pkb / akt expression and phosphorylation in atrophied l6
myoblasts . [ results ] the phosphorylation of pkb / akt was significantly lower in l6
myoblasts under serum - free starvation than that of the control group .
serum - free
starvation for 6 , 12 , 24 , 36 , 48 , 72 , 96 , and 120 hours significantly decreased the
phosphorylation of pkb / akt .
furthermore , the decrease of pkb / akt phosphorylation under
serum - free starvation was partially restored by sp600125 , an inhibitor of sapk / jnk .
[ conclusion ] these results suggest that decrease of pkb / akt phosphorylation due to
serum - free starvation with low glucose is partially related to the activity of sapk / jnk in
l6 myoblasts . | INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION |
this year half a million people will be diagnosed with oral squamous cell carcinoma ( oscc ) or oropharyngeal cancer , and about one quarter of that number will die from the disease , often disfigured from treatment .
cure rates have improved only slightly over the decades . paradoxically , while early curable lesions are visible in the mouth , they are seldom diagnosed . because oral and oropharyngeal cancers are often asymptomatic until the final stages , improved screening to detect cancerous lesions in the oral cavity is a key component to reducing this cancer .
detection of suspicious oral lesions by a general dentist includes a visual inspection of the oral mucosa and visible throat .
the clinician looks for either nonhomogenous or verrucous surfaces , of unknown cause , whitish or reddish in color .
the examination of the oral cavity can be aided by toluidine blue vital staining , because the dye is retained in cells with malignant changes , or by the use of a fluorescent light source as premalignant and malignant lesions may differ from normal mucosa in their production of fluorescence . on the detection of a suspicious lesion ( of duration over 2 weeks ) , the patient may be advised to make an appointment with an oral surgeon so the lesion can be biopsied .
the histopathological examination of a stained tissue section by a pathologist is the gold standard for diagnosis of oral neoplasia .
a diagnosis is made based on changes in cell and nuclear size and mucosal architecture .
problems with this procedure include the difficulty for all but the most experienced practitioners to know which part of a heterogeneous lesion should be sampled , the need for multiple biopsies , the preference of only some dentists and physicians to perform oral biopsies , the refusal of some patients to submit to oral biopsies , and the subjective nature of the pathological analysis .
the invasive nature and skill required to perform the procedure limit its usefulness as a part of oral cancer screening .
the procedure of using a cytology brush to harvest mucosal cells from suspicious lesions to detect oscc and oropharyngeal cancer was first attempted many years ago as reviewed earlier .
this methodology , offered by one company in particular , oralcdx , has been promoted over the last 12 years as a substitute for tissue pathology [ 3 , 4 ] .
more ambitious approaches use cells from the oral cavity or throat obtained with a brush or oral rinse as a source of dna or rna that can be used to determine mutations [ 5 , 6 ] or changes in gene expression linked to cancer .
finally , saliva itself can be analyzed to detect rna that is associated with not only head and neck squamous cell carcinoma ( hnscc ) but also systemic cancers .
all these approaches offer the admirable goal of eliminating the need for oral biopsy as a methodology of oscc detection .
until 2004 it was largely thought that rna harvested from the oral mucosa using a cytology brush would be so severely degraded as to disallow the identification of specific mrnas .
early pilot studies demonstrated that the isolation of rna from brush oral cytology was possible and that mrna could be detected using rt - pcr or microarray analysis , but it was not clear how reliable the method was and what was being measured [ 8 , 9 ] .
remarkably , in their pioneering human study spivack et al . saw a qualitative correlation of detectable expression of a number of mrnas in laser microdissected lung tissue and brush cytology cells from the same patients .
however , large interpatient variability in mrna quantitation was seen ( up to 10,000 fold ) , and the source of this variation was not explored . in a pilot study , increased levels of the l5gamma2 mrna in rna from brush cytology were found in human oral carcinoma versus normal tissue , though this study lacked statistical analysis of the data .
a source of variation in these studies may be methods of rna preparation and analysis and statistical data evaluation . finally , pilot studies demonstrated increases in krt17 mrna and the splice variant atp6v1c mrna in rna from brush cytology of oscc [ 11 , 12 ] .
studies done comparing rna from brush cytology of benign mucosa of smokers and nonsmokers have shown differential expression of genes by global gene expression analysis that were verified using rt - pcr , though the rna was not 100% intact [ 13 , 14 ] .
it has been our finding that careful selection of primer target size allows reproducible measurement of specific mrnas in rna from brush cytology . over the last 4 years
we have shown that not only is the rna of high enough quality to allow the measurement of specific mrnas but also that samples taken over consecutive weeks from oscc in hamster showed consistent levels of specific mrnas .
the difficulty in extracting totally intact mrna from brush oral cytology is thought to be due to the high level of ribonuclease in saliva present during cell collection , storage , and processing , which results in differences in levels of specific mrnas [ 17 , 18 ] .
another important contribution to the rna quality may be the dead and dying cells that make up the squamous epithelium .
in fact a case could be made that brush cytology samples of any squamous epithelium , such as skin , cervix , or oral and pharyngeal tissue , are going to include partially degraded rna . despite this ,
rna from brush cytology has shown changes in gene expression supported by work from different laboratories when rt - pcr is used with suitable mrna controls and consistent primer design [ 15 , 16 , 19 , 20 ] .
there is a large legacy of over 20 earlier studies on global gene expression changes measured in surgically obtained tissues for hnscc , mainly of the oral cavity , oropharynx , hypopharynx , and larynx [ 2125 ] .
these supply a list of over 100 genes that show expression changes correlated to hnscc that can be tested using rt - pcr with rna from brush oral cytology of suspect malignant lesions .
rna from brush oral cytology of the oral mucosa represents almost exclusively cells of a single type in contrast to tissue from surgical samples which include variable amounts of stromal tissue . despite the claims of some brush producers , the brush collects cells from at best the top 2/3 of the mucosal in normal tissue , typically 100% epithelial cells .
as is now well understood , analysis of homogeneous cells allows much more sensitive detection of gene expression changes of that cell type [ 15 , 27 ] .
work from our laboratory exploited the list of oscc marker genes in surgically obtained head and neck tumor tissue [ 2125 ] .
twenty - one mrnas from this list were quantified in rna from brush cytology samples of oscc associated with tobacco usage and benign oral lesions .
six mrnas showed differential expression , and an oscc classifier was developed based on the level of 5 mrnas , with 4 from the list ( data not shown ) .
these data and results from other laboratories , while requiring further validation , lend support to the idea that a well - designed screen of rna from brush cytology has the potential to aid in oscc screening [ 11 , 12 , 15 , 16 ] .
while basic research scientists catalogue gene expression , identifying genes actively synthesizing mrnas that are translated into protein , the clinician is more interested in mrnas as markers whose levels correlate with disease . for some years
efforts have been made to correlate the presence of oral cancer with changes in specific rnas in saliva [ 28 , 29 ] . from the start , this approach has been championed by one group that has worked to perform the difficult task of cataloging mrna fragments in cell - free saliva . with the rationale that the best screening method uses the easiest sample collection , the wong group has kept the methodology simple .
no effort is made to induce salivation ; patients are only asked to refrain from eating one hour prior to sample acquisition and samples are taken at a uniform time of day and placed in a rna preservative .
the original finding that rna could be detected in saliva was unexpected despite the fact that multiple rna forms had been detected in plasma .
it was originally thought that no rna could survive extracellularly due to the high level of ribonuclease in saliva [ 17 , 18 , 31 ] .
although one report showed rna is undetectable in saliva , there is ample evidence that there is extracellular rna in saliva at very low levels [ 3234 ] .
the source was originally thought to be nearby lysed oral or pharyngeal tumor cells . however , measured changes in salivary rnas with systemic disease , such as mammary and pancreatic cancer , led to the idea that rna in saliva comes from plasma prior to its secretion by the salivary glands [ 35 , 36 ] .
now it is understood that while rna can be found in plasma or saliva , perhaps bound to proteins , another source is exosomes [ 3739 ] .
these small membrane - bound vesicles can be produced in many cells and are thought to be part of a not well - understood exchange system for mrna , mirna , protein , and other macromolecules . because exosomes are thought to freely travel in the blood and possibly exchange in other body fluids such as saliva , it would then be understandable how diseases at distal sites can contribute to saliva rna populations .
also , perhaps with the acceptance that most saliva mrnas are likely to be in exosomes , appropriate refinements in rna purification may improve quality and yield of saliva rna preparations .
the evidence for saliva - based rna as a classifier for oscc , and that changes in saliva rna levels are linked to a variety of diseases , is almost exclusively from one laboratory . on the subject of oscc
there is a published study from another group that showed rt - pcr detectable mmp1 in saliva in 20% of oscc patients but not in any healthy controls . in this study rna from centrifuged saliva pellets was examined , not cell - free saliva , and a set of 3 mrnas served as controls .
the original publication from the wong group demonstrating mrnas with increased concentration in saliva associated with oscc was based on 32 patients with early stage oscc and 32 healthy , age and smoking history matched controls .
microarray analysis initially showed 17 mrnas were overrepresented in cell - free saliva of oscc patients while no genes were downregulated .
remarkably , after focusing on the genes known to be associated with cancer , 7 out of 9 showed increased levels in saliva using rt - pcr ; these were il8 , il1b , dusp1 , ha3 , oaz1 , s100p , and sat .
li et al . then created a classifier for oscc based on levels of these 7 rnas in saliva , reporting a sensitivity of 0.91 and a specificity of 0.91 using the same training set . a study from the same group in 2010 focused on a serbian population differing in race and including all oscc tumor stages . in that study ,
6 out of the 7 original mrnas were tested using nested rt - pcr , and all values were normalized to control rnas from 3 housekeeping genes , not to saliva volume as in the first study . while the study did validate the increase in levels of 4 out of 6 rnas tested in this population of patients with oscc , it by no means validated their value as a classifier for oscc as substantial changes were made to the original classifier after testing multiple alternatives .
it will be important to validate this new classifier of 4 saliva rnas and 3 saliva proteins , without modification , in a study of independent subjects .
the discovery that extracellular rna in saliva is protected in exosomes added great strength to the idea that rna in cell - free saliva could be used to diagnose systemic disease .
the wong group has done multiple studies linking changes in saliva rna to systemic disease including ovarian and pancreatic cancer [ 35 , 36 ] .
while the two studies named do show differential expression of certain marker rnas in saliva for both diseases using two sets of patient samples , they did not maintain separate test and validation patient sample sets when developing the classifier predictive of the disease under study .
for that reason , it is likely that the high level of sensitivity and specificity for disease identification by measuring the mrnas they recommend will likely decrease when a true independent set of patient saliva samples is examined and that further refinement of the classifier will be necessary with the measurement of additional or different rnas .
the initial observation of relatively intact rna in the extracellular saliva by the wong group was a seminal finding .
however , validation for all the disease classifiers with an independent set of subjects is needed before the use of salivary rna as a screen for disease can be fully evaluated [ 3739 ] .
hypermethylation of cpg islands in the promoter regions of many tumor suppressor genes has been linked to the loss of expression of these genes that occurs with the multiple tumor types that make up the family of hnsccs . in recent years , this method of tumor cell analysis has overshadowed mutational analysis of the hnscc or oscc genome as having promise to identify these diseases . to perform methylation analysis , dna isolated from tumor tissue is exposed to bisulfite to convert cytosines not methylated at the 5 position to uracil , followed by hybridization of oligonucleotide primers to the altered sequence and detection using pcr .
this produces a quantitative measure of methylation at specific cpg sites after normalization to a housekeeping gene promoter site known not to show differential methylation .
while these analyses have been done with surgically obtained oral tissue , they can also be done with exfoliated cells from saliva or an oral rinse with or without a previous brushing to dislodge cells [ 42 , 43 ] .
this greatly simplifies cell acquisition , especially from unseen pharyngeal lesions , though it dilutes the numbers of cells that come directly from the lesion .
possibly because tumors may tend to shed cells at high rates and field cancerization can cause changes in gene expression in wide areas of tissue around a tumor , the method seems to work .
usage of exfoliated cells and not surgically acquired tumor tissue showed only a slight decrease in sensitivity to promoter methylation detection and then only for some genes [ 44 , 45 ] .
a major stumbling block to dna methylation studies in the past was the relatively large amount of material needed to perform the analysis and the lack of a true high throughput approach to catalog differential promoter methylation .
while dna microarray hybridization analysis allows the measurement of the levels of thousands of rnas in one experiment , methylation studies of cpg islands in promoters have , until recently , been done one gene at a time , typically on genes first identified as hypermethylated in hnscc cells lines . as one might expect hyper- and hypo - cpg methylation patterns that occur in hnscc cell lines can be markedly different than those seen in tumor tissue . of the published records , of about 50 prospective genes tested as methylation markers for hnscc or oscc in saliva ,
nevertheless , this approach has provided studies linking hypermethylation of certain genes in cells found in oral rinses to not only hnscc but also moderate - to - severe dysplasias based on ednrb promoter methylation and to verrucous hnscc relapse prediction based on methylation status of specific promoter sites in a panel of 5 genes [ 45 , 47 ] . in the last few years
, high throughput dna methylation assays have become available that offer multiplexed systems for determination of cpg methylation status at thousands of sites at once [ 44 , 48 ] . as an example , recent work using this approach with oral tissue from 4 osccs , 4 leukoplakia patients , and 4 healthy controls detected 301 hypermethylated and 62 hypomethylated genes promoter sites .
that research focused on 8 genes shown to be underexpressed in hnscc and also hypermethylated in at least some tumor types in earlier studies .
four of these were used to identify scc among a validation set of 55 hnscc and 37 normal surgically obtained tissue samples , with 94% sensitivity and 97% specificity .
accuracy dropped greatly when used on dna harvested from oral rinses of patients with hnscc and controls .
the loss of accuracy may be due to the use of saliva cells while the classifier was developed with tumor tissue .
as noted , certain genes show poor correlation in methylation status between tissue and exfoliated cells .
this suggests that , if possible , exfoliated cells from patients should be used directly for the multiplexed analysis of gene methylation status with hnscc though the amounts of dna are more limited . with the ability to rapidly screen many methylation sites , dna hypermethylation analysis of oral rinse cells may allow the rapid identification of genes ideal for oscc and oropharyngeal cancer classification .
it also must be recognized that oscc and oropharyngeal cancer can be different cancers with different etiologies , gene expression , and mutation patterns and that attempts to provide a single classifier for all the forms may be difficult or impossible [ 49 , 50 ] .
dna is much more stable than rna , and it is assumed that even in exfoliated cells the loss of methylation and dna degradation occur at low rates and are not a factor , though that will need to be verified . as has been noted , standardization of sample acquisition and dna purification will be necessary
. it will be interesting to see if saliva dna methylation analysis will show sufficient sensitivity to detect oral premalignancy or if it will be necessary to use a cytology brush to increase the number of cells from the lesion .
it will be crucial to show that the methodology not only differentiates hnscc from healthy mucosa but also from benign pathology , such as reactive inflammation , to increase specificity in the clinic .
examination of oral cells also may prove useful in the analysis of some systemic diseases .
methylation of gene promoters of cells in saliva or obtained with a brush from the oral mucosa has been linked to cigarette smoke - induced changes in the lungs [ 5153 ] . it has been suggested as an alternative to lung biopsy to noninvasively size up changes in the lungs using saliva dna methylation analysis with the goal of providing guidance on lung cancer susceptibility .
furthermore , the characterization of cells in sputum from the respiratory system showed changes in dna promoter methylation associated with lung cancer .
it is speculated that traces of dna in respired air can also be scanned for the presence of methylation of specific sites of the dna to track lung cancer , though this approach is in its infancy .
rna from brush cytology and dna from oral rinses come almost exclusively from epithelial cells of oral and adjoining tissue mucosa . as stated earlier homogeneous samples offer more sensitive detection of rna population changes in the cells of interest .
it may also eliminate much of the variability between studies that use surgical samples harvested in different ways and thus containing variable amounts of stroma , a problem that has plagued between - laboratory comparisons of gene expression - based classifiers .
while studies using oral cells to measure rna , or dna methylation , have taken advantage of genes identified in earlier studies of surgically obtained tissue , new genes better suited to oscc and hnscc identification may also come to light , given the pure cell population used .
analysis of rna from brush cytology and methylated dna from oral rinses shows great promise to offer screening for oral disease . there is a need for more evidence that both methods work with external validation sets , though less so for analysis of dna from oral rinses where
more studies have been done . while studies on rna from brush cytology has compared samples from malignant versus benign lesions , most research on dna methylation in oral rinses
thus there is a need to establish if the latter method can differentiate malignant versus benign disease .
rna from cell - free saliva may allow detection of oral and systemic disease based on changes in rna in the saliva .
this is thought to be due to the presence of rna released throughout the body and carried to the oral cavity via the blood .
the high number of cell types thought to be contributing to the extracellular saliva rna population makes it difficult to suggest there will be rna signatures sufficiently specific to systemic diseases to allow accurate detection of a large number of these diseases .
however , the possibility of using this approach to detect oral and oropharyngeal disease where the diseased cells should be a dominant rna source is promising for this method whose great virtue may be the simplicity of sample collection .
interestingly , recent analyses from several groups suggest that the analysis of mirna in both unfractionated and cell - free saliva may have potential to provide a classifier for oscc [ 5658 ] .
a major question is how will any of the three methodologies be used in the clinic if they do prove to add value to diagnosis ?
there is great commercial interest in the development and manufacture of portable instrumentation for automated isolation of dna and rna from samples outside the laboratory , performance of cdna synthesis , or bisulfite reaction , followed by pcr allowing quantification of the sequences of interest .
direct hybridization detection of targets will in time simplify the methodology . while these machines are chiefly designed for use with blood ,
they are adaptable to saliva analysis and should provide point - of - care rapid diagnosis of oral disease in the dental or medical clinic , eliminating the need for patient referral for this in just a few years .
noninvasive methods using gene expression analysis to detect early oral malignancy will likely be used in the clinic to provide point - of - care detection in five years time and for definitive diagnosis sometime after that . at this point ,
the analysis of dna methylation has the most promise to be the method of choice . unlike rna from brush cytology
, dna methylation has had a large number of resources directed toward it , and , differing from analysis of extracellular rna in saliva , it has shown utility by several research groups .
recent findings provide encouragement that the days of missing early and curable cancerous lesions of the mouth and pharynx for lack of a simply applied screen are coming to a close . | noninvasive diagnosis , whether by sampling body fluids , body scans , or other technique , has the potential to simplify early cancer detection .
a classic example is pap smear screening , which has helped to reduce cervical cancer 75% over the last 50 years .
no test is error - free ; the real concern is sufficient accuracy combined with ease of use .
this paper will discuss methods that measure gene expression or epigenetic markers in oral cells or saliva to diagnose oral and pharyngeal cancers , without requiring surgical biopsy .
evidence for lung and other distal cancer detection is also reviewed . | 1. Introduction
2. RNA from Brush Oral Cytology
3. RNA from Cell-Free Saliva
4. Epigenetic Changes in DNA from Cells in Saliva
5. Discussion
6. Conclusion |
myopic foveoschisis ( mfs ) in highly myopic eyes is a more recently recognized clinical entity whose clinical description has been facilitated via optical coherence tomography ( oct ) studies .
previously , myopic foveoschisis has been poorly characterized and may have been mistaken for macular holes or shallow retinal detachments [ 1 , 3 ] .
the first description of this entity was by phillips who noted that localized posterior retinal detachment over posterior staphyloma can occur even in the absence of a retinal hole .
myopic foveoschisis affects 9% to 20% of myopic eyes with staphylomas [ 5 , 6 ] .
utilizing oct , it is now known that mfs can lead to the development of subtle shallow retinal detachments and/or macular holes in patients with high myopia and account for previously unknown causes of vision loss in these patients [ 1 , 7 ] . to date ,
a 73-year - old woman with high myopia was referred with complaints of bilateral worsening vision .
the best - corrected visual acuity was 20/70 od and 20/80 os with a refraction of 15.5 + 3.00 113 od and 18.5 + 2.25 72 os .
fundus examination revealed bilateral staphylomas , optic nerve crescents , and degenerative myopic changes ( figures 1(a ) and 1(b ) ) .
fluorescein angiography ( figures 1(c ) and 1(d ) ) revealed a normal choroidal pattern , window defects in the macular regions and staining of the optic nerve crescents in both eyes .
both eyes were obtained within 24 hours for autopsy under a protocol approved by the institutional review board of the national eye institute .
grossly , the right globe measured 26 24 24 mm in the anterior - posterior , horizontal and vertical diameters , respectively .
histologically , the right eye demonstrated degenerative retinoschisis with interbridging strands in the outer plexiform layer of the macular region ( figures 2(a ) and 2(b ) ) .
a staphyloma with loss of photoreceptors , attenuated inner nuclear layer , absence of retinal pigment epithelium , and choroid resting against sclera were present at the temporal peripapillary region .
a thin fibroglial preretinal membrane was adherent to the internal limiting membrane ( ilm ) in the macula .
interestingly , there were multiple cystic degeneration in the outer plexiform layer , and there appeared to be folding of the inner layers of the retina .
these histopathologic observations are not readily apparent during oct analysis of mps patients [ 7 , 8 ] .
the fovea , perifovea , and optic nerve head in the left eye were missing .
peripherally , classical age - related retinoschisis in the outer plexiform layer , ganglion cell layer , and nerve fiber layer was noted . additionally , a thin fibrous preretinal membrane was present ( figures 2(c ) and 2(d ) ) .
high myopia predisposes patients to degenerative conditions that range from development of lacquer cracks and neovascular membrane formation to development of retinal detachments .
the etiology of myopic degeneration is still not clear , but it is believed to stem from a combination of genetic and environmental factors . published oct imaging studies have demonstrated that high myopia along with the presence of staphyloma may lead to the development of mfs [ 7 , 8 ] . prior to oct , it was difficult to differentiate these schisis cavities from shallow retinal detachments , macular holes or macular edema [ 7 , 8 ] . even with more recent oct , it was difficult to determine the exact nature and components of the schisis cavity .
this study illustrates that retinal schisis cavities can form in various layers of the neurosensory retina in high myopes .
myopic foveoschisis leads to decreases in visual acuity because of disruption of the neurosensory elements and predisposes patients to foveal retinal detachments [ 1 , 3 , 7 ] .
johnson reviewed the interactions between the vitreous and retina that are thought to be causes of these vitreoretinal interface abnormalities .
he discusses that mfs is likely caused by a relative stiffness of the inner retina compared with the outer retina within the concavity of the staphyloma resulting from cortical vitreous remnants after incomplete posterior vitreous detachment ( pvd ) .
the fibroglial preretinal membrane that was adherent to the ilm in our specimen supports oct and more recent ultrastructural studies that the preretinal membranes and incomplete pvd in highly myopic patients contribute to mfs formation [ 6 , 10 , 11 ] .
reported the presence of vertical column - like structures seen on oct which are consistent with findings seen in our sections ( figure 2(d ) ) . a long - term evaluation of 29 eyes with mfs demonstrated that the natural evolution of this disease is rather diverse .
risk factors for worsening va increases when there are associated premacular structures such as epiretinal membranes or a partially detached vitreous cortex .
several studies propose that vitrectomy is a reasonable consideration in these cases [ 1318 ] . | this is a clinicopathological paper on the histologic findings in myopia - associated macular foveoschisis .
the findings on ophthalmic pathological study of a 73-year - old woman with high myopia are reviewed .
multiple retinoschisis cavities involving both the macula and retinal periphery were disclosed .
our paper offers tissue evidence and supports recent ocular coherence tomography reports of eyes with high myopia and associated macular foveoschisis . | 1. Introduction
2. Case Report
3. Discussion |
malignant mixed mllerian tumors ( mt ) are a rare mixed mesenchymal and epithelial group of neoplasms .
although these tumors occur most commonly in the endometrium and less frequently in other parts of the female genital tract , such as the cervix , ovaries , fallopian tubes and vagina , extragenital primary peritoneal mt that are extremely rare have been described , and only few cases have been reported in the literature [ 1 , 2 ] . these tumors occur commonly in elderly postmenopausal women [ 1 , 2 ] and it has been hypothesized that they arise in the secondary mllerian system consisting of the abdominal and pelvic peritoneum and its underlying mesenchymal tissue .
a 46-year - old woman was admitted to the hospital complaining of diffuse abdominal pain and swelling , nausea and decrease of appetite . abdominal examination revealed multiple abdominal masses and ascites .
she underwent a hysterectomy and oophorectomy 6 years ago , secondary to a benign disease ; other than this , there was no remarkable gynecological history .
abdominal ultrasound and computed tomography revealed multiple peritoneal masses with a diameter of 4 - 10 cm .
laparotomy achieved total resection of a bleeding abdominal tumor , measuring 10 cm at its maximal diameter , attached to the retroperitoneal area , and most of the peritoneal masses leaving approximately 40% of the visible disease .
the patient had an eastern cooperative oncology group ( ecog ) performance status of 3 , with diffuse edemas , loss of appetite , fatigue and dispnea at moderate physical efforts .
after a short course of high doses of steroids such as anabolic drugs , intravenous albumin , diuretics , morphine and blood transfusions , the patient achieved an ecog of 1 - 2 after two weeks and she could leave the hospital .
the larger part of the tumor consisted of cords and nests of poorly differentiated intermediate - sized cells .
the carcinoma component was formed by indifferentiated diffuse cells and glandular structures composed of larger cells focally resembling adenocarcinoma . the stromal component consisted of chondromatous areas ( fig .
2 ) , spindle cells with pleomorphic nuclei , mostly with a haphazardous architecture , and pleomorphic giant cells in some areas . the immunohistochemical findings showed expression of cytokeratins ( fig .
4 ) in the epithelial and mesenchymal components , respectively , and the absence of desmin and estrogen and progesterone receptors .
postoperatively , the patient was given chemotherapy with a combination of paclitaxel and carboplatin in a weekly schedule because of the regular general condition .
the patient experienced clinical benefit and marked decrease of serum levels of ca 125 after two cycles . at that time ,
mt are uncommon neoplasms characterized by their biphasic pattern containing both malignant epithelial and stromal components .
these tumors most commonly arise in the uterus and other parts of the female genital tract , but the occurrence of mt in an extragenital location , although it exists , is very rare .
there are different sites for extragenital mt and the most frequent location appears to be the pelvic peritoneum .
other sites are serosal surface of the colon , retroperitoneum , antero - lateral abdominal peritoneum and the mesentery .
peritoneal surfaces are a host to a range of benign and malignant diseases commonly encountered in the mllerian duct system of the female genital tract .
primary peritoneal mt have been thought to arise either from foci of endometriosis , from mllerian duct remnants or directly from the mesothelium and submesothelial mesenchyme through a process of metaplasia .
this mllerian potential of the peritoneal serosal and adjacent mesenchyme makes it evident that they share mesodermal ancestry with the primary mllerian system , which derives from invaginated coelomic epithelium .
lauchlan called the areas secondary mllerian system which are present in the peritoneum and not restricted to females [ 3 , 4 ] . in reviews of cases of peritoneal mt ,
this disease was found to be associated with synchronous gynecologic tumors of mllerian duct origin ( i.e. , ovarian tumors , primary serous carcinoma of the peritoneum , fallopian tube cancer , endometrial cancer and cervix adenocarcinoma ) or colonic carcinomas and serous carcinoma of the peritoneum .
although this coexistence may be incidental , it may also imply a possible linkage between these tumors . sometimes , these tumors may appear along the clinical evolution of the first neoplasm ( metachronic ) . in most cases ,
mt including genital and extragenital locations are described in postmenopausal women older than 60 years who present risk factors such as obesity , nulliparity , exogenous estrogen or long - term tamoxifen use . here
, we report a case of a young woman with mt stage iiic of abdominal peritoneum origin without other associated tumors .
the patient was operated for hysterectomy and double oophorectomy 6 years before the diagnosis because of a benign disease ; she has no other relevant gynecological history and did not present any of the known risk factors for this neoplasm .
the pathologic stage at diagnosis seems to be the most reliable predictor of prognosis in mt of uterine origin .
although usually the prognosis of mt is poor , it seems to improve with combinations of treatments .
surgical excision is the most effective treatment and radiotherapy and various combinations of chemotherapy have achieved inconsistent results .
however , wong et al . observed that patients with mt of the uterus who received sequential adjuvant therapy , using cisplatin and ifosfamide chemotherapy and radiotherapy , had an improved survival rate . in our case ,
after that , the patient at first begun a combination of chemotherapy consisting of paclitaxel and carboplatin in a weekly schedule because of the regular general condition .
she tolerated the therapy well and presented with a marked decrease in serum levels of ca 125 .
this is the first case reported according to our knowledge in which the schedule of chemotherapy is performed weekly and with this combination of drugs .
it is relevant to bear these results in mind because this schedule might be an alternative to combination of cisplatin and ifosfamide , which are more toxic drugs . in summary ,
we report on a primary peritoneum neoplasm , exhibiting both carcinomatous and sarcomatous features , in a young woman without known risk factors who experienced a marked clinical benefit after cytoreductive surgery with a maximal effort and chemotherapy with a well - tolerated schedule . | extragenital malignant mixed mesodermal mllerian tumors ( mt ) are rare neoplasms with poor prognosis .
most of them affect women older than 60 years .
we present here a case with primary peritoneal malignant mixed mllerian tumor occurring in a young woman who underwent previous hysterectomy and double oophorectomy secondary to a benign disease .
we report on the clinical , pathological , and immunohistochemical features of this lesion , which was composed of a poorly differentiated epithelial component and multiple areas of chondromatous differentiation . along with a brief review of previously reported literature about genital and extragenital mt ,
some concepts relevant to this case are discussed . | Introduction
Case Report
Discussion |
although peripartum cardiomyopathy ( ppcm ) was first described in 1880 , much is still unknown about its etiology , epidemiology , characteristics , and clinical outcome .
the disease has a wide geographic spread , and is an important cause of heart failure ( hf ) in northern nigeria ; it is responsible for as high as 18.7% of all hf cases , and is as important as hypertension as a cause of hf among women .
it is believed that left ventricular ( lv ) function recovers in 2341% of ppcm patients over time , and mortality rates also vary widely and could be as high as 16% at 6 months . however , robust outcome data from many parts of the world with high disease prevalence is still lacking .
it is , therefore , imperative to study the disease in northern nigeria which has a modest health care capacity , in an attempt to better understand the disease .
therefore , the present study aimed to describe the 1-year survival and left ventricular reverse remodeling ( lvrr ) in a cohort of ppcm patients from three referral hospitals in kano , nigeria .
this was a longitudinal study carried out in three referral hospitals in kano , nigeria . before the commencement of the study , the research protocol was approved by the research ethics committees of the study centers and kano state hospitals management board .
the study conformed to the ethical guidelines of the declaration of helsinki , on the principles for medical research involving human subjects .
patients ' inclusion criteria were : ( i ) new diagnosis of ppcm before commencement of medical treatment ; ( ii ) onset of hf symptoms between last few months of pregnancy and first 5 months postpartum ; ( iii ) presenting between last few months of pregnancy and first 9 months postpartum ; ( iv ) at least 18 years of age ; ( v ) contact telephone number , except patients who gave reassurance that they were willing to attend the follow - up visits ; and ( vi ) giving written informed consent .
ppcm was defined according to the recommendations of the hf association of the european society of cardiology working group on ppcm , and lv systolic dysfunction was defined as left ventricular ejection fraction ( lvef ) < 50% . at the study sites ,
physicians and obstetricians were approached and requested to refer all patients with suspected ppcm to the principal investigator ( pi ) for further evaluation at no cost .
hospital in - patients with ppcm were clinically evaluated and underwent investigations within the first 48 h of admission .
demographic data , relevant aspects of history and physical signs , results of investigations , medications , co - morbid conditions , and complications were included in a detailed questionnaire . for patients who did not have contact telephone number but who agreed to participate , attending the 1 month follow - up with the supervising physician was used as evidence of commitment and for inclusion .
all patients were given appointment cards as a reminder , and were also telephoned to be informed of the 6 and 12 months follow - up visits . at the recruitment visit ,
each subject underwent a 12-lead electrocardiogram ( ecg ) at rest and transthoracic echocardiogram at the study centers according to standard recommendations .
the echocardiographic examination was carried out using sonoscape s8 doppler ultrasound system ( shenzhen , china , 2010 ) .
other baseline investigations recommended for the management of patients with ppcm were carried out in the laboratories of the study center , including plasma hemoglobin ; serum urea , electrolytes and creatinine ; blood counts ; liver enzymes ; and serum albumin .
the pi re - evaluated the patients at 6 and 12 months follow - up , using the same protocol as at recruitment including ecg and echocardiogram examinations , but blood tests were not repeated .
systemic hypertension was defined using standard cut - off values for systolic blood pressure ( sbp ) 140 mmhg and or diastolic blood pressure 90 mmhg .
anemia was defined as hemoglobin < 12 g / dl , according to the recommendation of the world health organization in nonpregnant women , renal impairment as serum creatinine > 176 mol / l ( > 2 mg / dl ) , hyponatremia as serum sodium < 135 mmol / l , and hypoalbuminemia as serum albumin < 35 g / l . of the standard echocardiographic recordings obtained , lvrr was defined as the presence of both absolute increase in lvef 10.0% and decrease in left ventricular end - diastolic dimension indexed to body surface area ( lveddi ) 33.0 mm / m , while recovered lv systolic function as lvef 55% , at 12 months follow - up .
lv diastolic function was defined and graded using transmitral flow and lv myocardial tissue doppler imaging velocities at the mitral annular level as follows :
normal lv diastolic function : e : a ratio 12 , deceleration time ( dt ) 160230 ms and e / e ' <
8.grade i left ventricular diastolic dysfunction ( lvdd ) ( impaired myocardial relaxation ) : e : a < 1.0 and dt > 240 ms.grade ii lvdd ( pseudonormalized pattern ) : e : a 11.5 , dt 160230 ms , e ' < 7 cm / s , and e / e ' > 15.0.grade iii lvdd ( restrictive filling ) : e : a > 2.0 , dt < 160 ms , e ' < 7 cm / s , and e / e ' > 15.0 .
normal lv diastolic function : e : a ratio 12 , deceleration time ( dt ) 160230 ms and e / e ' < 8 .
grade i left ventricular diastolic dysfunction ( lvdd ) ( impaired myocardial relaxation ) : e : a < 1.0 and dt > 240 ms . grade ii lvdd ( pseudonormalized pattern ) : e : a 11.5 , dt 160230 ms , e ' < 7 cm / s , and e / e ' > 15.0 .
grade iii lvdd ( restrictive filling ) : e : a > 2.0 , dt < 160 ms , e ' < 7 cm / s , and e / e ' > 15.0 . frequencies , mean , median , and inter - quartile ranges ( iqr ) were used to describe patients ' characteristics .
chi - squared , fisher 's exact , student t and mann whitney u - tests were used to compare categorical and continuous variables as appropriate .
spearman correlation coefficient and logistic regression models were used to assess potential associations between lvrr or mortality and variables of interest .
two - sided p < 0.05 was considered as the minimum level of statistical significance .
before the commencement of the study , the research protocol was approved by the research ethics committees of the study centers and kano state hospitals management board .
the study conformed to the ethical guidelines of the declaration of helsinki , on the principles for medical research involving human subjects .
patients ' inclusion criteria were : ( i ) new diagnosis of ppcm before commencement of medical treatment ; ( ii ) onset of hf symptoms between last few months of pregnancy and first 5 months postpartum ; ( iii ) presenting between last few months of pregnancy and first 9 months postpartum ; ( iv ) at least 18 years of age ; ( v ) contact telephone number , except patients who gave reassurance that they were willing to attend the follow - up visits ; and ( vi ) giving written informed consent .
ppcm was defined according to the recommendations of the hf association of the european society of cardiology working group on ppcm , and lv systolic dysfunction was defined as left ventricular ejection fraction ( lvef ) < 50% . at the study sites ,
physicians and obstetricians were approached and requested to refer all patients with suspected ppcm to the principal investigator ( pi ) for further evaluation at no cost .
hospital in - patients with ppcm were clinically evaluated and underwent investigations within the first 48 h of admission .
demographic data , relevant aspects of history and physical signs , results of investigations , medications , co - morbid conditions , and complications were included in a detailed questionnaire . for patients who did not have contact telephone number but who agreed to participate , attending the 1 month follow - up with the supervising physician was used as evidence of commitment and for inclusion .
all patients were given appointment cards as a reminder , and were also telephoned to be informed of the 6 and 12 months follow - up visits . at the recruitment visit ,
each subject underwent a 12-lead electrocardiogram ( ecg ) at rest and transthoracic echocardiogram at the study centers according to standard recommendations .
the echocardiographic examination was carried out using sonoscape s8 doppler ultrasound system ( shenzhen , china , 2010 ) .
other baseline investigations recommended for the management of patients with ppcm were carried out in the laboratories of the study center , including plasma hemoglobin ; serum urea , electrolytes and creatinine ; blood counts ; liver enzymes ; and serum albumin .
the pi re - evaluated the patients at 6 and 12 months follow - up , using the same protocol as at recruitment including ecg and echocardiogram examinations , but blood tests were not repeated .
systemic hypertension was defined using standard cut - off values for systolic blood pressure ( sbp ) 140 mmhg and or diastolic blood pressure 90 mmhg .
anemia was defined as hemoglobin < 12 g / dl , according to the recommendation of the world health organization in nonpregnant women , renal impairment as serum creatinine > 176 mol / l ( > 2 mg / dl ) , hyponatremia as serum sodium < 135 mmol / l , and hypoalbuminemia as serum albumin < 35 g / l .
of the standard echocardiographic recordings obtained , lvrr was defined as the presence of both absolute increase in lvef 10.0% and decrease in left ventricular end - diastolic dimension indexed to body surface area ( lveddi ) 33.0 mm / m , while recovered lv systolic function as lvef 55% , at 12 months follow - up .
lv diastolic function was defined and graded using transmitral flow and lv myocardial tissue doppler imaging velocities at the mitral annular level as follows :
normal lv diastolic function : e : a ratio 12 , deceleration time ( dt ) 160230 ms and e / e ' <
8.grade i left ventricular diastolic dysfunction ( lvdd ) ( impaired myocardial relaxation ) : e : a < 1.0 and dt > 240 ms.grade ii lvdd ( pseudonormalized pattern ) : e : a 11.5 , dt 160230 ms , e ' < 7 cm / s , and e / e ' > 15.0.grade iii lvdd ( restrictive filling ) : e : a > 2.0 , dt < 160 ms , e ' < 7 cm / s , and e / e ' > 15.0 .
normal lv diastolic function : e : a ratio 12 , deceleration time ( dt ) 160230 ms and e / e ' < 8 .
grade i left ventricular diastolic dysfunction ( lvdd ) ( impaired myocardial relaxation ) : e : a < 1.0 and dt > 240 ms . grade ii lvdd ( pseudonormalized pattern ) : e : a 11.5 , dt 160230 ms , e ' < 7 cm / s , and e / e ' > 15.0 .
grade iii lvdd ( restrictive filling ) : e : a > 2.0 , dt < 160 ms , e ' < 7 cm / s , and e / e ' > 15.0 .
frequencies , mean , median , and inter - quartile ranges ( iqr ) were used to describe patients ' characteristics .
chi - squared , fisher 's exact , student t and mann whitney u - tests were used to compare categorical and continuous variables as appropriate .
spearman correlation coefficient and logistic regression models were used to assess potential associations between lvrr or mortality and variables of interest .
two - sided p < 0.05 was considered as the minimum level of statistical significance .
a total of 72 patients were referred to the investigators with a diagnosis of ppcm based on clinical features and findings on chest radiograph .
after further evaluation including echocardiography , 18 subjects ( 25.0% ) were excluded and the remaining 54 ( 75.0% ) were confirmed to have ppcm , and all were of hausa fulani ethnic group [ figure 1 ] . of these 54 patients ,
29 had contact phone numbers and were contacted and the remaining 25 ( 46.3% ) did not have contact phone numbers , 4 ( 16.0% ) of whom qualified for follow - up .
overall , therefore , 33 patients were followed up as shown in figure 1 . when the 21 patients who did not have contact phone numbers and did not attend follow - up were compared with the 33 followed up patients , their baseline characteristics were similar ( p > 0.05 ) except for the lower mean hemoglobin in the former group ( 11.5 2.0 g / dl ) compared with the latter group ( 12.8 1.6 g / dl ) ( p = 0.026 ) .
flowchart of recruitment and follow - up of patients the age of the patients ranged between 18 and 45 years with a mean of 26.6 6.7 years , and 19 of them ( 35.2% ) were between 18 and 20 years , 24 ( 44.5% ) between 20 and 30 years , and the remaining 11 ( 20.4% ) were older than 30 years .
no patient had a history of smoking , diabetes mellitus , alcohol drinking , stroke , or morbid arrhythmias .
one patient had lv thrombus and developed lower limb gangrene needing bilateral below knee amputations .
screening for human immunodeficiency virus was not carried out and none of the recruited patients was known to have the disease .
patients ' body mass index ( bmi ) < 18.5kg / m ( under - weight ) was found in 14 ( 25.9% ) , 18.524.9 kg / m ( normal body weight ) in 29 ( 53.7% ) , 25.029.9 kg / m in 8 ( 14.8% ) , and 30.05 kg / m in only 2 ( 3.7% ) patients .
nine ( 16.7% ) patients had hypotension ( sbp < 100 mmhg ) and 25 ( 46.3% ) had pregnancy - induced hypertension at presentation .
two patients became pregnant again before the 6 months follow - up , and both survived follow - up ; their lvef increased from 43.5 5.0% at baseline to 52.5 5.0% and 54.5 3.5% at 6 and 12 months follow - up , respectively .
of the 17 survivors at 12 months follow - up , 5 ( 29.4% ) had recovered lv systolic function ( lvef 55% ) , 10 ( 58.8% ) had increased lvef of at least 10% , and 8 ( 47.1% ) had reduced lveddi 33.0 mm / m [ table 1 ] .
there was no relationship between the use of angiotensin converting enzyme inhibitors ( acei ) , angiotensin ii receptor blockers ( arb ) , beta - blockers ( p = 0.203 ) , other medications or echocardiographic variables ( p > 0.05 ) and lvrr ( p = 0.325 ) , in binary logistic regression models .
characteristics of patients with and without lv reverse remodeling of note , mean lvef , lvedd , as well as left atrial ( la ) size and new york heart association ( nyha ) functional class all significantly improved at 6 months ( p < 0.05 ) , but the differences between the 6 and 12 months follow - upvalues were not statistically significant ( p > 0.05 ) [ figure 2a ] .
furthermore , patients with lvrr had significantly shorter qrs duration than those without ( p = 0.003 ) .
at 12 months , qrs duration correlated negatively with lvef ( r = 0.602 ; p = 0.018 ) and positively with left ventricular mass index ( lvmi ) ( r = 0.612 ; p = 0 , 012 ) . however , these associations were not significant ( p > 0.05 ) at baseline or 6 months follow - up .
( a)pattern of changes in left ventricular ejection fraction and end - diastolic dimension , left atrial dimension , and symptoms in peripartum cardiomyopathy patients over 1-year , ( b ) pattern of changes in left ventricular diastolic dysfunction in peripartum cardiomyopathy patients over 1-year the pattern and changes over 1-year of the lvdd are illustrated in figure 2b . at baseline , lvdd was found in a total of 48 patients ( 88.9% ) and 6 ( 11.1% ) had normal function . of the patients with lvdd , 44 ( 91.7% ) had grade iii , 1 ( 2.1% ) had grade ii , while the remaining 3 ( 6.3% ) had grade i lvdd . at 6 months
follow - up , 12 patients ( 48.0% ) had normal lv diastolic function and 13 ( 52.0% ) had lvdd ( p = 0.003 compared with baseline results ) , while at 12 months 6 patients ( 35.3% ) had normal lv diastolic function and 11 ( 64.7% ) had lvdd ( p = 0.02 compared with baseline results )
. however , the prevalence of lvdd at 6 and 12 months follow - ups did not differ ( p = 0.414 ) .
of the 33 patients followed up , 12 died ( 36.4% ) , 8 ( 66.7% ) within the first 6 months and the remaining 4 ( 33.3% ) before the 12 months follow - up , four patients were lost to follow - up ( 12.1% ) , and 17 ( 51.5% ) completed the follow - up [ figure 1 ] .
the baseline characteristics of the 17 survivors ( 58.6% ) were similar to the deceased ( 41.4% ) except for lower serum albumin and lvmi , and higher plasma hemoglobin ( p < 0.05 ) [ table 2 ] . the mean nyha class for survivors reduced from 2.53 0.80 at baseline to 1.47 0.62 at 1-year follow - up ( p < 0.001 ) .
none of these or other variables including lvrr predicted mortality in the regression models ( > 0.05 ) . the median survival time from diagnosis for the deceased patients was 20.0 ( iqr = 926 ) weeks .
the age of the patients ranged between 18 and 45 years with a mean of 26.6 6.7 years , and 19 of them ( 35.2% ) were between 18 and 20 years , 24 ( 44.5% ) between 20 and 30 years , and the remaining 11 ( 20.4% ) were older than 30 years .
no patient had a history of smoking , diabetes mellitus , alcohol drinking , stroke , or morbid arrhythmias .
one patient had lv thrombus and developed lower limb gangrene needing bilateral below knee amputations .
screening for human immunodeficiency virus was not carried out and none of the recruited patients was known to have the disease .
patients ' body mass index ( bmi ) < 18.5kg / m ( under - weight ) was found in 14 ( 25.9% ) , 18.524.9 kg / m ( normal body weight ) in 29 ( 53.7% ) , 25.029.9 kg / m in 8 ( 14.8% ) , and 30.05 kg / m in only 2 ( 3.7% ) patients .
nine ( 16.7% ) patients had hypotension ( sbp < 100 mmhg ) and 25 ( 46.3% ) had pregnancy - induced hypertension at presentation .
two patients became pregnant again before the 6 months follow - up , and both survived follow - up ; their lvef increased from 43.5 5.0% at baseline to 52.5 5.0% and 54.5 3.5% at 6 and 12 months follow - up , respectively .
of the 17 survivors at 12 months follow - up , 5 ( 29.4% ) had recovered lv systolic function ( lvef 55% ) , 10 ( 58.8% ) had increased lvef of at least 10% , and 8 ( 47.1% ) had reduced lveddi 33.0 mm / m [ table 1 ] .
there was no relationship between the use of angiotensin converting enzyme inhibitors ( acei ) , angiotensin ii receptor blockers ( arb ) , beta - blockers ( p = 0.203 ) , other medications or echocardiographic variables ( p > 0.05 ) and lvrr ( p = 0.325 ) , in binary logistic regression models
. characteristics of patients with and without lv reverse remodeling of note , mean lvef , lvedd , as well as left atrial ( la ) size and new york heart association ( nyha ) functional class all significantly improved at 6 months ( p < 0.05 ) , but the differences between the 6 and 12 months follow - upvalues were not statistically significant ( p > 0.05 ) [ figure 2a ] .
furthermore , patients with lvrr had significantly shorter qrs duration than those without ( p = 0.003 ) .
at 12 months , qrs duration correlated negatively with lvef ( r = 0.602 ; p = 0.018 ) and positively with left ventricular mass index ( lvmi ) ( r = 0.612 ; p = 0 , 012 ) .
however , these associations were not significant ( p > 0.05 ) at baseline or 6 months follow - up .
( a)pattern of changes in left ventricular ejection fraction and end - diastolic dimension , left atrial dimension , and symptoms in peripartum cardiomyopathy patients over 1-year , ( b ) pattern of changes in left ventricular diastolic dysfunction in peripartum cardiomyopathy patients over 1-year
the pattern and changes over 1-year of the lvdd are illustrated in figure 2b . at baseline , lvdd was found in a total of 48 patients ( 88.9% ) and 6 ( 11.1% ) had normal function . of the patients with lvdd , 44 ( 91.7% ) had grade iii , 1 ( 2.1% ) had grade ii , while the remaining 3 ( 6.3% ) had grade i lvdd . at 6 months follow - up , 12 patients ( 48.0% ) had normal lv diastolic function and 13 ( 52.0% ) had lvdd ( p = 0.003 compared with baseline results ) , while at 12 months 6 patients ( 35.3% ) had normal lv diastolic function and 11 ( 64.7% ) had lvdd ( p = 0.02 compared with baseline results )
. however , the prevalence of lvdd at 6 and 12 months follow - ups did not differ ( p = 0.414 ) .
of the 33 patients followed up , 12 died ( 36.4% ) , 8 ( 66.7% ) within the first 6 months and the remaining 4 ( 33.3% ) before the 12 months follow - up , four patients were lost to follow - up ( 12.1% ) , and 17 ( 51.5% ) completed the follow - up [ figure 1 ] .
the baseline characteristics of the 17 survivors ( 58.6% ) were similar to the deceased ( 41.4% ) except for lower serum albumin and lvmi , and higher plasma hemoglobin ( p < 0.05 ) [ table 2 ] . the mean nyha class for survivors reduced from 2.53 0.80 at baseline to 1.47 0.62 at 1-year follow - up ( p < 0.001 ) .
none of these or other variables including lvrr predicted mortality in the regression models ( > 0.05 ) . the median survival time from diagnosis for the deceased patients was 20.0 ( iqr = 926 ) weeks .
the present study describes the 1-year mortality and lvrr of a cohort of ppcm patients recruited from three referral hospitals in kano , nigeria .
of the 33 patients ( 80% < 30 years old ) followed up , 47.1% had lvrr and 29.4% recovered lv systolic function .
of the 29 remaining patients after excluding the four lost to follow - up , 17 survived ( 58.6% ) and 12 died ( 41.4% ) during the follow - up period , with a median survival time of 20 weeks .
of the 17 survivors at 12 months follow - up , 47.1% satisfied the criteria for lvrr while 29.4% recovered lv systolic function .
there was no relationship between the use of hf medications or other variables and lvrr in the regression models .
in addition , significant improvement in mean lvef , lvedd , la size , lvdd , and nyha functional class had already manifested at 6 months , with no further significant improvement at 12 months follow - up .
lvdd was similar ; showing a maximum fall in its prevalence from 89% at baseline to 52% at 6 months follow - up .
therefore , lv recovery in our ppcm patients involved both systolic and diastolic functions , with maximum improvement achieved at 6 months follow - up in most patients , independent of aceis , arbs , and beta - blockers .
however , almost all the patients were treated with frusemide , spironolactone , and digoxin , as a treatment for hf .
our findings on lvrr seem to be similar to those previously reported from south africa ( 21% ) and haiti ( 28% ) but lower than what was reported from usa ( 54% ) likely because of the differences in the level of health care between the three countries .
furthermore , the achievement of maximum recovery within 6 months in our cohort of patients is also supported by fett et al . and elkayam .
finally , our inability to identify predictors of recovery of lv function or reverse remodeling , including hf medications , was similarly reported by fett et al . however , blauwet et al .
found older age and smaller lv end - systolic dimension to be significant predictors of lv recovery among south africans .
in addition , our results show that patients with lvrr had significantly shorter qrs duration than those without , and qrs duration correlated with lvef and with lvmi , but only at 1-year follow - up .
thus , aside from mechanical remodeling , our results also show that electrical remodeling does occur in ppcm , and is likely related to the progression or otherwise of the lv disease .
similar observations were previously made by shamim et al . among patients with dilated and ischemic cardiomyopathies .
progressive lv disease eventually results in increased myocardial stiffness and a rise in diastolic pressures . the resulting increase in lv filling pressures and consequent ischemia of the subendocardium
depolarization delay , which if prolonged could result in subendocardial fibrosis and permanent conduction disturbance .
thus , in dilated and dysfunctioning ventricles , progressive broadening of the qrs complex can be taken as a marker of worsening of the ventricular disease .
of the 29 patients with complete 12 months follow - up , 58.6% had significantly lower serum albumin and lvmi , and higher plasma hemoglobin than the deceased . however , none of these or other variables could predict mortality in regression models . two - thirds of the deaths occurred within 6 months of diagnosis while the remaining one - third died before the 12 months follow - up .
much lower mortality rates of 13.0% over 6 months in south africa , 15.3% over 2 years in haiti , and 28.0% over 5 years in usa , respectively , have been reported .
although some researchers did not identify any predictors of mortality in agreement with our finding , others reported inconsistent predictors of mortality including younger age at diagnosis , lower bmi , and echocardiographic variables .
it is clearly difficult to compare mortality results between studies given the varying follow - up times and several other challenges including the possible strong influence of sociopolitical crises on the mortality .
similar to our findings , 53.3% of those who died in the haiti study did so within 60 days after diagnosis .
whitehead et al . also reported that in a cohort of ppcm patients in the usa , 18% of deaths occurred within 1-week and 87% within 6 months of diagnosis .
therefore , most of the mortality in ppcm , as well as recovery , seem to occur within 6 months of diagnosis .
although the reasons for these observations are not clear , they seem to give hope to patients of better outcomes once they survive the first 6 months of the disease .
it is , therefore , imperative that patients are supported with optimal medical treatment to be able to survive the first 6 months of the disease .
first , natriuretic peptides and other biomarkers of hf were not assessed because the tests were not readily available at the study centers .
second , 21 out of 54 patients could not be followed up because they lacked phone numbers and so could not be contacted , and did not turn up for follow - up in spite of adequate counseling
. however , these patients had similar baseline characteristics as those followed up except for their lower mean hemoglobin levels .
of the 17 survivors at 12 months follow - up , 47.1% satisfied the criteria for lvrr while 29.4% recovered lv systolic function .
there was no relationship between the use of hf medications or other variables and lvrr in the regression models .
in addition , significant improvement in mean lvef , lvedd , la size , lvdd , and nyha functional class had already manifested at 6 months , with no further significant improvement at 12 months follow - up .
lvdd was similar ; showing a maximum fall in its prevalence from 89% at baseline to 52% at 6 months follow - up .
therefore , lv recovery in our ppcm patients involved both systolic and diastolic functions , with maximum improvement achieved at 6 months follow - up in most patients , independent of aceis , arbs , and beta - blockers .
however , almost all the patients were treated with frusemide , spironolactone , and digoxin , as a treatment for hf .
our findings on lvrr seem to be similar to those previously reported from south africa ( 21% ) and haiti ( 28% ) but lower than what was reported from usa ( 54% ) likely because of the differences in the level of health care between the three countries .
furthermore , the achievement of maximum recovery within 6 months in our cohort of patients is also supported by fett et al . and elkayam .
finally , our inability to identify predictors of recovery of lv function or reverse remodeling , including hf medications , was similarly reported by fett et al
found older age and smaller lv end - systolic dimension to be significant predictors of lv recovery among south africans .
in addition , our results show that patients with lvrr had significantly shorter qrs duration than those without , and qrs duration correlated with lvef and with lvmi , but only at 1-year follow - up .
thus , aside from mechanical remodeling , our results also show that electrical remodeling does occur in ppcm , and is likely related to the progression or otherwise of the lv disease .
similar observations were previously made by shamim et al . among patients with dilated and ischemic cardiomyopathies .
progressive lv disease eventually results in increased myocardial stiffness and a rise in diastolic pressures . the resulting increase in lv filling pressures and consequent ischemia of the subendocardium
depolarization delay , which if prolonged could result in subendocardial fibrosis and permanent conduction disturbance .
thus , in dilated and dysfunctioning ventricles , progressive broadening of the qrs complex can be taken as a marker of worsening of the ventricular disease .
of the 29 patients with complete 12 months follow - up , 58.6% had significantly lower serum albumin and lvmi , and higher plasma hemoglobin than the deceased . however , none of these or other variables could predict mortality in regression models . two - thirds of the deaths occurred within 6 months of diagnosis while the remaining one - third died before the 12 months follow - up .
much lower mortality rates of 13.0% over 6 months in south africa , 15.3% over 2 years in haiti , and 28.0% over 5 years in usa , respectively , have been reported .
although some researchers did not identify any predictors of mortality in agreement with our finding , others reported inconsistent predictors of mortality including younger age at diagnosis , lower bmi , and echocardiographic variables .
it is clearly difficult to compare mortality results between studies given the varying follow - up times and several other challenges including the possible strong influence of sociopolitical crises on the mortality .
similar to our findings , 53.3% of those who died in the haiti study did so within 60 days after diagnosis .
whitehead et al . also reported that in a cohort of ppcm patients in the usa , 18% of deaths occurred within 1-week and 87% within 6 months of diagnosis .
therefore , most of the mortality in ppcm , as well as recovery , seem to occur within 6 months of diagnosis .
although the reasons for these observations are not clear , they seem to give hope to patients of better outcomes once they survive the first 6 months of the disease .
it is , therefore , imperative that patients are supported with optimal medical treatment to be able to survive the first 6 months of the disease .
, natriuretic peptides and other biomarkers of hf were not assessed because the tests were not readily available at the study centers .
second , 21 out of 54 patients could not be followed up because they lacked phone numbers and so could not be contacted , and did not turn up for follow - up in spite of adequate counseling
. however , these patients had similar baseline characteristics as those followed up except for their lower mean hemoglobin levels .
this study has described the lvrr and 1-year survival of ppcm in three referral hospitals in kano , nigeria .
lvrr occurred in almost half the patients at 6 months but was not predicted by any clinical or echocardiographic variable .
our results also showed that lvrr was associated with shorter qrs duration which correlated with lvef and lvmi at 1-year follow - up , thus signifying electrical remodeling in ppcm .
finally , none of the variables predicted the 41.4% mortality , of which two - thirds occurred before the first 6 months follow - up .
the authors feel strongly that further studies should be carried out to better understand the disease . | background : peripartum cardiomyopathy ( ppcm ) is common in north - western nigeria .
this study aimed to describe the 1-year survival and left ventricular reverse remodeling ( lvrr ) in a group of patients with ppcm from three referral hospitals in kano , nigeria.methods:ppcm was defined according to recommendations of the heart failure ( hf ) association of the european society of cardiology working group on ppcm .
lvrr was defined as absolute increase in left ventricular ejection fraction ( lvef ) by 10.0% and decrease in left ventricular ( lv ) end - diastolic dimension indexed to body surface area 33.0 mm / m2 , while recovered lv systolic function as lvef 55% , at 12 months follow-up.results:a total of 54 newly diagnosed ppcm patients with mean age of 26.6 6.7 years , presented with classical features of predominantly left - sided hf and 33 of them qualified for follow - up . of the 17 survivors at 12 months , 8 patients ( 47.1% ) satisfied the criteria for lvrr , of whom 5 ( 29.4% ) had recovered lv systolic function ( lvef 55% ) , but lvrr was not predicted by any variable in the regression models .
the prevalence of normal lv diastolic function increased from 11.1% at baseline to 35.3% at 12 months ( p = 0.02 ) . at 1-year follow - up ,
41.4% of patients had died ( two - thirds of them within the first 6 months ) , but mortality was not predicted by any variable including lvrr.conclusions:in kano , ppcm patients had modest lvrr but high mortality at 1-year .
further studies should be carried out to identify reasons for the high mortality and how to curb it . | INTRODUCTION
METHODS
Clinical evaluation
Cardiac function assessment
Statistical analysis
RESULTS
Patients' baseline demographics and clinical characteristics
Left ventricular reverse remodeling
Left ventricular diastolic function
Mortality
DISCUSSION
Left ventricular reverse remodeling
Mortality in peripartum cardiomyopathy patients
Study limitations
CONCLUSIONS |
nematodes are of ancient origin and constitute one of the most speciose animal phyla . estimates of species numbers range from 100,000 to 100 million , although the upper limits may be exaggerated , perhaps by ten - fold ; approximately 25,000 nematodes have now been described ( hugot et al .
nematodes have engendered considerable interest in their population and evolutionary biology because they are remarkably adaptable to virtually every ecological habitat , resulting in a cosmopolitan distribution that features free - living and obligate plant and animal parasitic life histories .
a paucity of conserved , easily scored morphological characters impeded early systematic analysis . with the advent of dna sequencing , including mitochondrial dna ( mtdna ) sequence analysis , elucidating phylogenetic affinities among nematodes has dramatically accelerated .
nematode mitochondrial genomes typically encode an orthologous set of 12 ( or 13 ) protein coding genes , two organelle - specific ribosomal rna ( rrna ) and 22 transfer rna ( trna ) genes , a typical metazoan mtdna gene content .
alignment of individual and catenated mitochondrial gene and protein sequences , and the precise order in which these same genes are positioned along this compact , circular genome , has contributed to the deduction of phylogenetic affinities among nematodes and has altered the way nematologists view the evolution of the phylum . as of april 2010 ,
the phylum is divided into two major taxonomic classes , the chromadorea and the enoplea .
sampling of nematode mtdna sequences is biased ; 26 genbank entries are derived from the chromodorea whereas seven represent enoplean nematodes .
such a limited census represents a startling underrepresentation given the species - rich nature of the phylum .
nevertheless , this narrow sampling has unmasked the unexpected finding that the evolutionary dynamics of mitochondrial genomes dramatically differs between the two taxonomic classes .
chromadorean mtdna molecules reveal , with a few exceptions , conservation of genome size , gene order , the absence of lengthy sequence duplications , and an exceptional asymmetry in transcriptional architecture as all protein coding genes are encoded on one of the two dna strands .
these mitochondrial genomes tend to be of a relatively constrained length , ranging from 13.6 to 20.5 kb .
conservation in genome size is directly related to the absence of major sequence duplications . if repeated mtdna segments are present , they tend to be short , variable number tandem repeats ( vntrs ; lunt et al . 1998 ) that do not encompass coding regions .
mitochondrial vntrs have been successfully employed to address questions in the population dynamics of the phytopathogenic root - knot nematodes ( whipple et al .
1997 ) . of the 26 available chromadorean genera mitochondrial protein coding and rrna gene orders ( without considering trna genes that transpose at an accelerated rate ) , 19 are fully syntenic
2005 ) and is pictured below as a linear representation for illustrative purposes : coi coii rrnl nd3 nd5 nd6 nd4l rrns nd1 atp6 nd2 cytb coiii nd4 beyond the common g7 transcriptional organization , several additional gene orders have been described within the chromadorea .
one differs from g7 only by simple translocation of several gene clusters ( genbank accession nc_008534 ) .
four others are unique and syntenic affinities with the common transcriptional organization(s ) are not obvious ; these idiosyncratic gene orders may be lineage specific ( kang et al . 2009 ) .
more extensive sampling will be required to further understand the molecular evolution of mitochondrial gene order within the chromadorea .
standing in direct contrast to the relatively conserved nature of chromadorean mtdna molecules , rare syntenic conservation , frequent kilobase - sized sequence duplication , and the use of both dna strands to encode genes are signature architectural features defining mitochondrial genomes of enoplean nematodes .
the lengthy duplications generate mtdna molecules that range from 12.6 to approximately 34 kb ; these include one of the smallest known animal mtdnas ( xiphinema americanum encoding 17 of the expected 22 organelle - specific trnas ; he et al .
2005 ) as well as some of the largest mtdna molecules observed within the metazoa ( thaumamermis cosgrovei , featured below ) . unlike short mtdna vntrs
, lengthy repeated sequences within enoplean mitochondrial genomes often encompass gene coding regions , creating small mitochondrial multigene families , the generation of pseudogenes , and the opportunity for gene rearrangement inconsistent with a duplication - random loss mechanism ( boore and brown 1998 ) .
the striking absence of syntenic relationships among these mitochondrial genomes suggests a rapid pace of gene order change within the enoplea .
to address the occurrence and evolution of nematode mtdna sequence rearrangement , we are studying mitochondrial genome variation within a more confined enoplean taxonomic unit , the family mermithidae .
the mitochondrial genome carried by mosquito parasitic nematode romanomermis culicivorax was among the very first nematode mtdna molecules to be characterized ( powers et al .
unexpectedly , this mtdna molecule exhibited extensive size variation ( 2632 kb ) due to a 3.2 kb expanse duplicated to different copy numbers within individual mitochondrial genomes .
this lengthy repeated sequence included genes for nd3 and several trnas ; some repeating units were present in an inverted orientation relative to others , resulting in genes residing on both mtdna strands .
a comparative mitochondrial genomics study of the mermithid nematodes has now been undertaken for the purpose of understanding the molecular evolution of the unusual r. culicivorax mtdna architecture .
moreover , it was anticipated that exploring the evolution of mermithid mtdna might prove a useful paradigm for understanding the evolution of enoplean mitochondrial genomes .
mermithid nematode mtdna variation at the family , intergeneric , and conspecific taxonomic levels are summarized here . rolling
circle mtdna amplification ( tang and hyman 2005 ) coupled with conventional and high - throughput massively parallel sequencing has resulted in complete nucleotide sequences for 11 mermithid mitochondrial genomes including mtdnas derived from three romanomermis congeners ( wu 2007 ) and three t. cosgrovei individuals ( tang and hyman 2007 ; lewis and hyman unpublished ) . shared
architectural features among enoplean mtdna molecules are the presence of functional genes on both dna strands and the presence of lengthy repeated mtdna segments ( though the repeats are not orthologous among any of the mitochondrial genomes ) .
the difference in lengths of duplicated regions and copy numbers of these repeated sequences contribute to the wide size variation of enoplean mitochondrial genomes . strikingly , there are no obvious syntenic relationships among any of the mermthid mtdnas , nor are gene orders shared with two other enoplean mitochondrial genomes characterized by other laboratories ( tang 2006 ; wu 2007 ) . within the phylum nematoda ,
the nematode class enoplea is considered to be ancestral , with the chromadorea a more contemporary monophyletic derivation . as
such , it could be argued that the antiquity of the enoplea is reflected in the considerable divergence of mitochondrial gene order change relative to that observed among chromadorean nematodes .
this possibility can be further tested by examining the conservation of mitochondrial gene orders between more recently diverged congeners .
in general , congeners that have been sampled across the metazoa typically share identical or highly similar mtdna protein coding and rrna gene orders ( gissi et al . 2008 ) .
complete synteny among congeners has been observed in all six genera sampled from the chromadorean nematodes .
information on intrageneric gene order variation is currently available in one enoplid genus , romanomermis .
surprisingly , each of the three romanomermis congeners r. culicivorax , r. nielseni , and r. iyengari carry mitochondrial genomes with distinct gene orders ( fig . 1 ;
this observation suggests that mitochondrial gene order change is more rapid than can be easily explained by the presumed relative age of the chromadorean and enoplean lineages .
what lineage specific forces are at work to engender such rampant mitochondrial gene order change among the enoplids remains an open question.fig .
genes in white boxes are transcribed left to right ; boxed gene cluster is shared with a partial sequence from a fourth romanomermis sp .
this figure was re - printed from ( wu 2007 ) with permission of the author complete gene order of three romanomermis sp .
genes in white boxes are transcribed left to right ; boxed gene cluster is shared with a partial sequence from a fourth romanomermis sp .
this figure was re - printed from ( wu 2007 ) with permission of the author
thamamermis cosgrovei , an obligate mermithid parasitic nematode of the terrestrial isopod armadillidium vulgare , carries an atypically large , size - variable mitochondrial genome of 1934 kb .
remarkably , no two individuals share the same haplotype as revealed by rolling circle amplification of mtdna and subsequent physical characterization by restriction enzyme analysis ( fig . 2 ;
tang and hyman 2007 ) ; we have adopted the term hypervariation to describe this unexpected observation . for the purpose of illustrating the extent of hypervariation to the symposium audience , mtdna analysis of six t. cosgrovei individuals randomly chosen from 43 recently characterized nematodes , each carrying a unique haplotype , are presented are presented in fig .
total cellular dna was isolated from six t. cosgrovei individuals and used as template for rolling circle amplification of mtdna . pictured
are restriction products of bglii - cleaved mtdna size - fractionated by agarose gel electrophoresis .
arrows indicate bglii restriction products derived from the common region and shared among all haplotypes ; these fragments represent the common skeleton of the t. cosgrovei mitochondrial genome containing all but one mitochondrial gene .
the remaining bands that are not shared among haplotypes are derived from the hypervariable region as described in the text .
lane 1 , 1 kb - ladder ; lanes 27 , mtdna haplotype hypervariation among t. cosgrovei individuals .
total cellular dna was isolated from six t. cosgrovei individuals and used as template for rolling circle amplification of mtdna . pictured
are restriction products of bglii - cleaved mtdna size - fractionated by agarose gel electrophoresis .
arrows indicate bglii restriction products derived from the common region and shared among all haplotypes ; these fragments represent the common skeleton of the t. cosgrovei mitochondrial genome containing all but one mitochondrial gene .
the remaining bands that are not shared among haplotypes are derived from the hypervariable region as described in the text .
lane 1 , 1 kb - ladder ; lanes 27 , mtdna the t. cosgrovei mitochondrial genome encodes the same 36 genes ( 12 protein , 22 trna and 2 rrna coding sequences ) typically found in nematode mtdnas ( tang and hyman 2007 ) .
the atpase subunit 8 gene is absent , as is the case for all other nematode mtdnas characterized to date with the exception of trichinella spiralis ( lavrov and brown 2001 ) .
the t. cosgrovei mtdna molecule can be divided into two expanses : a constant region , identified by a common ensemble of restriction enzyme products that is shared among all haplotypes and contains most of the coding regions , and a hypervariable segment that houses the small mitochondrial rrna ( rrns ) gene and four mitochondrial trna genes ( trnf , trnh , trnv , trnw ) .
this locus also contains partial , non - functional pseudogene copies of nd4 , atp6 and in some haplotypes a remnant rrns copy . the frequent and large scale conspecific size variation ( hypervariability ) is a consequence of extensive dna duplication within this region , coupled with frequent sequence rearrangement .
duplicated gene copies reveal a complex organization in that they are interspersed with six different dna sequence motifs 91293 bp in length of unknown function ( elements a through e ; tang and hyman 2007 ) .
variation of both length and sequence organization of the hypervariable region can be ascribed to differences in the copy number and arrangement of different combinations of these genes , pseudogene copies , and non - coding sequence elements .
no shared haplotypes are found when individual t. cosgrovei nematodes are sampled from within local populations or from geographically isolated populations separated by 4050 km . on occasion
rare , multiply - infected isopod hosts can be recovered ( tang and hyman , 2007 ) .
individual nematodes harvested from the host as a brood appear to carry the same mtdna haplotype .
this observation suggests that ( 1 ) isopods may be passively infected by ingesting egg clutches from a single maternal source prior to egg hatching or ( 2 ) actively infected by recently hatched , multiple infectious j2 stage nematodes derived from a single maternal lineage , prior to dispersal in the soil .
nematodes have been singled out as a taxon with mtdna evolutionary dynamics that differ from most other metazoa ( blaxter 2002 ; gissi et al .
this premise is the experimental demonstration that nematode mitochondrial genomes undergo intra - molecular recombination ( lunt and hyman 1997 ) , a process that may be absent in many other metazoan lineages .
recombination processes seem the most plausible mechanism to explain the diversity of transcriptional organizations and hypervariation summarized here .
current taxonomic status of the nematoda bifurcates the phylum into two classes : the chromadorea and the enoplea .
gene orders for 26 chromadorean mitochondrial genomes can be inferred from complete nucleotide sequences available in public databases and reveal common features of a limited mtdna size range , unidirectional transcription , and easily recognizable syntenic relationships . of the 26 chromadorean genera with completely sequenced mitochondrial genomes , 19 share the same gene order ( g7 ; he et .
conservation of gene order across wide distances within the chromadorea is consistent with the hypothesis that the chromadorea is a monophyletic group , as inferred from the nuclear 18s small subunit rna gene sequence data ( deley and blaxter , 2002 ) .
the most common transcriptional organization ( g7 ) , or one of a very similar genetic architecture , may represent the mtdna molecule transmitted at the ancestral speciation event leading generation of the chromadorea .
why is it that the evolutionary dynamics of mitochondrial genomes appears to differ between the two major nematode taxonomic classes ? while it is tempting to propose a bottleneck that generated a small population of progenitor mtdna molecules and at present we are surveying an early window in chromadorean evolution , this hypothesis may be too simplistic .
mitochondrial genomes from but 26 chromadorean genera have been characterized , a sample size that may be too modest ; the few idiosyncratic
mitochondrial gene orders that have been described may ultimately prove not to be exceptional , indicating rates of change between the two nematode classes is not as different as currently perceived .
evolutionary time alone appears not to be the exclusive factor in the observed class distinction between mitochondrial genome diversity levels .
the rampant congener gene order variation associated with romanomermis mtdna suggests changes in mtdna synteny can occur over more modest time intervals that define speciation events ; hypervariation of t. cosgrovei mitochondrial genomes indicate that change can occur in real - time .
moreover , it can not yet be ascertained if enoplean nematode mtdna variation has been generated at a consistent trajectory through time or is episodic . because congener comparisons appear to reflect mitochondrial genome plasticity at higher taxonomic levels ( gissi et al .
2008 ) , it will be important to discover if romanomermis is unique among the enoplean lineages with respect to the rapidity of mtdna gene order change .
if the observed mtdna plasticity is a consequence of genetic recombination ( lunt and hyman 1997 ) , requisite enzymatic machinery in the form of recombinases is likely involved .
mitochondrial gene order changes and related processes such as hypervariation within specific lineages may be due to a loss or gain of the ability to target these proteins to the organelle .
studies on the mechanistic enzymology of nematode mitochondrial genome rearrangement in species such as m. incognita and t. cosgrovei , where real - time mtdna variation has been characterized ( lunt and hyman , 1997 ; tang and hyman 2007 ) should provide another layer of understanding as to why the evolutionary dynamics of mitochondrial genomes varies throughout the phylum . | rare syntenic conservation , sequence duplication , and the use of both dna strands to encode genes are signature architectural features defining mitochondrial genomes of enoplean nematodes .
these characteristics stand in contrast to the more conserved mitochondrial genome sizes and transcriptional organizations of mitochondrial dnas ( mtdnas ) derived from chromadorean nematodes . to address the frequency of gene rearrangement within nematode mitochondrial dna ( mtdna ) ,
mitochondrial genome variation has been characterized within a more confined enoplean taxonomic unit , the family mermithidae .
the complete nucleotide sequences of the mosquito parasitic nematodes romanomermis culicivorax , r. nielseni , and r. iyengari mtdna have been determined .
duplicated expanses encompassing different regions of the mitochondrial genomes were found in each of these congeners .
these mtdna shared few rrna and protein gene junctions , indicating extensive gene rearrangement within the romanomermis lineage .
rapid structural changes are also observed at the conspecific level where no two individual nematodes carry the same haplotype . rolling circle amplification
was used to isolate complete mitochondrial genomes from individuals in local populations of thaumamermis cosgrovei , a parasite of terrestrial isopods .
mitochondrial dna length variants ranging from 19 to 34 kb are observed , but haplotypes are not shared between any two individuals .
the complete nucleotide sequences of three haplotypes have been determined , revealing a constant region encoding most mitochondrial genes and a hypervariable segment that contains intact and pseudogene copies of several mitochondrial genes , duplicated to different copy numbers , resulting in mtdna size variation .
constant rearrangement generates new t. cosgrovei mtdna forms . | Introduction
Class distinctions in nematode mtDNA evolutionary dynamics
Mitochondrial genome plasticity in the nematode family mermithidae
Mitochondrial genome plasticity among mermithid congeners
Hypervariation: an extreme example of conspecific mtDNA variation
Conclusions |
the three closely related genera of dermatophytes : trichophyton , microsporum , and epidermophyton usually cause superficial infections of skin , hair , and nail . the various clinical forms caused by dermatophytes are tinea capitis , tinea faciei , tinea unguium , tinea manuum , tinea corporis , tinea pedis , tinea barbae , tinea cruris and tinea gladiotorum .
an article on tinea capitis in botswana has already been published by the author.1 one of the most prevalent species of this group is trichophyton rubrum.2,3 rarely these pathogens may cause a more aggressive and invasive infection.4,5 dermatophyte infections are common in hiv patients and occur at some point during their illness.6,7 it has been estimated that these infections may not occur any more frequently in hiv patients than in control groups.8 one study has reported an apparently higher prevalence of onychomycosis in hiv - positive patients relative to general patients visiting dermatologic clinics.9 the severity and variability of presentation are more common in hiv / aids.10,11 in severely immunosuppressed patients with aids , lesions may have little inflammation and often lack the elevated border and central clearing typical of tinea ( anergic tinea).7 they may resemble sharply marginated lesions of dry skin .
goodman et al observed that the prevalence of dermatophytosis was four times higher amongst hiv infected individuals.12 bizarre presentations and failure to respond to treatment should alert care providers to the possibility of an underlying immunologic problem.13 some of the dermatophyte species are cosmopolitan in distribution , but some species , which are confined to a particular geographical region , can no longer remain geographically restricted , because of frequent travel and migration .
though t. rubrum is a very common cause of dermatophyte infection all over the world , it can be rare in some geographical regions . in some regions of africa ,
from january 2009 to december 2010 , samples were collected from 450 patients with a clinical diagnosis of dermatophytosis .
samples were collected in the microbiology section of the national health laboratory , gaborone , botswana .
all the samples were submitted for potassium hydroxide ( koh ) 10%20% mount ( figure 1 ) and fungal culture .
skin scrapings and nail clippings were collected after cleaning the suspicious area with 70% alcohol . in case of tinea capitis ,
we used a scalpel blade and the wet swab for collecting hair and scales.1 for the collection of samples from the suppurative lesions , especially from children suffering from tinea capitis , sterile swabs were used . in case
the lesions had vesicles and bullae , the top of the vesicles and bullae was clipped off and added to the sample .
diagnosis of pityriasis versicolor was made on the typical morphology of skin scrapings in 10% koh , which resembles spaghetti and meatball . for suspected
deeper lesions like majocchi s granuloma , punch biopsy was collected in a sterile container for koh and culture , and the remaining tissue was sent to the histology section in formol saline .
incubation of sabouraud plate at 37c was done for 57 days to identify yeasts ( candida ) .
germ tube test , morphological characteristics on corn meal agar , and chromagar candida were performed for speciation .
a non - dermatophyte fungus was considered relevant only when on microscopic examination , fungal hyphae , spores or yeast cells were seen on repeat culture , and the same species of non - dermatophyte fungus was isolated . if direct microscopy was negative but cultures positive , the case was included .
cases with positive direct microscopy and with a negative culture were excluded . where more than one site yielded the same organism , the case was counted as a single infection .
where more than one species was found in different sites or at the same site both species were counted . teased mount preparations were made in lacto phenol cotton blue stain to study the microscopic structures .
urease test and in vitro hair perforation tests were done for the confirmation of trichophyton interdigitale species .
also , other standard tests required for the identification of the dermatophyte species were done in accordance with the textbooks , manuals , and journals.1519
trichophyton violaceum was found to be the most common species responsible for most of the clinical forms of dermatophytosis ( n=96 [ 80% ] ) ( tables 1 and 2 and figures 25 ) .
next in frequency was t. interdigitale ( n=16 [ 3.33% ] ) ( figures 68 ) .
other species isolated were trichophyton tonsurans ( n=5 [ 4.16% ] ) ( table 1 and figure 9 ) , epidermophyton floccossum ( n=2 [ 1.66% ] ) ( table 1 ) and only one case of microsporum ferrugineum 0.83% ( table 1 and figure 10 ) .
tinea unguium was found to be the predominant clinical form ( n=33 [ 27.50% ] ) ( figures 11 and 12 ) .
though tinea unguium is common in older people and the incidence increases with age , but in our study , no such association was found ( table 3 ) and it was statistically insignificant .
other clinical forms in descending order were tinea corporis ( n=24 [ 20% ] ) ( figures 11 and 13 ) , tinea capitis ( n=21 [ 17.50% ] ) ( figures 11 and 14 ) , tinea faciei ( n=19 [ 15.83% ] ) , ( figure 11 ) , tinea pedis 15 ( 12.50% ) ( figure 15 ) , tinea manuum ( n=4 [ 3.33% ] ) and also tinea cruris ( n=4 [ 3.33% ] ) .
involvement of all the nails of both hands ( figure 12a ) was found in three cases , but in one case koh mount and culture was negative , so it was excluded from the study .
we isolated t. violaceum from the remaining two cases and the involvement of nails was of endonyx type ( figure 12 ) .
tinea capitis was the most common clinical form in children below 10 years ( 76.2%)1 ( figure 14 ) .
tinea capitis is common in younger age groups , below 20 years ( table 3 ) and statistically significant .
extensive lesions of tinea corporis without central clearing were seen in few hiv / aids patients ( figure 13 ) .
one of the patients suffering from tinea manuum appears to have acquired the infection in south africa .
he gave the history of having played soccer in south africa , and within 2 weeks of returning from there , he started complaining of itching , and was prescribed steroid cream .
his condition did not improve and skin scrapings were collected and cultured , which yielded growth of t. tonsurans ( figure 9 ) .
positive cases for superficial fungal infections :
dermatophytes ( 120 cases)candida ( five cases)malassezia species ( five cases)non - dermatophyte moulds in onychomycosis ( four cases ) dermatophytes ( 120 cases ) malassezia species ( five cases ) non - dermatophyte moulds in onychomycosis ( four cases )
t. violaceum was found to be the predominant species , and was found to be the causative organism for most of the clinical forms .
tinea unguium of the fingernails was found to be due to t. violaceum , and in two hiv cases ten fingers involvement was found .
two cases of tinea unguium of the toenails were due to t. interdigitale and one was due to t. tonsurans .
it has been observed that there has been a rise and fall of certain species of dermatophytes .
this could have been due to the change of habitat , war , better medical facilities , and more effective drugs .
there has not been any major study in botswana before and after the hiv / aids era .
the only relevant information available is in vismer and findlay s published data about botswana , and in which , they reported trichophyton schoenleinii and t. violaceum.20 we did not isolate t. schoenleinii in our study , but t. violaceum was found to be the predominant species .
botswana has got high prevalence of hiv / aids , and dermatophytic lesions in hiv / aids patients can be deep , widespread , and atypical .
we did not isolate t. rubrum in any of the samples . since we did not isolate t. rubrum from any of the patients in our study or in any samples referred to our laboratory from various hospitals and clinics , we can assume , that t. rubrum could be rare .
the reason for the less involvement of the toenails could be due to either absence or rarity of t. rubrum in botswana .
t. rubrum is the most prevalent species of dermatophyte in many geographical regions of the world .
it has been found responsible for causing tinea pedis and tinea unguium in a vast majority of cases .
the history of onychomycosis is analogous to that of t. rubrum , the major causative fungal pathogen involved in the pathogenesis of onychomycosis and tinea pedis.21 increased population mobility that resulted from world wars , mass migration , and recreational travel led to the translocation and subsequent distribution of t. rubrum from its original endemic regions to the new ecological environments in europe and america.21,22 in the united states , the first documented case of onychomycosis is said to have been reported in 1928.21,23 world war ii and the korean and vietnam wars , increased participation in fitness activity , the occlusive footwear and periodic and migratory movement of populations , have contributed towards the increased prevalence of tinea pedis and onychomycosis in the 20th century.24 after the vietnam war , t. rubrum surpassed t. interdigitale as the most commonly isolated dermatophyte worldwide.24 so , the involvement of the toenail is more common in the countries , where , t. rubrum is the predominant species , and involvement of finger nails could be more prevalent in our study because of t. violaceum being the predominant species . in brief ,
tinea pedis is the source of infection for the toenail infections ; and tinea capitis and tinea corporis could be the source of infection for the fingernails in our study .
also , in the literature , there is only one case report of toenail onychomycosis due to t. violaceum.25 since we did not know the hiv status of all the patients , we can not know if tinea unguium was more prevalent in hiv infected individuals
. a larger study is needed in which the hiv status of all enrolled cases should be known .
t. violaceum was found to be the predominant dermato - phyte species and tinea unguium was found to be the most frequent clinical type . in our study ,
involvement of fingernails was more frequent as compared to toenails , 26 and three respectively .
involvement of fingernails in all the cases was found due to t. violaceum , which presented both unilateral ; involving 24 fingers ; and bilateral , involving all ten fingers ( figure 12a and b ) .
it appears that the source of infection for tinea unguium of fingernails is the scalp .
it has been mentioned by mapelli et al.25 both the scalp and fingernails can remain potential sources of infection to the person himself and to others , because it can be transmitted easily to others .
both these conditions require both dermatological and mycological expertise for the appropriate treatment and follow - up . | backgrounddermatophyte infections are a common cause of superficial fungal infection in different geographical locations of the world .
usually , it involves superficial invasion of keratinized tissue , eg , skin , nails , and hair , but in immunosuppressed individuals , it may cause atypical , extensive and deep lesions , which may pose serious diagnostic and therapeutic challenges.aimto find out the causative dermatophyte species responsible for the various clinical types of dermatophyte infection.resultstrichophyton violaceum was found to be the predominant species , being the causative organism responsible for all the clinical types.conclusiont .
violaceum was found to be the most common species responsible for most of the clinical forms of dermatophytosis ( 96 ; 80% ) .
tinea unguium was found to be the most frequent clinical type of dermatophytosis ( 33 ; 27.50% ) . | Introduction
Material and methods
Results
Discussion
Conclusion |
the present study aimed to collate the findings from observational studies reporting psychological distress among amputees in india . the search strategy included electronic search engine databases : pubmed , psychinfo , and google scholar .
the keywords for the search were amputation , india , and psychological distress or depression or anxiety or posttraumatic stress disorder .
unpublished material and nonpeer - reviewed material were not included as a part of the review , and hand searches of libraries were not conducted as a part of the present review .
the present review included observational studies published in peer - reviewed english language journals pertaining to psychological distress .
nonlimb amputation was also not included in the present review . those studies which did not report the prevalence of psychological distress in the study sample
full texts of these abstracts were searched . upon careful reading of the studies , 4 of 16 were not included in the review as they did not report the prevalence of psychological distress in the study sample . they were analysis and discuss the epidemiology , services and rehabilitation of amputees in india , prevalence , etiology , levels of amputation , rehabilitation after amputation , and effect of anxiety , and depression on unilateral transtibial amputees .
the review included 12 published articles based on ten study samples as mentioned in table 1 .
the causes of amputation had been primarily traumatic ones ( accidents - motor vehicle accident and railway track accidents , machinery injury , blasts , etc . ) although other causes were also represented in the sample of amputees .
in addition , lower limb amputation was noted in majority of cases than upper limb amputation and among them , most amputation performed with one limb .
assessment methods included clinical impression and diagnosis , as well as used of structured scales such as beck depression inventory , beck hopelessness scale , carroll rating scale for depression , general health questionnaire , hamilton anxiety rating scale , hamilton depression rating scale , hospital anxiety depression scale , mini - international neuropsychiatric interview state - trait anxiety inventory , structured clinical interview for dsm disorder , and trauma symptom inventory .
follow - up studies show that rates of anxiety and depression decrease over a period of time .
phantom limb phenomenon had been observed in a considerable proportion of patients with amputations ( 14%92% ) associated with pain , telescopy , and movement .
the search strategy included electronic search engine databases : pubmed , psychinfo , and google scholar .
the keywords for the search were amputation , india , and psychological distress or depression or anxiety or posttraumatic stress disorder .
