Datasets:

Joemgu

/

sumstew

like 8

Summarize: UPDATE: Rutgers football player had gloves, crushed Tylenol in his car for murder plot, cops say A linebacker on the Rutgers University football team was accused Tuesday of involvement in a plot to murder two members of a friend's family, authorities said. Izaia Bullock, 22, a junior at the university from Linden, faces two counts of first-degree attempted murder and two counts of first-degree conspiracy to commit murder. Bullock was dismissed from the Rutgers football team Tuesday, and the university said in a statement that he will face disciplinary proceedings. Rutgers coach Chris Ash, through a school spokesperson, declined comment after Tuesday's practice. Middlesex County Prosecutor Andrew Carey and Rutgers Police Chief Kenneth Cop announced his arrest and the charges in a statement Tuesday evening. They said the charges came after determining that on Monday, "Bullock initiated a plot to murder the family members of an acquaintance." The targets, who are not affiliated with Rutgers, were not injured, a prosecutor's spokeswoman said. Bullock joined the team in September 2017 through a walk-on tryout. According to his player page on the university's athletic website, Bullock played linebacker and running back at Linden High School, and played with the Gattaca Football Club. Gattaca is a private junior college-like program that assists high school graduates in getting recruited by NCAA football programs. Bullock is being held at the Middlesex County Adult Correction Center before a first appearance in Superior Court in New Brunswick. Anyone with information that can assist with the investigation can contact Rutgers Detective Lauren Tredo at 848-932-8025 or prosecutor's Detective Michael Connelly at 732-745-3254. - Reporter Keith Sargeant contributed to this story Joe Brandt can be reached at jbrandt@njadvancemedia.com. Follow him on Twitter @JBrandt_NJ. Find NJ.com on Facebook. Have a tip? Tell us. nj.com/tips The now-former Rutgers football player charged with involvement in an attempted double-murder plot was a walk-on from a nearby town who took an unusual road to the Scarlet Knights. Izaia Bullock, 22, was dismissed from the program Tuesday and faces university disciplinary hearings after he was charged with two counts of first-degree attempted murder and two counts of first-degree conspiracy to commit murder. Rutgers coach Chris Ash declined comment after Tuesday's practice through a team spokesman. Law enforcement determined Monday that "Bullock initiated a plot to murder the family members of an acquaintance," according to a statement by Middlesex County Prosecutor Andrew Carey and Rutgers Police Chief Kenneth Cop. The targets were not injured and are not affiliated with Rutgers, a prosecutor's spokeswoman said. Bullock charged in attempted double-murder plot Bullock is the ninth current or former Rutgers football player to be arrested since this summer. Eight players were charged in connection with an alleged credit card fraud scheme in August. Four of those players have already been dismissed from or left the program, while four others remain suspended indefinitely until their legal matters are settled. Here is a closer look at Bullock's biography: * High school: Bullock was a starting defensive player at Linden High. He graduated in 2014, and he had four interceptions in 2013 for a Tigers team that advanced to the North Jersey, Section 2, Group 5 semifinals, where they fell to eventual sectional champion Ridge. * Junior college: Bullock attended Middlesex County College, which does not have a football team, from 2014-17. During that time, he also played for Gattaca Football Club, which is a private junior college team not associated with any specific institution. Bullock then walked on at Rutgers in 2017. * Limited action: Bullock did not appear in any games in 2017 for the Scarlet Knights and played in just one game this fall, Rutgers' 48-13 loss to Buffalo on Oct. 22. He did not record any statistics in that game. James Kratch may be reached at jkratch@njadvancemedia.com. Follow him on Twitter @JamesKratch. Find NJ.com Rutgers Football on Facebook. Rutgers dismissed Izaia Bullock from the football program Tuesday after the linebacker was charged with plotting to murder two people. Bullock, 22, "initiated a plot to murder the family members of an acquaintance" earlier in the week, according to a statement from the Middlesex County Prosecutor's Office. Bullock was charged Tuesday with two counts of attempted murder in the first degree and two counts of conspiracy to commit murder in the first degree. The prosecutor's office said the two victims are not affiliated with the university. Bullock is in police custody awaiting a court appearance, according to the prosecutor's office. Bullock is no longer on the Scarlet Knights' online football roster. He appeared in at least one game earlier this year, but had not registered any statistics. Rutgers had off-the-field problems involving players earlier this year. Eight players were charged with credit card fraud in August. Four of those players left the program or were dismissed prior to the start of the season. The four others remain suspended as their case works its way through the legal system. A Middlesex County judge referred their charges to a grand jury in early October.

Summary: Izaia Bullock's dismissal Tuesday from the Rutgers University football team is surely the least of the linebacker's concerns. It came hours after the 22-year-old junior from Linden, NJ, was charged with two counts of first-degree attempted murder and two counts of first-degree conspiracy to commit murder, making him the ninth current or former Rutgers football player to be arrested since the summer, reports NJ.com. Police determined "Bullock initiated a plot to murder the family members of an acquaintance" on Monday, per a release. The two intended victims, unaffiliated with the university, were ultimately uninjured, a prosecutor's rep says. Bullock graduated in 2014 from Linden High School, where he played linebacker and running back, per NJ.com. He then attended a private program meant to help recruit athletes to NCAA football programs before making the Rutgers team with a walk-on tryout in September 2017. ESPN reports the Scarlet Knight played at least one game this year but didn't register any statistics. His case follows the August arrests of eight other Rutgers football players charged in connection with alleged credit card fraud. While announcing his dismissal Tuesday, the university said Bullock would face disciplinary proceedings.