, further studies were identified from the cross references . unpublished material and nonpeer - reviewed material
were not included as a part of the review , and hand searches of libraries were not conducted as a part of the present review .
the present review included observational studies published in peer - reviewed english language journals pertaining to psychological distress .
nonlimb amputation was also not included in the present review . those studies which did not report the prevalence of psychological distress in the study sample
full texts of these abstracts were searched . upon careful reading of the studies , 4 of 16 were not included in the review as they did not report the prevalence of psychological distress in the study sample . they were analysis and discuss the epidemiology , services and rehabilitation of amputees in india , prevalence , etiology , levels of amputation , rehabilitation after amputation , and effect of anxiety , and depression on unilateral transtibial amputees .
the review included 12 published articles based on ten study samples as mentioned in table 1 .
the causes of amputation had been primarily traumatic ones ( accidents - motor vehicle accident and railway track accidents , machinery injury , blasts , etc . ) although other causes were also represented in the sample of amputees . in addition , lower limb amputation was noted in majority of cases than upper limb amputation and among them , most amputation performed with one limb .
assessment methods included clinical impression and diagnosis , as well as used of structured scales such as beck depression inventory , beck hopelessness scale , carroll rating scale for depression , general health questionnaire , hamilton anxiety rating scale , hamilton depression rating scale , hospital anxiety depression scale , mini - international neuropsychiatric interview state - trait anxiety inventory , structured clinical interview for dsm disorder , and trauma symptom inventory .
the rates of depression reported in the studies varied from 10.4 to 63% . rates of ptsd have ranged from 3.3% to 56.3% .
follow - up studies show that rates of anxiety and depression decrease over a period of time .
phantom limb phenomenon had been observed in a considerable proportion of patients with amputations ( 14%92% ) associated with pain , telescopy , and movement .
the present review suggests that indian literature pertaining to psychological effects of amputation has gradually accrued over time .
the studies have been heterogeneous and have attempted to understand the psychological impairment and psychiatric disorders among the amputees from different perspectives .
the studies though have been consistent in finding that a substantial proportion of those individuals who undergo amputation do suffer from psychological distress and psychiatric disorders .
the prevalence of psychiatric disorders among amputees has been found to be in the range of 32%84% .
these rates are generally high as compared to population - based psychiatric prevalence studies conducted in india .
however , the case controls studies in the present study provided an inconclusive picture .
the study by bhojak and nathawat found a lower level of hopelessness among surgical controls , while the study by mozumdar and roy found a comparable level of depression among non - amputated healthy males . the rates of depression and ptsd also have been alarming in some of the studies .
the findings of this review call for adept management of the psychological distress among the amputees . depression and anxiety are common problems among patients who have suffered from amputation .
both the antecedent circumstances preceding the amputation and the irreversible procedure of amputation itself may contribute to the occurrence of symptoms of psychological distress .
the surgical treatment providers need to liaise with psychiatrists and psychologists so that a comprehensive evaluation occurs when required and treatment of psychiatric disorders if identified can be initiated .
previous literature suggests that symptoms of anxiety and depression become better over the course of time although patient may need support from various sources while coming to terms with the impairment .
the numbers of studies which have followed up patients over a period of time are quite limited .
since indian social support system and health - care delivery services are quite different from the western world , the changes with time in the psychological distress and psychiatric morbidity can give a glimpse of remedial and accentuating factors .
moreover , studies need to consistently need to use standardized methods of making psychiatric diagnoses and eliciting symptoms using scales .
consistent subgroup analysis of traumatic and nontraumatic amputations can help discern the acuity of the psychological distress in these two groups .
moreover , intervention studies need to be conducted to assess the effectiveness of interventions among the amputees in the local context . | amputation is a major health burden on the families , society , and on medical services as well .
traumatic limb amputation is a catastrophic injury and an irreversible act which is sudden and emotionally devastating for the victims .
in addition , it causes inability to support self and the family and driving many patients toward various psychiatric disorders .
extensive information regarding the effects of amputation has not been ascertained and therefore it was decided to do a systematic review . the goal of this review was to provide comprehensive information of peer - reviewed papers examining the psychological distress among amputees in india .
a search of the literature resulted in a total of 12 articles with varied sample size from 16 to 190 .
the sample has been largely comprised males with lower limb amputation caused by primarily traumatic ones , i.e. , motor vehicle accident , railway track accidents , machinery injury , blasts , etc .
, the prevalence of psychiatric disorders among amputees has been found to be in the range of 32% to 84% including depression rates 10.4%63% , posttraumatic stress disorder 3.3%56.3% , and phantom limb phenomenon 14%92% . although the studies reported that symptoms of anxiety and depression become better over the course of time , however surgical treatment providers need to liaise with psychiatrists and psychologists to support and deal with the psychological disturbances . | METHODOLOGY
Search strategy
Study selection
Data extraction
RESULTS
DISCUSSION
Financial support and sponsorship
Conflicts of interest |
meningoencephaloceles are defined as herniation of brain tissue through a defect of the skull and can be classified according to their location21 ) .
common areas are occipital , cranial vault , fronto - ethmoidal and posterior fossa encephaloceles , while basal encephaloceles account for only 1.5% of cases6 ) .
the subgroup of basal encephaloceles can further be differentiated in transethmoidal , spheno - ethmoidal , fronto - sphenoidal or sphenoorbital and transsphenoidal ( temporo - sphenoidal ) encephaloceles21 ) .
a frequent first symptom of a temporo - sphenoidal encephalocele is cerebrospinal fluid ( csf)-rhinorrhea2,9,13 ) with consecutive recurrent meningitis11 ) .
the majority of cases occur during childhood19 ) , however , a number of reports described encephaloceles that manifested in adults2,11,17 ) .
papanikolaou et al.17 ) presented an overview of different origins of skull base defects , which can lead to a herniation of brain tissue ( table 1 ) . in this report
we present the case of a 35-year - old female patient with csf - rhinorrhea and a first - time seizure .
brain tissue had herniated through a bone defect of the middle cranial fossa into the lateral sphenoid sinus .
a 35-year - old female patient was referred to the department of otolaryngology ( ent ) because of recurrent clear nasal discharge after an infection .
a 2-transferrin - test of the nasal fluid was positive , proving csf - rhinorrhea .
diagnostic imaging ( high - resolution computed tomography , hrct ) of the paranasal sinus showed a defect of the skull base in the area of the roof of a far lateral recessus of the right sphenoid sinus .
1 ) . in a first therapeutic approach by the ent department an exploration of the right sphenoid sinus via an endonasal approach was performed .
further exploration localized the origin of csf in a far lateral recessus of the right sphenoid sinus , but it was not possible to directly visualize the pathological area .
an ethmoidectomy was performed and it was attempted to stop the leakage by covering the bone and sealing the lateral recess with a fibrinogen und thrombin patch . in spite of this effort , the leakage of csf persisted . an intravenous antibiotic treatment with clindamycin
a post operative mri revealed , besides a discontinuation of the skull base in the lateral area of the roof of the right sphenoid sinus ( t1 weighted images ) , a herniation of brain tissue .
due to an adjacent severe inflammatory reaction and the extrinsic fibrinogen and thrombin patch , visualization of the encephalocele was challenging .
the fluid - sensitive sequences ( t2-weighted / fluid attenuated inversion recovery ) showed increased signal of the right anterior temporal lobe , which was in line with the diagnosis of encephalitis ( fig .
the patient was transferred to the department of neurosurgery for further treatment . on admission ,
because of the initial clinical course , the mri results ( inflammatory reactions of the temporal lobe ) and a following operation with resulting additional irritation of the temporal lobe we decided to establish an anticonvulsive therapy with levetiracetam perioperatively . a frontotemporal craniotomy and exploration of the middle fossa was performed with neuronavigation support .
the encephalocele was visualized and resected and the dural defect was closed using galea , a fibrinogen and thrombin patch ( " tachosil " ) and fibrin glue ( fig .
histological analysis was performed of two samples taken from the herniated brain tissue and confirmed a meningoencephalocele .
after craniotomy , csf - rhinorrhea had successfully been stopped and surveillance on intensive care unit was without any complication . a post - operative control cranial computed tomography scan showed no complications . one week later , the asymptomatic patient was discharged .
three months later , csf - rhinorrhea reappeared without the presence of another encephalocele , as evidenced by an additional mri . in the second attempt to close the dural defect
the patient had gotten a lumbar drainage in the perioperative period . via the old fronto - temporal approach the illustration of the middle cranial fossa revealed that the galea - fibrinogen - thrombin - patch completely disappeared .
the reason for this remains uncertain , perhaps it was related to the inflammatory milieu of the adjacent tissue .
closure of the defect was done with temporalis fascia , another fibrinogen - thrombin patch and fibrin glue .
invasive intracranial pressure ( icp ) measurement detected a raised icp . with dose increase of levetiracetam and a shunting procedure
there were no further episodes of csf - rhinorrhea and no more seizures reported at follow - up .
the application of levetiracetam had been stopped without any further appearance of seizures . in the two year
follow - up mri the inflammatory area of the fronto - mesial temporal lobe and the encephalocele were no longer detectable ( fig .
this case demonstrates a temporo - sphenoidal encephalocele that became clinically apparent by csf - rhinorrhea and a first time seizure .
the sphenoid sinus is a rather rare location for encephaloceles and depending on the topography of the encephalocele different clinical symptoms may occur .
based on the literature a classification of basal encephaloceles with regard to topography and clinical symptoms can be summarized ( table 2 ) . for a temporo - sphenoidal encephalocele in adulthood ,
an epileptic seizure is not a common clinical sign , nevertheless an association between seizures and this special entity of encephaloceles has been well documented18,23 ) . a variety of structural changes of the herniated parenchyma or the adjacent cerebral tissue such as meningoangiomatosis23 ) , reactive gliosis or even extension of the reactive gliosis to the amygdalohippocampal lesion16 ) are suggested to lead to the clinical sign of a first time seizure . in addition , there is also a body of evidence that inflammatory and immune mediators initiate seizures and epileptogenesis7 ) .
etiological explanations of encephaloceles are quite heterogeneous . in general , classification differs between spontaneous and acquired skull base defects17 ) .
furthermore , a differentiation of encephaloceles between congenital ( childhood ) and idiopathic ( adulthood ) encephaloceles was made17 ) .
the temporo - sphenoidal encephalocele often protrudes through the foramen caecum ( patent craniopharyngeal canal ) .
catala5 ) suggested that the persistence of the craniopharyngeal canal may play a crucial role in the appearance of temporo - sphenoidal encephaloceles . besides
, regarding the embryology of the sphenoid bone , it is known that in mammals the alisphenoid and the basi - pre - sphenoid are of neural crest cell origin , otherwise the orbitosphenoid and the basi - post - sphenoid derive from the cephalic mesoderm5 ) . in consequence ,
the sphenoid bone is a complex structure which contains parts of different origin regarding its derivates and genetic control5 ) , which makes it vulnerable to defects which may result in predilection sites for possible herniations9 ) .
some authors found that sternberg 's canal ( membranous space in the lateral wall of the sphenoid sinus ) is associated with spontaneous csf - rhinorrhea and meningoencephaloceles in the lateral recess of sphenoid sinus22 ) .
interestingly , there is an aerated lateral recess of the sphenoid sinus ( pterygoid recess ) in up to 10% of the normal population , which has been assumed to act as a pathway between the middle fossa and the paranasal sinuses and may subsequently lead to encephalocele with potential csf - flow through the sinus9 ) .
furthermore , arachnoid pits and decreased stability of the skull base lateral to the sites of fusion of ossification centers could be responsible for encephaloceles and could result in a secondary acquired leak3 ) .
regarding the mechanism of the protruding brain tissue in cases of far lateral sphenoid encephalocele through these skull base defects , pithole enlargement in the skull base due to normal intracranial pressure variations might play a crucial role9 ) .
a classification and differentiation by location between the rare lateral sphenoid and the more common perisellar encephaloceles seems to be useful2,12 ) . for the perisellar encephaloceles endoscopic surgery
stopping the csf flow with this variant is challenging but also less invasive than the transcranial approach22 ) .
in contrast , for the cases of the lateral sphenoid encephaloceles , the frontotemporal approach seems to be the best choice11,13,18 ) .
hereby , a controlled resection of the encephalocele with a good overview of the operation area is possible11,13 )
. the endoscopic transnasal approach may still be successful for surgical ablation of the encephalocele and repair of the bony defect in some cases12 ) .
however , in keeping with our case presented here , landreneau et al.13 ) reported of patients with lateral sphenoid encephaloceles which had undergone unsuccessful transnasal attempts and required a transcranial middle fossa approach for successful treatment .
some authors reported of a sphenoidal encephalocele in adulthood with csf - flow into the sinus where invasive icp measurement after intervention with closure of the defect showed raised intracranial pressure10 ) .
besides this , mechanisms had been described , where csf production increases because of the chronic rhinorrhea4 ) . for these cases a shunting procedure ( ventriculoperitoneal , lumboperitoneal ) solved those problems4,10 ) . in our case
a lumbar drainage in the perioperative period ensured the preservation of the success of the second operation regarding the arrest of the rhinorrhea .
because of raised icp a shunting procedure was necessary . in our opinion , a precise topographical classification of encephaloceles based on familiar classifications21 ) with previous precise localisation of the encephalocele and the skull base defect with the help of hrct and mri is the key for the choice of the right intervention . for the choice of the suitable strategy some goals of surgery have to be considered : removal of herniation , sealing of the defect , preservation of functional neuronal tissue and , if necessary , normalisation of raised intracranial pressure or raised csf - flow via a shunting procedure11 ) . regarding this ,
it is necessary for the choice of the approach to precisely know the topographical and extension details of the defect , pneumatisation of the sphenoid sinus , csf pressure , symptoms and recurrence of symptoms because of insufficient intervention and experience of the surgeon with the different strategies11 ) .
besides the right choice of intervention , involved specialists of otolaryngology , neurology and neurosurgery should be aware of the rare entity of a temporo - sphenoidal encephalocele in case of the combination of recurrent rhinorrhea and a first time seizure . | this case report describes the symptoms and clinical course of a 35-year - old female patient who was diagnosed with a temporo - sphenoidal encephalocele .
it is characterized by herniation of cerebral tissue of the temporal lobe through a defect of the skull base localized in the middle fossa . at the time of first presentation
the patient complained about recurrent nasal discharge of clear fluid which had begun some weeks earlier .
she also reported that three months earlier she had for the first time suffered from a generalized seizure . in a first therapeutic attempt an endoscopic endonasal approach to the sphenoid sinus
was performed .
an attempt to randomly seal the suspicious area failed .
after frontotemporal craniotomy , it was possible to localize the encephalocele and the underlying bone defect .
the herniated brain tissue was resected and the dural defect was closed with fascia of the temporalis muscle .
in summary , the combination of recurrent rhinorrhea and a first - time seizure should alert specialists of otolaryngology , neurology and neurosurgery of a temporo - sphenoidal encephalocele as a possible cause .
treatment is likely to require a neurosurgical approach . | INTRODUCTION
CASE REPORT
DISCUSSION
CONCLUSION |
gastric cancer is the second leading cause of cancer - related death , with the highest mortalities in east asia , including japan , korea , and china.1 d2 gastrectomy is commonly regarded as the standard surgical procedure for advanced gastric cancer in east asia .
however , over 40% of patients experience cancer recurrence after gastrectomy.2 s-1 is an oral fluoropyrimidine comprising tegafur , gimeracil ( cdhp ) , and oteracil potassium , and is used as a standard postoperative adjuvant chemotherapy agent in patients with stage ii or iii gastric cancer in japan.3 the phase iii adjuvant chemotherapy trial of s-1 for gastric cancer ( acts - gc ) found that 34.2% of patients had discontinued s-1 at 1 year post - surgery.4 this low completion rate of s-1 treatment remains a clinically - unresolved issue , though information on the reasons for discontinuation is sparse .
in addition , a post - hoc analysis of the acts - gc trial data , which have not been published in a journal , showed that patients who completed the planned 1-year s-1 treatment survived longer than patients who discontinued s-1 .
however , data on compliance , dose reduction , and treatment schedule modifications during s-1 adjuvant chemotherapy in gastric cancer patients in clinical practice are lacking .
adjuvant chemotherapy aims to increase the probability of a cancer cure , and increasing the currently low completion rate of s-1 adjuvant chemotherapy is thus an important issue .
identification of the risk factors associated with discontinuation of s-1 adjuvant chemotherapy would allow clinicians and community pharmacists to support patients with those risk factors .
we therefore retrospectively investigated the risk factors for discontinuation of s-1 adjuvant chemotherapy in patients with gastric cancer .
this retrospective observational study was carried out at ehime university hospital using electronic medical record data .
we extracted the necessary clinical information on patient demographics , compliance , treatment outcomes , and toxicities . between august 2006 and february 2014 , we investigated patients with curatively - resected gastric cancer who received s-1 adjuvant chemotherapy .
s-1 was administered at 80 - 120 mg / day , depending on body surface area ( bsa ) , on days 1 - 28 every 6 weeks ( in principle ) for 1 year , in the absence of recurrence , unacceptable side effects , or patient refusal .
patients with a bsa < 1.25 m received 80 mg / day ; patients with a bsa of 1.25 - 1.5 m received 100 mg / day ; and patients with a bsa > 1.5 m received 120 mg / day .
the dose or treatment schedule of s-1 was modified at the clinicians ' discretion , according to the toxicity profiles .
the clinicopathologic findings were determined in accordance with the japanese classification of gastric carcinoma.5 consenting patients with stages i - iv ( m0 ) gastric cancer were candidates for adjuvant chemotherapy .
creatinine clearance ( ccr ) was calculated using the cockcroft - gault formula by adding 0.2 mg / dl to the serum creatinine level measured by the enzymatic peroxidase - antiperoxidase method.6 according to the pharmaceutical company 's guide , we categorized each initial s-1 dose for patients with a ccr < 60 ml / min as an underdose , standard dose , or overdose .
for example , patients with a bsa > 1.5 m received 120 mg / day standard dose , but patients with a low ccr < 60 ml / min received a standard dose of 100 mg / day .
a total of 88 patients were enrolled , but 17 were subsequently excluded because of hospital transfer ( n=10 ) , ongoing treatment ( n=3 ) , or a ccr of < 30 ml / min ( n=4 ) . the 71 remaining patients were assessed and relapse - free survival ( rfs ) and overall survival ( os ) were compared between patients who completed the schedule s-1 treatment ( s-1-completed group ) and those who discontinued treatment ( s-1-discontinuation group ) .
a further analysis was performed to assess the risk factors associated with s-1 discontinuation after the exclusion of seven patients who discontinued s-1 because of relapse ( n=64 ) .
the study protocol was approved by the ethics committee of ehime university hospital ( approval number : 1402005 ) and was conducted in accordance with the ethical principles of the japanese ethics guidelines for epidemiological studies .
rfs was defined as the interval from the date of surgery to the date when relapse was confirmed by computed tomography or positron emission tomography - computed tomography , death from any cause , or last follow - up , whichever came first .
os was defined as the interval from the date of surgery to the date of death from any cause or last follow - up .
rfs and os were compared between the s-1-completed and s-1-discontinuation groups using the kaplan - meier method .
hazard ratios ( hrs ) for relapse and death were compared between the completed and discontinuation groups using log - rank tests .
patient characteristics and side effects were compared using student 's t , welch 's t , and tests , as appropriate .
multivariate logistic regression analysis was used to evaluate the risk factors associated with s-1 discontinuation .
possible explanatory variables with p<0.05 in univariate analysis were included in the multivariate model . cut - off values for continuous variables such as serum albumin and ccr were calculated using receiver operating characteristic ( roc ) curves and categorized as categorical variables .
the relative dose intensity ( rdi ) of s-1 was defined as the actual dose divided by the planned dose during the period of s-1 treatment .
all analyses were performed using jmp 8.0 ( sas institute , tokyo , japan ) .
this retrospective observational study was carried out at ehime university hospital using electronic medical record data .
we extracted the necessary clinical information on patient demographics , compliance , treatment outcomes , and toxicities . between august 2006 and february 2014 , we investigated patients with curatively - resected gastric cancer who received s-1 adjuvant chemotherapy .
s-1 was administered at 80 - 120 mg / day , depending on body surface area ( bsa ) , on days 1 - 28 every 6 weeks ( in principle ) for 1 year , in the absence of recurrence , unacceptable side effects , or patient refusal .
patients with a bsa < 1.25 m received 80 mg / day ; patients with a bsa of 1.25 - 1.5 m received 100 mg / day ; and patients with a bsa > 1.5 m received 120 mg / day .
the dose or treatment schedule of s-1 was modified at the clinicians ' discretion , according to the toxicity profiles .
the clinicopathologic findings were determined in accordance with the japanese classification of gastric carcinoma.5 consenting patients with stages i - iv ( m0 ) gastric cancer were candidates for adjuvant chemotherapy .
creatinine clearance ( ccr ) was calculated using the cockcroft - gault formula by adding 0.2 mg / dl to the serum creatinine level measured by the enzymatic peroxidase - antiperoxidase method.6 according to the pharmaceutical company 's guide , we categorized each initial s-1 dose for patients with a ccr < 60 ml / min as an underdose , standard dose , or overdose .
for example , patients with a bsa > 1.5 m received 120 mg / day standard dose , but patients with a low ccr < 60 ml / min received a standard dose of 100 mg / day .
a total of 88 patients were enrolled , but 17 were subsequently excluded because of hospital transfer ( n=10 ) , ongoing treatment ( n=3 ) , or a ccr of < 30 ml / min ( n=4 ) . the 71 remaining patients were assessed and relapse - free survival ( rfs ) and overall survival ( os ) were compared between patients who completed the schedule s-1 treatment ( s-1-completed group ) and those who discontinued treatment ( s-1-discontinuation group ) .
a further analysis was performed to assess the risk factors associated with s-1 discontinuation after the exclusion of seven patients who discontinued s-1 because of relapse ( n=64 ) .
the study protocol was approved by the ethics committee of ehime university hospital ( approval number : 1402005 ) and was conducted in accordance with the ethical principles of the japanese ethics guidelines for epidemiological studies .
rfs was defined as the interval from the date of surgery to the date when relapse was confirmed by computed tomography or positron emission tomography - computed tomography , death from any cause , or last follow - up , whichever came first .
os was defined as the interval from the date of surgery to the date of death from any cause or last follow - up .
rfs and os were compared between the s-1-completed and s-1-discontinuation groups using the kaplan - meier method .
hazard ratios ( hrs ) for relapse and death were compared between the completed and discontinuation groups using log - rank tests .
patient characteristics and side effects were compared using student 's t , welch 's t , and tests , as appropriate .
multivariate logistic regression analysis was used to evaluate the risk factors associated with s-1 discontinuation .
possible explanatory variables with p<0.05 in univariate analysis were included in the multivariate model . cut - off values for continuous variables such as serum albumin and ccr were calculated using receiver operating characteristic ( roc ) curves and categorized as categorical variables .
the relative dose intensity ( rdi ) of s-1 was defined as the actual dose divided by the planned dose during the period of s-1 treatment .
all analyses were performed using jmp 8.0 ( sas institute , tokyo , japan ) .
seventy - one patients were included in the study , 26 patients ( 36.6% ) of whom discontinued s-1 therapy .
there were no significant differences between the s-1-completion and s-1-discontinuation groups in terms of baseline characteristics , except for ages , serum albumin levels , and ccr levels ( table 1 ) .
the rfs rates at 5 years post - surgery in the s-1-completed and s-1-discontinuation groups were 88.1% and 55.8% , respectively ( fig .
the hr for relapse in the s-1-completed group compared with that in the discontinuation group was 0.18 ( 95% confidence interval [ ci ] 0.04 - 0.38 ; p<0.001 ) , indicating that completing s-1 treatment reduced the risk of relapse by 82% .
the os rates at 5 years post - surgery in the s-1-completed and s-1-discontinuation groups were 89.4% and 59.8% , respectively ( fig .
the hr for death in the s-1-completed group compared with that in the discontinuation group was 0.19 ( 95% ci 0.04 - 0.49 ; p=0.002 ) .
we subsequently evaluated the risk factors associated with s-1 discontinuation , excluding seven patients who discontinued s-1 because of relapse .
digestive symptoms and hematological toxicity of any grade were frequent side effects of s-1 ( table 2 ) .
the reasons for s-1 discontinuation were side effects in 16 patients ( 84.2% ) and patient refusal in three patients ( 15.8% ) ( table 3 ) .
dose reduction was required during treatment in 20 patients ( 44.4% ) in the s-1-completion group and five patients ( 26.3% ) in the s-1-discontinuation group .
the treatment schedule was modified during treatment in 42 patients ( 93.3% ) in the s-1-completion group and eight patients ( 42.1% ) in the discontinuation group .
univariate analysis revealed that s-1 discontinuation was not significantly associated with age , s-1 modification / dose reduction during treatment , surgical procedure , complications including diabetes mellitus or hypertension , prescription of prophylactic antidiarrheal , laxative , probiotic , and antiemetic agents , prescription of therapeutic antidiarrheal , probiotic , and antiemetic agents , side effects including vomiting , diarrhea , stomatitis , anorexia , dysgeusia , pigmentation , skin rash , lacrimation , anemia , thrombocytopenia , and others .
variables that showed a significant difference in univariate analysis were included in a multivariate model .
multivariate logistic regression analysis revealed that s-1 discontinuation was significantly associated with an initial overdose of s-1 , having stage i cancer , ccr < 66 ml / min , and a side effect of nausea ( fig .
there is currently little information on the optimal management of s-1 adjuvant chemotherapy in patients with gastric cancer in the clinical practice setting .
the present study showed that the s-1 discontinuation rate was 36.6% , which was similar to the dropout rate identified in the previous acts - gc trial.4 in addition , patients who completed s-1 chemotherapy benefited from lower relapse and death rates than those who discontinued s-1 chemotherapy , suggesting that it was a very important evidence to maintain a continuous administration of s-1 after gastrectomy in patients with gastric cancer .
furthermore , multivariate logistic regression analysis demonstrated the first report that s-1 discontinuation was significantly associated with an initial overdose of s-1 , having stage i cancer , a ccr < 66 ml / min , and a side effect of nausea .
recent studies reported that the dose of s-1 should take into consideration the renal function of each patient , with the aim of enabling patients to complete 1 year of s-1 treatment.2,7,8 s-1 includes cdhp , an inhibitor of dihydropyrimidine dehydrogenase ( dpd ) , which is the rate - limiting enzyme for the degradation of fluorouracil.9 cdhp clearance depends on renal function , resulting in high blood concentrations of fluorouracil because of reduced dpd activity .
this may lead to severe and/or frequent s-1-induced side effects in patients with low ccr levels .
yamanaka et al . reported that baseline renal function was a significant risk factor for severe neutropenia caused by s-1 chemotherapy in advanced gastric cancer.10 iwasa et al .
reported that patients with low ccr levels tended to require s-1 dose reduction.7 a recent 6-month study found that ccr < 60 ml / min was a significant risk factor for discontinuation of s-1 adjuvant chemotherapy.8 our results showed that s-1 discontinuation was significantly associated with an initial overdose of s-1 and ccr < 66 ml / min .
we excluded four patients with ccr < 30 ml / min because the pharmaceutical company 's guidance cites ccr < 30 ml / min as a contraindication to s-1 therapy .
the appropriate initial dose of s-1 of 80 - 120 mg / day should thus take into consideration not only bsa , but also pretreatment ccr level , paying particular attention to patients with ccr < 66 ml / min .
clinicians and community pharmacists can provide support for patients with the above risk factors . in the present study ,
the dose of s-1 was reduced in 44.4% of patients in the s-1-completed group , which was comparable to that in the acts - gc trial ( 46.5% ) .
reported that the planned 1 year s-1 adjuvant therapy for stage ii or iii gastric cancer could be completed in most patients by modifying the dose and/or treatment schedule.7 kim et al .
, however , reported that a decreased rdi was related to poor dfs in patients with stage ii - iv gastric cancer who underwent curative surgery and received s-1 adjuvant chemotherapy.2 in this study the hrs for relapse and death in the s-1-completion group were significantly lower ( 0.18 and 0.19 , respectively ) than those in the discontinuation group .
the average rdi in the s-1-completion group was 94.4% with a 95% ci of 53.6 - 127.1% .
however , we were unable to calculate the optimal rdi cut - off value using an roc curve because of the small sample size .
previous studies found that persistent gastrointestinal toxicities , even of low grade , were the major reason for patient refusal to continue s-1 treatment.4,7 in the present study , s-1-induced digestive symptoms were relatively common side effects , as seen in the acts - gc trial .
our results showed that having stage i cancer and a side effect of nausea were risk factors for discontinuing s-1 adjuvant chemotherapy .
it is possible that s-1 adjuvant chemotherapy might be associated with both less benefit and more side effects in patients with stage i cancer , resulting in patient refusal to continue treatment .
however , a dose - reduction of one level should be considered in patients with uncomfortable digestive symptoms : from 120 mg to 100 mg / day , from 100 mg to 80 mg / day , or from 80 mg to 60 mg / day .
maximum effort should be made to maintain dose intensity , in light of these results .
first , it was a retrospective , single - institution study with a small sample size .
second , we assessed consenting patients with stages i - iv disease ( m0 ) who were candidates for adjuvant chemotherapy , whereas patients with stage ii or iii gastric cancer were eligible for the acts - gc trial.4 there may thus have been some bias in our results .
large - scale , multicenter studies are needed to confirm the results of this study . this study is the first to clarify the risk factors for discontinuation of s-1 adjuvant chemotherapy 1 year post - surgery in patients with gastric cancer in a clinical setting , using multivariate logistic regression analysis .
the results suggest that patient renal function should be assessed to avoid initial s-1 overdose .
early management of s-1-induced side effects , especially nausea , may also support the continuation of s-1 adjuvant chemotherapy in patients with gastric cancer . | purpose : the aim of this study was to clarify the risk factors for discontinuing tegafur / gimeracil / oteracil potassium ( s-1 ) adjuvant chemotherapy following gastrectomy in patients with gastric cancer.methods : we retrospectively investigated patients with curatively - resected gastric cancer who received s-1 adjuvant chemotherapy .
s-1 was administered orally at 80 - 120 mg / day , depending on body surface area , on days 1 - 28 every 6 weeks for 1 year .
the dose and treatment schedule were modified at the clinicians ' discretion , according to toxicity.results : seventy - one patients were included in the study , 26 of whom discontinued s-1 therapy .
the relapse - free survival rates in the s-1-completed and s-1-discontinuation groups at 5 years post - surgery were 88.1% and 55.8% , respectively .
the overall survival rates in the s-1-completed and s-1-discontinuation groups at 5 years post - surgery were 89.4% and 59.8% , respectively .
the hazard ratios for relapse and death were significantly lower in the s-1-completed group compared with those in the s-1-discontinuation group ( 0.18 ; p<0.001 and 0.19 ; p=0.002 , respectively ) .
multivariate logistic regression analysis revealed that s-1 discontinuation was significantly associated with an initial overdose of s-1 , having stage i cancer , creatinine clearance < 66 ml / min , and a side effect of nausea.conclusions : these results suggest that assessing renal function to avoid initial overdose of s-1 , together with the early management of side effects , may support the continuation of s-1 adjuvant chemotherapy in patients with gastric cancer . | Introduction
Materials and methods
Patients and study design
Statistical analysis
Results
Discussion |
in the 1990s , smithkline beecham ( skb ) and connaught laboratories independently conducted extensive laboratory and animal studies of ospa vaccines and then launched highly publicized phase iii clinical trials involving large numbers of volunteers and clinical sites ( sigal et al .
the main difference between the two vaccines was that skb 's lymerix contained an aluminum adjuvant ( often used to boost immunity ) , while connaught 's imulyme did not ( which theoretically might lead to fewer side effects ) . in order to maximize the signal - to - noise ratio in a disease whose
diagnostic criteria and boundaries had long been subject to intense controversy , both trials used narrow , objective criteria for what would constitute a lyme disease case in the study population .
definite lyme disease was defined as the presence of erythema migrans ( em , the characteristic ld rash ) or objective neurologic , musculoskeletal , or cardiovascular manifestations of ld , plus laboratory and/or biopsy confirmation ( of rash ) of infection .
such criteria maximized the specificity of the diagnosis and minimized the possibility of mistakenly seeing no preventive effect of a vaccine when one existed , which might result if many wrong or questionable cases were counted as ld .
subjects who received the full three doses had at least a 75 percent reduction in definite ld compared with the controls , and in the second year of the lymerix trial ( the only one to study this question ) , there were no cases of asymptomatic infection ( defined by laboratory evidence of infection without symptoms ) in the treated group .
the absence of asymptomatic seropositives among the vaccinated could be understood as powerful evidence of vaccine efficacy because asymptomatic seropositive cases are ascertained only by objective measures , unlike clinical diagnoses , which might be counted mistakenly on the basis of how trial subjects perceived and reported symptoms and sought medical care and of differences in physicians diagnostic practices .
in both trials , only a small fraction of initially suspected cases were confirmed as definite lyme disease ( in the 10% to 20% range ) , suggesting widespread overdiagnosis ( or , alternatively , that the diagnostic criteria were too narrow ) . because these data were from the carefully observed conditions of a well - funded clinical trial , a much larger problem certainly existed in everyday clinical practice . at the same time , a high percentage ( 30% ) of cases confirmed by biopsies of skin rashes in the lymerix trial were not accompanied by positive serology , suggesting that underdiagnosis was also present in the world outside trials , especially when clinicians depended on serology , for example , in cases presenting without the characteristic rash or after the rash was gone .
the fda licensed lymerix in 1998 after a hedged recommendation for approval by its vaccines and related biological products advisory committee ( vrbpac ) .
it 's rare that a vaccine be voted on with such ambivalence and a stack of provisos ( altman 1998 , a1 ) .
after the fda 's approval , recommendations for use in clinical practice were taken up by the highly influential advisory committee on immunization practices ( acip ) of the centers for disease control and prevention ( cdc ) .
some acip members considered lymerix to be a yuppie vaccine , its manufacturer - driven and consumer - driven
market limited to worried suburbanites who will pay a lot of money for their nikes and their esprit and shop at l.l .
bean 's will have no consideration for cost - effectiveness when they want a vaccine because they re going to travel to cape cod
acip members concerned with this yuppie vaccine steered the committee to a lukewarm should consider
recommendation for people at high risk and a may be considered for others exposed to tick - infested habitat but whose exposure is neither frequent nor prolonged ( acip 1998 ) .
acip member paul offit ( personal communication , 2011 ) noted that it was highly unusual for such a lukewarm recommendation to be given to a vaccine approved by the fda .
in addition to the small numbers of people who would unambiguously benefit , support for lymerix among regulators and advisory boards was hedged because ( 1 ) the trials had excluded children , limiting the vaccine 's use until the efficacy and safety for children were established ; ( 2 ) boosters would probably be needed to keep a high enough concentration of antibodies in the tick meal to kill spirochetes ; and ( 3 ) concern that vaccine 's side effects might appear with a longer follow - up ( especially concerns about vaccine - induced arthritis , discussed later ) .
connaught 's anticipated market edge for imulyme may have evaporated when the vaccine was not proved to be any safer than the skb product in the efficacy trials.1 leonard sigal ( personal communication , july 6 , 2011 ) , the lead investigator on the connaught vaccine trial , believed that the manufacturer concluded that marketing and other costs would be greater than the low revenues expected from the sales .
connaught 's competition , skb , also had superior resources and experience to market its vaccine in the united states .
stanley plotkin ( personal communication , july 18 , 2011 ) , a prominent vaccine researcher and consultant to the pharmaceutical industry , believed that there were record - keeping problems in the connaught trial that would have made regulatory approval difficult .
although not privy to connaught 's decision - making process or drivers , loren cooper ( personal communication , august 11 , 2011 ) , an skb lawyer , offered that it was not uncommon for one vaccine company to look at the experience of others when making development decisions .
in this instance , connaught may have anticipated that the controversy surrounding lymerix would also impact its vaccine and presciently decided to stop the bleeding rather than pursue a vaccine unlikely to be commercially successful .
one early warning sign of these problems was the report that volunteers in the clinical trials were suing vaccine manufacturers for the harm they experienced ( rierden 1996 ) .
many of the problems with low demand were predictable far in advance of the pharmaceutical companies decisions to withdraw their products .
in most parts of the united states , the disease is rare ; it can be successfully treated by antibiotics and is not deadly .
most experts believe that complications like arthritis , bell 's palsy ( temporary yet scary facial nerve paralysis ) , heart block , and back pain are infrequent , respond to treatment , and , even if untreated , eventually resolve .
infection can be prevented by individual measures such as tick checks and protective clothing . to the degree that these measures are a burden , a vaccine could never totally supplant them anyway because ticks carry other infectious diseases besides ld and vaccine efficacy is never 100 percent . because there is no person - to - person ld transmission ,
even the most effective vaccine would offer no protection to the unvaccinated ( i.e. , no herd immunity ) .
so it remains puzzling why connaught invested so much in vaccine development and its successful phase iii clinical trial only to withdraw the vaccine before fda approval or , similarly , why skb anticipated a much larger market .
i return to this puzzle later . at the time of the fda 's licensing of lymerix
, there were only limited data on the vaccine 's long - term safety and the duration of immunity . since the rationale for a vaccine against a mild and easily treated disease affecting small populations in specific regions remained marginal , regulators and others had an understandably cautious , wait - and - see attitude toward the vaccine 's safety , mandating skb to conduct postmarketing surveillance ( skb agreed to set up a novel , hmo - based surveillance system ) . at the time of licensing ,
regulators and others were quite concerned that the vaccine might induce an autoimmune reaction that would result in arthritis and other complications resembling the late complications of lyme disease ( discussed in greater detail later ) .
on the efficacy side , there was great interest in whether the vaccine might prevent the intermediate and long - term neurological , rheumatological , and other effects of the disease .
but since the trials led to the prompt diagnosis and treatment of cases in both the experimental and control groups , such effects were rarely seen . during the 1998 vrbac meeting , dr .
thomas fleming pressed allen steere , the discoverer of ld and the chief investigator of the lymerix trial , and others for evidence that the vaccine prevented these feared chronic manifestations .
steere told the committee that there were virtually no chronic or systemic problems , only one case of trigeminal neuropathy and one with lyme arthritis .
since these sequelae also were rare in the placebo group , a reasonable interpretation of the very low rate of chronic or systemic problems was that the trial led to the prompt diagnosis and treatment of ld cases and that such treatment was very effective at warding off later problems .
when the vrbpac met again in 2001 to review the safety and efficacy of lymerix after more than two years on the market , skb officials continued to argue that the vaccine was safe.2 there was no evidence of a pattern of serious side effects reported from either the usual adverse event reporting or the hmo surveillance program . despite some evidence of a link between the vaccine and musculoskeletal problems
in all those studies the nature and the frequency of the adverse events were similar to the pre - licensure clinical trial experience , concluded skb researcher dr .
but many lyme disease activists and others at the advisory board meeting already had turned against the vaccine in a major way and were not buying skb 's assurances about its safety .
vaccine recipients at the meeting claimed that their health had been severely and negatively impacted by the vaccine .
i m not as knowledgeable as this distinguished panel of experts that i speak to today , asserted one lay witness .
it was lymerix which somehow had this devastating effect on my seventeen - year - old child
some advisory panel members were puzzled by the disconnect between the reassuring adverse event reporting and the surveillance data presented by the skb officials and the passionate narratives of physical and mental anguish following vaccination .
benjamin luft , a prominent ld researcher , noted a failure to deliver on an earlier , if implicit , promise that in return for very quick approval of a
personal choice vaccine , surveillance data would be collected to resolve lingering doubts about safety .
i m disappointed today . because i hear some information here and i hear some information there .
we really are sitting in a situation in a sea of just what we feel . because no one is giving us data ( vrbpac 2001 ) .
one reason that data were scarce was that the vaccine was being used much less often than predicted , making it difficult for either the adverse event reporting system or the hmo surveillance program to reliably identify vaccine problems .
the low uptake also signaled that the vaccine was in ( market ) trouble . in february 2002 ,
dear doctor / investigator letters were sent , and refunds were given for returned vaccine vials .
the preexisting controversy over the definition , scope , and significance of chronic lyme disease ultimately shaped every aspect of the controversy over the ld vaccine .
in retrospect , the developers of the ld vaccine did not fully appreciate what was at stake in these controversies and how these stakes would affect the reception of the vaccine .
skb gave financial support to different ld advocacy groups in the 1990s , presumably expecting them to be allies in bringing an effective and safe vaccine to market .
they indeed might have helped turn the great concern about ld in endemic areas into vaccine sales , but instead , many ld advocates and the groups representing them ultimately turned on the vaccine and vaccine makers . as loren
cooper ( personal communication , august 11 , 2011 ) , counsel to skb for much of the ensuing ld litigation , put it in retrospect , given the discord within the medical community and among ld advocates and support groups , we stepped into a hornet nest . one example of skb 's early strategy was the testimony on behalf of skb and lymerix at the 1998 vrbpac meeting given by dr .
the etiological spirochete can lurk or secrete itself in certain areas of the body , perhaps the central nervous system or perhaps the joint spaces , only to reappear months or maybe years later in the form of late stages of illness , which are harder to diagnosis and treat .
he went on to show pictures of a patient with bell 's palsy and describe a patient with heart block , both real but rare ld complications .
because this message was consonant with the heterodox view of ld , it was understandable that skb might have expected significant enthusiasm in the ld advocacy community for an effective vaccine . yet the vaccine 's social and psychological efficacy the work it does or might do for potential consumers besides blocking b. burgdorferi in the tick 's midgut turned out to be complex and contradictory .
from skb 's perspective , the vaccine promised to restore a sense of control and reduce the fears of many people living in an ld - endemic area .
this work was crucial to developing a market larger than the relatively small numbers of individuals at high risk for b. burgdorferi infection .
and even those at high risk needed additional reasons to take the vaccine , given the concerns about its cost , side effects , boosters , and incomplete protection .
more than putting pressure on scientific authorities to be included in the investigator - initiated research , ld advocates focused on garnering support and attention for their alternative picture of the disease as chronic and protean and often requiring prolonged treatment .
as the prominent ld researcher alan barbour wrote in an op - ed about ld advocacy at the very onset of the ld vaccine controversy , most of the lobbying has focused on what lyme disease is rather than how to prevent it ( 1997 , 23 ) . also absent from the heterodox opposition to the ld vaccine was any overt linkage to the long tradition of antivaccination campaigns in the united states in any of its guises : libertarian , religious , homeopathic , antimedicalization , and the like ( see colgrove 2006 ) . a contentious point about
dixie snyder , an fda advisory panel member , recalled that the vrbpac 's earlier rather benign
observation that most ld cases were treatable with antibiotics resulted in thousands of letters from the public indicating that that was n't true
the gap between the orthodox and heterodox positions has been wide and consequential . from the orthodox vantage point
it was as if people who had biopsies for breast cancer and tested negative demanded a say in how breast cancer practices and policies were being developed .
some ld advocates believe their children or partners died from lyme disease , while most experts are skeptical that ld is ever fatal .
members of both communities frequently acknowledge that they have been living in different and oppositional worlds .
one patient advocate complained at the postmarketing regulatory hearings . but out where the ticks are , out in the hinterland , nobody knows about it , or they are not telling you ( pat easton , testimony , vrbpac 2001 ) .
one lay advocacy organization that skb initially supported was the lyme disease foundation . at the 1998 vrbpac meeting that ultimately gave approval to the vaccine ,
karen vanderhoof - forschner , the foundation 's president , offered passionate support for lymerix .
similar in many ways to the skb - sponsored clinician who addressed the meeting , vanderhoof - forschner argued that ld was a geographically widespread , underdiagnosed , chronic , devastating , and costly disease and thus worthy of prevention by vaccination .
but in 2001 she told the same advisory board that the vaccine represents an imminent and substantial hazard to the public health and needs to be immediately recalled .
ld advocates were not , of course , against preventing the disease per se but were against the way the vaccine might reinforce the idea that ld was an acute , unproblematic , and clinical entity . for many in the heterodox community ,
the vaccine , the vaccine 's scientific efficacy , and the narrow disease definition had become mutually reinforcing concepts .
once the vaccine 's efficacy was established , there was a collateral implication that the narrow diagnostic criteria used to establish this efficacy worked as well .
this type of stabilization of both the technology and its target is sometimes understood as co - production in science and technology studies ( jasanoff 2006 ) .
the heterodox antipathy to the vaccine also might have followed from the potential impact of widespread vaccination to reduce the ability of people to claim they had ld .
although there was never any evidence of this motivation , it was clearly in the minds of ld vaccine supporters .
david weld , executive director of the american ld foundation ( perhaps the sole advocacy group that supported the orthodox position ) , in testimony at the 1998 acip meeting , had wondered out loud if the vaccine may be very beneficial in that it 's going to reduce the incidence of a lot of people claiming to have lyme disease when they do nt . while the efficacy trials , adverse event reports , and the hmo surveillance system had not found evidence of the vaccine 's dangers , the 2001 vrbpac meetings heard a lot of testimony from individuals claiming serious harm .
what disturbs me is that in the smithkline presentation there were 950 adverse events , chair robert daum noted .
there was a nice presentation of that . and this afternoon we heard testimony from twenty individuals of twenty , of approximately twenty people who had very significant adverse events . and
the disconnect for me is i m hearing that and i m seeing that data , and i do n't see any reflection of one to the other as if we were in two different universes .
not only were different types of evidence ( statistics comparing the vaccinated and controls with the personal narratives ) marshaled , but some heterodox advocates offered radically different interpretations of the same evidence . rather than understanding the absence of asymptomatic seroconversion among the vaccinated as evidence of vaccine efficacy , some detractors offered a diametrically opposed interpretation : the vaccine caused people with prior or latent infection to become symptomatic with an ld - like disease , resulting in no one left to be asymptomatic .
as one vaccine skeptic put it , the vaccine is turning asymptomatic lyme disease into symptomatic cases ( kathleen dixon , testimony , vrbpac 2001 ) .
kay lyon , another vaccine skeptic , argued that asymptomatic infection was better understood as a smoldering infection and that the vaccine might be a trigger that turns this smoldering infection on , converting it almost instantly into late - stage disseminated lyme disease . in support of the view that asymptomatic infection could later turn into serious disease , she noted that asymptomatic seroconverters , whom the research was designed to detect , had been treated with antibiotics by study investigators .
lyon continued : this was , of course , the humane way to treat study participants .
but it is absolutely not reflective of medical practice in the real world our children live in ( vrbpac 2001 ) .
again , ld advocates proved adept at using insiders knowledge of how research was conducted to score points for the heterodox position .
some heterodox objections to the vaccine echoed a standard observation made by historians of technology and science : scientific practices and technologies often have built into them the choices , values , and interests of specific groups .
critics observed that the values and interests of ld experts and pharmaceutical companies shaped the design of vaccine and drug clinical trials , which in turn shaped beliefs about what was true about ld and everyday clinical practices .
there was , in effect , great path dependency on some initial decisions and commitments made by scientists , clinicians , and regulators who shared the orthodox view .
exhibit number one for this line of criticism was the relationship between the vaccine and the diagnostic criteria for ld , long a battlefield in the lyme wars .
many people in the heterodox community were incensed when in 1994 , years before the launch of ospa vaccines , experts at a consensus group meeting in dearborn , michigan , sponsored by the cdc , removed from the diagnostic criteria a western blot band associated with an antigen likely to be part of the ld vaccine .
this band was removed so that the immunological tests would not be fooled by vaccination , that is , falsely diagnosing ld among the merely vaccinated .
some ld advocates objected that some infected people would be excluded from their rightful ld diagnosis because of these changed criteria . in effect , these would - be ld patients , now ineligible for the diagnosis , were sacrificed by the cdc experts in order to accommodate a vaccine of dubious value .
one ld advocate observed that the changed laboratory criteria meant that it was now impossible for us to know which of our children are infected and which are not .
it is therefore impossible to gauge the true safety or efficiency of this vaccine , efficacy of this vaccine in this population .
on the other hand , in the world of smithkline beecham data , we do find lymerix ; we have an experiment whose success is based , in part , on a set of criteria created to enable the success of the experiment .
( kay lyon , vrbpac 2001 ) from the orthodox perspective , arguing that different bands on western blots should be used to define ld was an intrusion into matters best left to the experts . and observing that diagnostic criteria were changed to minimize the chance that vaccinated people might later be falsely diagnosed with lyme disease was sensible and unexceptional clinical policy .
heterodox critics pointed out that the surveillance systems used to identify vaccine complications were imperfect and rigged to underreport problems .
reports of adverse reactions depend entirely on the willingness , energy , and competence of the physicians in practice .
side effects would not be reported if physicians believed they were not related to vaccine exposure .
so recognizing adverse reactions was , in effect , a closed , circular system in which preexisting biases shaped reporting , which in turn reinforced these biases .
no wonder there was underreporting of the vaccine 's side effects . when asked if they had reported this to the administering doctor and if the doctor had reported the adverse event , lay advocate pat smith observed ,
the usual response was that the doctor did not take the complaint seriously or did not think that these symptoms were related
skb had promised to make adverse event reporting more sensitive and objective by establishing a surveillance system based on the electronic medical records of a large managed care system in new england .
but the vaccine was used much less often than expected , making surveillance difficult . at the postmarketing regulatory hearings , some
ld advocates heavily criticized this program , even though the low uptake that made this surveillance system a failure was partly caused by the activists opposition to the vaccine .
they argued that postmarketing surveillance had made guinea pigs out of the vaccine users .
one advocate observed about the licensed vaccine , and that by taking this vaccine our family would unwittingly become subjects of an ongoing drug trial
the case against the ld vaccine was different from what had inspired the opposition to other vaccines in recent decades .
higher than expected levels of guillame - barre syndrome had ended the 1976 swine flu immunization program ( neustadt and fineberg 1978 ) ; increased numbers of intussusceptions had led to the recall of an early rotavirus vaccine just around the time lymerix was first being marketed ; and the alleged link between mmr vaccine and autism has been a simmering controversy since the time of the ld vaccine controversy .
this concern about the vaccine has its origin in the belief that some late - stage complications of ld were caused by immune mechanisms rather than by direct effects of the infection .
in particular , ld experts have speculated that some ld - associated arthritis , particularly cases that are not responsive to antibiotics , is due to the body 's immune attack on joints triggered by spirochete infection .
evidence for an autoimmune explanation of treatment - resistant ld - associated arthritis has included clinical similarities with rheumatoid arthritis , long understood as an autoimmune process , and the failure to find spirochetes in the affected joints .
it is a small step from belief in an autoimmune mechanism for ld - related arthritis to concerns that the ld vaccine could induce autoimmunity .
what if the antigens used in the vaccine were the same spirochete bits that caused autoimmunity following natural infection ? moreover , the heterodox community frequently cited autoimmunity as the mediating mechanism for the chronic fatigue , pain , and other signs and symptoms that were prominent and most contested and feared in the alternative ld construction .
if the vaccine itself caused a syndrome that was the same or similar to chronic lyme disease , then these side effects constituted evidence in support of the alternative disease definition . and
if the vaccine did not cause these symptoms , then the heterodox position , to which putative autoimmune mechanisms were central , could be undermined .
these uncertain and contested beliefs about autoimmunity were the fertile soil from which opposition to the vaccine arose .
central to the case against the vaccine was the considerable scientific speculation in the years just before the vaccine 's introduction that ospa itself was the culprit antigen that triggered treatment - resistant ld - arthritis via molecular mimicry .
allen steere , who is credited with discovering ld in the 1970s , did much of this research .
he had suggested a possible connection between individuals who express hla dr4 antigen ( hla antigens play crucial roles in distinguishing self from nonself and are frequently evoked to explain who develops autoimmunity ) , exposure to ospa , and subsequent treatment - resistant arthritis .
there was some evidence that the ospa protein was similar to a human protein named lfa-1 , which may play a role in autoimmune arthritis ( kalish , leong , and steere 1993 ) .
to some observers , steere 's role in advancing and legitimating these concerns was paradoxical .
after all , he helped develop the vaccine and also led the lymerix clinical trial while simultaneously championing a theory that suggested that the vaccine might be dangerous
. why would you develop and study a vaccine against lyme disease that you had serious reason to believe might cause some of its late manifestations ( sigal personal communication , july 6 , 2011 ) ? according to a new york times profile , steere has his doubts about the safety of the vaccine
( france 1999 , f7 ) . but a less contradictory interpretation of steere 's actions was that he believed that ospa 's role in autoimmunity was still an unproven hypothesis and that the potential benefits of the vaccine were likely to trump any harm done by treatment - resistant arthritis .
pursuing the mechanism of ld - related arthritis and the efficacy and safety of the vaccine were both valid and important scientific efforts . in any event , the ospa molecular mimicry hypothesis subsequently fell out of favor , and neither clinical trial produced evidence of vaccine - induced arthritis . yet the theoretical concern about the vaccine causing ld - like damage persisted as the basis for opposition to the vaccine .
a well - publicized suit against the vaccine , settled by skb in 2003 , was based on the manufacturer 's liability and responsibility to the class of people at risk for an autoimmune reaction ( shea 2003 ) .
promises were made about the language of a future package insert if the vaccine were ever reintroduced , and attorneys fees ( but no patient damages ) were paid.3 because the lymerix trial did not result in greater numbers of arthritis cases , treatment sensitive or resistant , skb did not include any warnings about autoimmunity in the lymerix package insert .
what seemed logical to the orthodox camp was evidence of a cover - up or hubris by the other side . at the 2001 vrbpac meeting ,
advocate jenny marra testified that smithkline was so concerned with this issue [ possible autoimmunity ] that they had study participants sign a paper indicating the theoretical possibility existed that vaccine might cause arthritis in certain genetically susceptible individuals .
yet smithkline did not include this information in the product labeling or inform the health care providers of this concern .
had i known this , i personally would not have taken the vaccine . autoimmunity has long been a fertile imagined space for etiological thinking about chronic diseases whose etiologies are unclear and that are characterized by exacerbations and remissions .
many of the psychosomatic diseases of midcentury ( asthma , hay fever , and ulcerative colitis ) were , in subsequent decades , reframed as autoimmune diseases ( aronowitz 1998 ) . while much of this reframing was built on real and important new understandings of immunity , it was also the case that one appealing , intuitive , and flexible overriding causal scheme psychosomatics was replaced by another , autoimmunity .
( for a general argument about the nexus of lay and scientific ideas about immunity in etiological thinking , see martin 1994 . )
the immune concerns about the ld vaccine have some parallels with concerns about drugs such as tamoxifen and finasteride , which have been marketed to prevent breast and prostate cancer , respectively . despite some evidence of their scientific efficacy for prevention and their regulatory approval , these drugs when used as preventives have been market failures .
in contrast , the screening tests for these cancers , mammography and psa tests , are widely used despite controversy over their efficacy , overdiagnosis , and iatrogenic harm .
one explanation is that these drugs , unlike the screening tests , evoke different fears because of their direct effects on the body .
tamoxifen , for example , can cause uterine cancer and immediately produces menopausal - like symptoms in many women .
the ld vaccines , like tamoxifen and finasteride , may be feared because of their putative direct effects on the body . in the case of the cancer preventives , the comparison with the enthusiasm for screening is telling because the indirect effects of screening
overtreatment resulting from overdiagnosis may be as consequential but , i surmise , are feared less because their negative impact on health is less direct ( welch , schwartz , and woloshin 2011 ) .
in addition , the risk of radiation from screening mammography has sometimes played a large role in these controversies ( aronowitz 2007 ) .
the point is that social and psychological effects of practices and products , as much as or more than their scientific efficacy , often play a determinant role in their actual use or rejection .
consumers worry that these preventives directly impact the body in unknown and uncertain ways , in one case toward cancer itself and in the other toward murky immune problems .
in each case , a preventive drug was marketed as reducing risk and controlling uncertainty / fear and yet has the potential to add risk and raise fears . as a result , many risk - reducing drugs and vaccines are unstable consumer products .
richard platt referred to lymerix as a personal choice vaccine . at these same hearings , consumer activist dr .
sidney wolfe recalled an earlier iom report that placed this whole idea in what they call their less favorable category , the lowest ranking in priorities of vaccine development , just because of the fact that ( a ) the vaccine is not extraordinarily effective ; ( b ) it is not preventing a life - threatening disease ; and ( c ) for most people , a successful antibacterial intervention can occur not when you have a tick but when you have some clinical symptoms that are suggestive of actually beginning to have lyme disease .
not everyone agreed that these characteristics of the vaccine and ld meant that the vaccine was optional and should receive less support or tighter regulation than most other vaccines . at the initial acip review in 1998 , committee member stanley plotkin argued that a safe and effective vaccine with a limited market should nevertheless get a strong recommendation from policymakers .
the issue of whether to actually use a highly recommended vaccine should remain with the individual .
one is going to have to permit the individual to make some choices about whether a reduction from two in one thousand to one in one thousand is significant for that person .
so i would urge the committee to distinguish in this type of vaccine between public health issues and individual issues .
( acip 1998 ) in this new world of personal choice , vaccine manufacturers were motivated to persuade potential consumers . in the case of ld vaccines
, consumers could be sold freedom from ld fears and the moral satisfaction following proper self - care for themselves and their family .
so to succeed in the marketplace , vaccine makers would need to raise awareness of the risk of ld and also of the benefits of the vaccine .
after the fda approved lymerix , skb launched one of the very first large direct - to - consumer advertising ( dtca ) campaigns .
until i found out you can get it in your local park , in your own back yard , or even mowing the lawn , was the voice - over in one television advertisement ( goetzl 2000 ) .
a print ad from the same period pictured a woman , with her dog , standing on her lawn who offered the following advice : i got lyme disease last spring and i m being treated for serious health problems .
i could n't prevent it then , but now you could.4 the campaign aimed to increase awareness of the risk of lyme disease and to communicate a sense of urgency about taking the vaccine.5 the dtca campaign resembled the aggressive one that merck used a decade later to promote its human papillomavirus ( hpv ) vaccine , gardasil ( aronowitz 2010 ) . in both cases ,
the vaccine manufacturers promoted their vaccines as consumer choices , raising awareness and fear of the target disease and promising relief from not only the target condition ( a benefit that would accrue to only a small segment of the population ) but also the anxiety , loss of control , and fear associated with being at risk for the disease . in both cases , vaccine manufacturers attempted to win over consumers by initially funding lay groups they believed could influence the vaccine 's market success . in the case of gardasil ,
merck also took aim at state legislators who might vote to include gardasil among the vaccines mandated for school entry .
given the great degree of concern already present in some communities about ld , skb had reason to believe that it had developed an economically successful vaccine .
a prominent ld investigator speculated in 1999 that one group who will demand it are people who fear lyme disease with no real cause
but the vaccine 's social and psychological efficacy was quickly undermined by individual stories of harm related to the vaccine 's putative immune dangers.6
many informed observers of ld vaccine developments have offered explanations for why the ld vaccines failed .
the withdrawal of the skb vaccine represents the most painful event in our lyme disease history and concluded that the vaccine was really withdrawn because of fear and lawsuits , not because of scientific findings
( 2006 , 629 ) . while there is a consensus among vaccine supporters that scientific findings had little to do with the vaccines downfall , there is little agreement about which nonscientific factors were at work .
many people have observed that there turned out to be not enough demand for the vaccine to be commercially viable .
but almost all the factors related to either ld ( e.g. , it was treatable , nondeadly , and preventable by other means ) or the vaccines ( potential for inducing autoimmunity , need for boosters ) that might have led to low demand were known before extensive investments in clinical trials , regulatory review , and initial marketing .
so these disease and vaccine characteristics are better understood as supporting players , while the more fundamental causes are the more contingent and unanticipated actions that occurred in the brief period after clinical trials were finished and before lymerix was withdrawn from the market .
these actions tipped the balance toward the vaccines demise . specifically , we need to understand ( 1 ) the origins of the intense heterodox opposition to the ld vaccine and the weak orthodox support for the vaccines once they were challenged and ( 2 ) why the efficacy of a personalized vaccine was inherently vulnerable to this opposition .
contingent events external to the ld controversy also influenced the market failure of ld vaccines especially the controversies surrounding the rotashield and mmr vaccines mentioned earlier but
i want to focus my analysis on the actors and actions within the developments concerning ld .
other ancillary influences include the theory offered by sigal ( personal communication , july 6 , 2011 ) that the advocacy community turned against the vaccine when skb withdrew its financial support and also the claim made by both offit ( personal communication , june 28 , 2011 ) and plotkin ( personal communication , july 18 , 2011 ) that the weak recommendations of the fda and cdc / acip led to physicians lack of enthusiasm for the vaccine .
the vaccine 's supporters have blamed ld advocates for undermining the vaccine with nonscientific claims of its dangers , and skb 's vigorous dtca promotion of lymerix may have led to backlash and distrust.7 heterodox groups came to believe that the vaccines efficacy supported the orthodox definition of ld and did what they could to undermine the vaccines . these beliefs and actions were neither inevitable nor strictly determined by the clinical and biological characteristics of the disease or the vaccines .
there was a great deal of enthusiasm in affected communities , as reflected in the easy recruitment for vaccine trials and the early lay criticism of the lack of medical interest in preventing ld . speaking at the 2001 vrbpac meeting , dr .
dixie snider recalled the very different atmosphere at the 1998 meeting , during which lay advocates told clinicians and scientists that they were insensitive to the needs of the communities that wanted the vaccine . but shortly after the launch of lymerix , many people in the ld activist community began to understand that the vaccine 's scientific efficacy stabilized the vaccine 's target : the orthodox view of ld that they so bitterly opposed . reinforcing these connections
were lay activists opposition to the ld experts and drug companies promotion of the vaccine ( my enemy 's friend is my enemy ) , the narrow case definition used in the trials ( if the vaccine worked , then so did the case definition ) , and the construction of the vaccine 's immune dangers in ways that reinforced the heterodox position ( severe side effects attributed to the vaccine proved the protean , immune consequences of natural ld ) . from the orthodox perspective , an effective prevention tool the product of determined and creative laboratory and clinical science
but why was this lay opposition so effective at weakening the demand for these products ?
labels like yuppie vaccine and personalized vaccine , cited by medical experts in regulatory hearings , point to why the ld vaccines were extremely sensitive to efforts to paint them as dangerous .
the social and psychological efficacy of risk - reducing products and practices is to provide safety , reassurance , fear reduction , and control of uncertainty .
this efficacy was easily unraveled by the ld advocates promotion of the vaccines putative immune dangers .
the ld vaccine controversy resembles the recent hpv vaccine controversy in which societal wariness regarding another marginally effective , highly profitable , risk - reducing product played a large part ( aronowitz 2010 ) .
the hpv vaccines have been resisted by groups suspicious of big pharmaceutical companies , abstinence only supporters , and others .
unlike the ld controversy , there has not been a concerted attempt to link the hpv vaccine to a specific , if theoretical , safety risk .
my analysis implies that such a risk might be the nidus in which a lot of other oppositional positions might form . in this sense , the ld vaccine controversy has more parallels with the recent vioxx controversy , a product whose market niche was to reduce risk ( of gastrointestinal complications associated with other nonsteroidal anti - inflammatory drugs ) but that was undone by evidence that the same product imposed a small but real risk of increased cardiovascular disease .
risk - reducing products are especially vulnerable to actions that raise fear and damage trust and thus undermine the social efficacy of the product .
ld activists were able to pollute the positive social and psychological efficacy with a small dose of personal anecdotes and theoretical concerns .
this class of practices and products necessarily lives and dies by an easy come , easy go
rule , that is , things that are easily and successfully promoted as relieving fear and reducing uncertainty can be just as readily undermined if they are shown or believed to be dangerous and risky .
the relatively weak and hedged support for the vaccine by members of both the vrbpac and the acip also followed from the vaccines identity as a risk - reducing product .
while reducing fear , providing reassurance , and controlling uncertainty are valid consumer needs , medical experts were skeptical that they balanced out even a small health risk .
personalized vaccines might dilute trust in the entire vaccine enterprise through their marginal health impacts ( see sidney wolfe 's testimony ) .
ld activists asked whether scientific and clinical developments were good or bad for the heterodox position usually answered
some clinicians and scientists lived in a complementary universe in which the vaccine might have contributed to a favorable end to the ld controversies by reducing the number of people who had , or could claim to have , ld .
these fixed positions reflect a very long controversy that is ultimately about who gets to decide how ld is defined and , as a result , who ultimately gets the diagnosis ( aronowitz 1991 ) .
policymakers , clinicians , and vaccine companies failed to understand the central heterodox position that patients get to decide the diagnostic criteria .
skb initially funded advocacy organizations and its dtca campaign bypassed doctors , but the support these advocates craved was for the heterodox definition of ld , not an awareness of ld or a vaccine that stabilized the orthodox viewpoint and was created by the experts they loathed . with the benefit of hindsight , it might have made more market sense for skb to have enlisted the support of more physicians and to have avoided any involvement with ld advocacy organizations .
this well - established controversy over chronic ld has not gone away . not long after the ld vaccines were withdrawn ,
the next major battle in the lyme wars was over attempts by the connecticut attorney general to sue a major infectious disease organization for monopolistic practices related to its consensus criteria for diagnosing and treating ld .
this mobilization of antitrust laws against the typical ways that expert physicians make and communicate consensus recommendations dismayed most medical observers but was seen by many in the heterodox community as a counterbalance to the power of the medical establishment to set the entry criteria for a much - coveted diagnosis and to discipline
more biomedical acceptance of the legitimacy of patients suffering , whether or not it fits an accepted diagnostic scheme , and clinical management strategies that focus on symptoms rather than specific diagnoses might go some way in lessening the heat of this thirty - five - year - old controversy ( aronowitz 1998 ) .
but because this controversy is so entrenched , these patient - centered approaches run against more dominant reductionist tendencies in clinical care and are unlikely to have much impact .
the ld vaccine controversy is unlike the controversies surrounding aids and other diseases that also have had a very determined and often oppositional lay advocacy ( epstein 1996 ) .
these controversies often center on the inclusion of patients , minority groups , and other stakeholders in the planning and execution of clinical trials and policymaking ( epstein 2007 ) .
advocates and experts have often lived in entirely different universes , in which basic assumptions and motivations are built on the negation of the other .
there has often been almost a totally incommensurate view of the opposing group 's actions .
arguably , inclusion should not be valorized in itself but for what it brings : fairness , accurate research sampling , different perspectives , and so forth .
the attempt to include the orthodox and heterodox perspectives in consensus conferences and other research and policymaking venues has , by any standard , failed .
perhaps it is time to name and act as if lyme disease and chronic lyme disease were separate entities that have very little to do with each other .
even if there are no ready solutions to the ld controversies , it remains important to understand what was at stake in the rise and fall of the ld vaccines because american medical practice is increasingly constituted by many similar , risk - oriented interventions ( aronowitz 2009 ) .
the ld vaccine narrative reconfirms that the success or failure of risk - reducing practices and products depends heavily on different sorts of trust .
biomedical interventions that promise risk reduction are different from others that relieve pain , take away symptoms , or reduce suffering .
the consumer of a risk - reducing product or practice has to place much more trust in aggregate probabilities of benefit and harm because these practices or products have no felt impact . at the same time
these interventions are often designed and promoted as practices or products that promise to restore control , combat fears , and lessen uncertainty .
but if these same interventions are later linked to even small probabilities of risk or harm , this social and psychological efficacy can be easily undermined , and the trust shattered .
the rise and fall of the ld vaccines shows just how hard it is for this trust to be maintained and how easily it can dissipate . and
a lack of trust can easily be generalized to other interventions . at the postmarketing hearings ( vrbpac 2001 )
, consumer activist sidney wolfe testified that the problem with the ld vaccines was that they reduced the public 's faith in other public health measures .
he compared the situation with the the tragic lesson of the swine flu vaccine when one sees a very questionable immunization campaign such as this going on , about the implication and the negative effect on public health generally and on vaccinations in specific .
knowledge of the social and historical context in which the ld vaccines became market failures may be useful to policymakers , especially as the number of health risk reducing interventions preventive measures , screening tests , and treatments aimed at reducing the probability of recurrence or new manifestations is growing ( aronowitz 2009 ) .
this history suggests that the evaluation of benefit and safety of risk - reducing practices and products , which increasingly dominate medical care , should proceed with more nuanced attention to the challenges posed by their social and psychological and not only by their scientific efficacy . in many cases ,
evidence - based , quantitative evaluations of objective health benefits and risks of interventions will profit from the simultaneous identification and examination of the expected and actual social and psychological work done by interventions sold as consumer products .
currently , the consideration of such factors is marginal and not explicit and is carried out in an ad hoc fashion . in the formation of ld vaccine policy ,
regulators and expert clinical opinion clearly had misgivings about what was sometimes referred to as the yuppie vaccine .
these misgivings were partly a matter of the limited objective health impact of any putatively effective vaccine , but they also were about diluting the moral and political consensus that has stood behind vaccines as public health measures , and the danger to medical credibility of blurring appeals to public and individual health benefits with consumerist benefits .
policymakers were , and remain , at a loss for dealing with the kind of oppositional lay advocacy manifested in ld . even the pharmaceutical companies acting as market actors seemed to have misunderstood , at least initially , what might be at stake in their new product .
responding to these challenges necessarily involves simultaneous critical appraisal of extant data about the objective dangers and benefits of interventions along with their anticipated social , political , and economic impacts . | contexttwo vaccines to prevent lyme disease ( ld ) were developed and tested in the 1990s . despite evidence of their safety and efficacy in clinical trials and initial postmarketing surveillance ,
one vaccine was withdrawn before the regulatory review and the other after only three years on the market .
an investigation of their history can illuminate ( 1 ) the challenges faced by many new risk - reducing products and practices and ( 2 ) the important role played by their social and psychological , as distinct from their biomedical or scientific , efficacy in how they are used , and their ultimate market success or failure.methodsthis article reviewed medical and popular literature on ld vaccines , analyzed the regulatory hearings , and conducted interviews with key participants.findingseven if proved safe and effective , ld vaccines faced regulatory and market challenges because the disease was geographically limited , treatable , and preventable by other means .
pharmaceutical companies nevertheless hoped to appeal to consumers desire for protection and control and to their widespread fear of the disease .
the ld advocacy community initially supported the vaccines but soon became critical opponents .
the vaccines success was seen as threatening their central position that ld was chronic , protean , and difficult to treat .
the activists opposition flipped the vaccines social and psychological efficacy . instead of the vaccines restoring control and reducing fear , demand was undermined by beliefs that the vaccines caused an ld - like syndrome.conclusionsthe social and psychological efficacy of many risk - reducing practices and products , such as new
personalized vaccines , is to provide insurance and reduce fear .
yet the actions of self - interested actors can easily undermine this appeal .
in addition to evaluating the scientific efficacy and safety of these practices and products , policymakers and others need to understand , anticipate , and perhaps shape the potential social and psychological work they might do . | What Happened?
Heterodox Opposition to Vaccine
The Vaccine's Immune Danger
A Personalized Product?
Conclusions |
immunohumanized animal models are invaluable tools in research related to human immunity
and infection .
these models are also useful as animal platforms in preclinical trials in
stem - cell - based regenerative medicine , in which damaged tissue can be regenerated in
vivo by the transplantation of stem cells .
mice models are useful , and
immunohumanized mice have been produced by using severely immunodeficient mice such as nog
and nsg mice [ 5 , 7 , 14 , 22 ] . however , because of several constraints associated with mouse models , such as
small size , short longevity , and a relatively large biological gap with humans , a model
using a large animal would be invaluable .
in particular , pigs have anatomical and
physiological features similar to humans , and
they have a higher reproductivity rate than other large animals .
therefore , we
previously developed immunodeficient pigs by targeting the il2rg gene
to produce a humanized pig model .
although an immunohumanized pig model can be theoretically produced using these pigs , some
difficulties remain for the efficient reconstitution of the human immune system .
for
example , the remaining porcine immune system can reject xenogeneic human cells . a severely
atrophied thymus in il2rg - knockout pigs , which is presumably because of the failure of thymocyte expansion , can constrain the development of human t cells .
transplantation to fetal pigs in utero can ameliorate these problems
because the immunity of the fetus is immature and fetal thymi can normally develop to some
extent without the interaction of thymocytes and thymic epithelial cells [ 9 , 19 ] .
however ,
the differentiation process of fetal porcine thymic function , which plays a significant role
in transplantation immunity by generating differentiated t cells , has not been
elucidated .
t - cell progenitors first immigrate
from the blood vessels to the cortex of the thymus .
this process is at least partially
regulated by the chemokine ccl25 and its receptor ccr9 [ 10 , 13 ] .
thymus - settling cells are
subjected to gene rearrangement of the t - cell receptor locus by the recombination - activating
gene ( rag ) complex to become cd4- and cd8-double - positive cells [ 2 , 15 ] .
double - positive thymocytes which express the t - cell receptor complex having a low avidity
with the self - peptide presented by the major histocompatibility complex ( mhc ) on the surface
of cortical epithelial cells are selected to survive .
the unique population of peptides that
are generated by thymic - specific proteasomes ( 5 t ) which are expressed exclusively in thymic
cortical epithelial cells deeply commits to this process by interacting with mhc class i
.
then , the
thymocytes that interact with the self - antigen presented by medullary epithelial cells or
dendritic cells with a high avidity are eliminated by apoptosis . this process , which is called negative selection , is at least
partially dependent on the autoimmune regulator ( aire ) , which has been suggested to be a
regulator of the expression of the peripheral self - antigen or the differentiation of medullary epithelial cells [ 4 , 23 ] .
thymocytes that escape
negative selection finally emigrate out of the thymus as cd4- or cd8-single - positive
cells . in this study
, we examined the levels of gene expression of several marker proteins and
factors considered to be relevant to thymic function , together with a histological analysis ,
to examine the developmental stage of each fetal thymus .
in addition , we also intended to
further elucidate porcine thymic function by examining the fetal thymi sequentially , which
was otherwise very difficult because all the thymic processes simultaneously occur in the
postnatal thymi .
the animals that were used in this study were healthy cross - bred pigs ( sus
scrofa ) that were conventionally reared in the national institute of livestock
and grassland sciences .
all animal experiments were approved by the animal care committee
of the national institute of agrobiological sciences . at 35 , 40 , 45 , 50 , 55 , 65 , and 85 days of gestation ( dg ) , two pregnant female pigs for
each stage were sacrificed , and their fetuses were recovered . in addition , newborn piglets
were sacrificed at 2 days postpartum ( dp ) . from these fetuses or piglets , thymi were
collected for quantitative rt - pcr and immunohistochemistry . in the case of fetuses at
dg35dg50 , the entire cervical portions of the fetus were excised for the histological
analysis .
kyoto , japan ) according to
the manufacturer s instructions . after being treated with dnase i ( takara bio inc . ,
otsu ,
japan ) at 37c for 30 min , rna was subjected to first - strand cdna synthesis at 37c for 30
min with a primescript rt reagent kit ( takara bio inc . ) .
real - time quantitative rt - pcr of the transcripts of interest was performed with a
lightcycler instrument ( roche diagnostics , basel , switzerland ) .
pcr amplification was
performed in a 20-l reaction mixture consisting of 1 l
of cdna , 0.4 m of each primer , and 10 l of sybr premix
ex taq ii ( takara bio inc . ) .
the cycling conditions were 95c for 3 min , which was
followed by 60 cycles at 95c for 5 sec , 55c or 58c for 30 sec each , and 72c for 30
sec .
the sequences of the primers that were used in quantitative rt - pcrforwardreverse accession no.foxn1tgacggagcactttccttactgcatcttgtcgatcttggcdb803240psmb11gctacgacatgagcacccagactctcccgcacgtggaagaxm_001925763aireatgtccacttcggtccagagcctggatgcacttcttggagxm_003358989ccl25tcctgctatccatgctcaagatatcacagcaggcaggttgnm_001025214ccr9cagaagccgcaagtctgatgaacacgagccagtacaatggnm_001001624ccl19gctaagcctctggacttctccagccatctcgaatgagcagnm_001170516ccr7tgaagaagagcctgctggtgtaaaggtccgcacgtccttcnm_001001532ptprcacaaggtggatgtctatggccaagctcacttctgtttctcxm_003130596il2rgcttggaacagcagctctgagaccaacagccagaagtgatcnm_214083cd3egtagttgacatctgcatcactgggctcatagtctggattgnm_214227rag1atgcggagaaggtccttctgcactgggtaatcgtccacagnm_001123184rag2tctcatggagatgggcattgcttgctatctccacatgctcnm_001128481foxp3catggagtacttcaagttccaacatgcgtgtgaaccagtgnm_001128438hprt1tactgtaatgaccagtcaacggcaaccttgaccatctttggnm_001032376 .
the relative quantification of target gene expression was normalized
against the expression of the hypoxanthine phosphoribosyltransferase 1
( hprt1 ) gene .
thymi or slices of cervical portions were embedded in molds with oct compound , snap
frozen in liquid nitrogen , and then stored at 80c .
frozen tissues were sectioned at 6
m with a cryostat ( hm-500 ; carl zeiss microscopy gmbh , jena , germany ) .
cryosections were air dried at room temperature and fixed with 4% paraformaldehyde in
phosphate - buffered saline [ pbs ( ) ] for 15 min . after washing with pbs ( ) , antigen
retrieval
was performed in a food steamer ( twinbird corporation , tsubame , japan ) with
10-mm citrate buffer ( ph 6.0 ) for 25 min .
the sections were washed with pbs ( ) and
incubated in 10% normal rabbit serum ( for foxn1 , with 0.05% tween20 ) or 10% normal goat
serum ( for ck5 ) for 60 min at room temperature to decrease nonspecific staining .
the
sections were then incubated overnight at 4c with a primary antibody against foxn1 [ abcam
plc , cambridge , uk ; 1:50 dilution in pbs ( ) , 1% bovine serum albumin ( bsa ) , and 0.05%
tween20 ] , aire [ everest biotech ltd .. , oxfordshire , uk ; 1:750 in pbs ( ) and 1% bsa ] , or
ck5 [ abcam plc ; 1:100 in pbs ( ) and 1% bsa ] .
after washing with pbs ( ) , they were
treated with 0.3% h2o2 in pbs ( ) for 15 min to quench endogenous
peroxidase activity . after washing with pbs ( ) , sections were incubated with anti - goat
igg horseradish peroxidase - coupled polymer immpress ( vector laboratories , inc . ,
burlingame , ca , usa ) for 30 min ( for foxn1 and aire ) or
horseradish peroxidase - conjugated
anti - rabbit igg ( bethyl laboratories , inc . , montgomery , tx , usa
; 1:100 in pbs ( ) and 1%
bsa ) for 60 min ( for ck5 ) , and this was followed by detection with 3,3-diaminobenzidine
[ peroxidase stain dab kit ( brown stain ) ; nacalai tesque , inc . ] .
then , the sections were
lightly counterstained with mayer s hematoxylin ( 2 min ) , dehydrated , and mounted with
entellan new ( merck millipore , darmstadt , germany ) .
statistical analyses were performed using tukey s honestly significant differences test
( hsd ) .
the animals that were used in this study were healthy cross - bred pigs ( sus
scrofa ) that were conventionally reared in the national institute of livestock
and grassland sciences .
all animal experiments were approved by the animal care committee
of the national institute of agrobiological sciences .
at 35 , 40 , 45 , 50 , 55 , 65 , and 85 days of gestation ( dg ) , two pregnant female pigs for
each stage were sacrificed , and their fetuses were recovered . in addition , newborn piglets
were sacrificed at 2 days postpartum ( dp ) . from these fetuses or piglets , thymi were
collected for quantitative rt - pcr and immunohistochemistry . in the case of fetuses at
dg35dg50 , the entire cervical portions of the fetus were excised for the histological
analysis .
total rna was extracted with sepazol ( nakalai tesque , inc . , kyoto , japan ) according to
the manufacturer s instructions . after being treated with dnase i ( takara bio inc . , otsu ,
japan ) at 37c for 30 min , rna was subjected to first - strand cdna synthesis at 37c for 30
min with a primescript rt reagent kit ( takara bio inc . ) .
real - time quantitative rt - pcr of the transcripts of interest was performed with a
lightcycler instrument ( roche diagnostics , basel , switzerland ) .
pcr amplification was
performed in a 20-l reaction mixture consisting of 1 l
of cdna , 0.4 m of each primer , and 10 l of sybr premix
ex taq ii ( takara bio inc . ) .
the cycling conditions were 95c for 3 min , which was
followed by 60 cycles at 95c for 5 sec , 55c or 58c for 30 sec each , and 72c for 30
sec .
the sequences of the primers that were used in quantitative rt - pcrforwardreverse accession no.foxn1tgacggagcactttccttactgcatcttgtcgatcttggcdb803240psmb11gctacgacatgagcacccagactctcccgcacgtggaagaxm_001925763aireatgtccacttcggtccagagcctggatgcacttcttggagxm_003358989ccl25tcctgctatccatgctcaagatatcacagcaggcaggttgnm_001025214ccr9cagaagccgcaagtctgatgaacacgagccagtacaatggnm_001001624ccl19gctaagcctctggacttctccagccatctcgaatgagcagnm_001170516ccr7tgaagaagagcctgctggtgtaaaggtccgcacgtccttcnm_001001532ptprcacaaggtggatgtctatggccaagctcacttctgtttctcxm_003130596il2rgcttggaacagcagctctgagaccaacagccagaagtgatcnm_214083cd3egtagttgacatctgcatcactgggctcatagtctggattgnm_214227rag1atgcggagaaggtccttctgcactgggtaatcgtccacagnm_001123184rag2tctcatggagatgggcattgcttgctatctccacatgctcnm_001128481foxp3catggagtacttcaagttccaacatgcgtgtgaaccagtgnm_001128438hprt1tactgtaatgaccagtcaacggcaaccttgaccatctttggnm_001032376 .
the relative quantification of target gene expression was normalized
against the expression of the hypoxanthine phosphoribosyltransferase 1
( hprt1 ) gene .
thymi or slices of cervical portions were embedded in molds with oct compound , snap
frozen in liquid nitrogen , and then stored at 80c .
frozen tissues were sectioned at 6
m with a cryostat ( hm-500 ; carl zeiss microscopy gmbh , jena , germany ) .
cryosections were air dried at room temperature and fixed with 4% paraformaldehyde in
phosphate - buffered saline [ pbs ( ) ] for 15 min . after washing with pbs ( ) , antigen
retrieval
was performed in a food steamer ( twinbird corporation , tsubame , japan ) with
10-mm citrate buffer ( ph 6.0 ) for 25 min .
the sections were washed with pbs ( ) and
incubated in 10% normal rabbit serum ( for foxn1 , with 0.05% tween20 ) or 10% normal goat
serum ( for ck5 ) for 60 min at room temperature to decrease nonspecific staining .
the
sections were then incubated overnight at 4c with a primary antibody against foxn1 [ abcam
plc , cambridge , uk ; 1:50 dilution in pbs ( ) , 1% bovine serum albumin ( bsa ) , and 0.05%
tween20 ] , aire [ everest biotech ltd .. , oxfordshire , uk ; 1:750 in pbs ( ) and 1% bsa ] , or
ck5 [ abcam plc ; 1:100 in pbs ( ) and 1% bsa ] . after washing with pbs ( ) ,
they were
treated with 0.3% h2o2 in pbs ( ) for 15 min to quench endogenous
peroxidase activity . after washing with pbs ( )
, sections were incubated with anti - goat
igg horseradish peroxidase - coupled polymer immpress ( vector laboratories , inc . ,
burlingame , ca , usa ) for 30 min ( for foxn1 and aire ) or
horseradish peroxidase - conjugated
anti - rabbit igg ( bethyl laboratories , inc . , montgomery , tx , usa ; 1:100 in pbs ( ) and 1%
bsa ) for 60 min ( for ck5 ) , and this was followed by detection with 3,3-diaminobenzidine
[ peroxidase stain dab kit ( brown stain ) ; nacalai tesque , inc .
] . then , the sections were
lightly counterstained with mayer s hematoxylin ( 2 min ) , dehydrated , and mounted with
entellan new ( merck millipore , darmstadt , germany ) .
statistical analyses were performed using tukey s honestly significant differences test
( hsd ) .
to outline the developmental process of thymi , we first examined the expression patterns of
several genes that are expressed in thymic epithelial cells and thymocytes .
the relative
expression levels of foxn1 a key regulator for the thymic organogenesis and
psmb11 , which encodes the thymic proteasome 5 t in whole thymi , were
highest at dg35 , and they declined with fetal development ( figs .
1 . the lavels of mrna expression of genes expressed in thymic epithelial cells .
foxn1(a ) , psmb11(b ) , and aire(c )
expression levels were examined by quantitative rt - pcr in the thymi at 35 , 40 , 45 , 50 ,
55 , 65 , and 85 days of gestation and 2 days postpartum . as an internal control ,
the
hypoxanthine phosphoribosyltransferase 1 ( hprt1 ) mrna levels were
measured in each sample .
the values were represented as the means sem of
arbitrary units ( n=46 ) .
different letters indicate values that are significantly
different at p<0.05 ( tukey s honestly significant difference ) . ) .
this suggested that the thymic cortical epithelial cells were differentiated at
dg35 , and the subsequent decline in the relative expression levels reflected a decrease in
the relative abundance of thymic cortical epithelial cells within the thymi because of an
increase in other types of cells with thymic development .
the levels of
aire , which is expressed in medullary thymic epithelial cells , increased from dg45 to dp2 ( fig .
this suggested that the thymic medulla began to develop
around at dg45 and that the development continued throughout the fetal stage .
foxn1(a ) , psmb11(b ) , and aire(c )
expression levels were examined by quantitative rt - pcr in the thymi at 35 , 40 , 45 , 50 ,
55 , 65 , and 85 days of gestation and 2 days postpartum . as an internal control ,
the
hypoxanthine phosphoribosyltransferase 1 ( hprt1 ) mrna levels were
measured in each sample .
the values were represented as the means sem of
arbitrary units ( n=46 ) .
different letters indicate values that are significantly
different at p<0.05 ( tukey s honestly significant difference ) .
next , we examined the expression pattern of genes that affect the migration of thymocytes .
ccl25 , which is a chemokine , plays a significant role in the recruitment
of t - cell progenitors to the thymus .
2 . the levels of mrna expression of genes that are involved in the migration of
thymocytes . ccl25 ( a ) , ccr9 ( b ) ,
ccl19 ( c ) , and ccr7 ( d ) expression levels were
examined by quantitative rt - pcr in the thymi at 35 , 40 , 45 , 50 , 55 , 65 , and 85 days of
gestation and 2 days postpartum . as an internal control , the hypoxanthine
phosphoribosyltransferase 1 ( hprt1 ) mrna levels were measured in each
sample .
the values are represented as the means sem of arbitrary units ( n=46 ) .
different letters indicate values that are significantly different at
p<0.05 ( tukey s honestly significant difference ) . ) .
the expression of ccr9 , which is widely expressed in
thymus - settling t - cell progenitors , rapidly increased from dg40 to dg65 ( fig .
this reflected the vigorous settlement
and/or expansion of t - cell progenitors in thymi during this period .
the levels of expression
of ccl19 and ccr7 , which are related to the cortex
ccr7 expression began to
increase at dg50dg55 , and ccl19 expression began to increase
simultaneously ( figs . 2c and 2d ) .
these results might suggest that the positive selection
process , which makes thymocytes ccr7 positive , began to be manifested from
approximately dg50 and that the cortex medulla migration was immediately activated by dg55
when the medulla had developed to some extent , as expected from the expression pattern of
aire .
the levels of mrna expression of genes that are involved in the migration of
thymocytes .
ccl25 ( a ) , ccr9 ( b ) ,
ccl19 ( c ) , and ccr7 ( d ) expression levels were
examined by quantitative rt - pcr in the thymi at 35 , 40 , 45 , 50 , 55 , 65 , and 85 days of
gestation and 2 days postpartum . as an internal control , the hypoxanthine
phosphoribosyltransferase 1 ( hprt1 ) mrna levels were measured in each
sample .
the values are represented as the means sem of arbitrary units ( n=46 ) .
different letters indicate values that are significantly different at
p<0.05 ( tukey s honestly significant difference ) .
the levels of expression of ptprc , which encodes the hematopoietic markers
cd45 and il2rg , widely expressed in immune cells , showed a similar
increasing pattern in the entire phase of analysis ( fig .
ptprc(a ) , il2rg(b ) , cd3e(c ) ,
rag1(d ) , rag2(e ) , and foxp3(f )
expression levels were examined by quantitative rt - pcr in the thymi at 35 , 40 , 45 , 50 ,
55 , 65 , and 85 days of gestation and 2 days postpartum . as an internal control ,
the
hypoxanthine phosphoribosyltransferase 1 ( hprt1 ) mrna levels were
measured in each sample .
the values are represented as the means sem of
arbitrary units ( n=46 ) .
different letters indicate values that are significantly
different at p<0.05 ( tukey s honestly significant difference ) . ) , which was considered to be a reflection of the continuous inflow to and the
settlement of t - cell progenitors in thymi .
in addition , the expressions of
cd3e , which encodes the essential component of the t - cell receptor , and
rag1 and rag2 , which are indispensable factors for the
rearrangement of t - cell receptor genes , rapidly increased from dg40 to dg65 ( figs . 3c ,
3d , and 3e ) .
these findings might suggest
that t - cell progenitors that settled in thymi were immediately subjected to the
differentiation process in the thymic cortex prior to the formation of the thymic medulla .
however , the expression of foxp3 , which is the factor that is critical for
the differentiation of regulatory t cells , began to increase at dg55 ( fig .
ptprc(a ) , il2rg(b ) , cd3e(c ) ,
rag1(d ) , rag2(e ) , and foxp3(f )
expression levels were examined by quantitative rt - pcr in the thymi at 35 , 40 , 45 , 50 ,
55 , 65 , and 85 days of gestation and 2 days postpartum . as an internal control ,
the
hypoxanthine phosphoribosyltransferase 1 ( hprt1 ) mrna levels were
measured in each sample .
the values are represented as the means sem of
arbitrary units ( n=46 ) .
different letters indicate values that are significantly
different at p<0.05 ( tukey s honestly significant difference ) . to outline the developmental process of thymi , we first performed hematoxylin and eosin
( h&e ) staining on the sections of the cervical portion of porcine fetuses at dg35 , dg40 ,
dg45 , dg50 , and dg55 , as well as on the thymic section of newborn piglets ( fig . 4fig .
the thymi at 35
( a ) , 40 ( b ) , 45 ( c ) , 50 ( d ) , and 55 ( e ) days of gestation and at 2 days postpartum ( f )
were subjected to hematoxylin and eosin staining .
the scale bars represent 500 m . the inserts show
images with a higher magnification ( scale bars=100 m ) . ) .
the well - developed thymi of newborn piglets had two distinct areas : a
darker - staining cortex and a lighter - staining medulla that was surrounded by the cortex .
the
darker staining by hematoxylin was considered to correspond to the dense accumulation of
thymocytes . at dg35 , the lobular structure that is characteristic of the thymus was already
formed , but it was still loosely organized .
as the fetuses developed , the thymic lobes
gradually became tightly organized , and no light - staining medulla could be observed until
dg45 . at dg50 , some medulla - like areas were faintly observed in the inner region .
the thymi at 35
( a ) , 40 ( b ) , 45 ( c ) , 50 ( d ) , and 55 ( e ) days of gestation and at 2 days postpartum ( f )
were subjected to hematoxylin and eosin staining .
the scale bars represent 500 m . the inserts show
images with a higher magnification ( scale bars=100 m ) . to detect the medulla formation more clearly
, we performed an immunohistochemical analysis
with cytokeratin 5 ( ck5 ) , which is a marker protein for the thymic medulla ( fig .
the thymi at
35 ( a ) , 40 ( b ) , 45 ( c ) , 50 ( d ) , and 55 ( e ) days of gestation and at 2 days postpartum
( f ) were stained with an anti - ck5 antibody .
the inserts show images with a higher magnification ( scale
bars=50 m ) . ) .
we first confirmed that the staining pattern for ck5 was restricted to the thymic
medulla with the areas that were lightly stained with hematoxylin in the thymic sections of
the newborn pig . at dg35 and dg40 ,
ck5 staining was detected in a scattered pattern
throughout the thymic lobes , suggesting that ck5 is expressed in the cortical epithelium
before the formation of a distinct cortex medulla organization . from dg45 to dg50 , ck5
staining was gradually localized to the inner region of the thymic lobes , which showed that
the medulla formation began in this stage . at dg55 , distinct ck5 staining was detected in
the inner region of the thymic lobe , and this corresponded to the lightly stained area .
this
result , together with the abovementioned observations of h&e staining , suggested that
cortex medulla organization begins from dg45 to dg50 and that it was apparently clarified up
to dg55 .
the thymi at
35 ( a ) , 40 ( b ) , 45 ( c ) , 50 ( d ) , and 55 ( e ) days of gestation and at 2 days postpartum
( f ) were stained with an anti - ck5 antibody .
in addition , the localization of characteristic transcription factors of thymic epithelial
cells was examined by immunohistochemistry .
foxn1 is an invaluable factor for both cortical
and medulla epithelial cells , and it has been reported to be expressed in both types of
epithelial cells , including immature cells , in mice [ 3 , 11 , 12 ] . at dg35 ,
almost all cells expressed foxn1 protein , and this corresponded to
the differentiation of the thymic epithelial cells ( fig .
the thymi at 35 ( a ) ,
40 ( b ) , 45 ( c ) , 50 ( d ) , and 55 ( e ) days of gestation and at 2 days postpartum ( f ) were
stained with an anti - foxn1 antibody .
the scale bars represent 100 m .
the inserts show images with a higher magnification ( scale bars=50
m ) . ) , although the expression levels of each cell appeared to be lower than those at
later stages .
this difference may reflect the distinct developmental status of thymic
epithelial cells at each fetal stage .
foxn1-positive cells in the thymi were detected in a
scattered pattern in all stages examined ( fig .
6 ) ,
although the frequency of positive cells was decreased , especially from dg40 to dg45 .
this
decrease can be attributed to the inflow and expansion of t - cell progenitors , which
eventually become the dominant population in the thymus , as expected by the expression of
ptprc .
aire is considered to be a key factor in the differentiation
and/or function of medullary epithelial cells , and its expression is essentially restricted
to these cells .
similarly , we detected a
medulla - restricted expression of aire after dg50 synchronously with the medulla formation
that was characterized by ck5 expression ( fig .
the thymi at 35 ( a ) , 40
( b ) , 45 ( c ) , 50 ( d ) , and 55 ( e ) days of gestation and at 2 days postpartum ( f ) were
stained with an anti - aire antibody .
the scale bars represent 100 m .
the inserts show images with a higher magnification ( scale bars=50
m ) . ) .
the thymi at 35 ( a ) ,
40 ( b ) , 45 ( c ) , 50 ( d ) , and 55 ( e ) days of gestation and at 2 days postpartum ( f ) were
stained with an anti - foxn1 antibody .
the scale bars represent 100 m .
the inserts show images with a higher magnification ( scale bars=50
m ) .
the thymi at 35 ( a ) , 40
( b ) , 45 ( c ) , 50 ( d ) , and 55 ( e ) days of gestation and at 2 days postpartum ( f ) were
stained with an anti - aire antibody .
the scale bars represent 100 m .
the inserts show images with a higher magnification ( scale bars=50
m ) .
collectively , porcine thymic function might be considered to be roughly completed around
dg50 to dg55 , as determined by the formation of the thymic medulla .
therefore , it is
possible that the circulating t cells after dg50 have been selected to survive by the
positive and negative selection in thymi and can be functional in immune rejection .
however ,
we inevitably need to precisely unravel the activities of the innate , humoral and cellular
immunity in porcine fetuses to determine the optimal window for the transplantation of
xenogeneic human cells .
moreover , our gene expression analyses suggested that genes that are critically involved in
thymic functions in mice are also significant in the porcine thymus .
it was also suggested
that the stepwise developmental processes of porcine thymic epithelial cells and thymocytes
may be essentially similar to those in mice .
overall , this study provided pioneering
information for the further elucidation of porcine thymic function . | the humanized pig model , in which human cells or tissues can be functionally maintained
in pigs , can be an invaluable tool for human medical research .
although the recent
development of immunodeficient pigs has opened the door for the development of such a
model , the efficient engraftment and differentiation of human cells may be difficult to
achieve .
the transplantation of human cells into fetal pigs , whose immune system is
immature , will ameliorate this problem .
therefore , we examined the development of porcine
fetal thymus , which is critical for the establishment of the immune system .
we first
analyzed the levels of mrna expression of genes that are relevant to the function of
thymic epithelial cells or thymocytes in whole thymi from 35 to 85 days of gestation ( dg )
and at 2 days postpartum ( dp ) by quantitative rt - pcr .
in addition , immunohistochemical
analyses of thymic epithelial cells from dg35 to dg55 and dp2 were performed .
these
analyses showed that the thymic cortex was formed as early as dg35 , and thymic medulla
gradually developed from dg45 to dg55 .
these findings suggested that , at least before
dg45 , the thymus do not differentiate to form fully functional t cells . | Introduction
Materials and Methods
Experimental animals
Collection of tissues from fetal and newborn pigs
Total RNA extraction and RT-PCR
Immunohistochemistry
Statistical analysis
Results and Discussion |
radioiodine-131 ( i ) as a radioactive iodine is widely used for treatment of patients with thyroid diseases , such as thyroid cancer and graves ' disease .
it emits beta particles and has a physical half - life of 8.02 days . dna damage and chromosomal breaks are main reasons for cell damage and death .
reactive oxygen species ( ros ) are generated by i [ 2 , 3 ] ; these toxic products can attack critical macromolecules , such as dna , leading to cell damage and death [ 4 , 5 ] .
however , i concentrates at high level in thyroid tissue with a high target to nontarget ratio which is perfect for thyroid cancer therapy ; it has side effects , such as sialadenitis , haematological depression , xerostomia , and radiation thyroiditis [ 611 ] .
several studies have shown that genetic damage is increased in patients after i therapy , with the frequency of micronuclei being elevated [ 1214 ] .
thus , protection of normal cells may mitigate side effects induced by i. resveratrol is a natural polyphenol compound that is found in fruits , such as grapes .
several pharmacological properties were reported for resveratrol , such as neuroprotective , chemosensitive , anti - inflammatory , anticancer , antitumourigenic , chemopreventive , and antioxidant actions [ 1520 ] .
recently we showed that resveratrol protected genotoxicity induced by i on normal human lymphocytes ; it significantly reduced the dna damage induced by i in vitro .
scavenging of free radicals is proposed as the main mechanisms for protective effects of resveratrol [ 23 , 24 ] .
however , resveratrol exhibited protective effects on cellular toxicity induced by beta particle on normal cells ; its effect is unclear on thyroid cancer cell during iodine-131 therapy . to further explore the beneficial effects of resveratrol , the aim of this study was to investigate its therapeutic effects on cell death induced by i in thyroid human cancer and human nonmalignant fibroblast cells in vitro
resveratrol ( rsv ) and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide ( mtt ) was purchased from sigma ( usa ) .
i - na in sterile solution was prepared by aeoi , tehran , iran , and was used freshly .
human thyroid cancer ( thr.c1-pi 33 ) and human nonmalignant skin fibroblast ( hfff2 ) cells were got from the pasture institute of iran .
these cells were cultured at 37c and 5% co2 in roswell park memorial institute ( rpmi ) 1640 medium ( gibco , paisley , uk ) supplemented with 10% fetal bovine serum ( fbs ) and 100 g / ml penicillin - streptomycin ( gibco ) .
untreated and treated thyroid cancer and hfff2 cells were subjected to cell proliferation assay using mtt to quantify the metabolic activity to cleave tetrazolium salts [ 25 , 26 ] .
after 24 h incubation , cells were treated with various concentrations of rsv ( 0.5 , 5 , 10 , and 50 g / ml ) and incubated for 48 h at 37c and 5% co2 .
after 48 hours of culture , 20 l mtt ( 5 mg / ml in phosphate buffer saline ) was added to each well , and culturing was continued for 4 hours . then , culture supernatant was discarded and replaced by dmso , and the cell plates were shaken for 10 minutes .
the absorbance of every culture well was read on an elisa reader ( bioteck , usa ) .
after 24 h incubation , cells were treated with various concentrations of rsv ( 0.5 , 5 , 10 , and 50 g / ml ) and incubated for 2 h at 37c and 5% co2 .
after incubation , the solution of i was added at dose 10 ci in 100 l to each well and incubated for 48 h. mtt assay was performed according to above protocol .
data were presented as mean standard deviation ( sd ) of three independent experiments .
data were compared with student t - test and the differences were considered significant if the p value < 0.05 .
effects of rsv on cell proliferation in thyroid cancer and hfff2 were determined by mtt assay .
thyroid cell proliferation was significantly inhibited by rsv at concentrations 10 and 50 g / ml ( p < 0.02 ) . a statistical difference between concentrations of rsv at doses 5 and 50 g / ml was observed .
rsv exhibited a reduction of 12% in cellular growth in thyroid cells when cells were treated with 10 and 50 g / ml of rsv .
figure 1(a ) shows the percentage of cell proliferation in the thyroid cancer cells treated by rsv . in the comparison of cancer cell
, human nonmalignant fibroblast cell ( hfff2 ) was used for any effect of rsv on cell proliferation .
rsv did not cause significant cellular toxicity in hfff2 cell ( figure 1(b ) ) .
figure 2 shows the combination effect of rsv and 131-iodine on percentage of cell proliferation in control , rsv - pretreated , and/or i in thyroid cancer and hfff2 cells .
rsv significantly reduced percentage of cell survival to 60% and 63% at concentrations 5 and 10 g / ml , respectively .
these results indicate that rsv has synergetic effects with i on inhibition of cell growth on thyroid cancer cell . a radiosensitive effect by rsv in thyroid cancer cells treated with i was observed .
it is interesting that rsv was not shown any enhancement of toxicity on hfff2 cell in combination with i. rsv exhibited an increase of cell growth in combination with i in hfff2 cells at concentrations of 0.5 , 10 , and 50 g / ml when these rsv treated groups were compared to i alone ( p < 0.05 ) .
in this study , rsv exhibited a radiosensitizing effect on thyroid cancer cell ; it reduced cell growth in combination with i. rsv increased cell growth in nonmalignant fibroblast cell ( hfff2 ) treated with i. then rsv exhibited a radiosensitive effect on cancer cell and radioprotective effect on normal cell .
radioactive iodine-131 ( i ) is widely used for the treatment of thyroid - related diseases .
i is taken up almost exclusively by thyroidal tissue , and high - dose radioiodine treatment is associated with limited side effects such as sialadenitis and xerostomia .
pharmacological treatment can be a promising strategy for protecting patients from side effects induced by i therapy .
recently we showed rsv significantly protected human lymphocytes from genotoxicity induced by i. rsv reduced micronuclei frequency in lymphocytes in combination with i .
in this study we tried to evaluate the effects of rsv on thyroid cancer cells , because it is hypothesised that rsv may have a protective effect on thyroid cancer cells , which will be contraindicated in thyroid cancer therapy with i. our results indicate that rsv has radiosensitizing effects on thyroid cancer cell and radioprotective effects on normal cells against cellular toxicity induced by i. these results are promising for using of this natural product in i therapy in patients .
resveratrol has been shown to have several biological properties such as antioxidant activity , induction apoptosis in cancer cells , and inflammation [ 2729 ] .
this effect was through activation of caspase and regulation of the akt / bcl-2 signaling pathway [ 30 , 31 ] .
rsv sensitized colon cancer cell lines to 5-fluorouracil treatment on the increase of apoptotic effect and exhibited stronger antitumor effect . in our study , rsv significantly sensitized thyroid cancer cell to i at concentrations 5 and 10 g / ml , while this cellular toxicity was not increased at higher concentration 50 g / ml .
rsv maximally enhanced cell death induced by i at concentration 5 g / ml .
rsv probably has tumor cell toxicity through activation or inhibition of cellular signal pathways , which was established in other studies .
rsv induced apoptosis in thyroid carcinoma cells ; it acts via a ras - mapk kinase pathway to increase p53 expression [ 28 , 3335 ] .
rsv suppressed anaplastic thyroid carcinoma cell growth via s - phase cell - cycle arrest and apoptosis ; it induced functional notch1 protein expression and activated the pathway by transcriptional regulation .
also , resveratrol increased iodide trapping in frtl-5 cells , iodide influx , and rnis protein level even in the absence of tsh .
these mechanisms may contribute to enhancement of cell toxicity through increasing of i uptake by thyroid cancer cells .
antioxidant activity against cellular oxidative stress is one of the main mechanisms related to protection of rsv .
rsv directly scavenges reactive oxygen species produced by oxidative stress and it is probably related to the presence of hydroxyl groups on the chemical structure of rsv [ 38 , 39 ] .
resveratrol strongly prevented c6 cells from h2o2-induced toxicity by modulating glial , oxidative , and inflammatory responses .
ionizing radiation produces free radicals that damages macromolecules such as dna leading to cell death in normal tissues .
antioxidant activity is a main mechanism for radioprotective of rsv in normal cells [ 21 , 41 ] .
also resveratrol inhibits il-1 expression induced by radiation via the activation of sirt1 ; this mechanism participates in radioprotection .
our findings indicate that resveratrol is a promising natural product in patients on radioiodine therapy ; it sensitizes thyroid cancer cell to i. also , rsv is an effective protective agent on normal cells against toxicity induced by radioiodine therapy . with these two beneficial actions , rsv may improve the treatment of patients with thyroid cancer during radioiodine therapy . |
background . in this study , the radiosensitizing effect of resveratrol as a natural product was investigated on cell toxicity induced by 131i in thyroid cancer cell . methods .
human thyroid cancer cell and human nonmalignant fibroblast cell ( hfff2 ) were treated with 131i and/or resveratrol at different concentrations for 48 h. the cell proliferation was measured by determination of the percent of the survival cells using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) assay . results .
findings of this study show that resveratrol enhanced the cell death induced by 131i on thyroid cancer cell . also , resveratrol exhibited a protective effect on normal cells against 131i toxicity .
conclusion .
this result indicates a promising effect of resveratrol on improvement of cellular toxicity during iodine therapy . | 1. Introduction
2. Materials
3. Results
4. Discussion |
gossypiboma is the term used to refer to an intraoperative mistake discovered postoperatively in which one or more surgical sponges , gauze pads , or other form of textile is left behind in the operative field after the patient is closed .
retained surgical sponges may become a nidus for infection and are often grounds for malpractice lawsuits . a retained foreign body after any surgery has medicolegal consequences , including mental agony , humiliation , huge monetary compensation , and imprisonment on the part of the surgeon , as well as increased morbidity , mortality , and financial loss on the part of the patient .
surgical personnel s forgetting textile material or instruments during a procedure occurs during a complicated , extended , or emergency surgery .
of course , the exact incidence of surgical gauze or other materials left behind in operated - upon patients is unknown .
gossypibomas are most commonly found in the abdomen ( 56% ) , pelvis ( 18% ) , and thorax ( 11% ) . in 2010 ,
israel s health ministry enacted an ordinance regarding the counting of instruments and textile materials used in surgery . in 2012 , it was forced to declare cases of neglect concerning surgical materials . in the two subsequent years , they found 13 cases . in 2014 ,
a committee for patient safety control concluded that it was necessary to review and correct the ordinance of 2010 . despite precautions ,
a 34-year - old woman was admitted to the emergency room with abdominal pain and fever for the previous month ; she had undergone an emergency cesarean section nine years earlier .
she suffered from abdominal pain for two months after the cesarean section ; however , subsequent visits to the treating hospital attributed the pain to surgical site infection .
she was a healthy woman with two pregnancies : one normal delivery and the last , a cesarean section , as described .
neither tumor nor hernia could be identified . a computed tomography scan of her abdomen and pelvis demonstrated an intra - abdominal and pelvic abscess covered by intestine in the lower abdomen .
the patient was informed of the findings and the necessity of surgery , and she gave her consent .
under general anesthesia , a midline laparotomy was performed in the lower abdomen , starting from the umbilicus .
it revealed a large tumor may have been formed by the omentum and small intestine .
the small bowel was easily separated from the tumor . after isolating the tumor conforming to the omentum ,
all the cultures of the pus were negative , and the direct visualization shows polymorphonuclear leukocytes .
she was discharged home on postoperative day 3 and had no complications at the time of this writing .
an exhaustive effort was carried out to find the operative count during the cesarean section , and we found a normal amount of devices and surgical sponges .
the risk factors for foreign bodies forgotten in a patient are gynecologic , emergency , and general surgery .
obesity patients also have an increased risk , and changes in the treatment team can also contribute to the issue .
surgical sponges are the most common foreign materials retained ( 70% ) in the abdominal cavity because of their frequent usage and small size .
moreover , a blood - soaked sponge in a hemorrhagic abdomen can be difficult to distinguish from blood .
the clinical presentation of a retained foreign body looks like a pseudotumor or migration through the bowel .
the symptoms are not necessarily specific ; they include abdominal pain , an abdominal mass , rectal bleeding , bowel obstruction , fever , diarrhea , and weight loss , , .
serra describes a series of seven patients in which the median interval time between the operation and gauze removal was five years .
liessi s paper reported on nine patients with an interval time between the operation and the diagnosis of seven days to 21 years .
one patient per year in every hospital suffers from a forgotten foreign body . besides the morbidity affecting the patient ,
a forgotten foreign body could involve a lawsuit for damages against the surgeon and the nurses affected .
the compensation that courts decide upon in these cases is extremely high ; however , above all , the surgeon loses his or her good name and reputation .
the promotion of safety requires that all personnel involved in a healthcare procedure be aware that the potential for errors exists , and that teamwork and communication are essential for preventing errors .
however , whenever accounting for material depends on humans , mistakes will continue to be committed .
retained sponge and other material remains a major problem for the patient , even today , despite preventive measures taken by the surgeon and the hospital .
consent was obtained from the patient and her family after we explained that this publication is anonymous .
sergio susmallian : conception and design , acquisition of data , critical revision of the article , final approval of the version to be published .
benjamin raskin : acquisition of data , drafting the article , final approval of the version to be published .
royi barnea : analysis and interpretation of data , drafting the article , final approval of the version to be published . | highlightsgossypiboma consist in retained surgical sponges are more usual than the reported.a young patient nine years after cesarean section with abdominal pain and fever.an abscess was diagnosed in the lower abdomen by ct.during laparotomy , a sponge was extracted from a large abscess.she had a normal post - operative course . | Introduction
Case report
Outcome
Discussion
Conclusion
Consent
Conflicts of interest
Funding
Ethical approval
Author contributions
Guarantor |
urinary incontinence can be described as an involuntary urine loss , which has become a social or hygienic problem .
increase of intra - abdominal pressure causes urine leakage during coughing , laughing , or weightlifting .
sui can be demonstrated objectively by some tests including stress test and q - tip test .
the transobturator tape procedure was developed by delorme to reduce the complications associated with the tension - free vaginal tape ( tvt ) including bladder perforation , urinary retention , and bowel injury .
recently , suburethral slings have become a standard surgical procedure for the treatment of stress urinary incontinence when conservative therapy failed .
libido is a subjective issue that refers to a person 's sex drive or desire for sexual activity .
the definition and explanation of this term has been problematic since the symptoms are vague and can be seen in other conditions too , for example , depressive disorders .
moreover , no cutoff level for a normal range of libido has been agreed on .
the treatment of stress urinary incontinence by a suburethral sling procedure may improve body image by reducing urinary leakage .
conversely , sexual satisfaction may worsen by developing dyspareunia after the suburethral sling procedure . in this study
, we aimed to evaluate the effects of the tot procedure on female sexual satisfaction using lss and determine the level of pleasure with the operation .
this prospective observational study was performed at the department of gynecology of numune education and research hospital in adana , turkey .
the inclusion criteria for the study were women younger than 65 who had documented sui symptoms , a positive stress test , and a sexually active life .
the exclusion criteria included pregnancy , a previous pelvic surgery , severe complaints of urgency incontinence , and urinary tract infection not responding to therapy .
a total of 59 sexually active women who underwent solely the transobturator tape outside - in procedure ( i - stop , mesh , polypropylene ) between january 2012 and october 2012 were included in this study .
the patients were discharged when the postvoid residual volume was less than 100 ml .
their sexual satisfactions were scored using self - administered questionnaire libido scoring system preoperatively and 6 months postoperatively . the libido scoring system ( lss )
was developed in 1997 by api et al . and involves four questions on four domains : orgasmic function , coital frequency , sexual desire , and sexual self - interest ( masturbation ) ( table 1 ) .
the ( female sexual function index ) fsfi was well - correlated with the lss , revealing a correlation coefficient of 0.96 ( p < 0.001 ) ( cronbach coefficient was found to be 0.83 and the kappa values of total scores were 0.67 and 0.77 ) .
the patients were scored according to table 1 and a total score less than 3 was considered as loss of libido ; scores of 3 and 4 were considered as low libido , 57 as moderate libido , and 812 as high libido .
the patients were asked to ask themselves four questions to fill out the self - completed questionnaire : how often do you have sex or masturbate?do you masturbate ? who starts the sexual activity ?
( who asks for or implies sex first)do you orgasm by yourself and/or with your partner
? how often do you have sex or masturbate ? who starts the sexual activity ?
( who asks for or implies sex first ) do you orgasm by yourself and/or with your partner ?
their general satisfaction with the tot procedure was evaluated with a visual analogue score ( vas ) .
this gives the greatest freedom and maximum opportunity for each respondent to express their personal pleasure .
such vas data are recorded in millimeters from the left of the line with the range from 0 to 100 .
statistical analysis was carried out on a personal computer using the statistical package for social sciences version 11.5 ( spss 11.5 , demo , spss inc . ,
kolmogorov - smirnov test with the lilliefors correction was used to test whether the variables used in the study were normally distributed .
normally distributed data were expressed as mean standard deviation , and data that were not normally distributed were expressed as medians ( interquartile range ) .
wilcoxon 's signed - ranks test was used to compare the differences between preoperative and postoperative parameters .
of all women who underwent a tot procedure alone during the study period , 59 were eligible and agreed to take part in the study .
the mean age was 45.1 9.5 years , and the mean ( body mass index ) bmi was 28.8 3.5 kg / m .
the median values for gravidity , parity and vas scores of patients with interquartile ranges were 4 ( 3 ) , 3 ( 1 ) , and 85 mm ( 34 ) , respectively .
tables 2 and 3 show the previous surgeries that the patients underwent and the accompanied diseases they had .
table 4 shows the changing of incontinence , sex frequency , who starts the sexual activity , orgasm and total libido scores preoperatively and 6 months postoperatively , and p values .
the rate of patients who masturbated pre- and postoperatively was 37.3% ( n = 22 ) .
as shown in table 4 , all parameters ( incontinence , who starts the sexual activity , orgasm , and total score ) , with the exception of sexual intercourse frequency , improved significantly when compared to the preoperative period . as shown in figure 1 , loss of libido and low libido rates decreased ( from 32% to 28% and from 22% to 18.6% , resp . ) , and moderate and high libido rates increased ( from 39% to 44% and from 6.8% to 8.5% ) after the transobturator tape procedure .
there was no correlation between the vas and the difference between the pre- and postprocedure total libido ( spearman 's rho : 0.128 , p = 0.334 ) .
in this study , prospective data have been presented on the effects of the tot procedure on sexual satisfaction in women .
it is common knowledge that libido is a subjective matter in men and women involving several aspects including desire , pleasure , sexual life , intercourse , erection , ejaculation , orgasm , and happiness clitoral or penile sensation .
this mood causes some sexual disorders including loss of focus on sexual intercourse , avoidance , hesitation , and fear of humiliation .
we designed this research based on the idea that sexual life will improve as a result .
a total of 59 patients were included in this study , and their pre- and postsurgery libidos were compared . besides , overall pleasure with the surgery was measured by vas .
our findings demonstrate that two parameters of the libido scoring system ( who starts the sexual activity and orgasm ) , total libido scores , and continence ratios get better after the sling procedure .
increase in orgasm and starting the sexual activity may indicate increased enjoyment of sexual intercourse .
there was no correlation between general pleasure with the tot procedure and changing of total libido scores .
women who took part in the present study were followed up for 6 months postoperatively .
similarly , in our study , the libido improved by 40.7% , whereas the deterioration rate was 15.3% .
typically , incontinence cure rate after the transobturator tape procedure is very high . in our study , the total subjective cure rate was 81.4% . in a systematic review and meta - analysis by jha about the impact of incontinence surgery on sexual function on eighteen studies which analyzed 1578 women , the combined analysis of all studies showed that , in just over half of all women , there was no change of overall sexual symptoms after surgery ( 55.5% ) . for midurethral tapes alone
our data showed that two parameters ( who starts the sexual activity and orgasm ) improved at a statistically significant level by the tot procedure . this may be explained by increasing body image and self - esteem just by reducing stress urinary incontinence .
similarly , arts - de jong et al . reported a significant improvement of satisfaction with sexual function after incontinence surgery .
sexuality can be measured through patient - doctor interviews as well as through self - completion questionnaires .
it is important that such questionnaires should be simple and easy for the patient to complete .
moreover , questionnaires must be applicable to the target population based on their cultural , educational , ethnic , and religious backgrounds [ 11 , 12 ] . according to the same meta - analysis
, questionnaires used in studies included the prolapse and incontinence sexual function questionnaire ( pisq 31 and 12 ) , female sexual function index ( fsfi ) , lemack , bristol female lower urinary tract symptoms questionnaire ( bfluts ) , and the electronic pelvic floor assessment questionnaire ( epaq ) .
the libido scoring system ( lss ) was not used earlier to evaluate sexual satisfaction following sling procedures . the correlation between fsfi , the mostwidely used diagnostic test , and lss
the other weakness is a single - point evaluation at the 6-month follow - up .
collecting patient data at additional intervals of 12 months might have made the study stronger . |
introduction and hypothesis .
most women experience automatic urine leakage in their lifetimes .
sui is the most common type in women .
suburethral slings have become a standard surgical procedure for the treatment of stress urinary incontinence when conservative therapy failed .
the treatment of stress urinary incontinence by suburethral sling may improve body image by reducing urinary leakage and may improve sexual satisfaction . methods .
a total of 59 sexually active patients were included in the study and underwent a tot outside - in procedure .
the lss was applied in all patients by self - completion of questionnaires preoperatively and 6 months after the operation .
general pleasure with the operation was measured by visual analogue score ( vas ) .
pre- and postoperative scores were recorded and analyzed using spss 11.5 .
results .
two parameters of the lss , orgasm and who starts the sexual activity , increased at a statistically significant rate .
conclusion . sexual satisfaction and desire
have partially improved after the tot procedure .
| 1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. Conclusion |
the center for disease control and prevention estimated 91.1 million visits to the emergency department ( ed ) in 2010 among adults aged 18 to 64 years .
emergency department visits for health care are a major concern because a majority of these visits are for the care of ambulatory care sensitive conditions ( acscs ) and can be prevented with timely primary care .
emergency department visits due to acscs account for us$38 billion of total health - care spending in the united states .
there is a common misperception that almost all ed users who have preventable conditions or are frequent ed users are uninsured .
emergency department visits by medicaid beneficiaries accounted for about 12% of the total health - care spending on ed services in 2012 . emergency department use among medicaid beneficiaries
has received considerable attention due to expanding medicaid eligibility in 31 states . as there is some evidence of an inverse relationship between ed visits and community - level supply of primary care providers and health centers ,
it could be hypothesized that providing health insurance coverage to the uninsured without corresponding increases in primary care availability may lead to increased ed visits for nonemergent care .
some investigations have found little or no change in the ed utilization after provision of insurance coverage to the uninsured , while others found that the medicaid expansion significantly increased both preventable and nonpreventable ed utilization .
these studies have limited ability to provide conclusive evidence because they did not include a systematic adjustment for a comprehensive set of patient- and county - level factors .
the primary objective of the current study is to use patient - level administrative claims data to examine the association between the patient- and county - level factors and the ed visits . for the purposes of the study , data on ed visits by adult , fee - for - service ( ffs ) medicaid beneficiaries residing in maryland , ohio , and west virginia were selected .
these states were chosen as part of a long - term plan to investigate differences between the impact of the medicaid expansion ( ohio did not immediately expand , while the other states did ) and the health insurance marketplace ( maryland created a state - based marketplace , ohio a federally facilitated marketplace , and west virginia a partnership model marketplace ) .
all states have many subtle differences within their medicaid programs and benefits , as well , which can be compared easily through the kaiser family foundation s online database .
andersen s behavioral model ( abm ) for health - care services usage was adopted to provide a conceptual framework for the study .
the abm model posits that the health - care services utilization ( ed visits in the current study ) can be influenced by predisposing , enabling , need , external environment factors , and personal health practices as explained in the measures section .
max files are prepared and released by the centers of medicare and medicaid in assistance with research data assistance center .
these files include ( 1 ) personal summary , ( 2 ) inpatient claims , ( 3 ) other therapy claims , and ( 4 ) prescription drugs claims .
the current study used data on medicaid beneficiaries residing in maryland , ohio , and west virginia .
the area health resources files contain national- , state- , and county - level data on approximately 6000 variables .
the county health rankings data provides information on health behaviors , clinical care , social and economic factors , and physical environment for all counties in all states .
the inclusion criteria were : ffs medicaid beneficiaries , aged 22 to 64 years , with continuous medicaid enrollment , not eligible for medicare , and alive during the entire observation period .
pregnant women were excluded from the analysis because they may have unique prenatal needs ( n = 68 882 ) .
emergency department visits were identified from inpatient and outpatient claims . to identify ed visits from the outpatient claims ,
emergency department visits from the inpatient claims were identified using revenue codes ( 45052 , 456 , 459 , and 981 ) .
predisposing factors were age , gender , and race / ethnicity . enabling factors were patient - level medicaid eligibility due to cash assistance / poverty ( cash eligibility , no cash eligibility ) , county - level college education rate , primary care use ( none , fragmented , continuous ) , and county - level unemployment rate .
primary care use was measured using the modified , modified continuity index ( mmci ) developed by magill and senf , which ranged from 0 to 1 .
the mmci was developed to solve limitations of the usual provider of care and modified continuity index .
need factors were patient - level complex chronic illness ( physical health conditions , mental health conditions , physical and mental health conditions , none ) , medicaid eligibility due to medical need / waiver , and polypharmacy ( yes , no ) .
polypharmacy was defined as concomitant use of multiple prescription drugs within a 90-day period and was based on number of prescription drugs 1 standard deviation above the mean . in this study , complex chronic illness was defined as those having both physical and mental health conditions .
the selection of physical and mental health conditions was based on the framework provided by the health and human services office of the assistant secretary of health .
both physical and mental health conditions were identified if patients had an inpatient or outpatient claim .
personal health practices were patient - level tobacco use ( clinically coded into the medicaid data ) and county - level obesity rates .
external environment factors were measured at the county - level and included metro status , health professional shortage area ( hpsa no , partial , and complete shortage areas ) , number of hospitals with eds , number of hospitals with psychiatric emergency services , number of rural health clinics , number of federally qualified health centers ( fqhcs ) , number of community mental health centers , and number of urgent care clinics per 100 000 population .
mean , interquartile range ( iqr ) , and 90th percentile were used to describe the frequency of ed visits .
the frequency of ed visits can be analyzed using a variety of count data regression models .
they include poisson regression , negative binomial regression ( nbr ) , zero inflated poisson regression ( zip ) , and zero inflated nbr ( zinb ) . after comparing the predicted and actual probabilities , and log likelihood from all 4 statistical models , nbr and zinb models
the zinb model is complex and difficult to interpret due to its 2-part structure , and many economists and statisticians discourage using zinb models when nbr models fit well with the data .
therefore , this study used both unadjusted and adjusted nbr models to examine the patient- and county - level factors associated with the number of ed visits .
the adjusted nbr models included predisposing , enabling , need , external environment factors , and personal health practices .
the parameter estimates from the nbr models were converted to incidence rate ratios ( irrs ) by exponentiating the regression coefficients , and 95% confidence intervals were estimated .
incidence rate ratio above 1.0 implies higher number of ed visits and irr below 1.0 implies lower number of ed visits .
the data consisted of all counties in maryland , ohio , and west virginia ( 167 ) and patients nested within these counties . therefore , the nbr models were adjusted for clustering due to counties using stata version 14 .
max files are prepared and released by the centers of medicare and medicaid in assistance with research data assistance center .
these files include ( 1 ) personal summary , ( 2 ) inpatient claims , ( 3 ) other therapy claims , and ( 4 ) prescription drugs claims .
the current study used data on medicaid beneficiaries residing in maryland , ohio , and west virginia .
the area health resources files contain national- , state- , and county - level data on approximately 6000 variables .
the county health rankings data provides information on health behaviors , clinical care , social and economic factors , and physical environment for all counties in all states .
max files are prepared and released by the centers of medicare and medicaid in assistance with research data assistance center .
these files include ( 1 ) personal summary , ( 2 ) inpatient claims , ( 3 ) other therapy claims , and ( 4 ) prescription drugs claims .
the current study used data on medicaid beneficiaries residing in maryland , ohio , and west virginia .
the area health resources files contain national- , state- , and county - level data on approximately 6000 variables .
the county health rankings data provides information on health behaviors , clinical care , social and economic factors , and physical environment for all counties in all states .
the inclusion criteria were : ffs medicaid beneficiaries , aged 22 to 64 years , with continuous medicaid enrollment , not eligible for medicare , and alive during the entire observation period .
pregnant women were excluded from the analysis because they may have unique prenatal needs ( n = 68 882 ) .
emergency department visits were identified from inpatient and outpatient claims . to identify ed visits from the outpatient claims , cpt codes ( 99281 - 85 ) were used .
emergency department visits from the inpatient claims were identified using revenue codes ( 45052 , 456 , 459 , and 981 ) .
predisposing factors were age , gender , and race / ethnicity . enabling factors were patient - level medicaid eligibility due to cash assistance / poverty ( cash eligibility , no cash eligibility ) , county - level college education rate , primary care use ( none , fragmented , continuous ) , and county - level unemployment rate .
primary care use was measured using the modified , modified continuity index ( mmci ) developed by magill and senf , which ranged from 0 to 1 .
the mmci was developed to solve limitations of the usual provider of care and modified continuity index .
need factors were patient - level complex chronic illness ( physical health conditions , mental health conditions , physical and mental health conditions , none ) , medicaid eligibility due to medical need / waiver , and polypharmacy ( yes , no ) .
polypharmacy was defined as concomitant use of multiple prescription drugs within a 90-day period and was based on number of prescription drugs 1 standard deviation above the mean . in this study , complex chronic illness was defined as those having both physical and mental health conditions .
the selection of physical and mental health conditions was based on the framework provided by the health and human services office of the assistant secretary of health .
both physical and mental health conditions were identified if patients had an inpatient or outpatient claim .
personal health practices were patient - level tobacco use ( clinically coded into the medicaid data ) and county - level obesity rates .
external environment factors were measured at the county - level and included metro status , health professional shortage area ( hpsa no , partial , and complete shortage areas ) , number of hospitals with eds , number of hospitals with psychiatric emergency services , number of rural health clinics , number of federally qualified health centers ( fqhcs ) , number of community mental health centers , and number of urgent care clinics per 100 000 population .
emergency department visits were identified from inpatient and outpatient claims . to identify ed visits from the outpatient claims , cpt codes ( 99281 - 85 ) were used .
emergency department visits from the inpatient claims were identified using revenue codes ( 45052 , 456 , 459 , and 981 ) .
predisposing factors were age , gender , and race / ethnicity . enabling factors were patient - level medicaid eligibility due to cash assistance / poverty ( cash eligibility , no cash eligibility ) , county - level college education rate , primary care use ( none , fragmented , continuous ) , and county - level unemployment rate .
primary care use was measured using the modified , modified continuity index ( mmci ) developed by magill and senf , which ranged from 0 to 1 .
the mmci was developed to solve limitations of the usual provider of care and modified continuity index .
need factors were patient - level complex chronic illness ( physical health conditions , mental health conditions , physical and mental health conditions , none ) , medicaid eligibility due to medical need / waiver , and polypharmacy ( yes , no ) .
polypharmacy was defined as concomitant use of multiple prescription drugs within a 90-day period and was based on number of prescription drugs 1 standard deviation above the mean . in this study ,
the selection of physical and mental health conditions was based on the framework provided by the health and human services office of the assistant secretary of health .
both physical and mental health conditions were identified if patients had an inpatient or outpatient claim .
personal health practices were patient - level tobacco use ( clinically coded into the medicaid data ) and county - level obesity rates .
external environment factors were measured at the county - level and included metro status , health professional shortage area ( hpsa no , partial , and complete shortage areas ) , number of hospitals with eds , number of hospitals with psychiatric emergency services , number of rural health clinics , number of federally qualified health centers ( fqhcs ) , number of community mental health centers , and number of urgent care clinics per 100 000 population .
mean , interquartile range ( iqr ) , and 90th percentile were used to describe the frequency of ed visits .
the frequency of ed visits can be analyzed using a variety of count data regression models .
they include poisson regression , negative binomial regression ( nbr ) , zero inflated poisson regression ( zip ) , and zero inflated nbr ( zinb ) . after comparing the predicted and actual probabilities , and log likelihood from all 4 statistical models , nbr and zinb models
the zinb model is complex and difficult to interpret due to its 2-part structure , and many economists and statisticians discourage using zinb models when nbr models fit well with the data .
therefore , this study used both unadjusted and adjusted nbr models to examine the patient- and county - level factors associated with the number of ed visits .
the adjusted nbr models included predisposing , enabling , need , external environment factors , and personal health practices .
the parameter estimates from the nbr models were converted to incidence rate ratios ( irrs ) by exponentiating the regression coefficients , and 95% confidence intervals were estimated .
incidence rate ratio above 1.0 implies higher number of ed visits and irr below 1.0 implies lower number of ed visits .
the data consisted of all counties in maryland , ohio , and west virginia ( 167 ) and patients nested within these counties .
therefore , the nbr models were adjusted for clustering due to counties using stata version 14 .
36% beneficiaries had 3 ed visits , 14% had 4 to 9 ed visits , and remaining 4% had 10 or more ed visits .
the majority were females ( 56.2% ) , older adults aged 45 to 64 ( 58.1% ) , whites ( 85.3% ) , were eligible for medicaid through cash assistance / poverty ( 81.4% ) , lived in counties designated as either whole / part county hpsa ( 79.5% ) , and had fragmented / no primary care use ( 89.4% ) . in all , 18% had polypharmacy and 38% had both physical and mental health conditions .
the following were the range of county - level factors : college education rate 4% to 42% , unemployment rate 2.7% to 10.5% , obesity rate 18.8% to 35.7% , number of hospitals with psychiatric emergency services/100 000 population 0 to 5.9 , number of eds/100 000 population 0 to 13.1 , number of rural health clinics/100 000 population 0 to 32.9 , number of urgent care centers/100 000 population 0 to 13.1 , number of fqhcs/100 000 population 0 to 64.1 , and number of community mental health centers/100 000 population 0 to 3.6 .
overall , the mean number of ed visits were 2 with an iqr of 02 .
the unadjusted nbrs revealed that many subgroups of the population had higher number of ed visits : adults in the age - group 35 to 44 ( irr = 1.25 ) and 45 to 54 ( irr = 1.22 ) years ; african americans ( irr = 1.46 ) ; medicaid eligibility due to poverty / cash assistance ( irr = 1.35 ) ; college education rate ( irr = 1.02 ) ; fragmented primary care use ( irr = 1.55 ) ; polypharmacy ( irr = 2.10 ) ; presence of physical health conditions ( irr = 2.46 ) ; presence of mental health conditions ( irr = 1.69 ) ; presence of both physical and mental health conditions ( irr = 4.23 ) ; medicaid eligibility due to medical needs ( irr = 1.35 ) ; tobacco use ( irr = 2.54 ) ; and number of hospitals with psychiatric emergency services ( irr = 1.21 ) .
some subgroups of the population had lower number of ed visits : female ( irr = 0.08 ) ; obesity rate ( irr = 0.95 ) ; nonmetro status ( irr = 0.81 ) ; number of rural health centers ( irr = 0.99 ) ; and number of fqhcs ( irr = 0.99 ) .
no associations were observed between ed visits and the following factors : those aged 55 to 64 years old ; unemployment rate ; no primary care use ; no / partial county hpsa ; number of hospitals with eds ; number of urgent care centers ; and number of community mental health centers .
the irrs and 95% confidence intervals from the adjusted nbr are summarized in table 2 .
the relationship between ed visits and the following factors remained the same as observed in the unadjusted nbr models : females , african americans , no medical eligibility , fragmented primary care use , polypharmacy , and presence of complex chronic illness .
for example , those with polypharmacy had higher number of ed visits ( irr = 1.89 ) when compared to those individuals without polypharmacy . however , the association between ed visits and the following factors changed : age - group 45 to 54 ( irr = 0.78 ) , and 55 to 64 ( irr = 0.66 ) ; unemployment rate ( irr = 0.94 ) ; no primary care use ( irr = 0.92 ) ; and number of urgent care centers ( irr = 0.96 ) .
no associations were observed between ed visits and the following factors : 35 to 44 years old , medicaid eligibility due to poverty , college education rate , obesity rate , no / partial hpsa , nonmetro status of the county , number of hospitals with psychiatric emergency services , number of rural health centers , number of fqhcs , and number of community mental health centers .
the study findings revealed that a number of patient - level and few county - level factors were associated with the ed visits among adult ffs medicaid beneficiaries . among predisposing factors ,
the current study observed that african americans and hispanics had a higher number of ed visits when compared to whites .
the findings on racial / ethnic disparities are consistent with the published literature on ed usage . among the enabling factors , county - level unemployment rate and primary care use were associated with the number of ed visits .
a counterintuitive finding of this study is the inverse relationship between county - level unemployment rate and number of ed visits .
the reasons behind lower number of ed visits by individuals living in counties with high unemployment rate are not known .
findings from the current study support the published literature in which primary care use is inversely related to ed visits .
medicaid beneficiaries with fragmented primary care use had higher number of ed visits when compared to those with primary care continuity .
these findings suggest that timely and continuous primary care in outpatient health - care settings can reduce the frequency of ed visits among adult ffs medicaid beneficiaries .
when primary care use is fragmented , the patient may choose to use ed for nonemergency services .
it has been documented that individuals without adequate primary care may delay receiving appropriate care , which may in turn lead to increased use of ed .
this finding is consistent with prior studies in which ed users were found to have high medical needs , have chronic conditions , suffer from mental illnesses , and have greater number of psychotropic medications
. a plausible explanation for higher ed visits by those with chronic complex illness may be due to complications of chronic conditions , side effects , and adverse events due to multiple medications use , fragmented care because of visits to multiple providers , and/or direct contraindications to therapy for one condition by other conditions themselves . among personal health practices ,
individuals with tobacco use had a higher number of ed visits when compared to those without tobacco use .
future research may examine whether eds can serve as appropriate health - care settings for the provision of smoking cessation interventions .
indeed , the results from a recently published randomized controlled trial revealed that a smoking cessation intervention offered in an ed declined smoking rates among low - income smokers significantly .
it is plausible that ed users have limited access to other health - care providers who can encourage them to quit tobacco use .
some county - level external environment factors were associated with ed visits among adult ffs medicaid beneficiaries .
for example , this study noted that with higher number of urgent care centers significantly lower number of ed visits were observed .
this finding is consistent with another study by weinick et al that observed about 13.1% to 27.1% of ed visits can be prevented with increased use of urgent care centers and other health - care settings .
studies that have compared urgent care and ed care have found that costs of care in urgent care centers are lower when compared to eds .
considering the geographic population , policy , and resource differences typically seen across states , the results of this study represent only maryland , ohio , and west virginia and not generalizable to the entire medicaid population . as medicaid beneficiaries enrolled under managed care plans
the study was conducted using observational data , ; therefore , it is difficult to account for selection bias , as ed users may have different attributes in unobserved variables compared to the non - ed users .
as all the independent variables were measured in the same as year as the outcome variable , temporal relationships can not be established .
substance abuse leads to increased ed use ; however , the current study could not account for alcohol use and drug abuse because of limited sample size .
additionally , administrative claims data were used , which are created for billing purposes rather than research .
considering the geographic population , policy , and resource differences typically seen across states , the results of this study represent only maryland , ohio , and west virginia and not generalizable to the entire medicaid population . as medicaid beneficiaries enrolled under managed care plans
the study was conducted using observational data , ; therefore , it is difficult to account for selection bias , as ed users may have different attributes in unobserved variables compared to the non - ed users . the cross - sectional design of the study does not allow causal inferences .
as all the independent variables were measured in the same as year as the outcome variable , temporal relationships can not be established .
substance abuse leads to increased ed use ; however , the current study could not account for alcohol use and drug abuse because of limited sample size .
additionally , administrative claims data were used , which are created for billing purposes rather than research .
to conclude , the study is timely because many states have surveillance and other research projects to monitor the use of ed by medicaid beneficiaries and are exploring policies and programs that can reduce preventable ed visits .
the current study highlighted that only very few county - level factors and many patient - level factors were associated with ed visits .
these findings suggest that health - care delivery models that provide comprehensive care to complex patients may reduce the likelihood of ed visits .
implementing value - based insurance designs that provide financial incentives to promote primary care continuity may go a long way in reducing ed visits among adult ffs medicaid beneficiaries .
our study also indicates urgent care centers may be a viable substitute for eds in providing care for acute conditions and exacerbations of chronic conditions .
future studies need to examine whether the emerging healthcare delivery models such as medical homes , and accountable care organizations ( aco ) , which are specifically designed to take care of complex patients , can reduce the number of ed visits by the complex patients .
medicaid aco demonstration projects , for example , may provide evidence about whether the new delivery models can reduce the use of ed as well as the relationship between individual - level unemployment , poverty , and ed visits .
this study provides important baseline information on medicaid ed usage and the county- and individual - level factors driving the number of visits .
as data become available , it is expected that many studies will attempt to compare and contrast ed utilization among different states who chose various policy options related to medicaid and the health insurance marketplace .
our model presents a starting point and baseline data from which to begin that exploration . | objectivethe objective of this study was to examine the association of patient- and county - level factors with the emergency department ( ed ) visits among adult fee - for - service ( ffs ) medicaid beneficiaries residing in maryland , ohio , and west virginia.methodsa cross - sectional design using retrospective observational data was implemented .
patient - level data were obtained from 2010 medicaid analytic extract files .
information on county - level health - care resources was obtained from the area health resource file and county health rankings file.resultsin adjusted analyses , the following patient - level factors were associated with higher number of ed visits : african americans ( incidence rate ratios [ irr ] = 1.47 ) , hispanics ( irr = 1.63 ) , polypharmacy ( irr = 1.89 ) , and tobacco use ( irr = 2.23 ) .
patients with complex chronic illness had a higher number of ed visits ( irr = 3.33 ) .
the county - level factors associated with ed visits were unemployment rate ( irr = 0.94 ) and number of urgent care clinics ( irr = 0.96).conclusionpatients with complex healthcare needs had a higher number of ed visits as compared to those without complex healthcare needs .
the study results provide important baseline context for future policy analysis studies around medicaid expansion options . | Introduction
Methods
Study Design
Data Sources
Medicaid Analytic Extract (MAX) Files-2010
Area Health Resources Files (AHRF)
County Health Rankings Data
Study Population
Dependent Variable
Number of ED visits
Independent variables
Statistical Analysis
Results
Discussion
Limitations
Conclusion |
galloway - mowat syndrome , which is also known as microcephaly - hiatal hernia - nephrotic syndrome , is an extremely rare genetic disorder transmitted by an autosomal recessive trait .
recent linkage studies in two algerian families identifi ed a homozygous mutation in the gms1 gene .
the protein encoded by this gene is expressed in many tissues , including brain and glomerular podocytes , and has yet an unknown function characterized by varieties of physical and developmental abnormalities that usually appear before age physical features may include an unusually small head ( microcephaly ) and additional abnormalities of the craniofacial area in addition to clusters of capillary damage in the kidneys ( focal glomerulosclerosis and /or diffuse mesangial sclerosis ) , resulting in abnormal kidney function or nephrotic syndrome .
additional findings in this syndrome include seizures , hiatal hernia and deformities of the extremities . in this case report
, we present the fi rst galloway - mowat syndrome recognized in iran with aconstellation of renal , neurological and facial characters , in addition to gastroesophageal reflux .
a 7 month old male infant from consanguineous parents , born at the 40th week of gestation , had a birth weight of 2900 g ( below -1 sd ) and head circumfence of 32 cm ( -3sd ) with microcephaly , dilated ventricles and decreased large cortical folds beside to some typical face features ( figure 1 ) .
microgenathia , low set larg ear , beak nose ,
high philthrum are prominent in this patiant .
the infant had hypotonia , delayed developmental milestones with exaggerated tendon reflex and frequent regurgitation that caused him to come to our clinic for additional investigations .
a barium swallow showed gastroesophageal
refl ux .
during the fifth month of life , gradually edema and
ascites appeared due to heavy proteinuria , associated hyperlipidemia and hypoalbuminemia which were remarkable for nephrotic syndrome and hypothyroidism . in general , the patient s appearance was remarkable for microcephaly ( head circumference at
the 7th month of life was 37 cm , severely below -3sd ) and his chest circumference was 40 cm .
his weight with severe ascites was 6500 g and height was 65 cm , both below -1sd .
the patient s head was flat in the vertex and back
( occiput ) of his head with a narrow forehead , sparse hair , high arched palate , hyperthelorism , almond eyes , small jaw ( microgenathia ) , large ears and strabismus(figures 3 ) .
sparse , almond eye , strabismus , high
philthrum , beak nose are apparent
the patient could not hold his neck , turn to his back or move in bed.he had severe proteinuria . the urine protein to creatinine ratio in a random sample was > 100 ( normal for age :
< 0.7 ) and serum albumin dropped below 1.7 mg / dl with hyperlipidemia ( triglycerides : 538 mg / dl , and cholesterol : 206 mg / dl ) and decreased renal function ( 19 ml / min/1.73 m in 2 months ) .
this case report discussed an infant male who , for the first time in iran , presented with hypotonia , microcephaly and slow growth of head circumference .
his skull growth curve had a greater decrease in contrast to other physical growth indices .
additionally , he had frequent regurgitation that was diagnosed as gastroesophageal reflux , hypothyroidism and nephrotic syndrome , each of which appeared in turn .
galloway - mowat syndrome is a rare syndrome transmitted as an autosomal recessive pattern although nonsense mutation in the gms1 gene has been suggested .
it is known as a triad of microcephaly , nephrotic syndrome and hiatal hernia which was first described in 1968 .
during the past decades
more than 40 infants having galloway - mowat syndrome type nephrotic syndrome together with primary microcephaly and mental retardation have been reported .
some published cases describe other extrarenal disorders such as hiatus hernia , dysmorphic features , and diaphragmatic defects .
the age at onset of the nephrotic syndrome has varied from the first days of life to months , or even later in childhood .
the early manifesting cases are often lethal while the later manifesting cases show a more variable renal prognosis including totally normal renal function , as reviewed
by meyers et al .
however , in infants with galloway - mowat syndrome , the outer layer of the brain may have folds that are abnormally small ( microgyria ) , there may be a reduced number of folds that are larger than normal ( pachygria ) or the folds may be absent or incompletely formed ( lissencephaly ) .
developmental abnormalities in affected infants and children may include an inability to perform certain movements ( motor ) , retarded mental activity ( psychomotor retardation ) and mental retardation .
our case was born from a term pregnancy with normal apgar from consaguinous parents without any similar cases in his family .
his hypotonia and microcephaly were prominent from birth due to brain atrophy and pachygyria
with dilated ventricles and subarachnoid spaces associated with developmental and severe motor delay .
his frequent regurgitation lead to the diagnosis of gastroesophageal reflux as seen on barium swallow imaging .
lastly , hypothyroidism and proteinuria were diagnosed simultaneously in the 5 month , although his nephritic syndrome
became more severe in the 7 month .
this confirmed other studies that early appearance of renal dysfunction was related to prognosis and decreased gfr has been seen more prominently in younger age groups who mostly have diffuse mesangial sclerosis .
although many facial characters have been described for galloway - mowat syndrome such as the shape of the skull , high arched palate , thin lips , saddle nose , almond eyes , sparse hair and microgenathia , all these features may not
be seen in all cases . in this case , however , many of the facial hallmarks were present , such as : vertex that was flat at the top and back , high narrow forehead , sparse hair , strabismus , almond eyes , widely spaced eyes ( ocular hypertelorism ) , small jaw bones ( micrognathia ) , high arched palate roof , large low set ears , high length philtrum , narrow lips and deep nasal bridge .
microcephaly that was accentuated after birth , craniofacial deformities , nephrotic syndrome , hypothyroidism and gastroesophageal reflux in addition to a rapid drop in glomerular filtration rate and increased proteinuria were hallmarks of our case that presented with galloway - mowat syndrome .
we express our appreciation to the authors named and patients that came with us until now .
| in this case report , we present the first diagnosed case of galloway - mowat syndrome in iran . a 7 month old infant boy with microcephaly that had prominently stunted head growth after birth , gastroesophageal reflux , multiple craniofascial characters , hypothyroidism and nephrotic syndrome diagnosed at 5 months of age associated with rapid decline in renal function and heavy proteinuria in 2 months . |
INTRODUCTION
CASE REPORT
DISCUSSION
ACKNOWLEDGMENT
CONFLICT OF INTEREST
|
malaria is a major public health problem in tropical and subtropical countries including india and its dynamics vary from place to place . among all anopheline vectors , anopheles culicifacies ( diptera : culicidae ) is a principal malaria vector in rural , periurban and tribal settings ( mishra et al .
culicifacies has a wide distribution that extends from ethiopia , yemen and iran in the west via afghanistan , pakistan , india , bangladesh , myanmar and thailand , to laos and vietnam and combodia in the east ( harrison 1980 , van bortel et al .
it is found in nepal and southern china , and in the south in sri lanka .
culicifacies is a complex of 5 isomorphic types which are designated as species a and b ( green and miles 1980 ) , species c ( subbarao et al . 1983 ) , species d ( subbarao et al .
1989 , vasantha et al . 1991 ) and species e ( kar et al . 1999 ) with varying biological characteristics such as feeding preference , biting activity , and susceptibility to commonly used insecticides in public health programs ( joshi et al .
madhya pradesh is situated in the central part of india with an area of 308 thousand km of which forest cover 76,429 km ( about 25% of the total land area ) .
madhya pradesh ( population 72.6 million ) along with other states like orrisa ( population 42 million ) , jharkhand ( population 33 million ) , and chhattisgarh ( population 25.5 million ) contributes for more than 60% of reported ( confirmed ) malaria cases in india . according to national vector borne diseases control program ( nvbdcp ) epidemiological data for 2010 from predominantly these tribal states with a total population of 173.1 million ( out of a total of the country population i. e. , 1.21 billion ) represent 14.3 % population show persistent malaria transmission with high api ( annual parasite incidence ) , slide positivity rate ( spr ) and very high pf% ( sharma 2012 ) .
madhya pradesh alone account for 6% of the total population of the country but contributes to 8.6% of the total malaria cases .
malaria is complex in madhya pradesh because of vast tracts of forest with tribal settlement ( 20% of state population ) ( singh et al .
2004 , anon 2007 ) . the magnitude of the problem can be accessed from an estimate made in 1987 , that 54 million individuals of various ethnic origins residing in forested area of india and accounting for 8% of the total population contributed 30% of total malaria cases , 60% of total falciparum cases and 50% of malaria deaths in the country ( sharma 1996 ) .
the reasons for such a high diseases prevalence in madhya pradesh is mainly due to locations of the villages in the deep forest and is characterized by rocky undulation interspersed with ravines and foothills .
these streams flow continuously and provide ample breeding sites covered with dense aquatic vegetation for production of number of anophelines particularly an .
therefore malaria control in these areas requires specific approaches and control strategies which includes the proper surveillance for distribution of an .
culicifacies members and their identification ( pattanayak et al . 1994 ) . since sibling species a , b , c , d and e of an .
culicifacies are morphologically indistinguishable at any stage of life and due to practical difficulties associated with classical cytotaxonomic method for the identification of members of the complex , a molecular method using an allele - specific polymerase chain reaction ( as - pcr ) assay targeted to the d3 domain of 28s ribosomal dna was used to distinguish these sibling species ( singh et al .
firstly in d3-pcr the species complex is distinguished in two groups i.e. , a and d in one group and species b , c and e in the second group . in second tier
involves ad - pcr assay which distinguishes species a from species d , whereas the bce - pcr assay distinguishes species b , c and e with each other . with combination of these two tier pcr assays it is possible to identify individual mosquito of the an .
culicifacies species in various districts of madhya pradesh , india . in the earlier reports from this region
species a , b , c and d were identified but species e reported from southern parts of india only was not reported from this area . noticeably in our study we encountered species e from some of the districts in co - habitation with species b which indicates that all the five members of an .
the adult anopheline mosquito species were collected from different districts of madhya pradesh ie , mandla ( dungaria village ) , jabalpur ( barela village ) , chindwara ( chakarpat and chikhla villages ) , hoshangabad ( dhadav and padav villages ) , narsinghpur ( chinki village ) and khandwa ( chighdhalia ) ( fig . 1 and table 1 ) .
these sites were selected on the basis as they represent the tribal belt along the streams of narmada river and also show high incidence of malaria ( singh 2004 , 2006 , 2009 , sharma 2012 ) .
the collections were made during the transmission period i.e. february march and august september in the morning period between 0600 h to 0800 h using mouth aspirator and battery operated torch .
the fed anophelines were captured at various collection sites including human dwellings , cattle sheds , mixed dwelling and random collection sites .
the fed mosquitoes were captured so that f1 generation of these mosquitoes can be utilized for further use after egg lay .
all adult mosquitoes were brought to the lab for their identification by using standard keys ( christopher 1933 , wattal and kalra 1961 , das et al .
each representative sample was pinned as a voucher specimen and kept in laboratory as a reference collection . from these collection
culicifacies female were separated and allowed for egg laying and the adult emerged from them are used for further standardization and identification of mosquito sibling species using allele specific polymerase chain reaction ( as - pcr ) ( goswami et al .
map showing different collection sites in the study list of collection sites and result using as - pcr assay of an .
culicifacies mosquito the dna extraction was done by using method as described in our previous publication ( sharma et al .
each single adult mosquito was homogenized in the micro centrifuge tube by adding 100 l lysis buffer .
the homogenate was immediately kept on ice for 10 minutes and followed by heat treatment at 65 c for 30 minutes .
subsequently , 30 l 5 m potassium acetate was added and immediately transferred to ice for one hour followed by centrifugation at 13,000 rpm for 15 minutes at 10 c . to the supernatant obtained
, a double volume of absolute chilled ethanol was added for precipitation of dna and kept tubes at 20 c for overnight .
after centrifugation at 13,000 rpm for 15 minutes at 10 c , the precipitated dna was washed in 70% ethanol twice .
the dna pallet was allowed to air dry and finally dissolved in 50 l te buffer .
the targeted region , d3 domain of 28 s rdna , was amplified by pcr using universal primers , d3a and d3b designed for platyhelminth ( litvaitis et al .
another set of allele specific primers namely aca and acb which are specific to species a / d and species b / c / e respectively were selected for design of multiplex as - pcr .
the sequences for the primers used were given in the table 2 with their annealing temperatures .
culicifacies sibling species the amplification was performed in a total of 15 l of reaction mixture consisting of tris .
hcl 10 mm ph 9.0 , kcl 50 mm mg cl2 2 mm , dntp 0.2 mm 10 pmoles of primer 0.5 u of taq dna polymerase ( mbi fermentas ) and 10ng of genomic dna .
reactions were performed in a ( biorad pcr system icycler ) thermal cycler . the pcr condition consisted of initial denaturation step for 5 min at 95 c followed by 35 cycles of 30 sec at 95 c , 30 sec at 55 c , and 60 sec at 72 c .
a total of seven primers of which three primers adf , adr , and df were used in the ad - pcr assay differentiating sibling species a from d , and the other four set of primers bcef , bcr , cr and er were used in the bce - pcr assay for the dedifferentiating species b , c and e from each other ( table 2 ) .
optimized condition for ad - pcr assay includes 35 cycles of the initial denaturation temperature at 95 c for 40 s , annealing at 50 c for 40 s , and extension 68 c for 40 s , followed by a final extension at 72 c for 10 min .
the pcr reaction was comprised of adf , adr and df primers each at 25 pmol , 200mol / l of each of the dntp , 1.5 mmol/ l mgcl2 , 20 mmol / l ( nh4 ) so4 , 75 mmol/ l tris - hcl ph 9.0 and 0.625 unit of taq dna polymerase . whereas the condition for bce - pcr assay are similar as described for the ad - pcr assay except for the primer concentration of 25 pmol bcef primer , 12 pmol bcr primer , 25 pmol er primer and 30 pmol cr primer respectively .
the adult anopheline mosquito species were collected from different districts of madhya pradesh ie , mandla ( dungaria village ) , jabalpur ( barela village ) , chindwara ( chakarpat and chikhla villages ) , hoshangabad ( dhadav and padav villages ) , narsinghpur ( chinki village ) and khandwa ( chighdhalia ) ( fig . 1 and table 1 ) .
these sites were selected on the basis as they represent the tribal belt along the streams of narmada river and also show high incidence of malaria ( singh 2004 , 2006 , 2009 , sharma 2012 ) .
the collections were made during the transmission period i.e. february march and august september in the morning period between 0600 h to 0800 h using mouth aspirator and battery operated torch .
the fed anophelines were captured at various collection sites including human dwellings , cattle sheds , mixed dwelling and random collection sites .
the fed mosquitoes were captured so that f1 generation of these mosquitoes can be utilized for further use after egg lay .
all adult mosquitoes were brought to the lab for their identification by using standard keys ( christopher 1933 , wattal and kalra 1961 , das et al .
each representative sample was pinned as a voucher specimen and kept in laboratory as a reference collection . from these collection
culicifacies female were separated and allowed for egg laying and the adult emerged from them are used for further standardization and identification of mosquito sibling species using allele specific polymerase chain reaction ( as - pcr ) ( goswami et al .
map showing different collection sites in the study list of collection sites and result using as - pcr assay of an .
the dna extraction was done by using method as described in our previous publication ( sharma et al .
each single adult mosquito was homogenized in the micro centrifuge tube by adding 100 l lysis buffer .
the homogenate was immediately kept on ice for 10 minutes and followed by heat treatment at 65 c for 30 minutes .
subsequently , 30 l 5 m potassium acetate was added and immediately transferred to ice for one hour followed by centrifugation at 13,000 rpm for 15 minutes at 10 c . to the supernatant obtained
, a double volume of absolute chilled ethanol was added for precipitation of dna and kept tubes at 20 c for overnight .
after centrifugation at 13,000 rpm for 15 minutes at 10 c , the precipitated dna was washed in 70% ethanol twice .
the dna pallet was allowed to air dry and finally dissolved in 50 l te buffer .
the targeted region , d3 domain of 28 s rdna , was amplified by pcr using universal primers , d3a and d3b designed for platyhelminth ( litvaitis et al .
another set of allele specific primers namely aca and acb which are specific to species a / d and species b / c / e respectively were selected for design of multiplex as - pcr .
the sequences for the primers used were given in the table 2 with their annealing temperatures .
culicifacies sibling species the amplification was performed in a total of 15 l of reaction mixture consisting of tris .
hcl 10 mm ph 9.0 , kcl 50 mm mg cl2 2 mm , dntp 0.2 mm 10 pmoles of primer 0.5 u of taq dna polymerase ( mbi fermentas ) and 10ng of genomic dna .
reactions were performed in a ( biorad pcr system icycler ) thermal cycler . the pcr condition consisted of initial denaturation step for 5 min at 95 c followed by 35 cycles of 30 sec at 95 c , 30 sec at 55 c , and 60 sec at 72 c .
a total of seven primers of which three primers adf , adr , and df were used in the ad - pcr assay differentiating sibling species a from d , and the other four set of primers bcef , bcr , cr and er were used in the bce - pcr assay for the dedifferentiating species b , c and e from each other ( table 2 ) .
optimized condition for ad - pcr assay includes 35 cycles of the initial denaturation temperature at 95 c for 40 s , annealing at 50 c for 40 s , and extension 68 c for 40 s , followed by a final extension at 72 c for 10 min .
the pcr reaction was comprised of adf , adr and df primers each at 25 pmol , 200mol / l of each of the dntp , 1.5 mmol/ l mgcl2 , 20 mmol / l ( nh4 ) so4 , 75 mmol/ l tris - hcl ph 9.0 and 0.625 unit of taq dna polymerase . whereas the condition for bce - pcr assay are similar as described for the ad - pcr assay except for the primer concentration of 25 pmol bcef primer , 12 pmol bcr primer , 25 pmol er primer and 30 pmol cr primer respectively .
the targeted region , d3 domain of 28 s rdna , was amplified by pcr using universal primers , d3a and d3b designed for platyhelminth ( litvaitis et al .
another set of allele specific primers namely aca and acb which are specific to species a / d and species b / c / e respectively were selected for design of multiplex as - pcr .
the sequences for the primers used were given in the table 2 with their annealing temperatures .
culicifacies sibling species the amplification was performed in a total of 15 l of reaction mixture consisting of tris .
hcl 10 mm ph 9.0 , kcl 50 mm mg cl2 2 mm , dntp 0.2 mm 10 pmoles of primer 0.5 u of taq dna polymerase ( mbi fermentas ) and 10ng of genomic dna .
reactions were performed in a ( biorad pcr system icycler ) thermal cycler . the pcr condition consisted of initial denaturation step for 5 min at 95 c followed by 35 cycles of 30 sec at 95 c , 30 sec at 55 c , and 60 sec at 72 c .
a total of seven primers of which three primers adf , adr , and df were used in the ad - pcr assay differentiating sibling species a from d , and the other four set of primers bcef , bcr , cr and er were used in the bce - pcr assay for the dedifferentiating species b , c and e from each other ( table 2 ) .
optimized condition for ad - pcr assay includes 35 cycles of the initial denaturation temperature at 95 c for 40 s , annealing at 50 c for 40 s , and extension 68 c for 40 s , followed by a final extension at 72 c for 10 min .
the pcr reaction was comprised of adf , adr and df primers each at 25 pmol , 200mol / l of each of the dntp , 1.5 mmol/ l mgcl2 , 20 mmol / l ( nh4 ) so4 , 75 mmol/ l tris - hcl ph 9.0 and 0.625 unit of taq dna polymerase . whereas the condition for bce - pcr assay are similar as described for the ad - pcr assay except for the primer concentration of 25 pmol bcef primer , 12 pmol bcr primer , 25 pmol er primer and 30 pmol cr primer respectively .
during the collection period a large number of anopheles mosquitoes were collected from the various collection sites ( fig .
1 and table 1 ) and per man per hour ( pmh ) count estimate was also made from each site .
culicifacies during the study period was found to be in the range of 8120 pmh , with a high density during august - september ( 90120 pmh ) and to a low density in february march ( 850 pmh ) . the as - pcr assay using different primers , the a / d specific primer ( aca ) in conjunction with d3b produces 313 bp amplification product and b / c / e - specific primer ( acb ) forms 133 bp product with d3a . additionally , the external primers d3a and d3b form common product in all the samples with 382bp products in species a and d whereas 385bp in species b / c / e serving as positive control ( fig .
2 ) . for further distinguishing the sibling species in a / d and b / c / e individually ,
a total of seven primers of which three primers adf , adr , and df were used in the ad - pcr assay differentiating sibling species a from d , and the other four set of primers bcef , bcr , cr and er were used in the bce - pcr assay differentiating sibling species b , c and e from each other . in ad - pcr ,
the sibling species a and d produced the bands of 359 bp for d species and 359 bp and 166 bp for sibling species a. on the other hand in bce - pcr , the products are 248 bp for b , 248 bp and 95 bp for c and 248 and 178 for sibling species e respectively ( fig .
d3-pcr showing the different bands to differentiate a / d and b / c / e sibling species of an .
culicifacies allele specific multiplex ad - bce - pcr showing different bands for each an .
culicifacies collected from different districts from madhya pradesh ie , mandla , jabalpur , chindwara , hoshangabad , narsinghpur and khandwa respectively .
the collected mosquitoes were subjected to two tier pcr assays . from the d3-pcr only narsinghpur and khandwa samples were identified in a / d group whereas all the other districts samples were identified in and identified in b / c / e group ( fig .
results obtained from ad - bce pcr showed the presence of sibling species b from jabalpur , chindwara and hoshangabad , c from hoshangabad only , d from narsinghpur and khandwa and sibling species e from mandla , chindwara and hoshangabad respectively ( fig .
the accurate identification and distribution pattern of anopheline mosquitoes is necessary for planning effective vector control strategies and for a better understanding of their potential role in malaria transmission .
wattal and kalra in 1961 described 32 species of female anophelines in different regions of india .
they divided india in six regions and included madhya pradesh in hyderabad region where about 28 species were described from this region ( wattal and kalra 1961 ) . in our collection
we have also encountered about 11 species of anopheles from the study area which includes an .
but in the study area malaria is mainly transmitted by two efficient vectors i.e. , an .
culicifacies being a major vector of malaria in india is responsible for approximately 65% of total malaria cases ( sharma 1998 ) . in india
culicifacies have been found among these species b was found throughout the country whereas species e was reported only from the southern parts of india .
they may be different in the feeding pattern an important characteristics that influence vectorial capacity .
distinct difference were observed in laboratory studies with reference to insemination rate , fecundity , longevity , oviposition , gonotropic cycle , egg hatching , larval mortality rates and adult emergence time have been observed in different species of an .
attempts to find morphological markers for the members of species complex have not been successful so far except the variation in spermatheca of sibling species a and b ( das 1990 ) but this difference still need to be reconfirmed by other techniques .
the classical technique of cytotaxonomic is difficult and has limited use as this requires semi gravid females only and moreover it requires highly skilled personnel . with the advent of dna based technology we are now able to differentiate members of an .
the dna based technology includes pcr assay which are simple and sensitive at the same time they are applicable to all stages and either sexes of mosquitoes ( goswami et al .
2006 ) . as reported by sharma ( 2012 ) in his review that the epidemiological indices of malaria in madhya pradesh revealed a very dismal picture of malaria .
an international team of experts reported a very high incidence of malaria in pregnancy ( mip ) .
for example in madhya pradesh ( rural ) 183,0001.5 million per year contract malaria in pregnancy , and result in 73,000629,000 lost foetus and 1,500 to 12,600 maternal deaths .
plausible estimate of 220,000 mip cases per year ( 136,000305,000 ) , 95,800 lost fetus ( 56,800147,600 ) and 1,000 maternal deaths ( 6501,600 ) ( diamond et al .
culicifacies mosquito species were collected from different malaria endemic district of madhya pradesh by using as - pcr we were able to identify four species b , c , d and e from these areas .
species e was not reported earlier from these areas as this species is prevalent only in southern peninsular part of india .
species e is highly anthropophagic and possesses high sporozoite rate up to 20% and also known as vector in southern india and srilanka ( kar et al .
we encountered species e from mandla , chindwara and hoshangabad districts respectively which have high disease prevalence and represent the tribal belts ( singh 2004 , 2006 , 2009 , sharma 2012 ) .
noticeably this species e was found sympatric with a non vector species b from chindwara and hoshangabad district , but in jabalpur district only species b and in mandla only species e were identified .
topographically the villages under study from mandla and jabalpur are very close to each other .
although species b is a poor vector of malaria in india but through examination of mitotic y chromosome morphology ( kar et al .
1999 ) , that what was reported as b on the sri lanka island is really a sympatric mixture of b and e ( surendran et al .
moreover these two sibling species in sri lanka differ in longevity and in their susceptibility to malaria parasite infection and common insecticides ( surendran et al .
it is evident from the literature that species e can not be differentiated from species b because they have homosequential polytene chromosome arrangements .
species e requires mitotic chromosome examination of male progeny and/or vectorial potential needs to be established for distinction from species b ( kar et al .
after screening several enzyme systems , electrophoretic variation at the lactate dehydrogenase ( ldh ) locus was useful .
it could group species a and d in one category and species b and c in another category ( adak et al .
species e showed the same ldhs allele as in species b and c ( kar et al .
e , the paradox that species b females from northern india are not vectors , but homosequential females from rameshwaram island are vectors is resolved .
similar studies are needed to be carried out to see the vectorial capacity and disease transmission in the studied districts of madhya pradesh . as in mainland areas close to rameshwaram , species e were found , populations in other parts of tamilnadu state where species b has been identified also should be examined ( kar et al .
culicifacies populations identified as species b in sri lanka also should be examined immediately for y - chromosome variations and correlated with malaria infection ( surendran et al .
1997 ) has reported acrocentric and submetacentric y - chromosomes within species b but no epidemiological or dissection data is available that indicates that species b is a vector .
thus , there is an urgent need to develop suitable markers that can differentiate species b and e and also to see the other biological characteristics of these two species in such cohabiting areas to conclude that which species is responsible for disease transmission .
moreover new areas should be explored for the presence of species e as it is a potent vector of malaria .
hence there is an urgent need for nationwide surveillance and identification of vector sibling species distribution once again so that modified species pattern in these areas could be established .
apart from confirming their identity , distribution pattern and their differential malaria vector status , it will be important to determine the susceptibility of these sibling species to insecticides in each part of the states/ country as this affects the efficiency of vector control operations in the malaria control programs in india .
in conclusion we can say that as we encountered a new sibling species e of an .
existence of such modified distribution of sibling species may exist in other areas also which necessitate for reconsidering the sibling species distribution in newer area .
knowledge of proper identification and distribution pattern of sibling species may further help us in development of vector control strategies . | background : anopheles culicifacies is an important vector of malaria in southeast asia , contributing to almost 70% of malaria cases in india .
it exists as a complex of five morphologically indistinguishable species a , b , c , d and e with varied geographical distribution patterns . in india
, 8% of the total population of madhya pradesh ( central india ) contributes about 30% of total malaria cases , 60% of total falciparum cases and 50% of malaria deaths .
an .
culicifacies is the major malaria vector in this state .
vector control mainly relies on the proper identification and distribution of vector species exists in a particular area .
the present study was carried out to identify the distribution of an .
culicifacies sibling species in certain endemic district of central india , madhya pradesh.methods:the an .
culicifacies mosquitoes collected from the study districts were identified morphologically .
the genomic dna was isolated from the mosquitoes and subjected to allele specific pcr targeting d3 domain of 28s ribosomal dna.results:the mean prevalence of an .
culicifacies during the study period was in the range of 8120 per man per hour ( pmh ) . from the study areas species
b was identified from jabalpur , chindwara and hoshangabad , species c from hoshangabad only , species d from narsinghpur and khandwa and sibling species e from mandla , chindwara and hoshangabad respectively.conclusion:this is the first report to detect species e from madhya pradesh region which necessitate for reconsideration of species distribution of each an .
culicifacies sibling species that would enable to develop required vector control strategies . | Introduction
Materials and Methods
Collection of Mosquitoes
DNA Isolation
Allele Specific PCR (AS-PCR)
D3-PCR
AD-PCR and BCE-PCR
Results
Discussion
Conclusion |
stooped
working positions require sustained trunk flexion , which can be a risk factor of
work - related musculoskeletal disorders1 , 2 .
postures that are used when working at
below - knee heights , such as stooping , occur more commonly on building sites than in other
work environments3 . stooped postures in
working situations are often related to neck and shoulder pain4 .
work - related musculoskeletal disorders such as overuse disorders
account for a significant proportion of work injuries
. certain risk factors also increase
upper - extremity muscle injuries , including repetitive work and assembly work5 , 6 .
work - related musculoskeletal disorders are
painful disorders of muscles and tendons that can be induced by work activities that are
repetitive or that involve awkward postures6 .
however , few studies have evaluated the effects of different
below - knee assembly work reach distances .
the purpose of this study was to evaluate the
effect of reach distances on the upper extremity disorders of below - knee workers .
sixteen young , male , right - hand - dominant workers with a mean age of 21.3 1.7 years ,
height of 172.7 6.4 cm , and weight of 66.1 9.6 kg were recruited .
they had no past history of orthopedic disorders
affecting the neck or shoulder region and no history of neurological disorders .
this study was approved by
the inje university faculty of health sciences human ethics committee .
muscle activity was
measured using the mp150 system ( biopac systems , santa barbara , ca , usa ) with a pair of
ag / agcl electrodes measuring 2 cm in diameter .
the upper trapezius , anterior deltoid , and
biceps brachii muscles are often the source of pain in the upper extremity4 .
three surface electrodes were placed on the
muscles of the dominant ( right ) side : slightly lateral to and halfway between the cervical
spine at c-7 and the acromion for the upper trapezius ; on the anterior aspect of the arm ,
approximately 4 cm below the clavicle for the anterior deltoid ; and for the biceps brachii ,
the subjects were asked to flex the forearm in the supinated position , and two active
electrodes were placed 2 cm apart , parallel to the muscle fibers at the center of the muscle
mass8 .
the sampling rate of the emg signal was
1,000 hz , and signals were band - pass filtered between 20 and 450 hz .
emg data were normalized using the maximum voluntary isometric
contraction ( mvic ) value of each muscle .
mvic was measured using the manual muscle test as
described by kendall et al9 .
all subjects
performed below - knee assembly work ( nut - and - bolt assembly ) for 3 min using the same
workstation . working postures for the task required sustained knee and trunk flexion .
the
experimental protocol specified three below - knee assembly work conditions : a height of 30 cm
and a reach distance of 30 cm ( rd30 ) ; a height of 30 cm and a reach distance of 45 cm
( rd45 ) ; and a height of 30 cm and a reach distance of 60 cm ( rd60 ) .
the activities of the right upper trapezius , anterior deltoid , and biceps
brachii muscles were measured for each below - knee assembly work condition .
the emg signal
was collected for 3 min , and the first and last 10 s were discarded . during data collection ,
the participants were barefoot .
statistical analysis was performed using one - way
repeated - measures analysis of variance ( anova ) .
the bonferroni correction was used to
identify specific differences among multiple pair - wise comparisons . all significance levels
were chosen as p < 0.05 , and spss software ( ver . 20.0 ; ibm , armonk , ny , usa ) was used for
statistical analyses .
the upper trapezius muscle activity of rd60 ( 21.9 7.0 ) was significantly higher than
those of rd45 ( 13.3 5.8 ) and rd30 ( 6.3 2.9 ) , and that of rd45 was higher than that of
rd30 ( p < 0.05 ) .
the anterior deltoid muscle activity of rd60 ( 29.4 8.8 ) was
significantly higher than those of rd45 ( 20.4 7.1 ) and rd30 ( 12.2 5.6 ) , and that of rd45
was significantly higher than that of rd30 ( p < 0.05 ) .
the biceps brachii muscle activity
of rd60 ( 12.7 7.0 ) was significantly higher than those of rd45 ( 9.0 5.5 ) and rd30 ( 6.2
4.2 ) , and that of rd45 was higher than that of rd30 ( p < 0.05 ) .
these results show that the activities of the upper trapezius , anterior deltoid , and biceps
brachii muscles increased significantly in below - knee assembly work at far distances .
anton
et al.10 found that activities of the
anterior deltoid and biceps brachii muscle increased more when overhead work was performed
under a far - reach condition than under close - reach condition .
chopp et al.11 showed that moving the task closer to the
worker decreased muscle activity .
haslegrave et al.12 found working with the arms away from the body ( a far reach or held
out to the side ) increased the potential for shoulder injury .
our present results are
consistent with previous reports indicating that moving the task closer to a worker
decreases upper - extremity muscle activity . below - knee
additionally , the
participants were not accustomed to below - knee assembly work , and fatigue was intentionally
minimized .
further studies should include subjects who are accustomed to below - knee assembly
work .
the present results indicate that , among the positions tested , muscle demands during
below - knee assembly work are lowest at a height of 30 cm above the floor and a reach
distance of 30 cm .
the present results indicate that below - knee workers should consider the
reach distance .
a greater reach distance appears to be a strong risk factor in below - knee
assembly work as it increases the potential for shoulder injury . | [ purpose ] we investigated upper - extremity muscle activity during below - knee assembly
work performed by healthy adults at three different reach distances evaluate the physical
risk factors associated with neck and shoulder disorders of reach distances .
[ subjects ]
sixteen young male workers were recruited .
[ methods ] activities of the right upper
trapezius , anterior deltoid , and biceps brachii muscles were measured during below - knee
assembly work at the three different reach distances . [ results ] the normalized emg data of
the upper trapezius , anterior deltoid , and biceps brachii muscles generally increased
significantly as the reach distance at which the assembly work was performed increased .
[ conclusion ] below - knee
workers should engage in work that involves shorter ( nearer ) reach
distances . | INTRODUCTION
SUBJECTS AND METHODS
RESULTS
DISCUSSION |
the pelvic floor muscles ( pfms ) have an important role in pelvic organ support and the
continence control system1 .
different
stages in a woman s life , such as pregnancy , postpartum period , and menopause , can cause
changes in these muscles2 . damage to the
pelvic floor can result in incontinence and constipation , decreased or total loss of pfm
strength , or genital prolapse .
pregnancy and vaginal delivery are major risk factors for weakened pfms , which can cause
stress urinary incontinence ( sui ) and pelvic organ prolapse in younger women .
pregnancy - related hormonal and mechanical factors can expose women to increased risk of
sui , thus worsening urinary urgency , and increasing micturition4 .
these conditions are believed to be caused by damaged
fascias , ligaments , peripheral nerves , and muscles that function in pelvic organ support and
continence control5 .
furthermore , pelvic
floor dysfunction can be affected by age , genetic factors , estrogen levels , and increased
body weight6 .
middle - aged women after one single vaginal birth have approximate increases of 12% and 8%
in the prevalence of urinary incontinence and symptomatic pelvic organ prolapse ,
respectively , compared with those with delivery by one caesarean section7 .
postpartum mri studies in one - para women
have revealed levator ani muscle injury in 610% of women after spontaneous vaginal
delivery , in 1733% of women after vacuum extraction , and in 6771% of women after forceps
delivery , but this injury was not identified in nulliparous women or after caesarean
section7 .
various methods
such as magnetic resonance imaging , perineometry , anal endosonography , translabial
ultrasound , manometry , electromyography , digital vaginal palpation , and neurophysiological
and urodynamic studies of the pelvic floor are used to evaluate the pfms and to diagnose
genitourinary and anal tract disorders3 , 8 , 9 .
pressure perineometry , which
is a simple manometric device to measure intravaginal pressure , was introduced by kegel in
194810 .
it is a reliable quantitative
method to measure intravaginal pressure and is widely used in clinical research .
it has been shown that the measurement of intravaginal pressure only reliably depicts the
pressure rise caused by a pfm contraction in combination with an inward movement of the
perineum .
however there are limited data on vaginal birth , urinary incontinence , qol , and
perineometry measurement in the study of pfm strength , and there is limited literature on
the effects of parity on pfm strength .
the aim of this study was to test pfm activity after
vaginal birth , and to analyze the effect of parity on pfm strength and qol in women with
urinary incontinence .
this study included 241 women who gave birth to all their children vaginally and
experienced urinary incontinence from december 2012 to june 2013 .
patients were diagnosed
according to their detailed histories and , clinical and physical examinations by a
gynecologist .
the patients were divided into three groups : group 1 ( n=132 ) consisted of
women having 13 children , group 2 ( n=88 ) consisted of women having 46 children , and group
3 ( n=21 ) consisted of women having more than 6 children .
the study was approved by the
ethical research committee of the faculty of medicine , abant izzet baysal university .
the women who participated in this study were recruited from the department of obstetrics
and gynecology , faculty of medicine , abant izzet baysal university , bolu in turkey .
the
inclusion criteria for participation in this study were normal contraction of the pfms ,
which was evaluated by vaginal palpation , urinary incontinence postpartum , and primipara or
multipara .
the exclusion criteria were pregnancy ; work as a manual laborer ; systemic disease
such as hypertension , diabetes mellitus , obesity , or chronic cough ; and history of pelvic
surgery or pelvic prolapse . some physical and demographic characteristics of the patients were recorded , including body
mass index , height , weight , medical history , job status , educational level , gravidity ,
abortus , parity , dilatation and curettage , type of delivery , and presence of episiotomy
and/or perineal tears .
the evaluations were conducted by an experienced
physiotherapist who was unaware of the subject group of the study .
pfm strength was evaluated according to pressure change in the vagina , which was measured
via a cavity probe ( myomed 932 ; enraf - nonius , delft , netherlands ) .
the device was adjusted
to perineometry mode , and it allows for the reproduction of pressure signals at an
adjustable sensibility and time scale . vaginal resting pressure can be shown on an lcd
screen after insertion of the probe into the vagina .
the tip of the probe is covered with a
silicone ring to control depth of insertion , and the duration of each contraction can be
precisely measured by means of lines displayed on the screen , which can be moved to capture
the actual parameter .
the device provides results in centimeters of water ( cm
h2o ) for pressure measurements .
reliability testing of the
device showed intra - observer reliability , with an intraclass correlation coefficient ( icc )
of 0.9712 .
prior to the procedure , the
participants were informed about how to contract the pfms .
they were asked to lie in a
standardized supine crook lying position and requested to produce the maximum number of
voluntary pfm contractions without pelvic movement or visible movement of hip , gluteal , or
abdominal muscles13 .
palpation and
observation were used as the basis of correct contraction , which was defined as an inward
movement involving squeezing the floor openings . after teaching the women how to contract
the pfms , they were asked to perform maximal voluntary contraction with three repetitions
and to maintain each contraction for 10 seconds .
the mean scores of these three contractions
were used . the turkish version of the self - administered incontinence quality of life instrument
( i - qol ) questionnaire was used to evaluate the effects of sui on participants qol .
the
instrument consists of a 4-item scale used to evaluate the degree of difficulty , comprising
0 = not at all , 1 = slightly , 2 = moderately , and 3 = greatly .
possible scores ranged
between 0 and 84 , representing 28 questions scored as 03 .
quantitative data are presented as the mean and standard deviation ,
while qualitative data are presented in percentage frequency ( n % )
a total of 241 participants completed the measurements , and 8 were excluded from the study .
of these 8 women , 4 withdrew from the study because they could not contract their pfms and 4
were excluded because they had not given birth to any children .
the mean age of the participants was
47.5 9.0 years in group 1 ( n=128 ) , 55.29.3 years in group 2 ( n=84 ) , and 51.922.2 years in
group 3 ( n=21 ) .
tables 1table 1.sociodemographic characteristics of the study population ( n= 233)group1n=128group2n=84group3n=21n%n%n%educational statusilliterate86.21619733.3literate32.389.514.8primary level8969.558691361.9high school level129.4 - ---university1612.522.4 - -occupationhousewife9775.87589.321100worker1410.956 - -retired1713.344.7 - -menopausal statepremenopausal3628.1161929.5normal4232.8910.7419postmenopausal5039.15970.21571.4 and 2table 2.demographic and clinical features of the patientsgroup 1n=128xsdgroup 2n=84xsdgroup 3n=21xsdage ( years)47.59.0 * 55.29.351.922.2height ( m)1.580.051.50.01.570.07weight ( kg)76.013.279.114.580.514.8bmi ( kg / m)30.45.332.26.133.06.3*signicant difference ( p 0.05 ) indicate some general and sociodemographic characteristics of the
patients .