multi_news

en

Write a title and summarize: Dynamics of biomolecular assemblies offer invaluable insights into their functional mechanisms. For extremely large biomolecular systems, such as HIV-1 capsid that has nearly 5 millions atoms, obtaining its normal mode dynamics using even coarse-grained models can be a challenging task. In this work, we have successfully carried out a normal mode analysis of an entire HIV-1 capsid in full all-atom details. This is made possible through our newly developed BOSE (Block of Selected Elasticity) model that is founded on the principle of resonance discovered in our recent work. The resonance principle makes it possible to most efficiently compute the vibrations of a whole capsid at any given frequency by projecting the motions of component capsomeres into a narrow subspace. We have conducted also assessments of the quality of the BOSE modes by comparing them with benchmark modes obtained directly from the original Hessian matrix. Our all-atom normal mode dynamics study of the HIV-1 capsid reveals the dynamic role of the pentamers in stabilizing the capsid structure and is in agreement with experimental findings that suggest capsid disassembly and uncoating start when the pentamers become destabilized. Our results on the dynamics of hexamer pores suggest that nucleotide transport should take place mostly at hexamers near pentamers, especially at the larger hemispherical end. The recent breakthroughs in experimental technology for structure determination, especially in single-particle cryo-electron microscopy [2], have helped unveil many large structure assemblies at near atomic resolution for the first time. It is well recognized that a thorough knowledge of their dynamics can offer invaluable insight into their functional mechanisms and yet at the same time the enormous size of these systems poses a significant challenge to the computational simulations and analysis of their dynamics. Large scale computations comprising of millions of atoms are considered as one of the key problems by National Science Foundation’s (NSF) Molecular and Cellular Biosciences (MCB) program https: //www. nsf. gov/funding/pgm_summ. jsp? pims_id=504858&org=MCB. Normal mode analysis (NMA) [3–5] is a powerful tool for studying the intrinsic dynamics of biological assemblies. Mathematically, the core of all NMA computations involves solving a generalized eigenvalue problem of the Hessian matrix and the mass matrix. For extremely large assemblies, the source of the challenge in running NMA is the size of the Hessian matrix, whose dimension is in the same order as the number of atoms in the system. Precisely, for a system with N atoms, the Hessian matrix is of dimension 3N × 3N. For large systems with millions of atoms, it would take an extremely large amount of memory just to store the whole Hessian matrix even if a sparse matrix is used. To address this problem, two types of approaches have been developed. One is to use special eigenvalue solvers such as ARPACK [6] or order N technique [7,8] that are designed to compute quickly a small number of eigenvalues and eigenvectors. Similar to standard eigenvalue solvers, this type of approaches still require knowledge of a full Hessian matrix (in the sparse matrix format), which can become severely limiting when dealing with extremely large systems such as HIV-1 capsid that has nearly 5 million atoms. The advantage of this type of approaches is that the accuracy is fully maintained and not compromised in any way. The other type of approaches for solving the eigenvalue problem of extremely large systems is by projection. RTB [9] and BNM [10] are two well-known approaches of this kind. Lezon and co-workers [11], for example, successfully applied an RTB-based approach to compute the normal mode dynamics of HIV-1 capsid at a coarse-grained level. The advantage of projection-based methods is clear: it greatly reduces the size of the Hessian matrix. A major drawback of projection-based methods is the loss of accuracy, especially in normal modes of higher frequencies. In our most recent work [1], we discovered a physical phenomenon that makes it possible to develop a new projection-based method that maintains all the advantages of projection-based methods and yet loses no or little accuracy. We discovered that the normal mode of a whole capsid at any given frequency ω is contributed nearly solely by vibrations of its individual capsomeres at around the same frequency, i. e., there is a sharp resonance between the vibrations of a whole capsid and those of its capsomeres. Based on these observations, we were able to define a projection matrix P (i) (1 ≤ i ≤ m, where m is the number of capsomeres) for each capsomere using the normal modes of the capsomere at a selected range of frequencies. The selection could be the modes below or a band of modes around a certain frequency [1]. For example, if there are N atoms in each capsomere and k modes are selected to represent P (i), P (i) will be a 3N × k matrix whose columns are the selected modes. Given P (i) s, the projection matrix for the whole capsid is constructed as follows [1]: P = (P (1) 0 ⋯ 0 0 P (2) 0 ⋮ ⋱ ⋮ 0 0 ⋯ P (m) ), (1) and the projected Hessian matrix is [1]: H s = P ⊤ H P, (2) where H is the original Hessian matrix. Hs is now a much smaller matrix than H (assuming that k ≪ 3N) and thus is much easier to solve. The present work is a continuation of our previous work on resonance and focuses on the following issues that were not addressed in the resonance paper [1]. Specifically, 1) we conduct a quantitative assessment of the quality of the modes produced by the BOSE model. The assessment is carried out using four capsid test cases whose normal modes (the benchmark) can be obtained directly from the original Hessian matrix. In addition to “cumulative overlap” that is commonly used to assess mode quality, we develop also a new measure called “degeneracy-based overlap” for assessing the quality of modes. 2) We develop an additional measure that can be used to predict the quality of modes for the case when benchmark modes are not available, which is often the case and is the very reason for the existence of projection-based methods. 3) We address the issue of block selection and its effect on the performance of the BOSE model. This is especially relevant for capsids of which the composition of capsomeres, which are used as panel blocks in BOSE, is not obvious from the literature. In such a situation, we show that the aforementioned mode quality predicting measure can be used to determine what is the best choice for panel blocks. 4) Lastly, we perform for the first time an all-atom normal mode analysis of an entire HIV-1 capsid, a system with nearly 5 million atoms. Recall that our aim here is to efficiently and accurately determine the normal modes of extremely large systems that have millions of atoms or more. We will focus on the low frequency normal modes in this work. The same method can be applied to obtain normal modes at other frequency ranges as well. The key realization behind the BOSE model is that large structure assemblies are made up of many components, or copies of proteins of the same or similar structures. BOSE reduces the complexity of the normal mode computation by effectively modeling the elasticity of each block with a small, selected number of normal modes. For the sake of simplicity, we assume in the following that the system being studied is composed of identical protein chains, even though the method still works otherwise. To evaluate the quality of normal modes determined from the projected Hessian matrix, either that of BOSE or of RTB, the following two measurements are used. Both of them require a comparison with the benchmark normal modes computed directly from the original Hessian matrix. In the following, we use v to denote a mode determined by a projection-based method (BOSE or RTB), and p a mode determined from the original Hessian matrix (the benchmark modes). The above mode quality assessment measures are still limited since in reality we generally don’t have the benchmark modes. The very reason for having the projection-based methods is that solving the eigenvalue problem of the original Hessian matrix is computationally prohibitive. Though we can assess the quality of BOSE modes on smaller systems for which benchmark modes are available and expect that the quality of BOSE modes remains the same by extrapolation, it is better to have a more direct way to predict the quality of modes. In our resonance paper [1], we have shown that a capsid mode of frequency ω is contributed mostly by block modes at around the same frequency due to resonance. Consequently, to reproduce accurately a capsid mode of frequency ω, it is sufficient to include in the projection matrix only block modes of about the same frequency (see Eq (4) ). Therefore, our first major step to ensure the quality of BOSE modes is to use only BOSE modes whose frequencies are within the range defined by the block modes, as modes outside the frequency range are not of reliable quality due to the principle of resonance. Second, to quantify the cumulative contribution of a group of block modes to a given capsid mode v ˜ i, we define block-mode cumulative square overlap (bmCSO) as follows: bmCSO (v ˜ i, t) = ∑ j = 1 t (∑ k = 1 m c j, k (i) 2), (15) where c j, k (i) is from Eq (10). The inner summation ∑ k = 1 m c j, k (i) 2 represents the contribution to v ˜ i from the jth modes of all the m panel blocks in the system. Summation ∑ j = 1 t denotes the cumulative contribution of the first t modes of all panel blocks. Clearly, bmCSO (v ˜ i, l) = 1 accordingly to Eq (11). Later on in Results section, we will show that bmCSO strongly correlates with d-overlap and thus can be used as a predictor of the quality of BOSE modes. bmCSO is a variant of cumulative square overlap (CSO) that was used in [17]. As aforementioned, capsomeres are the natural choice for panel blocks to be used in BOSE. The capsomeres often take the form of hexamers, pentamers, trimers, or dimers. For most capsids, the composition of the capsomeres is clear. Most capsomeres are so stable that they exist in isolation. For a few other capsids, it is not clear even from the literature what is the composition of the capsomeres: are they pentamers, trimers, or dimers? Fortunately, as will be shown in Results section, our mode quality assessment measure is capable of indicating what is the best choice for panel blocks, especially when it is not obvious. In this work, we use four small capsids for benchmark tests before applying the BOSE model to the large HIV-1 capsid. The benchmark structures are prepared in the following way: The HIV-1 capsid structure is prepared by taking steps 1,3, and 4. The structures used by ANM are obtained by keeping only the Cα atoms. In our experiments, spring-based Normal Mode Analysis (sbNMA) [20] is