* signicant difference ( p 0.05 ) comparison of pfm strength showed a significant intergroup difference ( p=0.002 ) .
the tukey
test indicated that the difference was caused by group 1 , which showed significantly higher
pfm strength scores than groups 2 and 3 ( table
3table 3.comparison of quality of life and pelvic floor muscle strength among
groupsgroup 1n=128xsdgroup 2n=84xsdgroup 3n=21xsdperineometry ( cm h2o)25.514.6 * 19.112.319.612.9i - qol31.522.536.725.351.922.2**signicant difference ( p 0.05 one - way anova ) ) .
i - qol scores related to stress incontinence showed a significant intergroup
difference ( p=0.001 ) . the mean i - qol values of groups 1 , 2 , and 3 were 31.522.5 , 36.725.3 ,
and 51.922.2 , respectively . as number of deliveries increased , quality of life
decreased .
the
literature includes studies of symptoms related to perineal muscle strength and urinary
incontinence2,3,4 . however , these studies
included women who had a maximum 2 deliveries7,8,9,10,11,12,13,14,15 .
there is a limited research on pfm strength among women who have had 2 or more deliveries .
it was found that
women who had 13 deliveries had the highest pfm strength ; and that pfm strength decreased
as the number of deliveries increased .
bo et al.16 concluded that vaginal
palpation was not a valid method to measure pfm strength .
although the international
continence society ( ics)17 ; validated the
use of a perineometer to evaluate pfm strength , it is difficult to achieve consistency in
results because a wide variety of devices of varying sizes and units have been used in the
literature18 .
marshall et al.19 used digital palpation , perineometry , and
electromyography and compared pfm strength in nulliparous and primiparous women .
the
procedure was carried out ten months after vaginal delivery , and it was observed that
nulliparous women had significantly higher pfm strengths . it is reported in the literature that pfms weaken after delivery , and that normal delivery
is the most important factor in damage to the pfms .
km et al.20
concluded that pelvic floor muscle contractions induce significantly different vaginal
pressures between subjects with nulliparous and vaginal delivery histories , but no
significant difference in vaginal pressure was induced between their vaginal delivery group
and cesarean delivery group . in the present study , we compared the pfm strength in women who
had 13 , 46 , and more than 6 deliveries .
the highest pfm strength was found in women who
had 13 deliveries , and the pfm strength decreased as the number of deliveries increased .
however , it was observed that there was no difference in pfm strengths between women who had
46 deliveries and those who had more than 6 deliveries .
it is believed that this was the
results of the smaller number of women who had more than 6 deliveries than those who had 46
deliveries .
bahl et al.21 analyzed pelvic
floor morbidity in 283 women three years after instrumental delivery and cesarean delivery
in the second stage of labor .
however , faltin et al.22 analyzed 100 women at 3 and 30 months after their first delivery
and reported that subsequent deliveries increase the risk of anal incontinence , especially
in women with a sphincter defect after their first delivery .
km et al.23 found significant differences between their nulliparous
group and vaginal delivery group ; and between their nulliparous group and cesarean delivery
group , and their results suggest that child birth delivery method changes the vaginal
pressure .
peschers et al.24 used
palpation , perineometry , and perineal ultrasound 38 days after delivery to evaluate pfm
strength values of primiparous and multiparous women who had vaginal deliveries .
their study
showed that pfm strength decreased significantly after vaginal delivery ; however , pfm
subsequently increased 610 weeks after delivery .
there was no significant difference in pfm
strength at 610 weeks postpartum compared with 915 months postpartum . in another study ,
pfm strength was evaluated during early postpartum ( 36 months)25 .
however , in turkey , the concept of gynecological
rehabilitation is quite new , and thus we were unable to evaluate the women in our study
immediately after normal delivery .
furthermore , our study was limited by patients avoidance
of gynecological examination , which prevented us from evaluating the women at an early
stage .
the causes of sui following pregnancy and delivery , especially long - term cases , are still
not fully understood .
on the other hand , damage to muscle , nerve , or connective tissue in the lower
urinary tract and pelvic floor are associated with vaginal delivery26 .
the literature contains a limited portion of prospective
long - term research with objective findings .
it was reported that levator ani muscle
abnormality was more common 912 months after the first delivery in women with urinary
incontinence when compared with continent primiparous women .
we believe that the most important cause of weak pfm strength in the women included in this
study was that none of the women took part in pfm strength training following delivery ; they
were not informed about strengthening the pfm , and thus were at greater risk of developing
urinary incontinence .
previous research shows that urinary incontinence has negative effects on qol28 , as it effects in psychological , physical ,
social , personal , and sexual relationships .
robinson et al.29 reported that a questionnaire format can reliably be used to
evaluate the complaints of women with urinary incontinence .
in this study , we found that qol decreased in women with urinary incontinence after normal
delivery .
there was a difference between the women who had 13 deliveries , 46 deliveries ,
and more than 6 deliveries .
we found that qol among women who had more than 6 deliveries was
lower than for women in other groups .
the findings indicate that as number of deliveries
increased , the incontinence - related qol of the women who had normal delivery decreased as
well .
dimp et al.30 reported that the pfms
underwent histomorphological changes due to vaginal delivery .
the present study suggests
that all women should attend programs for pfm exercises after vaginal delivery , whether or
not they have urinary incontinence .
the ics recommends that women who have vaginal delivery
for the first time should attend a pfm strength program to reduce the possibility of
developing urinary incontinence after delivery31 .
number of deliveries has been observed to increase in association with low educational
level in turkey , particularly in rural regions32 .
physiotherapists working in the field of women s health and gynecologists believe
that raising awareness among women of pfm training will reduce potential postpartum
incontinence due to weak pfm strength , and will increase qol .
considering that the number of
deliveries is high in turkey , we believe that it is important to provide family planning
training in health centers ; thus , maintaining the number of deliveries at an optimal level
might have a positive impact on pfm strength .
in addition , family visits should be
intensified , and families should be informed about methods of contraception . | [ purpose ] the purpose of this study was to analyze the pelvic floor muscle ( pfm ) activity
after vaginal birth , and the effect of parity on pfm strength and quality of life ( qol ) in
women with urinary incontinence .
[ subjects and methods ] patients ( n=241 ) who gave birth
vaginally and experienced urinary incontinence were divided into three groups : group 1
consisted of women having 13 children , group 2 consisted of women having 46 children ,
and group 3 consisted of women having more than 6 children .
all patients underwent
detailed examination of the pfm . the turkish version of the self - administered incontinence
quality of life instrument ( i - qol ) questionnaire was used to evaluate the effects of
stress urinary incontinence on participants qol .
[ results ] comparison of pfm strengths
showed a significant intergroup difference .
group 1 showed significantly higher pfm
strength scores than those of groups 2 and 3 .
i - qol scores related to stress incontinence
showed a significant intergroup difference .
as number of deliveries increased , quality of
life decreased .
comparison of pfm strengths and i - qol scores related to stress
incontinence showed a significant intergroup difference .
[ conclusion ] increasing the
awareness of pfm training in women will reduce potential postpartum incontinence due to a
weak pfm strength ; and will increase quality of life . | INTRODUCTION
SUBJECTS AND METHODS
RESULTS
DISCUSSION |
occlusion established during try - in stage is subject to change because of inaccuracies in mounting procedures , distortion of the recording bases , unfastened mounting rings , or processing errors .
minor faults can be corrected by selective grinding with dentures in patient 's mouth , if a split cast remount procedure was used immediately after the dentures were processed.1 - 6 however , a general dental practice survey revealed that less than 5% of dentists use the split cast procedure to rectify the errors of processing.7 besides , the displaceable oral soft tissues and saliva also interferes with selective adjustment procedure . for these reasons
, clinical remount is preferred by few practitioners.8 the clinical remount is an indispensible step in the fabrication of complete dentures and it is used to ascertain favorable occlusion.8 - 17 many practitioners consider that the dentures should be permitted to " settle in " before occlusal corrections are performed.18 - 23 with this philosophy , however , the dentist fails to control the change in occlusion because the denture bases will change position to accommodate occlusal interferences , leading to irregular pressure on the underlying soft and hard tissues .
intraoral occlusal adjustment is difficult because of the movement of denture bases over resilient ridges and uneven tissue contact .
such corrections are less accurate than mounting the finished dentures in an articulator by means of a centric relation record and subsequent elimination of interceptive contacts .
routine remounting of dentures requires making remount casts or blocking out undercuts and then mounting with quick - setting plaster.4,24 the purpose of this article was to provide a simplified remounting procedure that used customized mounting platforms ( cmp ) and has these advantages : ( 1 ) remount casts are not fabricated separately for remounting complete dentures ; ( 2 ) the mandibular denture can be remounted quickly with a new centric relation record , in case of incorrect centric relation record ; ( 3 ) blocking out undercuts from the tissue surface of denture is not necessary ; ( 4 ) mounting can be performed at chair - side with minimal mess and ; ( 5 ) the putty impression material can be conserved as a record to be used in successive appointments if needed .
the putty material is costly ; however , the procedure is expedient and little material is required because maximum expanse in the articulator will be occupied by the maxillary and mandibular cmps and the edentulous ridges fabricated in acrylic resin .
this clinical remount technique utilizes maxillary and mandibular cmps that are fabricated over mounting plates of articulator .
enfold boxing wax ( deepti dental products , ratnagiri , india ) around the outside edge of the maxillary and mandibular mounting plates to form diverging housing for holding the dental plaster ( fig .
1).reduce the boxing wax for the maxillary and mandibular mounting plates such that the diameter at the opening is 6.5 cm.similarly , trim the height of maxillary boxing wax at 2.5 cm and that of mandibular boxing wax at 2 cm.pour a mix of dental plaster ( kalstone , kalabhai karson , mumbai , india ) to fill both the divergent cylinders.allow the dental plaster to set and remove the boxing wax ( fig . 2).carve a horse - shoe shaped groove on the flat surfaces of both the divergent cylinders thus formed ( fig . 3).form a mix of self cure acrylic resin ( dp cold cure , dental products of india , mumbai , india ) into two spools and place over the grooves of both the maxillary and mandibular divergent cylinders to form u - shaped positive replica of edentulous ridges . adjust the vertical height of the ridges to 5 to 6 mm.trim these acrylic edentulous ridges with fissure bur to make buccal and lingual undercuts that will provide port for the putty impression material during subsequent mounting of the dentures ( fig .
enfold boxing wax ( deepti dental products , ratnagiri , india ) around the outside edge of the maxillary and mandibular mounting plates to form diverging housing for holding the dental plaster ( fig .
1 ) . reduce the boxing wax for the maxillary and mandibular mounting plates such that the diameter at the opening is 6.5 cm . similarly , trim the height of maxillary boxing wax at 2.5 cm and that of mandibular boxing wax at 2 cm .
pour a mix of dental plaster ( kalstone , kalabhai karson , mumbai , india ) to fill both the divergent cylinders .
2 ) . carve a horse - shoe shaped groove on the flat surfaces of both the divergent cylinders thus formed ( fig .
3 ) . form a mix of self cure acrylic resin ( dp cold cure , dental products of india , mumbai , india ) into two spools and place over the grooves of both the maxillary and mandibular divergent cylinders to form u - shaped positive replica of edentulous ridges .
trim these acrylic edentulous ridges with fissure bur to make buccal and lingual undercuts that will provide port for the putty impression material during subsequent mounting of the dentures ( fig .
check the intaglio surface of each denture in the mouth with pressure - indicating pastes or waxes and make the needed adjustments.3,4make a centric relation inter - occlusal record with a soft medium such as warm aluwax ( bite registration wax , duplep global , mumbai , india ) to confirm closure without contact of the denture teeth or bases.4attach the maxillary and mandibular cmps in the articulator ( fig .
5).place the putty impression material ( zetaplus , zhermack , rovigo , italy ) in the form of a u - shaped roll over the mandibular acrylic resin edentulous ridge on the cmp and position the mandibular denture on it.secure the maxillary denture over mandibular denture with the help of the centric interocclusal record in aluwax , place the putty material in the denture in the region of alveolar ridge , and close the upper member of the articulator into the putty material.after the putty impression material has set , open the articulator and remove the interocclusal record ( fig . 6).the
7).close the denture onto articulating paper ( pd , vevey , switzerland ) and adjust the occlusion ( fig . 8) .
check the intaglio surface of each denture in the mouth with pressure - indicating pastes or waxes and make the needed adjustments.3,4 make a centric relation inter - occlusal record with a soft medium such as warm aluwax ( bite registration wax , duplep global , mumbai , india ) to confirm closure without contact of the denture teeth or bases.4 attach the maxillary and mandibular cmps in the articulator ( fig .
place the putty impression material ( zetaplus , zhermack , rovigo , italy ) in the form of a u - shaped roll over the mandibular acrylic resin edentulous ridge on the cmp and position the mandibular denture on it .
secure the maxillary denture over mandibular denture with the help of the centric interocclusal record in aluwax , place the putty material in the denture in the region of alveolar ridge , and close the upper member of the articulator into the putty material .
after the putty impression material has set , open the articulator and remove the interocclusal record ( fig .
close the denture onto articulating paper ( pd , vevey , switzerland ) and adjust the occlusion ( fig . 8) .
enfold boxing wax ( deepti dental products , ratnagiri , india ) around the outside edge of the maxillary and mandibular mounting plates to form diverging housing for holding the dental plaster ( fig .
1).reduce the boxing wax for the maxillary and mandibular mounting plates such that the diameter at the opening is 6.5 cm.similarly , trim the height of maxillary boxing wax at 2.5 cm and that of mandibular boxing wax at 2 cm.pour a mix of dental plaster ( kalstone , kalabhai karson , mumbai , india ) to fill both the divergent cylinders.allow the dental plaster to set and remove the boxing wax ( fig . 2).carve a horse - shoe shaped groove on the flat surfaces of both the divergent cylinders thus formed ( fig . 3).form a mix of self cure acrylic resin ( dp cold cure , dental products of india , mumbai , india ) into two spools and place over the grooves of both the maxillary and mandibular divergent cylinders to form u - shaped positive replica of edentulous ridges . adjust the vertical height of the ridges to 5 to 6 mm.trim these acrylic edentulous ridges with fissure bur to make buccal and lingual undercuts that will provide port for the putty impression material during subsequent mounting of the dentures ( fig .
enfold boxing wax ( deepti dental products , ratnagiri , india ) around the outside edge of the maxillary and mandibular mounting plates to form diverging housing for holding the dental plaster ( fig .
1 ) . reduce the boxing wax for the maxillary and mandibular mounting plates such that the diameter at the opening is 6.5 cm . similarly , trim the height of maxillary boxing wax at 2.5 cm and that of mandibular boxing wax at 2 cm .
pour a mix of dental plaster ( kalstone , kalabhai karson , mumbai , india ) to fill both the divergent cylinders .
2 ) . carve a horse - shoe shaped groove on the flat surfaces of both the divergent cylinders thus formed ( fig .
3 ) . form a mix of self cure acrylic resin ( dp cold cure , dental products of india , mumbai , india ) into two spools and place over the grooves of both the maxillary and mandibular divergent cylinders to form u - shaped positive replica of edentulous ridges .
trim these acrylic edentulous ridges with fissure bur to make buccal and lingual undercuts that will provide port for the putty impression material during subsequent mounting of the dentures ( fig .
check the intaglio surface of each denture in the mouth with pressure - indicating pastes or waxes and make the needed adjustments.3,4make a centric relation inter - occlusal record with a soft medium such as warm aluwax ( bite registration wax , duplep global , mumbai , india ) to confirm closure without contact of the denture teeth or bases.4attach the maxillary and mandibular cmps in the articulator ( fig .
5).place the putty impression material ( zetaplus , zhermack , rovigo , italy ) in the form of a u - shaped roll over the mandibular acrylic resin edentulous ridge on the cmp and position the mandibular denture on it.secure the maxillary denture over mandibular denture with the help of the centric interocclusal record in aluwax , place the putty material in the denture in the region of alveolar ridge , and close the upper member of the articulator into the putty material.after the putty impression material has set , open the articulator and remove the interocclusal record ( fig . 6).the
7).close the denture onto articulating paper ( pd , vevey , switzerland ) and adjust the occlusion ( fig . 8) .
check the intaglio surface of each denture in the mouth with pressure - indicating pastes or waxes and make the needed adjustments.3,4 make a centric relation inter - occlusal record with a soft medium such as warm aluwax ( bite registration wax , duplep global , mumbai , india ) to confirm closure without contact of the denture teeth or bases.4 attach the maxillary and mandibular cmps in the articulator ( fig .
place the putty impression material ( zetaplus , zhermack , rovigo , italy ) in the form of a u - shaped roll over the mandibular acrylic resin edentulous ridge on the cmp and position the mandibular denture on it .
secure the maxillary denture over mandibular denture with the help of the centric interocclusal record in aluwax , place the putty material in the denture in the region of alveolar ridge , and close the upper member of the articulator into the putty material .
after the putty impression material has set , open the articulator and remove the interocclusal record ( fig .
close the denture onto articulating paper ( pd , vevey , switzerland ) and adjust the occlusion ( fig . 8) .
correct occlusal relationships are a part of the success in prosthetic treatment for edentulous patients with complete dentures .
a clinical remount procedure of the finished dentures is a constituent part of prosthetic patient treatment in practice of complete dentures .
it corrects the clinical and laboratory inaccuracies in occlusion and establishes an occlusion that ensures even pressure in all areas of the arch .
the clinical remount also maintains the stability of dentures when the mandible is in centric relation position .
the clinical remount technique described in this article has utilized a hanau h2 semi - adjustable articulator .
the dimensions of cmps are based on the authors ' experience that making a 2.5 cm high maxillary cmp and a 2 cm high mandibular cmp leaves sufficient inter - ridge space on the articulator to accommodate almost any denture without interference .
the remount casts obtained in putty impression material compensates for the setting expansion occurring with plaster remount casts .
the remount platforms can be fabricated in advance , thereby saving the chair - side time of both the patient and the dentist .
the only limitation of this technique is that the cases with decreased inter - ridge distance might require more amount of putty material for fabrication of the remount casts , thereby increasing the cost factor . for such cases ,
the height of the edentulous ridges in acrylic resin can be increased to compensate for decreased inter - ridge distance . | correct occlusal relationships are part of the successful prosthetic treatment for edentulous patients .
fabrication of complete dentures comprises of clinical and laboratory procedures that should be executed accurately for achieving success with fabricated dentures . errors occurring during the clinical and laboratory procedures of a denture
may subsequently lead to the occlusal errors in the final prosthesis .
these occlusal errors can be corrected in two ways : i ) in patient 's mouth ii ) by recording new centric relation and remounting dentures on an articulator .
the latter method is more feasible because the mobility of denture base on the mucosa in oral cavity does not permit the identification of premature contacts in centric occlusion and tooth guided eccentric excursions .
this article describes a modest and effective clinical chair - side remount procedure using customized mounting platforms . | INTRODUCTION
PROCEDURE
Fabrication of CMPs
Chair-side remounting of the dentures
DISCUSSION |
we present the nonsurgical management and the use of a fibrin sealant for an anastomotic leak that followed rectosigmoid resection and anastomosis for stage iv endometriosis .
a 43-year - old female presented to our tertiary care center with cyclic vaginal and rectal bleeding with magnetic resonance imaging that showed a 3-cm mass consistent with an endometrioma in the anterior wall of the sigmoid and upper vaginal wall .
her past surgical history was significant for a total abdominal hysterectomy 4 years prior to presentation with pathology showing adenomyosis .
she subsequently underwent an exploratory laparotomy , bilateral ovarian cystectomy of endometriomas , lysis of adhesions , bilateral salpingectomy and right para - ovarian cyst removal for cyclic pelvic pain and vaginal bleeding 1 year prior to presentation .
she underwent laparoscopic lysis of adhesions , robotic - assisted en - bloc resection of the apex of the vagina and portion of rectum with an end - to - end anastomosis 6 cm from the anal verge , left ureterolysis , bilateral salpingo - oophorectomy and pelvic drain placement . during the first attempt at anastomosis ,
she was discharged on postoperative day 4 following a bowel movement and pelvic drain removal .
on postoperative day 5 , she presented to the emergency department and was readmitted for subjective fever , leukocytosis ( wbc 11.4 ) and abdominal distension .
the patient was afebrile on admission , her vital signs were within normal limits and the patient declined operative management .
she was started on broad - spectrum antibiotics , and interventional radiology placed a right upper abdomen drain .
after 5 days , repeat ct showed the improvement of the pneumoperitoneum and no extraluminal contrast .
the patient followed up for a repeat ct scan on postoperative day 13 , which showed an air / fluid collection in the presacral space suspicious for an anastomotic leak .
interventional radiology placed a left lower quadrant drain anterior to the anastomosis and a left transgluteal drain into a recurrent presacral collection ( fig .
2 ) .
figure 1:ct scan of the abdomen with i.v . and oral contrast from postoperative day 5 .
( b ) the radiopaque anastomotic staple line ( arrow ) and presacral extraluminal fluid and gas collection ( arrowheads ) are clearly shown .
ct scan of the abdomen with i.v . and oral contrast from postoperative day 5 .
( b ) the radiopaque anastomotic staple line ( arrow ) and presacral extraluminal fluid and gas collection ( arrowheads ) are clearly shown .
on postoperative day 21 , there was peripheral enhancement of the presacral collection , and the transgluteal drain was upsized .
on postoperative day 28 , the left lower quadrant drain was removed due to minimal output and resolution of the fluid collection on imaging .
on postoperative day 32 , a ct scan showed interval decrease in the presacral collection size .
a tube sinogram showed that contrast immediately leaked from the presacral space into the rectum through a focal anastomotic dehiscence . during this time
the presacral drain was left in place and she returned to her home country on postoperative day 46 with a plan for a repeat sinogram .
the patient returned to the usa for a sinogram on postoperative day 86 , which showed a persistent communication with the rectosigmoid at the surgical anastomosis .
the fibrin sealant administration procedure was performed with the patient in the prone position for easy access to the transgluteal drain , and with local anesthetic .
the drain was injected with contrast , fluoroscopic and radiographic evaluation confirmed persistence of the anastomotic leak ( fig .
the existing catheter was removed over a guidewire and a catheter of smaller caliber was advanced into the tract .
tisseel fibrin sealant ( baxter healthcare corporation , deerfield , il ) was injected into the catheter in sufficient quantity to fill abundantly across the anastomotic opening and was given until some of it refluxed back to the skin entry site .
two days following fibrin sealant injection , the patient was asymptomatic and the drain was removed as it had no output .
the patient has been contacted three times over the last 4 months , has no complaints , returned to work and restarted her hormone replacement .
( a ) contrast injection of the fistula showed a mature thin tract ( arrowheads ) to the rectosigmoid without any residual abscess cavity ( arrow ) .
( b ) after administration of the fibrin sealant , a drain was left in place away from the anastomosis to avoid disruption of the fibrin plug at the site of anastomotic leak .
( a ) contrast injection of the fistula showed a mature thin tract ( arrowheads ) to the rectosigmoid without any residual abscess cavity ( arrow ) .
( b ) after administration of the fibrin sealant , a drain was left in place away from the anastomosis to avoid disruption of the fibrin plug at the site of anastomotic leak .
the development of a postoperative anastomotic leak is a feared complication due to the increased morbidity and mortality and the great amount of time , hospital resources and subsequent procedures needed for management .
the incidence of colorectal anastomotic leaks has been reported as between 1% and 19% . however , the evidence on anastomotic leak is primarily based on studies involving patients with cancer and not endometriosis . in a recent study on 41 patients who underwent laparoscopic , segmental , rectosigmoid resection for endometriosis ,
there was one anastomotic leak ( 2.4% ) in a patient with an unprotected anastomosis .
based on the patient s stable clinical features and the patient s desire to avoid repeat surgical intervention , we managed the patient by the expertise of our interventional radiology department .
a previous study used a six - round modified delphi research method to find consensus among a group of surgeons and interventional radiologists to determine standardized management algorithms .
based on the article s algorithm , ct - guided drainage is appropriate for clinically stable patients with multiloculated collections and further research was required before further recommendations could be made regarding fibrin glue .
although the leukocytosis , pain and fluid collections improved with drain placement and antibiotics , the anastomotic connection persisted 86 days postoperatively .
the connection was ultimately closed using a fibrin sealant administered into the fistulous tract . to the best of our knowledge ,
the use of fibrin glue has not previously been reported in the gynecologic literature following bowel resection for endometriosis .
this approach requires a clinically stable patient who is willing to follow - up over a prolonged period of time until the leak is completely sealed .
tissue sealants can be considered when an air leak or fistulous tract persists despite drainage and antibiotics . | anastomotic leakage is a dreaded complication of gastrointestinal surgery .
the complication is difficult to manage and is associated with prolonged hospitalizations and increased morbidity and mortality .
we present the nonsurgical management and the use of a fibrin sealant for an anastomotic leak that followed rectosigmoid resection and anastomosis for stage iv endometriosis .
this approach requires a clinically stable patient who is willing to follow - up over a prolonged period of time until the leak is completely sealed .
tissue sealants can be considered when an air leak or fistulous tract persists despite drainage and antibiotics . | Introduction
Case Report
Discussion
Conflict of Interest Statement |
pain is one of the principal motives to consult a health care professional . among the analgesic modalities used by rehabilitation professionals , transcutaneous electrical nerve stimulation ( tens )
is commonly used , as it is noninvasive , safe , and affordable ; it has no undesirable side effects and can be easily administrated in clinical settings as well as by the patients themselves . during or following tens application , categorized as either conventional tens or acupuncture - like tens ( al - tens ) ,
parameters for conventional tens include high - frequency ( 50100 hz ) , low - intensity ( nonpainful paraesthesias ) stimulations , and a small pulse width ( 50200 s ) . on the other hand ,
al - tens parameters include low - frequency ( 210 hz ) , high - intensity ( above pain threshold ) stimulations , and a longer pulse width ( 100400 s ) .
conventional tens analgesia is explained by the gate control theory [ 3 , 4 ] , whereas the al - tens pain modulation mechanism is explained by descending endogenous opiate system .
the later pain modulation mechanism modulates nociceptive transmission by inhibiting ascending nociceptive pathways in the dorsal horn of the spine at multiple segmental levels as a result of descending efferents [ 68 ] .
although other pain control mechanisms might be involved in al - tens , such as gaba and serotonin ( demonstrated in animal models ) , muscle contraction , the main analgesic effect arises from this classic opioid - dependent descending inhibitory pathway .
although the pain modulation mechanisms involved in al - tens are well known , there is limited evidence in the literature regarding the duration of analgesia induced by al - tens .
the current data is arising from clinical studies [ 8 , 1113 ] , studies involving experimental pain stimuli in healthy subjects [ 1418 ] , and animal studies [ 1921 ] .
the results range from 30 minutes to at least an hour postapplication and it is generally accepted that al - tens analgesia is of longer duration than the analgesia induced using the conventional tens . however , the results regarding the duration of al - tens pain modulation in the above studies have to be interpreted with caution since the duration of analgesia was not the main outcome tested in any of these studies
. a better understanding of al - tens analgesia , specifically duration , would be beneficial since the duration of the analgesia induced by al - tens can influence the therapeutic options chosen by the rehabilitation professionals ( i.e. , al - tens versus conventional tens ) . with this in mind
, the main objective of this study was to describe the duration of analgesia and magnitude of analgesia induced by the application of al - tens on healthy subjects with an experimentally induced heat pain stimulus .
the secondary objective was to verify if the duration or magnitude of analgesia induced by the al - tens was influenced by the duration of the application of the al - tens ( 15 and 30 minutes ) .
a repeated - measures , intrasubject randomized experimental design was used , where each participant was his / her own control .
participants were randomly assigned to either begin with the 15 ( t15 ) or 30 ( t30 ) minutes application of al - tens .
this counterbalancing of participants minimized a potential sequence effect . since this was an intrasubject design , concealment of allocation was not possible all subjects knew that they would receive the 15 or 30 minutes treatment during the second session .
the study was conducted in accordance with the helsinki declaration , and after approval from the ethics review board of the centre de recherche clinique tienne lebel ( chus ) ; data was collected from 22 healthy volunteers , 8 men and 14 women .
inclusion criteria were healthy and pain - free volunteers aged 18 years or above , being able to understand and follow instructions .
volunteers were excluded if they were presenting any painful pathology , loss of sensibility to heat , and pain on treatment areas or had any contraindication to al - tens ( i.e. , wearing a pacemaker or cardioverter defibrillator , wearing a metal implant under the treatment area by the al - tens , suffering of epilepsy , and presenting a haemorrhagic risk , a malignancy , or damaged skin under the treatment area ) . all participants were advised to avoid any kind of analgesic medication for a period of 12 hours before the experimentation and avoid caffeinated beverages 4 - 5 hours before experimentation since caffeine can block the analgesic effect of tens [ 23 , 24 ] .
all participants were recruited on a voluntary basis and were nave to al - tens .
all subjects signed an informed consent form and received a free parking voucher for each visit .
the study took place at the school of rehabilitation of the universit de sherbrooke between january 2011 and november 2011 .
all five students were trained by the principal investigator ( ytl ) in order to standardize the data collection process .
all participants received the experimental procedures in the same sequential order ; familiarization , determination of test - stimulus intensity , test stimulus , al - tens application , and assessment of al - tens analgesia .
all subjects received al - tens application in two separate sessions ( on different days ) of either 15 or 30 minutes duration by random assignment .
we arbitrarily chose 15 and 30 minutes treatment times since they are the typical treatment durations .
both experiments were separated by at least 6 days to limit any possible carryover effect from session 1 to session 2 . a sustained ( tonic )
experimental heat pain test was chosen since it is safe , easily reproducible and may be more comparable to clinical pain than to brief ( phasic ) pain tests .
the noxious stimulus was induced by a 9 cm thermode ( tsa ii , neurosensory analyzer , medoc instruments , north carolina , usa ) .
they were then familiarized with the experimental ( thermal ) pain ( test stimulus ) induced by the thermode on the palm of the dominant hand .
subjects were advised that the thermode temperature would gradually increase to a maximum of 51c and reassured that it could not induce any burn .
this procedure was repeated twice and the subjects had to verbally report when they began to feel pain ( pain threshold ) and when the pain was intolerable ( pain tolerance ) . to determine the test - stimulus intensity ( temperature of heat pain ) , the thermode was applied on the volar aspect of the dominant forearm .
pain perception was assessed with a computerized visual analogue scale ( covas ) graduated from 0 ( no pain ) to 100 ( maximum tolerable pain ) linked to the thermode .
this instrument has a good validity and reliability and was previously used in other experimental pain studies .
the subjects had to move the cursor when they reported initial pain sensation ( covas score : 1/100 which corresponds to the pain threshold ) .
as the temperature of the thermode increased , subjects moved the cursor towards the right .
when the maximum temperature they could tolerate was reached , the cursor needed to be at the extreme right ( covas score : 100/100 which corresponds to the pain tolerance ) .
the thermode was placed on another area of the forearm to avoid overstimulation and possible local sensitization .
subjects were given at least two trials of test stimulus to practice heat pain ratings with the covas and to ensure consistent responses between trials .
then , the temperature rated as 50/100 on the covas was used for the next part of the experimentation , the test stimulus ( one - minute constant stimulation ) . for the test stimulus ,
the thermode was applied to the volar aspect of the dominant forearm one minute at the temperature corresponding to 50/100 pain perception on covas .
subjects were told that they had to move the cursor left or right as decreased function of the pain perceived . in this part of the test
, the temperature always increased to reach the temperature corresponding to 50/100 pain perception and then remained constant for one minute .
all subjects were blinded to the temperature used during the test stimulus and to the study 's hypothesis .
the pain perception within this period had to be between 40/100 and 60/100 on the covas .
below or above these values , the temperature of the thermode was adjusted 0.5c to fit in this reasonable interval .
when the temperature of the thermode produced a pain perception of approximately 50/100 , al - tens was then applied .
the al - tens ( eclipse , empi ) was applied on the posterolateral aspect of the nondominant shoulder of all patients with the following parameters : 2 hz frequency and 180 msec impulse duration ( 1 channel , 2 2 inches nonadhesive , reusable , black carbon rubber electrodes ) .
this specific location was chosen for two reasons : ( 1 ) for standardization across all participants and most importantly ( 2 ) for demonstrating that al - tens induces a diffuse analgesic effect rather than a gate - control ( segmental ) analgesic effect .
the pain intensity and unpleasant perception were recorded at 2 minutes intervals during the al - tens application by a numerical verbal scale ranging from 0 ( no pain ) to 100 ( maximum tolerable pain ) .
since al - tens application needs to be painful in order to induce analgesia , the intensity of al - tens was increased until the subjects reported a perceived pain of at least 30/100 with the verbal numeric pain scale since it is shown that this type of descending analgesia can only be activated by a noxious stimulus . to measure the duration of al - tens analgesia , series of one minute test stimulus
were performed with the contact thermode one minute after the al - tens application and repeated at five minutes intervals until the mean perceived pain intensity was equal or above the perceived heat pain during the first test stimulus ( before al - tens application ) .
when this occurred , we considered that there was no more analgesia induced by al - tens and the experiment was terminated .
the thermode was placed on another area of the dominant forearm between each repetition to avoid overstimulation . to measure the magnitude of al - tens analgesia ( the amount of pain modulation produced by al - tens ) , we calculated the difference between the mean pain intensity score of the heat pain stimulus before and after the al - tens .
we considered that analgesia was no longer present when individual mean pain ratings of the post - al - tens test stimulus were above minus 0/100 ( or a positive score ) .
descriptive statistics are presented as median and interquartile range ( iqr ) [ 25th and 75th percentile ] in the text and as median and standard error in the figures . in order to measure the duration of analgesia induced by the al - tens ,
a kaplan - meier survival analysis was used , with median duration as well as 95% confidence intervals .
the mcnemar test ( non parametric ) was used to determine if the duration of application of the al - tens ( 15 or 30 minutes ) influenced the duration and/or magnitude of analgesia induced by the al - tens .
during the 15 minutes application of al - tens , the mean pain intensity was 34.12 17.7/100 and the mean pain unpleasantness 58.12 20.9/100 .
for the 30 minutes application of al - tens , the mean pain intensity was 31.95 16.0/100 and the mean pain unpleasantness 58.4623.6/100 .
the median duration of the analgesia induced by al - tens was 10 minutes following both applications of either 15 or 30 minutes of al - tens ( t15 = 10,00 [ 1,6818,31 ] ; t30 = 10,00 [ 0,0023,58 ] ) .
the analgesia induced by al - tens ranged from 060 minutes for the 15 minutes application and from 080 minutes for the 30 minutes application .
figure 1 illustrates the number of subjects that still had analgesia ( analgesia versus no analgesia criteria ) through time for both treatment times .
the survival analysis performed showed no significant difference in the duration of analgesia between the 15 minutes and the 30 minutes application of al - tens as the two curves intersect throughout the graph ( p = 0.991 ) .
only half of the participants still had heat - pain analgesia induced by the al - tens at 15 minutes postapplication following both t15 and t30 groups ( figure 1 ) .
finally , we observed that al - tens application did not induce analgesia in all participants .
there were 3 participants in each group , the same subjects in the t15 and the t30 groups , who did not have a pain reduction during the first test stimulus after al - tens application .
the magnitude of al - tens analgesia was calculated for each 1-minute test stimulus following the al - tens application for the first 15 minutes post - tens application since more than 50% of the subjects did not show analgesia after this point .
we observed a statistically significant reduction in pain ratings after the application of al - tens ( p = 0.016 and p = 0.03 for the t15 and t30 groups , resp . ) .
the percentage of reduction in pain intensity for the t15 group ranged between 26% and 36% ( figure 2 ) .
similarly , the percentage of reduction in pain for the t30 group during the same period ranged between 20% and 31% .
no participant had a complete analgesia ( 100% in reduction pain ratings ) with al - tens , as presented in figure 2 .
we observed that either 15 or 30 minutes application of al - tens induced comparable magnitudes of analgesia at all points in time ( all p values > 0.05 ) ( see figure 2 ) .
this study used a standardized experimental pain procedure and an intrasubject design to specifically determine the duration of the analgesia induced by al - tens . according to our findings ,
the median duration of al - tens analgesia on experimental heat pain was 10 minutes .
although the maximum duration was 80 minutes for the t30 and 60 minutes for the t15 , the median durations for the two treatments time were comparable .
some experimental studies point out that at higher intensities al - tens produces inhibition of central nociceptive transmission for at least 1 hour [ 8 , 13 , 16 , 19 , 20 ] . the duration of analgesia we observed was much shorter , considering that it lasted less than 15 minutes for 50% of the sample as shown by the survival analysis .
one previous study explored the duration of noxious conditioning pain modulation ( which relies on the same pain modulation mechanism ) on healthy volunteers where the noxious conditioning pain was the cold pressor test ( cpt ) . in this study ,
the mean duration of cpm analgesia was 35 minutes following the 7c cpt and 10 minutes following the 12c cpt .
these results regarding the duration of analgesia are within the same range as we observed and further suggests that descending inhibition may represent an all - or - none phenomenon .
this is not surprising given that comparable methodology and population were used to assess the duration and magnitude of the cpm .
as part of the second objective , we wanted to determine if the duration of application of the al - tens ( 15 versus 30 minutes ) influenced the duration of analgesia .
our survival analysis showed no significant difference between the analgesia duration following the 15 or 30 minutes application of al - tens .
no previous study tried to determine if a longer application time of al - tens produced longer lasting analgesia .
since the duration of al - tens application did not seem to influence the analgesia duration , we can suppose that 15 minutes of al - tens application would be enough to produce analgesia which would allow the clinician ( i.e. , physical therapist ) to maximize the efficiency of his intervention .
as we observed ( see figure 1 ) , it seems that the application of al - tens for 30 minutes tends to produce longer analgesia duration for some patients .
along with the duration , we wanted to determine if the magnitude of analgesia induced by the al - tens was influenced by the duration of application of the al - tens ( 15 and 30 minutes ) . as expected with al - tens application , we observed a reduction in the perceived pain intensity with the application of either 15 or 30 minutes of al - tens .
however , there was no significant difference in the percentage of reduction of pain intensity between the 15 and 30 minutes application and this at each observation point after al - tens application .
furthermore , we found a large variation in the magnitude of reduction in pain perception between subjects .
for example , in the t15 group the reduction between subjects varied between 67% and 10% at the 10 minutes observation .
however , the large variability we observed in the magnitude of analgesia might explain the fact that the results were comparable at all points in time .
this is the first study to explore the analgesia duration of al - tens with standardized protocol of experimental pain , which assure that all participants received comparable noxious stimuli during al - tens .
furthermore , we used an intrasubject design , which compares the results of the same participants following a 15 and a 30 minutes application of al - tens , where each participant was his own control .
the main limitation of this study is linked to the fact that it was done on healthy subjects and used an experimental pain model that does not mimic clinical pain ; it is wise not to extrapolate the present findings to clinical use and therefore the external validity is limited .
another limitation of this study is that most of the 22 participants were young ( mean age 25.41 9.33 years old ) ascribable to a possible voluntary response bias .
the application of al - tens on the shoulder above the pain threshold reduced perceived pain intensity of experimental heat pain at the dominant forearm in healthy participants for approximately 10 minutes .
the analgesia induced by al - tens ranged from 060 minutes for the 15 minutes application and from 080 minutes for the 30 minutes application .
furthermore , using an intrasubject design , we observed that a longer application of al - tens ( 30 minutes versus 15 minutes ) induced neither longer duration of analgesia nor greater magnitude ( greater analgesic effect ) .
this experimental study is the first step leading to the investigation of al - tens analgesia duration on a population suffering from clinical pain .
further studies could also explore precisely the impact of al - tens intensity on analgesia . this could help narrow down the best way to use al - tens in physical therapy . |
background .
acupuncture - like tens ( al - tens ) is a treatment modality that can be used to temporarily reduce pain .
however , there is no clear data in the literature regarding the specific duration of analgesia induced by al - tens
. objectives . to describe and quantify the duration and magnitude of al - tens analgesia on experimental heat pain in healthy subjects and verify if the duration or magnitude of analgesia induced by the al - tens was influenced by the duration of the application of the al - tens ( 15 versus 30 minutes ) . methods .
a repeated - measures , intrasubject randomized experimental design was used , where each participant was his / her own control . 22 healthy volunteers underwent heat pain stimulations with a contact thermode before ( pretest ) and after ( posttest ) al - tens application ( 15 and 30 minutes ) .
outcome measures included subjective pain during al - tens , duration , and magnitude of al - tens - induced analgesia . results .
survival analysis showed that the median duration of al - tens analgesia was 10 minutes following the application of either 15 or 30 minutes of al - tens .
the magnitude of analgesia following either application was comparable at all points in time ( p values > 0.05 ) and ranged between 20% and 36% pain reduction .
conclusion .
only half of the participants still had heat - pain analgesia induced by the al - tens at 15 minutes postapplication . | 1. Introduction
2. Methodology
3. Results
4. Discussion
5. Conclusion |
in recent years , nanomaterials have steadily received growing interests as a result of their peculiar and fascinating properties and applications superior to their bulk counterparts .
a wealth of interesting and new phenomenoa associated with nanostructures has been found with the best established examples including size - dependent excitation and emission .
it is generally accepted that the quantum confinement of electrons by the potential well of nanometer - sized structure may provide one of the most powerful means to control the electrical , optical , magnetic , and thermoelectric properties of solid - state functional materials .
thus the ability to generate such minuscule structures is essential to much of modern science and technology [ 1 - 4 ] .
nickel oxide ( nio ) has been under extensive investigations for decades as a kind of important functional material .
it is regarded as a very prosperous material and can be used as battery cathodes , catalysts , gas sensors , electrochromic films , and in magnetic materials [ 5 - 8 ] .
because of the volume effect , the quantum size effect , and the surface effect , nanocrystalline nio is expected to possess many improved properties than those of micro - sized nio particles . the particle structural property ( particle size , distribution , and morphology )
so far , various methods on the preparation of nio nanostructures including nanoparticles and nanoflowers have been reported [ 9 - 15 ] .
wu et al . synthesized nio nanoparticles of different shapes by four different methods using different amines and surfactants .
it was shown that by altering the concentration and composition of solvents , different morphologies having variant diameters , shape , and distribution can be achieved .
microemulsion route has been employed to prepare nio nanoparticles by using cationic surfactant by han et al . .
obtained nio nanoparticles using nickel acetate as precursor at 723 k. a method for the synthesis of nio nanocrystals using nickel chloride hydrate as nickel source has been introduced by an et al . .
all the above methods for the formation of nio nanostructures are technically complex , require high temperature , harsh growth conditions , expensive experimental setup , complicated control processes , and have made frequent use of organics . seeking a simple approach for low cost , lower temperature , larger - scale production , and controlled growth without additives
the fabrication of nanomaterials emphasis not only size , the geometry , and chemical homogeneity , but also the simplicity and practicability of synthesis techniques . when developing a synthesis method for generation of nanostructures , the most important issue that one needs to consider is the simultaneous control over composition , dimensions , morphology , and monodispersivity . here in
, we report an alternative low temperature approach to the synthesis of nio nanoparticles and nanoflowers by a soft reaction of nickel powder and water without using organic dispersant or capping agent . to the best of our knowledge ,
this is the first report of synthesis where water is used as a solvent as well as a source of oxygen .
our studies lay down a convenient producer for the synthesis of nio nanostructures at low temperature without using organics and templates which may be scaled up for industrial applications .
the methodology may provide a one - step , fast , non - toxic , and mass production route for the synthesis of other functional oxide materials .
in a typical synthesis , appropriate amount of nickel powder was taken with 20 ml of distilled water in a glass vial and the mixture was well sonicated for about 10 min .
the reaction mixture was transferred to teflon - lined stainless steel autoclave of 50 ml capacity before keeping at desired temperature .
the autoclave was kept in a furnace , which was preheated to 100 c for different reaction times .
after a desired period of time , the autoclave was taken out and cooled to room temperature naturally .
the final product was filtered , washed with de - ionized water and ethanol several times and finally dried in air .
x - ray diffraction patterns of the samples were recorded with siemens d 5005 diffractometer using cu k ( = 0.15141 nm ) radiation .
the morphology and crystalline size of samples were studied by high - resolution field emission scanning electron microscopy ( fesem ) ( fei nova nanosem-600 ) coupled with energy dispersive spectroscopy .
in a typical synthesis , appropriate amount of nickel powder was taken with 20 ml of distilled water in a glass vial and the mixture was well sonicated for about 10 min .
the reaction mixture was transferred to teflon - lined stainless steel autoclave of 50 ml capacity before keeping at desired temperature .
the autoclave was kept in a furnace , which was preheated to 100 c for different reaction times .
after a desired period of time , the autoclave was taken out and cooled to room temperature naturally .
the final product was filtered , washed with de - ionized water and ethanol several times and finally dried in air .
x - ray diffraction patterns of the samples were recorded with siemens d 5005 diffractometer using cu k ( = 0.15141 nm ) radiation .
the morphology and crystalline size of samples were studied by high - resolution field emission scanning electron microscopy ( fesem ) ( fei nova nanosem-600 ) coupled with energy dispersive spectroscopy .
for the micro - structural analysis , the as - synthesized samples were directly transferred to the fesem chamber without disturbing the original nature of the products .
figure 1 shows fesem images of the as - prepared samples obtained by reacting micrometer - sized nickel particles with water under different conditions .
nanoparticles were not observed for a sample reacted for 12 h at room temperature ( fig .
1a ) , while almost uniform spherical nanoparticles were produced for sample heated at 100 c for 12 h ( fig .
the diameters of the nanoparticles are in the range of 5070 nm with an average diameter of 60 nm . using higher reaction time of 24 h , the average diameter of the nanoparticles increased from 60 to 80 nm ( fig .
our studies indicate that the average diameter of the nanoparticles increases with the increase in reaction time , accompanied by an increase in aspect ratio . a similar study using polyvinylpyrrolidone as precursor has been reported by tao and wei .
finally , the reaction mixture was kept for 36 h and nanoflower - like product resulted .
earlier , yang et al . have reported nickel hydroxide nanostructures including nanosheets and nanoflowers by a hydrothermal methods using naoh as solvent .
this work has ruled out the role played by the solvents and organics in the structural evaluation of nio nanostructures .
fesem images of nanoparticles and nanoflowers obtained by the reaction of nickel metal with water at 100 c for 1236 h. ( a ) images of samples at room temperature for 12 h , ( b ) at 100 c for 12 h , ( c ) at 100 c for 24 h , ( d ) 100 c for 36 h the edx measurement indicates that nanoparticles are composed of ni and o , and the analysis in the nio nanoparticles / nanoflowers indicates an atomic ratio of 86% ni and 14% o , which is very near to the theoretical value ( 7% error is attributed to the analysis technique ) .
04 - 0835 , and the sharp diffraction peak in the pattern can be exactly indexed to cubic structure of nio with cell constanta = 4.193 , which is in agreement as reported in the literature .
no characteristic peaks of impurity were observed . the xrd pattern of the nio nanoparticles prepared at 100 c the pl spectrum of nanoparticles and nanoflowers is presented in fig .
3a , b. the room temperature pl spectra of nio nanoparticles and nanoflowers show an uv emission band at 325 and 390 nm , respectively .
the emission in the uv region is attributed to the recombination between electrons in conduction band and holes in valence band .
there is a sharp band in the pl spectra of nio nanoparticles and nanoflowers at 380 and 490 nm , respectively .
the visible emission is related to the defects - related deep level emission such as oxygen vacancies and ni interstitials .
finally , there are a weak and a broad visible emission band at 600 nm in both the spectra that is usually attributed to native defects such as ni interstitials and o vacancies as suggested by lyu et al . .
( b ) room temperature photoluminance spectra of nio nanoflowers prepared at 100 c the formation of various nanostructures by the reaction of nickel with water can be explained as follows .
nickel gives hydrogen on reaction with water . here s , l , and g represent solid , liquid , and gas , respectively .
the similar study has been reported earlier , where evolution of hydrogen has been documented by zhao et al . .
the ni metal on reaction with water slowly gives out hydrogen ( g ) and the liberated oxygen reacts with metal to give oxides as shown in the above reaction .
the ni reacts with oxygen and forms nuclei , which further serve as seeds for nio nanostructures growth .
the growth of nanostructures could be occurring at the small oxide nuclei that may be present on the metal surfaces .
moreover , water at elevated temperatures plays an essential role in the precursor material transformation because the vapor pressure is much higher and the state of water at elevated temperatures is different from that at room temperature .
the solubility and the reactivity of the reactants also change at high pressures and high temperatures , and high pressure is favorable for crystallizations .
based on the corrosion theory , we know that at high temperature in the absence of oxygen , the corrosion of nickel by water involves two key component movements : the transport of oxygen - bearing species to the metal / oxide interface and the diffusion of nickel ions become saturated at some points on the surface , a nio layer then nucleates and grows . the most widely cited classical model for shape control of crystals is given by gibbs curie willff theorem
this theory suggests that the shape of a crystal is determined by the surface energy of individual crystallographic faces .
the final crystal shape is determined in such a way that the total free energy of the system is minimized .
it is believed that the physical and chemical properties of solvent can influence the solubility , reactivity , and diffusion behavior of reagents . in the present reaction
, water is only used as a solvent and hence has the same influence on the crystal phases of nanoparticles and nanoflowers .
in summary , nio nanoparticles and nanoflowers were successfully synthesized by a reaction of nickel powder and water without organics and substrates at 100 c .
this synthetic technique has the following advantages : firstly , it is a one - step synthesis approach , making it easy to control the growth kinetics .
secondly , the synthesis needs no sophisticated equipments since it is conducted at low temperature of 100 c under normal atmosphere .
thirdly , the clean surfaces of the as - synthesized nanostructures can be readily functionalized for various applications since there is neither a capping reagent nor a substrate . forth
therefore , the technique could be extended and expanded to provide a general simple and convenient strategy for the synthesis of nanostructures of other functional materials with important scientific and technological applications .
the author is pleased to acknowledge world bank for their financial support in procuring sophisticated equipments in national institute of technology , srinagar . | nickel oxide nanoparticles and nanoflowers have been synthesized by a soft reaction of nickel powder and water without organics at 100 c . the mechanism for the formation of nanostructures
is briefly described in accordance with decomposition of metal with water giving out hydrogen .
the structure , morphology , and the crystalline phase of resulting nanostructures have been characterized by various techniques .
compared with other methods , the present method is simple , fast , economical , template - free , and without organics . in addition , the approach is nontoxic without producing hazardous waste and could be expanded to provide a general and convenient strategy for the synthesis of nanostructures to other functional nanomaterials . | Introduction
Experimental
Preparation of NiO Nanostructures
Structural Characterization
Results and Discussions
Conclusion
Acknowledgments |
all authors had expenses paid by pfizer to attend the european policy roundtable on smoking cessation . | on 24 november 2015 , under the auspices of the european policy roundtable on smoking cessation , 15 experts on tobacco control and dependence from across the european union , chaired by professor luke clancy , met in oslo , norway , to discuss the implementation of the tobacco products directive and the who framework convention on tobacco control , namely article 14 . on the occasion of the 10th anniversary of the framework convention on tobacco control ,
this paper reports the consensus reached by all roundtable participants on the need to further advance the availability and access to services to support cessation of tobacco use .
the implementation of services to support cessation of tobacco use in line with article 14 can and should be significantly improved to protect the health of european citizens .
the meeting was initiated and funded by pfizer . | Conflicts of interest |
nf-1 , also called von recklinghausen 's disease , is an autosomal dominant disorder characterized by three major features : multiple neural tumors , caf - au - lait spots , and pigmented iris hamartomas .
pseudoaneurysms formation and rupture is a rare complication of neurofibromatosis . to the best of our knowledge ,
the pseudoaneurysm of internal pudendal artery associated with nf-1 has never been reported in the literature . here ,
we present a case of a spontaneous ruptured pseudoaneurysm of the right internal pudendal artery associated with nf-1 , which was successfully managed with transcatheter embolization .
a 62-yr - old man was admitted to the emergency department because of a sudden pain and rapid enlarging mass in the perinea and scrotum regions . he had a history of nf-1 since childhood but denied any family history or traumatic event .
physical examination revealed multiple neurofibromas all over the body , a large hematoma measuring about 886 cm in the perinea and scrotum regions , and the extremely swollen penis ( fig .
computed tomography ( ct ) of the abdomen and pelvis disclosed a large slightly high - density mass in the ischiorectal cavity , which extended to the perinea and scrotum regions .
routine blood samples on admission showed a red blood cell count of 4.4510/l , hemoglobin concentration of 122 g / l , platelet of 23610/l .
he suffered from a recurrent and intolerable pain in the perineal region the next day .
an emergent blood routine test showed a drop of red blood cell count to 3.0810/l , hemoglobin to 84
g / l . however , his vital signs were stable , the blood pressure was 140/68 mmhg , and the heart rate was 84 beats / min .
transfemoral bilateral external and internal iliac artery angiography revealed a ruptured pseudoaneurysm and active bleeding of the right internal pudendal artery .
then , a 3-french microcatheter ( cook , bloomington , mn , usa ) was navigated coaxially through a 5-french cobra catheter ( terumo , tokyo , japan ) into the right internal pudendal artery .
we tried to advance the microcatheter beyond the pseudoaneurysm so as to occlude both afferent and efferent vessel but failed .
so , only afferent vessel just proximal to the pseudoaneurysm was embolized with two spiral coils ( cook ) in dimension of 220 mm .
after endovascular management , the patient was given conservative therapy because the clinical symptoms mitigated obviously with the hematoma getting softer and smaller the next day .
nf-1 , also called von recklinghausen 's disease , is an autosomal dominant disorder linked to chromosome 17q11.2 ( 1 ) , characterized by growth impairment of the neural crest cells manifested by multiple neural tumors , cutaneous pigmentations , and lisch nodules .
the birth incidence of nf-1 lies between 1 in 2,500 - 3,300 and its prevalence in the population is 1 in 5,000 ( 2 ) .
however , 30 - 50% patients suffered from nf-1 has no family history . sporadic case , as shown in our report , may arise from germ cell mutations ( 3 ) .
it is well known that nf-1 can also involve the vascular tree , which may result in stenosis or occlusion of the vessel as well as arteriovenous malformation , arteriovenous fistula and aneurysm formation .
fibrous dysplasia or fibrosis of the vessel wall complicated with myocyte atrophy or sacculated aneurysm are its common pathological features . however , nf-1 is remarkable for its association with occlusive or aneurismal arterial disease affecting predominantly the renal arteries and less often the abdominal aorta , and mesenteric and peripheral arteries ( 4 ) .
aneurysm or pseudoaneurysm formation in nf-1 has been thought to be a result of friable vasculature secondary to arterial dysplasia or vascular invasion by the neurofibroma .
the neurofibromatous tissue itself also has an abnormal vascular structure with thin - walled ecstatic blood vessels lying in loose neural stroma that replaces the normal adipose tissue .
the involved arteries include intrathoracic , gastrointestinal , extracranial arteries and so on ( 5 - 7 ) .
however , to the best of our knowledge , this is the first case of nf-1 with spontaneous ruptured pseudoaneurysm of the internal pudendal artery . as for aneurysms or pseudoaneurysms of nf-1 ,
but transcatheter embolization is preferred because surgical repair is aggressive and complex , and vessel reconstruction is limited by arterial fragility ( 8) . obviously , excluding the pseudoaneurysm from the native circulation and preserving the parent artery is ideal in endovascular interventional procedures .
however , it is uncommon and limited in these patients which associated with arteriole , just as shown in our case . for aneurysm , it is a general rule to occlude both proximal and distal ends of the parent vessel .
embolization of the feeding arteriole is an efficient means to halt active bleeding , which can serve as a preoperative procedure or a radical cure management .
embolization of the internal pudendal artery can cause sexual functional disturbance such as erectile dysfunction ( 9 ) , because the penile arterial supply is derived from the internal pudendal arteries .
however , sexual function kept intact in this case 6 months later , which may be explained by the affluent communication of the bilateral internal iliac artery . in conclusion , we report here on the first documented case of a spontaneous ruptured pseudoaneurysm of the right internal pudendal artery associated with nf-1 , which was successfully managed with embolization of the feeding internal pudendal artery .
endovascular techniques proved to be effective in the management of vascular complication of the nf-1 . | neurofibromatosis type 1 ( nf-1 ) is an autosomal dominant disorder .
pseudoaneurysms formation and rupture is an unusual complication of neurofibromatosis . to date , pseudoaneurysm of the internal pudendal artery associated with nf-1 has not been reported . in this article , we present a 62-yr - old man with nf-1 suffering from spontaneous hematoma of the perinea and scrotum .
a digital substraction angiography disclosed a ruptured pseudoaneurysm of the right internal pudendal artery , which was successfully managed with transcatheter embolization . | INTRODUCTION
CASE REPORT
DISCUSSION |
monocytes , macrophages , and neutrophils myeloid effectors of innate immunity play pivotal roles in atherosclerosis .
neutrophils have gained increasing interest in recent years , with the current consensus being that they have a proatherogenic role , especially in the initial stages of the disease.1 , 2 human monocytes can be divided into the
cd14cd16 populations , which are considered to correspond to the inflammatory ccr2cx3cr1ly6c and steady state ccr2cx3cr1ly6c monocyte populations in mice.3 classical monocytes predominate in human circulation and are preferentially recruited into inflammatory sites and atherosclerotic plaques compared with their nonclassical counterparts.3 we previously showed that blood counts of neutrophils and of the classical cd14cd16 monocytes correlate with the incidence of acute cardiovascular events,4 , 5 suggesting that factors governing myeloid cell homeostasis might play important roles in human cardiovascular disease .
myeloid cell dynamics are tightly regulated through a complex network of growth factors , cytokines , and chemokines . in mice ,
macrophage colonystimulating factor ( mcsf ) promotes maturation of ly6c into ly6c monocytes,6 supports the survival of ly6c monocyte and macrophages in blood and tissues,7 and promotes an antiinflammatory macrophage phenotype with important roles in tissue repair and homeostasis.8 in contrast , granulocyte and granulocytemacrophage colonystimulating factors induce proinflammatory activation of neutrophils , macrophages , dendritic cells , and eosinophils.8 , 9 under steady state conditions , only mcsf can be consistently measured in the circulation , whereas granulocyte and granulocytemacrophage colonystimulating factors increase and become measurable mainly during inflammatory reactions.9
besides growth factors , a complex network of chemokines control myeloid cell production , trafficking , and function and have been found to be involved in the pathogenesis of cardiovascular disease.2 , 10 monocyte chemotactic protein 1 ( mcp1 ; also known as cc motif chemokine ligand 2 [ ccl2 ] ) is the most important regulator of monocyte trafficking and has been shown to have potent proatherogenic properties.2 , 11 , 12 similarly , fractalkine ( also known as cx3c motif chemokine ligand 1 [ cx3cl1 ] ) , macrophage inflammatory protein 1 ( mip1 ; also known as ccl3 ) , macrophage inflammatory protein 1 ( mip1 ; also known as ccl4 ) , ccl20 , cxc motif chemokine ligand 1 ( cxcl1 ) and cxcl16 promote monocyte and neutrophil recruitment and survival , supporting atherogenesis and plaque vulnerability in mice.2 , 13 , 14 the cxcr1 and cxcr2 ligand cxcl6 ( granulocyte chemotactic protein 2 ) is also involved in neutrophil recruitment,15 but its role in cardiovascular disease has not been examined previously .
much of the knowledge related to myeloid mediators and the roles they play in cardiovascular disease has been gained from animal studies , and human data are lacking to a large extent .
the aim of our study was to identify whether plasma levels of mcsf , mcp1 , ccl3 , ccl4 , ccl20 , cxcl1 , cxcl6 , cxcl16 , and cx3cl1 can predict the incidence of firsttime coronary events and improve the currently used models for cardiovascular risk prediction .
to this end , we studied the correlations between baseline levels of these proteins and incident coronary events in plasma samples collected from 292 middleaged persons with no previous history of coronary artery disease who had an acute coronary event during followup and 366 sex and agematched controls who remained event free .
the mdc has a populationbased prospective epidemiological cohort of 28 449 participants enrolled between 1991 and 1996.16 between october 1991 and february 1994 , every other participant was invited to take part in a substudy of the epidemiology of cardiovascular disease ( mdccv ) , yielding a cohort of 6103 participants.17 all participants were followed from the baseline examination until first hospitalization for an acute coronary event , death , emigration , or june 30 , 2009 .
incident cases of patients experiencing coronary events were retrieved by data linkage to the swedish hospital discharge register and the cause of death registry of sweden . following prior exclusion of 102 participants with prevalent nonfatal myocardial infarction ( 1.7% of the mdccv cohort ) , 402 incident coronary events ( 6.6% of the mdccv cohort )
a coronary event was defined as a nonfatal or fatal myocardial infarction on the basis of international classification of diseases , ninth revision ( icd9 ) code 410 and icd10 code i21 .
death due to ischemic heart disease was defined on the basis of codes 412 and 414 ( icd9 ) or i22 , i23 , and i25 ( icd10 ) .
free control participants of the same age , sex , and time of participation in the baseline examination ( 6 months ) .
control cohort ) because of prevalent revascularization ( percutaneous coronary intervention or coronary artery bypass grafting ) or incident revascularization before the first coronary event in cases or before the end of the followup period in controls .
furthermore , 81 cases and 28 controls ( 13.6% of the case control cohort ) were excluded because of incomplete clinical data or missing plasma samples , yielding a cohort consisting of 292 cases and 366 controls ( 81.8% of the case
control cohort ) . the study design and exclusion details are described in figure 1 .
although all participants were deemed to be apparently healthy at the time of inclusion , we can not rule out the possibility that some participants might have had a potential history of chronic inflammatory conditions such as autoimmune disease , human immunodeficiency virus , cancer , or thrombosis .
because of unavailable information , we were unable to identify and exclude these participants from the study .
the study was approved by the regional ethics review board and was conducted in accordance with the declaration of helsinki .
cvd indicates cardiovascular disease ; hdl , highdensity lipoprotein ; mdc , malm diet and cancer study ; mi , myocardial infarction . information on baseline characteristics was collected from selfadministered questionnaires and clinical examination .
smoking habits were categorized into never or former smokers ( who quit smoking at least 1 year before the examination ) and current smokers .
diabetes mellitus was defined as fasting whole blood glucose > 6.1 mmol / l ( corresponding to a threshold of 7.0
mmol / l in fasting plasma glucose ) , selfreported physician diagnosis of diabetes mellitus , or use of antidiabetic medication .
hypertension was defined as systolic blood pressure 140 mm hg or diastolic blood pressure 90 mm hg or the use of blood pressure lowering medication .
fasting venous blood glucose , serum cholesterol , lowdensity lipoprotein cholesterol , highdensity lipoprotein cholesterol , creactive protein ( crp ) , and triglycerides were analyzed with standard methods at the clinical laboratory of malm university hospital .
myeloid markers were analyzed in plasma by the proximity extension assay technique using the proseek multiplex cvd96x96 reagents kit ( olink bioscience ) at the clinical biomarkers facility , science for life laboratory , in uppsala , sweden .
briefly , oligonucleotidelabeled antibody probe pairs were allowed to bind to their respective targets present in the plasma sample .
addition of dna polymerase led to extension and joining of the 2 oligonucleotides and formation of a polymerase chain reaction template .
universal primers were used to preamplify the dna templates in parallel . finally , the individual dna sequences were detected and quantified using specific primers in a microfluidic realtime quantitative polymerase chain reaction chip ( 96.96 , dynamic array integrated fluidic circuit , fluidigm biomark ; fluidigm corp ) .
the chip was run with a biomark hd instrument.18 the respective intra and interassay variations were 7% and 18% for mcp1 , 7% and 12% for mcsf , 10% and 18% for ccl3 , 8% and 12% for ccl4 , 8% and 9% for ccl20 , 6% and 13% for cxcl1 , 8% and 12% for cxcl6 , 10% and 14% for cxcl16 , and 9% and 14% for cx3cl1 .
data analysis was performed by a preprocessing normalization procedure using olink wizard for genex ( multid analyses ) .
general calibrator curves to calculate the approximate concentrations are available on the olink website ( http://www.olink.com ) .
whitney nonparametric tests for nonnormally distributed continuous data and with student t tests for normally distributed continuous data .
nonnormally distributed continuous data are presented as medians and interquartile ranges , and normally distributed continuous data are presented as meansd .
nonnormally distributed variables were natural logarithm transformed , and biomarker variables were standardized before inclusion into regression analyses .
independent associations among myeloid biomarkers , baseline variables , and incident coronary artery disease were evaluated by calculating partial correlations between each pair of variables and constructing a partial correlation network that included correlations with a bonferroniadjusted p<0.05 .
calculations were performed in r v. 3.1.1 ( r foundation for statistical computing ) , and the partial correlation network was drawn using the yed graph editor software v. 3.14 ( yworks gmbh ) , with a hierarchical layout algorithm .
cox proportional hazards regression models were used to evaluate risk factor adjusted hazard ratios and 95% cis for each biomarker .
model a included the traditional risk factors used in the framingham risk score ( age , sex , smoking , total cholesterol , highdensity lipoprotein cholesterol , and systolic blood pressure ) as well as diabetes mellitus , blood pressure lowering medication , and lipidlowering medication .
model b was additionally adjusted for potential confounders that differed significantly between cases and controls at baseline : diastolic blood pressure , body mass index , triglycerides , lowdensity lipoprotein , creatininebased estimated glomerular filtration rate , crp , and white blood cell count .
the stepwise forward selection of variables also included mcp1 , mcsf , ccl3 , ccl4 , ccl20 , cxcl1 , cxcl6 , cxcl16 , cx3cl1 , and crp in both models .
plots of the hazard function in different groups over time did not indicate that the proportional hazards assumption was violated .
metrics of risk discrimination were assessed using logistic regression analysis adjusted for matching variables to take the matched case
control design into account . to estimate the risk in the original population cohort , the risk model calculated from case
control data was adjusted for the incidence rate in the original cohort and for the case
control ratio as described by huang et al19 and pencina et al.20 receiver operating curves and c statistics , net reclassification index , and integrated discrimination improvement were calculated and used to compare the performance of the model based on traditional risk factors with models including traditional risk factors and biomarkers for the prediction of incident coronary events . to be applicable to the case
control design , net reclassification index calculations were extended , as suggested by pencina et al.20 statistical differences in the areas under the receiver operating characteristic curves were calculated according to delong et al.21
statistical analyses were carried out using ibm spss statistics v. 22 ( ibm corp ) and r v. 3.1.1 ( and the r packages proc , predictabel , rcmdr , and qgraph ) .
the mdc has a populationbased prospective epidemiological cohort of 28 449 participants enrolled between 1991 and 1996.16 between october 1991 and february 1994 , every other participant was invited to take part in a substudy of the epidemiology of cardiovascular disease ( mdccv ) , yielding a cohort of 6103 participants.17 all participants were followed from the baseline examination until first hospitalization for an acute coronary event , death , emigration , or june 30 , 2009 .
incident cases of patients experiencing coronary events were retrieved by data linkage to the swedish hospital discharge register and the cause of death registry of sweden . following prior exclusion of 102 participants with prevalent nonfatal myocardial infarction ( 1.7% of the mdccv cohort ) , 402 incident coronary events ( 6.6% of the mdccv cohort )
a coronary event was defined as a nonfatal or fatal myocardial infarction on the basis of international classification of diseases , ninth revision ( icd9 ) code 410 and icd10 code i21 .
death due to ischemic heart disease was defined on the basis of codes 412 and 414 ( icd9 ) or i22 , i23 , and i25 ( icd10 ) .
free control participants of the same age , sex , and time of participation in the baseline examination ( 6 months ) .
control cohort ) because of prevalent revascularization ( percutaneous coronary intervention or coronary artery bypass grafting ) or incident revascularization before the first coronary event in cases or before the end of the followup period in controls .
furthermore , 81 cases and 28 controls ( 13.6% of the case control cohort ) were excluded because of incomplete clinical data or missing plasma samples , yielding a cohort consisting of 292 cases and 366 controls ( 81.8% of the case
control cohort ) . the study design and exclusion details are described in figure 1 .
although all participants were deemed to be apparently healthy at the time of inclusion , we can not rule out the possibility that some participants might have had a potential history of chronic inflammatory conditions such as autoimmune disease , human immunodeficiency virus , cancer , or thrombosis .
because of unavailable information , we were unable to identify and exclude these participants from the study .
the study was approved by the regional ethics review board and was conducted in accordance with the declaration of helsinki .
cvd indicates cardiovascular disease ; hdl , highdensity lipoprotein ; mdc , malm diet and cancer study ; mi , myocardial infarction .
smoking habits were categorized into never or former smokers ( who quit smoking at least 1 year before the examination ) and current smokers .
diabetes mellitus was defined as fasting whole blood glucose > 6.1 mmol / l ( corresponding to a threshold of 7.0
mmol / l in fasting plasma glucose ) , selfreported physician diagnosis of diabetes mellitus , or use of antidiabetic medication .
hypertension was defined as systolic blood pressure 140 mm hg or diastolic blood pressure 90 mm hg or the use of blood pressure lowering medication .
fasting venous blood glucose , serum cholesterol , lowdensity lipoprotein cholesterol , highdensity lipoprotein cholesterol , creactive protein ( crp ) , and triglycerides were analyzed with standard methods at the clinical laboratory of malm university hospital .
myeloid markers were analyzed in plasma by the proximity extension assay technique using the proseek multiplex cvd96x96 reagents kit ( olink bioscience ) at the clinical biomarkers facility , science for life laboratory , in uppsala , sweden .
briefly , oligonucleotidelabeled antibody probe pairs were allowed to bind to their respective targets present in the plasma sample .
addition of dna polymerase led to extension and joining of the 2 oligonucleotides and formation of a polymerase chain reaction template .
universal primers were used to preamplify the dna templates in parallel . finally , the individual dna sequences were detected and quantified using specific primers in a microfluidic realtime quantitative polymerase chain reaction chip ( 96.96 , dynamic array integrated fluidic circuit , fluidigm biomark ; fluidigm corp ) .
the chip was run with a biomark hd instrument.18 the respective intra and interassay variations were 7% and 18% for mcp1 , 7% and 12% for mcsf , 10% and 18% for ccl3 , 8% and 12% for ccl4 , 8% and 9% for ccl20 , 6% and 13% for cxcl1 , 8% and 12% for cxcl6 , 10% and 14% for cxcl16 , and 9% and 14% for cx3cl1 .
data analysis was performed by a preprocessing normalization procedure using olink wizard for genex ( multid analyses ) .
general calibrator curves to calculate the approximate concentrations are available on the olink website ( http://www.olink.com ) .
whitney nonparametric tests for nonnormally distributed continuous data and with student t tests for normally distributed continuous data .
nonnormally distributed continuous data are presented as medians and interquartile ranges , and normally distributed continuous data are presented as meansd .
nonnormally distributed variables were natural logarithm transformed , and biomarker variables were standardized before inclusion into regression analyses .
independent associations among myeloid biomarkers , baseline variables , and incident coronary artery disease were evaluated by calculating partial correlations between each pair of variables and constructing a partial correlation network that included correlations with a bonferroniadjusted p<0.05 .
calculations were performed in r v. 3.1.1 ( r foundation for statistical computing ) , and the partial correlation network was drawn using the yed graph editor software v. 3.14 ( yworks gmbh ) , with a hierarchical layout algorithm .
cox proportional hazards regression models were used to evaluate risk factor adjusted hazard ratios and 95% cis for each biomarker .
model a included the traditional risk factors used in the framingham risk score ( age , sex , smoking , total cholesterol , highdensity lipoprotein cholesterol , and systolic blood pressure ) as well as diabetes mellitus , blood pressure lowering medication , and lipidlowering medication .
model b was additionally adjusted for potential confounders that differed significantly between cases and controls at baseline : diastolic blood pressure , body mass index , triglycerides , lowdensity lipoprotein , creatininebased estimated glomerular filtration rate , crp , and white blood cell count .
the stepwise forward selection of variables also included mcp1 , mcsf , ccl3 , ccl4 , ccl20 , cxcl1 , cxcl6 , cxcl16 , cx3cl1 , and crp in both models .
plots of the hazard function in different groups over time did not indicate that the proportional hazards assumption was violated .
metrics of risk discrimination were assessed using logistic regression analysis adjusted for matching variables to take the matched case
control design into account . to estimate the risk in the original population cohort , the risk model calculated from case
control data was adjusted for the incidence rate in the original cohort and for the case
control ratio as described by huang et al19 and pencina et al.20 receiver operating curves and c statistics , net reclassification index , and integrated discrimination improvement were calculated and used to compare the performance of the model based on traditional risk factors with models including traditional risk factors and biomarkers for the prediction of incident coronary events . to be applicable to the case
control design , net reclassification index calculations were extended , as suggested by pencina et al.20 statistical differences in the areas under the receiver operating characteristic curves were calculated according to delong et al.21
statistical analyses were carried out using ibm spss statistics v. 22 ( ibm corp ) and r v. 3.1.1 ( and the r packages proc , predictabel , rcmdr , and qgraph ) .
the clinical characteristics of the study cohort at baseline are summarized in table 1 .
the case group contained a larger percentage of participants who were smokers , were overweight ( body mass index 25 ) , were diabetic , and had hypertension compared with the sex and agematched control group .
cases also had higher total cholesterol , triglycerides , lowdensity lipoprotein cholesterol , crp , and white blood cell counts , whereas highdensity lipoprotein cholesterol levels were lower than in controls .
a higher percentage of participants within the case group received antidiabetic medication at baseline . the median time from baseline to the occurrence of a coronary event was 10.6 years ( interquartile range 6.413.5 years ) .
control cohort au indicates arbitrary units ; bmi , body mass index ; ccl , cc motif chemokine ligand ; crp , creactive protein ; cxcl , cxc motif chemokine ligand ; cx3cl1 , cx3c motif chemokine ligand 1 ; egfr , estimated glomerular filtration rate ; hdl , highdensity lipoprotein ; ldl , lowdensity lipoprotein ; mcp1 , monocyte chemotactic protein 1 ; mcsf , macrophage colonystimulating factor .
data are presented as number ( percentage of cases / controls ) for categorical data , meansd for normally distributed continuous variables , and median ( interquartile range ) for nonnormally distributed variables . mann
whitney test was used for nonnormally distributed data , t test was used for normally distributed data , and test was used for categorical data .
bmi was calculated as weight / height ( kg / m ) and categorized as normal weight ( bmi < 25 ) and overweight / obese ( bmi 25 ) .
blood pressure 140/90 mm hg or treatment . to concomitantly explore the independent associations among myeloid biomarkers , baseline clinical variables , and incident coronary artery disease
, partial correlations were calculated between each pair of variables , controlling for all of the others , and a partial correlation network was constructed ( figure 2 ) .
partial correlation network of the relationships among clinical variables , myeloid biomarkers , and incident firsttime coronary events in the study group .
positive partial correlations are depicted in black , and negative partial correlations are shown in gray .
only partial pearson correlations with bonferroniadjusted p values < 0.05 are shown , with the partial correlation coefficients reported in boxes on the lines indicating correlations .
positive correlations for categorical variables indicate higher numbers of cases , patients with diabetes mellitus , current smokers , and women .
bmi indicates body mass index ; bp , blood pressure ; ccl , cc motif chemokine ligand ; crp , creactive protein ; cxcl , cxc motif chemokine ligand ; cx3cl1 , cx3c motif chemokine ligand 1 ; dbp , diastolic blood pressure ; dm , diabetes mellitus ; egfr , estimated glomerular filtration rate ; hdl , highdensity lipoprotein ; mcp1 , monocyte chemotactic protein 1 ; mcsf , macrophage colonystimulating factor ; sbp , systolic blood pressure ; tc , total cholesterol ; tg , triglycerides ; wbc , white blood cells .
when the 9 biomarkers were tested individually , mcsf , mcp1 , and cxcl1 were significantly associated with incident coronary events in cox proportional hazard models adjusted for the traditional cardiovascular risk factors included in the framingham risk score ( age , sex , smoking , total cholesterol , highdensity lipoprotein , systolic blood pressure ) and for blood pressure lowering medication , lipidlowering medication , and diabetes mellitus ( model a ) ( table 2 ) .
the associations remained significant following further adjustment for potential confounders that differed between cases and controls at baseline : diastolic blood pressure , body mass index , triglycerides , lowdensity lipoprotein , estimated glomerular filtration rate , crp , and white blood cell count ( model b ) ( table 2 ) .
the relationships between biomarkers and outcome were linear , as demonstrated by gradually increasing hazard ratios for each increasing mcp1 quartile and gradually decreasing hazard ratios for the mcsf and cxcl1 quartiles ( p for linear trend < 0.001 ) ( table 2 ) .
correlations between baseline biomarker levels and incident coronary events during followup number of participants included in the analysis : 292 cases and 366 controls .
ccl indicates cc motif chemokine ligand ; cxcl , cxc motif chemokine ligand ; cx3cl1 , cx3c motif chemokine ligand 1 ; hdl , highdensity lipoprotein ; hr , hazard ratio ; mcp1 , monocyte chemotactic protein 1 ; mcsf , macrophage colonystimulating factor ; q , quartile . per 1sd increase in the respective variable .
after bonferroni correction for multiple testing . model a : 10 tests , critical cutoff p=0.005 .
model a : cox regression analysis adjusted for age , sex , diabetes mellitus , current smoking , total cholesterol , hdl , systolic blood pressure , blood pressure lowering medication , and lipidlowering medication .
model b : cox regression analysis adjusted for age , sex , diabetes , current smoking , total cholesterol , hdl , systolic blood pressure , blood pressure lowering medication , lipidlowering medication , diastolic blood pressure , body mass index , triglycerides , lowdensity lipoprotein , estimated glomerular filtration rate , creactive protein , and white blood cell count .
next , we included all biomarkers alongside traditional risk factors , diabetes mellitus , crp , and medication in a cox forward stepwise regression model to identify the strongest independent relationships between potential predictors and incident coronary events . only the correlations for mcp1 , mcsf , crp , cxcl1 , and ccl4 remained statistically significant in the final model when a bonferroni correction for multiple testing was applied ( model a ) ( table 3 ) .
the distinctively strongest predictors of coronary events were mcsf ( hazard ratio 0.49 [ 95% ci 0.410.6 ] ; p=3.510 ) and mcp1 ( hazard ratio 2.06 [ 95% ci 1.752.43 ] ; p=5.110 ) , confirming the results of the partial correlation network analysis .
the cox forward stepwise regression model including all potential confounders yielded similar results ( model b ) ( table 3 ) . among all considered biomarkers , mcp1 and mcsf remained the strongest predictors of coronary events when men , women , diabetic and nondiabetic participants , and those above and below the median age were analyzed separately ( data not shown ) .
notably , the incidence of acute coronary events was negatively associated with mcsf and positively associated with mcp1 , indicating that these 2 biomarkers might have complementary value as predictors of incident coronary events . to illustrate this relationship
, we divided the patients into high and low groups based on median plasma levels of mcsf and mcp1 and created kaplan meier survival curves for the combinations of high and low biomarker levels ( figure 3 ) .
we found that participants with high mcsf and low mcp1 had a markedly improved coronary eventfree survival compared with the rest of the cohort ( logrank p for trend < 0.001 ) .
independent predictors of incident coronary events in the cohort final model of a cox proportional hazards regression analysis with stepwise forward selection of variables . only variables with an adjusted p value < 0.05 after bonferroni correction are shown .
number of participants included in the analysis : 292 cases and 366 controls . variables not retained in the final model a : age , sex , diabetes , current smoking , systolic blood pressure , total cholesterol , hdl , blood pressure lowering medication , lipidlowering medication , ccl3 , ccl20 , cx3cl1 , cxcl6 , and cxcl16 .
variables not retained in the final model b : age , sex , diabetes mellitus , current smoking , systolic blood pressure , diastolic blood pressure , total cholesterol , blood pressure lowering medication , lipidlowering medication , body mass index , lowdensity lipoprotein , hdl , triglycerides , estimated glomerular filtration rate , white blood cells , ccl3 , ccl20 , cx3cl1 , cxcl6 , and cxcl16 .
ccl indicates cc motif chemokine ligand ; crp , creactive protein ; cxcl , cxc motif chemokine ligand ; cx3cl1 , cx3c motif chemokine ligand 1 ; hdl , highdensity lipoprotein ; mcp1 , monocyte chemotactic protein1 ; mcsf , macrophage colonystimulating factor . per 1sd increase in the respective variable .
after bonferroni correction for multiple testing . model a : 19 tests , critical cutoff p=0.003 .
meier curves illustrating coronary eventfree survival of participants with high or low plasma levels of mcp1 and mcsf .
thin lines indicate low mcp1 levels ( below median ) , and thick lines indicate high mcp1 , whereas gray lines indicate low mcsf and black lines indicate high mcsf .
mcp1 indicates monocyte chemotactic protein 1 ; mcsf indicates macrophage colonystimulating factor . to test whether mcsf , mcp1 , cxcl1 , or ccl4 could improve the predictive value of the traditional risk factors for firsttime coronary events , receiver operating characteristic curves were constructed for binary logistic regression models including traditional risk factors ( age , sex , smoking , total cholesterol , highdensity lipoprotein , systolic blood pressure , and diabetes mellitus ) , blood pressure lowering medication , and lipidlowering medication , as well as mcsf , mcp1 , cxcl1 , ccl4 , and crp alone or in combination ( table 4 and figure 4 )
the addition of mcsf or mcp1 alone significantly improved the discriminative ability of the traditional risk factor model for coronary artery disease risk , whereas addition of cxcl1 , ccl4 , or crp alone did not improve discrimination .
the addition of mcp1 to the model already including mcsf and traditional risk factors further improved discrimination ( p=1.110 ) .
the model including mcsf and mcp1 alongside traditional risk factors had a significantly improved c statistic compared with traditional risk factors alone ( 0.81 [ 95% ci 0.780.85 ] versus 0.67 [ 95% ci 0.620.70 ] ; p=6.610 ) .
comparison of risk prediction models for acute coronary events comparative c statistic analysis of different predictive models for incident coronary events , based on traditional risk factors ( age , sex , current smoking , total cholesterol , highdensity lipoprotein cholesterol , systolic blood pressure , blood pressure lowering medication , lipidlowering medication , and presence of diabetes ) , with and without the addition of biomarkers .
ccl indicates cc motif chemokine ligand ; crp indicates creactive protein ; cxcl , cxc motif chemokine ligand ; mcp1 , monocyte chemotactic protein 1 ; mcsf , macrophage colonystimulating factor ; nri , net reclassification index .
receiver operating characteristic curves of binary logistic regression models for acute coronary event risk discrimination .
the broken line represents the model including traditional risk factors ( age , sex , total cholesterol , highdensity lipoprotein , systolic blood pressure , smoking , diabetes mellitus ) as well as blood pressure lowering medication and lipidlowering medication .
the continuous line represents the model with traditional risk factors , medication , mcp1 , and mcsf .
we also performed reclassification analyses for 3 predefined risk categories for incident coronary events : < 10% ( low risk ) , 10% to 20% ( moderate risk ) , and > 20% ( high risk ) ( table 5 ) .
the addition of mcsf and mcp1 significantly improved the predictive value of the traditional risk factor model , with a net reclassification index of 0.52 ( 95% ci 0.420.62 ; p<0.001 ) and integrated discrimination improvement of 0.18 ( 95% ci 0.150.21 ; p<0.001 ) .
of 86 participants with low coronary event risk according to the traditional model , 8 ( 9.3% ) were correctly upclassified and 6 ( 7% ) were incorrectly upclassified after the addition of mcp1 and mcsf . among participants in the intermediaterisk group , 146
were correctly downclassified and 61 were correctly upclassified ( total correct reclassification 207 of 292 , 71% ) compared with 26 incorrectly downclassified and 15 incorrectly upclassified ( total incorrect reclassification 41 of 292 , 14% ) . within the highrisk group , we recorded 73 of 280 ( 26% ) with correct downclassification compared with 50 of 280 ( 18% ) with incorrect downclassification . taken together
, these results suggest that addition of mcsf and mcp1 to the traditional cardiovascular risk factors for prediction of firsttime coronary events is useful mainly in the intermediaterisk population , leading to correct net total reclassification of 166 of 292 ( 57% ) participants in this category .
analysis of reclassification in cases and controls revealed that the addition of mcsf and mcp1 was particularly effective in the control group , leading to a net downclassification of 54% of participants who did not have a coronary event during followup . in the coronary case group , the combined model led to a minimal net downclassification of 2% of participants ( table 5 ) .
reclassification of study participants between risk categories for incident coronary events after addition of mcp1 and mcsf to a traditional risk factor model the number of participants and row percentage are shown .
the model without biomarkers included age , sex , current smoking , total cholesterol , highdensity lipoprotein cholesterol , systolic blood .
net reclassification index was 0.52 ( 95% ci 0.420.62 ; p<110 ) and integrated discrimination improvement was 0.18 ( 95% ci 0.150.21 ; p<110 ) after addition of mcp1 and mcsf .
to concomitantly explore the independent associations among myeloid biomarkers , baseline clinical variables , and incident coronary artery disease , partial correlations were calculated between each pair of variables , controlling for all of the others , and a partial correlation network was constructed ( figure 2 ) .
partial correlation network of the relationships among clinical variables , myeloid biomarkers , and incident firsttime coronary events in the study group .
positive partial correlations are depicted in black , and negative partial correlations are shown in gray .
only partial pearson correlations with bonferroniadjusted p values < 0.05 are shown , with the partial correlation coefficients reported in boxes on the lines indicating correlations .
positive correlations for categorical variables indicate higher numbers of cases , patients with diabetes mellitus , current smokers , and women .
bmi indicates body mass index ; bp , blood pressure ; ccl , cc motif chemokine ligand ; crp , creactive protein ; cxcl , cxc motif chemokine ligand ; cx3cl1 , cx3c motif chemokine ligand 1 ; dbp , diastolic blood pressure ; dm , diabetes mellitus ; egfr , estimated glomerular filtration rate ; hdl , highdensity lipoprotein ; mcp1 , monocyte chemotactic protein 1 ; mcsf , macrophage colonystimulating factor ; sbp , systolic blood pressure ; tc , total cholesterol ; tg , triglycerides ; wbc , white blood cells . when the 9 biomarkers were tested individually , mcsf , mcp1 , and cxcl1
were significantly associated with incident coronary events in cox proportional hazard models adjusted for the traditional cardiovascular risk factors included in the framingham risk score ( age , sex , smoking , total cholesterol , highdensity lipoprotein , systolic blood pressure ) and for blood pressure lowering medication , lipidlowering medication , and diabetes mellitus ( model a ) ( table 2 ) .
the associations remained significant following further adjustment for potential confounders that differed between cases and controls at baseline : diastolic blood pressure , body mass index , triglycerides , lowdensity lipoprotein , estimated glomerular filtration rate , crp , and white blood cell count ( model b ) ( table 2 ) .
the relationships between biomarkers and outcome were linear , as demonstrated by gradually increasing hazard ratios for each increasing mcp1 quartile and gradually decreasing hazard ratios for the mcsf and cxcl1 quartiles ( p for linear trend < 0.001 ) ( table 2 ) .
correlations between baseline biomarker levels and incident coronary events during followup number of participants included in the analysis : 292 cases and 366 controls .
ccl indicates cc motif chemokine ligand ; cxcl , cxc motif chemokine ligand ; cx3cl1 , cx3c motif chemokine ligand 1 ; hdl , highdensity lipoprotein ; hr , hazard ratio ; mcp1 , monocyte chemotactic protein 1 ; mcsf , macrophage colonystimulating factor ; q , quartile .
after bonferroni correction for multiple testing . model a : 10 tests , critical cutoff p=0.005 .
model a : cox regression analysis adjusted for age , sex , diabetes mellitus , current smoking , total cholesterol , hdl , systolic blood pressure , blood pressure lowering medication , and lipidlowering medication .
model b : cox regression analysis adjusted for age , sex , diabetes , current smoking , total cholesterol , hdl , systolic blood pressure , blood pressure lowering medication , lipidlowering medication , diastolic blood pressure , body mass index , triglycerides , lowdensity lipoprotein , estimated glomerular filtration rate , creactive protein , and white blood cell count .
next , we included all biomarkers alongside traditional risk factors , diabetes mellitus , crp , and medication in a cox forward stepwise regression model to identify the strongest independent relationships between potential predictors and incident coronary events . only the correlations for mcp1 , mcsf , crp , cxcl1 , and ccl4 remained statistically significant in the final model when a bonferroni correction for multiple testing was applied ( model a ) ( table 3 )
the distinctively strongest predictors of coronary events were mcsf ( hazard ratio 0.49 [ 95% ci 0.410.6 ] ; p=3.510 ) and mcp1 ( hazard ratio 2.06 [ 95% ci 1.752.43 ] ; p=5.110 ) , confirming the results of the partial correlation network analysis .
the cox forward stepwise regression model including all potential confounders yielded similar results ( model b ) ( table 3 ) . among all considered biomarkers , mcp1 and mcsf remained the strongest predictors of coronary events when men , women , diabetic and nondiabetic participants , and those above and below the median age were analyzed separately ( data not shown ) .
notably , the incidence of acute coronary events was negatively associated with mcsf and positively associated with mcp1 , indicating that these 2 biomarkers might have complementary value as predictors of incident coronary events . to illustrate this relationship
, we divided the patients into high and low groups based on median plasma levels of mcsf and mcp1 and created kaplan
meier survival curves for the combinations of high and low biomarker levels ( figure 3 ) .
we found that participants with high mcsf and low mcp1 had a markedly improved coronary eventfree survival compared with the rest of the cohort ( logrank p for trend < 0.001 ) .
independent predictors of incident coronary events in the cohort final model of a cox proportional hazards regression analysis with stepwise forward selection of variables . only variables with an adjusted p value < 0.05 after bonferroni correction are shown .
number of participants included in the analysis : 292 cases and 366 controls . variables not retained in the final model a : age , sex , diabetes , current smoking , systolic blood pressure , total cholesterol , hdl , blood pressure lowering medication , lipidlowering medication , ccl3 , ccl20 , cx3cl1 , cxcl6 , and cxcl16 . variables not retained in the final model b : age , sex , diabetes mellitus , current smoking , systolic blood pressure , diastolic blood pressure , total cholesterol , blood pressure lowering medication , lipidlowering medication , body mass index , lowdensity lipoprotein , hdl , triglycerides , estimated glomerular filtration rate , white blood cells , ccl3 , ccl20 , cx3cl1 , cxcl6 , and cxcl16 .
ccl indicates cc motif chemokine ligand ; crp , creactive protein ; cxcl , cxc motif chemokine ligand ; cx3cl1 , cx3c motif chemokine ligand 1 ; hdl , highdensity lipoprotein ; mcp1 , monocyte chemotactic protein1 ; mcsf , macrophage colonystimulating factor . per 1sd increase in the respective variable .
after bonferroni correction for multiple testing . model a : 19 tests , critical cutoff p=0.003 .
meier curves illustrating coronary eventfree survival of participants with high or low plasma levels of mcp1 and mcsf .
thin lines indicate low mcp1 levels ( below median ) , and thick lines indicate high mcp1 , whereas gray lines indicate low mcsf and black lines indicate high mcsf .
to test whether mcsf , mcp1 , cxcl1 , or ccl4 could improve the predictive value of the traditional risk factors for firsttime coronary events , receiver operating characteristic curves were constructed for binary logistic regression models including traditional risk factors ( age , sex , smoking , total cholesterol , highdensity lipoprotein , systolic blood pressure , and diabetes mellitus ) , blood pressure lowering medication , and lipidlowering medication , as well as mcsf , mcp1 , cxcl1 , ccl4 , and crp alone or in combination ( table 4 and figure 4 ) .
the addition of mcsf or mcp1 alone significantly improved the discriminative ability of the traditional risk factor model for coronary artery disease risk , whereas addition of cxcl1 , ccl4 , or crp alone did not improve discrimination .
the addition of mcp1 to the model already including mcsf and traditional risk factors further improved discrimination ( p=1.110 ) .
the model including mcsf and mcp1 alongside traditional risk factors had a significantly improved c statistic compared with traditional risk factors alone ( 0.81 [ 95% ci 0.780.85 ] versus 0.67 [ 95% ci 0.620.70 ] ; p=6.610 ) .
comparison of risk prediction models for acute coronary events comparative c statistic analysis of different predictive models for incident coronary events , based on traditional risk factors ( age , sex , current smoking , total cholesterol , highdensity lipoprotein cholesterol , systolic blood pressure , blood pressure lowering medication , lipidlowering medication , and presence of diabetes ) , with and without the addition of biomarkers .
ccl indicates cc motif chemokine ligand ; crp indicates creactive protein ; cxcl , cxc motif chemokine ligand ; mcp1 , monocyte chemotactic protein 1 ; mcsf , macrophage colonystimulating factor ; nri , net reclassification index .
receiver operating characteristic curves of binary logistic regression models for acute coronary event risk discrimination .
the broken line represents the model including traditional risk factors ( age , sex , total cholesterol , highdensity lipoprotein , systolic blood pressure , smoking , diabetes mellitus ) as well as blood pressure lowering medication and lipidlowering medication .
the continuous line represents the model with traditional risk factors , medication , mcp1 , and mcsf .
we also performed reclassification analyses for 3 predefined risk categories for incident coronary events : < 10% ( low risk ) , 10% to 20% ( moderate risk ) , and > 20% ( high risk ) ( table 5 ) .
the addition of mcsf and mcp1 significantly improved the predictive value of the traditional risk factor model , with a net reclassification index of 0.52 ( 95% ci 0.420.62 ; p<0.001 ) and integrated discrimination improvement of 0.18 ( 95% ci 0.150.21 ; p<0.001 ) .
of 86 participants with low coronary event risk according to the traditional model , 8 ( 9.3% ) were correctly upclassified and 6 ( 7% ) were incorrectly upclassified after the addition of mcp1 and mcsf . among participants in the intermediaterisk group , 146
were correctly downclassified and 61 were correctly upclassified ( total correct reclassification 207 of 292 , 71% ) compared with 26 incorrectly downclassified and 15 incorrectly upclassified ( total incorrect reclassification 41 of 292 , 14% ) . within the highrisk group , we recorded 73 of 280 ( 26% ) with correct downclassification compared with 50 of 280 ( 18% ) with incorrect downclassification . taken together , these results suggest that addition of mcsf and mcp1 to the traditional cardiovascular risk factors for prediction of firsttime coronary events is useful mainly in the intermediaterisk population , leading to correct net total reclassification of 166 of 292 ( 57% ) participants in this category
. analysis of reclassification in cases and controls revealed that the addition of mcsf and mcp1 was particularly effective in the control group , leading to a net downclassification of 54% of participants who did not have a coronary event during followup . in the coronary case group , the combined model led to a minimal net downclassification of 2% of participants ( table 5 ) .
reclassification of study participants between risk categories for incident coronary events after addition of mcp1 and mcsf to a traditional risk factor model the number of participants and row percentage are shown .
the model without biomarkers included age , sex , current smoking , total cholesterol , highdensity lipoprotein cholesterol , systolic blood .
net reclassification index was 0.52 ( 95% ci 0.420.62 ; p<110 ) and integrated discrimination improvement was 0.18 ( 95% ci 0.150.21 ; p<110 ) after addition of mcp1 and mcsf .
we are the first to compare the ability of several mediators related to myeloid cell homeostasis and function ( mcsf , mcp1 , ccl3 , ccl4 , ccl20 , cxcl1 , cxcl6 , cxcl16 , and cx3cl1 ) to predict firsttime acute coronary events in middleaged persons with no previous history of coronary artery disease .
we identified , for the first time , a strong independent negative association between mcsf and coronary artery disease risk and confirmed the previously described positive relationship between mcp1 and coronary events in this population.22 , 23 participants at low risk of having acute coronary events were characterized by high levels of mcsf and low levels of mcp1 in plasma . combining mcsf and
mcp1 with the classic cardiovascular risk factors included in the framingham risk score improved prediction accuracy in the intermediaterisk group and led to correct net downclassification of approximately half of the participants that did not have a coronary event during followup .
nevertheless , the model did not improve identification of participants who subsequently developed clinically manifested coronary artery disease . to our knowledge , this study is the first on the potential role of plasma mcsf as a biomarker of cardiovascular risk in persons with no clinical evidence of coronary artery disease .
interestingly , the negative correlation between the circulating levels of this myeloid growth factor and the incidence of coronary events was independent of traditional cardiovascular risk factors , crp , and other myeloid mediators , including mcp1 .
our findings raise the important question of whether mcsf plays a protective role in the pathogenesis of atherosclerotic plaque development and rupture .
interesting data recently published by swirski and colleagues revealed that macrophage numbers in established atheroma are maintained mainly through local proliferation rather than constant replacement by recruited monocytes , whereas the development of early lesions relies on monocyte recruitment.24 similar findings have been reported in other tissues , and mcsf has been identified to play an important role in both monocyte recruitment and macrophage proliferation.7 , 25 , 26 macrophages generated in vitro in response to mcsf are being referred to as
mmac and are similar but not identical to m2 polarized macrophages.27 it has been proposed that mmac / m2like macrophages represent the normal state of tissue macrophages and are hyporesponsive to inflammatory stimuli.9 m1 macrophages and their secreted mediators mcp1 , tumor necrosis factor , interleukin 1 , and interleukin 12 promote inflammation within the atherosclerotic plaques,12 whereas m2 macrophages and their signature cytokines interleukin 10 and transforming growth factor inhibit inflammation , promote neovascularization and tissue repair , confer atheroprotection , and may be involved in plaque regression.12 , 28 , 29
early studies have demonstrated immunosuppressive properties of mcsf in vitro and in vivo.30 mcsf or mcsf receptor blockade in mouse models of breast cancer led to the expansion of circulating neutrophils and inflammatory ly6c monocytes , promoting enhanced metastasis.31 conversely , mcsf administration before allogeneic hematopoietic cell transplantation in mice expanded the host macrophage pool , reduced donor tcell activation , and significantly inhibited the development of graftversushost disease.32 mcsf plays an important role in all stages of mononuclear phagocyte homeostasis , from bonemarrow production to recruitment , proliferation , and survival in the tissues.33 perhaps unsurprisingly , because monocytes and macrophages play a central role in atherogenesis , impaired monocyte / macrophage function and survival in mcsf
deficient csf1
mice and in hyperlipidemic mice treated with an mcsf receptor inhibitor impair monocyte recruitment and delay atherosclerosis development.34 , 35 mcsf receptor blockade , however , had no effects on more advanced atherosclerotic plaques,36 and treatment with recombinant human mcsf suppressed atherogenesis in hyperlipidemic rabbits due to enhanced lipoprotein clearance and cholesterol metabolism.37 , 38 importantly , mcsf deficiency in ldlrcsf1 mice is associated with increased macrophage apoptosis within the advanced atherosclerotic lesions , which could potentially trigger plaque instability and rupture.34
the ability of mcsf to predict incident coronary events has been investigated previously in patients with already established , clinically manifested coronary artery disease .
consecutive papers by rallidis et al identified high plasma mcsf at hospital admission as a positive predictor of inhospital adverse events39 and high mcsf measured at the 6week followup time point as a predictor of longterm negative prognosis in patients with severe unstable angina.40 these results are supported by similar findings by saitoh et al in a mixed cohort of 142 patients admitted with stable or unstable angina41 and by ikonomidis et al in 100 stable angina patients.42 notably , patients with acute or prevalent myocardial infarction or revascularization procedures were excluded from these studies , and the incident event rate during followup was driven to a large extent by recurrent angina .
in contrast , we reported a negative relationship between circulating mcsf and the incidence of hard coronary events , represented by myocardial infarction and death due to ischemic heart disease , in a mediumsized cohort of persons with no previous history of coronary artery disease .
the only other study to date to assess the predictive value of mcsf for firsttime cardiovascular events revealed a positive relationship between plasma mcsf and the incidence of stroke in a cohort of participants aged 70 years43 ; however , the relationship could not be confirmed after adjustment for traditional cardiovascular risk factors in the validation cohort consisting of men aged 77 years.43 taken together with the conflicting experimental data , the results of the clinical studies performed so far , including ours , suggest that the role of mcsf in cardiovascular disease is complex and is probably dependent on the stage of the disease . if studies in other cohorts confirm our results , it is tempting to speculate that in healthy persons , mcsf might promote survival of the homeostatic antiinflammatory m2 macrophages , maintaining a stable plaque phenotype ; however , these mechanisms could be disturbed by concurrent factors in patients with advanced atherosclerotic disease , leading to plaque destabilization . whether mcsf plays a pathogenic role in this context or whether the elevated mcsf levels in these patients are the expression of an unsuccessful attempt to restore tissue homeostasis and
interestingly , previous experimental data demonstrating that mcsf treatment accelerates the healing process after myocardial infarction support the latter hypothesis.44 , 45
mcp1 ( also known as ccl2 ) mediates ly6c monocyte release from the bone marrow and recruitment of neutrophils and ly6c monocytes into inflammatory sites.2 mcp1 is upregulated in murine and human atherosclerotic lesions and has been shown to have a potent proatherogenic role in mice.11 , 12 , 46 in humans , polymorphisms in the mcp1 promoter are associated with increased plasma mcp1 and with a history of coronary events , suggesting active involvement of the chemokine in the pathology of coronary artery disease.47 in crosssectional studies of large patient cohorts , plasma mcp1 was directly correlated with the presence of peripheral artery disease23 and with the severity of coronary artery disease measured as coronary calcium score.48 two independent prospective studies previously demonstrated that increasing plasma mcp1 concentrations are associated with elevated risk for firsttime acute coronary events.22 , 23 in the work by herder et al , the relationship between plasma mcp1 and incident coronary heart disease narrowly lost statistical significance after adjustment for age , sex , and other cardiovascular risk factors.22 compared with our study , the authors used a case cohort design based on a significantly younger population with a shorter followup time and curtailed incident coronary event followup at age 75 years,22 which can explain the difference in the results between the studies .
our study has some limitations that preclude direct translation of the data into clinical practice .
the primary purpose of the study was to compare the value of several myeloid cell related mediators as biomarkers with regard to incident coronary events .
consequently , we used a method able to measure a large number of parameters in the same plasma samples at the same time .
the results of the analysis are expressed as relative arbitrary units and can not be extrapolated directly to absolute plasma concentrations .
subsequently , we can not propose a cutoff value for either biomarker that could be used in the clinic .
moreover , our study cohort was originally designed as a casecontrol sample matched for sex , age , and time of inclusion ; therefore , interpretation of the results with regard to unselected populations has to be done with due caution . to address this issue , we statistically compensated our calculations using the method proposed by pencina et al,20 by taking into account event frequency in our cohort compared with event frequency among the 6103 participants in the mdccv cohort , from which our cohort was selected .
last , matching cases and controls on age and sex may have lessened the influence of these strong risk predictors in the model based on traditional risk factors alone , and the c statistic of this model may have been underestimated compared with other studies .
it is also possible that incremental improvements in risk prediction with the addition of mcp1 and mcsf to our traditional risk factor model may be overestimated .
to our knowledge , this study is the first on the potential role of plasma mcsf as a biomarker of cardiovascular risk in persons with no clinical evidence of coronary artery disease .
interestingly , the negative correlation between the circulating levels of this myeloid growth factor and the incidence of coronary events was independent of traditional cardiovascular risk factors , crp , and other myeloid mediators , including mcp1 .
our findings raise the important question of whether mcsf plays a protective role in the pathogenesis of atherosclerotic plaque development and rupture .
interesting data recently published by swirski and colleagues revealed that macrophage numbers in established atheroma are maintained mainly through local proliferation rather than constant replacement by recruited monocytes , whereas the development of early lesions relies on monocyte recruitment.24 similar findings have been reported in other tissues , and mcsf has been identified to play an important role in both monocyte recruitment and macrophage proliferation.7 , 25 , 26 macrophages generated in vitro in response to mcsf are being referred to as
mmac and are similar but not identical to m2 polarized macrophages.27 it has been proposed that mmac / m2like macrophages represent the normal state of tissue macrophages and are hyporesponsive to inflammatory stimuli.9 m1 macrophages and their secreted mediators mcp1 , tumor necrosis factor , interleukin 1 , and interleukin 12 promote inflammation within the atherosclerotic plaques,12 whereas m2 macrophages and their signature cytokines interleukin 10 and transforming growth factor inhibit inflammation , promote neovascularization and tissue repair , confer atheroprotection , and may be involved in plaque regression.12 , 28 , 29
early studies have demonstrated immunosuppressive properties of mcsf in vitro and in vivo.30 mcsf or mcsf receptor blockade in mouse models of breast cancer led to the expansion of circulating neutrophils and inflammatory ly6c monocytes , promoting enhanced metastasis.31 conversely , mcsf administration before allogeneic hematopoietic cell transplantation in mice expanded the host macrophage pool , reduced donor tcell activation , and significantly inhibited the development of graftversushost disease.32 mcsf plays an important role in all stages of mononuclear phagocyte homeostasis , from bonemarrow production to recruitment , proliferation , and survival in the tissues.33 perhaps unsurprisingly , because monocytes and macrophages play a central role in atherogenesis , impaired monocyte / macrophage function and survival in mcsf deficient csf1
mice and in hyperlipidemic mice treated with an mcsf receptor inhibitor impair monocyte recruitment and delay atherosclerosis development.34 , 35 mcsf receptor blockade , however , had no effects on more advanced atherosclerotic plaques,36 and treatment with recombinant human mcsf suppressed atherogenesis in hyperlipidemic rabbits due to enhanced lipoprotein clearance and cholesterol metabolism.37 , 38 importantly , mcsf deficiency in ldlrcsf1 mice is associated with increased macrophage apoptosis within the advanced atherosclerotic lesions , which could potentially trigger plaque instability and rupture.34
the ability of mcsf to predict incident coronary events has been investigated previously in patients with already established , clinically manifested coronary artery disease .
consecutive papers by rallidis et al identified high plasma mcsf at hospital admission as a positive predictor of inhospital adverse events39 and high mcsf measured at the 6week followup time point as a predictor of longterm negative prognosis in patients with severe unstable angina.40 these results are supported by similar findings by saitoh et al in a mixed cohort of 142 patients admitted with stable or unstable angina41 and by ikonomidis et al in 100 stable angina patients.42 notably , patients with acute or prevalent myocardial infarction or revascularization procedures were excluded from these studies , and the incident event rate during followup was driven to a large extent by recurrent angina .
in contrast , we reported a negative relationship between circulating mcsf and the incidence of hard coronary events , represented by myocardial infarction and death due to ischemic heart disease , in a mediumsized cohort of persons with no previous history of coronary artery disease . the only other study to date to assess the predictive value of mcsf for firsttime cardiovascular events revealed a positive relationship between plasma mcsf and the incidence of stroke in a cohort of participants aged 70 years43 ; however , the relationship could not be confirmed after adjustment for traditional cardiovascular risk factors in the validation cohort consisting of men aged 77 years.43 taken together with the conflicting experimental data , the results of the clinical studies performed so far , including ours , suggest that the role of mcsf in cardiovascular disease is complex and is probably dependent on the stage of the disease .
if studies in other cohorts confirm our results , it is tempting to speculate that in healthy persons , mcsf might promote survival of the homeostatic antiinflammatory m2 macrophages , maintaining a stable plaque phenotype ; however , these mechanisms could be disturbed by concurrent factors in patients with advanced atherosclerotic disease , leading to plaque destabilization . whether mcsf plays a pathogenic role in this context or whether the elevated mcsf levels in these patients are the expression of an unsuccessful attempt to restore tissue homeostasis and plaque stability is unclear .
interestingly , previous experimental data demonstrating that mcsf treatment accelerates the healing process after myocardial infarction support the latter hypothesis.44 , 45
mcp1 ( also known as ccl2 ) mediates ly6c monocyte release from the bone marrow and recruitment of neutrophils and ly6c monocytes into inflammatory sites.2 mcp1 is upregulated in murine and human atherosclerotic lesions and has been shown to have a potent proatherogenic role in mice.11 , 12 , 46 in humans , polymorphisms in the mcp1 promoter are associated with increased plasma mcp1 and with a history of coronary events , suggesting active involvement of the chemokine in the pathology of coronary artery disease.47 in crosssectional studies of large patient cohorts , plasma mcp1 was directly correlated with the presence of peripheral artery disease23 and with the severity of coronary artery disease measured as coronary calcium score.48 two independent prospective studies previously demonstrated that increasing plasma mcp1 concentrations are associated with elevated risk for firsttime acute coronary events.22 , 23 in the work by herder et al , the relationship between plasma mcp1 and incident coronary heart disease narrowly lost statistical significance after adjustment for age , sex , and other cardiovascular risk factors.22 compared with our study , the authors used a case cohort design based on a significantly younger population with a shorter followup time and curtailed incident coronary event followup at age 75 years,22 which can explain the difference in the results between the studies .
our study has some limitations that preclude direct translation of the data into clinical practice .
the primary purpose of the study was to compare the value of several myeloid cell related mediators as biomarkers with regard to incident coronary events .
consequently , we used a method able to measure a large number of parameters in the same plasma samples at the same time .
the results of the analysis are expressed as relative arbitrary units and can not be extrapolated directly to absolute plasma concentrations .
subsequently , we can not propose a cutoff value for either biomarker that could be used in the clinic .
moreover , our study cohort was originally designed as a casecontrol sample matched for sex , age , and time of inclusion ; therefore , interpretation of the results with regard to unselected populations has to be done with due caution . to address this issue , we statistically compensated our calculations using the method proposed by pencina et al,20 by taking into account event frequency in our cohort compared with event frequency among the 6103 participants in the mdccv cohort , from which our cohort was selected .
last , matching cases and controls on age and sex may have lessened the influence of these strong risk predictors in the model based on traditional risk factors alone , and the c statistic of this model may have been underestimated compared with other studies .
it is also possible that incremental improvements in risk prediction with the addition of mcp1 and mcsf to our traditional risk factor model may be overestimated .
in conclusion , we are the first to reveal a strong negative association between plasma mcsf and the incidence of coronary events in humans . we demonstrated that mcsf and mcp1 display opposing associations with the risk for firsttime coronary events in middleaged persons with no previous history of coronary artery disease .
those with high levels of mcsf and low levels of mcp1 in plasma are at low risk of developing acute coronary events .
the negative relationship between mcsf and incident acute coronary events requires further confirmation in other cohorts and warrants further investigation into the potential protective role of mcsf against the development of acute coronary events in humans .
this work was supported by grants from the swedish research council ( stockholm ) , the swedish heart lung foundation ( stockholm ) , the marianne and marcus wallenberg foundation ( stockholm ) , swedish foundation for strategic research ( stockholm ) , the albert phlsson foundation ( stockholm ) , skne university hospital foundation ( lund ) , the royal physiographic society in lund , bundy academy lund university ( lund ) , and the lundstrm foundation ( malm ) . | backgroundmyeloid cells play a central role in atherosclerosis .
we investigated the associations between the plasma levels of growth factors and chemokines that regulate myeloid cell homeostasis and function and the risk of firsttime acute coronary events in middleaged persons.methods and resultswe measured baseline plasma levels of macrophage colonystimulating factor ; monocyte chemotactic protein 1 ; cc motif chemokine ligands 3 , 4 , and 20 ; cxc motif chemokine ligands 1 , 6 , and 16 ; and cx3c motif chemokine ligand 1 in 292 participants who had a coronary event during followup and 366 controls matched for age , sex , and time of inclusion who remained event free .
study participants were recruited from the malm diet and cancer study population cohort and had no previous history of coronary artery disease .
we found a strong independent negative association between macrophage colonystimulating factor and incident coronary events in a forward stepwise cox proportional hazards model including all biomarkers alongside the classic framingham risk factors ( age , sex , smoking , total cholesterol , highdensity lipoprotein cholesterol , systolic blood pressure ) , diabetes mellitus , and medication .
conversely , monocyte chemotactic protein 1 had the strongest independent positive association with the outcome .
the addition of macrophage colonystimulating factor and monocyte chemotactic protein 1 significantly improved the predictive ability of a model including traditional risk factors alone ( c statistic 0.81 [ 95% ci 0.780.84 ] versus 0.67 [ 95% ci 0.630.71 ] ; net reclassification index 0.52 [ 0.420.62 ] ; p<0.001 ) .
the combined model led to a 54% net downclassification of participants who did not have a coronary event during followup and was particularly effective in the intermediaterisk group.conclusionshigh levels of macrophage colonystimulating factor and low levels of monocyte chemotactic protein 1 in plasma characterize middleaged persons at low risk to develop clinically manifested coronary artery disease . | Introduction
Materials and Methods
Study Cohort
Baseline Assessment
Analysis of Myeloid Markers in Plasma
Statistics
Results
Myeloid Markers in Plasma and Incidence of FirstTime Acute Coronary Events
MCSF and MCP1 Improve the Discriminative Ability of a Traditional Risk Factor Model for Coronary Artery Disease
Discussion
MCSF and Coronary Artery Disease Risk
MCP1 and Coronary Artery Disease Risk
Study Limitations
Conclusions
Sources of Funding
Disclosures |
a lip switch flap is an axial - pattern flap using the inferior labial artery as a feeding blood vessel .
its morphology is appropriate to improve the upper lip morphology in the presence of severe cleft lip and nose deformity .
it is capable of simultaneously reconstructing the philtrum and extending the bridge of the nose , and was reported to be very useful and be associated with fewer complications in many cases.[14 ] cutting et al .
described it was very important to proceed in secondary bilateral cleft lip reconstruction with lip switch flap only after the midface and nose repair done . on the other hand ,
the vascular pedicle of this flap is very thin and circulatory disorder occurs due to 180 rotation of the pedicle , being a risk for flap necrosis .
the grafted flap was returned to the donor site to improve blood circulation of the flap , followed by its re - transplantation , which prevented necrosis of the flap . here ,
severe cleft lip nose deformity , i.e. a short bridge and flat apex of the nose , were observed . under general anesthesia
, the nasal morphology was improved using cartilage of the nasal septum , and the lip deformity was improved by forming a tubercle of the upper lip using a lip switch flap with left inferior labial arterial and venous pedicles , the philtrum and bridge of the nose .
the lower lip flap was designed to have a 10-mm width and a 17-mm length and transplanted to the upper lip .
its color immediately after surgery was favorable ( figure 1(a ) ) , but marked swelling of the flap and surrounding tissue was noted 6 h after surgery , with which the flap developed venous congestion ( figure 1(b ) ) . to release pressure due to the swelling on the vascular pedicle
, sutures around the pedicle were removed , but blood circulation of the flap did not improve and congestion aggravated .
since flap necrosis was predicted , the flap that had been transplanted to the upper lip was returned to the lower lip 8 h after surgery to improve its blood circulation and prevent necrosis . under venous sedation
, the flap transplanted to the upper lip was released to a free state so that the mouth could be opened , oropharyngeal intubation was applied and sedation was switched to general anesthesia .
hematoma around the flap was removed by washing well with saline . after confirming blood flow from the flap stump ,
the flap was returned to the lower lip and fixed by sutures , and the transplantation site was simply sutured ( figure 1(c ) ) .
( a ) at the completion of surgery , ( b ) 6 h after surgery and ( c ) the flap was returned to the lower lip .
after surgery , the flap was covered with heparinized saline - soaked gauze to further reduce congestion .
congestion was improved 7 h after surgery ( figure 2(a ) ) , and the flap returned to the donor site had almost completely recovered 1 week after surgery ( figure 2(b ) ) .
the flap was re - transplanted with sufficient tissue around the pedicle under local anesthesia ( figure 2(c ) ) .
as of 2 years after surgery ( figure 2(d ) ) , the cleft lip nose deformity had improved with a favorable course .
( a ) seven hours after returning the flap to the donor site , ( b ) 1 week after surgery , ( c ) re - transplantation of the lip switch flap and ( d ) 1 week after surgery .
in cleft lip patients with upper lip tissue defects , a complication of a lip switch flap , flap necrosis , results in failure of upper lip reconstruction .
the feeding artery of a lip switch flap , the inferior labial artery , is distributed within 15 mm from the upper end of the lower lip .
it is very thin , and 180 rotation of the vascular pedicle is likely to cause ischemia due to twisting and pressure . since the vein distributing along with the inferior labial artery is unclear , venous perfusion by the surrounding oral mucosa
but , when oral mucosa is too thick , there is the problem that the shape of upper lip comes to worse .
similarly , when pressure is loaded on the vascular pedicle and surrounding tissue by tension induced by flap rotation and swelling after surgery , venous congestion readily occurs , being a risk for partial or total necrosis .
since the vascular pedicle of the flap is very thin , the risk should be fully considered , and we encountered it in 2 of 32 patients treated over the last 10 years . in the present patients , venous congestion was treated by removing sutures around the vascular pedicle to release tension loaded by the surrounding tissue , such as mucosa and muscle , and phlebotomy was also applied , but these were ineffective , and congestion of the flap rapidly progressed , being likely to result in total necrosis .
we considered the application of medical leeches to improve congestion , but this was abandoned because the patient rejected it and the progression of congestion was rapid due to the small size of the flap .
when severe venous congestion develops in a lip switch flap , like this case , it is likely to rapidly progress and result in total necrosis .
thus , the early discovery of congestion by careful observation of the flap after surgery and rapid treatment upon suspecting congestion are very important
. the flap could be re - transplanted after it was returned to the donor site to sufficiently recover circulation in tissue around the vascular pedicle , and it engrafted and achieved a favorable upper lip morphology , reconfirming that , when congestion is suspected , the flap should be treated without hesitation .
various modifications have recently been added to the previous lip switch flap , and the vascular pedicle was further thinned to improve mobility in some modifications . in these two cases ,
attention should be paid to venous congestion , and preparation for its treatment may be important .
the authors report no conflicts of interest . the authors alone are responsible for the content and writing of this article . | abstractin a 21-year - old male with bilateral cleft lip who developed marked venous congestion of a lip switch flap , we returned the grafted flap to the donor site to improve blood circulation of the flap and then re - transplanted it , which prevented flap necrosis . here ,
we report the procedure and case . | Introduction
Case report
Discussion
Disclosure statement |
among the many causes of dyspnea associated with ph in a patient with history of cancer , paraneoplastic thrombotic pe is the most common aetiology and must be considered in priority .
but tumour cells can metastasize in the pulmonary vasculature in three mechanisms : occlusion of the small pulmonary arteries , pulmonary tumour thrombotic microangiopathy , or reach the lymphatic system .
a 72yearold woman was admitted to a hospital 2 months ago for exerciseinduced dyspnea .
she had history of left breast cancer pt2pn1m0 treated 2 years before with mastectomy , chemotherapy , and chest radiation .
ddimer serum level was elevated , so a ct angiogram was performed and showed no evidence of pulmonary embolus , whereas ventilation perfusion lung scan revealed two perfusion defects throughout superiors lobes with normal ventilation .
distal pe was suspected , and oral anticoagulation therapy was initiated and the patient discharged .
two months later , an echocardiogram revealed elevated right ventricular systolic pressure at 78 mmhg .
the right ventricle was moderately dilated ( 30 mm ) , nonhypertrophic , with good systolic function .
she had severe hypoxemia of 52 mmhg , a ph of 7.46 , a pc02 of 34 , and hco3
of 24 mmol / l with 10 l / min of oxygen .
the pulmonary function tests , the viral serologies , and the immune checkup were normal .
a second chest ct showed nonspecific groundglass opacities and lung fibrosis consistent with previous radiation therapy but no sign of pe , nor interlobular septal thickening , adenopathy , or mass .
right cardiac catheterization established precapillary ph with mean pa pressure of 48 mmhg and not elevated pulmonary wedge pressure ( 4 mmhg ) .
atrial pressure was low ( 5 mmhg ) , cardiac output was normal ( 2.66 l / min / m ) , and pulmonary vascular resistance were increased at 8.6 wood units .
a specific ph tritherapy was administrated ( sildenafil , ambrisartan , and epoprostenol ) , but her condition worsened rapidly with acute rhf , respiratory distress , acute renal failure , and microangiopathic hemolytic anaemia . in this context , in absence of diagnostic , we decided to withhold invasive ventilator support .
the autopsy showed three etiologies of ph consistent with hematogenous metastasis of breast cancer in pulmonary vasculature : carcinomatous cell inside lymph vessels ( lymphangitis carcinomatosis ) ( figure
1 ) , tumour cell embolization inside small arteries ( tumoural cells emboli ) ( figure
2 ) and pulmonary tumour thrombotic microangiopathy ( pttm ) ( figures
3 and 4).this latter is histologically characterized by intimal and medial fibromuscular thickening with accumulation of carcinomatous cells in the residual lumen of the small arteries and arterioles .
( haematoxylin and eosin ) : tumoural cells inside lymph vessels ( black arrow ) ; pleura ( dotted arrow ) .
( haematoxylin and eosin ) : tumoural cells inside arteriole lumen ( black arrow ) ; intimal fibroblastic proliferation ( black star ) ; fibrinrich thrombus ( * ) ; internal elastic lamina destruction .
( haematoxylin and eosin ) : tumoural cells inside arteriole lumen ( black arrow ) ; intimal fibroblastic proliferation ( black star ) ; internal elastic lamina destruction ( dotted black arrow ) ; hypertrophic arteriole wall ( double black arrow ) .
it was first described in 1990 in 3.3% of an autopsic series of patients , who had died of metastatic adenocarcinoma , mostly of gastric origin.1 recently , a large case series estimated the incidence of 1.4% among 2215 autopsy patients with carcinoma and confirmed the stomach as the primary site of cancer associated with pttm .
most of the time , there is evidence of metastatic disease , but many occult cancers have been reported as in our description .
previous studies have shown that tumour cells have the abilities to activate coagulation pathway and local thrombus formation and trigger fibroblastic intimal proliferation via production of cytokines such as tissue factor,2 vascular growth factor , or plateletderived growth factor.3 high vegf expression associated with gastric cancer could explain the high incidence of pttm .
in addition to mechanical occlusion , these phenomena rapidly lead to arterioles remodelling and stenosis , increased pulmonary vascular resistance , and ph .
the tumoural cells are beyond the resolution of the ct angiogram , but their presence explains the perfusion defect on lung scan . recently , a treeinbud pattern , usually seen in bronchiolitis and characterized by small centrilobular nodules and branching linear opacities , was reported on thinsection ct of pttm patients.4
disseminated intravascular coagulation5 or cancer associated hemolytic anaemia has often been described consistent with elevated ddimer .
a study has estimated the median survival as 5 days from admission to hospital.6 pttm may be identified using videoassisted thoracoscopic surgery , transbronchial biopsy , right heart catheterization , and ctguided biopsy.7
in the rare antemortem diagnosis case , specific chemotherapy was administrated often associated with empiric treatment such as corticosteroids or anticoagulation .
the best survival reported was 15 months probably because diagnosis was made prior to the development of ph.8
chronic pe is the main cause of unexplained progressive dyspnea with precapillary ph in the context of cancer .
but when large proximal pe is absent in ct angiogram whereas lung scan show multiple perfusion defects , clinicians must consider other tumoural embolic causes in the differential , especially pttm .
thereby , they will be able to perform pulmonary cytology or biopsy before the patient 's condition deterioration .
a rapid specific chemotherapy administration is the only way to improve the survival of patients . | abstracta 72yearold woman with history of breast cancer only treated surgically was referred to our department for pulmonary hypertension ( ph ) suspicion .
echocardiogram revealed elevated right ventricular systolic pressure .
computed tomography ( ct ) angiogram showed no pulmonary embolism ( pe ) , but lung scan revealed two ventilationperfusion mismatch areas .
right cardiac catheterization established precapillary ph . despite treatment with ph specific therapy ( sildenafil , ambrisentan , and epoprostenol ) , her condition worsened rapidly with acute right heart failure ( rhf ) .
she died 22 days after admission .
postmortem microscopic examination showed a rare combination of ph etiologies consistent with metastasis of breast cancer in pulmonary vasculature including the rare pulmonary tumour thrombotic microangiopathy ( pttm ) . | Introduction
Case report
Discussion |
berries are gaining
increased attention lately for their chemopreventive
and therapeutic potential against several cancers .
blueberry
contains an abundance and distinct spectrum of anthocyanins , namely ,
the glycosides of cyanidin ( cy ) , delphinidin ( dp ) , petunidin ( pt ) ,
peonidin ( pe ) , and malvidin ( mv ) .
a compelling body of literature
suggests berry phytochemicals , including anthocyanins , have multifunctional
chemopreventive and therapeutic effects , including anti - inflammatory , radiation protection , and antioxidant .
anthocyanins , which
comprise the largest group of water - soluble pigments , are widely distributed
in dark - colored fruits , vegetables , grains , and flowers and are responsible
for their red , purple , and blue hues .
anthocyanins from different
plant sources , including blueberry , have been shown to possess potential
anticancer activities .
several studies have shown that anthocyanins can inhibit cellular
growth , induce apoptosis , and kill cancer cells in vitro .
animal studies , although limited , have also demonstrated
the chemopreventive potential of berries and their bioactive constituents
such as anthocyanins and ellagitannins .
the protective effects of
these bioactives could be related to their potent antioxidant activity ,
as demonstrated in various in vitro and in vivo studies , among other effects . in our previous
studies
, we demonstrated the chemopreventive potential of blueberry
against breast cancer using the aci rat model and
the therapeutic potential of blueberry anthocyanidins against lung
cancer using the nude mouse xenograft model . in the latter study
, we also demonstrated that a mixture of anthocyanidins
exhibited synergistic therapeutic activity compared with individual
entities , both in vitro and in vivo .
the
synergistic effects in this study presumably resulted from the effect
of the anthocyanidins on some distinct and overlapping protein targets
associated with cell proliferation , apoptosis , inflammation , invasion ,
and metastasis . despite reports
of berry anthocyanins protection against
cancers and other diseases , a significant gap exists between what was shown in many in vitro
studies and what can be achieved in vivo .
several studies were conducted
to evaluate the bioavailability / pharmacokinetics in blood and tissue
using high doses of individual anthocyanins .
extraction of anthocyanins or their metabolites from blood generally
relies upon solid phases such as water s oasis hlb or c18 sep - pak
cartridges .
however , tissue bioavailability data are scarce because
there are few standardized methods for extractions from tissue .
moreover ,
the stability of anthocyanins and anthocyanidins during the workup
has always been a concern . given these scenarios and multiple
biological effects , anthocyanin / anthocyanidin
bioavailability in non - gastrointestinal ( gi ) tissues
studies on the bioavailability
of anthocyanins from a single berry can provide direct and valuable
information about their absorption .
our unpublished data show 3035%
reduction of cigarette smoke - induced lung tumor in a / j mice by 2.5%
w / w dietary berries . we have also demonstrated that anthocyanidins
delivered intraperitoneally have antitumor activity against lung cancer
xenograft .
hence , this study was designed
to evaluate and compare stability parameters of anthocyanidins and
develop a sensitive method to assess the bioavailability of anthocyanins / anthocyanidins
and their metabolites in lung tissues .
hplc grade water , acetonitrile , methanol ,
and other hplc solvents , hydrochloric acid ( hcl ) , formic acid , acetic
acid , and trifluoroacetic acid were obtained from sigma chemical co.
( st . louis , mo , usa ) .
authentic anthocyanin standards were obtained
from chromadex ( irvine , ca , usa ) .
freeze - dried highbush blueberry powder
( 50:50 blend of tifblue and rubel ) was received from the u.s .
the native mixture of anthocyanidins
( 95% pure ) was isolated in our laboratory from 36% anthocyanin - enriched
bilberry extract ( indena , seattle , wa , usa ) , which contains five major
anthocyanidins , delphinidin , cyanidin , malvidin , peonidin , and petunidin
in the ratio of 33:28:16:16:7 , as described in our previous study .
extraction , enrichment , and hydrolysis of the
bilberry were carried out using essentially the same method as described
previously .
briefly , the enriched bilberry
extract powder was extracted with 75% aqueous ethanol containing 0.1%
hcl and enriched by loading the concentrated extracts on an xad-761/diaion
hp-20 ( 1:1 ) column .
pooled elutes were concentrated and hydrolyzed
with 2 n hcl ( 5 volumes ) .
hydrolysates were purified using
c18 sep - pak cartridges ( waters , milford , ma , usa ) .
anthocyanidins
and other polyphenols were eluted with acidified ( 0.01% hcl ) methanol .
the enriched extracts were dried under reduced pressure using a savant
speed - vac ( thermo scientific , usa ) and stored at 20 c
until use .
the enriched extracts were dissolved in acidified water ,
and anthocyanidins were selectively extracted in isoamyl alcohol and
dried under vacuum .
the extracted anthocyanidins
were further purified by loading on the c18 cartridges per the manufacturer s
guidelines .
ain-93 m diet supplemented
with blueberry powder
at 5% ( w / w ) was prepared in pellet form by harlan - teklad ( madison ,
wi , usa ) and stored at 4 c in the dark in vacuum - sealed bags
until use .
animal experiments
were performed in agreement
with an approved protocol from the institutional animal care and use
committee of the university of louisville .
female athymic nude mice
( 56 weeks old ) were purchased from harlan sprague dawley ,
inc .
two animal studies were conducted to
test different routes of administration . in study 1 , after a week
of acclimatization , animals were randomized into two groups ( n = 4 ) and provided either ain-93 m diet or diet supplemented
with 5% blueberry powder ( w / w ) .
the diet was changed every other day , and the food intake
was monitored .
after 10 days of treatment , animals were euthanized
by co2 asphyxiation , and lung was collected , snap frozen ,
and stored at 80 c until use .
blood was collected by
cardiac puncture ; plasma was separated and stored at 80 c . in study 2 , animals were treated with a bolus dose of the native
mixture of anthocyanidins isolated from bilberry ( 10 mg / mouse ) by
gavage in 10% dimethyl sulfoxide .
two hours after the treatment , animals
were euthanized ; lung tissue was collected , snap frozen , and stored
at 80 c until use .
blood was collected by cardiac puncture ;
plasma was separated and stored at 80 c . to test the stability of anthocyanidins
in various solvents , cyanidin
chloride ( 100 g / ml )
was dissolved in ( i ) acetonitrile , ( ii )
methanol , and ( iii ) methanol acidified with 0.1% hcl .
samples maintained at room temperature were analyzed at 1
h intervals for 5 h. the concentration was plotted against percent
of cyanidin chloride at initial time point . because methanol provided
complete stability as described under results , all of the analyses from tissue were done by using methanol containing
0.1% hcl .
anthocyanins
in biological samples ( see below ) were analyzed at anthocyanidin level .
conversion of anthocyanins to anthocyanidins in the presence of biological
matrix was optimized as follows : to 500 l of plasma was added
100 l of bilberry extract ( 1 mg / ml ) , the mixture was acidified
with 0.1% formic acid , acetic acid , trifluoroacetic acid , phosphoric
acid , or hydrochloric acid .
samples were incubated for 15 min at 37
c and then extracted with 5 volumes of acetonitrile .
the sample
was centrifuged at 10000 g , and the supernatant was
collected and evaporated to dryness under vacuum ( savant speed - vac ) .
the dried extracts were dissolved in acidified ( 0.1% hcl ) methanol
and analyzed by uplc .
parameters
such as the stability of anthocyanidins in different buffers and acid
environment , extraction efficiency , and selectivity in different solvents ,
etc . , were established before tissue extractions .
first , we analyzed
the recovery of anthocyanidins by spiking lung tissues collected from
untreated rats from another study .
methods described previously were used to detect berry anthocyanins / anthocyanidins , except for the following modifications : extraction
of anthocyanins in acidified ( 0.1% hcl ) acetonitrile , evaporation
of solvent , and reconstitution in 50% methanol containing 2 n hcl
followed by acid hydrolysis and selective extraction of anthocyanidins
in isoamyl alcohol without any use of solid liquid chromatography .
furthermore , uplc separation method was developed by identifying solvents
to separate reference anthocyanidins and protocatechuic acid ( pca ) ,
a bioactive metabolite of cy , and spiking
the tissue homogenate with dp , cy , and pca .
briefly , after the optimization , lung tissue from two mice was pooled
( two pools per group ) in both animal studies and homogenized in 400
l of 1.15% kcl ; anthocyanins were extracted in acetonitrile
containing 0.1% hcl as described above .
the extract
was then hydrolyzed ( 100 c/1 h ) to convert anthocyanins to anthocyanidins ,
and the latter were selectively extracted in isoamyl alcohol .
finally , the samples were dried under reduced
pressure ( savant speed - vac ) and reconstituted in 40 l of acidified
( 0.1% hcl ) methanol just before injection , and 10 l was analyzed
by uplc .
the limits of detection for the various anthocyanidins ( cy ,
dp , pt , pe , and mv ) ( 0.30.75 ng ) and pca ( 0.2 ng ) were established .
anthocyanins and anthocyanidins were
analyzed on a shimadzu uplc system composed of two lc-20ad - xr pumps ,
an sil-20a - xr autosampler , and an spd - m20a photodiode array detector
( pda ) controlled by class vp software ( ver 7.4 , sp3 ) attached to a
shim - pack xr - ods - ii column ( 3.0 150 mm ; 2.2 m ) .
a linear
gradient of 3.5% phosphoric acid ( solvent a ) and acetonitrile ( solvent
b ) with a flow rate of 0.75 ml / min was used . in the gradient ,
solvent
b was initially 15% for 2 min and increased to 20% by 3 min .
solvent
b was further increased to 60% from 3 to 10 min , held for 1 min , and
returned to 15% by 12 min . reversed - phase chromatography
of anthocyanidins
was performed on a thermo scientific ( san jose , ca , usa ) accela lc
system .
the mobile phases consisted of buffer a , water / formic acid
( 100:0.1 , v / v ) , and buffer b , acetonitrile / formic acid ( 100:0.1 , v / v ) .
five microliters of sample was injected onto a hypersil gold c18 column ( 50 2.1 mm , 1.9 m , 175 ) from
thermo scientific .
a step gradient at a flow rate of 100 l / min
was used to elute the compounds .
the gradient started at 5% buffer
b and increased to 40% buffer b in 10 min , then increased to 90% buffer
b in 3 min , and was maintained at 90% buffer b for 7 min .
elute from
the lc was directed to an ltq - orbitrap xl mass spectrometer ( thermo
scientific ) .
the compounds were ionized by electrospray ionization
and detected by orbitrap at 30000 mass resolution ( full scan , m / z 2201000 ) or by multiple reaction
monitoring ( mrm ) .
the spray voltage was 4.0 kv , and the capillary
temperature was 250 c .
the sheath , auxiliary , and sweep gas
flows were set to 15 , 5 , and 0 , respectively . in mrm
, molecular ions
of anthocyanidins were selected with 3.0 m / z isolation window and fragmented by collision - induced dissociation
( cid ) . for cid , collision energy , activation q , and
activation time ( ms ) were 35 , 0.25 , and 30 , respectively .
full scan
ms / ms spectra of the compounds ( m / z 100400 ) were acquired by orbitrap at 7500 mass resolution .
the transitions used for anthocyanidin detection are shown in panel
c of figure 4 .
the
limits of detection by lc - ms for dp and cy were > 0.5 and 0.25 ng ,
respectively , whereas those for pt , pe , and mv were 2.5 pg .
blueberry
extract was applied onto the xad-761/hp-20 column ( 1:1 )
for the enrichment of anthocyanins and other polyphenols , and the
enriched extract was hydrolyzed to convert the glycones to aglycones
( i.e. , anthocyanins to anthocyanidins ; figure 1 ) .
the enriched anthocyanidins were extracted in isoamyl alcohol
and further purified by c18 column chromatography .
the final extract
contained highly pure ( > 94% ) anthocyanidins ( figure 2 ) .
when analyzed by uplc , the purified extract showed five
anthocyanidins in the following descending order : dp ( 33% ) , cy ( 28% ) ,
pt ( 16% ) , ma ( 16% ) , and pe ( 7% ) ; a small amount of quercetin was also
found in the sample ( figure 2 ) .
blueberry fruits and
chemical structure of anthocyanins and anthocyanidins
found in blueberry / bilberry .
uplc profiles of unhydrolyzed and hydrolyzed extract of blueberry
in anthocyanins ( a ) and anthocyanidins ( b ) .
an , anthocyanins ; dp ,
delphinidin ; cy , cyanidin ; pt , petunidin ; pe , peonidin ; mv , malvidin ;
querc .
the rate of degradation
was slow initially , but nearly 60% was degraded in 5 h ( supporting information figure s1 ) .
the stability
was better in methanol , where there was only a slight decline and
80% of the compound was found intact .
interestingly , acidified methanol
provided complete stability to cyanidin , and no degradation or loss
was observed even after 5 h at room temperature .
hence , all of the
analyses from tissues were done by using methanol containing 0.1%
hcl .
the recovery of anthocyanins and anthocyanidins was variable depending
on the type of acid used .
formic acid and acetic acid did not provide
any recovery of anthocyanins / anthocyanidins from pbs , whereas trifluoroacetic
acid , phosphoric acid , and hydrochloric acid gave good recoveries .
when these three acids were tested for recovery of anthocyanins / anthocyanidins
from plasma , the recovery was in the following order : hydrochloric
acid > phosphoric acid > trifluoroacetic acid ( table 1 ) .
however , hydrochloric acid extraction also resulted
in
conversion of some anthocyanins to anthocyanidins .
nearly 5595%
of anthocyanins and 63100% of anthocyanidins were recovered
from plasma ( table 1 ) .
quantification of pe
and mv was skewed due to the lack of separation of these two peaks
in the uplc conditions used .
for measurement from biological matrices
from animal experiments , the hydrochloric acid treatment was extended
in a boiling water bath for 60 min to convert all anthocyanins to
anthocyanidins and then quantified by uplc - pda .
tfa , trifluoroacetic
acid . when
plasma was acidified with acetic acid or formic acid , below 2% amounts
were recovered . when acidified with hcl ,
due to interfering peak with pe - glucoside
and mv , their recoveries were skewed .
, we demonstrated the presence of anthocyanins in the
blueberry - fed rodent tissues following conversion to anthocyanidins .
sensitivity of detection of the individual reference anthocyanidins
was determined by lc - ms and uplc - pda and ranged from 0.25 ng to 2.5
pg and from 0.3 to 0.75 ng , respectively .
the detection limit for
pca , a metabolite of cy , was 0.2 ng .
cy was readily detected by uplc
( figure 3 ) in the samples extracted from mouse
lung with a limit of detection of 0.3 ng , whereas the other anthocyanidins
were undetectable due to higher detection limits .
a small peak was
detected at the retention time for dp ; however , it was not confirmed
by ms .
however , with lc - ms analysis by specific ion monitoring , pe ,
pt , and mv were readily detectable below 0.25 ng ; pe could
be detected in the picogram range .
no peak corresponding to anthocyanidins
was detected in the lung of control animals by uplc or lc - ms .
detection of
anthocyanidins at 520 nm ( b ) and 260 nm for protocatechuic
acid ( pca ) ( a ) , a bioactive metabolite of cyanidin in lung tissue
of rats given dietary blueberry ( 5% w / w ) for 10 days by uplc - pda .
chromatograms shown are composites : x , lung tissue from rats on control
diet ; y , lung tissue from rats on blueberry diet .
reference compounds :
z1 , peak 1 ( pca ) ; z2 , reference anthocyanidins .
peaks : 2 , dp ; 3 , cy ;
4 , pt ; 5 , pe ; 6 , mv .
several anthocyanidin peaks were
found in the samples extracted
from the lungs of mice fed blueberry diet by ltq - mrm ( low mass resolution ) .
to confirm the presence of anthocyanidins in lung samples , an mrm
with orbitrap ( high mass resolution )
ion chromatograms of standards from
orbitrap mrm are shown in figure 4 , with a m / z window
width of 0.06 that provides better selectivity .
dp and cy were not
detected in lung samples by orbitrap mrm , but other anthocyanidins
( pe , pt , and mv ) were detected by mrm ( figure 5 ) and further confirmed by ms / ms .
multiple reaction monitoring ( a ) and the
respective ms ( b ) and
ms / ms ( c ) of indicated reference anthocyanidins .
peonidin and malvidin
were eluted at the same retention time , and therefore they appear
in the same spectrum .
anthocyanidins were separated with a hypersil
gold c18 column ( 50 mm 2.1 mm ) in a binary gradient of 1% formic
acid and acetonitrile containing 1% formic acid as described under materials and methods .
mrm detection of peonidin ( a ) , petunidin ( b ) , and malvidin ( c )
from the lung tissue of rats provided a native mixture of anthocyanidins
isolated from bilberry by gavage ( a bolus dose of 10 mg / mouse ) or
by diet supplemented with blueberry ( 5% w / w ) for 10 days .
delphinidin
( d ) and cyanidin ( not shown ) could not be detected by lc - ms analysis .
several
studies in recent years have focused attention on anthocyanin
bioavailability both in humans and in experimental animals .
most of
these studies reported that anthocyanins were poorly absorbed and
were excreted unmetabolized .
few studies have also reported
that anthocyanins are bioavailable when delivered at very high doses ;
however , most of the bioavailability studies are focused on individual
anthocyanidins , particularly cy .
the plausible reasons for lack of anthocyanins detection
include ( i ) instability of anthocyanins , ( ii ) metabolism by gut microflora ,
( iii ) high rate of excretion , and ( iv ) unavailability of suitable
analytical techniques .
the aim of this work was to develop a method
to assess the stability of anthocyanins / anthocyanidins , their selective
extraction , and the impact on tissue bioavailability of anthocyanins .
there are several reports on the solubility and stability of anthocyanins
in acidic environment .
acidified methanol enhances the
stability of anthocyanidins compared to acetonitrile . in methanol ,
the degradation of anthocyanins was very slow , with > 80% of anthocyanins
remaining intact after 5 h , whereas after acidification no degradation
occurred .
these results are consistent with published data demonstrating
higher stability of anthocyanins in acidic ph .
several methods of anthocyanin extraction are available describing
varying recovery of anthocyanins from a biological matrix .
these methods involve solid phase extraction using water s
oasis hlb and sep - pak c18 cartridges .
we standardized the extraction
of anthocyanins from tissues of rats administered dietary blueberry
by converting them to anthocyanidins , which reduces the number of
compounds to five , and allowed us their detection due to their higher
amounts .
in complex matrices , where interference in peak separation
was observed , use of isoamyl alcohol significantly improved the selectivity
of anthocyanidins , albeit with a slight loss of recovery ( 67% ,
data not shown ) . in this study , first , we determined stability
and extractability
of anthocyanidins isolated from bilberry and then determined their
tissue bioavailability .
bilberry contains 15 anthocyanins containing
galactose , glucose , and arabinose derivatives of dp , cy , pt , pe , and
mv . these anthocyanins were converted to five anthocyanidins upon
acid hydrolysis .
glycones of the same anthocyanidins are also reported
in blueberry . in the present work
,
we initially failed to detect anthocyanins
in lung tissue from rats fed for 10 days with a 5% blueberry diet .
the dietary route provides a slow ingestion of the berry phytochemicals .
under these conditions ,
anthocyanins were also not detected in the
lung tissue following a bolus dose ( 10 mg / mouse ) by gavage .
on the
other hand , when the tissue anthocyanins were converted to their respective
aglycons by acid hydrolysis and selectively extracted in isoamyl alcohol ,
dp and cy were detected in the lung tissue , indicating that anthocyanins
can reach and exert their effects beyond the gi tract .
the possibility
of bioavailable proanthocyanins being converted to anthocyanidins
during acid hydrolysis can not be ruled out .
this presence of anthocyanins
in lung tissue could be explained by their ability to permeate the
gastrointestinal barrier .
these data
demonstrate that the conversion of anthocyanins to anthocyanidins
prior to analysis is an effective method for detecting anthocyanins
in tissues .
however , conversion of proanthocyanidins to anthocyanidins
in vivo could also enhance the levels on anthocyanidins in animal
tissue .
pca , which is produced by degradation of cy , was also detected in lung tissue , suggesting that lung
pca and anthocyanins along with some unknown metabolites are presumably
bioactives responsible for the known anticarcinogenic potential of
blueberry in the lung .
a series
of papers have shown the bioavailability of anthocyanins
in brain tissue , and a few other studies report
the presence of anthocyanins in other organs including the lung following
treatment of rodents with individual anthocyanin at high doses .
our study is the first demonstration
indicating the presence of anthocyanidins in lung tissue following
low - dose dietary blueberry .
the blueberry dose used in this study
is the same or just 2-fold higher as used in our previous study in
which it was found to inhibit estrogen - mediated mammary tumorigenesis .
the results from our other study also showed the efficacy of the
native mixture of anthocyanidins from bilberry against lung cancer
xenografts . in summary , we show
for the first time that anthocyanins are bioavailable
in the lung following a low dose of dietary blueberry powder .
the
detection has been possible by conversion of anthocyanins to their
native anthocyanidins , followed by extraction in isoamyl alcohol .
this technique can be utilized to demonstrate bioavailability of anthocyanins
in different tissues and correlate their levels with disease inhibition . | dietary
polyphenols may contribute to the prevention of several
degenerative diseases , including cancer .
anthocyanins have been shown
to possess potential anticancer activity .
the aim of this study was
to determine anthocyanin bioavailability in lung tissue of mice fed
a blueberry diet ( 5% w / w ) for 10 days or a bolus dose ( 10 mg / mouse ;
po ) of a native mixture of bilberry anthocyanidins .
all five anthocyanidins
present in the blueberry were detected in the lung tissue using improved
methods .
the effect of various solvents on the stability of anthocyanins
and their recovery from the biomatrix was analyzed .
detection of anthocyanins
and their metabolites was performed by uplc and lc - ms .
although anthocyanins
were not detected , cyanidin was detected by uplc - pda and other anthocyanidins
were detected by lc - ms , following conversion to anthocyanidins and
selective extraction in isoamyl alcohol .
the results show that anthocyanins
can be detected in lung tissue of blueberry - fed mice and thus are
bioavailable beyond the gastrointestinal tract . | Introduction
Materials
and Methods
Results
Discussion |
microcystis aeruginosa is a freshwater cyanobacteria , known producer of a family of toxins termed microcystins ( mcs ) [ 1 , 2 ] .
mcs are hepatotoxic cyclic heptapeptides released into water during or on senescence of cyanobacterial blooms .
the peptide rings of mcs contain five nonprotein amino acids , whereas the two - protein amino acids distinguish mcs from one another .
mc - lr is one of the most commonly occurring [ 2 , 4 ] and the most toxic microcystin .
the intact cells as well as the toxins released after cellular lysis can be responsible for the toxic effects observed in many organisms , from microalgae to mammals including human [ 810 ] .
exposure to toxic cyanobacteria or administration of mcs may cause hepatotoxic effects [ 1113 ] , oxidative stress , kidney damage [ 15 , 16 ] , growth inhibition [ 17 , 18 ] , reproductive injury , haematological and biochemical alterations [ 2022 ] , apoptosis , and even fish death .
alterations in normal behavioral patterns may be the first line of defense when an animal is exposed to an environmental perturbation [ 2528 ] .
the effects of mc on fish behavior are still unknown , but some issues have already been addressed .
[ 34 , 35 ] reported changes in the spontaneous locomotor behavior of zebrafish ( danio rerio ) and leucaspius delineatus after mc - lr exposure , and cazenave et al
. showed changes in swimming activity of jenynsia multidentata fed with microcystin - rr ( mc - rr ) .
in addition , studies using different exposure routes ( intraperitoneal injection , oral ingestion , or immersion ) have demonstrated that mcs can accumulate in fish tissues , mainly in the liver [ 21 , 3639 ] , intestine [ 37 , 3941 ] , gills [ 42 , 43 ] , kidney [ 37 , 39 ] , muscle [ 40 , 41 , 4446 ] , gallbladder , blood [ 40 , 41 , 48 ] , and brain .
altogether , these findings indicate possible neurotoxic effects of mcs on fish , causing serious risks to the success of fish populations and changes in biodiversity , among other ecological consequences . the zebrafish is rapidly becoming a popular model species in many areas of biological research .
its application includes the fields of developmental biology , toxicology , neurophysiology , biomedicine , drug discovery , human diseases [ 5254 ] , pharmacology and behavioral analysis [ 5559 ] .
these fish exhibit robust behavioral responses , well - characterized genome , neural and endocrine systems homologous to humans [ 6062 ] , and possess all of the classical vertebrate neurotransmitters [ 63 , 64 ] .
additionally , zebrafish are an ideal animal model for laboratory research because they are inexpensive , require low maintenance , and produce abundant offspring .
recently , this fish was also used for proteomic studies on the toxicity of mcs [ 66 , 67 ] . in order to better understand the neurotoxic effects of mcs on fish and to improve the knowledge of mechanisms underlying the toxicity , the main goal of this study was to assess the effects of mc - lr on zebrafish behavioral parameters and endocrine ( whole - body cortisol ) response after toxin exposure .
wild - type adult ( < 8 months old ) zebrafish ( danio rerio ) of both sexes were obtained from specialized supplier ( redfish agroloja , rs , brazil ) .
animals were kept in 50 l housing tanks with tap water previously treated with tetra 's aquasafe ( to neutralize chlorine , chloramines , and heavy metals present in the water that could be harmful to fish ) and continuously aerated ( 7.20 mg o2/l ) at 26 2c , under a 1410 h light / dark photoperiod in a density of up to five animals per liter .
the procedures were previously approved by the animal ethics committee of pontifical catholic university of rio grande do sul ( pucrs ) under the protocol number 10/00142-ceua .
the amount of mc - lr in the cell culture of m. aeroginosa ( strain rst9501 ) was detected by a quantitative antibody immunoassay ( elisa ) against mc - lr provided by envirologix ( portland , usa ) , within a range of detection from 0.05 to 2.5 g / l mcs .
a suitable dilution was applied to the culture sample to provide detection within the range .
zebrafish were distributed in three groups : the first group ( controls ) was exposed to water containing the culture medium of m. aeroginosa for 24 hours ; the second and third groups were exposed to cell culture in a final mc - lr concentration of 50 g / l and 100 g /
immediately after the exposure , animals were tested in tank - diving behavioral test and social interaction .
the mc - lr concentrations and the time of exposure were chosen based on a previous study using j. multidentata .
besides , such concentrations are commonly encountered in cyanobacterial bloom events [ 68 , 69 ] .
behavioral testing took place during the light phase between 10:00 am and 4:00 pm the animals were individually transferred to a 2.7 l tank ( 24 cm l 8 cm w 20 cm h ) with laterals and bottom white covered to avoid any visual disturbances and habituated to the tank for 30 s , as previously described .
the locomotor activity of the animals was video - recorded using logitech quickcam pro9000 for five minutes after the habituation period and further analyzed using the any - maze recording software ( stoelting co. , wood dale , il , usa ) .
the tank was divided into equal sections with four vertical lines and one horizontal line , and the following behavior patterns were measured : distance traveled ( meters ) , immobility time ( seconds ) , number of crossings , absolute turn angle , path efficiency , and time ( seconds ) spent in the bottom portion .
this task exploits the natural tendency for zebrafish to spend most of the time at the bottom when introduced into a novel environment and then gradually extend the swimming range , over a period of minutes , to include the upper portions of the test tank .
zebrafish is a schooling fish that may exhibit preference for its conspecifics under certain circumstances .
after 24 hours of exposition to 50 or 100 g / l of mc - lr , fish were placed in groups of five in a small experimental tank ( 30 cm l 15 cm h 10 cm w ) .
on one side of the experimental tank , an empty fish tank was placed , and , on the other side , there was a tank of identical size containing 15 conspecifics .
the experimental fish were allowed to acclimate to the experimental tank for a 30 s period , after which their behavior was analyzed .
the time that all five experimental fish spent on the side of the tank closer to the conspecific school was measured using a stopwatch .
this experiment consisted in keeping each animal enclosed into microcentrifuge plastic tubes of 2 ml with the cap closed and small openings in both ends to allow free water circulation inside the tube and completely avoid fish locomotion . after 90 min of confinement , animals were gently captured and immediately frozen in liquid nitrogen and stored at 80c until cortisol extraction .
aeration ( 8 ppm , labcom test cambori , sc , brazil ) and water temperature ( 26 2c ) were controlled throughout the test .
the extraction and measurement of whole - body cortisol from zebrafish have been described in detail by barcellos et al . .
briefly , zebrafish were distributed in four groups : the first group , which consisted of zebrafish exposed to water containing the culture medium of m. aeroginosa for 24 hours , was considered the negative control ; the second and third groups were exposed to cell culture in a final mc - lr concentration of 50 g / l and 100 g / l during 24 hours , respectively ; in the fourth group , considered the positive control , zebrafish were submitted to the ars protocol .
after , zebrafish were captured and immediately frozen in liquid nitrogen and stored at 80c until whole - body cortisol extraction .
each zebrafish was weighed , and a pool of three fish was minced and placed into a disposable stomacher bag with 2 ml of phosphate buffered saline ( pbs , ph 7.4 ) for 6 min .
the contents were transferred to a 10 ml screw top disposable test tube , and 5 ml of laboratory grade ethyl ether was added .
the tube was vortexed for 1 min and centrifuged for 10 min at 3000 rpm .
the tube was then immediately frozen at liquid nitrogen , and the unfrozen portion ( ethyl ether containing cortisol ) was decanted .
the ethyl ether was transferred to a new tube and completely evaporated under a gentle stream of nitrogen for 2 h , yielding a lipid extract containing the cortisol .
the extract was stored at 20c until the elisa was conducted on the samples suspended with 1 ml of pbs buffer . in order to prevent a possible stress response induced by manipulation ,
the time elapsed between capture and killing was less than 10 s. whole - body cortisol was measured in duplicate samples of tissue extract with a commercially available high sensitivity salivary cortisol - enzyme immunoassay kit ( salimetrics , usa ) .
the specificity of the test was evaluated by comparing the parallelism between the standard curve and serial dilutions of the tissue extracts in pbs ( ph 7.4 ) .
the standard curve constructed with the human standards ran parallel to that obtained using serial dilutions of zebrafish tissue extracts . in the linear regression test , high positive correlation ( r = 0.9818 ) was found between the curves .
data of the exploratory assessment , social interaction , and cortisol levels were expressed as mean sem and analyzed by one - way anova , followed by newman - keuls post hoc test .
distinct parameters of zebrafish swimming activity were evaluated in the 5-min tank - diving behavioral test .
mc - lr exposure at 100 g / l significantly ( one - way anova / newman - keuls , p < 0.0081 , n = 10 ) decreased the distance traveled ( 3.7 0.6 meters ) in relation to control animals ( 10.3 1.7 meters ) ( figure 1(a ) ) and significantly ( one - way anova / newman - keuls , p < 0.039 , n = 10 ) increased the immobility time ( 137.6 27.6 seconds ) when compared to the control group ( 41.5 17.3 seconds ) ( figure 1(b ) ) whereas mc - lr exposure at 50 g / l did not alter both parameters .
no differences in the number of line crossings , absolute turn angle , and path efficiency were observed in both concentrations tested ( figure 1(c ) , 1d and 1e , resp . ) .
control animals spent 58.4% of time ( 175.0 28.6 ) in the bottom portion of the test tank .
animals exposed to 50 and 100 g / l mc - lr significantly ( one - way anova / newman - keuls , p < 0.0003 , n = 10 ) increased ( 93% ) the time spent in the bottom portion of the test tank ( 282.1 7.90 and 282.7 9.7 , resp . ) when compared with control group ( 175.0 28.6 ) ( figure 1(f ) ) . in relation to social interaction test , the results showed that 50 and 100 g / l of mc - lr concentrations did not promote any alteration in the animals regarding this behavior ( figure 2 ) .
levels of whole - body cortisol also were measured . the ars protocol ( positive control )
resulted in enhanced whole - body cortisol in relation to control group ( one - way anova / newman - keuls , p < 0.005 , n = 7 ; 10.7 1.4 and 6.7 0.7 , resp . ) .
zebrafish treated with both concentrations of mc - lr did not present altered levels of cortisol in relation to control group ( figure 3 ) .
behavioral alterations reflect how an animal senses and responds to its environment and is the first line of defense when an animal is exposed to an environmental perturbation . since it was already demonstrated that the effects promoted by cyanobacterial crude extracts on aquatic organisms were either more pronounced or different from those observed using pure toxins [ 75 , 76 ] , we used cell culture of the microcystin - producing cyanobacterium m. aeruginosa ( mc - lr ) in order to evaluate the effects of mcs on zebrafish behavior .
the toxin concentration and time period of animals ' exposure were chosen based on previous studies that showed mcs accumulation in fish tissues [ 21 , 3748 ] .
the results presented herein demonstrated that 100 g / l mc - lr decreased the distance traveled and increased the immobility time .
however , no significant alterations were found in the number of line crossings with both concentrations . when animals were exposed to 50 and 100
g / l , mc - lr led to a significant increase in the time spent in the bottom portion .
the results also showed that none of the mc - lr concentrations tested promoted significant alterations in the absolute turn angle , path efficiency , or social interaction . since behavior links physiological function with ecological processes for a given species
the potential of the zebrafish as a model in neurobehavioral research has emerged only recently .
studies have examined behavior in zebrafish larvae [ 7881 ] , as well as their responses to different drugs , such as ethanol [ 82 , 83 ] and fluoxetine .
studies on adult zebrafish include social behavior [ 8587 ] , olfactory - related behaviors [ 88 , 89 ] , anxiety , addiction [ 9092 ] , sleep , learning and memory [ 94 , 95 ] .
verified that exposure to mc - lr caused dose - effect - related changes in spontaneous locomotor activity in zebrafish . whereas exposure to lower concentrations ( 0.5 and 5 g / l ) caused an increase in daytime mobility , elevated exposures ( 15 and 50 g / l ) led to significantly increased immobility
the highest exposure ( 50 g / l ) also reduced the spawning activity and reduced spawning success .
in contrast to daytime activities , night - time swimming activity was significantly greater at the higher mc - lr exposures . in another study ,
baganz et al . showed changes in the spontaneous locomotor behavior of zebrafish and l. delineatus after exposure to mc - lr in concentrations of 0.5 , 5 , and 15 g / l for 17 days and 50 g / l for six days . during the daytime ,
the mobility of zebrafish as well as l. delineatus increased significantly by exposure to the lowest concentrations , whereas higher concentrations led to significantly decreased mobility . influenced by mc - lr
, the swimming time of l. delineatus reversed , going from a prominently diurnal activity to a nocturnal one ; zebrafish remained active during the daytime .
additionally , cazenave et al . reported changes in the swimming activity of j. multidentata fed with contaminated food pellets containing mc - rr .
low levels ( 0.01 g / g ) increased the swimming activity , while the highest dose ( 1 g / g ) used produced significant changes with respect to control group ( only since approximately 20 hours of exposure ) , when the swimming activity was decreased . in this sense , our findings demonstrate that mc - lr at the highest concentration ( 100 g / l ) caused a decrease in the distance traveled and an increase in the immobility time in zebrafish .
interestingly , no significant alterations in the number of line crossings were found at the same mc - lr concentration and time of exposure , despite the tendency to decrease the number of crossings in greater concentration .
it is important to emphasize that these findings are similar to the results published previously by baganz et al . .
however , these authors have used purified toxin whereas a cell culture of the microcystin - producing cyanobacterium m. aeruginosa ( mc - lr ) was used in our experiments . reduction in swimming capability , resulting in a reduction in the rate of activity , may decrease the ability to gather food and make the fish more vulnerable to predation . under natural conditions , this reduced overall level of activity will eventually cause disadvantages to the organisms in the ecosystem , and , therefore , influence the biocoenotic structures and functions .
exposure to a novel environment evokes a robust anxiety response in zebrafish , as they dive to the bottom ( geotaxis ) until they feel safe to swim in the upper regions of the tank .
here , mc - lr at 50 and 100 g / l promoted an increase in the time spent in the bottom portion , suggesting an anxiety behavior .
shoaling behavior commences soon after hatching and fish reared in isolation quickly form shoals when placed together .
one study has demonstrated that exposure to nonylphenol over a 5-day period decreased shoaling tendency in juvenile rainbow trout ( oncorhynchus mykiss ) .
locomotor activity , aggressive behavior , and group preference of the male zebrafish and group preference of the females were clearly inhibited when zebrafish were exposed for 60 days to 100 g / l nonylphenol concentration .
for this reason , we evaluated the effect of mc - lr exposure on zebrafish social interaction .
however , no significant alteration was found between control and mc - lr - exposed animals .
an elevated plasma cortisol level is a primary indicator of a stress response in fish .
zebrafish , like humans , employ cortisol as a primary stress response hormone . considering this , we measured whole - body cortisol in zebrafish to verify if mc could elicit a stress response in treated fish .
however , no significant alterations were found in whole - body cortisol levels in animals exposed to both concentrations of mc - lr compared to the control group .
barcellos et al . demonstrated that whole - body cortisol level of zebrafish increases after visual contact with a predator species .
cortisol levels were significantly higher in zebrafish submitted to unpredictable chronic stress ( ucs ) protocol when compared to control group . bury et al .
reported a significant increase in plasma cortisol levels of the brown trout ( salmo trutta ) after 1 h and returned to the control level after 24 h of exposure to lysed toxic microcystis aeruginosa cells .
crucian carp ( carassius auratus ) exposed to sublethal and lethal doses ( 150 g / kg and 600 g / kg , resp . ) of microcystis extracts exhibited a significant acute increase in plasma cortisol levels , which suggested that mc elicited a stress response in treated fish .
the profiles of cortisol changes in fish treated with mc appeared to be dose dependent , indicating that fish in the high - dose group experienced greater mc - induced disturbance . in summary , behavioral response of fish may be a promising biomarker of sublethal toxicity and water contamination .
several behavioral endpoint measurements , especially locomotor activity and the time spent in the bottom portion , may provide an effective assessment of mcs in aquatic ecosystem . | microcystins ( mcs ) are toxins produced by cyanobacteria ( blue - green algae ) , primarily microcystis aeruginosa , forming water blooms worldwide . when an organism is exposed to environmental perturbations ,
alterations in normal behavioral patterns occur .
behavioral repertoire represents the consequence of a diversity of physiological and biochemical alterations . in this study , we assessed behavioral patterns and whole - body cortisol levels of adult zebrafish ( danio rerio ) exposed to cell culture of the microcystin - producing cyanobacterium m. aeruginosa ( mc - lr , strain rst9501 ) .
mc - lr exposure ( 100 g / l ) decreased by 63% the distance traveled and increased threefold the immobility time when compared to the control group .
interestingly , no significant alterations in the number of line crossings were found at the same mc - lr concentration and time of exposure . when animals were exposed to 50 and 100 g / l , mc - lr promoted a significant increase ( around 93% ) in the time spent in the bottom portion of the tank , suggesting an anxiogenic effect .
the results also showed that none of the mc - lr concentrations tested promoted significant alterations in absolute turn angle , path efficiency , social behavior , or whole - body cortisol level .
these findings indicate that behavior is susceptible to mc - lr exposure and provide evidence for a better understanding of the ecological consequences of toxic algal blooms . | 1. Introduction
2. Materials and Methods
3. Results
4. Discussion |
the online version of this article ( doi:10.1007/s00134 - 010 - 1979 - 1 ) contains supplementary material , which is available to authorized users .
health - related quality of life ( hrqol ) is an important patient - reported outcome after critical illness . in the intensive care context , several generic profile instruments , such as the sf-36 ,
the sickness impact profile , and the nottingham health profile , have been used . also , the eq-5d , a generic utility instrument enabling the calculation of quality - adjusted life years ( qalys ) and allowing the comparison of the cost - utility of interventions across different medical specialities , has been used [ 48 ] . although no hrqol instrument can claim to be the gold standard , the 2002 brussels roundtable consensus meeting recommended the sf-36 and eq-5d as the preferred hrqol instruments in the critical care setting , but at the same time encouraged further methodological research and instrument design .
there is still an evident lack of comparisons between utility instruments in the critical care setting .
the rand-36 ( sf-36 ) and the eq-5d have been compared , and the former turned out to have slightly more discriminatory power . however , the eq-5d is currently the most widely used utility instrument worldwide for the calculation of qalys .
thus , it seemed appropriate to choose it in this study as the comparator to the 15d , which is the most frequently used utility instrument in finland , although a possibility to generate a utility score ( sf-6d ) also from the sf-36 data has been introduced .
the 15d and eq-5d have previously been compared in a number of other populations and patient groups [ 1315 ] , but not in critical care .
the data were collected prospectively in the helsinki university hospital between 1 january 2003 and 31 december 2004 .
the study population consisted of 3,600 patients treated in two intensive care ( icu ) and three high - dependency units ( hdu ) .
the eq-5d and 15d were mailed to patients alive and with a known address 6 and 12 months after admission to the icu or hdu together with an accompanying letter and an informed consent form .
the patients were asked to return the questionnaires and the consent in a prepaid envelope . in case of non - response , one reminder was sent .
the eq-5d consists of five dimensions : mobility , self - care , usual activities , pain or discomfort , and anxiety or depression .
each dimension is divided into three levels : no problems , some problems and severe problems . instead of the finnish vas - based valuation algorithm used in some earlier finnish critical care studies [ 5 , 16 ]
tariff , which is the most commonly used valuation system for the eq-5d . according to it
the utility scores range from 0.59 to 1 , where 1 means full health and 0 stands for death .
no health state can obtain a score between 0.88 and 0.99 , and negative scores indicate health states worse than death .
the minimal clinically important difference ( mid ) for the eq-5d tto is about 0.08 .
the 15d consists of 15 dimensions : breathing , mental function , speech , vision , mobility , usual activity , vitality , hearing , eating , elimination , sleeping , distress , discomfort and symptoms , depression and sexual activity .
the utility scores of the 15d range from 0 to 1 , with 1 being equivalent to full health and 0 to death .
the mean and median scores of the two instruments at 6 months were calculated .
the visual inspection of the distribution of the eq-5d scores suggested that the use of classical parametric tests to compare the two sets of scores may not be appropriate .
therefore , the wilcoxon signed - rank test was used to test the difference in medians and distributions .
the spearman rank correlation coefficient was used to measure the association and a bland - altman plot to describe the agreement between the sets at 6 months .
the discriminatory power of the instruments was explored by comparing the proportion of patients obtaining the ceiling score of 1 ( ceiling effect ) . to analyse the agreement in the direction of change of the hrqol scores between 6 and 12 months ,
the changes were classified according to mid as negative , if the change was 0.08 and 0.03 , and positive , if the change was 0.08 and 0.03 for the eq-5d and 15d , respectively .
the mcnemar - bowker test was used to test whether the instruments give a similar picture of the changes ( the matrix is symmetric ) and cohen s kappa to test the agreement between the instruments .
the data were collected prospectively in the helsinki university hospital between 1 january 2003 and 31 december 2004 .
the study population consisted of 3,600 patients treated in two intensive care ( icu ) and three high - dependency units ( hdu ) .
the eq-5d and 15d were mailed to patients alive and with a known address 6 and 12 months after admission to the icu or hdu together with an accompanying letter and an informed consent form .
the patients were asked to return the questionnaires and the consent in a prepaid envelope . in case of non - response , one reminder was sent .
the eq-5d consists of five dimensions : mobility , self - care , usual activities , pain or discomfort , and anxiety or depression .
each dimension is divided into three levels : no problems , some problems and severe problems . instead of the finnish vas - based valuation algorithm used in some earlier finnish critical care studies [ 5 , 16 ]
tariff , which is the most commonly used valuation system for the eq-5d . according to it
the utility scores range from 0.59 to 1 , where 1 means full health and 0 stands for death .
no health state can obtain a score between 0.88 and 0.99 , and negative scores indicate health states worse than death .
the minimal clinically important difference ( mid ) for the eq-5d tto is about 0.08 .
the 15d consists of 15 dimensions : breathing , mental function , speech , vision , mobility , usual activity , vitality , hearing , eating , elimination , sleeping , distress , discomfort and symptoms , depression and sexual activity .
the utility scores of the 15d range from 0 to 1 , with 1 being equivalent to full health and 0 to death .
the mean and median scores of the two instruments at 6 months were calculated .
the visual inspection of the distribution of the eq-5d scores suggested that the use of classical parametric tests to compare the two sets of scores may not be appropriate .
therefore , the wilcoxon signed - rank test was used to test the difference in medians and distributions .
the spearman rank correlation coefficient was used to measure the association and a bland - altman plot to describe the agreement between the sets at 6 months .
the discriminatory power of the instruments was explored by comparing the proportion of patients obtaining the ceiling score of 1 ( ceiling effect ) . to analyse the agreement in the direction of change of the hrqol scores between 6 and 12 months ,
the changes were classified according to mid as negative , if the change was 0.08 and 0.03 , and positive , if the change was 0.08 and 0.03 for the eq-5d and 15d , respectively .
the mcnemar - bowker test was used to test whether the instruments give a similar picture of the changes ( the matrix is symmetric ) and cohen s kappa to test the agreement between the instruments .
both the 6- and 12-month questionnaires were returned by 998 patients ( 38% of the 2,600 patients alive ) .
however , 69 of the eq-5d questionnaires were not filled in completely , leaving 929 patients for final analysis . of them ,
31% had been treated in an icu and 69% in a hdu . for characteristics of the study population ,
the distributions of the eq-5d and 15d scores at 6 months are presented in fig . 1 .
the distribution of the eq-5d scores was wide , three - peaked and discontinuous , whereas that of the 15d was one - peaked and continuous .
the mean ( median ) utilities at 6 months were 0.832 ( 0.859 ) and 0.731 ( 0.760 ) for the 15d and eq-5d , respectively .
the medians and distributions were different ( p < 0.001 ) and the agreement between the sets poor ( bland - altman plot in electronic material ) .
the eq-5d detected fewer health states than the 15d ( at 6 months 79 vs. 767 , at 12 months 70 vs. 745 ) . using the eq-5d
, 26% of patients had a ceiling score of 1 compared to 6% for the 15d .
regarding the clinically important change in the hrqol scores between 6 and 12 months , the instruments had the same direction of change in 53% of the patients .
overall , the instruments gave a different picture of the changes ( bowker 53.9 , p < 0.001 ) , and the agreement between them was only fair ( kappa 0.24 , 95% ci 0.19 , 0.29 ; ( table 1).fig .