used in all normal mode computations. We use four capsids as test cases to evaluate the quality of BOSE modes. The four capsids are: capsid of Satellite Tobacco Necrosis Virus (STNV, pdb-id: 4V4M) [31], capsid of Sesbania mosaic virus (SeMV, pdb-id: 4Y5Z) [32], a mutant structure of the capsid of Grouper nervous necrosis virus (GNNV, pdb-id: 4RFT) [33], and capsid of a lumazine synthase from the thermophilic bacterium Aquifex aeolicus (AaLS, pdb-id: 5MPP) [34]. The four capsids all have icosahedral symmetry. BOSE and RTB are both projection-based methods that reduce the size of the original Hessian matrix through restricting the motion space of structural building blocks, which can be either protein chains, capsomeres, or groups of residues. RTB restricts the motion of each building block to only rigid body motions. BOSE treats each building block still as a flexible unit, by modeling its elasticity using a selected subset of its normal modes. BOSE thus restricts the motions of each building block by allowing only vibrations within a certain frequency range. The allowed vibrations or normal modes define the selected elasticity of the block (which is a capsomere). To have a fair comparison between BOSE and RTB, we let the two models have the same degrees of freedom for each capsomere. Consequently, the size of their reduced Hessian matrices are the same. The accuracy of either model is measured by comparing its modes with the benchmark modes determined from the original Hessian matrix. In this section, we present ways to predict the quality of BOSE modes when benchmark modes are not available. This will be the case when applying BOSE to compute the normal modes of new capsids, especially those that are so large that it is infeasible to compute their normal modes without employing a projection-based method. For such systems, we cannot apply cumulative overlaps or degeneracy-based overlaps to assess the mode quality since the benchmark modes are not available. Fig 3 shows the cumulative contributions of block modes to the normal modes of two whole capsids: STNV (pdb-id: 4V4M) [31] and AaLS (pdb-id: 5MPP) [34]. In the figure, all the 1800 modes of the capsid are equally divided into nine groups. Each curve represents the average bmCSO (see its definition in Methods section) of the modes within that group. The solid line curves represent capsid modes whose frequencies are within the range of the frequencies of the block modes. For these modes, we have confidence of their quality due to the principle of resonance [1]. The remaining groups of modes whose frequencies are out of range are drawn in dashed lines. The quality of these modes are unreliable. The bmCSO plot can be used to predict the quality of BOSE modes. To demonstrate this, we plot in Fig 4 bmCSO and degeneracy-based overlap (d-overlap) for all four capsids. The d-overlap assesses the quality of modes at different frequencies (abscissa axis). The red line shows the block-mode cumulative square overlap (bmCSO) when the first 90% of the block modes are used, or bmCSO (90%). The blue line shows the degeneracy-based overlap of the BOSE modes. A d-overlap value close to 1 means high quality. The black solid vertical line marks the frequency upper limit of the panel block modes. It marks a frequency threshold above which capsid modes are no longer of good quality due to resonance, as seen in the sharp drop in the blue lines. Thus only modes below the frequency threshold (i. e., to the left of the vertical line) are of interest. Under this frequency threshold, bmCSO (90%) (red line) matches closely with d-overlap (blue line), implying that both the frequency threshold and bmCSO (90%) are good indicators of mode quality. Notice that in the zone between the dashed vertical line, which is 3 cm-1 to the left of the solid vertical line, and the solid vertical line itself, bmCSO (90%) starts to drop significantly while d-overlap remains fairly high. The reason is that a capsid mode of frequency ω is contributed mostly by block modes of frequencies [ω − Δω, ω + Δω] where Δω is 3 cm-1 according to resonance [1]. The gap between the solid and dashed lines thus represents a “twilight” zone: the quality of modes in this frequency range is still fairly good according to d-overlap though it is not evident from the bmCSO (90%) measure. In summary, when computing the normal modes of a new capsid using BOSE, we have two ways to assess the quality of the modes according to Fig 4. One is to simply use the frequency threshold, the vertical solid line in Fig 4: normal modes below this frequency all have a high d-overlap value. The other is to use bmCSO (90%): normal modes with a large bmCSO (90%) value also have a high d-overlap value. We investigate also the effect of panel block selection on the mode quality. This is especially necessary for cases when the choice of the capsomeres is not obvious. In the following, we consider two capsids: one is the capsid of Sesbania mosaic virus (SeMV, pdb-id: 4Y5Z) [32] and the other is a mutant structure of the capsid of Grouper nervous necrosis virus (GNNV, pdb-id: 4RFT) [33]. From the literature where the structures of these two capsids were first reported [32,33], it is not entirely clear what are the capsomeres of these capsids: are they pentamers or trimers or something else? In the following, for both capsids, two different choices of panels are tested: i) using trimers as panel blocks and 90 modes per panel block; ii) using pentamers as panel blocks and 150 modes per panel block. In both selection schemes, a total of 1,800 BOSE modes are generated for the whole system and compared with the benchmark modes of sbNMA. Fig 5 shows bmCSO and d-overlap plots of SeMV capsid when pentamers are used as panel blocks (panels (A) and (C) ) and when trimers are used as panel blocks (panels (B) and (D) ). The mode quality is significantly better when pentamers are used. The same plots are repeated in Fig 6 for GNNV capsid, for which the opposite is true: the mode quality is significantly better when trimers are used as panel blocks. In both cases, even without seeing the d-overlap plots that shows the quality of the modes but cannot be computed without the benchmark modes, the bmCSO plots clearly reveal what panel choices are better. The right choice of panel blocks produces not only significantly higher bmCSO values but also more modes of reliable quality below the frequency threshold, i. e., more solid lines and fewer dashed lines (see panels (A) and (B) in Figs 5 and 6). Table 1 lists the computational costs of BOSE, RTB, or sbNMA. The sbNMA Hessian matrix without symmetricity consideration would take more than 2 Tb memory space, which is too large for most computer systems. However, by applying group theory and taking advantage of the inherent icosahedral symmetry [35–37], the Hessian matrix can be reduced to 10–15 Gb and normal modes can be obtained without losing any accuracy. On the other hand, both BOSE and RTB use a significantly less amount of memory. BOSE uses about 30% more computational time than RTB. The extra time is spent on computing the normal modes of the capsomeres. In this section, we apply the BOSE model to study the normal mode dynamics of an extremely large system in atomic details, the HIV-1 capsid. The HIV-1 capsid is a large structure with a molecular mass of 35 MDa and has nearly 5 million atoms. Because of its extremely large size, all-atom normal mode computations of this assembly are prohibitive on most computer systems. Our projection-based BOSE model allows us to perform all-atom normal mode computations of this large assembly for the first time. Our normal mode computations reveal in atomic details the intrinsic motion patterns of this large structure, particularly the dynamics of the pentamers, N-terminal loops of the capsid proteins, and hexamer pores. Though the HIV-1 capsid studied in this work is one of the largest structures determined so far [12], it is expected that atomic structures of even larger assemblies will come into light in the near future, such as structures of some of the bacterial microcompartments [43], which are known to be made up of thousands of protein chains [43,44]. Faustovirus (pdb-id: 5J7V) [45] is another example. It has an astounding number, 8,280 to be precise, of chains. How can we ready ourselves for the dynamics studies of these giant assemblies? A possible way to manage their immense size is to employ a hierarchical modeling of the whole structure. Specifically, a whole capsid may be first divided into fragments, with each fragment piece composed of a manageable number of capsomeres. Once this hierarchical structure is set up, one may apply the principle of resonance iteratively by obtaining first the dynamics of fragments from those of capsomeres and then the dynamics of the whole capsid from those of fragments. Such studies may help also pave the way for future simulations of organelles and even of cells. In this work, BOSE is applied solely to homomeric capsids. It is foreseeable that it can be easily extended to heteromeric capsids with minor adjustment and possibly, even to non-capsid assemblies. When a biomolecular system is composed of different proteins or even nucleic acids, different approaches may need to be combined. For example, when studying the ribosome that is made up of ribosomal RNAs and several dozens of distinct proteins, elastic units can be selected by considering the sizes of RNAs and proteins and their structural shapes, and the number of modes may be selected according to the size of each unit. We plan to extend BOSE to study such systems in future work. HIV-1 capsid uses the central pores of its hexamers to import nucleotides and to fuel encapsidated DNA synthesis [42]. The pores of the hexamers were thought to undergo an iris-like opening and closing motion [42]. Are the iris-like motions of the pores totally uncorrelated or fully synchronized somehow, or somewhere in between? Currently little is known and it is certainly worth investigating. Note that HIV-1 capsid in this regard resembles closely bacterial microcompartments (MCP), which also are enveloped by structural shells that are fully proteinaceous. The capsids of MCP serve as a diffusion barrier that isolates toxic reaction intermediates from the cytoplasm while allowing substrates, co-factors, and products to pass through [43,44]. The MCP capsids are composed of up to a few thousand shell proteins, most of which form hexamers or pseudo-hexamers (trimers) with central pores that are important functionally and are regulated dynamically. The dynamic regulation of MCP pores again is not well understood and normal mode analysis of these systems may provide the needed insights. It should be noted that at present the atomic structures of most MCP capsids are yet unknown except for a few, including the recent determined shell structure from Haliangium ochraceum [14].

Title: All-atom normal mode dynamics of HIV-1 capsid Summary: Supramolecular assemblies are large biomolecular complexes composed of hundreds or even thousands of protein chains. They function as molecular machines or as large containers that store or facilitate the chemical reactions of other molecules. Whatever they do, their functional mechanisms are tightly linked to their structures and intrinsic dynamics. Recently, due to breakthroughs in experimental techniques, many supramolecular assemblies have been determined, such as the capsid of human immunodeficiency virus (HIV) that is composed of nearly 5 millions of atoms. Computational studies of these systems are challenging due to their extremely large sizes. In this work, we have successfully carried out a dynamics study of an entire HIV capsid in full all-atom details. Our study reveals new insights into the dynamics of the N-terminal loops, the stabilizing role of the pentamers, and where the nucleotide transport may take place.

lay_plos

en

Summarize: President Barack Obama announced his intention today to send up to 300 U.S. military advisers into Iraq to help train the country's military. The president expressly stated that the move does not 'foreshadow' a military intervention and said sending troops back into Iraq to fight radical extremists would not benefit the U.S. 'American forces will not be returning to combat in Iraq,' Obama said,'but we will help Iraqis as they take the fight to terrorists who threaten the Iraqi people, the region and American interests, as well.' The president also said the U.S. was currently ‘identifying targets’ associated with the Islamic State of Iraq and Syria terrorist group and that the U.S. would take ‘targeted and precise military action if and when we determine that the situation on the ground requires it' - an obvious nod to air strikes. Scroll down for video. President Barack Obama announced today that the U.S. would send in up to 300 soldiers to train and advise the Iraqi military. American forces still won't be engaging in combat he promised. After meeting with national security advisers early this afternoon, the president said in a statement that the U.S. intended would coordinate with Iraqi security forces, put up joint operation centers in Baghdad and share intelligence with the Iraqi government. Already, the president had deployed 275 armed marines to protect State Department personnel working at the embassy in Baghdad. He had also sent the USS George H.W. Bush aircraft carrier with. its usual battleship escort, the USS Mesa Verde, an amphibious transport. ship that can carry 550 marines and helicopters and armed F-18 Super Hornet warplanes to do surveillance. Obama told members of Congress during a meeting on Wednesday that he did not need their permission to take the actions he was considering. However, he said on Thursday that he would continue to work with Congress to provide additional equipment to the Iraqi military through his newly created Counterterrorism Partnership Fund and that he would consult Congress, as well as Iraqi leaders, if he decided to pull the trigger on air strikes. Iraqi. Prime Minister Nouri al-Maliki, a Shiite, has asked President Obama for air. strikes against the Sunni Islamist militants who have been carving a. wide swath through his country, but Obama has been slow to comply. The President told congressional leaders yesterday that the U.S. does not have strong enough intelligence at this time to carry out the strikes, an aide with knowledge of the discussion told the Huffington Post yesterday. Obama also expressed anxiety about the number of civilian casualties that the strikes could cause, as well concerns about instability within Iraq's government. The president said last week that he would not provide Iraq with military assistance until the country's leaders made serious moves toward putting their sectarian differences aside. Standing up for themselves: More than 200,000 Iraqis have volunteered to defend their country, including this group of farmers. Vice President Joe Biden spoke on Wednesday with Maliki, the country's Sunni parliamentary speaker and the the. president of the country's self-ruled Kurdish region. He. praised their efforts to bring together their respective communities in. a televised show of unity against ISIS, the White House said. Lawmakers. have been putting pressure on Obama to call for Maliki's resignation. for days, and the Associated Press said reported Thursday morning that. Obama might ask Maliki to resign as a Hail Mary effort to stop the. country's civil war. However, Obama repeatedly said on Thursday, 'It's not the place for the United States to choose Iraq's leaders.' There. is an 'urgent' need for Iraq to convene a new parliament that gives all. Iraqis the sense that they are part of a unity government, though, Obama said. 'Right now what is happening is the fate of Iraq hangs in the balance.' The U.S. president hedged when asked at a presser Thursday after his statement if he had lost faith in Maliki to lead. the country and referred back to his previous statements. US President Barack Obama meets with Congressional leadership including Senate Majority Leader Harry Reid (2nd R), Senate Minority Leader Mitch McConnell (L), House Speaker John Boehner (2nd L), and House Minority Leader Nancy Pelosi (R), in the Oval Office of the White House on June 18, 2014 in Washington, DC. The leaders met to discuss strategy on Iraq. Former U.S. general David Petraeus,. who led the'surge' that finally brought calm to Iraq, struck a cautious. note on Western intervention on Wednesday. Speaking. at a conference in London, General Petraeus said the Iraqi government. needed to reach out to the Sunni minority before the US got involved. militarily. He said: 'If. the US is to support the Iraqi government it would have to be a. government against terrorism, rather than one side in a civil war.' 'This. cannot be the United States being the air force for Shia militias, or a. Shia on Sunni Arab fight,' he told the Margaret Thatcher Conference on. Liberty. President Obama. expressed concern at doing just that on Thursday and again called on. Iraq's government to come together to fight the common treat to their. nation. He also fired a warning shot at Iran. The. U.S. welcome's the country to play a 'constructive role' in Iraq, he. said, but 'If Iran is coming in solely as an armed force on behalf of. the Shia, and it is framed in that fashion, that probably worsens the. situation.' 'Obviously. what has happened in Syria in part is the result of Iran coming in hot. and heavy' on one side, Obama said, referring to the upheaval in that. country. Obama said he hopes Iran will take a'more promising path' in Iraq, 'but old habits die hard.' Deployment: F-18 launches off the flight deck of the aircraft carrier USS George H.W. Bush during flight operations in the Arabian Gulf after the ship was deployed into the Gulf in response to the crisis in Iraq. MH-60R Sea Hawk helicopter lands on the aircraft carrier USS George H.W. Bush during flight operations in the Arabian Gulf on June 17, 2014. Yesterday's surveillance missions mark the first declared U.S. flyovers since American troops left Iraq at the end of 2011. Reports. first surfaced on Twitter from ABC, NBC and Fox News about the sorties,. which are taking off and landing on the USS George H.W. Bush, an. aircraft carrier in the Persian Gulf. The Obama administration had already authorized'manned and unmanned' surveillance flights, Fox News reported. But F-18s are not surveillance aircraft. They are attack planes. A. U.S. official hinted to Fox that part of the strategy is to project. strength by rolling out the big guns even on routine video and photo. missions. 'It's not so much about looking as it is being seen,' the official said. The White. House told reporters on Wednesday afternoon that the president is still. undecided about whether to commit military force to the country that. once hosted 143,000 American servicemen and women. Obama said on Thursday that he would prefer Iraq's neighbors in the region step up instead. On that note Obama said he would be sending Secretary of State John Kerry to the Middle East and Europe to meet with the U.S.'s allies abroad about working together to quell the violence in Iraq. 'Rather than play whack-a-mole where these terrorist networks pop up,' the president said, the U.S. has to be able to build effective partnerships. The big picture: ISIS has taken the red-shaded areas in this map and are making progress in their advance toward Baghdad