1the distributions of the eq-5d and 15d scores at 6 monthstable 1the direction of the minimal clinically important change ( mid ) in the hrqol scores between 6 and 12 monthschange greater than the mid ( 0.08 ) in the eq-5d scoretotalnegative ( % ) unchanged ( % ) positive ( % ) change greater than the mid ( 0.03 ) in the 15d scorenegative ( % ) 10.111.82.824.7unchanged ( % ) 6.432.47.246.0positive ( % ) 1.616.810.929.3total ( % ) 18.161.020.9100.0 the distributions of the eq-5d and 15d scores at 6 months the direction of the minimal clinically important change ( mid ) in the hrqol scores between 6 and 12 months
patient - reported outcomes such as hrqol have gained increased importance as measures of effectiveness of health care . of the hrqol instruments used in the assessment of critical care ,
these include the eq-5d and 15d , which we compared in this large cohort study .
regardless of the statistical test used , the agreement between the instruments was only moderate .
the main reason for this may be the wide , three - peaked and discontinuous distribution of the tto - based eq-5d scores with a high ceiling effect . because of these features of the eq-5d scores , classical methodology used for comparisons and evaluation of agreement between scores may not be applicable .
the existence of negative utilities implies that hrqol could be improved by dying , which is not logically congruent with the objectives of care , although from an ethical and economic point of view , a permanent non - independent health state may be worse than death .
the distribution of the 15d scores ( all positive values ) was one - peaked and continuous and , importantly , only 6% of the patients evaluated their health state as perfect at 6 months after critical illness , indicating better discriminatory power of the 15d in minor health problems .
the eq-5d detected fewer health states and clinically important changes in hrqol than the 15d .
in this light , the 15d appeared more sensitive than the eq-5d in terms of discriminatory power and responsiveness to clinically important change , although in the absence of a gold standard , it is not possible to say which instrument is right . in these respects our results agree with those obtained previously in a number of populations and patient groups [ 1315 ] .
in addition , the patient population was large ( despite of the response rate of 38% ) .
in general , the lack of baseline hrqol scores may be seen as a limitation , but in the comparison of two instruments , as in our study , does not pose a problem .
icu and hdu patients were analysed together , but as only 34% of the sample belonged to the icu subset , our results do not necessarily reveal how the instruments may work in comparison when applied exclusively to icu patients .
in addition , the patient population was large ( despite of the response rate of 38% ) .
in general , the lack of baseline hrqol scores may be seen as a limitation , but in the comparison of two instruments , as in our study , does not pose a problem .
icu and hdu patients were analysed together , but as only 34% of the sample belonged to the icu subset , our results do not necessarily reveal how the instruments may work in comparison when applied exclusively to icu patients .
in conclusion , the 15d may be more sensitive than the eq-5d in terms of discriminatory power and responsiveness to clinically important change .
as utilities differ depending on the hrqol instrument used , the results of the cost - utility studies in the critically ill are difficult to compare . in the future ,
large cohort studies are warranted to produce sufficient comparative evidence regarding utility measures , including the sf-6d and the 15d , before the gold standard for utility measurement may be announced .
below is the link to the electronic supplementary material .
supplementary material 1 ( doc 74 kb ) supplementary material 2 ( doc 43 kb ) | purposereliable measures are required for proper cost utility analysis after critical care .
no gold standard is available , but the eq-5d health - related quality of life instrument ( hrqol ) has been proposed .
our aim was to compare the eq-5d with another utility measure , the 15d , after critical illness.methodsa total of 929 patients filled in both the eq-5d and 15d hrqol instruments 6 and 12 months after treatment at an intensive care or high - dependency unit .
the difference in the medians and distributions of the scores of the instruments was tested with wilcoxon signed - rank test and their association with spearman rank correlation .
discriminatory power was compared by the ceiling effect and agreement between the instruments regarding the direction of the minimal clinically important change in the hrqol scores between 6 and 12 months was tested with the mcnemar - bowker test and cohen s kappa.resultsthe utility scores produced by the instruments and their distributions were different .
agreement between the instruments was only moderate .
the 15d appeared more sensitive than the eq-5d both in terms of discriminatory power and responsiveness to clinically important change.conclusionthe agreement between the two utility measures was only moderate .
the choice of the instrument may have a substantial effect on cost - utility results .
our results suggest that the 15d performs well after critical illness , but further large cohort studies comparing different utility instruments in this patient population are warranted before the gold standard for utility measurement can be announced.electronic supplementary materialthe online version of this article ( doi:10.1007/s00134 - 010 - 1979 - 1 ) contains supplementary material , which is available to authorized users . | Electronic supplementary material
Introduction
Materials and methods
Patients
HRQoL instruments
Statistical analysis
Results
Discussion
Strengths and limitations
Conclusion
Electronic supplementary material |
free air in the spinal canal has been presented in a number of situations , but it is rare for patients to develop symptomatic epidural gas ( eg ) after spinal surgery .
only 3 cases of eg , after surgery on the lumbar spine followed by the operative procedure , have been reported in the literature2,8,17 ) , but pathogenetic mechanism is still unclear so far .
the aim of this report is to alert the neurosurgeons to this potential complication , demonstrate the radiological imaging findings , especially the combined use of computed tomography ( ct ) and magnetic resonance imaging ( mri ) , in symptomatic spinal eg , following an open discectomy , and to reconsider the pathogenetic mechanism of postoperative eg in association with the vacuum phenomenon . to the best of our knowledge ,
this is the first case of postoperative symptomatic eg , which occurred in the distant two levels , simultaneously , after lumbar microdiscectomy .
a 68-year - old woman was presented with lower back pain and radiating pain to the anterior aspect of her left thigh and calf .
ct scan showed stenosis in l3 - 4 , herniated disc and vacuum within the disk space in l2 - 3 and l5-s1 where scattered gas was also observed in the extruded disc of both levels ( fig .
mr examination confirmed the disk herniation and also exhibited the signal void areas consistent with the gas in l2 - 3 , l5-s1 levels , but not in l3 - 4 level ( fig .
she underwent a partial hemilaminectomy , foraminotomy at l2 - 3 , l3 - 4 , l5-s1 three levels , and discectomy at only l2 - 3 and l5-s1 two levels .
her symptoms resolved during the postoperative period , but she returned to the hospital 2 weeks after discharge , with complaints of recurrent preoperative symptom .
she was re - evaluated clinically and with imaging studies , including radiography , ct , and mr imaging .
however , contrary to the previous symptoms , the patient complained of the aggravation of symptoms with weight - bearing .
radiographs showed the narrowing of the l2 - 3 and l5-s1 disk space , vacuum phenomenon and post - laminectomy defect .
mr image showed epidural , signal void , space - occupying , cyst - like lesions in l2 - 3 and l5-s1 level , which suggested air or calcified disk fragment .
a subsequent non - contrast ct of the lumbar spine confirmed well - defined , ovoid air - attenuation in the epidural space in l2 - 3 and l5-s1 level ( fig .
the gas was compressing the dural sac and right l3 and left s1 nerve root .
the patient received conservative treatment , including absolute bed rest ( abr ) , steroid , nonsteroidal anti - inflammatory drug medication for 2 weeks , but her neurologic condition did not improve .
needle aspiration was performed in l2 - 3 and l5-s1 level under the fluroscopic guidance .
temporary relief of pain was achieved for 2 days , but she complained of recurrence of the symptoms .
ct scan , which was taken 1 week after the aspiration of gas , revealed the amount of epidural gas was increased again in both levels ( fig .
no herniated disk was found and gas pocket surrounded by a thin , blister like membranous structure was observed at the inferolateral portion of roots in l2 - 3 , and l5-s1 levels ( fig .
total removal of cystic structure and curettage of remnant soft tissue , as well as further discectomy in disc space were done .
surgical field , including intradiscal space was irrigated with isotonic saline at the last stage of the operation .
the postoperative period was uneventful and the patient 's previous symptom disappeared completely . immediate postoperative ct revealed disappearance of gas in epidural space ( fig .
follow - up lumbar ct taken after 1 year from the last operation showed no epidural gas ( fig .
the patient remained symptom - free for 1 and a half year follow - up period .
a 68-year - old woman was presented with lower back pain and radiating pain to the anterior aspect of her left thigh and calf .
ct scan showed stenosis in l3 - 4 , herniated disc and vacuum within the disk space in l2 - 3 and l5-s1 where scattered gas was also observed in the extruded disc of both levels ( fig .
mr examination confirmed the disk herniation and also exhibited the signal void areas consistent with the gas in l2 - 3 , l5-s1 levels , but not in l3 - 4 level ( fig .
she underwent a partial hemilaminectomy , foraminotomy at l2 - 3 , l3 - 4 , l5-s1 three levels , and discectomy at only l2 - 3 and l5-s1 two levels .
her symptoms resolved during the postoperative period , but she returned to the hospital 2 weeks after discharge , with complaints of recurrent preoperative symptom .
she was re - evaluated clinically and with imaging studies , including radiography , ct , and mr imaging .
however , contrary to the previous symptoms , the patient complained of the aggravation of symptoms with weight - bearing .
radiographs showed the narrowing of the l2 - 3 and l5-s1 disk space , vacuum phenomenon and post - laminectomy defect .
mr image showed epidural , signal void , space - occupying , cyst - like lesions in l2 - 3 and l5-s1 level , which suggested air or calcified disk fragment .
a subsequent non - contrast ct of the lumbar spine confirmed well - defined , ovoid air - attenuation in the epidural space in l2 - 3 and l5-s1 level ( fig .
. the gas was compressing the dural sac and right l3 and left s1 nerve root .
the patient received conservative treatment , including absolute bed rest ( abr ) , steroid , nonsteroidal anti - inflammatory drug medication for 2 weeks , but her neurologic condition did not improve .
needle aspiration was performed in l2 - 3 and l5-s1 level under the fluroscopic guidance .
temporary relief of pain was achieved for 2 days , but she complained of recurrence of the symptoms .
ct scan , which was taken 1 week after the aspiration of gas , revealed the amount of epidural gas was increased again in both levels ( fig .
during the surgery , no herniated disk was found and gas pocket surrounded by a thin , blister like membranous structure was observed at the inferolateral portion of roots in l2 - 3 , and l5-s1 levels ( fig .
total removal of cystic structure and curettage of remnant soft tissue , as well as further discectomy in disc space were done .
surgical field , including intradiscal space was irrigated with isotonic saline at the last stage of the operation .
the postoperative period was uneventful and the patient 's previous symptom disappeared completely . immediate postoperative ct revealed disappearance of gas in epidural space ( fig .
follow - up lumbar ct taken after 1 year from the last operation showed no epidural gas ( fig .
the patient remained symptom - free for 1 and a half year follow - up period .
free air in the spinal canal has been reported in a number of situations , including craniocervical trauma , epidural anesthesia , and percutaneous spinal procedure . other local structures and processes , such as inter - apophyseal joints , thoracic surgery , pneumothorax ,
penetrating chest wounds , intestinal necrosis , pyogenic infections produced by gas - forming organisms and osteonecrosis , are another potential source of gas in the spinal canal3,6,7,8,12 ) . in most cases , the gas formation in the spinal canal is associated with disc herniation12,13 ) , but isolated so - called pseudocyst have also been reported4,12,13 ) .
postoperative eg formation causing a severe radicular pain , however , is very unusual . as mentioned , the current literature documents 7 cases of symptomatic eg after lumbar microdiscectomy .
three of these patients have undergone a revision surgery for the removal of gas ( table 1)1,2,8,17 ) .
sasani et al.17 ) suspected that , in cases of postoperative symptomatic eg , air becomes trapped during the surgical procedure within the soft tissue when blood in the surgical field causes soft tissue margins to bind .
they thought that this " closure " eventually leads to the formation of a membrane that encases the gas collection .
but , in the current case , postoperative mri taken just 1 day after the primary operation did n't show any significant sign of air bubble in the spinal canal . by this radiological finding , it can be assumed that postoperative intraspinal air was originated from the spinal structure itself , not by air trapping during the operation .
they might be formed insidiously sometime after the operation and had a relationship with the removal of the disc .
intraspinal air was thought to have the relationship with vacuum phenomenon by many authors5,6 ) .
some authors demonstrated the existence of communication between the intradiscal gas and the intraspinal gas by confirming the flow of contrast media into the pseudocyst using a ct after discography9,13 ) .
intradiscal gas can migrate into the epidural space , through this communication , as a result of normal movements of the lumbar spine acting as a piston , and this can , albeit infrequently , lead to nerve root compression20 ) . in this case ,
postoperative intraspinal air was seen just only in the l2 - 3 and l5-s1 levels , where the preoperative intradiscal vacuum phenomenon had been shown and a discectomy was performed , but not in the l3 - 4 level where only a laminectomy had been done and preoperative intradiscal air was not seen .
authors also could find some scattered gas , which had already been in the extruded disc in l2 - 3 and l5-s1 levels .
these findings correspond to previous reports that the presence of the gas in the intervertebral disk was at the same level as the postoperative bubble2,8 ) , and support the hypothesis of vacuum phenomenon as the cause of postoperative eg , as other authors mentioned .
we suggest that annular tear , which had already existed and had the role of the channel between intradiscal and epidural space , was enlarged by a discectomy procedure during the operation , and intradiscal air was expelled to the spinal canal through this channel more easily .
regarding the characteristics of recurred pain , aggravation of symptoms when weight - bearing , while sitting and recumbency are associated with pain relief , was also observed in this case , as previous reports had described4,18 ) .
the mechanism of reversible root compression was thought to be a back and forth movement of air through the channel by a piston - like pneumatic compression , and distraction of the vertebral body in a closed system consist of intradiscal space and encapsulated cyst .
this mechanism could be the rationale for abr and immobilization with brace which was done in this case as the one of the therapeutic strategies for this complication .
it 's why the amount of gas in the spinal canal increased again after the needle aspiration and previous symptom recurred after just 2 days .
some authors mentioned the " valve - pump mechanism " or " ball - valve effect " as the cause of increased amount of gas in the spinal canal15,20 ) .
if the total amount of the air in disc space and spinal canal is constant , the air movement from disc space to spinal canal would lead to decreased amount of intradiscal air by this mechanism . however , based on the imaging data when symptom recurred after the aspiration procedure , the amount of intradiscal air was not decreased , even seemed to be a little bit increased .
it means more intradiscal gas had been being produced since the needle aspiration , and there is another mechanism to make further gas formation in the disc space .
various reported observations have demonstrated or suggested the reversible formation and absorption of gas and fluid in the disc space11,15,19,20 ) .
biomechanically , negative pressure is produced by enlarging the clefts in the disc that attracts gas from the surrounding extracellular spaces6 ) .
authors assume that in company with normal movement of the lumbar spine , leakage of intradiscal gas to the spinal canal can contribute to this negative pressure in disc space , which could lead to further recruitment of gas in the disc space , which results in a more accumulation of gas in the spinal canal in conjunction with " valve - pump mechanism " .
this assumption should be further investigated and considered on the biomechanical and physiologic background , which was mentioned above in order to understand the exact pathogenesis of postoperative eg in the spinal canal .
treatment options for postoperative intraspinal air range from nonoperative to operative , depending on the clinical symptoms presented . based on the current case and those previously reported
, we think that conservative management should always be attempted first , when clinical signs of eg appear after lumbar surgery .
but , if the patient does not improve with conservative treatment , more invasive procedure , including the needle aspiration , or surgery , is needed .
needle aspiration is one of the therapeutic options , but was reported to have the chance of recurrence1,16,20 ) .
some authors stressed complete removal of the cyst wall as the preventive measure of recurrence of air collection .
just simple aspiration of the air , through the encapsulated cyst , seems not to be enough to resolve this problem because the closed system formed by encapsulated cyst and intradiscal space may not be collapsed , and air could be collected in the pseudocyst again .
some authors also suggest the presence of granulation tissue surrounding the epidural gas is a predictor for surgery .
open surgery is most reliable in cases where there is no response to conservative therapy , and is definitely required to remove chronic encapsulated air and the cyst wall totally , and break this closed system1,16 ) .
although further gas was formed in the spinal canal , it may be absorbed by the adjacent soft tissue after the removal of the cyst wall .
other authors suggested that the treatment needs to be targeted to the disc , as well as the gaseous cyst , and recommended ensuring adequate foraminotomy , carefully removing the membranous soft tissue near the nerve root during the operation in order to prevent reaccumulation or persistence of air in the lumbar epidural space16,20 ) . irrigating the surgical field well with isotonic saline and longer
stay of the drain , postoperatively , during the revision surgery was also mentioned as surgical tips10 ) . the abr and immobilization with brace to restrict the motion in pathologic segments are also advisable , in order to lower the chances of radicular compression by the re - accumulation of the air .
although symptomatic eg is rare clinically , it should be considered as one of the possible causes for postoperative radiculopathy . combined use of ct and mri
is helpful to diagnose the eg in the spinal canal , and differentiate other pathological lesions .
open revision surgery is the most reliable method to treat the postoperative eg , by removing the encapsulated cyst wall totally if conservative treatment fails . | the authors report a case of symptomatic epidural gas accumulation 2 weeks after the multi - level lumbar surgery , causing postoperative recurrent radiculopathy .
the accumulation of epidural gas compressing the dural sac and nerve root was demonstrated by ct and mri at the distant two levels , l3 - 4 and l5-s1 , where vacuum in disc space was observed preoperatively and both laminectomy and discectomy had been done .
however , postoperative air was not identified at l4 - 5 level where only laminectomy had been done in same surgical field , which suggested the relationship between postoperative epidural gas and the manipulation of disc structure .
conservative treatment and needle aspiration was performed , but not effective to relieve patient 's symptoms .
the patient underwent revision surgery to remove the gaseous cyst .
her leg pain was improved after the second operation . | INTRODUCTION
CASE REPORT
Presentation and examination
Operation and postoperative course
Needle aspiration/postoperative course
Revision surgery/postoperative course
DISCUSSION
CONCLUSION |
traditional treatment for b cell lymphoma includes chemotherapy , radiotherapy , and hematopoietic stem cell transplantation .
however , for many refractory , relapse , or elderly lymphoma patients who can not tolerate chemotherapy and stem cell transplantation , immune treatment has attracted more attention in recent years .
although adoption of autologous t lymphocytes with the same mhc antigen to normal tissues can avoid rejection , it may produce immune tolerance for lymphoma cells that still have tumor - related antigen immune tolerance on this part of autologous t cells .
thus , the clinical curative effect of the abovementioned method is still far from being able to cure lymphoma . in recent years , with the development of genetic engineering technology , the antibody that identifies the tumor associated antigen could be connected to the costimulatory molecule gene sequence required for t cell activation to form the carrier .
then , it could be transfected to t lymphocytes in vitro , which combines the high affinity of the antigen antibody with the cell - killing mechanism of cytotoxic t cells .
this develops the t cell targeted killing effect , which become a new exploration for tumor cell immune therapy .
since most non - hodgkin s lymphoma originated from b cells , and more than 90% of patients expressed cd20 antigen , anti - cd20 antibody fusion genes are widely used for b cell lymphoma treatment .
induction of t cell activation , proliferation , and differentiation to effector cells needs a costimulatory signal . cd28 and cd137 are 2 important costimulatory molecules ;
the former is expressed stably on the t cells , and the latter is able to activate t lymphocytes independent of cd28 .
some reports suggested that overexpression of cd137 and cd28 in t cells can significantly improve its cytokines secretion and anti - tumor effect , extend t cells survival time , and improve t cell proliferation ability .
our study aimed to construct an anti - cd20-cd28-cd137-tcr fusion gene and transfect it to the peripheral blood t lymphocyte by lipofection transfection method to observe its cytotoxic effect in vitro and the therapeutic effect on lymphoma in a nude mouse model .
hd - lai plasmid was provided by the geneart company ( grand island , ny ) .
egfp vector and ligase were provided by the neb company ( ipswich , gk ) .
bamhi , asci , bglii was provided by mbi company ( fermentas , canada ) .
packaging plasmid plp1 , plp2 , plp / vsvg , dmem + ; fbs , lipofectamine2000 , opti - mem , 0.05% trypsin were all from invitrogen ( grand island , ny ) .
( kunming , china ) ; cytotox 96 non - radioactive cytotoxicity assay kit was bought from promega ( beijing , china ) ; nude mice was purchased from beijing vital river co. , ltd ( beijing , china ) .
293 t cell and raji cell were derived from the atcc cell bank ( manassas , va ) .
after hd - lai plasmid was double - digested by bglii and asci and after plenti6.3_mcs_ires2-egfp vector was double - digested by bamhi and asci , the fragment and vector were connected by ligase .
peripheral blood was collected from lymphoma patients , and a cobe machine was used to collect the mononuclear cells .
the cd4 + cd8 + t cells were seeded in the cell culture bottles and maintained at 37c and 5% co2 in an incubator overnight .
the transfection was performed on the second day , when the packaging mix and lentivirus plasmid were mixed in the 37c preheated opti - mem , while lipo2000 was added to opti - mem . after standing at room temperature for 5 min ,
the plasmid solution and lipo2000 diluent solution were mixed and reacted at room temperature for 20 min .
and then , the solution was added to the cell culture bottle and incubated for 6 h. after changing the medium and incubating for 48 h , the cell supernatant was collected and centrifuged to get the anti - cd20-cd28-cd137-tcr fusion gene modified t cells .
the transfection effect was observed under fluorescence microscope and flow sorting was performed to obtain the cd20-cd28-cd137-tcr car t cells .
the ldh test was performed to detect the in vitro cytotoxic effect of car - t cells by co - culture of car - t cells and raji cells .
raji cells were seeded in 96-well plates and maintained at 37c for 24 h. car - t cells were added to raji cells at the ratio of 1:2 , 1:1 , 3:1 , and 10:1 .
after 4 h , the cells was added with lysis and incubated at 37c for 45 min .
after centrifugation , 50 l of supernatant was moved to a new 96-well plate and 50 l of assay buffer resuspended substrate mixture was added and incubated at room temperature away from light for 30 min . after adding 50 l of terminated liquid ,
lymph node biopsy was performed on suspected lymphoma patients after they signed written informed consent , and part of the lymph node was stored at 80c .
after pathological diagnosis was clear , 2 cases of chronic b cell lymphoma / chronic lymphocytic leukemia ( we saved the lymph nodes and chronic lymphocytic leukemia cells at the same time ) , 2 cases of diffuse large b lymphoma , and 2 cases of follicular b lymphoma were selected for experimentation .
a small piece of lymph node tissue from malignant lymphoma was cut into 111 mm for transplantation . according to the literature ,
we anesthetized 45 weeks old balb / c nude mice by caudal vein injection of sodium pentobarbital ( 30 mg / kg ) .
after open the abdomen , an incision 3 mm deep to mucosa was performed on the rectum , and 2 pieces of 111 mm tumor tissue were fixed on the mucous layer of the rectum .
diet and mental state of the nude mice were observed every day , tumor volume was measured every 5 days , and the survival time was observed .
differences between means were analyzed using student s t test or 1-way anova , when necessary .
hd - lai plasmid was provided by the geneart company ( grand island , ny ) .
egfp vector and ligase were provided by the neb company ( ipswich , gk ) .
bamhi , asci , bglii was provided by mbi company ( fermentas , canada ) .
packaging plasmid plp1 , plp2 , plp / vsvg , dmem + ; fbs , lipofectamine2000 , opti - mem , 0.05% trypsin were all from invitrogen ( grand island , ny ) .
( kunming , china ) ; cytotox 96 non - radioactive cytotoxicity assay kit was bought from promega ( beijing , china ) ; nude mice was purchased from beijing vital river co. , ltd ( beijing , china ) .
293 t cell and raji cell were derived from the atcc cell bank ( manassas , va ) .
after hd - lai plasmid was double - digested by bglii and asci and after plenti6.3_mcs_ires2-egfp vector was double - digested by bamhi and asci , the fragment and vector were connected by ligase .
peripheral blood was collected from lymphoma patients , and a cobe machine was used to collect the mononuclear cells .
the cd4 + cd8 + t cells were seeded in the cell culture bottles and maintained at 37c and 5% co2 in an incubator overnight .
the transfection was performed on the second day , when the packaging mix and lentivirus plasmid were mixed in the 37c preheated opti - mem , while lipo2000 was added to opti - mem . after standing at room temperature for 5 min , the plasmid solution and lipo2000 diluent solution
and then , the solution was added to the cell culture bottle and incubated for 6 h. after changing the medium and incubating for 48 h , the cell supernatant was collected and centrifuged to get the anti - cd20-cd28-cd137-tcr fusion gene modified t cells .
the transfection effect was observed under fluorescence microscope and flow sorting was performed to obtain the cd20-cd28-cd137-tcr car t cells .
the ldh test was performed to detect the in vitro cytotoxic effect of car - t cells by co - culture of car - t cells and raji cells .
raji cells were seeded in 96-well plates and maintained at 37c for 24 h. car - t cells were added to raji cells at the ratio of 1:2 , 1:1 , 3:1 , and 10:1 . after 4 h , the cells was added with lysis and incubated at 37c for 45 min .
after centrifugation , 50 l of supernatant was moved to a new 96-well plate and 50 l of assay buffer resuspended substrate mixture was added and incubated at room temperature away from light for 30 min . after adding 50 l of terminated liquid ,
lymph node biopsy was performed on suspected lymphoma patients after they signed written informed consent , and part of the lymph node was stored at 80c . after pathological diagnosis was clear , 2 cases of chronic b cell lymphoma / chronic lymphocytic leukemia ( we saved the lymph nodes and chronic lymphocytic leukemia cells at the same time ) , 2 cases of diffuse large b lymphoma , and 2 cases of follicular b lymphoma were selected for experimentation .
a small piece of lymph node tissue from malignant lymphoma was cut into 111 mm for transplantation . according to the literature ,
we anesthetized 45 weeks old balb / c nude mice by caudal vein injection of sodium pentobarbital ( 30 mg / kg ) .
after open the abdomen , an incision 3 mm deep to mucosa was performed on the rectum , and 2 pieces of 111 mm tumor tissue were fixed on the mucous layer of the rectum .
diet and mental state of the nude mice were observed every day , tumor volume was measured every 5 days , and the survival time was observed .
differences between means were analyzed using student s t test or 1-way anova , when necessary .
the target fragment was used to synthesize cd20-cd28-cd137-tcr gene by gene - on - demandtm technology and connected into plvx lentivirus vector ( figure 1 ) . meanwhile ,
anti - cd20 scfv gene was constructed by the same method as the positive control .
agarose gel electrophoresis was used to detect target fragment connection to the plvx lentivirus vector ( figure 2 ) .
compared with the known sequence , the tested sequence and insertion direction were correct ( figure 3 ) .
after transfection with lentivirus vector , green fluorescent protein was found expressed in t cells under the fluorescence microscope ( figure 4 ) .
these findings show that our vector can successfully transfect to t cells with relative high transfection efficiency .
these effects show that at the ratio of 10 : 1 , car - t cells can kill raji cells effectively ( figure 4 ) .
t lymphocytes modified with anti - cd20-cd28-cd137-tcr recombination gene exhibited an inhibitory effect on tumors in b lymphoma transplantation on balb / c nude mice . from the second day after the tumor inoculation surgery , diet and mental conditions of the nude mice were good .
angiogenesis on the tumor surface could be found on the third day through the skin .
the results showed that the tumor formation rate was 86.67% in 30 mice , of which mice in the blank control group and the negative control group all had tumor formation .
tumor growth in the test group mice was obviously inhibited , with only 6 mice having tumor formation .
mice in the negative control group and blank control group became thinner , lost appetite , appeared depressed , and were less active , while the mice in the experimental group appeared to be in better condition .
the mean tumor volume ( 20829 mm ) was significantly smaller than in the negative control group ( 2100239 mm ) and blank control group ( 2311361 mm ) ( p<0.05 ) , while there was no statistical difference between the negative control and blank ( figure 5 ) .
the target fragment was used to synthesize cd20-cd28-cd137-tcr gene by gene - on - demandtm technology and connected into plvx lentivirus vector ( figure 1 ) . meanwhile ,
anti - cd20 scfv gene was constructed by the same method as the positive control .
agarose gel electrophoresis was used to detect target fragment connection to the plvx lentivirus vector ( figure 2 ) .
compared with the known sequence , the tested sequence and insertion direction were correct ( figure 3 ) .
after transfection with lentivirus vector , green fluorescent protein was found expressed in t cells under the fluorescence microscope ( figure 4 ) .
these findings show that our vector can successfully transfect to t cells with relative high transfection efficiency .
these effects show that at the ratio of 10 : 1 , car - t cells can kill raji cells effectively ( figure 4 ) .
t lymphocytes modified with anti - cd20-cd28-cd137-tcr recombination gene exhibited an inhibitory effect on tumors in b lymphoma transplantation on balb / c nude mice . from the second day after the tumor inoculation surgery , diet and mental conditions of the nude mice were good .
angiogenesis on the tumor surface could be found on the third day through the skin .
the results showed that the tumor formation rate was 86.67% in 30 mice , of which mice in the blank control group and the negative control group all had tumor formation .
tumor growth in the test group mice was obviously inhibited , with only 6 mice having tumor formation .
mice in the negative control group and blank control group became thinner , lost appetite , appeared depressed , and were less active , while the mice in the experimental group appeared to be in better condition .
the mean tumor volume ( 20829 mm ) was significantly smaller than in the negative control group ( 2100239 mm ) and blank control group ( 2311361 mm ) ( p<0.05 ) , while there was no statistical difference between the negative control and blank ( figure 5 ) .
non - hodgkin s lymphoma ( nhl ) is a group of malignant hyperplastic diseases , including various different clinical manifestations and biological characteristics , which accounts for about 90% of all lymphoid neoplasms .
although the appearance of cetuximab , represented by the anti - cd20 monoclonal antibody drug , greatly improved patient prognosis , allogeneic hematopoietic stem cell inhibition could be a treatment choice for resistance or recurrence patients , but its use has been limited by the high probability of graft - versus - host disease after allograft transplantation and non - recurrence mortality rate .
it allows t lymphocytes to remain alive in the body without clearance by the immune system , but still can not avoid tumor - related antigen immune tolerance .
thus , the clinical curative effect of the abovementioned method is still far from lymphoma healing .
autologous t lymphocytes transfected through cd20 antibody exhibited better curative effect on b cell lymphoma in a nude mouse model .
the first signal is produced by the combination of antigen and t cell surface receptor , and the second signal is generated by the combination of t cell surface receptors with costimulatory molecules that exist on antigen - presenting cells . to increase the antitumor activity and tumor antigen - specific cytokines production of car - t cells , a costimulatory area
cd28 is an important type of costimulatory molecular receptor that is expressed on most of the t cells with relatively stable expression .
it is a member of the immunoglobulin superfamily , and also is a type of glycoprotein . cd28
combined with b7 molecule on antigen - presenting cells can provide a positive stimulus signal for t lymphocytes activation . at the same time
, it can promote cytokines such as interleukin 2 secretion to strengthen the function of t lymphocytes .
it has been reported that cd28 monoclonal antibody plays an important role in the process of cd4-cd25-t lymphocyte proliferation .
single application of cd28 monoclonal antibody within 3 days can make cd4-cd25-t lymphocyte group amplify 20 times .
it was also found in the transplant that lack of cd28 costimulatory signal may lead no immune response to the donor t cells , which showed that cd28 also plays an important role in maintaining the balance of immune activity .
it is expressed on the surface of the activated t lymphocytes , monocytes , activated eosinophils , eosinophils , follicular dendritic cells , nk cells , and microglial cells .
it not only participates in the innate immune response , but also can participate in the adaptive immune response , and plays an important role in immune adjustment and immune response .
it can activate t lymphocytes independent of cd28 and initiate t cell - mediated immune response .
its biological activity can be summarized as promoting t cell proliferation , inhibiting apoptosis , and extending the survival time of activated t cells .
lentivirus vector is a kind of gene therapy vector , which was developed based on the human immunodeficiency virus ( hiv ) 1 .
it not only has the infection ability to the divisive cells , but can infect the undivided cells .
it can integrate the foreign genes into the host cell s chromosome and achieve persistent expression .
this research used the efficient lentivirus vector to transfect cd20-cd28-cd137-tcr single - chain antibody gene to modify t cells , which solves the problem of low transfection efficiency in the car - t cell immune therapy .
we introduced cd28 , cd137 cytoplasm signal domain to the cd20 monoclonal antibody gene to give the transfected t cells sustained survival and long - term proliferation in the body , so as to achieve the immune monitoring to tumor cells . at the same time , we set up multiple controls to certify the results .
our results show that t lymphocytes have specific recognition and killing effect of the b lymphocyte tumor cell line raji cells that expressed cd20 antigen after transfection for 24 h. when the ratio of car - t cells and raji cells reached 10 : 1 , car - t cells exhibited greater killing effect on raji cells .
the tumor formation rate of the nude mice treated with t lymphocytes transfected with plvx - cd20-cd28-cd137-tcr fusion protein ( 60% ) was significantly lower than the blank control group ( 100% ) and the negative control group ( 100% ) .
the mean tumor volume in the treatment group was also obviously smaller than in the negative control group and blank control .
these findings indicate that t lymphocytes transfected with plvx - cd20-cd28-cd137-tcr fusion protein can significantly inhibit the growth of b lymphocyte tumors in nude mice in vivo and in vitro .
in summary , transfecting monoclonal antibody gene to autologous t lymphocytes provides a new strategy for tumor - targeted therapy , while enhancing t cell function and prolonging its action time through gene fusion provides new support for immune gene therapy . | backgroundimmunotherapy has been explored as a new therapy for b cell lymphoma , which is a non - hodgkin s lymphoma . because cd20 is a b lymphocyte - specific marker ,
anti - cd20 single chain - tagged t lymphocytes have already begun to be experimentally used in b cell lymphoma treatment , but its use is still limited because of its unspecific targeting .
t cells transfected with cd28 and cd137 can significantly improve the ability of cytokines secretion and anti - tumor effect , as well as extending t cell survival time and improving their proliferation ability.material/methodsgenes containing anti - cd20-cd28-cd137-tcr were constructed .
after cloning and sequencing , the plasmid was constructed and packaged by lentivirus .
it was transfected to the peripheral blood t lymphocyte after identification transfection to induce the fusion protein expression .
the cells were incubated with raji cells and the ldh test was performed to detect the cytotoxic effect of car - t cells ; the tumor volume and survival rate were measured to observe its inhibitory effect on b cell lymphoma in nude mice.resultsgene with anti - cd20-cd28-cd137-tcr was successfully constructed and transfected to the t cell surface .
ldh assay revealed that car - t cells can kill the raji cells with a killing rate of 32.896.26% .
it can significantly inhibit b cell lymphoma growth in nude mice.conclusionst lymphocytes transfected with anti - cd20-cd28-cd137-tcr fusion gene can kill b cell lymphoma , which could provide a new strategy for tumor treatment . | Background
Material and Methods
Material
Recombinant plasmid construction
Lentivirus packaging and transfection
Cytotoxic effect
Case selection
Animal experiments
Statistical analysis
Results
Recombination lentivirus vector construction, virus packaging and identification
CAR-T cells exhibited cytotoxic effect
Discussion
Conclusions |
plasmodiophora brassicae ssi e4 and e9 collected as isolates from diseased hosts were identified as race 4 and race 9 , respectively , via inoculation into williams ' differential varieties .
these ssis were mass - propagated in the sensitive chinese cabbage cultivar ( black pearl , dongbu hannong co. ) and subsequently used in this study .
( 1994 ) was conducted in a side - by - side fashion to eliminate the impurities , except for resting spores originating from plant tissue .
first , the root galls were washed several times with running water to eliminate soil particles and foreign materials , after which the resting spores of p. brassicae were separated after grinding the samples in sterilized water with a homogenizer ( 13,500 rpm/5minutes ) .
plant tissues and impurities of chinese cabbage were eliminated from a suspension prepared from root galls via filtration through sterilized gauze folded eight times followed by 15 minutes of centrifugation at 3,000 rpm , after which the pellet was recovered and subjected to the sucrose method .
the concentration of the refined spore suspension was adjusted to 1 10 spores / ml using a haemacytometer , and 0.5 l of the suspension was then dropped onto a cover slip using a micro - pipette .
once the single resting spores were confirmed , two- or three - day - grown seedlings were placed on the cover glass containing the spores and then covered lightly with sterilized fine soil , after which they were planted in pots and covered with vinyl for one day to maintain humidity .
the plants were subsequently cultivated for seven to eight weeks at 20~25 in a greenhouse ( kageyama et al . , 1995 ) .
genomic dna of p. brassicae was extracted via the ctab method ( doyle and doyle , 1990 ) . by performing the single spore isolation mentioned above in conjunction with the sucrose method ,
foreign materials originating from a host plant were removed . the sample was then centrifuged at 3,000 rpm for 15 minutes , after which the pellet was removed and treated with 50 l dnase i(sigma , d-4263 ) at 50 unit / ml .
next , 300 ppm streptomycin and 100 ppm rifampicin were applied and the sample was incubated at 37 for one hour . to inactivate the dnase i , 5 l of proteinase k ( 25 g/l )
were added to the sample , which was subsequently incubated at 37 for one hour .
next , 300 l of 5 mm edta was added and the sample was then treated at 80 in a heating block for 5 minutes . the conidial suspension with inactivated dnase i was then centrifuged again at 4,000 rpm , after which the supernatant was removed and the pellet was freeze - dried and stored until subsequent use . for dna extraction , the pellets were thoroughly ground with 0.2 g glass beads ( 0.09~0.15 mm diameter ) using a pellet pestle ( sigma ) , after which 400 l of extraction buffer [ 200 mm tris - cl ( ph 8.0 ) , 200 mm edta , 1.4 m nacl , 1% pvp ] were added .
the mixture was then extracted with 600 l of chloroform : isoamyl alcohol ( 24 : 1 ) , after which dna extraction and purification was conducted using a g - spintmgenomic dna extraction kit ( intron biotechnology , korea ) .
the purified dna was then eluted in 200 l of h2o in the final step , and the samples were maintained at -20 until subsequent analysis .
the primers tested in this study were the 12 urp primers provided in a uniprimertm kit ( seoulin bioscience institute , korea ) , operon 10-base primer for dna polymorphism analysis ( mller and harling , 1996 ) and the rfm8 - 1 , rfm8 - 2 primer set for race determination ( klewer et al .
the effective primers , upr-3 ( 5'-cccagcaactgatcgcacac-3 ' ) , urp-6 ( 5'-atgtgtgcgatcagttgctg-3 ' ) and opa-07 ( 5'-agtcagccac-3 ' ) , were employed in this study .
urp - pcr reactions were conducted in a reaction mixture with a final volume of 30 l that contained 5 ng of genomic dna , 100 ng urp primers , 800 m dntps , 10 mm tris - hcl , 50 mm kcl , 1.5 mm mgcl2 and 2.5 units of taq polymerase ( solgent co. , ltd .
pcr reactions using opa-07 were conducted in a reaction mixture with a final volume 50 l that contained 10 ng of genomic dna , 1 m operon 10-base primer , 2 mm dntps , 10 mm tris - hcl , 50 mm kcl , 1.5 mm mgcl2 and 2.5 units of taq polymerase ( solgent co. , ltd .
korea ) ( table 1 ) . for variation analysis in the same generation of p. brassicae
, root galls that were obtained from the black pearl cultivar after inoculation with the e4 and e9 isolates were divided into five pieces and the dna was extracted from each piece , after which rapd analysis was conducted using the urp 3 and urp 6 primers to reveal the active polymorphisms between the pathogen isolates . to investigate patterns of longitudinal variation of the pathogen , second and third generations were made through regrowth after single spore inoculation with e4 as an original generation .
to determine the genetic stability among generations , rapd analysis was conducted using the urp 3 and opa-7 primers .
the isolate , e4 , was used for this study because it showed the strongest pathogenicity ( jang , 2006 ) and is easy to form the gall by inoculation of single resting spore .
plasmodiophora brassicae ssi e4 and e9 collected as isolates from diseased hosts were identified as race 4 and race 9 , respectively , via inoculation into williams ' differential varieties .
these ssis were mass - propagated in the sensitive chinese cabbage cultivar ( black pearl , dongbu hannong co. ) and subsequently used in this study .
( 1994 ) was conducted in a side - by - side fashion to eliminate the impurities , except for resting spores originating from plant tissue .
first , the root galls were washed several times with running water to eliminate soil particles and foreign materials , after which the resting spores of p. brassicae were separated after grinding the samples in sterilized water with a homogenizer ( 13,500 rpm/5minutes ) .
plant tissues and impurities of chinese cabbage were eliminated from a suspension prepared from root galls via filtration through sterilized gauze folded eight times followed by 15 minutes of centrifugation at 3,000 rpm , after which the pellet was recovered and subjected to the sucrose method .
the concentration of the refined spore suspension was adjusted to 1 10 spores / ml using a haemacytometer , and 0.5 l of the suspension was then dropped onto a cover slip using a micro - pipette .
once the single resting spores were confirmed , two- or three - day - grown seedlings were placed on the cover glass containing the spores and then covered lightly with sterilized fine soil , after which they were planted in pots and covered with vinyl for one day to maintain humidity .
the plants were subsequently cultivated for seven to eight weeks at 20~25 in a greenhouse ( kageyama et al . , 1995 ) .
genomic dna of p. brassicae was extracted via the ctab method ( doyle and doyle , 1990 ) . by performing the single spore isolation mentioned above in conjunction with the sucrose method , foreign materials originating from a host plant were removed .
the sample was then centrifuged at 3,000 rpm for 15 minutes , after which the pellet was removed and treated with 50 l dnase i(sigma , d-4263 ) at 50 unit / ml .
next , 300 ppm streptomycin and 100 ppm rifampicin were applied and the sample was incubated at 37 for one hour . to inactivate the dnase i , 5 l of proteinase k ( 25 g/l )
were added to the sample , which was subsequently incubated at 37 for one hour .
next , 300 l of 5 mm edta was added and the sample was then treated at 80 in a heating block for 5 minutes . the conidial suspension with inactivated dnase i was then centrifuged again at 4,000 rpm , after which the supernatant was removed and the pellet was freeze - dried and stored until subsequent use . for dna extraction , the pellets were thoroughly ground with 0.2 g glass beads ( 0.09~0.15 mm diameter ) using a pellet pestle ( sigma ) , after which 400 l of extraction buffer [ 200 mm tris - cl ( ph 8.0 ) , 200 mm edta , 1.4 m nacl , 1% pvp ] were added .
the mixture was then extracted with 600 l of chloroform : isoamyl alcohol ( 24 : 1 ) , after which dna extraction and purification was conducted using a g - spintmgenomic dna extraction kit ( intron biotechnology , korea ) .
the purified dna was then eluted in 200 l of h2o in the final step , and the samples were maintained at -20 until subsequent analysis .
the primers tested in this study were the 12 urp primers provided in a uniprimertm kit ( seoulin bioscience institute , korea ) , operon 10-base primer for dna polymorphism analysis ( mller and harling , 1996 ) and the rfm8 - 1 , rfm8 - 2 primer set for race determination ( klewer et al . , 2001 ) .
the effective primers , upr-3 ( 5'-cccagcaactgatcgcacac-3 ' ) , urp-6 ( 5'-atgtgtgcgatcagttgctg-3 ' ) and opa-07 ( 5'-agtcagccac-3 ' ) , were employed in this study .
urp - pcr reactions were conducted in a reaction mixture with a final volume of 30 l that contained 5 ng of genomic dna , 100 ng urp primers , 800 m dntps , 10 mm tris - hcl , 50 mm kcl , 1.5 mm mgcl2 and 2.5 units of taq polymerase ( solgent co. , ltd .
pcr reactions using opa-07 were conducted in a reaction mixture with a final volume 50 l that contained 10 ng of genomic dna , 1 m operon 10-base primer , 2 mm dntps , 10 mm tris - hcl , 50 mm kcl , 1.5 mm mgcl2 and 2.5 units of taq polymerase ( solgent co. , ltd .
for variation analysis in the same generation of p. brassicae , root galls that were obtained from the black pearl cultivar after inoculation with the e4 and e9 isolates were divided into five pieces and the dna was extracted from each piece , after which rapd analysis was conducted using the urp 3 and urp 6 primers to reveal the active polymorphisms between the pathogen isolates .
to investigate patterns of longitudinal variation of the pathogen , second and third generations were made through regrowth after single spore inoculation with e4 as an original generation .
to determine the genetic stability among generations , rapd analysis was conducted using the urp 3 and opa-7 primers .
the isolate , e4 , was used for this study because it showed the strongest pathogenicity ( jang , 2006 ) and is easy to form the gall by inoculation of single resting spore .
because the resting spores of p. brassicae are haploid , single spore isolates propagated from these spores should constitute a genetically homothallic genotype ( voorrips , 1995 ) .
however , evidence of this issue has not been clearly demonstrated in most molecular biological studies , including those conducted to analyze genetic polymorphisms of this pathogen due to difficulties in the mass extraction of dna and contamination of foreign materials originating from the host plant .
this pathogen can grow only in a host plant ; therefore , it is difficult to obtain a large number of pathogens when compared to other pathogens that can be propagated through pure cultivation in media .
dna extraction of p. brassicae includes two complex steps , isolation of resting spores of the pathogen from a host plant and a second step in which dna is extracted from the isolated resting spores .
indeed , all procedures involved in the extraction of dna from p. brassicae involve long and complex processes to remove the large amounts of foreign materials that originate from host cells and contamination of the host dna . nevertheless , these processes still result in the loss of target dna .
additionally , if the amount of dna recovered using these procedures was small or contaminated with host dna , the rapd and rflp bands will be unclear or indistinct , even though the experiments were properly conducted .
thus , the development of an effective dna extraction method , as well as a mass pathogen propagation method within the host plants remains acutely necessary .
the mass propagation of an experimental material from single spore isolates might be resolved to some degree by using a susceptible host plant , but isolates demonstrating very little pathogenicity are still being propagated .
accordingly , the development of a more effective propagation method independent of the degree of the pathogenicity of the single spore isolate should be resolved in future studies .
this study used race 4 ( e4 ) and race 9 ( e9 ) , which are both known as prevalent pathogens in korea , to secure sufficiently propagated single spore isolates as the experimental material ( heo , 2004 ; jang , 2006 ) .
additionally , during the dna extraction stage , the extraction efficiency was maximized by a physical grinding method using a glass bead and a pellet pestle .
resting spores have a spherical shape , are only 3.8 m in diameter and are composed of hard chitin compounds ; therefore , they are not damaged when they are examined using a ccd phase - contrast microscope ( iponacology , japan ) ( 2,161 ) after treating them with edta or sds .
conversely , the method of grinding them with very small glass beads ( 0.09~0.15 mm diameter ) can damage the resting spores , leading to over 80% of the spores being destroyed ( jang , 2005 , 2006 ) .
variation analysis within a same generation performed using urp 3 and urp 6 revealed nearly no variation in the patterns of bands of e4 and e9 ( fig . 1 , 2 ) .
additionally , rapd analysis conducted to investigate the occurrence of longitudinal variation through progeny generations revealed that only the band patterns produced using the urp 3 and 6 primers and opa-07 primer produced varying patterns . in a previous study ,
only the three primers out of a group of primers evaluated for their effectiveness for variation analysis and race differentiation using p. brassicae showed a high enough number of bands and differences in band patterns to separate organisms according to race ( heo , 2004 ) . since williams ' differential system ( williams , 1966 ) and the european clubroot differential system ( buczacki et al . , 1975 )
were suggested , an extremely small number of single spore isolates ( ssi ) including only a few races have been reported , and the development of genetic markers has not be progressed because the diversity of ssis has not been fully elucidated .
we detected no differences in band types in our variation analysis of the progeny generation using urp 3 and opa 7 primers among generations from the original e4 to the third generation ( fig .
thus , the results of this study showed that the ssi of p. brassicae are stably genetically inherited following infection and residence within the host independently , and this occurs via an asexual process .
however , to make more accurate conclusions regarding the genetic stability following the growth of this pathogen , the possibility of genetic variation due to combined inoculation of isolates of different races should also be examined . | single spore isolates of plasmodiophora brassicae e4 and e9 obtained from diseased chinese cabbage were identified as race 4 and race 9 , respectively , by the williams ' differential variety set . to confirm the possibility of variation in same generation and progeny of a single spore isolate of p. brassicae
, random amplified polymorphic dna ( rapd ) analysis was conducted using the urp 3 , 6 and opa 7 primers .
there was no difference in band type at each part of the gall of chinese cabbage obtained by inoculation of e4 and e9 and amplification using the urp 3 and 6 primers when the same generation was analyzed .
in addition , the progeny analysis , which was expanded to the third generation and conducted using the urp 3 and opa 7 primers , revealed no differences in the band type of the e4 isolate .
based on these results , the single spore isolate of p. brassicae was genetically stable . | Materials and Methods
Pathogen isolates
Single spore isolation
RAPD analysis
Variation analysis in the same generation
Variation analysis through progeny generations
Results and Discussion |
midurethral sling ( mus ) surgery is the most frequently performed procedure to treat stress urinary incontinence ( sui ) in women .
although incontinence is resolved in most patients , some patients experience voiding dysfunction ( vd ) , which is a common complication of mus surgery for sui .
vd clinically represents subjective voiding difficulties and objective significant postvoid residual ( pvr ) and decreased flow rate . in the literature , vd after mus surgery represents a wide spectrum of postoperative voiding problems . in one study ,
post - mus vd was investigated under strict criteria defined as the need for urethral catheterization for at least 3 days .
other authors defined post - mus vd as transient voiding difficulty , which included subjective voiding difficulty or a straining pattern .
although vd is a well - recognized complication , there are no clear criteria to define vd . symptoms of vd may vary in type and severity in a range between a feeling of incomplete emptying and prolonged urinary retention .
the definition of vd includes the need for reoperation , acute urinary retention that requires transient catheterization , and subjective symptoms with or without objective voiding parameters .
objective voiding parameters include significant pvr with a decreased urinary flow rate ( as assessed by uroflowmetry ) .
the need for an additional procedure for bladder emptying after urethral catheter removal is also regarded as post - mus vd .
the incidence of vd is variable and is difficult to compare owing to the various procedures and definitions of vd .
surgical intervention for vd and urinary retention has been reported in 0% to 5% of patients undergoing the mus procedure .
postoperative voiding difficulties lasting longer than 4 weeks occur in 3% to 7% of patients undergoing burch procedures .
therefore , the risk factors of post - mus vd appear to be related to diverse parameters . in addition
, the various definitions of post - mus vd can cause confusion during the explanation of informed consent and how to manage postoperative vd .
such confusion could lead a clinician to overlook the patients ' complaint or overstate the risk of postoperative vd .
thus , it is meaningful to analyze the risk factors for post - mus vd with the use of various definitions for vd . in the mus era ,
the definitions of and methods for evaluating vd are still controversial , however . in this study
, we retrospectively analyzed patients in a single institutional cohort to investigate the incidence and risk factors of vd after the transobturator tape procedure ( tot ) by applying various criteria for vd .
from june 2006 to december 2014 , a total of 467 patients underwent a transvaginal mus operation for sui at a single institution . excluding the cases of surgery for mus - related complications , the medical records of 449 patients were reviewed retrospectively .
the urodynamic study included cystometrogram , pressure - flow study , and measurement of urethral closure pressure and leak point pressure .
the urodynamic study was performed with an mms international model solar silver urodynamic system ( mms international , dover , nh , usa ) . by use of pressure - flow study parameters
, we discriminated between patients with an underactive detrusor or female bladder outlet obstruction ( boo ) .
underactive detrusor was defined as less than 20 cmh2o in detrusor pressure at maximal flow rate ( pdetqmax ) and less than 15 ml / s in peak flow rate ( qmax ) .
female boo was defined as more than 20 cmh2o in pdetqmax and less than 15 ml / s in qmax .
specific evaluations of sui such as the pad test for urine leakage , q - tip test , and pelvic examination for pelvic organ prolapse were performed preoperatively .
the tot operation was performed with the patients under spinal anesthesia and in some cases under general anesthesia .
the monarc subfascial hammock system ( american medical systems , minnetonka , mn , usa ) was used for the vaginal tape .
the tension of the indwelled tape was adjusted to a tension - free state taking into account the condition of the sphincter and detrusor . at the end of the operation ,
a 16-fr foley catheter was indwelled and was removed the next day in most patients .
after removal of the urethral catheter , the patients ' voiding state was recorded with uroflowmetry and measurement of pvr .
voiding parameters and voiding symptoms were evaluated during routine check - ups at postoperative 1 week and 1 month .
acute urinary retention was regarded in cases requiring catheterization for failure to void or pvr of more than 200 ml after foley catheter removal .
subjective voiding symptoms and storage symptoms from the day of catheter removal through the follow - up period were surveyed .
voiding difficulty was regarded as patients ' subjective complaints such as straining , slow stream , and feeling of incomplete emptying .
significant pvr was defined as greater than 100 ml or pvr of more than 50% of voided volume .
patients were divided into two groups by use of the various categories to investigate the risk factors of vd .
in addition , relationships between postoperative subjective symptoms and objective voiding parameters were analyzed . in the statistical analysis ,
the two groups were compared by use of the pearson chi - square test and student t - test for differences in categorical and continuous variables , respectively . to analyze risk factors ,
a multivariate logistic regression analysis was adopted for factors with a p - value of than 0.1 in the univariate analysis .
statistical analysis was performed with ibm spss ver . 19.0 ( ibm co. , armonk , ny , usa ) .
the mean patient age was 52.2 years ( range , 30 - 82 years ) .
ninety - nine patients ( 25.3% ) experienced preoperative obstructive voiding symptoms and 5 patients ( 1.1% ) had a history of urinary retention .
the number of patients with a preoperative qmax less than 15 ml / s and with significant pvr was 48 ( 10.9% ) and 22 ( 5.1% ) , respectively .
urodynamic study detected underactive detrusor and female boo in 69 ( 17.9% ) and 98 patients ( 25.5% ) , respectively .
the operation was performed under spinal anesthesia in 57.9% of patients , and 9.6% underwent concomitant gynecology operations .
the subjective cure rate was 92.3% and the satisfaction rate was 77.7% after 1 year .
of the 449 patients , 10 ( 2.2% ) experienced retention requiring additional catheterization and 2 ( 0.4% ) underwent tape cutting for prolonged postoperative voiding difficulty .
forty - seven patients ( 10.5% ) experienced subjective postoperative voiding difficulty until 3 months . on the day of catheter removal , 18 patients ( 4.0% ) complained of voiding difficulty ; 36 patients ( 11.8% ) complained of voiding difficulty at 1 week , and 29 ( 11.6% ) did so at 1 month .
of the patients who experienced retention with additional catheterization , none underwent reoperation for vd or recurrent incontinence .
patients with postoperative vd showed more postoperative obstructive voiding symptoms as well as a greater decrease in qmax and more significant pvr ( table 2 ) . in most follow - up periods , there were significant differences in qmax and pvr between the groups created by use of the various criteria .
comparative analysis was performed to determine the risk factors for post - tot vd . in a multivariate logistic analysis ,
the independent risk factors for postoperative retention requiring catheterization were previous retention history ( odds ratio [ or ] , 8.93 ; 95% confidence interval [ ci ] , 1.17 - 68.1 ) and a preoperative history of hysterectomy .
risk factors for postoperative voiding difficulty were underactive detrusor ( or , 2.52 ; 95% ci , 1.03 - 6.13 ) and preoperative obstructive voiding symptoms ( or , 8.20 ; 95% ci , 2.04 - 32.9 ) . for concomitant postoperative voiding difficulty and significant pvr , a previous urinary retention history ( or , 58.6 ; 95% ci ,
the independent risk factors for significant postoperative pvr were spinal anesthesia ( or , 0.46 ; 95% ci , 0.24 - 0.89 ) and previous urinary retention history ( or , 17.8 ; 95% ci , 1.52 - 209 ) .
preoperative medical disease related to neuropathic bladder and preoperative urgency symptoms were not correlated with postoperative vd ( table 3 ) .
the risk factors for vd after mus surgery remain controversial , and this inconsistency in risk factors may have several causes . the pathophysiology of post - mus vd is not well understood .
the inconsistent definitions of vd after mus may be responsible for the wide spectrum of vd reported in various studies .
the types of vd evaluated and the timing of symptom presentation can influence the definitions adopted in the literature .
colposuspension and pubovaginal sling operations have been replaced by midurethral synthetic slings , which are currently accepted as the gold standard for the management of sui .
voiding difficulties appear to be more likely after colposuspension than after the transvaginal tape ( tvt ) procedure .
furthermore , as operative methods evolve , the severity of vd tends to be reduced .
the tot procedure appears to have a lower incidence of postoperative retention than does retropubic tvt . in studies on burch colposuspension and pubovaginal slings , many authors investigated post - mus vd with use of the criteria of the need for surgical revision or the need for catheterization for several weeks .
in one pooled meta - analysis , the rates of reoperation for urinary retention were reported as 3.0% ( range , 2.3%-3.9% ) of the population who received a pubovaginal sling compared with 1.2% ( range , 0.9%-1.7% ) and 1.1% ( range , 0.7%-1.5% ) of the tvt and tot populations , respectively . in the era of mus surgery , many studies have investigated vd under the criteria of objective voiding parameters or subjective voiding symptoms . in the present study , compared with the tvt group , the tot group had a lower frequency of vd ( 4% vs. 7% ; risk ratio , 0.53 ; 95% ci , 0.43 - 0.65 ) .
another pitfall of the study of vd is the lack of consensus on which parameters are important voiding problems .
the method used for the voiding trial just after catheter removal can influence the incidence of vd .
furthermore , intervention methods such as indwelling bladder catheterization or intermittent catheterization for retention affect the recovery period . in one study ,
urinary retention was acknowledged when catheterization lasted at least 4 weeks , whereas in another study this parameter was at least 1 day . in the present study ,
significant pvr was considered to be a pvr of more than 50% of voided volume , whereas others have adopted a cutoff of 100 ml pvr .
it is also debated whether to catheterize for obstructive voiding symptoms or not . in the tvt population ,
more severe cases underwent a releasing operation , which occurs in 1.2% of the population with tvt . in studies of tot ,
the majority definitions applied for vd are decreased objective voiding parameters or subjective voiding difficulties . in the tot population , 7.6% to 26% show mild postoperative vd . the diversity and complexity of vd after sui correction require various criteria to evaluate postoperative obstructive voiding problems .
we applied several criteria to elucidate the incidence and risk factors of vd . in our cohort , all patients underwent the tot procedure as opposed to pubovaginal sling or tvt .
therefore , there were few severe complications such as reoperation for releasing ( 0.4% ) or retention requiring catheterization ( 2.2% ) .
subjective postoperative voiding difficulty occurred in 10.5% of patients , and 3.3% had simultaneous voiding difficulty and significant pvr .
the various vd rates in our cohort were comparable to those of other previous studies on tot .
many studies have been performed to investigate preoperative urodynamic and clinical parameters for predicting vd after sling surgery . in one study
, concomitant vaginal surgeries did not affect the rates of vd in terms of retention or requiring a releasing operation .
high preoperative pvr , low preoperative qmax , and low detrusor pressure during a pressure - flow study have been indicated as significant risk factors for postoperative vd after antiincontinence surgeries . in another study , however , there were no definite risk factors for post - mus vd among the urodynamic parameters . in our study
, preoperative qmax and underactive detrusor appeared to predict postoperative vd by use of some criteria .
on the whole , our data showed subjective preexisting obstructive voiding symptoms ( e.g. , urinary hesitancy , slow stream , intermittent flow , and incomplete emptying ) to be risk factors . with regard to other risk factors excluding urodynamic study parameters , spinal anesthesia compared with general anesthesia appeared to be a risk factor for significant pvr in our results .
these inconsistencies may originate from our incomplete data , which were retrospectively collected , and the small number of patients with a history of preoperative retention . in terms of satisfaction
, there was a report that a high level of satisfaction with operative results is associated with greater cure rates and fewer complications . in our study , however , there were no significant differences in cure rates or satisfaction rates between the vd group and the non - vd group except for the criterion of retention .
follow - up loss after 3 months was seen in up to half of the patients .
this was compensated for by use of a telephone survey at 1 year postoperatively . during the follow - up period , the examinations performed were diverse , including cystoscopy , radiologic study , and postoperative urodynamic study .
furthermore , it was impossible to examine the optimal timing for the proper management of prolonged retention or voiding difficulties .
these criteria represent the wide spectrum of post - mus vd from mild subjective complaints to severe obstructive voiding symptoms requiring prolonged catheterization . with these various criteria ,
postoperative vd can be predicted and managed more efficiently . although there were no consistent preoperative risk factors in our study
, our data suggest that preoperative obstructive voiding symptoms , preoperative retention history , and objective voiding parameters suggesting impaired detrusor function may predict vd . a more sophisticated analysis in a large | purposethe definition of posttransobturator tape procedure ( post - tot ) voiding dysfunction ( vd ) is inconsistent in the literature . in this study , we retrospectively investigated the risk factors for post - tot vd by applying various definitions in one cohort.materials and methodsthe medical records of 449 patients were evaluated postoperatively .
acute urinary retention requiring catheterization , subjective feeling of voiding difficulty during follow - up , and postoperative postvoid residual ( pvr ) greater than 100 ml or pvr greater than 50% of voided volume ( significant pvr ) were adopted for the definition of vd . with these categories ,
multivariate analysis was performed for risk factors of postoperative vd.resultsten patients ( 2.2% ) required catheterization , 47 ( 10.5% ) experienced postoperative voiding difficulty , and 63 ( 14.7% ) showed significant pvr . in the multivariate logistic analysis , independent risk factors for postoperative retention requiring catheterization were previous retention history ( p=0.06 ) and preoperative history of hysterectomy .
risk factors for subjective postoperative voiding difficulty were underactive detrusor ( p=0.04 ) and preoperative obstructive voiding symptoms ( p<0.01 ) .
previous urinary retention history ( p<0.01 ) ) was an independent risk factor for concomitant postoperative voiding difficulty and significant pvr .
spinal anesthesia ( p=0.02 ) and previous urinary retention history ( p=0.02 ) were independent risk factors for significant postoperative pvr.conclusionswith the use of several definitions of vd after the midurethral sling procedure , postoperative peak flow rate and pvr were significantly different between groups . although there were no independent risk factors consistent with various definitions of vd , preoperative obstructive voiding symptoms and objective parameters suggesting impaired detrusor tend to have predictive power for post - tot vd . | INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUSIONS |
foreign body injuries with date thorns , metal and wooden splinters are common in middle east region , as most of it is desert .
some of the injuries lead to cellulitis or abscess formation , if neglected or improperly managed results in osteomyelitis or septic arthritis of foot structures .
this is the first report of isolated navicular osteomyelitis following neglected foreign body in a paediatric foot .
a 10 year old male patient presented with discharging sinus in left mid - foot 3 years after penetrating injury with wooden splinter .
patient was treated with complete removal of foreign body ( wooden splinters ) , surgical debridement and combination of iv and oral cloxacillin for period of 6 weeks . at 18 months
follow up , patient had painless foot with no recurrence or collapse of navicular bone .
the neglected foreign body can result in osteomyelitis of small bones of foot in pediatric patient .
the ultrasound is more useful tool in localizing foreign bodies ; those are not radio - opaque . early and
prompt diagnosis with adequate treatment of established osteomyelitis by complete removal of foreign body , curettage and antibiotics can give good results .
the majority of oman is geographically a desert and 25% of children account for total population residing in suburban , rural areas and most walk with open foot wear for daily activities .
thus they are exposed to wide range of injuries from simple puncture wounds to complete penetration caused by date thorns and wooden splinters .
most of deep seated infections of structures of foot reported in literature are commonly due to prick injuries related to thorns , nails .
however , no case of isolated osteomyelitis of navicular bone caused by neglected foreign body has been reported in literature .
pain and inability to bear weight are the main concerns of the affected patient , as the mobility is impaired
we present a previously healthy 10 year old boy , presented with history of on and off pain in the left foot for 3 months duration .
later , patient presented with swelling in the foot , which progressed to rupture . on further evaluation into past history
, he gives history of penetrating injury with wooden splinter 3 years back . on presentation , there was discharging sinus over medial border of mid foot corresponding to navicular bone with mild swelling and tenderness over plantar aspect without any antecedent systemic symptoms .
plain x - rays revealed multiple osteolytic lesions involving the navicular bone with osteoporosis and intact articular surface without collapse ( fig .
pre - operative ultrasound suggested fragments of foreign body with surrounding collection on plantar aspect of mid - foot .
2 ) pre - op x - ray : showing osteolytic lesion involving navicular bone with intact cortex pre - op ct scan : showing multiple osteolytic lesions involving whole of navicular bone without involving adjacent joints surgical exploration was done through two incisions . through plantar incision ,
the wooden splinters with surrounding pockets of frank pus drained from deeper layer of foot and sent for cultures ( fig .
there was sinus tract lined by granulation tissue extending from wooden splinter ( foreign body ) to the exterior on medial aspect on navicular bone perforating the bone itself .
navicular bone was curetted with small dental bur and debridements of wounds were done through the medial incision .
patient was prescribed initial 2 weeks of iv cloxacillin followed 4 weeks of oral cloxacillin , as the pus culture yielded staphylococcus aureus sensitive to cloxacillin .
the foot was protected in plaster and non weight bearing for period of 10 weeks .
lazy s incision over medial aspect of foot , exposing wooden splinters second incision over medial aspect of midfoot including sinus the removed specimen of wooden splinters
foreign body penetration injuries are very much common in middle east region especially in children .
foreign bodies can be retained for a significant time before diagnosis , as high a 15 years . in our case ,
the majority of osteomyelitis of paediatric foot bones are either primary or heamotogenous in origin , mainly involving calcaneum , talus , navicular , cuboid and metatarsal bones .
most common organisms were staphylococcus aureus or group a streptococcus however , pseudomonas is common organism found in deep infection following plantar punctured wounds . to the best of our knowledge ,
this is the first report of neglected foreign body as the cause of isolated navicular osteomyelitis in pediatric foot .
delayed presentation is a significant marker for deep - seated infection . further infection or relapse after initial improvement suggests the presence of osteomyelitis or a retained foreign body .
clinical signs were minimal compare to early presentation of patients with osteomyelitis . since much of the spreading foot sepsis from puncture wounds is deep to the deep fascia , and because the sole of the foot has thick skin and subcutaneous fibrous septae , crepitus is not as easily appreciated as it is at other sites .
also the rubor of the inflammatory response is minimal in subfascial sepsis and it is therefore easy to underestimate the extent of deep gangrene most of foreign bodies initiate a low grade inflammatory activity without causing infection .
ultrasound is more useful tool in localizing foreign bodies ; those are not radio - opaque , especially when there is lack of mri facility .
however , ultrasound , computed tomography or magnetic resonance imaging should be considered for initial evaluation of these patients with penetrating injuries .
the ct scans correctly predicted the presence or absence of osteomyelitis and proved helpful in evaluating foot problems . in our case
, we did not do either mri or bone scan for better evaluation of pathology . in countries with limited resources
, the emphasis should be on clinical assessment for diagnosis , and good surgical technique for treatment .
-at 18 months follow up , patient had painless foot without recurrence and collapse of navicular bone .
the complete removal of foreign body , debridement and curettage was the key to successful treatment .
ultrasound is more useful tool in localizing foreign bodies ; those are not radio - opaque . early and
prompt diagnosis with adequate treatment of established osteomyelitis by complete removal of foreign body , curettage ofbone and antibiotics can give good results . | introduction : foreign body injuries with date thorns , metal and wooden splinters are common in middle east region , as most of it is desert .
some of the injuries lead to cellulitis or abscess formation , if neglected or improperly managed results in osteomyelitis or septic arthritis of foot structures .
this is the first report of isolated navicular osteomyelitis following neglected foreign body in a paediatric foot.case report : a 10 year old male patient presented with discharging sinus in left mid - foot 3 years after penetrating injury with wooden splinter .
the diagnosis of navicular osteomelitis is confirmed with plain radio - graphs .
the ultrasound of foot was done to localize the foreign bodies .
patient was treated with complete removal of foreign body ( wooden splinters ) , surgical debridement and combination of iv and oral cloxacillin for period of 6 weeks . at 18 months
follow up , patient had painless foot with no recurrence or collapse of navicular bone.conclusion:the neglected foreign body can result in osteomyelitis of small bones of foot in pediatric patient .
the ultrasound is more useful tool in localizing foreign bodies ; those are not radio - opaque .
early and prompt diagnosis with adequate treatment of established osteomyelitis by complete removal of foreign body , curettage and antibiotics can give good results . | Introduction:
Case Report:
Conclusion:
Introduction
Case Report
Discussion
Conclusion |
computed tomography ( ct ) angiography is an established modality for evaluation of a variety of peripheral vascular disorders including peripheral arterial diseases ( pad ) and peripheral vascular malformations . besides increasing detector rows allowing shorter acquisition time ,
an equally important component of this success is the evolution of techniques to trigger the scan at an appropriate time . over the years ,
bolus tracking technique in ct has become the most popular and is a time - tested technique . in patients with asymmetrical pad
, variable transit time of contrast through the diseased vessels can render their opacification inadequate .
such pitfalls can also occur in patients with vascular malformations of the extremities which has not been highlighted in the literature to the best of our knowledge .
we present a case of lower limb arteriovenous malformation ( avm ) , where bolus tracking technique failed to trigger the scan acquisition as the threshold hounsfield value ( hu ) could not be attained .
a 27-year - old female , a diagnosed case of left foot avm , presented with asymmetrical enlargement of the left lower limb since childhood and recent onset bleeding from the foot following trivial trauma . on examination , there was swelling of left lower limb , predominantly of the left foot and leg .
oozing of fresh blood was noted from a small ulcer over the lateral aspect of foot .
a ct angiography ( cta ) was planned to evaluate the avm and contemplate angioembolization .
cta was performed on a 64-detector ct scanner ( lightspeed vct ; ge healthcare , buckinghamshire , uk ) at 120 kvp , 250 ma , collimation of 0.625 mm , and reconstruction interval of 1.25 mm , pitch of 0.5 , and scan time of 9 sec .
one hundred milliliters of iohexol ( omnipaque 300 ; ge healthcare , princeton , nj , usa ) was injected without a saline flush at a rate of 4 ml / sec through an 18-gauge cannula placed in the right antecubital fossa .
a circular region of interest ( roi ) was placed covering approximately two - thirds of the abdominal aortic diameter below the level of renal vessels .
real - time hu versus time plot revealed gradual increase in enhancement that reached a maximum hu value of 150 at 20 sec after which the plot showed a falling trend , failing to reach the desired hu of 200 .
evaluation of cta images revealed early opacification of veins in the left lower limb [ figures 2 and 3 ] .
a fall in the enhancement value following initial increase to a peak of 150 hu was noted , causing a critical lapse in the functioning of automatic triggering of scan acquisition .
image from the monitoring phase of cta shows the roi placed in the lumen of abdominal aorta ( upper panel ) .
plot of enhancement ( y - axis ) versus time ( x - axis ) in the lower panel reveals initial rise followed by a fall in the peak enhancement subtracted coronal volume - rendered ( vr ) image reveals the abnormal tangle of vessels on the dorsum of foot ( arrows ) and dilated , tortuous early filling veins ( short arrows , compare with the right lower limb ) sagittal maximum intensity projection ( mip ) image reveals a large number of vessels in the leg ( arrows ) suggestive of early filling veins
contrast detection and appropriate timing of scan acquisition is a critical component of cta and an error of a few seconds can render the study non - diagnostic . amongst the various methods of contrast timing ( fixed scan delay , test bolus technique , and bolus tracking technique ) ,
bolus tracking technique is the most efficient for optimizing contrast enhancement in the peripheral arteries .
this technique employs a single low - dose non - contrast ct image at the level of abdominal aorta .
a circular roi , 10 - 15 mm , is placed inside the aortic lumen . following a delay of 10 sec after iv contrast injection ,
serial low - dose monitoring ct scans are acquired at the same table position as the non - contrast scan at a pre - determined interval ( usually 2 sec ) .
when the preset enhancement level is achieved within the roi , the table is moved into position for beginning the scan and automatic triggering of scan occurs .
this allows a real - time assessment of contrast enhancement characteristics leading to a highly precise timing of scan acquisition with a secondary advantage of reduced contrast requirement compared to the test bolus technique .
suggested that the bolus tracking technique yields more homogeneous enhancement than does the test bolus technique .
others , however , have found that with the use of appropriate timing , test bolus technique can yield similar results to bolus tracking .
the threshold for triggering the scan is rather arbitrary and ranges anywhere between 50 and 150 hu depending on the ct scanner and the operator .
however , the mean arterial attenuation values ranging between 232 hu and 281 hu have been found in patients with augmented peripheral arterial flow due to vascular grafts .
an arterial attenuation of 200 hu or more has also been suggested for better differentiation of arteries and veins on multidetector cta ( mdcta ) .
another issue is the additional delay required between the detection of optimal contrast enhancement and actual initiation of scanning .
this delay , varying from 2 to 9 sec , depends on the table position and the ct scanner capabilities .
a remedy to long delay in scan initiation is using a lower enhancement threshold . yet another problem with this method of contrast timing
if the roi is not placed properly in the center of the vessel , erroneous triggering occurs , yielding non - diagnostic studies .
adequate contrast opacification is also dependent on patient - related factors like weight , gender , height , and cardiac output , injection rate and duration , iodine concentration , anatomical area of scan coverage , as well as scanner specifications and duration of scanning .
bolus tracking , as employed in our case , substantially overcomes the individual variability of cardiac output .
however , the failure to reach the threshold value in the absence of cardiac compromise can be due to various factors .
the peripheral high - flow avm can result in a localized hyperdynamic circulation with a rapid run off from the arteries into the arterio - venous - precapillary anomalous connections .
this would lead to decrease in local circulation time as well as greater mixing of contrast with unopacified inflowing blood in the volume of interest in the absence of cardiac function derangement , both leading to inability to attain predetermined threshold values .
, where instead of a uniphasic or biphasic rate of contrast injection , an exponentially decreasing rate is used .
however , this needs to have be an inbuilt commercially available tool for implementation at the time of data acquisition . optical sensor based tracking of the contrast bolus has also been recently described which offers the possibility of radiation - free monitoring of contrast kinetics .
saline chase is a standard technique in cta as it has been shown to decrease the contrast volume and reduce artifacts . monye
reported slightly higher attenuation with the addition of bolus chaser to 80 ml of contrast material in carotid ct angiography .
thus , in the present case , lack of saline chase may have contributed to the inadequate cta . in the present case , an interesting pitfall of bolus tracking technique is documented .
avm of lower limb causes early filling of the deep veins with rapid mixing of the fresh contrast bolus with unopacified arterial inflow during first - pass flow .
the resultant fall in the hu value in the roi leads to erroneous interpretation and failure of scan triggering .
unnecessary delay due to such a technical lapse can cost a cta study as arterial washout occurs during this period .
we suggest that in case of suspected avm of the periphery where cta is planned , test bolus technique may be a better method of scan timing , though at the cost of a greater contrast and radiation dosage .
modification in cta scan timing technique is required in patients with peripheral avm as the bolus tracking technique may fail to achieve adequate scan timing in these patients .
the purpose of highlighting this case is to bring to the forefront the often unreported or glossed over suboptimal scans due to suboptimal vascular opacification .
close visual monitoring is needed during acquisition to detect a fall in peak enhancement early so that scanning can be immediately initiated manually .
the threshold value also needs to be kept low as a localized decrease in circulation time would allow rapid mixing of unopacified blood and contrast dilution .
automatic triggering methods should ideally be in place to initiate the scanning in case a fall in peak enhancement is present before reaching the threshold value . instead of a
one size fits all approach , each scan must be tailored with meticulous attention to each of the variable factors like patient age , sex , weight , and cardiac output , and the area of interest .
there is a need for a commercially available algorithmic approach inbuilt into the scanners , which takes into account these factors before scanning is initiated . | multidetector computed tomography angiography ( mdcta ) has become a well - established modality for limb angiography for a variety of indications .
the technique of mdcta depends on the scanner features including the number of detector rows , rotation speeds and single or dual source energy .
integral to a diagnostic quality cta is the acquisition timing .
various techniques are available for determining the appropriate timing of scan acquisition which includes fixed delay , test bolus and the bolus tracking technique .
the transit times of contrast from the aorta to the peripheral arteries shows a wide variability and is dependent upon the inter individual hemodynamic states .
the bolus tracking technique is the most preferred one which allows reliable scan timing with acceptable contrast volume and radiation dose .
pitfalls with all these techniques are well described and we report one such technical pitfall in a case of left foot arteriovenous malformation ( avm ) where the bolus tracking technique employed for scan triggering failed to initiate acquisition . | Introduction
Case Report
Discussion
Conclusion |
viruses exploit the molecular machinery of the infected host to support their own life cycle and target host defense mechanisms to escape host resistance .
this is achieved by establishing a virus - specific protein interaction network that perturbs cell processes , such as dna replication , gene expression , growth and differentiation ( 1,2 ) .
a prerequisite for a complete understanding of a virus life cycle is a proteome - wide description of the complexes formed by viral proteins , either on their own or in combination with host proteins . over the past decades ,
a growing number of small- or large - scale studies reported evidence for interactions between viral and host proteins .
although this information can in principle be extracted from generic protein interaction databases , 5 years ago we developed virusmint ( 3 ) , a protein - protein interaction ( ppi ) database focused on viral interactions .
this offered two advantages : an increased focus of the mint ( 4 ) curation team on the curation of viral interactions and the development of a dedicated website that could archive information useful for the community of experimental virologists .
virhostnet ( 5 ) , a second resource dedicated to virus interactions , adopted the strategy of merging various data sources .
this database contains re - curated data extracted from primary resources that use different curation strategies .
this approach has generated a network consisting of nearly 5000 non - redundant interactions between viral and host proteins .
however , the integration strategy adopted by this resource implies substantial work making updates infrequent . as a consequence ,
as technologies to identify protein interactions evolve , generic or specialized journals regularly report new viral host protein interaction information ( 6,7 ) .
this abundance of data demands for a strategy to capture and integrate this information regularly , with minimal hands - on effort . in order to automate data merging
, we recently implemented a resource called mentha that automatically integrates the content of five different ppi databases ( 8) . by exploiting a similar automatic procedure we created virusmentha , a resource that builds on the work started in virusmint by offering the curated data from our group combined with the data captured from the other imex ( 9 ) partners . every week
, virusmentha integrates the virus host interactions curated by the imex databases removing redundancy . differently from other valuable resources
, virusmentha is not exclusively focused on specific organisms or viruses , such as hcvpro ( http://cbrc.kaust.edu.sa/hcvpro/ ) ( 10 ) or hiv host - interaction map ( http://www.ncbi.nlm.nih.gov/projects/refseq/hivinteractions/ ) ( 11 ) .
virusmentha captures all published virus host interactions without limitation with respect to virus strain or to host organism .
it also offers interactions between viral proteins and different host organisms , such as homo sapiens , mus musculus , arabidopsis thaliana and so on .
molecular interaction evidence is reported in the scientific literature in natural language format , thus making retrieval and processing a difficult task ( 12,13 ) .
the data contained in virusmint is manually curated by our curation team in compliance with imex standards . in order to further expand the coverage of the virus virus and virus host interactome
, we decided to integrate our data with data curated and stored in the databases of the imex partners .
imex is an international consortium whose purpose is to make protein interaction curation more efficient by distributing the curation load and by limiting the duplication of effort .
imex standards represent a seal of quality among the several ppis repositories ( 14 ) .
the databases that we chose to integrate are mint , intact ( 15 ) , dip ( 16 ) , matrixdb ( 17 ) and biogrid ( 18 ) .
virhostnet data were not imported because the database does not fully conform to psi - mi standards and does not provide enough experimental details .
the procedure used for data merging is the same as the one developed for mentha .
mentha retrieves data from external resources using the psicquic ( proteomics standard initiative common query interface ) protocol ( 19 ) which provides standard programmatic access to molecular interaction repositories . using the ontology trees defined by imex
, the procedure identifies whether two pieces of evidence are actually the same piece of evidence described at different levels of curation depth .
virusmentha exploits the same procedure and offers direct access to evidence of viral protein interactions .
the mentha procedure detects redundancy using the psi - mi tab file provided by the five source databases listed above .
the key information to identify redundancy are supported by every database of the imex consortium , i.e. interaction type , experimental method , publication i d .
however , these databases do not offer the same version of psi - mi tab file .
mint and intact are currently the two major databases in the imex consortium that offer psi - mi tab 2.7 format defined in psicquic .
the psi - mi tab file format has been updated to version 2.7 to allow curators to add extra information , such as for instance the polypeptide fragment ( of viral polyproteins ) involved in the interaction . in order to preserve the richness of such format ,
virusmentha implements a detailed view if the evidence is curated by databases supporting psi - mi tab 2.7 .
the classification is based on the baltimore classification which is based on the nucleic acid content of the virion ( 20,21 ) .
this classification is generally used in conjunction with the ictv ( the international committee on taxonomy of viruses ) classification system in order to create a tree of viral species ( 22 ) .
this figure shows the strategy used by virusmentha to group all viruses into families . on the right ,
the taxonomy tree is used to map back to the viral family , highlighted by red ovals . in order to give access to this hierarchy of viral strains and families ,
we have reconstructed the taxonomy tree of viruses using the classification information provided by uniprot ( 23 ) . in this taxonomy tree , as show in figure 1 , the first level is defined as per the baltimore classification while families are defined according to the ictv classification system . in order to handle this taxonomic hierarchy , the retrieval and integration procedure of virusmentha analyses each interaction and for each viral protein in the interaction it extracts its taxonomy i d ( organism ) .
the mapping procedure is illustrated in figure 1 . using the taxonomy tree , each virus strain ( taxonomy number )
is mapped to the most general viral family , without dropping the original strain identifier .
over the past years , the mint curation team has curated a large number of articles using a detailed curation policy .
the integration of virusmint data with other databases on a weekly basis resulted in the most comprehensive and self - updating resource available so far . on august 2014 ,
virusmentha contained up to 8084 non - redundant interactions supported by 8450 publications ( figure 2 ) .
( a and b ) venn diagrams to show the relative contribution to the virusmentha data set of the curation effort of virusmint and that of the others imex databases .
( b ) the pie chart represents the number of interactions of the main virus families as annotated in virusmentha .
searches in the virusmentha data set can be carried out directly from the home page by entering in the search field uniprot ids , gene names , polypeptide names , keywords or single pmid ( pubmed publication i d ) . to offer direct access to the virusmentha data set we implemented the possibility of searching and downloading viral interaction evidence from a virus or host perspective .
the user can decide to search the entire database or to restrict the search to specific organisms or viral families .
the search results are presented as a list of proteins whose gene name , uniprot i d , description or pmid matches the query .
the user can select the proteins of interest by adding them to the protein bag. all the interactions related to the selected proteins can be browsed either as a list in a table format or in a network view by starting a graphical applet .
the user who wants to compare the same protein from different isolates can use the align button , to see their similarities ; the alignment is performed on the fly using blosum62 as substitution matrix , with the following penalties : open : 10 ; extend : 0.5 .
experimental details linked to each interaction can be accessed by clicking the show evidence button . together with the link to the original paper , the interaction detection method and the interaction type of the experiment are displayed .
moreover , by clicking to the magnifier icon , a pop - up window opens showing the curation details as per psi - mi tab 2.7 . in the binary interaction result page it is possible to filter relevant interactions using keywords .
for instance , the user can search a specific human protein that interacts with several types of herpes simplex virus strains and , using the field provided , restrict the list only to the patton strain .
the virusmentha interface has been developed to facilitate the assembly and modification of networks of interactions .
the networks built by the user through various searches and/or network manipulations can be downloaded as a plain text file .
finally , for each protein virusmentha reports the associated gene ontology terms ( 24 ) , links to antibodies through antibodypedia ( 25 ) , cleaved polypeptides and , for each interaction , the mint score and links to papers supporting the interaction are reported ( figure 3 ) .
the user is presented with a list a gag - pol genes from several hiv isolates .
each gene is accompanied with essential information extracted from uniprot including the polypeptide fragments processed inside the virion .
( b ) if the user loads one of these proteins into the protein bag and clicks list , all binary interactions are presented in a table - like view , together with details about papers supporting the interaction .
( c ) alternatively , the collected proteins can be browsed by displaying the interactions with a graphic applet .
virusmint was developed as a public repository to capture and organize manually curated information about interactions between viral and host proteins .
virusmentha extends this concept to offer the most comprehensive and self - updating resource for viral interactions available so far .
in addition , virusmentha exploits the curation potential of five different database curation teams by integrating data curated by databases adhering to the imex consortium .
in addition , virusmentha continues to benefit from the virusmint curation team that regularly captures data published in peer - reviewed scientific journals .
finally , virusmentha has the advantage of being regularly and automatically updated every week . according to google scholar
, virusmint has been cited in 100 papers ( 99 in august 2014 ) testifying the interest of the community of virologists for such a dedicated protein interaction repository . as more relevant information
is reported in the scientific literature , we expect the higher coverage and curation depth that characterize virusmentha to become a valuable resource for more comprehensive analysis of viral mechanisms and interactions .