Summary: President Obama announced today that he would send 300 soldiers into Iraq to train, advice and support Iraqi security forces. He had also sent in 275 marines to protect State Department personnel in Baghdad, the USS George H.W. Bush aircraft carrier, the USS Mesa Verde and armed F-18 Super Hornet warplanes to do surveillance. Iraq's Prime Minister Nouri al-Maliki has asked President Obama for air strikes to combat ISIS but Obama is holding out. The president said today that the U.S. 'identifying targets' associated with the Islamic State of. Iraq and Syria terrorist group. But U.S. will only take 'targeted and. precise military action if and when we determine that the situation on. the ground requires it' Obama said. Obama still didn't ask Maliki to resign despite pressure from lawmakers to do so.

cnn_dailymail

en

Summarize: FIELD OF THE INVENTION This invention relates generally to the mounting and wiring of ultrasonic transducers in an array to a patch for the delivery of ultrasound for dermal and transdermal applications. More particularly, the application relates to the mounting and wiring of such a transducer array by use of a flexi-PCB. BACKGROUND TO THE INVENTION Traditionally, ultrasound has been applied through hand-held transducer probes/heads in diagnostic and therapeutic scenarios. The ‘head’ has to be continuously moved for both practical and safety reasons. In diagnostic scanning, dynamic images are displayed on a screen and movement allows the object to be viewed from multiple angles. The time averaged intensities are lower in diagnostic ultrasound but nevertheless constant movement also minimises cumulative ultrasound exposure of a given volume of soft or hard tissue. Therapeutic ultrasound (e.g. physiotherapy) utilises higher (averaged) intensities of ultrasound and is employed purely to provide a physiological response, e.g. muscle repair following a sporting injury. Constant movement of hand-held devices is important to avoid over and under exposure. Over-exposure can lead to over-heating/thermal damage and also standing waves being created with the potential to cause lysis of cells. Conversely, under-exposure will reduce the amount of ultrasonic energy received by a particular area of the body and therefore cause reduced therapeutic benefit. Relying on manual movement of the device is unreliable and cannot guarantee even coverage and therefore even exposure. Some areas will not receive the same level of treatment as others and are highly dependent on the abilities of the practitioner to keep the device moving at a constant steady speed potentially over a 20-30 minute period leading to arm/wrist/hand fatigue and uneven treatment of the patient. Electronic movement over an array of transducers will obviate operator error normally associated with uneven/erratic movement of an otherwise hand-held device. The underlying technology on which this invention is based is thin, flexible patches or bandages containing an array of ultrasound transducers that operate in close contact with complex bodily surfaces such as the face. As with all applications and geometries of applied ultrasound, to perform correctly there needs to be an ‘air-free’ acoustic path for the ultrasound from transducer surface to skin surface. Air cavities/bubbles etc would severely impede propagation of ultrasound due to their significantly lower acoustic impedance causing reflection and refraction of the propagating wave so lowering the intensity of ultrasound impinging on and propagating through the skin. Such a flexible ultrasound patch would thus need to conform closely to bodily surfaces and avoid, as much as possible, any buckling of the patch to allow air spaces to come between the patch and the skin. This problem may be overcome somewhat by using free-flowing gels that fill any air-spaces. Arrays of transducers need to be wired to enable every element in that array to be activated. This wired array also needs to be encapsulated to prevent water (e.g. coupling gel) ingress and general soiling. Encapsulating materials that have some inherent elasticity may allow moulding to doubly curved surfaces, but the associated electrical circuit contained within is most unlikely to allow such complex bending. Within the ultrasonic patch, each of the transducers require robust electrical interconnection that can withstand frequent and numerous flexing/bending. Failure of the connections could result in a transducer failing to operate and may even cause failure of entire sub-groups of transducers. Therefore, there needs to be an electrical interconnecting system that can withstand repetitive bending while allowing moulding to complex surfaces. Materials applied to the surface of the human body or other complex shapes typically employ some degree of tension in many directions to keep the material in contact with that object, e.g. Lycra/Spandex™ clothing. Flexible sheets of material such as paper can easily conform to singly curved shapes, e.g. cylindrical, but have difficulty in conforming to doubly curved shapes, e.g. a sphere. It is known to mount an array of transducers on a flexible printed circuit board (flexi-PCB). Previous studies (e.g. Arunachalam et al., 2008, ‘Performance evaluation of a conformal TMS sensor array’ Int. J. Hyperthermia, 24(4), 313-325) describe flexible PCB mounted temperature sensors for measuring skin surface temperatures. The study employed multi-layer Kapton® polyimide film which is known to have stable mechanical, physical and thermal properties as well as high tensile strength and folding endurance (285 k cycles) suitable for use when wrapped around the human torso. However, the Arunachalam et al. study uses a single continuous sheet of flexible PCB. That sheet of flexi-PCB would curve and bend to conform to a cylindrical geometry, but not to a doubly curved surface such as a sphere or a saddle point. WO 2008137030(A1), entitled ‘A flexible conformal ultrasonic imaging transducer and system’, discloses a system that is intended for, but not limited to, ultrasonic imaging via send and receive ultrasonic pulses. A conformal flexible transducer array for contact to various parts of the human body is disclosed. However, like the conformal TMS array described in Arunachalam et al, the transducers are mounted on a continuous sheet of Kapton® polyimide flexible printed circuit substrate which would limit the number of bending directions to one, hence only achieving close conformity to a singly curved surface such a cylinder. U.S. Pat. No. 5,735,282 (A) discloses the mounting of a linear 1D array of ultrasound transducers on multiple flex circuit segments, wherein sub-groups of the transducers in the linear array are respectively mounted on different flex circuits. It is stated that in an array of 128 PZT elements, each on a 0.3 millimeter pitch, it may be advisable to have eight or more individual flex segments. The more flex segments that are used, the greater the ability of the array to flex. However, when multiple layers of flex circuit are folded on top of one another, there can be a disadvantage associated with the increased overall thickness of the assembly and the increased vulnerability to cross-talk. In fact, the linear array must only flex along the azimuth, although because of the way the arrangement is constructed, the individual flex circuits must also simultaneously fold around the back of the array. SUMMARY OF THE INVENTION According to the invention, there is provided an ultrasound transducer patch comprising: an array of ultrasound transducers; and a flexi-PCB containing multiple tracks; wherein each of the transducers in the array is mounted on the flexi-PCB, each transducer being electrically connected to first and second of the multiple tracks of the flexi-PCB; and wherein the flexi-PCB is configured so as to be bendable about non-parallel axes. By providing a flexi-PCB that is configured so as to be bendable about non-parallel axes, the array of transducers mounted thereon is able to conform to a complex 3D surface, such as a portion of a face. Accordingly, the transducers are each able to deliver ultrasound efficiently to the underlying surface. The flexi-PCB may include cut-out portions to provide the required bendability. The cut-out portions may define multiple fingers, each finger including at least first and second tracks and at least one transducer electrically connected to those tracks. Alternatively, the cut-out portions may define a mesh of lands interconnected by bridges, each land including at least first and second tracks and at least one transducer electrically connected to those tracks. Alternatively, multiple tracks or islands of flexi-PCB mounted ultrasonic transducers could be held within an elastomeric matrix whereby tension applied to the matrix would increase the spacing between these sub-groups and so allow different radii of curvature across the patch. Such a patch under tension could be a large area cuff around a limb or a simple band around the head. The transducers may be grouped into sub-groups, with at least first and second respective tracks addressing each sub-group. The sub-groups may be mounted on respective fingers or lands. With the (sub-groups of) transducers mounted on individual fingers, each having first and second tracks, then these sub-groups could be encapsulated within, for example, a medical grade elastomer to form individual fingers that can move independently of each other allowing doubly-curved surface moulding. Similarly, with the (sub-groups of) transducers mounted on individual lands, the interconnecting bridges allow each track to bend and mould independently of each other for such independent conformance. By virtue of the first and second tracks on each finger or land, all of the transducers on a particular finger or land may be addressed simultaneously. This arrangement reduces the number of tracks needed to address each transducer and simplifies the connections, simultaneously meaning that fewer tracks are needed for each finger or land, thus enhancing the flexibility of the finger or land relative to the remainder of the patch. The transducers may be clustered in sub-groups, positioned and addressed so as to provide enhanced depth of penetration when driven. The transducers of the type necessary for use in a treatment patch according to the invention must be relatively small and therefore have a limited depth of penetration. It has been determined that by arranging individual transducers in a cluster, the depth of penetration of the cluster is greater than that which can be achieved by such an individual, small transducer. The ultrasound transducer patch may further comprise an electrical cable for connection to electrical drive means, the cable including leads connected to conductive pads on the flexi-PCB that are electrically connected to the respective tracks. The ultrasound transducer patch may further comprise a connector assembly enclosing the connections between the leads of the cable and the conductive pads of the flexi-PCB. The cable enables connection to a remote drive means, so the patch itself does not have to include this. This enables the patch to be lightweight and comfortable for the user. The addition of a connector assembly helps to protect the connections between the leads in the cable and the pads and hence the tracks of the flexi-PCB. Moreover, the connector assembly can ensure that the connection is protected by a fluidic seal to prevent shorting of the electrical connections. According to another aspect of the invention, there is provided an ultrasound treatment system comprising: an ultrasound transducer patch as described above and including an electrical cable; and electrical drive means coupled to the patch via the cable. The system may typically be adapted to be worn on a user's body and allow ambulatory use. In conventional (e.g. physiotherapy) ultrasound devices, the drive means may be a separate unit, and may even be portable, but these have not been designed to be worn by the user. There would be no reason to make such an adaptation, because the use of such a device is limited to trained personnel, not by the user themselves. In contrast, with the inventive system, the user (i.e. the person on whom the ultrasound treatment is being applied) is able to remain mobile which using the system. It is envisaged that the drive means, with appropriate power source, such as a battery, could be incorporated into the patch itself, in which case there would be no need for a cable to couple the drive means to the patch. BRIEF DESCRIPTION OF THE DRAWINGS The invention will be described, by way of example, with reference to the accompanying drawings, in which: FIG. 1 a is a schematic perspective view of a dual-frequency ultrasound transducer; FIG. 1 b is a cross-sectional view of the transducer of FIG. 1 a, mounted on an acoustic medium; FIG. 2 a is a top perspective view of an ultrasound treatment patch according to one embodiment; FIG. 2 b is a bottom perspective view of the ultrasound treatment patch of FIG. 2 a; FIG. 3 is a cross-sectional view of an arrangement for mounting a transducer to a flexi-PCB; FIGS. 4 a - c show alternative ultrasound treatment patches; FIG. 5 is a cross-sectional view of an alternative arrangement for mounting a transducer to a flexi-PCB; FIG. 6 is an illustration of a small transducer for use in a patch according to the invention, showing a typical size compared to the wavelength of the low frequency ultrasound component; FIG. 7 is a plot showing depth of propagation of the transducer of FIG. 6 ; FIG. 8 is an illustration of a cluster of transducers of the type shown in FIG. 7, showing a typical size compared to the wavelength of the low frequency ultrasound component; and FIG. 9 is a plot showing enhanced depth of propagation of a transducer cluster. DETAILED DESCRIPTION The invention is for a flat, flexible PCB 10 (flexi-PCB) which allows the mounting and electrical drive of one or more dual-frequency ultrasonic transducers 20. The combination of the transducers 20 and the flexi-PCB 10 then forms a flexible patch 100 which is capable of applying ultrasonic energy over an area in a flexible format which can form to allow effective contact on a 3D surface. FIGS. 1 a and 1 b show a typical structure for a dual-frequency transducer 20, which comprises a piezo-electric, circular plate 22 bonded concentrically to a circular plastic or metal substrate 24. This construction allows the generation of acoustic energy at two different frequencies. The transducer construction used to generate the double frequency is to have a single device (the ‘transducer’ 20) vibrate in both bending mode (for the low frequency, 50 kHz) and thickness mode (for the high frequency, 3 MHz). The transducer 20 is a “unimorph”, in other words a piezo-electric plate 12 bonded to an elastic substrate (also a plate 24 ). The transducer 20 is able to transmit the above ultrasonic frequencies, under appropriate drive control, into an underlying acoustic medium 26. Alternative formats for the transducer 20 construction are possible—and these include alternative shapes (eg. a square piezo-electric plate 22 and square elastic substrate 24 ) and alternative structures (e.g. a “bimorph” structure which would consist of two piezo-electric plates 22 sandwiching a thin, conductive layer, with no elastic substrate required). Possible advantages of a square shaped transducer 20 would be to maximise the area of the skin directly covered by an array of closely packed transducers 20. Ad vantages of a “bimorph” structure would be the increased vibrational amplitude compared to a “unimorph” transducer 20 for the same level of electrical drive. An exemplary patch 100 is shown in FIGS. 2 a and 2 b and generally comprises a flexi-PCB 10 on which is mounted a plurality of transducers 20. The transducers are each electrically connected to respective first and second tracks 12 within the flexi-PCB, as described more fully below. External electrical drive to the patch 100 is provided via an electrical cable 30 (the ‘umbilical’) which has electrical connections soldered directly onto conductive pads on the flexi-PCB 10. A simple connector assembly 40 is used to protect these soldered connections and to provide mechanical robustness to the soldered joint (and a fluidic seal to prevent shorting of the electrical connections). The patch 100 may be held in contact with the target surface via an elastic or non-elastic bandage, which applies a pressure to the patch to ensure that all transducers 20 contact the target surface. An acoustic gel may be manually applied to the patch 100 or skin in order to provide an effective acoustic coupling. The acoustic medium 26 may be the skin and underlying flesh of a patient or may be an intermediate medium, such as an acoustic gel or gel pad, to improve the transmission of the ultrasound energy to the desired area. This pad could be applied directly to individual or groups of transducers 20 and could have double-sided adhesive layers. This would allow the patch 100 to be attached directly to the skin surface with no need for bandages. This would make it easier to apply the patch to areas of the body which are cannot support the use of a bandage (e.g. the face or head) With reference to FIG. 3, the flexi-PCB 10 is manufactured using industry standard methods—with multiple, bonded layers to provide the electrical tracks 12 and electrical insulation required for the patch construction. The electrical tracks 12 comprise the means to drive the transducers 20. Layers 15, 17 above and below these electrical tracks 12 contain a conductive grid pattern which can be driven electrically in order to provide EMC shielding—to reduce the EMC emissions from the patch 100. The transducers 20 are electrically and mechanically mounted to specific locations on the flexi-PCB 10. Where required, groups of transducers can be electrically connected in parallel using the conductive tracks 12 in the flexi-PCB 10 —the tracks are capable of carrying the maximum current required to drive the transducers. Each transducer 20 is mounted to a lower, active surface of the flexi-PCB 10 by way of a conductive mounting ring 14 that is electrically connected at its upper end to a conductive pad 16 that is in turn electrically connected to a first track. The lower end of the mounting ring 14 is secured to the elastic substrate 24 using an electrically conductive adhesive. The mounting ring 14 is bonded to the conductive pad 16 using a solder and/or electrically conductive adhesive. Electrical connection of the transducer 20 to a second track is made via a conductive flexible tab 18 that makes an electrically connection to the piezo-electric plate 22. The flexible tab 18 is bonded to the upper surface of the piezo-electric plate 22 using a solder and/or electrically conductive adhesive. The transducer surface is slightly proud of the mounting ring 14 in order to ensure that the transducer 20 contacts the acoustic medium 26 effectively. A flexible layer 50 may also be attached to the upper surface of the flexi-PCB 10 in order to seal and cover any exposed electrical connections to the transducers 20. A conformal coating layer 52 is applied to the active surface of the transducer (the substrate 24 and mounting ring 14 ) in order to provide adequate electrical insulation. The shape of the flexi-PCB 10 allows a degree of conformance to a 3D surface. The exemplary patch 100 of FIG. 2 uses a number of flexible ‘fingers’ 110 extending distally from a common portion 112, each finger 110 carrying five transducers 20 (the individual transducers 20 of a finger 110 may be grouped electrically and driven in parallel, each being connected to common first and second tracks 12 ). The fingers 110 are defined by interceding cut-out portions 114. Alternative examples are shown in FIGS. 4 a - c. For example, FIG. 4 a shows a cross-shaped patch 200 having four fingers 210 extending from a common central portion 212 and defined by cut-out portions 214. FIG. 4 b shows a patch 300 having three fingers 310 extending from a common central portion 312 and defined by cut-out portions 314. FIG. 4 c shows an alternative patch 400 comprising a mesh of lands 410 interconnected by bridges 412, each land 410 including at least first and second tracks and at least one transducer 20 electrically connected to those tracks. The lands 410 and bridges 412 are defined by cut-out portions 414. In this arrangement, each land 410 can tilt relative to its neighbours by flexing of the connecting bridges 412. Accordingly, the transducer 20 or sub-group of transducers on each land can tilt relative to the other transducers. Due to the array of multiple transducer elements needed to achieve a thin, flexible patch 100, the individual transducers 20 are small compared to those incorporated into conventional (e.g. physiotherapy) devices. This has the implication that, at low frequencies, each individual transducer 20 is small compared to the wavelength of the low frequency ultrasound component (see FIG. 6 ) and consequently limits its depth of propagation due to the divergent beam profile as shown in FIG. 7. In general, the depth of penetration can be increased by: 1. Increasing the diameter of each transducer 20 in the array; 2. Decreasing the spacing between each transducer 20 ; and 3. Increasing the intensity (e.g. in W/cm 2 ) of ultrasound emitted from each transducer 20. However, recent modelling work shows how ‘clustering’ of individual transducers 20 can provide an additive ‘field’ effect which greatly extends the depth of penetration. A typical cluster arrangement is shown in FIG. 8, with results of a typical enhanced depth of penetration model being shown in FIG. 9. This clustering of transducers, and associated enhanced depth of penetration opens up the opportunity to provide regenerative therapy from a thin patch 100 to target deeper e.g. musculoskeletal locations as well as more superficial dermal layers. Such ‘clusters’ of transducers 20 can thus be mounted onto individual flexi-PCB ‘islands’ and then incorporated into patches, cuffs and other forms of therapeutic covering. For example, each finger 110, 210, 310 or land 410 of the above exemplary patches 100, 200, 300, 400 could have mounted thereon a cluster of transducers 20 positioned and addressed so as to provide enhanced depth of penetration when driven. The numerical modelling example shown in FIG. 9 demonstrates how effective depth can be enhanced with such clustered groups of transducers 20. It is envisaged that groups of e.g. 4-7 transducers 20, each mounted on conformable portions of flexi-PCB 10, will provide improved depth of penetration as the combined width of these group sizes near the wavelength of ultrasound in soft tissue ( FIG. 8 ). The flexi-PCB 10 incorporates specific features such as: Integrated, conductive tracks 12 to allow the driving of the transducers 20. The tracks 12 would be capable of supplying the power required to operate the transducers whilst still allowing the patch 100 to flex. The tracks 12 can be laid out such that arrays (i.e. sub-groups) of transducers 20 can be driven in parallel—so reducing the total number of input drive channels. Simple method of electrical connection from the flat flexi-PCB format to a drive cable 30 (or ‘umbilical’) via soldered connections. The number of electrical connections would be minimised if groups of transducers 20 are driven in parallel. Electrically driven EMC shielding layers 15, 17 (to minimise the emissions of EMC from the patch 100 ) Low cost electrical connections between the flexi-PCB 10 and the transducers 20. These connections could be via pads 16 or tracks on the outer layer(s) of the flexi-PCB 10. Specific shaping (e.g. ‘fingers’ 110) of the flexi-PCB 10 to allow patch conformity to 3D structures. Potential use of double-sided low tack adhesive gel pads to attach the ultrasonic transducers 20 to skin—either a large pad for a group of transducers or individual gel pads for individual transducers. The flexi-format would also simplify the inclusion of additional conductive tracks 12 and additional functionality in the patch 100 such as sensors (e.g. thermistors for thermal control) buzzers LEDs micro-switches resistive heating tracks solid-state cooling elements Conformal die-electric coating of the transducer substrates in order to provide electrical insulation. An alternative transducer mounting method may be used in order to maximise the acoustic penetration of the lower frequency mode. This could be achieved by providing a simple line contact between the rigid mounting ring 14 and the transducer substrate 24 and then using a compliant material (e.g. elastomeric adhesive, silicone rubber) to ensure contact between the mounting ring 14 and the transducer 20. Instead of the transducer(s) 20 being connected to the flexi-PCB 10 using the mounting methods described above, a wrap-around electrode may be used on the piezo-electric plate 22 thus to electrically connect the transducer 20 to the flexi-PCB 10 via: soldered wires which are fed through a hole in the flexi-PCB 10 ; or a miniature flexi-PCB. Instead of the electrical connection to the piezo-electric plate 22 being made by the flexible tab 18, an alternative method of achieving the electrical connection could be achieved via a soldered or conductive adhesive joint: using a soldered wire which is fed through a hole in the flexi-PCB 10 ; or using a miniature flexi-PCB to connect the transducer 20 and to the flexi-PCB 10 (on the main patch flexi-PCB this connection could be via a soldered or plug connection) Another alternative mounting arrangement is reverse mounting of the transducers 20 (transducers 20 mounted on the top of the flexi-PCB 10 ). Main advantage may be the fact that transducers 20 will move away from each other as the patch 100 flexes—so the initial transducer pitch can be minimised. The flexi-PCB 10 can also act as an effective electrical barrier and be easy to clean. Such mounting would be achieved by: attaching the transducer 20 to the upper surface of the flexi-PCB 10 Possible advantages are that the flexi-PCB layer under the actuator could have a driven EMC shield layer, so EMC protection is maximised. attaching the piezo disk 22 directly to the flexi-PCB 10. This would reduce part count and cost. The material stiffness and thickness of the flexi-PCB underneath the piezo disk would have to allow the generation of the low frequency mode. Further alternatively, the transducer substrate material 24 may be dished, forming a cavity in which the piezo-electric plate 22 can be housed, to reduce the cost of the transducer sub-assembly by eliminating the need for a mounting ring 14. Further alternatively, the contact surface of the transducer substrate 24 may be shaped in order to minimise the risk of air inclusions if a liquid acoustic coupling gel is used. Further alternatively, as shown in FIG. 5, the circular piezo-electric plate 22 could be bonded directly to the upper surface of the flexi-PCB 10 and the transducer substrate 24 could be bonded in an aligned location to the bottom surface of the flexi-PCB 10. Advantages would be that it simplifies the electrical connection between the upper surface of the flexi-PCB 10 and the piezo-electric plate 22, such as by means of a flexible tab 18 and a conductive via 19 ; a raised substrate on the lower surface of the flexi-PCB 10 will help to ensure good acoustic contact with the skin (an advantage over the simple reverse mounted alternative); and surfaces of the patch 100 in contact with the skin will be electrically insulated from the electrical drive system. There may also be manufacturing advantages to assembling the piezo-electric plate 22 directly to the flexi-PCB 10 rather than to the transducer substrate 24. The flexi-PCB 10 may be plugged directly into a socket connector on a PCB, such that the cable 30 and connector 40 are re-usable and the flexi-PCB 10 (and patch 100 ) can be easily replaced after one or more uses. Areas of application for the patch 100 include: cosmetic dermatology, medical dermatology (e.g. wound healing a ), transdermal drug delivery, physiotherapy and bone healing b. No significant modifications would be required as the essential characteristics of the flexible patch 100 would be the same, i.e. to conform to complex surfaces. a Dyson, M and Smalley, D: Effects of ultrasound on wound contraction. In Millner, R and Corket, U (eds): Ultrasound Interactions in Biology and Medicine. Plenum, New York, 1983, p 151. b Li J. K.; Chang W. H. 1; Lin J. C.; Ruaan R. C.; Liu H. C.; Sun J. S., Cytokine release from osteoblasts in response to ultrasound stimulation, Biomaterials, Volume 24, Number 13, June 2003, pp. 2379-2385(7) In the cases of medical dermatology, transdermal drug delivery, physiotherapy and bone healing, the technology would be equally applicable to all relevant veterinarian applications. Although the invention has been described by reference to a patch including dual-frequency transducers, it will be appreciated that the mounting concept applies equally to other forms of transducers, such as conventional single-frequency transducers.