; italian association for cancer research [ n ig 2013 n.14135 to g.c . ] .
funding for open access charge : oncodiet project of the italian ministry of education [ rbap11lp2w to g.c . ] ; italian association for cancer research [ n ig 2013 n.14135 to g.c . ] . | viral infections often cause diseases by perturbing several cellular processes in the infected host .
viral proteins target host proteins and either form new complexes or modulate the formation of functional host complexes . describing and understanding the perturbation of the host interactome following viral infection is essential for basic virology and for the development of antiviral therapies . in order to provide a general overview of such interactions , a few years ago we developed virusmint .
we have now extended the scope and coverage of virusmint and established virusmentha , a new virus virus and virus
host interaction resource build on the detailed curation protocols of the imex consortium and on the integration strategies developed for mentha .
virusmentha is regularly and automatically updated every week by capturing , via the psicquic protocol , interactions curated by five different databases that are part of the imex consortium .
virusmentha can be freely browsed at http://virusmentha.uniroma2.it/ and its complete data set is available for download . | INTRODUCTION
IMPLEMENTATION
TAXONOMY ORGANIZATION
DATA GROWTH AND STATISTICS
WEB INTERFACE
CONCLUSION AND PERSPECTIVES
FUNDING |
when compared with abdominal hysterectomy ( ah ) and laparoscopic - assisted vaginal hysterectomies ( lavh ) , tlh has been reported to result in shorter procedure durations , lower blood losses , and shorter hospital stays .
typically , vaginal hysterectomy ( vh ) and lavh are performed in patients with at least moderate prolapse usually associated with parity , but some of these patients may later develop vaginal prolapse or incontinence .
one recent report describes recurrence of prolapse in 12% of patients having a vaginal hysterectomy with vaginal vault suspension compared with 4% having a laparoscopic uterosacral ligament uterine suspension . among nulliparous patients
, the vaginal dissection may be difficult due to absence of prolapse and small vaginal capacity and may result in more complications .
tlh may offer a minimal blood loss , short hospital stay , and be practicable in most women with minimal risk of complications , but randomized trials are lacking .
a recent cochrane meta - analysis of hysterectomy approaches reviewed 24 randomized trials of 3643 women , but only 2 trials with 71 women were identified for type vii tlh .
very few contemporary newly trained gynecologists will have sufficient expertise and confidence to tackle tlh , which requires the highest level of surgical skill .
they concluded that [ t]he newest approach to hysterectomy ( tlh ) should be further evaluated .
it is speculated that if a tlh technique used familiar open technique standards and was observed to be safe in a large retrospective series , potentially more surgeons would learn and safely perform the technique , and randomized controlled trials could be designed to compare the various routes . in this article ,
technique and complications are reviewed and analyzed in great detail so that surgeons learning and newly performing tlh may avoid complications , and subsequent randomized trials could be planned .
all tlh cases were identified from computerized billing lists by using the current procedure terminology codes for all types of hysterectomy .
approval by the investigation review board at sequoia hospital in redwood city , california , has been maintained with yearly updates .
all consecutive , eligible patients were offered simple tlh for every benign gynecologic indication , stage ia1 ( < 37 mm invasion ) cervical cancer , occult ovarian cancer , and clinical stage iia or less endometrial cancer .
patients were ineligible if they had documented severe abdominal adhesions from a prior operative report , or endometrial cancer in a uterus too large for intact removal through the vagina .
every surgery was performed by the author ( kao'h ) from september 5 , 1996 to april 1 , 2006 , at 4 california hospitals , assisted by a categorical obstetrics and gynecology resident , a gynecologist , or a general surgeon . for clarification in this article , the technique used for this type vii tlh
the patient is in modified lithotomy position with hips extended , in a 40-degree angle trendelenburg position .
shoulder bolsters prevent slippage up the table , and the arms are padded and tucked by the side . after the examination with the patient anesthetized , a humi uterine manipulator ( cooper surgical , inc .
trumbull , ct , usa ) is inserted , unless the patient has endometrial cancer , in which case the manipulator is inserted after laparoscopic washings and bipolar cautery occlusion of the proximal fallopian tubes .
after visual inspection of the ureter at the pelvic brim , the infundibulopelvic ligament , or , utero - ovarian ligament is coagulated and incised with an ultrasonic scalpel ( ethicon endo - surgery , cincinnati , oh , usa ) .
immediately after the round ligament is incised , the uterus , on the uterine manipulator , is pushed cephalad to recreate the traction - counter - traction
a bladder flap is incised and the anterior cervical fascia is exposed with blunt dissection off of the cervix broadly below the cervicovaginal margin .
the uterine arteries are coagulated with a bipolar cautery at the mid lower cervical length , and then incised with the ultrasonic scalpel .
the uterine arteries are pushed downward to expose the cardinal ligament fibers attaching the arteries to the cylindrical cervical fascia ; then the cardinal fibers are incised posteriorly to the uterosacral ligaments , and inferiorly , identifying the cervicovaginal margin as the lowest limit of dissection .
the cervicovaginal margin is laparoscopically palpated with the laparoscopic instruments by using visual and manual cues to delineate the posterior margin , the lateral edges , and the anterior margin of the cervical stroma ( figure 1 ) .
typically , the cervical stroma is firm and moves as a solid object , and the vaginal wall is pliant and dimples with pressure . if the cervicovaginal margin is not obvious , a thin malleable ribbon is inserted into the anterior vagina and elevated , identifying the anterior - most cervicovaginal margin .
then the ultrasonic scalpel incises into the vagina at the precise margin of the cervix and vagina ( figure 2 ) .
when the pneumoperitoneum is lost , the uterine manipulator is removed and a surgical glove containing 2 fluffed 44 gauze sponges is inserted to obturate the lower vagina .
two semb toothed cupped graspers ( # a5261 , olympus surgical , orangeburg , ny , usa ) are used to expose the cervicovaginal margin for ultrasonic incision around the cervix .
a tenaculum is inserted through the vagina ( under or beside the glove ) to grasp the cervix and remove the uterus . when the uterus is large , but only in the absence of endometrial cancer , it is morcellated transvaginally .
any pelvic mass is placed intact in a lapsac surgical tissue pouch ( # 054100 , cook urological , spencer , in , usa ) for frozen section .
the edges of the pouch are brought out through the introitus , and a speculum is inserted into the pouch , allowing puncture or morcellation and removal of the mass with no intraperitoneal spillage .
the vaginal apex is closed with # 1 polygalactic acid jk10 ( ethicon endo - surgery , cincinnati , oh , usa ) suture in 3 or more figure - of - eight ( technically spiral ) sutures with semb graspers and a wolfe needle driver ( # 8393.502 , richard wolf surgical instruments , vernon hills , il , usa ) , fixing the vaginal angle to the uterosacral ligaments for suspension .
anova , chi - square , and spearman and pearson correlation techniques were used with significance set at p<0.05 .
the right lower uterine segment is seen with suction irrigator delineating the posterior cervicovaginal margin .
after incising the cardinal ligament , the pliant vaginal wall is palpated laterally , anteriorly , and posteriorly to confirm the location of the cervicovaginal margin .
three had massive myomata in the lower uterine segment obstructing laparoscopic ligation of the uterine arteries .
the fourth patient was converted to laparotomy to explore a limited retroperitoneal bleeding site that was identified as a likely trocar injury .
the fifth patient had persistent bleeding of the left infundibulopelvic vessels that had retracted into the retroperitoneum .
preoperative diagnoses additional procedures performed with total laparoscopic hysterectomy * some patients had more than one procedure .
all cases of malignancy were managed with strict standards of oncological principles : pelvic masses were removed intact in a ripstop nylon bag .
the typical patient in this series had a mean age of 50.1 years ( sd=11.0 ; range , 21 to 90 ) .
the average parity was 1.3 ( sd=1.3 ; range , 0 to 9 ) with 38.2% ( n=315 ) of these women being nulliparous .
their mean body mass index ( bmi ) was 27.8 kg / m ( sd=7 ; range , 16 to 71 ) with 57% ( n=468 ) of the women being in the overweight or higher bmi range ( > 24.9kg / m ) .
surgical duration was abstracted from operating room records and included all gynecologic procedures and incidental appendectomy .
patients requiring staging lymphadenectomy and omentectomy for malignancy , or other general surgical procedure such as cholecystectomy were not included in the duration analysis .
the mean surgery duration was 130 minutes ( sd=56 ; range , 28 to 355 ) .
over one fifth ( 23.7% ) of patients ' surgeries were completed in 90 minutes or less . neither age ( r=0.025 , p=0.513 ) , body mass index ( r=0.060 , p=0.115 ) , nor parity ( t=1.896 , p=0.058 ) impacted duration , but the increasing number of cases performed by the surgeon reduced duration ( r=0.448 , p<0.001 ) .
blood loss was estimated by examining the contents in the canister before irrigation , or by surgeon and anesthesiologist agreement .
the average blood loss was 130 ml ( sd=178 ; range , 0 to 1200 , median 75 ) with 16% of patients ( n=132 ) losing less than an estimated 10ml of blood .
this estimate is made when there is virtually no observable blood lost during the procedure , little or none observed in the pelvic cul de sac at the end of the procedure , and little or none lost from the laparoscopic incisions .
more than half of the patients lost less than 50 ml of blood . while age ( r = 0.018 , p=0.633 ) and bmi ( r=0.050 , p=0.184 ) did not correlate with blood loss , lower parity ( t = 2.91 , p=0.004 ) and increasing experience ( r=0.247 , p<0.001 ) correlated with reduced blood loss .
transfusions , mostly related to complications , were needed in 3.0% of women ( 11.0 vs. 1.7% , p=0.0001 ) , especially a reoperative complication ( 13 vs. 2.4% ,
age was not significantly related to having a transfusion ( t=0.09 , p=0.93 ) , nor was bmi ( t=0.7109 , p=0.48 ) . however , those requiring transfusions had longer surgery ( t=3.50 , p=0.000 ) and more days in the hospital ( t=2.35 , p=0.028 ) .
the median uterine weight was 160 , and the mean was 239 g , ( sd = 291 ; range , 50 to 3131 ) .
of the 632 with recorded uterine weights , 16% were between 250 grams and 499 g , and 12% were between 500 grams and 3131 g. bmi did not impact uterine weight ( r=0.056 , p=0.156 ) ; however , increasing age correlated with smaller uteri ( r = 0.113 , p=0.004 ) .
having a larger uterus correlated with increased surgical time ( r=0.268 , p<0.001 ) and more blood loss ( r=0.347 , p<0.001 ) .
seven nulliparous , obese patients with bmi ranging from 31 to 46 , and massive uteri , had a tlh followed by a planned 6-cm pfannenstiel incision used only for evacuation of the disconnected uterine tissue , weighing 1047 g to 3131 g. only evacuation of tissue was performed through the pfannenstiel incisions .
the pfannenstiel incisions were immediately closed , and the remainder of the case , including suture of the vaginotomy , was completed laparoscopically . had any portion of these cases required laparotomy for completion of the hysterectomy / oophorectomy dissection , these cases would have been classified as converted or as a laparoscopic - assisted abdominal hysterectomy .
the average hospital stay was 1.37 days ( sd=0.97 ; range , 0 to 13 , median , 1 day ) .
duration of hospital stay was recorded only by days , not hours ; however , 73% of patients left the hospital by lunchtime the next day .
longer stays were not associated with age , bmi , parity , or uterine size , but did correlate with longer surgical times ( r=0.347 , p<0.001 ) and more blood loss ( r=0.346 , p<0.001 ) .
the length of hospital stay decreased with the increasing number of cases performed by the surgeon ( r=0.452 , p<0.001 ) .
complications occurred in 83 patients ( 10% ) , and of those complications about half required reoperation ( 39 patients , 4.7% ; table 3 ) .
urologic complications occurred in 23 ( 2.8% ) patients and resulted in reoperation in about half ( 1.4% ) .
complications were more likely to occur in women with a lower bmi ( or 0.95 ; 95% ci=0.90 to 0.99 ) , with a high surgical blood loss ( or 1.002 ; 95% ci=1.001 to 1.003 ) resulting in longer operating times ( or 1.007 ; 95% ci=1.003 to 1.012 ) and a longer length of stay in the hospital ( or 1.78 ; 95% ci=1.39 to 2.28 ) .
the demographics , diagnoses , and surgicopathological data reflect a broad diversity of consecutive patients and demonstrate a broad utility for tlh .
senior age and high bmi are not contraindications to tlh . because type vii tlh does not depend on vaginal descensus , capacity , or laxity , minimally invasive hysterectomy is available to more women , including the nulliparous and obese . with a 38% nulliparity rate , few of these patients would have qualified for a vh or an lavh .
agostini et al report a high rate of successful vaginal hysterectomy in their 52 nulliparous patients , but their complication rate was 13.46% , higher than our total complication rate for this subset ( 10.82% ) , and much higher than our reoperative rate ( 4.5% ) in this subset .
their hemorrhage rate was 7.69% , which was much higher than our transfusion rate of 3.2% .
this report responds to their conclusion that laparoscopic assistance for nulliparous women having hysterectomy needed further investigation .
their findings underscore the benefit of performing the entire surgery laparoscopically rather than struggling through a narrow vagina to reach a cervix with no descensus .
it is unfortunate that operating time for tlh only was not recorded in the operating room records .
the mean operating time of 132 minutes is thus an overestimate of the time needed for tlh only .
the duration decreased with surgeon 's experience , with the last 100 cases taking 99 minutes or less . in controlled trials ,
type vii tlh has been observed to take the same or slightly more time than ah , similar or shorter time than lavh , and 53 minutes longer than vh .
it is a weakness of this study that blood loss was not measured in a more precise fashion . in randomized trials ,
type vii tlh confers less blood loss than ah and lavh do , and confers a similar blood loss as that of vh .
precise assessment of patient hospital stays would have required calculation of the hours from the end of surgery to the hour of discharge .
patients stayed in the hospital 2 days ; however , in the second half of the series , it became routine to discharge patients on postoperative day one .
this has caused no problems , and no readmissions have been observed for an extra day of observation .
randomized trials reveal that type vii tlh confers a shorter hospital stay than do ah and lavh , and a similar stay as that of vh .
uterine size did not correlate with increasing likelihood of complication ( p=0.6705 ) , urologic complication ( p=0.5782 ) , or conversion to laparotomy , as others have seen .
lower uterine segment fibroids in 3 cases precluded access to the uterine arteries necessitating conversion to laparotomy for bleeding control .
preoperative evaluation of the parametrium of patients with lower uterine segment fibroids can identify patients with an increased risk of laparotomy .
laparoscopic myomectomy for optimal visualization of the cervical anatomy is used when lower uterine fibroids are large .
the total complication rate of 9.8% and major complication rate of 4.5% in this series are comparable to rates in other tlh series ( table 3 ) .
hoffman et al had a total and major complication rate of 10% and 5.6% , while heinberg et al had a major complication rate of 14.4% , and chapron reported complications in 10% . a complication rate of 13.4% has been observed for vh performed on nulliparous women , and 18% for vh after cesarean delivery . in randomized , controlled trials , type vii tlh conferred fewer complications , fewer wound infections , similar urologic complication rates , and was more cost effective than was ah , and resulted in comparable complications as lavh and vh .
six categories of complications are analyzed for possible prevention strategies : urologic injuries , intestinal injuries , hemorrhagic events , infections , wound healing problems , and retained device complications .
nineteen ( 2.3% ) patients had a urological injury , with half requiring reoperation : 3 cystoscopic ureteral stent placements , 4 ureteral reimplantations , and 2 laparotomies for closure of bladder fistula .
tlh urological injury rates are reported at 2.5% to 3.4% and 2.2% in the first half of one series , decreasing to 0.9% in the second half .
six injuries occurred during bladder flap dissections in patients with large lower uterine fibroids ( uterine weights all > 510 g ) and 3 with prior cesarean deliveries .
one injury occurred during dissection of the anterior abdominal wall peritoneum to access the space of retzius for a burch procedure . to repair these , a running 3- 0 polygalactic acid suture in 2 layers
it was successful in all but 2 patients who required laparotomy for successful repair after developing delayed breakdown of the laparoscopic cystotomy repair .
when the margins of the bladder are not obvious before any dissection , inflating the bladder with a small amount of carbon dioxide can effectively delineate the edges . by clamping a hemostat on the foley catheter , attaching the insufflator tubing to it , and slowly opening the clamp while laparoscopically watching the bladder inflate with a small amount of carbon dioxide
, patients typically have scarring on the upper portion of the anterior cervix and lower uterine segment , extending as low as the middle level of the cervix , but rarely ever lower . to dissect below this scar to unoperated vesicocervical fascia ,
the broad ligament adventitia is opened widely along the anterolateral aspect of the cervix until below the scar , where the smooth anterior white fascia of the cervix is easily separated from the bladder . then cutting ultrasonic dissection of the scar
ureterotomy or ureteral transsection with immediate and successful repair occurred in 2 patients . in one case very early in the series ( case # 31 ) ,
in the other , redundant peritoneum was being trimmed after the completed hysterectomy for a massive , predominantly retroperitoneal fibroid uterus , without reconfirmation of the ureteral location . in both cases ,
a stent was inserted cystoscopically , and laparoscopically placed in the proximal portion of the ureter , with ureteroureterostomy by using 4 - 0 vicryl suture on the spatulated ends , and peritoneal closure without a drain . constant attention to the ureteral location would have prevented both injuries .
eight ureteral fistulae developed postoperatively , most in the first third of the series , due to 2 sites of potential injury.it is well known that lack of recognition of the ureter in the lateral parametrial canal when ligating the uterine artery can result in ureteral injury 4 cm to 5 cm from the ureterovesical junction .
an additional site of ureteral injury has come about solely through tlh due to the lack of precise recognition of the cervicovaginal margin and dissection too far down the vagina .
dissection below the cervicovaginal margin can injure the ureter 2 cm to 3 cm from the ureterovesical junction . in open cases
, surgeons have easily avoided this injury by carefully palpating the cervicovaginal margin between thumb and forefinger .
surgeons keep the uterus on traction - counter - traction during laparotomy and feel the cervicovaginal margin repeatedly before incising into the vagina precisely at the cervicovaginal margin .
the standard for laparoscopic surgeons must be the same : always know the exact site of the cervicovaginal margin by palpating the cervicovaginal margin with laparoscopic instruments to feel the precise change from the firmness of the cervical body to the pliancy of the vaginal wall , anteriorly , posteriorly , and laterally .
when any of these landmarks are in question , a long right - angled heaney retractor or 1-inch ribbon is inserted to the anterior vagina and elevated , and the vaginotomy is performed safely onto the retractor 's edge at the anterior central cervicovaginal margin .
cystoscopy after tlh should be performed in any case in which bladder or ureteral integrity is in question , to confirm closure of any repaired defect or to confirm patency of ureters after procedures , such as uterosacral ligament plications or burch colposuspensions .
a 5-mm laparoscope can be used after instilling saline in the bladder with the suction irrigator .
no indigo carmine is required to see the ureteral jets . using the irrigator and laparoscope gently as described
three intestinal injuries occurred in the series ; only one was recognized immediately and repaired .
one patient had slippage of the trocar outside of the abdominal cavity , with reinsertion performed without direct observation , through the bowel wall , requiring a figure - of - eight imbrication of both sites with 3- 0 polygalactic acid suture .
the other 2 were occult injuries , presenting on days 7 and 29 , possibly from a lighted scope left in the abdomen touching the bowel , or inadvertent injury from ultrasonic scalpel dissection .
three patients developed obstructive small - bowel adhesions to the vaginal apex , as evidenced by prolonged ileus and radiological demonstration of small - bowel obstruction at the vaginal apex .
vaginal hemorrhage , retroperitoneal hemorrhage , and intraabdominal hemorrhage occurred in 11 ( 1.3% ) , 6 ( .8% ) , and 5 ( .7% ) patients , respectively , as observed in other series .
of the 11 patients with vaginal hemorrhage , 5 occurred in the recovery room with immediate return to the operating room for additional suture placement vaginally .
using at least 3 figure - of - eight ( technically spiral ) sutures along the vaginal apex seems essential , even when there is good hemostasis of the cuff edge .
six patients developed brisk arteriolar cuff bleeding on days 7 through 10 , and 4 required sutures in the office .
none of these 4 patients were diagnosed with a coagulopathy ; however , the suture material appeared dissolved in each .
two patients had bleeding remote from the hospital and were observed in an emergency room without suture . of the 11 patients with abdominal or retroperitoneal hemorrhage , 6 were managed expectantly because they maintained normal vital signs or presented long after discharge with hematoma , which resolved .
two had unexpectedly intense pain in the first 12 hours after surgery , which might have been an early warning symptom .
no bleeding sites were identified in any of the reoperative cases , and none required laparotomy .
nine patients ( 1% ) were diagnosed with pelvic cellulitis and received oral antibiotics with resolution of symptoms .
five ( 0.4% ) patients were suspected of having pelvic abscess : 2 had 3.0-cm fluid collections with ct aspirate of clear sterile fluid .
three had abscess : 2 were laparoscopically irrigated and drained , while one patient required laparotomy .
four patients developed small - bowel herniation into a 5-mm trocar site , with 3 diagnosed after discharge from the hospital .
each patient developed nausea and abdominal distension ; and ct was confirmatory in all cases . in each case , laparoscopic release resulted in recovery of bowel function after 3 days .
herniation into a 5-mm trocar may occur with more degrees of instrument manipulation stretching the fascial incisions .
five patients have had partial vaginal dehiscence , most after sexual penetration after the 6-week postoperative vaginal examination .
one patient developed complete dehiscence of the vaginal apex 18 days after her surgery , and required operative repair .
none of the other 4 patients required surgical repair , but all patients were advised to use a 1-cm thick foam ring around their partner 's penis during sexual activity to prevent their deepest penetration for the next 3 months .
there have been no further incidents since warning all patients of the 1% chance of rupture with deep penetration after 6 weeks .
an 8-mm segment of metal element from the bipolar cautery was retrieved laparoscopically from 1 patient in postoperative week 4 .
most of the gynecological , hemorrhagic , infectious , and general surgical complications were addressed laparoscopically , vaginally , or locally .
while all of the urological complications were treated by laparotomy except for cystoscopic stenting , this statistic will likely shift in time to laparoscopic repair .
nineteen ( 2.3% ) patients had a urological injury , with half requiring reoperation : 3 cystoscopic ureteral stent placements , 4 ureteral reimplantations , and 2 laparotomies for closure of bladder fistula .
tlh urological injury rates are reported at 2.5% to 3.4% and 2.2% in the first half of one series , decreasing to 0.9% in the second half .
six injuries occurred during bladder flap dissections in patients with large lower uterine fibroids ( uterine weights all > 510 g ) and 3 with prior cesarean deliveries .
one injury occurred during dissection of the anterior abdominal wall peritoneum to access the space of retzius for a burch procedure . to repair these , a running 3- 0 polygalactic acid suture in 2 layers
it was successful in all but 2 patients who required laparotomy for successful repair after developing delayed breakdown of the laparoscopic cystotomy repair .
when the margins of the bladder are not obvious before any dissection , inflating the bladder with a small amount of carbon dioxide can effectively delineate the edges . by clamping a hemostat on the foley catheter , attaching the insufflator tubing to it , and slowly opening the clamp while laparoscopically watching the bladder inflate with a small amount of carbon dioxide ,
, patients typically have scarring on the upper portion of the anterior cervix and lower uterine segment , extending as low as the middle level of the cervix , but rarely ever lower . to dissect below this scar to unoperated vesicocervical fascia
, the broad ligament adventitia is opened widely along the anterolateral aspect of the cervix until below the scar , where the smooth anterior white fascia of the cervix is easily separated from the bladder . then cutting ultrasonic dissection of the scar
ureterotomy or ureteral transsection with immediate and successful repair occurred in 2 patients . in one case very early in the series ( case # 31 ) ,
parametrial dissection landmarks were distorted by large lower uterine segment fibroids . in the other , redundant peritoneum was being trimmed after the completed hysterectomy for a massive , predominantly retroperitoneal fibroid uterus , without reconfirmation of the ureteral location . in both cases ,
a stent was inserted cystoscopically , and laparoscopically placed in the proximal portion of the ureter , with ureteroureterostomy by using 4 - 0 vicryl suture on the spatulated ends , and peritoneal closure without a drain .
eight ureteral fistulae developed postoperatively , most in the first third of the series , due to 2 sites of potential injury.it is well known that lack of recognition of the ureter in the lateral parametrial canal when ligating the uterine artery can result in ureteral injury 4 cm to 5 cm from the ureterovesical junction .
an additional site of ureteral injury has come about solely through tlh due to the lack of precise recognition of the cervicovaginal margin and dissection too far down the vagina .
dissection below the cervicovaginal margin can injure the ureter 2 cm to 3 cm from the ureterovesical junction . in open cases , surgeons have easily avoided this injury by carefully palpating the cervicovaginal margin between thumb and forefinger .
surgeons keep the uterus on traction - counter - traction during laparotomy and feel the cervicovaginal margin repeatedly before incising into the vagina precisely at the cervicovaginal margin .
the standard for laparoscopic surgeons must be the same : always know the exact site of the cervicovaginal margin by palpating the cervicovaginal margin with laparoscopic instruments to feel the precise change from the firmness of the cervical body to the pliancy of the vaginal wall , anteriorly , posteriorly , and laterally .
when any of these landmarks are in question , a long right - angled heaney retractor or 1-inch ribbon is inserted to the anterior vagina and elevated , and the vaginotomy is performed safely onto the retractor 's edge at the anterior central cervicovaginal margin .
cystoscopy after tlh should be performed in any case in which bladder or ureteral integrity is in question , to confirm closure of any repaired defect or to confirm patency of ureters after procedures , such as uterosacral ligament plications or burch colposuspensions .
a 5-mm laparoscope can be used after instilling saline in the bladder with the suction irrigator .
no indigo carmine is required to see the ureteral jets . using the irrigator and laparoscope gently as described
three intestinal injuries occurred in the series ; only one was recognized immediately and repaired .
one patient had slippage of the trocar outside of the abdominal cavity , with reinsertion performed without direct observation , through the bowel wall , requiring a figure - of - eight imbrication of both sites with 3- 0 polygalactic acid suture .
the other 2 were occult injuries , presenting on days 7 and 29 , possibly from a lighted scope left in the abdomen touching the bowel , or inadvertent injury from ultrasonic scalpel dissection .
three patients developed obstructive small - bowel adhesions to the vaginal apex , as evidenced by prolonged ileus and radiological demonstration of small - bowel obstruction at the vaginal apex .
vaginal hemorrhage , retroperitoneal hemorrhage , and intraabdominal hemorrhage occurred in 11 ( 1.3% ) , 6 ( .8% ) , and 5 ( .7% ) patients , respectively , as observed in other series .
of the 11 patients with vaginal hemorrhage , 5 occurred in the recovery room with immediate return to the operating room for additional suture placement vaginally .
using at least 3 figure - of - eight ( technically spiral ) sutures along the vaginal apex seems essential , even when there is good hemostasis of the cuff edge .
six patients developed brisk arteriolar cuff bleeding on days 7 through 10 , and 4 required sutures in the office .
none of these 4 patients were diagnosed with a coagulopathy ; however , the suture material appeared dissolved in each .
two patients had bleeding remote from the hospital and were observed in an emergency room without suture . of the 11 patients with abdominal or retroperitoneal hemorrhage ,
6 were managed expectantly because they maintained normal vital signs or presented long after discharge with hematoma , which resolved .
two had unexpectedly intense pain in the first 12 hours after surgery , which might have been an early warning symptom .
no bleeding sites were identified in any of the reoperative cases , and none required laparotomy .
nine patients ( 1% ) were diagnosed with pelvic cellulitis and received oral antibiotics with resolution of symptoms .
five ( 0.4% ) patients were suspected of having pelvic abscess : 2 had 3.0-cm fluid collections with ct aspirate of clear sterile fluid .
three had abscess : 2 were laparoscopically irrigated and drained , while one patient required laparotomy .
four patients developed small - bowel herniation into a 5-mm trocar site , with 3 diagnosed after discharge from the hospital .
each patient developed nausea and abdominal distension ; and ct was confirmatory in all cases . in each case , laparoscopic release resulted in recovery of bowel function after 3 days .
herniation into a 5-mm trocar may occur with more degrees of instrument manipulation stretching the fascial incisions .
five patients have had partial vaginal dehiscence , most after sexual penetration after the 6-week postoperative vaginal examination .
one patient developed complete dehiscence of the vaginal apex 18 days after her surgery , and required operative repair .
none of the other 4 patients required surgical repair , but all patients were advised to use a 1-cm thick foam ring around their partner 's penis during sexual activity to prevent their deepest penetration for the next 3 months .
there have been no further incidents since warning all patients of the 1% chance of rupture with deep penetration after 6 weeks .
an 8-mm segment of metal element from the bipolar cautery was retrieved laparoscopically from 1 patient in postoperative week 4 .
most of the gynecological , hemorrhagic , infectious , and general surgical complications were addressed laparoscopically , vaginally , or locally .
while all of the urological complications were treated by laparotomy except for cystoscopic stenting , this statistic will likely shift in time to laparoscopic repair .
this technique for type vii tlh appears safe and allows excellent access to the entire abdomen as needed in cancer surgeries , for patients with pelvic mass , endometriosis , pain , or adhesions with minimal morbidity .
a total laparoscopic capability makes the benefits of a minimally invasive approach available to more women , including obese and nulliparous women . with an understanding of the complications from this technique
, it is hoped that complications can be avoided and that more surgeons will safely learn tlh
. experienced laparoscopic surgeons are urged to initiate needed randomized clinical trials of type vii tlh . | objective : this study analyses the technique and complications from total laparoscopic hysterectomy.methods:retrospective chart abstraction was performed on 830 consecutive patients operated on between 1996 and 2006 .
demographic and surgical data were analyzed by anova , chi - square , and spearman and pearson correlation techniques were used with significance set at p<0.05.results : of 830 consecutive patients , 5 ( 0.6% ) were converted to laparotomy .
patients had a mean age of 50 ( 11 ) years , a mean of 1.3 ( 1.3 ) pregnancies , and a mean bmi of 27.6 ( 6.8 ) kg / m2 .
the mean surgical duration was 132 ( 55 ) minutes , with mean blood loss of 130 ( 189 ) ml and average hospital stay of 1.4 ( 0.9 ) days .
duration of surgery , blood loss , and hospital stay all decreased with the surgeon 's increasing experience .
reoperative complications occurred in 38 patients ( 4.7% ) .
urologic injuries were observed in 23 patients ( 2.6% ) , with 9 ( 1.1% ) requiring reoperation.conclusions:this technique for tlh offers the benefits of minimally invasive surgery for patients needing hysterectomy , even those without vaginal capacity and uterine prolapse . | INTRODUCTION
METHODS
RESULTS
DISCUSSION
Urologic Injuries
Intestinal Injuries
Hemorrhagic Events
Infections
Wound Healing Problems
Retained Device
CONCLUSION |
recurrent cutaneous ( necrotizing ) eosinophilic vasculitis is a rare eosinophilic vasculitis of unknown etiology that runs a chronic course .
this benign condition remains limited to the skin manifesting as pruritic purpuric papules and plaques with angioedema .
it shows good response to systemic steroids ; but almost always needs long - term maintenance therapy . here ,
we report a female patient with recurrent cutaneous eosinophilic vasculitis who required low dose prednisolone to maintain disease control .
forty - five - year - old female patient attended our institution with intensely pruritic , persistent red raised lesions over forearms , legs , palms , and soles of 5 years duration .
she did not give a history of bronchial asthma , allergic disorders , or any other systemic diseases .
no food item or drug was found to precipitate the lesions . with the diagnosis of erythema multiforme ,
she was treated at a nearby hospital with prednisolone 20 mg daily to which her skin lesions responded . tapering the dose of prednisolone to 2.5 mg always brought out recurrences
; hence , she was continued on 5 mg prednisolone for the past 5 years .
one month before attending our outpatient department , the patient stopped prednisolone as per the advice of her clinician in an attempt to withdraw steroids which resulted in exacerbation of skin lesions .
as no control could be achieved with antihistamines and emollients , she was referred to us .
clinical examination revealed multiple , discrete , and confluent purpuric papules and plaques distributed over forehead [ figure 1 ] , neck , abdomen , and limbs .
erythematous , purpuric discrete , and confluent papules and plaques on the forehead of a patient with recurrent cutaneous eosinophilic vasculitis angioedema of lips in recurrent cutaneous eosinophilic vasculitis complete hemogram , absolute eosinophil count , peripheral smear analysis , bleeding and clotting time , and prothrombin time with international normalized ratio , urine microscopy , and renal and liver function tests were within normal limits .
serology was negative for infections due to mycoplasma and herpes simplex , hepatitis a , b , and c , and human immunodeficiency viruses .
chest radiography , electrocardiogram , and ultrasonogram of abdomen and pelvis were within normal limits .
biopsy was taken from a lesion on the right upper arm and was sent for histopathology analysis and immunofluorescence study .
histology revealed perivascular inflammatory infiltrate [ figure 3 ] predominantly composed of eosinophils with fibrinoid necrosis of vessel walls and extravasation of erythrocytes [ figure 4 ] conclusive of eosinophilic vasculitis .
skin biopsy showing perivascular inflammatory infiltrate in recurrent cutaneous eosinophilic vasculitis ( h and e , 100 ) ( a ) high power view of the biopsy specimen from the skin lesions of recurrent cutaneous eosinophilic vasculitis showing the eosinophils infiltrating the walls of small dermal vessels and fibrinoid necrosis of vessel walls ( h and e , 400 ) .
( b ) another section of the same biopsy revealing eosinophils invading the vessel walls with fibrinoid necrosis and extravasation of erythrocytes ( h and e , 1000 ) serum cryoglobulins and antineutrophil cytoplasmic antibodies were negative . serum complement level ( c1q , c3 , and c4 ) and immunoglobulin profile were within normal limits .
radiography of paranasal sinuses , computerized tomogram of the thorax , and nerve conduction study ( peripheral neuropathy can be a manifestation of idiopathic hypereosinophilic syndrome or churg strauss vasculitis ) returned normal results .
since a detailed evaluation ruled out any underlying systemic disease and since there was no systemic involvement , we arrived at a diagnosis of recurrent cutaneous eosinophilic vasculitis .
her skin lesions resolved in 710 days . on tapering steroids , the patient remained symptom free up to a dose of 5 mg daily . trying to reduce the dose to 2.5 mg precipitated a flare up ; hence , she was advised to continue prednisolone at 5 mg / day .
now , after 4 months patient is well maintained on 5 mg prednisolone with no more recurrences .
described three patients who presented with pruritic purpuric papules , annular urticarial plaques , and angioedema .
the chronic course , the clinical picture , and the histopathology feature pointed to the diagnosis of recurrent cutaneous eosinophilic vasculitis in our patient .
peripheral blood eosinophilia , which is documented as a common finding of recurrent cutaneous eosinophilic vasculitis was conspicuously absent in our case . a similar finding was documented by tsunemi et al .
lack of peripheral blood eosinophilia persisting for more than 6 months and absence of systemic involvement ruled out the possibility of idiopathic hypereosinophilic syndrome in our patient .
patient giving no history of bronchial asthma , lack of peripheral blood eosinophilia , and absent extravascular granuloma on histology were against a diagnosis of churg
eosinophilic vasculitis without any leukocytoclasia observed on biopsy performed on a 4 days old lesion in our patient excluded urticarial vasculitis .
erythema multiforme was unlikely in our patient since the two common precipitating infections ( herpes simplex and mycoplasma ) were ruled out , and since she was not on any medications prior to the disease onset .
histologically also erythema multiforme differs by featuring keratinocyte necrosis , interface dermatitis , and dermal infiltrate composed of mixed inflammatory cells .
abnormal eosinophil mediated - immune response against an unidentified antigen is proposed to play a role in the pathogenesis of recurrent cutaneous eosinophilic vasculitis .
it is postulated that interleukin-5 , c4 , and platelet - activating factor released by eosinophils may increase vascular permeability and induce purpuric papules and angioedema .
so far no systemic associations are noted for recurrent cutaneous eosinophilic vasculitis , though a positive serology for antinuclear antibody is documented in occasional cases .
li et al . reported a case of recurrent cutaneous eosinophilic vasculitis in a patient with psoriasis , but no correlation was established between the two .
this rare vasculitis responds well to systemic steroids , but often requires long - term maintenance dose as observed in our patient .
other therapeutic options found useful are systemic tacrolimus , indomethacin , and suplatast tosilate ( a drug found useful in atopic dermatitis ) .
we did not come across any previous reports of recurrent cutaneous eosinophilic vasculitis from india , and we found only one other case of the same that manifested without peripheral blood eosinophilia .
we report this case to highlight the existence of this rare entity and to underscore the need for long - term systemic steroid therapy .
we did not come across any previous reports of recurrent cutaneous eosinophilic vasculitis from india , and there is only one other instance when it has been reported without peripheral blood eosinophilia .
there are no conflicts of interest . we did not come across any previous reports of recurrent cutaneous eosinophilic vasculitis from india , and there is only one other instance when
there are no conflicts of interest . we did not come across any previous reports of recurrent cutaneous eosinophilic vasculitis from india , and there is only one other instance when | recurrent cutaneous necrotizing eosinophilic vasculitis is a rare entity described by chen et al .
it has a benign course without any systemic involvement .
however , often long - term treatment with systemic steroids is required .
the exact etiopathogenesis remains unknown .
we report a female patient , who presented with recurrent pruritic purpuric papules and plaques affecting different body parts of long duration .
disease was well controlled with low dose systemic steroids , but invariably recurred on its withdrawal .
histology revealed the features of eosinophilic vasculitis .
subsequent detailed evaluation ruled out systemic involvement , underlying diseases , and any precipitating factors .
hence , a diagnosis of recurrent cutaneous eosinophilic vasculitis was made .
patient showed excellent response to prednisolone , and on tapering the drug , it was found that she needed a maintenance dose of 5 mg / day .
we did not come across any previous reports of recurrent cutaneous eosinophilic vasculitis from india . | Introduction
Case Report
Discussion
None
Financial support and sponsorship
Conflicts of interest |
clinically amyopathic dermatomyositis ( cadm ) , a subtype of dermatomyositis ( dm ) , with little or no muscle involvement , is frequently accompanied by rapidly progressive interstitial lung disease ( rp - ild ) , which is resistant to aggressive immunosuppressive therapy and often fatal ( 1 - 3 ) .
the detection of the antibody to cadm-140/melanoma differentiation - associated gene 5 ( mda5 ) is diagnostic for cadm , and is strongly associated with the pathogenesis , disease activity , and mortality of rp - ild ( 4 - 6 ) .
the mortality rate of anti - mda5 antibody - positive cadm patients who develop rp - ild is reported to be approximately 50% , with most deaths occurring during the very early stages of the illness ( 7,8 ) . to our knowledge , there have been no reports of patients experiencing multiple deteriorations of anti - mda5 antibody - associated ild .
this report describes the case of an anti - mda5 antibody - positive cadm patient who experienced three deteriorations of ild over 9 years .
a 59-year - old japanese woman presented to our hospital with a high fever and erythema on her elbows and knees that had started 2 weeks previously .
she had no relevant medical history , and no history of cigarette smoking or allergies .
a physical examination revealed gottron 's papules , periungual erythema , the shawl sign , scaling erythema on both knees and elbows , and fine crackles at the bases of both lungs .
we did not observe muscle weakness , myalgia , reverse gottron 's sign or skin ulcers .
a chest x - ray revealed ground glass opacities ( ggo ) in both lower lung fields ( fig .
chest computed tomography ( ct ) revealed bilateral lower consolidation , non - septal plate - like opacity , intralobular septal thickening , and traction bronchiectasis ( fig .
laboratory analyses revealed an erythrocyte sedimentation rate of 93 mm / h , a c - reactive protein concentration of 1.9 mg / dl , a kl-6 level of 1,147 iu / l , an sp - d concentration of 250 ng / ml , a creatinine kinase level of 303 iu / l , and an aldolase level of 5.1 iu / l .
she was diagnosed with possible dermatomyositis ( 9 ) and treatment with oral prednisolone ( psl ; 30 mg / day ) was initiated .
chest x rays of our patient at the onset ( a ) and after the first ( b ) , second ( c ) , and third ( e ) deteriorations of ild , showing the peripheral infiltration in the lower lung field and volume loss . a chest x ray taken during remission , between the second and third deteriorations ,
chest ct scans of our patient at the onset ( a ) and after the first ( b ) , second ( c ) , and third ( e ) deteriorations of ild , showing peribronchovascular consolidation in the dorsal lungs and non - septal plate - like opacities , intralobular septal thickening , traction bronchiectasis , and peripheral intralobular reticular opacities .
the longitudinal levels were not the same , because typical patterns are shown in this figure .
a chest ct scan taken during remission , between the second and third deteriorations , is shown for comparison ( d ) .
one year later , the patient presented with dyspnea on exertion ( doe ) , low - grade fever , and the worsening of gottron 's papules and scaling erythema .
an arterial blood gas ( abg ) analysis in ambient air revealed partial pressure oxygen ( pao2 ) level of 74.7 torr in the arterial blood and a partial pressure carbon dioxide ( paco2 ) level of 37.5 torr .
chest x - ray and ct revealed the worsening of peripheral intralobular reticular opacities , bilateral patchy consolidations , and ggos , which were dominant along the bronchi in the dorsal lung ( fig .
treatment with cyclosporine and psl ( 30 mg / day ) , improved her symptoms and chest x - ray findings , but she developed general malaise and thrombocytopenia .
four years after the first visit , she experienced a second deterioration while taking low - dose psl ( 10 mg / day ) as a maintenance therapy .
she presented with doe , a high fever , a productive cough , and the worsening of gottron 's papules and the shawl sign .
1c ) , and chest ct showed peripheral intralobular reticular opacities and subpleural non - segmental patchy ggos ( fig . 2c ) .
she was diagnosed with the deterioration of ild and started on high - dose methylprednisolone ( 500 mg / day ) for 3 days , followed by psl ( 30 mg / day ) .
we recommended that she start taking an immunosuppressive agent , but she refused due to the adverse effects to the drugs that she had experienced at the time of the first deterioration .
moreover , her response to steroid treatment was fairly good , her symptoms improved and she was discharged .
her psl dose was gradually tapered , and she was maintained on psl ( 5 mg / day ) as an outpatient .
the chest x - ray and chest ct findings showed that she remained in remission at 8 years after the initial visit ( fig .
nine years after the first visit , she again presented with doe , a high fever , the worsening of gottron 's papules , periungual erythema , the shawl sign , and scaling erythema ( fig .
3 ) . an abg analysis in ambient air revealed a pao2 value of 71.3 torr and a paco2 value of 42.2 torr .
her serum levels of kl-6 and ferritin were 652 u / ml and 162 ng / ml , respectively , but her ck and aldolase levels were within the normal limits .
the levels of anti - cyclic citrullinated peptide ( ccp ) and anti - centromere antibodies were also elevated , but arthritis , scleroderma , dysphagia and constipation were not observed . a hand x - ray and echocardiography revealed no bone erosion or pulmonary hypertension .
1e ) , while chest ct showed multiple , random , peribronchial consolidation and ggos that were dominant in the dorsal lung ( fig .
assays of her bronchoalveolar lavage fluid showed a cell count of 1.910/l , with a cell differential of 89% macrophages and 11% lymphocytes , but no pathogens .
she was again diagnosed with a deterioration of ild and was treated with high - dose methylprednisolone ( 500 mg / day ) for 3 days , followed by the tapering of the methylprednisolone to 40 mg / day .
the patient 's rash and dyspnea improved , as did the new consolidations that were observed on her chest ct scans .
the outcomes of her two previous deteriorations suggested that low - dose corticosteroid therapy was insufficient .
thus , following corticosteroid pulse therapy , she was started on azathioprine ( 100 mg / day ) .
she developed nausea and vomiting which was suspected to be an adverse effect to azathioprine ; thus , she was switched to tacrolimus ( 1.4 mg / day ) . since being discharged 12 months ago
, she has remained well and is being maintained on low - dose corticosteroid and tacrolimus without adverse effects .
the skin symptoms of this patient , showing ( a ) periungual erythema ( arrows ) and gottron s papules ( arrowheads ) , and ( b ) scaling erythema on the elbows .
muscle weakness and myalgia were not observed throughout her clinical course , and her ck and aldolase levels were normal , peaking at 303 iu / l and 7.8 iu / l , respectively .
her clinical course of mild recurrent deteriorations initially suggested that the ild was associated with an antibody to aminoacyl transfer rna synthetase ( ars ) ( 1 ) , but she was negative for anti - ars antibodies , including antibodies to jo-1 , pl-7 , pl-12 , oj , and ej .
she was also negative for antibodies to mi-2 , ro-52 , pm75 , pm100 , signal recognition particle , u1-ribonucleoprotein , and ssa .
however , immunoprecipitation assays revealed that she was positive for the anti - mda5 antibody , which led to a diagnosis of anti - mda5 antibody - associated ild .
she was initially diagnosed with dm at year 0 , and experienced acute deteriorations of ild during years 1 , 4 , and 9 .
after the first deterioration , she was treated with cyclosporine ( 125 mg / day ) plus psl ( 30 mg / day ) .
after the second and third deteriorations , she was treated with methylprednisolone ( 500 mg / day ) .
after the third deterioration , she was also treated with azathioprine , but was later switched to tacrolimus . at the third deterioration , anti - mda5 antibodies were detected . at the present time , 12 months after the third deterioration , she remains well and is continuing treatment with low - dose corticosteroids and tacrolimus .
to our knowledge , this is the first description of an anti - mda5 antibody - positive ild patient who experienced multiple deteriorations . following each deterioration ,
this patient showed a good response to immunosuppressive therapy . in patients with dm , specific antibodies , including those directed against mda5 and ars ,
the anti - mda5 antibody is a useful prognostic marker for this disease , which is associated with rp - ild , a condition with a high mortality rate .
rp - ild is usually resistant to immunosuppressive therapy , and patients with this condition require early treatment with high - dose corticosteroids and immunosuppressive agents .
most deaths occur during the very early stages of illness , usually within 6 months of diagnosis .
a small retrospective analysis reported that the long - term prognosis of patients with anti - mda5 antibodies who survive the first 6 months is generally good and that the recurrence rate is very low ( 7 ) .
however , the long - term clinical course and prognosis of cadm patients with anti - mda5 antibody - associated ild remain unclear .
anti - ars antibody - positive ild patients have a chronic and recurrent clinical course , as well as a more favorable response to treatment than anti - mda5 antibody - positive ild patients ( 1 ) .
the clinical course of our patient suggested that her ild was associated with anti - ars antibodies .
the long - term clinical course of our patient indicates that cadm - ild patients can experience recurrent deteriorations .
the reduction of the steroid dose in this patient was not associated with the second and third deteriorations of ild , since the steroid dose had been tapered more than 2 years before the deterioration .
the recurrent deteriorations that were observed in this patient may therefore have been caused by her maintenance therapy , which consisted of low - dose steroid therapy without immunosuppressants .
a retrospective study from the united states found that rp - ild only occurred in 22% of anti - mda5 antibody - positive patients , a rate that is significantly lower than that in patients of asian ethnicity ( 12 ) .
approximately 90% of japanese patients who are positive for anti - mda5 antibodies develop ild , with a mortality rate of approximately 40% .
in addition to the antibody itself , the genetic variations among these patients may influence the progression of ild ( 13 ) .
although the phenotyping of dm patients according to their specific antibodies is important in guiding treatment decisions , distinct forms may exist .
second , the favorable response of this patient to treatment may have been due to the severity of rp - ild .
the general risk factors for rp - ild in dm patients include high pre - treatment serum levels of ferritin and high alveolar - arterial oxygen gradients ( 14 ) . at the time of the third deterioration ,
our patient 's serum ferritin level and alveolar - arterial oxygen gradient were both low , suggesting that this patient belongs to a low - risk group .
there is no consensus on the ideal regimen or the intensity of immunosuppressive therapy for cadm - ild patients who are in remission , nor is there a consensus on the management of patients with stable ild in association with dermatomyositis .
the combination of an immunosuppressive agent and prednisolone has been recommended for maintenance of dermatomyositis - associated ild , as is the gradual tapering of prednisolone with the careful monitoring of disease activity ( 15 ) .
the findings in our patient indicate that cadm - associated ild can be chronic and recurrent , suggesting that combination therapy is required in the management of cadm - ild even during the remission phase .
first , our patient was also positive for anti - ccp and anti - centromere antibodies , suggesting that these antibodies may be associated with ild . however , neither rheumatoid arthritis nor systemic sclerosis was diagnosed , which may have been due to the low - dose steroid therapy ( 16,17 ) .
the deterioration of ild in this patient was related to the deterioration of her skin symptoms , including gottron 's papules and the shawl sign , both of which are specific for dm ; thus , she was diagnosed with cadm - associated ild . moreover , her chest ct findings revealed lower consolidation , peripheral intralobular reticular opacities , and non - septal plate - like opacities , findings that are typical in patients with anti - mda5 antibody - positive ild ( 18 ) .
second , we only tested the patient for anti - mda5 antibodies after the third deterioration , which made it difficult to determine whether the anti - mda5 antibody had been associated with the two prior deteriorations .
however , the presence of ggos , the consolidation patterns , and the exacerbation of her skin symptoms during the three deteriorations were quite similar , suggesting that all three deteriorations were associated with the same etiology . in summary , we have described the case of a cadm patient with an unusual clinical course who developed three mild deteriorations of ild over 9 years .
further research is warranted to understand the distinct clinical course of ild in anti - mda5 antibody - positive patients . | anti - mda5 antibody - positive patients with clinically amyopathic dermatomyositis ( cadm ) are at high risk of developing rapidly progressive interstitial lung disease ( ild ) , which is associated with a high mortality rate . approximately half of the patients with ild recover ; however , the long - term clinical course of these patients has not been fully reported and is not completely understood .
this report describes the atypical clinical course of an anti - mda5 antibody - positive cadm patient who experienced three deteriorations of ild in 9 years .
these findings indicate that the ild in anti - mda5 antibody - positive patients may not only be rapidly progressive , but may also be chronic and recurrent . | Introduction
Case Report
Discussion
The authors state that they have no Conflict of Interest (COI). |
in a normal brain , the blood flow is from arteries to veins through a capillary bed . in the case of cerebral arteriovenous malformation ( cavm )
condition ,
the normal blood flow is affected and there arteries are directly connected to veins without a capillary bed , forming a tangle of abnormal blood vessels .
the central part of the malformation consisting of tangled abnormal vessels is called nidus .
there is very low pressure in the avm ;
hence , a large amount of blood drawn into this .
this causes lot of pressure built up in the blood vessels , especially in the veins .
the risk of rupturing of the veins draining
the malformation is high because veins can not handle as much blood pressure as that of arteries .
the need for modelling is to help doctors to take preventive steps and for early
diagnosis for the risk of rupture and treatment planning for the avm patients .
figure 1 shows the avm complex structure , which is very difficult and challenging to model bifurcations .
the researchers analysed vessels bifurcation for various organs based on the mechanical property of the blood flows , but some clinical parameters for modelling are not considered .
hoogstraten studied the bifurcation angle and bifurcation analysis based on the radius and length of the vessel ,
but not considered angle variations .
the author goubergrits investigated vessel geometry modelling for the carotid artery ,
to analyse various geometric parameters using mechanical modelling . in another study , the author malve ,
analysed modelling of asymmetrical network , based on the womersley numbers .
the literature shows symmetrical network modelling is available for the coronary artery ,
to model lad and lcx based on the lumped parameter model .
the researchers studied various lumped network model for the analysis ,
concentrating on the calculation of the bifurcation angle .
ghasemalizadeh et.al ,
analysed on the anatomical model for the blood flow in heart , the limitation is that the major assumptions included
in the blood flow model concern the pressure radius relationship , the radial velocity profile , and pressure loss at vessel bifurcations .
have produced a preliminary model , which indicates that blood vessel movement may have a significant effect on coronary blood flow .
the author smith has analysed on the anatomical model for the blood flow in heart ,
the limitation is that the major assumptions included in the blood flow model concern the pressure radius relationship , the radial velocity profile , and pressure loss at vessel bifurcations .
milan et al . have produced a preliminary model , which indicates that blood vessel movement may have a significant effect on coronary blood flow .
the effect of vessel movement limited by mechanical parameters in the mechanical model by determining the flow profile using , vessel movement relative to blood flow velocity .
avm complex structure the author murray , has showed that , ratio of the bifurcating vessel diameter ( d1/d2 ) ratio changes ( increases / decreases ) when the bifurcation angle varies .
in literature , there exist relationship between the bifurcation angle and ratio of the diameters , i.e. bifurcation angle is inversely proportional to the change in the branch diameter ratio .
however ,
there is no direct relationship between angle and lumped model networks as per the literature .
the proposed model addresses the above limitations with creation of direct relationship with bifurcation angle ,
diameter and pressure measurement using electrical network . in this paper
, we proposed the modelling for the segment of the bifurcation by navigating through the complex vessels .
the bifurcation is combination of asymmetric and symmetric bifurcation based on the clinical parameters of the blood vessels and model output based on the segmented vessels .
the methodology used to implement the bifurcation model for the blood vessel are as follows : the input image used is 2d/3d image of various imaging modality like digital subtraction angiography ( dsa ) and 3d - rotational angiogram .
the image is pre - processed using fast fourier transform ( fft ) and image enhancement and smoothing filters applied to the image is performed , that helps to find the accurate distance
and length of the vessels .
the pre - processed image segmented using otsu segmentation for drawn roi ( region of interest ) [ 17 - 19 ] .
the electrical model is based on the model was based on the principle of electrical networks -kirchhoff s voltage law ( kvl ) as shown in table 1 .
lumped models are equivalent to simple electrical networks , where blood pressure represented by voltage and blood flow by amperage of the electrical current through the network .
the formation of lumped model using r - l - c elements is constructed using windkessel model [ 21 - 22 ] .
the three - element windkessel model used to represent the pressure - blood flow relationship of regional circulation helps to capture the dynamics of the cerebral circulation .
the lumped parameter model derived from electrical circuit analogies where current ( i ) represents blood flow ( cm / s ) and voltage ( v ) represents pressure ( mmhg ) .
resistances ( r , ohms ) represent vascular resistances ; capacitor ( c , microfarads ) represents volume compliance of the vessels that allows them to store significant amounts of blood .
windkessel models have advantages over other parametric models that they provide a simple model structure in terms of individual elements ( r , c ) of its electrically analogous circuit ,
facilitating the extraction and interpretation of physiological changes from the dynamic variation of each element .
the diameter and length variation determines design of network formation such as r - r ,
r - l , r - c , rlc combinations .
the electrical network updated according the diameter and length of the vessel bifurcations as shown in table 2 .
the electrical network created based on the vessel diameter and length , the equations 1 and 2 are formed by applying kvl for rlc and rc is as follows :
vi(t)=ri(t)+ldidt+1cdt
( 1 )
vi(t)=rcdvdt+lcdv2dt2+v0(t )
( 2 )
electrical network components variations the equations are solved using ode-4 runge - kutta method [ 25 - 26 ] .
the input image used is 2d/3d image of various imaging modality like digital subtraction angiography ( dsa ) and 3d - rotational angiogram .
the image is pre - processed using fast fourier transform ( fft ) and image enhancement and smoothing filters applied to the image is performed , that helps to find the accurate distance
and length of the vessels .
the pre - processed image segmented using otsu segmentation for drawn roi ( region of interest ) [ 17 - 19 ] .
we have segmented bifurcation vessels near nidus for various frames based on adaptive segmentation .
the electrical model is based on the model was based on the principle of electrical networks -kirchhoff s voltage law ( kvl ) as shown in table 1 .
lumped models are equivalent to simple electrical networks , where blood pressure represented by voltage and blood flow by amperage of the electrical current through the network .
the formation of lumped model using r - l - c elements is constructed using windkessel model [ 21 - 22 ] .
the three - element windkessel model used to represent the pressure - blood flow relationship of regional circulation helps to capture the dynamics of the cerebral circulation .
the lumped parameter model derived from electrical circuit analogies where current ( i ) represents blood flow ( cm / s ) and voltage ( v ) represents pressure ( mmhg ) .
resistances ( r , ohms ) represent vascular resistances ; capacitor ( c , microfarads ) represents volume compliance of the vessels that allows them to store significant amounts of blood .
windkessel models have advantages over other parametric models that they provide a simple model structure in terms of individual elements ( r , c ) of its electrically analogous circuit ,
facilitating the extraction and interpretation of physiological changes from the dynamic variation of each element .
the diameter and length variation determines design of network formation such as r - r ,
r - l , r - c , rlc combinations .
the electrical network updated according the diameter and length of the vessel bifurcations as shown in table 2 .
the electrical network created based on the vessel diameter and length , the equations 1 and 2 are formed by applying kvl for rlc and rc is as follows :
vi(t)=ri(t)+ldidt+1cdt
( 1 )
vi(t)=rcdvdt+lcdv2dt2+v0(t )
( 2 )
electrical network components variations the equations are solved using ode-4 runge - kutta method [ 25 - 26 ] .
the input pressure at feeding arteries simulated using electrical parameters and the results are validated using mechanical
outputs .
the clinical parameters are converted to voltage and current , simulated with rlc networks , the part of the vessel analysis
implementation by electrical network is shown in figure 2 .
we have simulated for the symmetrical and asymmetrical bifurcation angles
variation in the vessels and our analysis shows that electrical network varied for different bifurcation angles that help to determine the pressure and flow parameters
of avm hemodynamic non - invasively .
the simulated angles are as per the bifurcation angles of the various locations of cerebral vasculature bending angles .
the simulation performed for various signal combinations like square , pulse and simulated pressure waveforms [ 28 - 29 ] . implementation of bifurcation angle
the bifurcation analysis for the asymmetric network based on the nodes unequal diameter ratio and angle variations .
the bifurcation model changed based on the diameters length and ratio as well as on the angles between the parent and child branch .
the ratio differences have a huge impact ,
which affects the electrical network of the bifurcation model .
it shows vessels p1 as the parent vessels , which bifurcate to vessels into various child branches - p2 , p3 , and p4 .
for each vessel the diameter and length is calculated and angle between the parent and child branch is calculated . the electrical network simulated for each vessel using vessel
diameter ,
length and angles between the parent and child vessel . the complete network created for the given vessel by parallel combination of t and pi network of vessels networks- ( ( p1 + || ( p2 ||p3 || ( p4 || p5 ) ) .
the measured diameter for vessel p1 is 0.93 cm and corresponding network elements are rl with values r-6.17 , l-2.5 ,
vessel p2 is of diameter 1.19 cm , and its corresponding network is rl with values ,
r-1.8 , l-1.89 .
the measurements of vessel p3 & p4 are 0.87 cm & 0.36 cm , with its corresponding network rl values , r-6.3 ; l-2.94 ; r-96.59 l-8.571 respectively .
table 3 denotes the results of node pressure measurements for various signal combinations .
asymmetrical network of cerebral avm vessel structure
results of node pressure measurements for asymmetrical networks using various signal combinations the symmetrical networks are networks that have branch angles are equal and of same diameter .
the symmetric bifurcation model created based on the diameters length and
ratio as well as on the angles between the parent and child branch .
the results of node pressure measurements for various input signal combinations for symmetrical networks shown in table 4 . for simulation purpose ,
we change the bifurcation angle of 75 to 45 degrees ( decrement of angle ) , results in the increase in the diameter ratio , results change in electrical network ,
and leads to change pressure variations for each part of the bifurcation angle change .
symmetrical network showing parent vessel - p1 , vessel diameter - 0.8 cm results of node pressure measurements for symmetrical networks using various signal combinations the electrical model validated with clinical outputs supported by the clinicians , the pressure values at bifurcations nodes validated with model outputs as voltages .
we have also validated our results with mechanical simulation using ansys fluent v12 software for various simulated inputs .
correlations between values derived from the new method and the classical methods were evaluated using least squares and systematic bias was calculated as the mean
of the difference between values derived from each method .
changes in hemodynamic were evaluated by a repeated - measures analysis of variance .
a p value of less than 0.05 considered statistically significant .
accuracy in percentage across various node outputs for various signal combinations for asymmetric networks and symmetric networks are examined .
the bifurcation analysis for the asymmetric network based on the nodes unequal diameter ratio and angle variations .
the bifurcation model changed based on the diameters length and ratio as well as on the angles between the parent and child branch .
the ratio differences have a huge impact ,
which affects the electrical network of the bifurcation model .
it shows vessels p1 as the parent vessels , which bifurcate to vessels into various child branches - p2 , p3 , and p4 . the p4 branch in turn bifurcates to sub - branch as p5 vessel .
for each vessel the diameter and length is calculated and angle between the parent and child branch is calculated .
the electrical network simulated for each vessel using vessel diameter ,
length and angles between the parent and child vessel .
the complete network created for the given vessel by parallel combination of t and pi network of vessels networks- ( ( p1 + || ( p2 ||p3 || ( p4 || p5 ) ) .
the measured diameter for vessel p1 is 0.93 cm and corresponding network elements are rl with values r-6.17 , l-2.5 ,
vessel p2 is of diameter 1.19 cm , and its corresponding network is rl with values ,
r-1.8 , l-1.89 .
the measurements of vessel p3 & p4 are 0.87 cm & 0.36 cm , with its corresponding network rl values , r-6.3 ; l-2.94 ; r-96.59 l-8.571 respectively .
table 3 denotes the results of node pressure measurements for various signal combinations .
asymmetrical network of cerebral avm vessel structure
results of node pressure measurements for asymmetrical networks using various signal combinations
the symmetrical networks are networks that have branch angles are equal and of same diameter .
the symmetric bifurcation model created based on the diameters length and
ratio as well as on the angles between the parent and child branch .
figure 4 shows the symmetrical network of cerebral avm vessel structure .
the results of node pressure measurements for various input signal combinations for symmetrical networks shown in table 4 .
for simulation purpose ,
we change the bifurcation angle of 75 to 45 degrees ( decrement of angle ) , results in the increase in the diameter ratio , results change in electrical network ,
and leads to change pressure variations for each part of the bifurcation angle change .
symmetrical network showing parent vessel - p1 , vessel diameter - 0.8 cm results of node pressure measurements for symmetrical networks using various signal combinations
the electrical model validated with clinical outputs supported by the clinicians , the pressure values at bifurcations nodes validated with model outputs as voltages .
we have also validated our results with mechanical simulation using ansys fluent v12 software for various simulated inputs .
correlations between values derived from the new method and the classical methods were evaluated using least squares and systematic bias was calculated as the mean
of the difference between values derived from each method . the accuracy of the identification of parameters evaluated using the difference of 1-r2 .
changes in hemodynamic were evaluated by a repeated - measures analysis of variance .
a p value of less than 0.05 considered statistically significant .
accuracy in percentage across various node outputs for various signal combinations for asymmetric networks and symmetric networks are examined .
the vessels have lot of complex geometry structures with different types of bifurcations inside in asymmetric / symmetrical networks .
the proposed model helps to simulate the physiologic and hemodynamic variations of the cavm patients .
23 cavm patients are analysed using our simulated model with 60 bifurcations of symmetrical and asymmetrical networks .
the pressure and flow parameters are measured for four bifurcation nodes for each cases , totally 60 measurements are validated with clinical /mechanical simulation .
we have also simulated the bifurcation analysis for symmetrical and asymmetrical network using the various signal combinations as input source to replicate the actual clinical scenarios of pressure variations in cavm patients by simulated pressure waveforms and by mixing of the signals .
in the asymmetrical network analysis
, the accuracy analysis shows that observation is that for the small vessel diameter less than 1 cm , the node pressure measurements has the deviation is in the range of 5 - 10% , and for the vessel diameter more than 1.5 cm , the analysis is that deviation is the range below 5% .
we have simulated for various bifurcation branches of one to five child nodes from parent nodes .
our results shows bifurcation branch pressure measurements of 60 branching vessels with node outputs for 30 input signal combinations .
the hemodynamic measurements are calculated non - invasively at each bifurcation of the vessels , which is the unique advantage of bifurcation modelling , where even catheter can not navigate to find pressure at various small branches or bifurcations .
in this paper , we have proposed bifurcation modelling of the avm based on the mathematical model to define bifurcation analysis in a vessel structure of symmetrical and asymmetrical bifurcation networks and further assess its role .
we have provided a rigorous approach for electric circuits whose physical constants ( r , l and c ) , are parameterized on the standard length of the vessel using normal in order to recover correct values for pressure or flow - rate at bifurcations for avm patients .
the bifurcation angles simulated for various types of networks and pressure measurements are calculated non - invasively for symmetrical and asymmetrical networks . with the help of the clinical data , we are able to validate our results with invasive measurement and with the simulated mechanical results as cross - validation analysis .
23 avm patients were studied with evaluation of 60 bifurcation vessels locations as node point of symmetrical and asymmetrical networks , the node measurements were evaluated with accuracy of 93% , and computed p - value is smaller than the significance level 0.05 .
such an integrative approach should possibly lead to a comprehensive understanding of the regulatory and management of cerebral neurovascular abnormality analysis .
our accuracy analysis shows that observation is that for the small vessel diameter less than 1 cm , the node pressure measurements has the deviation is in the range of 5 - 10% , and for the vessel diameter more than 1,5 cm , the analysis is that deviation is the range below 5% . from a medical viewpoint , it provides us new insight into the role of haemodynamic analysis on the neurovascular vessel analysis .
this work can be extended to develop more complex geometric bifurcations vessels analysis of the various parts of cavm . in summary , a novel approach to determining access flow and pressure measurements by non - invasively at various bifurcation nodes and the feasibility of determining access volume flow independent of access geometry is examined .
| background and objective : cerebral arteriovenous malformation ( cavm ) hemodynamic is disease condition , results changes in the flow and pressure level in cerebral blood vessels .
measuring flow and pressure without catheter intervention along the vessel is big challenge due to vessel bifurcations / complex bifurcations in arteriovenous malformation patients .
the vessel geometry in cavm patients are complex , composed of varying diameters , lengths , and bifurcations of various angles .
the variations in the vessel diameter and bifurcation angle complicate the measurement and analysis of blood flow features invasively or non - invasively .
methods : in this paper , we proposed a lumped model for the bifurcation for symmetrical and asymmetrical networks in cavm patients .
the models are created using matlab simulation software for various bifurcation angles . each bifurcation angle created using electrical network- rlc .
the segmentation and pre - processing of bifurcation vessels are implemented using adaptive segmentation .
the proposed network address clinicians problem by measuring hemodynamic non - invasively .
the method is applicable for any types of bifurcation networks with different bifurcation angles in cavm patients .
results : in this work , we constructed a mathematical model , measured hemodynamic for 23 patients ( actual and simulated cases ) with 60 vessel bifurcation angles variations .
the results indicate that comparisons evidenced highly significant correlations between values computed by the lumped model and simulated mechanical model for both networks with p < 0.0001 .
a p value of less than 0.05 considered statistically significant .
conclusion : in this paper , we have modelled different bifurcation types and automatically display pressure and flow non - invasively at different node and at different angles of bifurcation in the complex vessel with help of bifurcation parameters , using lumped parameter model
. we have simulated for different bifurcation angles and diameters of vessel for various imaging modality and model extend for different organs .
this will help clinicians to measure haemodynamic parameters noninvasively at various bifurcations , where even catheter can not be reached .
| Introduction
Material and Methods
Pre-processing
Segmentation
Electrical Model
Results
Asymmetric Network
Symmetric Networks
Statistics
Discussion
Conclusion |
a 52-year - old male , body weight 62 kg , height 161 cm , was planned for hand - assisted laparoscopic low anterior resection ( hal - lar ) for rectal cancer .
there was no history of allergy , including asthma , atopy , or drug allergy , either for the patient himself or his family .
the patient received glycopyrrolate 0.2 mg and midazolam 2 mg i m as premedication 40 min before surgery .
preanesthetic blood pressures ( bp ) and heart rates ( hr ) were 120/80 mmhg and 65 beats / min ( bpm ) , respectively . in the supine position
, endotracheal intubation was performed 1 minute after the iv administration of 1% propofol ( pofol inj , dongkook co. , republic of korea ) 12 ml and rocuronium ( esmeron , nv organon , netherlands ) 50 mg .
the 7.5 mm i d endotracheal tube was secured at 23 cm at upper teeth , and equal breathing sounds were noted in both lung fields through a stethoscope .
sevoflurane - n2o 2 l / min - o2 2 l / min was then delivered for maintenance under volume controlled ventilation at a tidal volume ( tv ) of 600 ml and respiratory rate ( rr ) of 10 rpm , at which the peak inspiratory pressure ( pip ) was 20 mmhg and end tidal carbon dioxide concentrations ( etco2 ) were 37 - 40 mmhg . however , 10 minutes after the administration of induction agents , bp suddenly dropped to 83/53 mmhg at a hr of 145 bpm .
although bp increased to 93/58 mmhg 15 minutes after induction , capnography showed an obstructive pattern with a high pip ( 41 mmhg ) along with skin eruptions within the upper thorax and on both upper extremities at the same time ( the severities of these were not followed after covering the body with surgical wraps during the operation ) .
on auscultation , no breathing sound was heard in the left lung field and mild wheezing was noted in the right lung . suctioning the airway produced no secretion .
we checked for proper tube placement by manual cuff palpation at the suprasternal notch , and ballottement of the cuff was strongly detected .
salbutamol sulfate was administered by inhalation three times through the endotracheal tube , but bp further declined to 75/40 mmhg at a hr of 110 bpm .
skin eruptions continued to be observed within the upper thorax and both upper extremities . after discontinuing n2o and sevoflurane ,
piprinhydrinate 3 mg and dexamethasone 5 mg were injected intravenously along with salbutamol sulfate administration , but pip and breathing sounds did not improve . even at tv 300 ml and rr 16 rpm , pip remained at 30 mmhg .
although the lowest observed spo2 value was 95% , etco2 was maintained at 35 mmhg .
epinephrine 10 g and hydrocortisone 50 mg were then administered intravenously twice and three times , respectively .
twenty minutes after the onset of symptoms , lung sounds recovered and the capnogram normalized with an etco2 of 36 mmhg and a pip of 25 mmhg under tv 500 ml and rr 13 rpm , and a bp and hr of 121/66 mmhg and 97 bpm , respectively .
surgery was performed under carbon dioxide pneumoperitoneum at a pressure of 15 mmhg in a 30 degree trendelenburg position under pressure controlled ventilation ( pcv ) that limited the pip to 27 mmhg , which demonstrated a tv of 450 - 500 ml
. however , 80 minutes after beginning surgery under an inspiratory sevoflurane concentration of 3.6 vol% , spo2 suddenly decreased from 97% to 91% immediate after an intravenous injection of furosemide ( lasix , handok , republic of korea ) 5 mg . at that time , no auscultation sounds were detected in the left lung field under a pip of 27 mmhg during pressure controlled ventilation ( pcv ) generating a tv of only 151 ml .
thus , salbutamol sulfate inhalation and intravenous hydrocortisone and epinephrine were re - challenged , and the posture changed from trendelenburg to supine .
10 minutes later , spo2 and bp recovered to 96% and 153/94 mmhg , respectively , and both lung sounds were fully regained .
the postoperative chest radiograph was normal , and the endotracheal tube was extubated 9 hours after completing surgery .
patch , skin prick , and intradermal tests ( idt ) were carried out on postoperative days 8 , 15 , and 16 to confirm the relationships between the patient 's symptoms and anesthetic agents .
skin prick tests were performed using solutions of the test drugs , diluted sequentially ( 10 and 10 ) in 0.9% saline and idts were conducted using a 10 dilution .
skin test results were graded + when a wheal of 3 - 5 mm with surrounding erythema of 5 - 10 mm arose within 15 minutes after injection , and as + + when a wheal of > 5 mm with erythema of > 10 mm appeared within 15 minutes .
it was found that rocuronium , succinylcholine , atracurium , vecuronium , and thiopental sodium produced a positive reaction only by idt ( table 1 ) .
surgery to repair the colostomy was carried out 50 days later under spinal anesthesia using 0.5% hyperbaric bupivacaine 15 mg , which had shown no reactivity on previous skin tests .
the anaphylactic symptoms caused by rocuronium are variable , and include ; tachycardia , severe hypotension , erythematous skin rash , facial or generalized edema , and bronchospasm .
although anaphylactic symptoms usually occur immediately after an allergen challenge , they can be delayed for 2 - 20 minutes about 70% of patients that experience an anaphylactic bronchospasm have accompanying cutaneous signs , such as , a rash or flush .
the symptom course during induction in our case was very similar to that reported for rocuronium - induced anaphylaxis .
. however , endobronchial intubation is also a risk factor of reflex bronchospasm because airway instrumentation near the carina , which contains abundant irritant receptors , can cause reflex bronchoconstriction .
however , reflex bronchospasm after intubation is not accompanied by cutaneous reactions because it does not occur via an immune pathway .
propofol can cause skin rashes irrespective of anaphylaxis , but for non - immune reactions , skin reactions are not associated with cardiovascular deteriorations .
accordingly , in our case , it is unlikely that the first ventilation disorder was caused by airway irritation , or that the skin eruptions were related to propofol induced nonimmune reactions .
it has been reported that the mean distance between the carina and the endotracheal tube tip in the supine position is 3.37 2.21 cm when palpating cuff ballottement at the suprasternal notch .
thus , the possibility of endobronchial intubation could be excluded by manual cuff palpation at the sternal notch in the supine position during the first ventilation disorder .
furthermore , a unilateral silent lung accompanied by a sudden decrease in bp suggested immune - related bronchospasm rather than endobronchial intubation .
thus , given this information and the skin test results , we were able to strongly associate the first incident with rocuronium - induced anaphylactic bronchospasm .
intradermal testing is valuable in terms of discerning whether a suspected perioperative allergic reaction is caused by ige - mediated immediate hypersensitivity , especially that due to anesthetics .
however , unilateral bronchospasm in our case was triggered by the systemic effects of intravenous agents .
tsubo et al . suggested that latex allergen , which is absorbed into systemic circulation during intra - abdominal gynecological surgery , might induce unilateral bronchospasm .
thus , it is possible that anaphylactic antigens can induce unilateral bronchospasm not only by topical irritation of the involved lung , but also rarely via systemic effects .
however , contrary to the first bronchospasm , chances were that other risk factors might influence on happening of the second case of unilateral silent breath sound .
the recurrence of anaphylactic symptoms is not common after successful resuscitation , and it our case , the trendelenburg position itself is considered unlikely trigger factor because nmbas - induced anaphylactic hypotension used to be resuscitated by placing patients in the trendelenburg position .
however , it is possible that pneumoperitoneum in the trendelenburg position might have induced unilateral endobronchial intubation .
furthermore , a zero risk of endobronchial intubation in the trendelenburg position under pneumoperitoneum is not guaranteed by confirming tube placement by manual cuff palpation in the supine position . however
, we did not recheck the cuff ballottement at the sternal notch after changing posture , and thus , it is not clear whether the second incident was caused by bronchospasm or a malpositioned tube .
moreover , although furosemide is known to be a causative agent of anaphylaxis , unilateral ventilatory failure was unlikely to been related to the administration of furosemide , because skin tests were negative . in conclusion , the intravenous administration of rocuronium can induce unilateral bronchospasm . nevertheless ,
although a patient may suffer unilateral bronchospasm due to anaphylaxis , it should also be considered that recurrent unilateral ventilatory failure might be induced during the same surgery by endobronchial intubation when a patient under pneumoperitoneum is in the trendelenburg position . | rocuronium is the anesthetic agent most likely to cause anaphylaxis . immediately after intravenous rocuronium administration
, the authors experienced ventilatory impairment due to unilateral bronchospasm ( left lung ) , which was relieved by emergency treatment .
however , 80 minutes after beginning laparoscopic surgery for rectal cancer , the left lung suddenly re - collapsed under pneumoperitoneum in the trendelenburg position .
a postoperative intradermal test revealed that rocuronium , vecuronium , atracurium , succinylcholine , or thiopental could induce anaphylaxis in this patient , but it was not established whether the second incident during surgery was due to endobronchial intubation or anaphylactic bronchospasm .
this case cautions that under pneumoperitoneum in the trendelenburg position , patients suspected of being prone to anaphylactic bronchospasm should also be considered at risk of endobronchial intubation . | Case Report
Discussion |
the development of colorectal cancer ( crc ) is a multi - step process characterized by the accumulation of genetic alterations ( 1 ) .
the evolution of colorectal cancer from polyps was first proposed by morson ( 2 ) . since the seminal publication of vogelstein and fearon ( 3 ) , we understand that most colorectal cancers arise in a multistep process progressing from mucosal hyperplasia to adenomas and carcinomas . the transformation of normal colonic epithelium to cancer is a multi - step process which is characterized by activating oncogenes and inactivating tumor suppressor genes .
kras ( kirsten rat sarcoma viral oncogene homologue ) is a small gtpase ( guanosin triphosphate cleaving enzyme ) involved in intracellular signal transduction .
kras mutations lead to the deregulation of kras protein activity , which results in the loss of gtpase activity and gain of oncogenic activity ( 5 ) .
specific mutations in the kras gene leads to the formation of constitutively active protein , which triggers the transduction of proliferative and/or differentiative signals , even in the absence of extracellular stimuli ( 6 ) .
mutations in the kras gene which are responsible for malignant transformation are point mutations in exons 2 and 3 .
mutations in the kras gene contribute at an early stage to the development in the colon tumourigenesis pathway ( 7 ) .
kras mutations occur in both microsatellite instable ( msi ) in about 20% and microsatellite stability ( mss ) in about 35% subsets of sporadic crc ( 8 , 9 ) .
there have been approximately 3000 kras point mutations in colorectal cancer reported in the literature ( 10 ) . according to a previous study in iran ,
this confirms that codons 12 and 13 are preferentially involved in iranian population as well ( 7 ) .
the aim of the study was to evaluate point mutations in exon 2 and 3 kras gene in 95 carcinomas and polyps samples , furthered by the comparison of mutations profile in the polyp and tumor samples .
finding the probable mutation and most frequent msi marker will be useful for early detection of sporadic colorectal cancer .
samples of cancer and polyps tissues were collected from 95 patients with sporadic colorectal cancers who underwent colonoscopy in taleghani hospital tehran from june 2008 to december 2009 .
the use of patient samples was approved by the local ethics committee at research center for gastroenterology and liver disease .
the patient panel was comprised of 73 men and 22 women , age ranging from 13 to 85 years with a median 49 years .
the 493 bp region in the exon 2 and 402 bp in exon 3 of kras gene that encompasses the mutation hotspots were amplified by pcr using specific forward and reverse primer , and taq dna polymerase ( table 1 , figure 1 , 2 ) .
specific primers for exon 2 and 3 pcr - product related to exon2 pcr - product related to exon3 the pcr was conducted with denaturing step at 94 c for 5 min , then 30 sec at 94 c , 30 sec at 56/63 c and 30 sec at 72 c for 30 cycles , followed by a final 5 min at 72 c .
the pcr products were then subjected to direct sequencing using the same primers , and all mutations were confirmed by sequence originating from both the upstream and downstream primers .
direct sequencing was performed using fluorescent dideoxy on abi sequencing 3130 xl according to manufacturer instructions .
samples were then subjected to direct sequencing of single - strand pcr product using the big dye terminator v1.1 cycle sequencing kit and the abi prism 3130xl genetic analyzer ( applied biosystems ) .
microsatellite analysis using fluorescence labeled primers and automated dna sequencer ( abi 3130xl applied biosystems , foster city , ca , usa ) were performed .
five human mononucleotide microsatellite , nr-24 , nr-21 , nr-27 , bat-25 and bat-26 were used as the markers ( 11 ) .
microsatellite analysis using five fluorescent - labeled primers were performed according to following pcr condition , 94 c for 5 min , then 30 sec at 94 c , 40 sec at 55 c and 30 sec at 72 c for 35 cycles , followed by a final 7 min at 72 c and automated dna sequencer .
analysis of msi status was based on multiplex amplification of the 5 quasimonomorphic mononucleotide repeat microsatellite ( 11 ) . as a result of microsatellite instability ,
msi was considered when one or more than one marker was altered but in mss no marker was changed .
kras mutations in exons 2 and 3 were evaluated in 95 patients with colorectal cancer including 47 polyps and 48 tumors . in polyp samples
furthermore , we detected the msi status of all polyps using pentaplex set of microsatellite markers .
our finding showed 8 ( 17% ) polyps samples with msi and 39 ( 83% ) samples with mss ( table 2 , 3 ) .
characteristics of samples with mutation msi - l : msi low ; mss : msi stable ; p= polyp ; t = tumor msi results related to tumor and polyp specimens six out of 48 ( 12.5% ) carcinoma specimens exhibited kras mutation including five in codon 12 ( gly12asp ) and one in codon 13 ( gly13cys ) .
all of the kras amino acid change in codon 12 was glycine to aspartic acid ( g12a ) .
five out of six ( 83.4% ) mutations occurred in females and just one ( 16.6% ) of them happened in a male .
msi analysis revealed that 5 msi ( 10.4% ) and 43 ( 89.6% ) mss ( table 2 , 3 ) .
furthermore , we could detect 9 intronic mutations in 48 tumor samples including five int.2271a > c ( 55.6% ) , three int.2271c ( 33.3% ) and one int.2271t > c ( 11.1% ) . while in 47 polyp samples 15 intronic mutations were found .
profile of intronic mutations in polyp and tumor samples as table 2 shows location of 5 out of 6 tumors with kras mutation were in colon and only one tumor was detected in rectum .
in contrast , 2 out of 3 polyps with kras mutation were located in rectum and just one of them was determined in colon . of the 6 tumors with kras mutations , 5 ( 83% ) were g to a ( gly12asp ) and one was ( 17% ) g to c ( gly12cys ) .
the frequency of g to a transition mutations in msi - l and mss was identical but they were higher than in msi - h cancer .
there was not any significant correlation between polyps or tumors with mutation and individuals clinical features ( data was not shown ) ( table 2 ) .
mutations in the kras oncogene are thought to occur at an early stage in the adenoma - carcinoma sequence , with the frequency of mutations increasing with the adenoma size in western countries , with an age - adjusted incidence of 49 out of 100,000 per year .
colorectal cancer is one of the most frequent malignant human tumors however , in iranian population crc incidence rate is 6 - 7.9 per 100,000 persons/ year ( 7 , 1214 ) .
these reports reflect that such incidence is remarkably lower than the rates reported in western countries .
this study investigated the ratio of kras exon 2 and 3 in adenoma and adenomcarcinoma tissues in order to compare the mutations in two types of samples .
replacement of glycine 12 of kras with any amino acid , except proline , causes the biochemical activation of kras by the reduction of its intrinsic gtpase activity of kras ( 15 ) .
substitution of glycine 12 with proline renders kras resistant to the catalysis of gaps yet increases intrinsic gtpase activity , which is biologically significant in hydrolyzing gtp to gdp and reverting kras back to its inactive form .
this phenotype is not aggressive in nature ( 16 ) . comparing the frequency of kras mutations highlighted
, it is found that the frequency of kras mutations detected in polyps is not statistically different from the frequency observed in msi and mss colorectal tumors .
various studies in colorectal cancer have suggested that kras codon 12 and 13 mutations are generally predictive of a poorer prognosis , with evidence being presented for mutation - specific prognostic as well as histopathology correlates ( 1316 ) .
the rate of mutation in intronic region in polyp samples was higher than mutation rate in tumor samples .
therefore it is confirmed that these regions probably are not located in alternative splicing of the kras gene .
five of the 6 mutations that were identified in tumor samples were missense and led to the substitution of glycine to aspartate .
our finding in respect of the most frequent mutation , gly12asp , in the studied population is compatible with the results revealed from italian population .
however , it was in contrast with another study from iranian population in a similar investigation ( 7 ) . these g a transition mutations occurred in two ways - either by misreplication of the unrepaired endogenously produced o6-methylguanidine dna methyltransferase ( mgmt ) from faulty s - adenosylmethionine methylation or due to exposure to nitrosamines ( 1719 ) . in this respect other dna repair systems , such as o6 methylguanine - dna methyltransferase activity ,
are linked to the inability to protect from g to a transition in kras induced by alkylating agents ( 20 , 21 ) .
it has been suggested that other repair systems could also contribute to this repair mechanism ( 21 ) .
further grouping of kras mutations with regard to type and nucleotide position was shown to be significantly less frequent .
, we could consider mutation gly12asp in exon 2 as a biomarker to prediagnosis susceptible individuals before tumorgenesis .
nevertheless , how the kras mutation may specifically modulate intracellular signaling is not well understood and remains a matter of ongoing research . | aimthe aim of the current investigation was to examine the profile of kras mutations accompanied with msi ( microsattelite instability ) status in polyps and colorectal carcinoma tissues in an iranian population.backgroundkras mutations in colorectal cancer cause resistance to anti - epidermal growth factor receptor ( egfr ) .
so it can be considered as a true indicator of egfr pathway activation status .
kras mutations can be detected in approximately 30% to 40% of all patients with colorectal cancer .
the most hot spot of the gene is located in exons 2 and 3.patients and methodsin this study we examined exons 2 and 3 kras gene using polymerase chain reactions and subsequent sequencing of the exons in 95 patients with sporadic colorectal cancer including 48 tumors and 47 polyps .
this study was performed using biopsy samples from the patients .
we sequenced the kras gene in a panel of human colorectal tumors and polyps in addition to detecting msi status using fluorescent technique.resultswe could detect 6 mutations in tumors including 5 mutations in codon 12 and one mutation in codon 13 . moreover , in polyps 2 mutations were determined in codon 13 and one in codon 12 .
microsatellite instability assay revealed the presence of 5 and 6 msi in tumors and polyps , respectively . among the msi mononucleotide markers , nr-21 marker demonstrated the most frequency ( 60% ) in the both groups.conclusionour findings showed that probably the profile of mutations in tumors is not entirely compatible with the pattern of mutations in polyps .
however , just one of the mutations , gly12asp , was similar in both groups . | Introduction
Patients and Methods
Results
Discussion |
aldose reductase ( ar ) is a key enzyme in the polyol pathway known to play important roles in the cataract formation and the pathogenesis of diabetic complications such as neuropathy , nephropathy , and retinopathy .
several naturally occurring and synthetic ar inhibitors with diverse structures have been studied in experimental animals and clinical trials to determine their effectiveness in preventing cataract formation and diabetic complications .
natural products are an excellent source of chemical structures with a wide variety of biological activities .
the development and progression of diabetic complications can be prevented by controlling blood glucose , but it is difficult to maintain normal blood glucose levels in a diabetic patient . ar inhibition is recognized as an important strategy for the prevention and attenuation of long - term diabetic complications .
ar inhibitors are being studied as potential therapeutic agents for use in treating diabetic complications [ 3 , 4 ] .
apart from diabetic microvascular disease , advanced glycation end products ( ages ) have also been implicated in a wide and seemingly disparate range of pathologies such as connective tissue diseases particularly in rheumatoid arthritis and neurological conditions such as alzheimer 's disease and end - stage renal disease . in vitro work
has mostly shown age to be part of complex interactions within oxidative stress and vascular damage , particularly in atherosclerosis and in the accelerated vascular damage that occurs in diabetes .
the complex fluorescent age molecules formed during the maillard reaction can lead to protein cross - linking and contribute to the development and progression of several diabetic complications , such as cataracts , atherosclerosis , nephropathy , and neuropathy . increased oxidative stress is a widely accepted contributor to the development and progression of diabetes and its complications .
diabetes is usually accompanied by an increased production of free radicals and impaired antioxidant defenses [ 7 , 8 ] .
therefore , inhibitors of ar and age formation provide an alternative mode of diabetes treatment , which is not dependent on the control of blood glucose level .
these inhibitors should be useful in the prevention or reduction of certain diabetic complications .
prunella vulgaris , with almost 15 known individual species , is widely distributed in europe , asia , northwest africa , and north america , where it is generally known as self - heal herb .
p. vulgaris is used to cure high blood pressure , headaches , lymphatic system disorders , goiter , tuberculosis , and tumors [ 1113 ] .
more recently , a hot water infusion of this plant has been used to treat sores in the mouth and throat .
phytochemical studies indicate that p. vulgaris contains oleanolic , betulinic , ursolic , 2 , 3-dihydroxyurs-12-en-28-oic , and 2 , 3-ursolic acids , triterpenoids , flavonoids , tannins , and anionic polysaccharide called prunellin [ 11 , 14 ] .
the current study aimed to evaluate the ar and age inhibitory of p. vulgaris extract .
these studies are important in understanding the inhibitory effects of p. vulgaris on diabetic complications .
dl - glyceraldehyde , the reduced form of nicotinamide adenine dinucleotide phosphate ( nadph ) , bovine serum albumin ( bsa ) , sodium phosphate , and quercetin used in this study were purchased from sigma ( st . louis , mo , usa ) .
human recombinant aldose reductase was purchased from wako pure chemical industries ( osaka , japan ) .
ric-1021 ) was deposited at regional innovation center , hallym university , republic of korea .