Summary: An ultrasound transducer patch ( 100 ) comprises an array of ultrasound transducers ( 20 ) mounted to a flexi-PCB ( 10 ) containing multiple tracks ( 12 ). Each transducer ( 20 ), or a sub-group of the transducers is electrically connected to first and second of the multiple tracks. The flexi-PCB ( 10 ) is configured, such as by virtue of cut-out portions ( 114, 414 ) or by inherent elasticity, to be bendable a out non-parallel axes. The enables the patch ( 100 ) to readily conform to a complex 3D surface such as a portion of a patient's face to ensure efficient transmission of ultrasound energy to a desired area of treatment.

big_patent

en

Summarize: The Winter Olympics start Thursday for those in need of a hard fix coming off their post-football crash. Super Bowl prop bets are a whirlwind of fast, goofy action that basketball and hockey can't quite match. But Sochi can, with odds to cover a wide swath of events, as well as specials ranging medal counts to the performance of the Jamaican bobsled team. The gold and overall medal counts will be closely watched by casual fans and those willing to put real money on the games. Currently, Norway is favored to win the most gold medals at 23/20 odds (courtesy of Bovada), but the United States is just behind at 5/2, followed by Germany at 7/1, and Russia and Canada both at 9/1. The U.S. is favored in the overall medal count at 1/1, however, followed by Norway at 9/5, Germany at 5/1, Russia at 13/2 and Canada at 16/1. Austria, South Korea and China lead the long shots in both categories. All three countries have 40/1 odds to win the gold medal count, and 80/1 odds to win the overall medal count. France and Sweden have done well at the Winter Olympics in the past, but both countries are at 50/1 odds to win the gold medal count and 100/1 odds to win the overall medal count. The United States' best odds for gold are in ice dancing, men's snowboarding and men's speedskating. The pairing of Meryl Davis and Charlie White are currently at 1/2 odds (meaning you would bet two dollars to make a profit of one) on the ice, which is somehow better than Shani Davis' 1/1 odds to win the men's 1,000-meter speedskating event. Shaun White trumps them all, however, with 2/5 odds to win the men's snowboard halfpipe. As for the plucky underdog Jamaican bobsleigh team, you can bet at 50/1 odds that it will medal, and 9/1 that it will finish in the top 10. If you're the cold-hearted type, you can take 3/1 odds that the two-man team will crash. Excluding hockey, here are some of the events in which the United States is favored to win one medal, or at least contend. Americans in bold. Head over to Bovada for a full list of odds. Bobsleigh -- Women's two-man Humphries/Moyse (CAN 1) -- 1/1 Meyers/Evans (USA 1) -- 11/5 Kiriasis/Fritz (GER 3) -- 6/1 Greubel/Williams (USA 2) -- 8/1 Schneiderheinze/Schneider (GER 2) -- 12/1 Martini/Senkel (GER 1) -- 14/1 Meyer/Mayer (SUI 1) -- 14/1 Kamphuis/Vis (NED) -- 28/1 Stulneva/Udobkina (RUS 1) -- 33/1 Fenlator/Jones (USA 3) -- 40/1 Women's snowboard slopestyle Jamie Anderson -- 5/2 Spencer O'Brien -- 4/1 Sarka Pancochova -- 5/1 Silje Norendal -- 5/1 Torah Bright -- 9/1 Christy Prior -- 14/1 Cheryl Maas -- 16/1 Jenna Blasman -- 16/1 Jenny Jones -- 16/1 Men's Snowboard halfpipe Shaun White -- 2/5 Yuri Podladchikov -- 6/1 Danny Davis -- 7/1 Gregory Bretz -- 12/1 Peetu Piirooinen -- 14/1 Taku Hiraoka -- 14/1 Taylor Gold -- 16/1 Nathan Johnstone -- 25/1 Markus Malin -- 40/1 Brad Martin -- 66/1 Men's 1,000-meter speedskating Shani Davis -- 1/1 Brian Hansen -- 7/2 Stefan Groothuis -- 8/1 Tae-Bum Mo -- 10/1 Denis Kuzin -- 10/1 Men's 1,500-meter speedskating Shani Davis -- 11/4 Denis Yuskov -- 4/1 Koen Vermeij -- 6/1 Brian Hansen -- 6/1 Ivan Skobrev -- 9/1 Figure skating -- Ice dancing Davis/White -- 1/2 Virtue/Moir -- 3/2 Ilinykh/Katsalapov -- 20/1 Pechelat/Bourzat -- 20/1 Bobrova/Soloviev -- 20/1 Women's figure skating Yuna Kim -- 5/6 Mao Asada -- 9/4 Carolina Kostner -- 8/1 Julia Lipnitskaia -- 8/1 Kanako Murikami -- 12/1 Ashley Wagner -- 18/1 Alpine skiing -- Men's downhill Aksel Lund Svindal -- 2/1 Erik Guay -- 13/2 Bode Miller -- 11/2 Christof Innerhofer -- 9/1 Patrick Kueng -- 12/1 Alpine skiing -- Men's Super G Aksel Lund Svindal -- 10/11 Bode Miller -- 3/1 Hannes Reichelt -- 12/1 Erik Guay -- 16/1 Ted Ligety -- 16/1 Alpine skiing -- Men's giant slalom Ted Ligety -- 11/10 Marcel Hircher -- 7/4 Felix Neureuther -- 8/1 Alexis Pinturault -- 8/1 Thomas Fanara -- 14/1 Bode Miller -- 25/1 More on the Winter Olympics: • Meet Team USA's brightest Winter Olympic athletes • Miracle Put on Ice: 1984 US hockey team never had a chance • The Ratchet Olympics "We need to be tough!" • What to expect on the bigger Olympic hockey rink • Hockey: Men’s schedule All 12 men’s rosters USA roster analysis • Henrik Lundqvist on Sweden's chances, tournament fatigue Sean McCabe More than 1,000 years ago, the Vikings evolved into fierce, intimidating conquerors. Now the Norsemen are at it again, this time in the form of the Olympic team from tiny Norway. This country of five million people is poised to pull off one of the great triumphs in sports by winning the overall medal race and likely the most gold medals at the Sochi Olympics. The Wall Street Journal's medal projections for Sochi suggest the Norwegians will win 33 medals, one more than a strong team from the U.S., whose population is roughly 65 times as large. The two countries should be neck and neck for the internationally coveted spot atop the gold-medal table as well. Deep teams from Canada and Germany could challenge for supremacy, too—and keep an eye on the Russians with their home-snow advantage. Alpine skier Ted Ligety may be a long shot for a U.S. medal. AFP/Getty Images Norway's Winter Olympics success over the years represents one of the unlikeliest feats in sports. Though it last swept the medal tables at a Winter Games in 1968, the country is the all-time leader in both gold and total Winter Olympics medals. And even though it lacks Cold War political ramifications, the "Knut vs. Goliath" battle between Norway and the U.S. in Sochi should make for one of the most entertaining Olympic medals races. At bottom, it's a competition between two diametrically opposed approaches to success in Olympic sports. The U.S. will bring 230 athletes and challenge for medals in everything from speed and figure skating to alpine skiing and Nordic combined, an event that requires both cross-country skiing and ski jumping. Meanwhile, Norway will focus its fire almost exclusively on Nordic sports that involve some form of cross country and ski jumping. "We concentrate where we can do well, and on what is closest to our hearts," said Gerhard Heiberg, the International Olympic Committee member who organized the 1994 Games in Lillehammer. Dress Rehearsal At last year's World Championships in Nordic sports, Norway won 16 gold medals and 30 overall. If it repeats that performance in Sochi, it could conceivably win both medal races without even bringing ice skates, alpine skis or a curling stone to Sochi. Kikkan Randall in cross country is a better bet. AFP/Getty Images The Journal's forecasting system, which has proved accurate to within a few medals in the last two Olympics, takes into account basic information such as interviews with experts and the performances of athletes in recent national and international competitions. But rather than simply anointing first-, second- and third-place finishers in each event, the model assigns probabilities to the top medal contenders, then uses those probabilities to project the most likely outcomes. For instance, Germany's two top duos in doubles luge—Tobias Wendl/Tobias Arlt and Toni Eggert/Sascha Benecken—have won every World Cup event this season. They have finished one-two in six of eight races. Together, the two teams are a combined 80% favorite to win the gold by our count. A tandem from Austria has a 20% chance. On the other hand, Ted Ligety, the American alpine skiing champion, performs in far more competitive events. He is the world's best technical skier, but he hasn't been on a Super G podium this season, even though he is the defending world champion in that event, so his chances of prevailing in Super G are just 25%. To compile the figures, we enlisted sports actuary John Dewan, founder of Stats LLC, to tally the probabilities and run 1,000 simulations of the Games. Norway won the most gold medals in 471 of these simulations, including ties, beating the U.S., which won the most golds 439 times. Germany (141), Canada (58) and Russia (48) were next. The results in the overall medal race lean significantly toward Norway, which won the most medals 549 times, compared with 369 for the U.S. Relative long shots by comparison are Canada, with 154 simulated overall medal wins; Russia, with 32; and Germany, with 28. A warning to Winter Olympics gamblers: Predicting outcomes of events that take place on slippery surfaces and on blades a few millimeters thick can be a fool's errand. The outcome of the medal tables could turn on a split-second brush with the wall. Early U.S. Promise In Vancouver in 2010, the U.S. slaughtered the competition in the overall medals race, winning 37 overall, seven more than second-place Germany. The Canadians collected a world-best 14 golds on home snow and ice after investing $100 million to improve their efforts. During the next three years, Team USA became even more formidable: It dominated world championships in alpine skiing last year, Kikkan Randall became the world's fastest freestyle Nordic skier and Tim Burke won a silver medal in the biathlon world championships. Also working in favor of the U.S.: The IOC in 2011 added two more competitions in snowboarding and freestyle skiing, sports at which the U.S. excels. And it added women's ski jumping, an event that now has an American world champion in Sarah Hendrickson. The stage appeared set for a U.S. triumph in enemy territory. A Rash of U.S. Injuries Then the Americans caught the injury bug. On Aug. 23, Evan Lysacek, the defending gold medalist in figure skating, tore his hip labrum, and Hendrickson tore her ACL and MCL in a training jump. Lysacek will miss the Games. Hendrickson just got back on snow three weeks ago. Earlier last year, two-time gold medalist in snowboard cross Seth Wescott tore his ACL filming a movie in Alaska. In December skier Lindsey Vonn, the defending downhill champion and a threat to win five medals, reinjured her ACL, removing her from contention. "You're simply not going to replace a Lindsey Vonn," says Alan Ashley, chief of Sport Performance at the U.S. Olympic Committee. Ashley says winning 37 medals again is "imaginable," but will go no further than that. The luge pair Tobias Wendl and Tobias Arlt have been hot this season for Germany. AFP/Getty Images Ashley is responsible for channeling the USOC's resources where the organization believes it has the best chances to excel. Since 2010, the organization has steered several million dollars from BMW toward the bobsled competition, enlisting the sponsor to design a new two-man sled for an American team that often features the sport's most gifted athletes—Olympic sprinters Lolo Jones and Lauryn Williams are on the team this year—but trails the Germans in technology. Now, American bobsledders, including Steve Holcomb, who piloted the victorious four-man crew in Vancouver, could win as many as four medals in Sochi. The problem for Team USA is that it needs to win medals in sports that are unpredictable. Alpine skiing produced two gold medals and eight overall for the U.S. in Vancouver. Ligety and 18-year-old prodigy Mikaela Shiffrin are the best at their events, but in alpine skiing, a momentary gaffe can mean the difference between a gold medal and 12th place. Where the Medals Are Norway, on the other hand, specializes in cross-country skiing and biathlon, which combines cross country and sharpshooting. They are the most medal-rich sports of the games, producing 69 medals—and among the least competitive. Throughout the 90-year history of the Winter Games, just four countries—Germany, Norway, France, and Russia and its Soviet predecessors—have won nearly three-quarters of biathlon medals. In cross-country skiing, five countries have won 82% of the medals. Aksel Lund Svindal, who is something of an oddity as a Norwegian alpine world champion, says nearly all the best athletes in his country pursue cross-country skiing, so Norway's projected success in Sochi doesn't surprise him. "When the best talent goes into sports that the U.S. doesn't hear about and you have a good program, it makes sense." Norway is continuing to reap the benefits of hosting the 1994 Winter Games in Lillehammer. The 20-somethings leading the Norwegian Olympic team now—cross-country stars Martin Sundby, Petter Northug and Therese Johaug—were young children then. They grew up on the new training facilities built for those Games, when the country recommitted itself to success at the Winter Olympics. But Heiberg, the Lillehammer organizer, has a different message: Beware of the Russians. "The Russians have mobilized so much that they will be hard to beat on home ground," he says. Indeed, U.S. medal totals jumped to 10 golds and 34 overall in Salt Lake in 2002 from six and 13 in 1998 in Nagano. Canada doubled its gold-medal haul to 14 in Vancouver from seven in Turin in 2006. The Russian team won just three gold medals and 15 overall in 2010, after which then-Russian President Dmitry Medvedev forced the head of Russia's Olympic Committee to resign as punishment for the lackluster showing. Russian sports officials have built new ski-jumping, bobsled and curling training facilities in recent years. They recruited foreign experts and athletes to bolster the Russian national teams. Led by Viktor Ahn, a former South Korean short-track speedskating champion, the Russians last month took the 5,000-meter relay at the European championships. The Russians will also have a huge team in Sochi, with some 225 athletes. "Even in the Soviet era, we didn't have as big a team for the Winter Olympics as we will have in Sochi," Alexander Zhukov, the Russian Olympic Committee president, said at a recent news conference. Officials have said Russia has a shot at winning medals in 11 sports, up from seven in Vancouver. Men's hockey is the priority. In recent years Russia's top pro league has recruited the country's NHL stars, including Ilya Kovalchuk, back to the motherland to prepare for the Games. Russian President Vladimir Putin has said he would be watching closely as Alexander Ovechkin and Evgeny Malkin take on Team USA on Saturday, Feb. 15, though the Russians will likely have to beat the defending champion Canadians to win the gold medal. Canadian Depth As Canada proved in 2010, it isn't just about hockey (or curling) anymore. Like the American team, the Canadians are deep and well-rounded. Dominique Maltais and Maelle Ricker are dominant in snowboard cross. Patrick Chan is a favorite for figure-skating gold, and his country may win the sport's first team gold medal, a new event. And what of Germany, the world's pre-eminent winter-sports country since unification? The Germans should clean up in luge, as usual, but they have fallen off in biathlon, which historically has been a strength. Its best biathlete, Magdalena Neuner, winner of three medals in Vancouver, two of them gold, retired in 2012 at 25, in part to pursue a fashion career. Still Michael Vesper, Germany's chef de mission for Sochi, predicts his country will take home at least 30 medals. "We have to do better in the new sports," Vesper said recently. "In snowboarding and moguls, we didn't get any medals in Vancouver. We think we can get some this time." Perhaps Germany might be better off sticking to what has traditionally made it so strong. That strategy seems to be working just fine for Norway. Matthew Futterman is a senior special writer for The Wall Street Journal in New York. He can be reached at matthew.futterman@wsj.com. Paul Sonne, a Journal reporter based in Moscow, contributed to this article. Email him at paul.sonne@wsj.com.