( 1 kg ) was extracted with water ( 5 l 2 times ) for 2 h at 100c .
the extract was suspended in distilled water and partitioned sequentially with n - hexane , methylene chloride ( ch2cl2 ) , ethyl acetate ( etoac ) , and n - butanol ( buoh ) , respectively .
ch2cl2 fraction was further purified by using a medium pressure liquid chromatography ( lichroprep rp-18 glass column ( 36 460 mm ; 2540 m particle size ) ; mobile phase meoh / h2o ( 40 to 50% ) ; flow rate 10 to 5 ml / min ) resulted in the isolation of compounds 5 ( 10.9 mg ) and 6 ( 13.5 mg ) . since the etoac fraction showed the ar inhibitory activity , this fraction ( 2.2 g ) was further purified by using a medium pressure liquid chromatography ( lichroprep rp-18 glass column ( 36 460 mm ; 2540 m particle size )
; mobile phase meoh / h2o ( 40 to 50% ) ; flow rate 10 to 5 ml / min ) resulted in the isolation of compounds 1 ( 102.8 mg ) , 2 ( 53.3 mg ) , 3 ( 10.6 mg ) , and 4 ( 27.9 mg ) .
crude rat lens aldose reductase ( rar ) was prepared as follows : lenses were removed from sprague - dawley rats weighing 250280 g and frozen at 70c until use . the rat lens homogenate was prepared according to the method of hayman and kinoshita with some modifications [ 1517 ] .
noncataractous transparent lenses were pooled and homogenate was prepared in 0.1 m phosphate buffer saline ( ph 6.2 ) .
after centrifugation at 10,000 rpm for 20 min in a refrigerated centrifuge , the supernatant containing the rar was collected .
ar activity was assayed spectrophotometrically by measuring the decrease in the absorption of nadph at 340 nm over a 4 min period according to the method of hayman and konoshita with some modifications , using dl - glyceraldehyde as the substrate .
each 1.0 ml cuvette contained equal units of the enzyme , 0.10 m sodium phosphate buffer ( ph 6.2 ) , 0.3 mm nadph , with or without 10 mm of the substrate , and an inhibitor [ 18 , 19 ] . the concentration of inhibitors giving 50% inhibition of enzyme activity ( ic50 ) was calculated from the least - squares regression line of the logarithmic concentrations plotted against the residual activity .
reaction mixtures consisted of 0.1 m potassium phosphate , 0.16 mm nadph , 2 mm of recombinant human aldose reductase ( rhar ) with varied concentrations of substrate dl - glyceraldehyde and ar inhibitor in a total volume of 200 l .
concentrations were ranged from 0.1 to 1 mm for dl - glyceraldehyde , and from 0.1 to 1 mm for active compound .
recombinant human aldose reductase activity was assayed spectrophotometrically by measuring the decrease in absorption of nadph at 340 nm after substrate addition using bio tek power wave xs spectrophotometer ( bio tek instruments , vt , usa ) .
lenses isolated from 10-week - old male rats were cultured for 6 d in tc-199 medium that contained 15% fetal bovine serum 100 units / ml penicillin and 0.1 mg / ml streptomycin under sterile conditions in an atmosphere of 5% co2 and 95% air at 37c .
the lenses were divided into 5 groups and cultured in medium containing 5 mm glucose , 30 mm galactose , and rosmarinic acid or caffeic acid ethylene ester .
galactitol was determined by hplc after its derivatization by reaction with benzoic acid to a fluorescent compound .
blood sample was collected in heparin - containing polypropylene tube from 10-week - old male rats . for sugar and sugar alcohol analysis , erythrocytes from heparinized blood
were separated from the plasma and buffy coat by centrifuging at 2000g for 10 min .
the cells were washed thrice with normal saline ( 0.9% nacl ) at 4c . in the final washing
, the cells were centrifuged at 2000 g for 10 min to obtain a consistently packed cell preparation .
the packed cells ( 1 ml ) were then incubated in a krebs - ringer bicarbonate buffer ( ph 7.4 ) containing 30 mm galactose in the presence or absence of samples at 37c in 5% co2 for 3 h. the erythrocytes were washed with cold saline by centrifuging at 2000 g for 10 min , precipitated by adding 6% of cold perchloric acid ( 3 ml ) , and centrifuged again at 2000 g for 10 min .
the supernatant was neutralized with 2.5 m k2co3 at 4c and used for galactitol determination .
hplc analysis for sugar and sugar alcohol in blood was performed with this supernatant of red blood cell homogenate after being benzoylated .
the modified procedure of lee et al . was followed . bovine serum albumin ( 10 mg / ml ) was incubated with 5 mm methylglyoxal in sodium phosphate buffer ( 100 mm ; ph 7.4 ) .
all of the reagent and samples were sterilized by filtration through 0.2 m membrane filters , and the mixture was incubated at 37c for 7 days .
the fluorescence intensity was measured at an excitation wavelength of 330 nm and an emission wavelength of 410 nm with a ls50b fluorescence spectrometer ( perkin - elmer ltd .
the abts diammonium salt ( 2 mm ) and potassium persulfate ( 3.5 mm ) were mixed and diluted in distilled water kept in the dark at room temperature for 24 h before use .
after addition of abts solution to 10 l of antioxidant compounds were recorded at after 10 min reaction . the percentage inhibition of absorbance at 750 nm is calculated and potted as a function of concentration of antioxidants .
the constituents of the dried p. vulgaris were extracted with water . in order to identify the active fractions from p. vulgaris
the ch2cl2 soluble and etoac soluble fractions were isolated by using a medium pressure liquid chromatography .
their chemical structures were elucidated by chemical and spectral analysis as caffeic acid ( 1 ) , protocatechuic acid ( 2 ) , p - hydroxycinnamic acid ( 3 ) , rosmarinic acid ( 4 ) , caffeic acid ethylene ester ( 5 ) , and protocatechualdehyde ( 6 ) .
compounds 2 , 3 , and 5 were isolated for the first time from this plant .
the present study was conducted to identify new potential rar inhibitors from p. vulgaris , which might have potential uses in the treatment of diabetic complications .
we showed that water extract of p. vulgaris inhibited the activity of rar . in order to identify the active compounds from p. vulgaris the extract was divided into several fractions that were tested for their rar inhibitory activity .
the etoac fraction had high inhibitory activity against rar with ic50 value of 2.99 0.10 g / ml . these results are shown in table 1 .
previous studies used quercetin as a positive control when comparing the inhibitory activity of active compounds isolated from natural products against lens or human recombinant aldose reductase [ 9 , 30 , 31 ] .
we compared the inhibition of rar and rhar by compounds 16 and quercetin , a natural aldose reductase inhibitor .
compounds 35 had ic50 values of 8.35 0.51 , 2.77 0.48 , and 3.2 0.55 m , respectively , for ar while compounds 4 and 5 had ic50 values of 18.62 0.40 and 12.58 0.32 m , respectively , for rhar .
of the compounds tested , rosmarinic acid had the most potent rar inhibitory activity , while caffeic acid ethylene ester showed almost the same activity at the same concentration .
compounds isolated from p. vulgaris had potent inhibitory effects on rhar , especially caffeic acid ethylene ester . to determine the type of inhibition activity produced by compounds 4 and 5 ,
a kinetic study was conducted using dl - glyceraldehyde as a substrate ( concentration : 0.11 mm ) at 3 different concentrations for each compound .
the lineweaver - burk plots of 1/velocity and 1/concentration for compounds 4 and 5 are shown in figure 2 .
changes in the concentration of the substrate dl - glyceraldehyde resulted in different slopes and different x axis intersects being obtained with the uninhibited enzyme and the 3 different concentrations for each compound .
the results indicated that the inhibition type of rhar by rosmarinic acid ( 4 ) and caffeic acid ethylene ester ( 5 ) was noncompetitive , showing that the inhibitor was unable to bind to either the substrate - binding region or the nadph - binding region of rhar .
we also studied the effects of compounds 4 and 5 on galactitol accumulation in rat erythrocytes and lenses ( table 3 ) .
rat lens incubation for 6 d in 30 mm galactose resulted in an increased intracellular accumulation of galactitol .
compounds 4 and 5 inhibited galactitol accumulation in rat erythrocyte by almost 35.5 and 31.7% at 5 g / ml , respectively .
quercetin ( the positive control ) inhibited galactitol accumulation in rat erythrocyte by 30.5% and in rat lenses by almost 36.9 and 22.5% at 5 g / ml , respectively .
the etoac fraction had high inhibitory activity against age with an ic50 value of 141.34 1.27 g / ml , showing almost the same activity with positive control ( table 4 ) .
inhibitory activity against age formation by the isolated compounds was tested using aminoguanidine as a positive control .
caffeic acid ethylene ester ( 5 ) exhibited potent inhibitory activity against age formation with an ic50 value of 33.16 0.54 m , compared with the positive control ic50 value of 1944.86 8.39 m ( table 5 ) .
oxidative stress might have a key role in the pathogenesis of vascular complications in diabetes , both microvascular and macrovascular , and it provides an early marker of such damage in the development of endothelial dysfunction [ 33 , 34 ] .
abts inhibitory activity of the isolated compounds was tested using trolox as the positive control .
p - hydroxycinnamic acid ( 3 ) had the strongest inhibitory activity with an ic50 value of 5.94 1.01 m , and caffeic acid ethylene ester ( 5 ) also had potent inhibitory activity with an ic50 value of 10.52 0.28 m , compared to a positive control ic50 value of 15.34 0.40 m ( see tables 6 and 7 ) .
the present study isolated six compounds from p. vulgaris by using a medium pressure liquid chromatography . among these compounds ,
caffeic acid ethylene ester ( 5 ) has potent ar , age inhibitory activity , and antioxidant .
specifically , this compound exhibited the most potent inhibition with age , with an ic50 of 33.16 0.54 m .
the inhibitory effect of this compound was 58.0-fold stronger than that of the positive control aminoguanidine ( ic50 = 1944.86 8.39 m ) .
these results suggest that this compound and p. vulgaris could potentially provide a new natural treatment for diabetic complications .
however , further studies on the mechanism of age action of caffeic acid ethylene ester ( 5 ) and more in vivo evidence from diabetic animals are required . | to evaluate the aldose reductase ( ar ) enzyme inhibitory ability of prunella vulgaris l. extract , six compounds were isolated and tested for their effects .
the components were subjected to in vitro bioassays to investigate their inhibitory assays using rat lens aldose reductase ( rar ) and human recombinant ar ( rhar ) . among them , caffeic acid ethylene ester showed the potent inhibition , with the ic50 values of rar and rhar at 3.2 0.55 m and 12.58 0.32 m , respectively . in the kinetic analyses using lineweaver - burk plots of 1/velocity and 1/concentration of substrate , this compound showed noncompetitive inhibition against rhar .
furthermore , it inhibited galactitol formation in a rat lens incubated with a high concentration of galactose . also it has antioxidative as well as advanced glycation end products ( ages ) inhibitory effects . as a result
, this compound could be offered as a leading compound for further study as a new natural products drug for diabetic complications . | 1. Introduction
2. Materials and Methods
3. Results and Discussion
4. Conclusions |
all individuals under the age of 18 are considered as children by the convention on the rights of children . forced marriage at a young age conflicts with turkish and international law .
imam ( traditional religious ) weddings are not legal and are made outside of formal marriage .
imam weddings engaged in by men who marry young children or more than 1 woman .
the 1998 law on the protection of the family states that women who do not have legal marriages can not benefit from protection provided by the law .
underage mothers are the children in the pediatric age group who become pregnant and give birth .
these cases are children who have been exposed to sexual assault in adolescence , were forced to marry by their family , or who ran away from home to marry .
it may be unfamiliar in western countries , but in middle - eastern countries ruled by religious laws and old - fashioned traditions , it is common for an older man to marry a girl . as a result , they get pregnant in childhood and become child - mothers .
this situation reveals a multi - dimensional problem due to the mother being a child .
these children , who did not complete the development of their own biopsychosocial aspects , assume very heavy responsibilities such as child - rearing and training .
childhood marriages are by definition within the scope of forced marriages . forced underage marriages reinforce the unequal position of women in society , reduce the choice of freedom in their lives , and make women more vulnerable to violence .
at the same time , early pregnancy age has negative effects on quality of life of both mothers and infants . according to the fourth world conference on women platform for action , each year
at least 15 million girls between the ages of 15 and 19 years give birth worldwide .
early motherhood increases the risk of complications during pregnancy and childbirth and also increases the rate of maternal mortality .
unfortunately , underage mothers are subjected to serious health and nutrition problems , poor economic and social conditions , and increased risk for committing crimes and exploitation .
additionally , children of underage mothers have higher rates of mortality and illness than normal population ratios [ 1,49 ] .
approximately 26% of pregnancies in adolescents ( < 20 years ) in the united states are terminated electively , 14% result in miscarriages , and 59% result in a birth .
the pregnancy termination rate is lower than that observed in 1990 ( 34% ) and represents approximately one - fifth of all abortions performed in the united states .
data from 2010 indicate adolescents ages 1819 years old account for 65% of abortions in adolescents , and adolescents < 15 years old account for about 3% .
adolescents appear to be at increased risk for adverse pregnancy outcomes such as low - birth - weight babies and infant deaths [ 1318 ] .
whether these outcomes are the result of biologic immaturity or sociodemographic factors related to adolescent pregnancy ( e.g. , nonwhite race , less educated , unmarried , lower economic status ) remains unclear .
these relationships were examined in a study of more than 130 000 primiparous white girls and women in utah aged 1324 years who delivered singleton infants . teenaged ( 17 years ) married mothers with appropriate educational levels ( for their age ) and adequate prenatal care had higher risks of delivering an infant with low birth weight ( relative risk [ rr ] 1.7 ) , prematurity ( rr 1.9 ) , or small for gestational age ( rr 1.3 ) , compared with mothers aged 2024 .
the authors suggested biologic immaturity might be responsible for the poorer pregnancy outcome among adolescents .
adverse outcomes in teenage pregnancies have been confirmed in some , but not all , studies .
black adolescents do not have an inherent biologically increased risk for preterm birth compared with older black women .
the primary cesarean birth rate for teenagers was approximately 20% in 2005 and appears to be increasing in all age groups .
teenage mothers require instrumental deliveries approximately twice as often as do women aged 2024 years , but the reason for this is not clear .
proposed explanations include the physical immaturity of the younger mother and fear or lack of cooperation during the second stage of labor .
other reports have evaluated the outcomes of subsequent pregnancies after a first teenage pregnancy . in a population - based series limited to teenage pregnancies , adverse perinatal outcomes were more common among second , but not first , births to nonsmoking teenage mothers . in another study , the increased rate of preterm birth diminished in subsequent pregnancies after the teenage period . in a prospective study of 623 adolescent mothers ( 18 years ) who were followed for 4 years postpartum
adolescent pregnancy is associated with several adverse socioeconomic outcomes for the mother , father , and child .
mothers are less likely to receive a high - school diploma , are more likely to live in poverty and receive public assistance for long periods , and are at risk for intimate - partner violence .
children are more likely to have health and cognitive disorders and are more likely to be neglected or abused [ 12,17,2833 ] . in turkey
, we do not have reliable data on the number of underage mothers . in this report
, we retrospectively evaluated 163 underage mothers who were patients at gaziosmanpasa university faculty of medicine between january 2003 and january 2013 .
we present this study to increase awareness and sensitivity , to scrutinize and discuss these topics , to describe the status of underage mothers within the framework of children s rights , and to draw attention to this issue .
underage pregnant girls who were seen at forensic science department outpatient clinics and obstetrics and gynecology department outpatient clinics of gaziosmanpasa university faculty of medicine between 2003 and 2013 were investigated retrospectively .
we collected data on mean age , gravida , parity , abortion , curettage , live children , gestational age of mothers , and how they attended the clinic ( brought by police or by consultation of forensic medicine , or voluntarily ) .
statistical analyses were performed with the spss software ( version 20 , chicago , usa ) .
most of our cases were between 16 and 17 years of age ( n : 117 , 71.8% ) ( table 1 ) .
nine cases had gravida 2 , 1 had gravida 3 , and 1 adolescent pregnant girl had gravida 4 , while the remaining 152 patients were found to have their first pregnancy .
eight patients ( 4.9% ) had a previous spontaneous abortion ( 1 case had 3 abortions and the other 7 had 1 abortion ) .
three patients were accompanied with police escort ( sent by the judicial authorities ) and 4 patients were referred from the forensic outpatient clinic .
two cases were 14 years old , while the other two were 16 and 18 years old .
the rate of teen childbearing in the united states has fallen steeply since the late 1950s , from an all - time high of 96 births per 1000 women aged 1519 in 1957 to an all - time low of 49 in 2000 .
birthrates fell steadily throughout the 1960s and 1970s , they were fairly steady in the early 1980s , then rose sharply between 1988 and 1991 before declining throughout the 1990s . in recent years , this downward trend has occurred among teens of all ages and races . in turkey ,
the rate of pregnancy among females ages 1519 years was 6% in 2008 . in this age group the pregnancy rate was 0.45% in 1988 , 0.60% in 1988 , and 0.35% in 2008 .
the seriousness of teenage pregnancy as a health issue is reflected in the health of the nation initiative .
the target was to reduce the conception rate for girls under age 16 years in england by at least 50% from its 1989 base of 9.5 per 1000 to 4.8 by the year 2000 . in england and wales , for girls under age 16
the number of girls aged under age 16 becoming pregnant rose slightly for the third year running in 1996 .
there were 8800 conceptions to girls aged under age 16 in 1996 compared with 8000 in 1995 .
the conception rate for girls aged 1315 years in 1996 was 9.4 per 1000 , higher than 8.5 per 1000 girls in 1995 .
therefore , these rates have not yet fallen sufficiently to reach the health of the nation targets .
a similar pattern was seen in scotland , with rates falling until 1995 and then increasing again in 1996 .
these pregnant girls had low socio - economic and education levels and they also had low - birth weights infants , high infant mortality risk , and increased congenital anomaly risks .
turkey demographic and health survey ( dhs ) data from 2008 indicate that by the adolescent period , 6% of the females started to bear children : 4% of these have children , and 2% were pregnant with their first child during the survey . according to data from the tdhs-2003 ,
fertility has begun in 8% of females in the adolescent period , but according to tdhs-2008 data , this rate decreased to 6% .
adolescent motherhood was found to be more common in rural than in urban areas ( 9% and 5% , respectively ) .
adolescent fertility levels indicate significant differences between regions ( 3% in the eastern black sea region and 10% in middle - eastern anatolia ) adolescent fertility was high in the aegean region ( 9% ) ; according to tdhs-2003 data , adolescent fertility is higher in this region ( 13% ) and this has been described as a surprising finding
this rate was 3.9 in 2008 , 3.6 in 2009 , continued to decline in 2010 , and was 3.1 in 2011 ( table 3 ) .
physical and mental development has not yet finished in girls , thus childbirth and the post - partum period may lead to physical and psychological problems that may lead to increased maternal and infant mortality rates and disease development . in a survey by kkner et al .
, in developed societies , fear of pregnancy has decreased because of the spread of contraception and also by granting the legal right to abortion . however , in underdeveloped societies , traditions and family pressures force young girls to marry at an early age ; accordingly , there is an increase in adolescent pregnancies .
psychological problems do not occur only because of pregnancy , childbirth , and the post - partum period they can also occur due to sexual assault that causes pregnancy and early - age motherhood .
psychological problems are not only caused by pregnancy , childbirth , and the post - partum period , but also by sexual assault and the continuation of the resultant pregnancy .
the most commonly seen mental problems are post - traumatic stress disorder , anxiety disorder , and depression [ 6,35,4044 ] keskinolu et al .
examined the socio - economic level of 945 pregnant adolescents and repored that 99.7% were from unemployed families , 59.8% had no health insurance , and 81.5% of them are nulligravid .
in the employed families , 18.2% of pregnant adolescents had preterm delivery and 12.1% delivered low birth weight infants . preterm labor and cesarean
section rates were significantly higher in underage mothers compared to adult mothers . according to the 2008 turkish demographic and health survey
, 7% of uneducated females begin to bear children during the adolescence period , but this rate was only 4% in those who graduated from high school .
the concept of underage motherhood is not only a medical issue it is a multi - dimensional problem with social , economic , cultural , religious , and legal aspects .
therefore , there must be collaboration with civil organizations , as well as other clinical and social services to consider the best interests of the child in the creation of social protection programs .
the new turkish penal code , which came into effect 1 june 2005 , initiated positive changes in children s rights , but practice is always more important than laws that may exist only on paper . | backgroundall individuals under the age of 18 are considered as children by the convention on the rights of children .
underage mothers are a pediatric - age group of children that become pregnant and give birth
. it may be unfamiliar in western countries , but in middle - eastern countries ruled by religious laws and old - fashioned traditions , it is common for an older man to marry a girl .
the aim of this study was to describe the status of underage mothers within the framework of children s rights and to draw attention to this issue .
we presented this study to increase awareness and sensitivity , and to scrutinize and discuss these topics.material/methodswe retrospectively investigated cases of underaged pregnant girls who applied to forensic science department outpatient clinics and obstetrics and gynecology department outpatient clinics of gaziosmanpasa university faculty of medicine between 2003 and 2013.resultswe accessed records of 163 underage mothers ( 18 age ) .
mean age was 16.90.83 ( 1418 years ) .
gravida and parity rates increased proportionately with increasing age .
most of our cases were 16 and 17 years of age ( n : 117 , 71.8%).conclusionsunderage motherhood is not only a medical issue ; it is a multi - dimensional problem with social , economic , traditional , religious , and legal aspects . | Background
Material and Methods
Results
Discussion
Conclusions |
alzheimer 's disease ( ad ) is the most common cause of dementia in the aging population .
it is the major neurodegenerative disease of aging brain , mainly associated with the extracellular deposits of amyloid- plaques and intracellular neurofibrillary tangles ( nft ) in hippocampus region of the brain .
several studies across the globe show a strong association between loss of metal homeostasis and ad .
consequently , the research community is seriously considering the role of various bimetals and environmental metal toxins in progression and clinical outcomes of alzheimer 's disease and other forms of neurodegenerative disorders .
metals play an important role in alzheimer 's pathology ; heavy metals such as lead , cadmium , and mercury especially are highly neurotoxic and have no other biological functions .
however , nowadays , people are mainly focusing on biologically important metals such as iron ( fe ) , zinc ( zn ) , and copper ( cu ) because their imbalance is related to ad .
earlier studies demonstrated that metals like copper and zinc play a critical role in amyloid beta ( a ) aggregation and neurotoxicity [ 14 ] .
metal ions , mainly cu , fe , and zn , have been found to colocalize with the amyloid beta ( a ) in high concentrations , and interaction of these metal ions with soluble / aggregated forms of a peptides has been associated to the development of ad . among these
, copper has attracted the most attention because both the amyloid beta protein ( app ) and amyloid- ( a ) peptides have significant interaction with the copper .
location of copper binding domain ( cubd ) is found in the n - terminal region of the app , a type i transmembrane protein .
the cubd is found in cysteine rich region ( between residues 124189 ) [ 7 , 8 ] .
his-147 , his-151 , tyr-168 , and met-170 are the main amino acid residues of the cubd , which is involved in the mechanism of cu coordination and reduction of cu ( ii ) into cu ( i ) .
in addition to binding cu to cubd of app , copper is also found to interact with aggregated a and lead to the production of ros via fenton 's chemistry mechanism [ 9 , 10 ] . in a ,
amino acid residues his-6 , his-13 , his-14 , and tyr-10 are mainly involved in binding with the copper . the copper binding domain present in app
reduces cu ( ii ) to cu ( i ) causes the production of reactive oxygen species , and results in oxidative damage [ 10 , 11 ] .
there are many defence mechanisms that protect the cells from oxidative injuries caused by reactive oxygen species ( ros ) like hydroxyl radicals , hydrogen peroxide , superoxide radicals , and singlet oxygen .
superoxide dismutase ( sod ) is one of the major antioxidative enzymes which catalyze the conversion of superoxide radical to hydrogen peroxide in the presence of molecular hydrogen [ 12 , 13 ] .
mainly 3 forms of sod are present in mammals ; copper / zinc sod ( cuzn - sod , sod1 ) , which is localized in the cytosol ; manganese sod ( mn - sod , sod2 ) , which occurs in the mitochondrial matrix , and sod3 that is located extracellularly is also a complex of cu and zn .
oxidative injury in case of alzheimer 's is well established , but the exact role of a peptide and copper ions during this process is controversial [ 15 , 16 ] . some people adduced that a toxicity is due to ros generation in the presence of the a-cu ( ii ) complex , while others argued that a has antioxidant role .
however , cu plays an important role in the generation of reactive oxygen species [ 17 , 18 ] . ongoing research in this area
focuses on the prevention of cu mediated a neurotoxicity and ros production by cu chelating therapy , which is an emerging trend in current research .
hence , there is immense need to develop such a suitable copper chelator that could prevent amyloid- aggregation by effectively sequestering extra cu ions .
recently , several groups are focusing on developing such types of new molecules [ 1925 ] .
more particularly , in a pioneering work , storr et al . have developed two carbohydrate - containing compounds , n , n-bis[(5--d - glucopyranosyloxy-2-hydroxy)benzyl]-n , n-dimethyl - ethane-1,2-diamine ( h2gl1 ) and n , n-bis[(5--d - glucopyranosyloxy-3-tert - butyl-2-hydroxy)benzyl]-n , n-dimethyl - ethane-1,2-diamine ( h2gl2 ) , that have shown to be promising in vitro properties as therapeutic tools against ad .
herein , we designed and synthesized novel compound l , 2 , 6-pyridinedicarboxylic acid , 2,6-bis[2-[(4-carboxyphenyl ) methylene ] hydrazide ] , to test the in vivo neuroprotective efficacy in a well - established drosophila transgenic model system .
2,6-pyridinedicarboxylic acid , hydrazine hydrate , and 4-carboxybenzaldehyde were purchased from sigma - aldrich chem co. , whereas the solvents were purchased from e. merck and freshly distilled prior to their use .
maldi - tof autoflex speed ( bruker , germany ) was used for ms study .
the compound l was synthesized in three steps as reported by us earlier starting from 2,6-pyridine dicarboxylic acid ( 1 mmol , 0.167 g ) .
its methyl ester was prepared by stirring it in excess methanol in the presence of catalytic amount of concentrated thionyl chloride ( socl2 ) at room temperature for one day .
the ester ( 1 mmol , 0.171 g ) thus isolated was then reacted with aqueous hydrazine hydrate ( 2.1 mmol , 0.12 ml ) in methanol under reflux for 3 h which resulted the production of solid 2 , 6-pyridinedicarboxylic acid , 2,6-bis[2-[(4-carboxyphenyl ) methylene ] hydrazide ] .
it ( 1 mmol , 0.195 g ) was finally reacted with 4-formyl - benzoic acid ( 2 mmol , 0.300 g ) in methanol at room temperature .
the product thus obtained was filtered and then purified by repeated recrystallization from hot ethanol .
yield : 85% , elemental analysis calculation for c23h17n5o6 ( % ) : c , 60.13 ; h , 3.70 and n , 15.25 . found ( % ) : c , 60.11 ; h , 3.67 ; and n , 15.24 .
maldi - tof / ms , [ m + h ] = 460.18 , [ m + na ] = 482.17 .
h nmr ( dmso - d
6 , 300 mhz ) : ( ppm ) 13.21 ( b , 2h , cooh ) , 12.43 ( s , 2h , nh ) , 8.80 ( s , 2h , ch = n ) , 8.36 ( m , 2h , chpy ) , 8.34 ( m , 1h , chpy ) , 8.03 ( d , 4h , arh ) , and 7.91 ( d , 4h , arh ) .
c nmr ( dmso - d
6 , 300 mhz ) : (ppm ) 166.98 ( c1 , cooh ) , 138.18 ( c2 , arh ) , 127.41 ( c4 , arh ) , 132.12 ( c5 , arh ) , 140.11 ( c6 , ch = n ) , 159.70 ( c7 , c(o)nh ) , 148.89148.15 ( c8 , c9 , py ) , and 125.79 ( c10 , py ) .
ir ( kbr pellet , cm ) : 3463 ( conh ) , 1671 ( cooh ) , and 1609 ( c
= n ) . c27h35n5o11s2 , m = 669.74 , monoclinic , a = 26.7068(15 ) , b = 10.1394(4 ) , c = 12.4951(6 ) , = 90 , = 110.310(6 ) , and = 90 ; space group c 2/c , z = 4 , v / = 3173.2(3 ) , reflections collected / unique = 6463/3552 [ r ( int ) = 0.0196 ] , and final r indices [ i > 2sigma(i ) ] = r1 = 0.0360 , wr2 = 0.0871 .
a solution of cu(no3)23h2o ( 0.241 g , 1 mmol ) in water ( 5 ml ) was added dropwise to a solution of l ( 0.459 g , 1 mmol ) in dmso ( 10 ml ) .
the reaction mixture after stirring for one day at room temperature was left for slow evaporation to get green precipitate .
the precipitate was washed with meoh followed by diethyl ether and then dried in air .
> 250c , elemental analysis calc for c23h17n7o12cu ( % ) : c , 39.42 ; h , 2.42 and n , 14.00
. found ( % ) : c , 39.40 ; h , 2.43 , and n , 14.02 .
maldi - tof / ms [ m + h ] = 699.17 ( s2 ) .
ir ( kbr pellet , cm ) : 3417 ( conh ) , 1686 ( cooh ) , and 1651 ( c
uv - vis absorbance :
max ( dmso - water mixture , 10 m ) , nm ( /10 mcm ) 315 ( 0.66 ) , 352 ( 0.45 ) , 385 ( 0.26 ) , and 568 ( 0.150 ) .
the absorption titrations of l with copper salt are performed by monitoring the changes in the absorption spectrum of l ( 10 m ) in dmso - water mixture ( 1 : 9 , v / v ) .
the concentration of l is kept constant at 10 m , while the concentrations of copper salt are varied within ( 110 ) 10 m. the absorption of guest molecule is eliminated initially by keeping their equal quantities separately in host l and reference solution . from the absorption data , the intrinsic association constant
k
a was determined from a plot of [ guest]/(
a
f ) versus [ guest ] using equation [ guest]/(
a
f ) = [ guest]/(
b
f ) + [ ka (
b
f ) ] where [ guest ] is the concentration of copper salt .
the apparent absorption coefficients
a ,
f , and
b correspond to aobsd/[l ] , the extinction coefficient of the free l and extinction coefficient of l in fully bound form , respectively .
the drosophila transgenic strain expressing a
42 under the control of uas ( uas - a
/cyo ) was a generous gift from dr .
m. konsolaki ( department of genetics , rutgers , the state university of new jersey , usa ) and eye specific gal4 line ( ey - gal4 ( w[ ] ; p{w[+mc]=uas - dab.w}2 , p{w[+mc]=gal4-ninae.gmr}12/cyo ) , which directs the expression specifically in eye tissue , used in this study was obtained from bloomington stock center ( bloomington stock no .
flies and larvae were reared at 24 1c on standard drosophila medium containing agar - agar , maize powder , sugar , yeast , nepagin ( methyl - p - hydroxybenzoate ) , and propionic acid .
over expression of the a
42 transgene under uas control was achieved by crossing it with ey - gal4 fly .
the uas- a
42
/ey - gal4 larvae were cultured in normal food ( nf ) to achieve eye neurodegeneration phenotypes .
the effect of copper on eye degeneration phenotypes was tested by feeding the a
42 expressing larvae in 500 m copper nitrate [ cu(no3)2 ] supplemented food .
further , copper ( 500 m ) along with compound l ( 250 m ) was tested to see if copper chelation has any effect on eye degeneration in a expressing flies .
wild type oregon r and undriven uas- a
42/uas- a
42 flies were taken as controls in every case ( data not shown ) .
the uas- a
42
/ey - gal4 flies from f1 generation with noncurly wings ( n = 100 in each case ) were observed under stereo zoom binocular microscope for scoring eye phenotypes .
data of eye phenotypes was collected in each case of uas- a
42
/ey - gal4 flies cultured on normal food ( nf ) , cu treated food ( cu food ) , compound l treated food , and cu + compound l supplemented food media , and statistical analysis was done by using one - way anova analysis ( prism 3 software ) .
the homogenate was centrifuged , and sod activity was estimated as described by nishikimi et al . with minor modifications as per singh et al . .
one unit of enzyme activity is defined as enzyme concentration required for inhibiting chromogen production ( optical density 560 nm ) by 50% in 1 min under assay conditions , and the data were expressed as the specific activity in units / min / mg protein .
adult flies were homogenized in homogenizing buffer following a method described previously .malondialdehyde ( mda ) content as a measure of lpo was assayed using tetraethoxypropane as an external standard .
lipid peroxide levels were expressed in terms of nmoles mda formed / h / mg protein .
we followed the method of wolff 2011 with minor modifications for the scanning electron microscopy of compound eyes .
about 46 representative flies from each group with different treatments were etherized , and heads were detached carefully under the binocular microscope to leave the eyes intact .
the decapitated heads with intact eyes were put into 1.5 ml eppendorf tube and fixed overnight in 1.5 ml fixative ( 0.1 m pbs , 25% glutaraldehyde and dh2o ) , dehydrated in ethanol ( once in 25% , 50% , 75% , and 100% ethanol each with 3 hrs and then thrice in absolute ethanol , 15 min each ) .
tissues were dried by using cpd ( critical point drying ) for removing any extra moisture present in sample and then analysed by using scanning electron microscope ( hitachi s-3400n ) .
the uv - vis titrations with compound l ( figure 1(a ) ) were carried out in dmso - water mixture ( 1 : 9 v / v ) solution using standard nitrate salts of cu , zn , and ag at room temperature .
uv - vis spectrum of the solution of l ( 1.0 10 m ) recorded upon the addition of cu , is shown in figure 2 .
upon addition of cu the absorption peak at 315 nm was decreasing , whereas the absorption peak at 352 nm was increasing .
the appeared isosbestic point shows that the stable complex ( figure 1(b ) ) is formed with a definite stoichiometric ratio between l and cation .
interestingly , the addition of other nitrate salts of zn and ag did not result in any observable change in the absorption spectrum of l at this wavelength .
colour changes are most probably due to the formation of complex between the amido groups and copper ion .
the value of association constant ( k
a ) for copper ion was found as 1 10 binding in 1 : 1 stoichiometry ( job 's plot , s3 ) .
electronic spectra for l remained unchanged in the presence of excess ( 20 mole equivalents ) of other nitrate salts of zn and ag . to determine the effect of copper chelator ( compound l ) on cu mediated a toxicity , a expressing larvae were cultured separately in copper ( 500 m ) , chelator ( 250 m ) , and cu + chelator ( 250 m ) supplemented food ( figure 3 ) .
the flies expressing a were also cultured in normal food ( nf ) , and wild type flies were taken as control in each case .
a expressing flies showed mild and severe eye degeneration phenotypes ( figure 3(d ) ii and iii , resp . ) when cultured in normal food .
the severity in eye degeneration was enhanced to several folds in cu treated flies as compared to untreated flies ( compare figure 3(d ) iv with iii ) , while the percentage of flies showing severe defects was unaltered .
the degree of severity was of two types ; flies observed form cu supplemented food showing more severity in eye phenotype with highly degenerative dark patches as compared to flies cultured in normal food ( compare figure 3(d ) iv with iii ) .
rescue in severe eye degeneration was found in compound l treated flies at 250 m concentration ( figure 3(c ) ) , which appears to be the best concentration for copper chelation in vivo .
compound l ( chelator ) alone was also tested on uas- a
42
/ey - gal4 flies ( without copper supplementation ) and found significant rescue only at 200 m concentration ( compare figure 4(a)with figure 3(a ) ) .
but chelator at 250 and 300 m concentrations did not show any apparent rescue ( figures 4(b ) and 4(c ) , resp . ) .
the ros activity in a expressing flies grown in normal food , copper ( cu ) treated , chelator ( che ) treated , and copper and chelator ( cu + che ) treated food was assessed indirectly by estimating sod and mda levels .
the effect of copper treatment on antioxidant markers like sod ( figure 5 ) and mda ( figure 6 ) in a-driven flies suggests increased ros activity .
we observed a significant ( p < 0.05 , p < 0.001 ) increase in the enzyme activity in a flies fed on normal and copper treated food , respectively ( figure 5 ) , and sod activity was reduced in chelator treated flies , which is comparable to wild type .
there was a significant increase of 1.6- and 1.9fold ( p < 0.05 , p < 0.001 ) in mda activity in flies grown on normal and copper supplemented food , respectively , as compared to wild type ( figure 6 ) . rescue in degenerative eye is clearly evident in digital microscopy imaging ( figure 7(d ) ) . but in order to clearly visualize the internal morphology of the eye , like structural arrangement of ommatidia and bristles , scanning electron microscopy ( sem ) is required .
sem has revealed the recovery of normal eye morphology in chelator treated flies ( figure 7(h ) ) as compared to flies treated with normal and copper supplemented food ( figures 7(f ) and 7(g ) , resp . ) .
this clearly indicates that compound l may be inhibiting cu mediated a toxicity which causes eye degeneration .
flies expressing the a
42 transgene in neurons showed severe eye degeneration when grown in normal food ( figures 7(b ) and 7(f ) ) , while food supplemented with cu ions showed highly degenerative ommatidial morphology with complete loss of bristles and reduction of eye size ( figures 7(c ) and 7(g ) ) .
however , in wild type control , flies smoothly arranged patterns of ommatidia and bristles are found ( figures 7(a ) and 7(e ) ) .
we have used a drosophila transgenic model of ad to investigate the therapeutic potential of a novel copper chelator , compound l that might be reducing copper mediated a toxicity .
many existing compounds aim to reduce a production by blocking and -secretases or by stimulating -secretase activity of app .
recent studies have shown that and -secretase inhibitors may cause side effects , because they are important for the cleavage of other biologically important molecules . alternatively , stimulation of the nonamyloidogenic amyloid precursor protein processing is being developed as a potential therapy against ad .
since metals play a very important role in mediated a toxicity , several researchers are working on the development of chelators that can effectively reduce metal toxicity .
further , cu mediated a toxicity also results in ros production , so several others are working on this to prevent ros generation due to cu induced a aggregation .
therefore , the main aim of this study is to investigate the neuroprotective efficacy of a newly synthesized copper chelator in an in vivo drosophila ad model and to appraise its use as a potential therapeutic agent . in this work , a novel copper chelator , compound ( l ) , was synthesized and characterized by ms and ea analyses . in order to test its efficacy ,
compound l was supplemented through diet to the transgenic drosophila expressing human a. we have used uas / gal4 system to express a
42 specifically in eye tissues .
the effect of this novel copper chelator in the rescue of severe neurodegenerative eye phenotype was observed by using statistical ( figures 3 and 4 ) as well as scanning electron microscopic studies ( figure 7 ) . to see the effect of cu and cu chelator on a developmentally induced retinal toxicity phenotypes ( the severe rough eye phenotype ) generated by cu induced a
42 , we have cultured a
42 expressing transgenic larvae on normal medium , cu ( 500 m ) supplemented medium , cu + chelator ( 250 m ) , and with chelator alone ( 200 m , 250 m , 300 m ) . the a
42 expressing flies in normal and cu
supplemented food showed mild and severe eye degeneration phenotypes in both the cases ( figures 3(a ) and 3(b ) , resp . ) .
however , the severity in eye degeneration in cu treated flies is more as compared to the flies grown in normal food though the % number of flies did not vary in both the cases ( figure 3(d ) ) .
interestingly , cu chelator at 250 m concentration showed very good rescue against cu induced severe neurodegeneration phenotype ( figure 3(c ) ) .
further , compound l alone at 200 m concentration also showed significant rescue against the severe rough eye phenotypes of a
42 expressing flies ( figure 4(a ) ) .
however , 250 m and 300 m concentrations did not show such recovery in eye phenotypes ( figures 4(b ) and 4(c ) ) , though there is no lethality associated with these doses of chelator .
perhaps further studies on concentration dependent a
42 chelator in vitro binding assays will shed light on this aspect .
we have also checked the effect of copper complex ( [ cu(l)]2no3 ) on eye phenotypes at the same concentrations used for chelator .
but , in this case , there is a lethality observed at both embryonic and early larval stages ( data not shown ) .
the lethality is caused due to the presence of high levels of cu in the complex itself .
similarly , in the sem analysis , we found that ommatidial irregularity was recovered by the treatment of compound l ( figure 7 ) .
we observed the best rescue ( ~7580% ) of the rough eye phenotype in a
42 expressing flies when treated with 250 m of compound ( l ) .
hua et al . , showed ameliorating the a-associated toxicity using cu and zn chelators , thus preventing and/or delaying the progression of ad .
our results show that supplementation with this novel copper chelator reduces copper mediated neurodegeneration by inhibiting a aggregation in drosophila eye .
however , the mechanism of action is not clear , and future work should also address the mechanism of action of this novel copper chelator in reducing the copper mediated a toxicity .
it is now widely accepted that cu promotes the a mediated ros production that causes toxicity to cells . in this context
, we have checked some in vivo ros markers like sod and mda in treated as well as control flies including wild type and found significant increase in sod and mda activities in flies fed on normal as well as copper treated food .
sod is an antioxidant enzyme and primarily acts to protect oxygen - metabolizing eukaryotic cells from the adverse effects of superoxide ions .
transgenic flies over expressing sod show a decreased level of oxidative damage and a 33% increase in life span compared to the controls .
generally , sod activity is observed to be elevated in case of any therapeutic drug , but in our case , we found significantly increased activity of sod in case of flies fed on normal and copper treated food , and reduction in sod activity was found after compound l treatment .
this observation of elevated sod activity in copper supplemented flies and reduced activity of sod in chelator treated flies could be due to cu and zn cofactor mediated sod activity .
however , further studies related to sod and other marker enzymes in this context are required to address this intriguing issue .
thus , our results indicate that this novel copper chelator plays a role in protecting against cu mediated a aggregation and neurotoxicity in an in vivo model system .
our results provide support for the neuroprotective effect of this novel compound l as a potential therapeutic agent for ad .
in conclusion , we show that the cu mediated toxicity of a peptides can be reduced through chelation of aggregation - promoting cu metal ions by suitable chelating agent as developed here ( l ) .
in addition , further investigations on the mechanism of action of this novel copper chelator are required . | alzheimer 's disease ( ad ) is a progressive neurodegenerative disease and associated with the extracellular deposits of amyloid- peptide in hippocampus region .
metal ions like cu , fe and zn are known to associate with the amyloid beta ( a ) at high concentration and interaction of these ions with soluble and aggregated forms of a peptide help in development of ad .
here we showed cu mediated neurotoxicity in the eye tissues of transgenic drosophila expressing human amyloid and its rescue through a novel cu chelator . in this context , we have synthesised and characterized the compound l 2,6-pyridinedicarboxylic acid , 2,6-bis[2-[(4-carboxyphenyl ) methylene ] hydrazide ] by mass spectra ( ms ) and elemental analysis ( ea ) .
the cu chelation potential of the compound l is tested in vivo in drosophila .
oral administration of copper to the transgenic larvae resulted in severe degeneration in eye tissues , which was rescued by the supplementation of compound l. the levels of anti - oxidant markers like sod and mda were measured in compound l treated flies and found a significant rescue ( p < 0.001 ) .
further rescue of the eye degeneration phenotypes as revealed by sem affirm the role of copper in a toxicity .
hence , use of compound l , an amidoamine derivative , could be a possible therapeutic measure for a induced neurotoxicity . | 1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. Conclusion |
cytotoxic t lymphocyte ( cd8 ) cell activation is a major cause of hiv pathology .
the expression of the activation markers cd38 and hla - dr on t cells is an indicator of cell activation .
hiv infection activates cd8 t cells resulting in their expansion and expression of hla - dr antigens . to date the effect of pregnancy on the immune activation of cd8 t cells that may affect hiv disease progression
thus , the study set to investigate the levels of activated cd8 t surface markers ( cd38 and hla - dr ) would lead to a better understanding of the immunological relationship of hiv and pregnancy .
the objective of the study was therefore to compare cd8 t lymphocyte activation surface markers ( cd38 and hla - dr ) levels in pregnant and nonpregnant women with hiv infection .
the study used cd8 cellular immune activation surface markers ( cd8/hla - dr / cd38 ) because cd8 cellular activation , as opposed to cd4 activation , is more predictive of long - term immunologic responses as cd4 cells are infected by hiv and are more likely to be removed through apoptosis .
the investigation was done in eldoret , kenya , at academic model for providing access to healthcare ( ampath ) centre outpatient clinics and moi teaching and referral hospital ( mtrh)mother child health care ( mch ) clinics .
ampath was started in 2000 as part of collaboration between moi university ( mu ) , mtrh , and a consortium of american universities led by indiana university of the united states .
mtrh is the second largest hospital in kenya and serves referral patients from rift valley and western kenya .
ampath aims at a comprehensive care for hiv - infected patients , enhancing education and research in hiv / aids . in a case - controlled study design asymptomatic hiv - positive pregnant and nonpregnant women with no prior receipt of antiretroviral medications and ages 18 years and 40 years
a study sample guideline - questionnaire was used to enquire from the study participants the possible period of hiv infection with 6 months set as the maximum period of hiv infection to recruit the study participants .
this was done for both study group and controls since it is naturally difficult to recruit participants of exactly similar time after infection ; this was one of the study limitations .
women with a history or diagnosis of any complications in pregnancy ( previous or present ) , for example , miscarriages , tumors , diabetic mellitus , pneumonia , influenza , herpes , autoimmunity , or evidence of acute infection , and untreated medical illness , for example , coinfections in pregnancy , were excluded from the study .
consecutive sampling technique was used to recruit thirty - six hiv - infected pregnant women as the study subjects and thirty - six hiv - infected nonpregnant women as control group .
specific levels of cd8 cellular immune activation markers ( cd8/hla - dr / cd38 ) were determined and correlated with cd4 counts between the two groups .
laboratory analysis to determine the levels of activated cd8 t lymphocytes was performed using a flow - cytometer facscalibur ( bd biosciences , san jose , ca , usa ) .
the flow - cytometer machine was equipped with 635 nm and 488 nm lasers and could detect four color fluorescence with emissions detectable in the ranges of 515545 nm , 562607 nm , > 650 nm , and 652608 nm .
blood samples were stained within 48 hours of collection and analyzed within 24 hours of staining .
cd8/hla - dr / cd38 surface markers were then labeled and analysed using cd38 and hla - dr monoclonal antibodies conjugated with fitc : fluorescein isothiocyanate ; pe : phycoerythrin ; pe - c5 : phycoerythrin - cyanine5 ; apc : allophycocyanin .
processing of the samples was done using facs lyse / no wash method , acquired from a bd facscalibur instrument . for each sample mixed with anticoagulant edta
twenty ( 20 ) l of the antibodies were put in each tube and vortexed .
then 50 l of the blood sample was added , vortexed , and incubated for 15 minutes . after staining and following incubation ,
cells were lysed with 450 l of bdfaclyse reagent and incubated for at least another 15 minutes .
live gating based on forward- and side - scatter properties was set on the cd3 and cd8 lymphocyte fraction .
live gating was used to collect 10 000 events by fsc and ssc cytogram with a gate set on the cd3 and cd8 lymphocyte fraction .
the percentage of cells cd8 t cells expressing cd38 and hla - dr surface markers was then read using the cell quest pro software ( bd biosciences , san jose , ca , usa ) .
all the data was recorded on a standard case report forms , a tool developed for this study .
statistical analysis of descriptive data focusing on frequencies , correlation , and cross - tabulations was determined using statistical package for social sciences ( spss ) version 16.0 ( norusis , spss , chicago , il , usa ) .
non - parametric methods were used to statistically evaluate the data and compare tests since the data was not normally distributed .
the study was given ethical approval by institutional research and ethics committee ( irec ) from moi university / moi teaching and referral hospital ( approval number is 000388 ) .
the study procedures did not interfere in any manner with the routine clinical care provided to patients enrolled in the study .
informed and voluntary consent by each subject was sought before any data was collected from the subjects .
the purpose , procedures , and risks and benefits of the study were also discussed with the subject .
the participants also retained the right to refuse to answer individual questions or to discontinue study participation without jeopardy .
the mean age of the 72 women included in this analysis at the time that it was performed was 30.35 years with that of the 36 nonpregnant women being 30.75 years and pregnant ones 29.94 years .
52 ( 72.2% ) were married and 56 ( 77.8% ) were unemployed or earned less than ksh10 , 000 ( 125 us dollars ) per month as income .
no statistically significant differences were found in the distribution of age , marital status , and income ( p > 0.299 ) between the two study groups and in subjects of different trimesters of pregnancy . statistical difference was however observed in the cd4 absolute count .
the study showed marked and significant lower activated cd8 t lymphocyte surface markers in pregnant women compared to the nonpregnant group ( cd8/hla - dr % ( p = 0.029 ) and cd8/cd38 % ( p = 0.011 ) ) as depicted in table 2 .
medians found in the cd8 cells expressing hla - dr and cd38 in nonpregnant hiv - infected individuals were 31.6% and 32.0% , respectively , while in the hiv pregnant women they were 28.4% and 27.3% , respectively .
variation of cd8 cellular immune activation markers in the pregnant group in different trimesters is as shown in table 3 . the cd8 t cell immune activation markers ( cd8/hla - dr / cd38 ) varied significantly in the different trimesters of pregnancy ( p < 0.028 ) .
the highest percent counts were observed in first trimester with a decrease towards the third trimester .
the medians of percent cd8 immune activation marker cd8/hla - dr in the first , second , and third trimesters were 39.2% , 28.4% , and 25.3% , respectively .
similarly the cd8/cd38 median percent counts in the subjects in the first , second , and third trimesters were 39.3% , 28.4% , 24.8% , respectively .
the relationship between the activated cd8 t cells ( cd8/hla - dr / cd38 ) and cd4 cell counts have been shown in tables 4 and 5 .
the expression of cd8/hla - dr ( denoted by a ) by cd8 t cells was correlated with cd8/cd38 and cd4 cells ( all denoted by b ) . when cd8 immune activation markers were correlated in both study groups
it was observed that the surface marker cd8/hla - dr positively correlated at 99% confidence level with cd8/cd38 ( p < 0.001 , r = 0.999 ) indicating that when high percent counts of cd8/hla - dr are observed , high percent cd8/cd38 counts were also noted in the study subjects .
the percentage of cd8 t cells that were cd38 and hla - dr had inverse correlations with both the percentage and absolute counts of cd4 t cells in both study groups .
however , nonsignificant inverse correlation for the cd8 cellular immune activation markers ( hla - dr and cd38 ) and cd4 cell counts was observed in the pregnant study group . in the nonpregnant group cd4 ,
absolute cell counts showed a 99% confidence level of negative correlation with the two surface markers of cd8 immune activation ( hla - dr and cd38 ) .
cd4 percent cell counts correlated negatively and significantly at 95% confidence level with the cd8 cellular immune activation markers ( hla - dr and cd38 ) in the nonpregnant subjects .
the present study investigated how pregnancy alters cd8 t cell immune activation and how this may correlate with cd4 counts , as an indicator of immune status .
no statistically significant differences were found in the demographics and social economic characteristics between the two groups as shown in table 1 .
it has been shown that the total cd8 lymphocytes may not be altered by pregnancy , but the present study indicates decrease in percentage of activated cd8 t cells in hiv - infected pregnant women .
progressive suppression was also observed in different trimesters of pregnancy in hiv - infected women as shown in table 3 .
this provides evidence that nonpregnant women can expect high turnover and effector function of activated cd8 t cells than pregnancy with hiv infection .
the data presented herein support the contention that high levels of cd38 and hla - dr expression correlate with cd8 t cell subset activation in hiv individuals [ 3 , 6 ] . chronic immune activation and constant turnover of activated cd8 t cells
are therefore a hallmark of hiv infection , and these factors are now thought of as playing a critical role in hiv pathogenesis and disease progression by increased rate of cd4 t cell depletion .
cd38 and hla - dr expression on cd8 t cell subsets correlated inversely ( significantly in nonpregnant subjects ) with cd4 t cell counts as shown in tables 4 and 5 .
this observation suggests that expression of these markers is an important marker for cd8 t cell activation and cd4 cell depletion , particularly in hiv infection with no pregnancy .
immune activation - driven death of cd4 cells , more than a direct virological pathogenic effect , could be responsible for decline in cd4 t cells [ 7 , 8 ] .
thus , hla - dr and cd38 expression on cd8 t lymphocytes may serve as a tag to identify those cd4 t cells that are being eliminated by activation - induced killing during hiv infection .
based on the study results cd8 cd38 dr t cell level seems to be depressed in pregnant hiv - infected patients and therefore may be an important prognostic parameter of immune status during pregnancy .
the present study design could not show the cause - effect relationship but gave a mere comparison of study groups and relationships of variables ; this could be rigorously studied using follow - up study design with more control arms including viral load counts to validate the observed results . |
background . to date the effect of pregnancy on the immune activation of cd8 t cells that may affect hiv disease progression has not been well studied and remains unclear .
objective . to determine the effect of pregnancy on cd8 t lymphocyte activation and its relationship with cd4 count in hiv infected pregnant women
. study design .
case control . study site .
ampath and mtrh in eldoret , kenya .
study subjects . newly diagnosed asymptomatic hiv positive pregnant and nonpregnant women with no prior receipt of antiretroviral medications . study methods .
blood samples were collected from the study participants and levels of activated cd8 t lymphocytes ( cd38 and hla - dr ) were determined using flow cytometer and correlated with cd4 counts of the study participants .
the descriptive data focusing on frequencies , correlation , and cross - tabulations was statistically determined .
significance of the results was set at p < 0.05 .
results .
hiv positive pregnant women had lower activated cd8 t lymphocyte counts than nonpregnant hiv positive women . activated cd8 t lymphocyte counts were also noted to decrease in the second and third trimesters of pregnancy .
conclusion .
pregnancy has a significant suppression on cd8 + t lymphocyte immune activation during hiv infections .
follow - up studies with more control arms could confirm the present study results . | 1. Introduction
2. Materials and Methods
3. Results
4. Discussion and Conclusions |
histone deacetylases remove acetyl groups from histone and non - histone proteins ; they are properly termed as lysine deacetylases or kdacs , but for historical reasons remain better known as hdacs .
eighteen hdacs have been identified so far in mammalian cells , which are divided into four classes : class i hdacs include hdacs 1 , 2 , 3 and 8 , and are homologous to yeast rpd3 .
class ii consists of hdacs 4 , 5 , 6 , 7 , 9 and 10 , and they have high similarity to yeast hda1 . additionally , class iia enzymes ( hdacs 4 , 5 , 7 , 9 ) depend on class i hdacs for their activity .
sirtuins , similar to yeast sir2 , form class iii hdacs and their activity is dependent on nad .
hdac11 is the only class iv hdac with features similar to class i and class ii hdacs .
histone deacetylase inhibitors ( hdis ) , small molecules that inhibit hdac activities , are potent anti - proliferative agents that selectively kill cancer cells .
currently available hdis belong to four classes based on their chemical structure : hydroxamate , cyclic peptide , aliphatic acids and benzamide . when used as a monotherapy agent
, hdis have shown a very positive response in patients with hematologic malignancies , but they have been less effective on solid tumors .
two broad - spectrum or panhdis , saha or vorinostat ( a hydroxamate class inhibitor ) and depsipeptide or romidepsin ( a cyclic peptide class inhibitor ) , are currently approved by the fda for the treatment of refractory cutaneous t - cell lymphoma ( ctcl ) .
this approval has spurred the creation and testing of several novel hdis and at least 20 of them are currently in preclinical or clinical trials .
an effective hdi to treat b - cell malignancies is still not available in the clinic and several phase i studies using saha / vorinostat are currently underway for lymphomas . while saha and depsipeptide are effective anti - neoplastic agents , the broad - spectrum mechanism of action of these fda - approved hdis was not fully understood .
hdacs and hdis have been studied mainly in the context of gene transcription and not genome stability in cancers .
for instance , acute myeloid leukemia ( aml ) is associated with misregulated gene expression due to recruitment of hdacs to ectopic loci by mutant transcription factors .
hdi treatment is therefore thought to kill these aml cells by reversing the repressive effects of aberrantly targeted hdacs . to develop and use specific selective inhibitors to individual hdacs , which might lead to a safer and more effective hdac inhibitors with less side - effects
, it is imperative to understand the transcription - independent functions of individual hdacs in normal and cancer cells .
this knowledge is required for not only better design , but also for the better understanding of the mode - of - action of selective hdac inhibitors .
several hdac inhibitors are currently being used in clinical trials for b - cell lymphomas and two of these inhibitors are fda - approved drugs for the treatment of refractory cutaneous t - cell lymphoma .
however , these fda - approved broad - spectrum hdac inhibitors inhibit ten different hdacs , and therefore have several adverse side effects in cancer patients , which include cardiac toxicity , thrombocytopenia and gastrointestinal toxicity . hence , using selective inhibitors against specific class i will cause maximum cytotoxicity in cancer cells , but at the same time minimize the side effects caused by the use of pan - hdac inhibitors .
before , we use selective hdac inhibitors in the clinic ; it is imperative to understand biological functions of individual hdacs . class i hdacs consist of hdac1 , 2 , 3 and 8 .
our previous studies uncovered novel functions for hdac3 in genome maintenance processes ( dna repair and dna replication ) . targeted deletion of hdac3 in the germ line led to embryonic lethality . using conditional hdac3 knockout mice
, we showed that the deletion of hdac3 leads to s - phase - dependent dna double - strand breaks in cycling cells and not in quiescent cells , which could provide a therapeutic window .
cell cycle analysis of hdac3-null cells revealed a delay in the progression of cells through the s - phase , accumulation of s - phase dependent dna damage and activation of the s - phase cell cycle checkpoint response .
moreover , hdac3-null cells displayed a reduction in both homologous recombination and non - homologous recombination pathways , suggesting that the absence of hdac3 impairs double - strand dna break repair .
even though short - term loss of hdac3 causes cell death in primary mouse embryo fibroblasts , long - term deletion of hdac3 in livers leads to hepatocellular carcinoma in mice .
thus , genetic knockout studies provide not only insights into the biological functions of hdacs , but also provide valuable information regarding the efficacy of hdis in cancer therapy when used for a short duration and the demerits of their sustained long - term use .
hdac3 activity is also required for the removal of h3k4 acetylation ( h3k4ac ) at centromeres and loss of hdac3 leads to dissociation of sister chromatids in hela cells .
the increase in h3k4ac in hdac3-depleted cells occurs before the entry of cells into mitosis , which is consistent with our findings that hdac3 dissociates from chromatin before the metaphase stage .
hence , in addition to dna repair and dna replication , hdac3 maintains genome stability by controlling centromeric functions .
recent intriguing discoveries demonstrate that hdac3 could regulate transcription independent of its catalytic activity in mouse livers . in this study ,
the interaction of hdac3 with its stable partners ncor and smrt was found to be important for the deacetylase - independent functions of hdac3 during transcription .
interestingly , we previously found that knockdown of both ncor and smrt decreased the total cellular levels of hdac3 and activated the dna damage response , demonstrating the importance of ncor - smrt - hdac3 nexus in regulating genome stability .
hence , targeting ncor and smrt , in addition to targeting hdac3 , would be another strategy to trigger dna damage response in cancer cells .
a great deal of knowledge gained from the elegant studies using conditional single gene or double gene knockout mouse models in various cell lineages or tissues have together shed light on the vital , redundant and non - redundant biological functions of hdac1 and hdac2 , which are two highly similar enzymes .
hdac2 pups died within a month , due to cardiac defects and abnormalities in myocyte proliferation . in another study , 50 percent of hdac2 pups died perinatally , whereas the remaining littermates survived .
the reason behind different phenotypes in hdac2 mice could be attributed to the different strategies used to make these knockout mice and ( or ) due to different mouse strains . in the vast majority of cell types ( including those made during hematopoiesis ) , targeted deletion of either hdac1 or hdac2 has minimal effects on proliferation and the cell cycle , likely due to compensation for one by the other . however
, combined deletion of both hdac1 and hdac2 ( hdac1,2 ) dramatically impairs proliferation in multiple cell types by blocking cells at the g1 to s phase stage . simultaneous deletion of hdac1 and hdac2 in early b - cell progenitors leads to a dramatic block in b - cell development and apoptosis .
however , mature non - dividing terminally differentiated b - cells can tolerate loss of both hdac1 and hdac2 , but their deletion affects proliferation upon exogenous mitogenic stimulation .
loss of hdac1,2 function in embryonic stem cells led to chromatin bridges and mitotic instability .
interestingly , loss of hdac1 function in tumor cells led to defective entry into mitosis , which in turn leads to apoptosis .
these findings together reveal that hdac1,2 play a crucial role when cells progress through the cell cycle . in mice with hdac2 alleles but without the hdac1 alleles ( i.e. , hdac1-null mice ) , immature thymocytes accumulation and lymphoblastic lymphomas were observed .
similarly , mice with hdac1 and no hdac2 alleles ( i.e. , hdac2-null mice ) also developed lymphomas .
however , lymphamogenesis was not observed when both hdac1 and hdac2 activities are lost in t - cells .
a similar dosage dependent effect upon loss of either hdac1 or hdac2 was observed on epidermal proliferation and differentiation . in this elegant study , deletion of a single hdac2 allele in hdac1-knockout mice
therefore , the use of genetic knockout mouse models in parallel with the isotype selective inhibitors of hdacs is required to compare and assess the mode - of - action , specificity , benefits , and pitfalls of complete and partial inhibition of individual hdacs .
the deletion of hdac8 , another class i hdac , in mice led to death within 46 h following birth .
conditional deletion of hdac8 specifically in the brain caused loss of cranial neural crest cells and instability of the skull in mice .
hdac8 is a deacetylase for smc3 ( sister maintenance of chromosome protein 3 , a core cohesion component ) , and mutations in hdac8 that disrupt smc3 deacetylation result in an improper renewal of cohesin components and inadequate recycling of the cohesin components in the next cell cycle .
this results in decreased cohesin occupancy in the genome leading to clinical features of cornelia de lange syndrome ( cdls ) , which is characterized by the congenital malformation disorder .
hence , all four class i hdacs are required for genome maintenance in mammalian cells .
however , hdac1,2 are recruited to sites of dna replication and dna damage break sites , suggesting a direct role for these two enzymes during dna replication and double - strand break ( dsb ) repair .
even though loss of hdac3 impairs dsb repair , it is not localized to dsb dna damage sites .
hence , the repair defects observed in hdac3-null cells is likely due to the defective chromatin structure .
direct functions for hdac8 at the replication fork and at dna damage sites remain to be investigated .
defective dna repair and/or dna replication are major causes of genome instability , which can trigger cell death .
deletion of both hdac1 and hdac2 using conditional knockout system results in the arrest of cells in the g1 phase , and hence it was difficult to study functions of hdac1,2 in the s - phase progression .
selective inhibitors make an excellent tool to study biological functions of hdac1,2 as we could transiently inhibit their functions for a short duration of time when there is an impact on dna replication and repair and before cells arrest in g1 phase . using selective inhibitors
, we examined whether hdac1,2 activities are required for efficient dna replication in mammalian cells . a decrease in replication fork velocity
was observed upon hdac1,2 inhibition , demonstrating that hdac1,2 activities are required for efficient replication fork elongation .
if stalled forks are not restarted in a timely fashion , it can result in fork collapse , formation of dsbs and activation of the dna damage response .
increased h2ax ( phosphorylated form of h2ax and a marker of double - strand breaks ) was observed in cells treated with hdac1,2 inhibitor or following knockdown of hdac1,2 .
rna - seq analysis of s - phase cells treated with hdac1,2 selective inhibitor showed no change in the expression of genes involved in dna replication or dna repair .
hence , our findings showed a direct role for hdac1,2 in ensuring the proper progression of the replication fork .
activation of dna damage response in s - phase cells due to obstruction of dna fork progression provided the mechanistic basis for how hdac1,2 selective inhibitors might be able to directly target regulators of genome stability in order to kill the rapidly cycling cancer cells . upon dissection of the mechanism behind these replication defects , we found that these enzymes control chromatin structure at and around replicating regions by targeting histone acetylation .
we developed a technique termed modified brdu - chip assay to examine histone modifications and replication proteins on nascent dna .
this technique is a complement to the elegant ipond technique that permits one to follow the dynamics of replication proteins associated with nascent dna . using the modified brdu - chip approach
, we showed that inhibition of hdac1,2 activity increases h4k16ac present on newly synthesized dna and at replicating origins .
therefore , we asked whether hdac1,2 regulate nascent chromatin packaging around replication forks by targeting h4k16ac ?
an increase in the release of brdu - labeled nascent dna associated with di- and tri - nucleosomes was observed following micrococcal nuclease digestion in hdac1,2 inhibitor - treated cells , confirming the role for hdac1,2 activities in chromatin compaction during dna replication .
smarca5 is a iswi - family atp - dependent chromatin remodeler , whose activity is inhibited by h4k16ac and h4k12ac marks , and both of these marks are targets of hdac1,2 . hence , we asked is there a connection between smarca5 and hdac1,2 functions at the replication fork ?
we found that smarca5 is present on nascent dna and importantly , loss of smarca5 also reduced fork velocity similar to the loss of hdac1,2 activities .
we found that the level of smarca5 associated with replication origins increases whereas the level of h4k16ac at replication origins decreases when cells enter the s - phase .
thus , hdac1,2 activity appears to be required for the deacetylation of h4k16ac to facilitate smarca5-mediated remodeling of chromatin around the replication fork during s - phase .
overall , our studies demonstrated the functional interplay between a chromatin remodeler ( smarca5 ) , regulatory histone modifications ( h4k12ac and h4k16ac ) and histone deacetylases ( hdac1,2 that target h4k12ac and h4k16ac ) at the replication fork .
moreover , these studies highlight the mechanism by which selective inhibition of hdac1,2 is able to directly target chromatin structure and the chromatin remodeling around replication forks in order to obstruct the progression of dna replication , trigger dna damage response and selectively kill the rapidly cycling cancer cells . diffuse large b - cell lymphoma ( dlbcl ) , a type of non - hodgkin 's lymphoma , is the most common lymphoid malignancy in the united states accounting for 40% of adult lymphomas .
a major advancement has been made in treating dlbcl with the addition of rituximab ( an anti - cd20 monoclonal antibody ) to the standard chemotherapy regimen chop ( vincistrine , doxorubicin , cyclophosphamide , prednisone ) . despite overall improvement in treating dlbcl using this cocktail regimen ,
a vast majority of b - cell lymphomas are derived from the germinal centers of lymphomas .
these lymphoma cells constitutively express bcl6 oncogene , due to translocations or mutations that result in deregulated bcl6 expression .
bcl6 oncoprotein acts as a key transcriptional repressor of the atm / atr / p53 dna damage - signaling pathway and facilitates hyperproliferation to provide a survival advantage to lymphoma cells .
the transcriptional repression is mediated through recruitment of hdacs 1 , 2 and 3 , via recruitment of smrt , ncor and bcor to the bcl6-regulated genes . hence , small molecule inhibitors targeting the bcl6 oncoprotein or hdacs ( specifically , hdac1 , 2 or hdac3 ) would have therapeutic benefits in this subset of lymphoma .
cancer cells in general , and refractory cancer cells in particular , utilize dna repair activities as a survival mechanism to overcome the dna damage caused by many chemotherapy drugs .
can we use this property of hdac1,2 to target specific cancers resulting from increased dna repair activities due to mutations in genes that code for proteins involved in dna repair ?
sequencing of dlbcl lymph node biopsy samples has identified somatic mutations in ezh2 ( enhancer of zeste homolog 2 ) .
ezh2 is the enzymatic component of the polycomb repression complex 2 ( prc2 ) and catalyzes trimethylation of h3 at the k27 residue ( h3k27me3 ) . in
about 22% of germinal center derived lymphomas , gain - of - function mutations in the tyrosine residue ( y641 ) within the ezh2 catalytic set domain is observed . this gain - of - function mutation in ezh2 ( ezh2 ) results in high levels of h3k27me3 levels in dlbcl cells and has been implicated to promote lymphomagenesis .
in fact , a positive relationship has been observed between increased h3k27me3 and chemoresistance in ovarian cancer .
gsk126 , a potent inhibitor of ezh2 activity , decreases h3k27me3 and promotes death in ezh2 dlbcl cells .
thus , inhibiting ezh2 activity using small molecules to decrease the aberrant h3k27me3 is one potential strategy to overcome lymphomagenesis and/or chemoresistance in these refractory ezh2-activating mutant dlbcl cells .
hence , one could postulate that increased levels of h3k27me3 at break sites would protect these ezh2 dlbcl cells from dna damage due to increased dna repair .
hence , inhibiting ezh2-specific dna repair pathway could cause cytotoxicity and dna damage selectively in dlbcl cells that harbor the ezh2 mutation .
our results showed that selective inhibition of hdac1,2 increases global h3k27ac without decreasing pre - existing h3k27me3 , but it decreases h3k27me3 specifically at dna break sites , and causes cytotoxicity in the ezh2dlbcl cells .
hence , our results further indicate a new mechanism whereby hdac1,2 inhibition induces cytotoxicity in the ezh2 dlbcl cells by just altering the h3k27ac / h3k27me3 ratio and the level of h3k27me3 specifically at dsb sites . in the future
, we will further decipher the cross talk between hdac1,2 and ezh2-mediated repair signaling in dlbcl cells to nail down the precise mechanism by which hdac1,2 inhibition overcomes the h3k27me3-mediated chemoresistance in dlbcl cells .
we have also found that ezh2 dlbcl cells overexpress bbap or dtx3l ( deltex ( dtx)-3-like e3 histone ubiquitin ligase ) , a chromatin - modifying enzyme that has a demonstrated role in chemoresistance .
bbap enzyme catalyzes monoubiquitination of h4k91 and hence the activity of bbap is not counteracted by the ezh2 inhibitor , gsk126 .
therefore , in addition to overcoming ezh2 and h3k27me3-mediated chemoresistance , it is also important to overcome the chemoresistance mediated by bbap .
importantly , bbap catalyzes h4k91 monoubiquitylation ( h4k91ub1 ) , that facilitates dna repair signaling mediated by 53bp1 .
we have found that selective inhibition of hdac1,2 results in an increase in h4k91ac , decreases h4k91ub1 levels during dna repair following treatment with doxorubicin ( a chemotherapy agent ) and thereby sensitizes the refractory ezh2dlbcl cells to doxorubicin .
hence , inhibition of hdac1,2 activities is able to impair the dna repair processes by altering the h3k27ac - h3k27me3 switch and the h4k91ac - h4k91ubiquityl switch during dna repair mediated by ezh2 and bbap enzymes , respectively , in order to overcome chemoresistance in the refractory ezh2dlbcl cells .
previously , knockdown of hdac1,2 was reported to impair 53bp1 recruitment to dna damage sites and this phenotype was attributed to the increase in h4k16ac .
hence , increased h4k91ac and h4k16ac is likely to contribute to the observed 53bp1-mediated dsb repair defects upon inhibition of hdac1,2 .
h4k91 is also linked to chromatin assembly during dna repair in yeast , in addition to 53bp1 signaling during dna repair in mammalian cells .
it is possible that increased h4k91ac following hdac1,2 inhibition could prevent h2a - h2b deposition onto the h3-h4 tetramer and disrupt nucleosome assembly , which in turn might result in an unstable nucleosome / chromatin that is prone to dna damage in cancer cells , thus providing another mechanism for hdac1,2 inhibitor action .
overall , selective inhibition of hdac1,2 activity using small molecules could therefore provide a novel dna repair mechanism - based therapeutic approach in the ezh2dlbcl cells by simultaneously negating two parallel and important pathways of dsb repair mediated by ezh2- and bbap .
these findings along with our dna replication studies reveal that hdis , more specifically selective hdac1,2 inhibitors , act as genome - stability mechanism based cancer therapeutics .
several hdac inhibitors are currently being used in clinical trials for b - cell lymphomas and two of these inhibitors are fda - approved drugs for the treatment of refractory cutaneous t - cell lymphoma .
however , these fda - approved broad - spectrum hdac inhibitors inhibit ten different hdacs , and therefore have several adverse side effects in cancer patients , which include cardiac toxicity , thrombocytopenia and gastrointestinal toxicity . hence , using selective inhibitors against specific class i will cause maximum cytotoxicity in cancer cells , but at the same time minimize the side effects caused by the use of pan - hdac inhibitors .
before , we use selective hdac inhibitors in the clinic ; it is imperative to understand biological functions of individual hdacs . class
our previous studies uncovered novel functions for hdac3 in genome maintenance processes ( dna repair and dna replication ) . targeted deletion of hdac3 in the germ line led to embryonic lethality . using conditional hdac3 knockout mice
, we showed that the deletion of hdac3 leads to s - phase - dependent dna double - strand breaks in cycling cells and not in quiescent cells , which could provide a therapeutic window .
cell cycle analysis of hdac3-null cells revealed a delay in the progression of cells through the s - phase , accumulation of s - phase dependent dna damage and activation of the s - phase cell cycle checkpoint response .
moreover , hdac3-null cells displayed a reduction in both homologous recombination and non - homologous recombination pathways , suggesting that the absence of hdac3 impairs double - strand dna break repair .
even though short - term loss of hdac3 causes cell death in primary mouse embryo fibroblasts , long - term deletion of hdac3 in livers leads to hepatocellular carcinoma in mice .
thus , genetic knockout studies provide not only insights into the biological functions of hdacs , but also provide valuable information regarding the efficacy of hdis in cancer therapy when used for a short duration and the demerits of their sustained long - term use .
hdac3 activity is also required for the removal of h3k4 acetylation ( h3k4ac ) at centromeres and loss of hdac3 leads to dissociation of sister chromatids in hela cells .
the increase in h3k4ac in hdac3-depleted cells occurs before the entry of cells into mitosis , which is consistent with our findings that hdac3 dissociates from chromatin before the metaphase stage .
hence , in addition to dna repair and dna replication , hdac3 maintains genome stability by controlling centromeric functions .
recent intriguing discoveries demonstrate that hdac3 could regulate transcription independent of its catalytic activity in mouse livers . in this study ,
the interaction of hdac3 with its stable partners ncor and smrt was found to be important for the deacetylase - independent functions of hdac3 during transcription .
interestingly , we previously found that knockdown of both ncor and smrt decreased the total cellular levels of hdac3 and activated the dna damage response , demonstrating the importance of ncor - smrt - hdac3 nexus in regulating genome stability .
hence , targeting ncor and smrt , in addition to targeting hdac3 , would be another strategy to trigger dna damage response in cancer cells .
a great deal of knowledge gained from the elegant studies using conditional single gene or double gene knockout mouse models in various cell lineages or tissues have together shed light on the vital , redundant and non - redundant biological functions of hdac1 and hdac2 , which are two highly similar enzymes .
hdac2 pups died within a month , due to cardiac defects and abnormalities in myocyte proliferation . in another study , 50 percent of hdac2 pups died perinatally , whereas the remaining littermates survived .
the reason behind different phenotypes in hdac2 mice could be attributed to the different strategies used to make these knockout mice and ( or ) due to different mouse strains . in the vast majority of cell types ( including those made during hematopoiesis ) , targeted deletion of either hdac1 or hdac2 has minimal effects on proliferation and the cell cycle , likely due to compensation for one by the other .
however , combined deletion of both hdac1 and hdac2 ( hdac1,2 ) dramatically impairs proliferation in multiple cell types by blocking cells at the g1 to s phase stage . simultaneous deletion of hdac1 and hdac2 in early b - cell progenitors leads to a dramatic block in b - cell development and apoptosis .
however , mature non - dividing terminally differentiated b - cells can tolerate loss of both hdac1 and hdac2 , but their deletion affects proliferation upon exogenous mitogenic stimulation .
loss of hdac1,2 function in embryonic stem cells led to chromatin bridges and mitotic instability .
interestingly , loss of hdac1 function in tumor cells led to defective entry into mitosis , which in turn leads to apoptosis .
these findings together reveal that hdac1,2 play a crucial role when cells progress through the cell cycle . in mice with hdac2 alleles but without the hdac1 alleles ( i.e. , hdac1-null mice ) , immature thymocytes accumulation and lymphoblastic lymphomas
similarly , mice with hdac1 and no hdac2 alleles ( i.e. , hdac2-null mice ) also developed lymphomas .
however , lymphamogenesis was not observed when both hdac1 and hdac2 activities are lost in t - cells .
a similar dosage dependent effect upon loss of either hdac1 or hdac2 was observed on epidermal proliferation and differentiation . in this elegant study , deletion of a single hdac2 allele in hdac1-knockout mice
therefore , the use of genetic knockout mouse models in parallel with the isotype selective inhibitors of hdacs is required to compare and assess the mode - of - action , specificity , benefits , and pitfalls of complete and partial inhibition of individual hdacs .
the deletion of hdac8 , another class i hdac , in mice led to death within 46 h following birth .
conditional deletion of hdac8 specifically in the brain caused loss of cranial neural crest cells and instability of the skull in mice .
hdac8 is a deacetylase for smc3 ( sister maintenance of chromosome protein 3 , a core cohesion component ) , and mutations in hdac8 that disrupt smc3 deacetylation result in an improper renewal of cohesin components and inadequate recycling of the cohesin components in the next cell cycle .
this results in decreased cohesin occupancy in the genome leading to clinical features of cornelia de lange syndrome ( cdls ) , which is characterized by the congenital malformation disorder .
hence , all four class i hdacs are required for genome maintenance in mammalian cells .
however , hdac1,2 are recruited to sites of dna replication and dna damage break sites , suggesting a direct role for these two enzymes during dna replication and double - strand break ( dsb ) repair .
associates with nascent chromatin during dna replication . even though loss of hdac3 impairs dsb repair , it is not localized to dsb dna damage sites .
hence , the repair defects observed in hdac3-null cells is likely due to the defective chromatin structure .
direct functions for hdac8 at the replication fork and at dna damage sites remain to be investigated .
defective dna repair and/or dna replication are major causes of genome instability , which can trigger cell death .
deletion of both hdac1 and hdac2 using conditional knockout system results in the arrest of cells in the g1 phase , and hence it was difficult to study functions of hdac1,2 in the s - phase progression .
selective inhibitors make an excellent tool to study biological functions of hdac1,2 as we could transiently inhibit their functions for a short duration of time when there is an impact on dna replication and repair and before cells arrest in g1 phase . using selective inhibitors
, we examined whether hdac1,2 activities are required for efficient dna replication in mammalian cells . a decrease in replication fork velocity
was observed upon hdac1,2 inhibition , demonstrating that hdac1,2 activities are required for efficient replication fork elongation .
if stalled forks are not restarted in a timely fashion , it can result in fork collapse , formation of dsbs and activation of the dna damage response .
increased h2ax ( phosphorylated form of h2ax and a marker of double - strand breaks ) was observed in cells treated with hdac1,2 inhibitor or following knockdown of hdac1,2 .
rna - seq analysis of s - phase cells treated with hdac1,2 selective inhibitor showed no change in the expression of genes involved in dna replication or dna repair .
hence , our findings showed a direct role for hdac1,2 in ensuring the proper progression of the replication fork .
activation of dna damage response in s - phase cells due to obstruction of dna fork progression provided the mechanistic basis for how hdac1,2 selective inhibitors might be able to directly target regulators of genome stability in order to kill the rapidly cycling cancer cells . upon dissection of the mechanism behind these replication defects , we found that these enzymes control chromatin structure at and around replicating regions by targeting histone acetylation .
we developed a technique termed modified brdu - chip assay to examine histone modifications and replication proteins on nascent dna .
this technique is a complement to the elegant ipond technique that permits one to follow the dynamics of replication proteins associated with nascent dna . using the modified brdu - chip approach
, we showed that inhibition of hdac1,2 activity increases h4k16ac present on newly synthesized dna and at replicating origins .
h4k16ac is known to block inter - nucleosomal interactions and disrupt chromatin packaging . therefore , we asked whether hdac1,2 regulate nascent chromatin packaging around replication forks by targeting h4k16ac ?
an increase in the release of brdu - labeled nascent dna associated with di- and tri - nucleosomes was observed following micrococcal nuclease digestion in hdac1,2 inhibitor - treated cells , confirming the role for hdac1,2 activities in chromatin compaction during dna replication .
smarca5 is a iswi - family atp - dependent chromatin remodeler , whose activity is inhibited by h4k16ac and h4k12ac marks , and both of these marks are targets of hdac1,2 .
hence , we asked is there a connection between smarca5 and hdac1,2 functions at the replication fork ?
we found that smarca5 is present on nascent dna and importantly , loss of smarca5 also reduced fork velocity similar to the loss of hdac1,2 activities .
we found that the level of smarca5 associated with replication origins increases whereas the level of h4k16ac at replication origins decreases when cells enter the s - phase .
thus , hdac1,2 activity appears to be required for the deacetylation of h4k16ac to facilitate smarca5-mediated remodeling of chromatin around the replication fork during s - phase .
overall , our studies demonstrated the functional interplay between a chromatin remodeler ( smarca5 ) , regulatory histone modifications ( h4k12ac and h4k16ac ) and histone deacetylases ( hdac1,2 that target h4k12ac and h4k16ac ) at the replication fork .
moreover , these studies highlight the mechanism by which selective inhibition of hdac1,2 is able to directly target chromatin structure and the chromatin remodeling around replication forks in order to obstruct the progression of dna replication , trigger dna damage response and selectively kill the rapidly cycling cancer cells .
diffuse large b - cell lymphoma ( dlbcl ) , a type of non - hodgkin 's lymphoma , is the most common lymphoid malignancy in the united states accounting for 40% of adult lymphomas .
a major advancement has been made in treating dlbcl with the addition of rituximab ( an anti - cd20 monoclonal antibody ) to the standard chemotherapy regimen chop ( vincistrine , doxorubicin , cyclophosphamide , prednisone ) . despite overall improvement in treating dlbcl using this cocktail regimen ,
a vast majority of b - cell lymphomas are derived from the germinal centers of lymphomas .
these lymphoma cells constitutively express bcl6 oncogene , due to translocations or mutations that result in deregulated bcl6 expression .
bcl6 oncoprotein acts as a key transcriptional repressor of the atm / atr / p53 dna damage - signaling pathway and facilitates hyperproliferation to provide a survival advantage to lymphoma cells .
the transcriptional repression is mediated through recruitment of hdacs 1 , 2 and 3 , via recruitment of smrt , ncor and bcor to the bcl6-regulated genes .
hence , small molecule inhibitors targeting the bcl6 oncoprotein or hdacs ( specifically , hdac1 , 2 or hdac3 ) would have therapeutic benefits in this subset of lymphoma .
cancer cells in general , and refractory cancer cells in particular , utilize dna repair activities as a survival mechanism to overcome the dna damage caused by many chemotherapy drugs .
can we use this property of hdac1,2 to target specific cancers resulting from increased dna repair activities due to mutations in genes that code for proteins involved in dna repair ?
sequencing of dlbcl lymph node biopsy samples has identified somatic mutations in ezh2 ( enhancer of zeste homolog 2 ) .
ezh2 is the enzymatic component of the polycomb repression complex 2 ( prc2 ) and catalyzes trimethylation of h3 at the k27 residue ( h3k27me3 ) . in
about 22% of germinal center derived lymphomas , gain - of - function mutations in the tyrosine residue ( y641 ) within the ezh2 catalytic set domain is observed . this gain - of - function mutation in ezh2 ( ezh2 ) results in high levels of h3k27me3 levels in dlbcl cells and has been implicated to promote lymphomagenesis .
in fact , a positive relationship has been observed between increased h3k27me3 and chemoresistance in ovarian cancer .
gsk126 , a potent inhibitor of ezh2 activity , decreases h3k27me3 and promotes death in ezh2 dlbcl cells .
thus , inhibiting ezh2 activity using small molecules to decrease the aberrant h3k27me3 is one potential strategy to overcome lymphomagenesis and/or chemoresistance in these refractory ezh2-activating mutant dlbcl cells .
hence , one could postulate that increased levels of h3k27me3 at break sites would protect these ezh2 dlbcl cells from dna damage due to increased dna repair .
hence , inhibiting ezh2-specific dna repair pathway could cause cytotoxicity and dna damage selectively in dlbcl cells that harbor the ezh2 mutation .
our results showed that selective inhibition of hdac1,2 increases global h3k27ac without decreasing pre - existing h3k27me3 , but it decreases h3k27me3 specifically at dna break sites , and causes cytotoxicity in the ezh2dlbcl cells .
hence , our results further indicate a new mechanism whereby hdac1,2 inhibition induces cytotoxicity in the ezh2 dlbcl cells by just altering the h3k27ac / h3k27me3 ratio and the level of h3k27me3 specifically at dsb sites . in the future
, we will further decipher the cross talk between hdac1,2 and ezh2-mediated repair signaling in dlbcl cells to nail down the precise mechanism by which hdac1,2 inhibition overcomes the h3k27me3-mediated chemoresistance in dlbcl cells .
we have also found that ezh2 dlbcl cells overexpress bbap or dtx3l ( deltex ( dtx)-3-like e3 histone ubiquitin ligase ) , a chromatin - modifying enzyme that has a demonstrated role in chemoresistance .
bbap enzyme catalyzes monoubiquitination of h4k91 and hence the activity of bbap is not counteracted by the ezh2 inhibitor , gsk126 .
therefore , in addition to overcoming ezh2 and h3k27me3-mediated chemoresistance , it is also important to overcome the chemoresistance mediated by bbap .
importantly , bbap catalyzes h4k91 monoubiquitylation ( h4k91ub1 ) , that facilitates dna repair signaling mediated by 53bp1 .
we have found that selective inhibition of hdac1,2 results in an increase in h4k91ac , decreases h4k91ub1 levels during dna repair following treatment with doxorubicin ( a chemotherapy agent ) and thereby sensitizes the refractory ezh2dlbcl cells to doxorubicin .
hence , inhibition of hdac1,2 activities is able to impair the dna repair processes by altering the h3k27ac - h3k27me3 switch and the h4k91ac - h4k91ubiquityl switch during dna repair mediated by ezh2 and bbap enzymes , respectively , in order to overcome chemoresistance in the refractory ezh2dlbcl cells .
previously , knockdown of hdac1,2 was reported to impair 53bp1 recruitment to dna damage sites and this phenotype was attributed to the increase in h4k16ac .
hence , increased h4k91ac and h4k16ac is likely to contribute to the observed 53bp1-mediated dsb repair defects upon inhibition of hdac1,2 .
h4k91 is also linked to chromatin assembly during dna repair in yeast , in addition to 53bp1 signaling during dna repair in mammalian cells .
it is possible that increased h4k91ac following hdac1,2 inhibition could prevent h2a - h2b deposition onto the h3-h4 tetramer and disrupt nucleosome assembly , which in turn might result in an unstable nucleosome / chromatin that is prone to dna damage in cancer cells , thus providing another mechanism for hdac1,2 inhibitor action .
overall , selective inhibition of hdac1,2 activity using small molecules could therefore provide a novel dna repair mechanism - based therapeutic approach in the ezh2dlbcl cells by simultaneously negating two parallel and important pathways of dsb repair mediated by ezh2- and bbap .
these findings along with our dna replication studies reveal that hdis , more specifically selective hdac1,2 inhibitors , act as genome - stability mechanism based cancer therapeutics .
in our recent publications ( bhaskara et al . ( 2013 ) and johnson et al .
( 2015 ) ) , we showed novel functions for hdac1,2 during dna replication and dna repair that contributes to chemoresistance in cancer cells .
these studies provide the basis to design a novel genome stability - targeted hdac inhibitor therapy for a subset of cancers .
hdac1,2 inhibition causes dna damage activation as a result of replication stress response and defective nascent chromatin structure in rapidly cycling cancer cells . at the same time , defective dsb repair results in the failure of cancer cells to repair dna damage resulting from collapsed replication forks and from treatment of cancer cells with chemotherapy agents , such as , doxorubicin .
we are currently testing whether this mechanism based strategy would be applicable for other cancers with perturbed specific repair pathways that involve hdac1,2 .
can hdac1,2 inhibition then provide therapeutic benefits for all cancers with increased dsb dna repair ?
there are 18 hdacs in mammalian cells and class iii sirtuin family hdacs have been associated with dsb repair . hence , one could speculate that repair defects due to loss of hdac1,2 activity might be compensated by other hdacs or the sirtuin family members that are also involved in dsb repair
. however , hdac1,2 inhibition might still be a efficient way to target specific repair pathways that are addicted to hdac1,2 and do not require sirtuin functions .
hence , it is critical to dissect out the repair mechanisms specifically targeted by hdac1,2 and not compensated by other hdac family members .
moreover , chromosomal translocations that recruit hdac1,2 as well as hdac3 in certain cancers , can not be targeted by inhibiting hdac1,2 or hdac3 alone . in these cases , combined action of hdac1,2 and hdac3 selective inhibitors may be necessary to achieve maximum clinical potency .
hence , mechanistic studies are going to be critical in order to avoid using selective hdac inhibitors as a pan - cancer therapy , which might lead to unwanted toxicity with little clinical effectiveness .
moreover , mi-2/nurd complex that contains hdac1,2 is required for proper heterochromatin formation and for s - phase progression .
do hdac1,2 regulate the chromatin during dna replication and dna repair via the nurd complex needs to be investigated in future .
while transient inhibition of hdacs causes cytotoxicity in cancer cells , conditional deletion of hdac3 specifically in the liver leads to hepatomegaly and hepatocellular carcinoma .
therefore , while long - term loss of hdac function may result in secondary tumors , short - term inhibition of hdac activity is a viable option for treating cancers .
overall , the comprehensive knowledge of how class i hdacs regulate genome stability will help us in the innovative design of monotherapy or combination therapies with inhibitors against other chromatin - modifying enzymes for certain cancers .
the use of new mechanism - based strategies will augment our ongoing efforts to understand cancer epigenetics as well as provide a potential novel effective cancer therapeutic strategy .
i sincerely thank my colleague in the hdac field , christian seiser ( max f. perutz laboratories , vienna biocenter , medical university of vienna ) for his critical reading of this review and valuable suggestions .
i also thank mahesh chandrasekharan ( huntsman cancer institute , university of utah ) for his valuable comments on the review .
i thank all the members of my lab for their valuable contributions to the work described on hdac1,2 .
funding for the work described here was provided by development funds to s.b . from the huntsman cancer institute and the department of radiation oncology . | histone deacetylases 1 and 2 ( hdac1,2 ) belong to the class i hdac family , which are targeted by the fda - approved small molecule hdac inhibitors currently used in cancer therapy .
hdac1,2 are recruited to dna break sites during dna repair and to chromatin around forks during dna replication .
cancer cells use dna repair and dna replication as survival mechanisms and to evade chemotherapy - induced cytotoxicity .
hence , it is vital to understand how hdac1,2 function during the genome maintenance processes ( dna replication and dna repair ) in order to gain insights into the mode - of - action of hdac inhibitors in cancer therapeutics . the first - in - class hdac1,2-selective inhibitors and hdac1,2 conditional knockout systems greatly facilitated dissecting the precise mechanisms by which hdac1,2 control genome stability in normal and cancer cells . in this perspective , i summarize the findings on the mechanistic functions of class i hdacs , specifically , hdac1,2 in genome maintenance , unanswered questions for future investigations and views on how this knowledge could be harnessed for better - targeted cancer therapeutics for a subset of cancers . | Histone Deacetylases (HDACs) and Histone Deacetylase Inhibitors (HDIs)
Genetic analyses of Class I HDACs using conditional knockout mouse models and knockdown systems reveal their important functions in the genome maintenance
HDAC1,2 maintain genome stability during DNA replication - the engine that drives rapid proliferation of cycling cells
HDAC1,2 is involved in DSB repair pathways that contribute to chemoresistance
Summary and Perspectives
Disclosure of Potential Conflicts of Interest
Acknowledgments
Funding |
Subsets and Splits