Summary: Though the opening ceremonies aren't until tomorrow, the 2014 Olympics officially kick off today in Sochi-and the Wall Street Journal is ready with its extremely complex medal prediction system, which proved to be accurate to within just a few medals at the last two Olympics. So who's likely to be the big winner this time around? The Journal predicts Norway will walk away with the most overall medals at 33, followed by the US at 32, Canada at 30, and Germany and Russia at 27 each. As for gold medals, Norway and the US are predicted to tie for the top spot with 13 each. Germany and Canada are also in the top four there, predicted to walk away with 10 and nine gold medals, respectively. What are the factors at play? Well, consider that Norway has already racked up the most Winter Olympics medals of all time and the most gold medals from the Winter Games. Their athletes are focused on Nordic sports like cross-country and ski jumping: "We concentrate where we can do well," explains an International Olympic Committee member who organized the 1994 Lillehammer Games. Meanwhile, the US gets a boost from three newly-added competitions in sports at which it excels: snowboarding, freestyle skiing, and women's ski jumping. But one big problem for the US? Many important athletes are struggling with injuries. A very different model-one that focuses on statistics like a country's GDP and exports rather than the athletes themselves-predicts the US will win out with 29 medals total, while Norway will only grab 16, Smithsonian reports. And if you'd rather look at betting odds for your prediction, the most recent story on SB Nation says the odds basically agree with the Journal: Norway is favored to be the top gold medal-winner, followed closely by the US, while the US is favored to bring home the most overall medals, followed by Norway.

multi_news

en

Summarize: [0001] This application claims priority to U.S. patent application Ser. No. 60/254,537 to Armarasinghe et al., filed Dec. 12, 2000, the contents of which are incorporated herein by reference. BACKGROUND OF THE INVENTION [0002] 1. Field of the Invention [0003] The invention relates to headgear for use with a mask suitable for the delivery of non-invasive positive pressure ventilation and for nasal CPAP treatment of sleep disordered breathing conditions such as obstructive sleep apnea. [0004] 2. Description of Related Art [0005] Obstructive Sleep Apnea (OSA) is a disease characterised by excessive daytime sleepiness, loud snoring and daytime irritability. Other effects of OSA can include depression, high blood pressure, serious heart conditions, sexual problems, memory lapses, intellectual deterioration and morning headaches. [0006] The treatment of OSA by the application of nasal Continuous Positive Airway Pressure (CPAP) was invented by Sullivan and is described in U.S. Pat. No. 4,944,310 (Sullivan, assigned to ResMed Limited). The technique involves the application of a flow of pressurised breathable gas (typically room air) to either the nose or nose and mouth of a patient while they sleep. The technique is said to “splint” open the airways. Typical treatment pressures are in the range of 3 to 20 cmH 2 O. Flows are up to approximately 200 L/min. The flow of pressurised air is produced by a blower and delivered to the patient via a patient interface. The blower and patient interface are joined by a conduit. Whilst there are other techniques for the treatment of OSA, such as surgery, the use of CPAP has become the “gold” standard. [0007] For a particular patient, the pressure which is needed to maintain open airways can vary throughout the night and vary on different nights. U.S. Pat. No. 5,245,995 (Sullivan and Lynch, assigned to ResMed Limited) describes a method and device for varying the pressure in accordance with indications. For example, if the patient starts to snore, the pressure automatically increases, whilst in the absence of snoring, the pressure automatically decreases. [0008] Non-Invasive Positive Pressure Ventilation (NIPPV) is another form of treatment for breathing disorders. In its most basic form, it involves a relatively higher pressure of gas being provided in the patient mask during the inspiratory phase of respiration and a relatively lower pressure or atmospheric pressure being provided in the patient mask during the expiratory phase of respiration. Typical treatment pressures are in the range of 3 to 30 cmH 2 O. [0009] In other NIPPV modes, the pressure can be made to vary in a complex manner throughout the respiratory cycle. For example, the pressure at the mask during inspiration or expiration can be varied through the period of treatment, as disclosed in international PCT patent application no. PCT/AU97/00631 (Berthon-Jones, assigned to ResMed Limited). [0010] In this specification, any reference to CPAP is to be understood as embracing all of the above-described forms of ventilatory treatment or assistance. One of the earliest patient interfaces for providing CPAP treatment was constructed to include a fibreglass model of the patient's nose. The model was adhered to the patient's nose each night and removed each morning. An advantage of this patient interface included the customised fit, which assisted in a good seal between the patient interface and the patient's airways. However, the use of adhesive to secure the mask was inconvenient and not desirable. [0011] Another suitable patient interface is described in U.S. Pat. No. 5,243,971 (Sullivan and Bruderer, assigned to the University of Sydney), entitled “Nasal Mask for CPAP having Ballooning/Moulding Seal with Wearer's Nose and Facial Contours”. This patent describes a nasal mask with a soft face-contacting portion, and a rigid shell. The mask is held in position using headgear. The headgear is attached to the mask and passes around the back of the wearer's head. The patent depicts two sets of straps in the headgear. The first set comprised a pair of straps passing from the forehead region to the back of the head. The second set comprised a pair of straps passing from the nasal region of the mask to the back of the head. [0012] Another known patient interface is the MIRAGE® nasal mask (by ResMed Ltd). This nasal mask includes a pair of headgear attachment points in the nasal region of the mask shell and a forehead support that includes another pair of headgear attachment points. The headgear includes a single piece of a soft, flexible composite fabric with a generally triangular back portion and four straps. The four straps include a pair of upper straps and a pair of lower straps connecting to the headgear attachment points on the forehead support and nasal mask shell respectively. At the end of each strap is secured a piece of hook material, which, in use, passes through a headgear attachment point and fastens on corresponding loop material on the strap. The generally triangular back portion engages the skull in the region of the occiput. The fabric stretches under a load. The base of the triangle is positioned near and generally in line with the upper straps. Each strap is approximately 2 cm wide and approximately 3 mm thick. The fabric is a composite of three layers. The inner layer, closest to the patient's head, is made from nylon. The middle layer is made from neoprene. The outer layer is made from loop material, suitable for engaging with hook fastening material such as Velcro™. The upper straps have an approximate length of 19 cm, from the end to the closest corner of the triangle, whilst the lower straps have an approximate length of 26 cm. Including the triangle, the upper and lower straps each have an approximate total length of 60.5 cm. The triangular back portion is an approximate isosceles triangle, with a base of approximately 13.5 cm and sides of approximately 9 cm. [0013] Some patients open their mouths during sleep, which means that they may not receive the benefit of CPAP due to mouth leaks. Various solutions have been proposed for this problem. One solution is taught in U.S. Pat. No. 6,123,082 (Berthon-Jones, assigned to ResMed Limited), whereby the lips are held dosed. Another solution is to use a mask that covers both the nose and mouth of the patient. An example of a mouth and nasal mask is described in U.S. Pat. No. 5,560,354 (Berthon-Jones, Calluaud, Lynch & Hely, assigned to ResMed Limited). [0014] Another suitable mask system is the MIRAGE® full-face mask (by assignee ResMed Limited). The MIRAGE® full-face mask and headgear is illustrated in FIGS. 1, 2 and 3. Suitable headgear ( 102 ) for this mask ( 100 ) is constructed from a composite material of nylon, neoprene and loop material. The headgear similarly comprises a pair of upper ( 104 ) and a pair of lower straps ( 106 ) and a generally triangular back portion ( 108 ). The upper strap has a total length of approximately 610 mm as shown in FIG. 3. The straps have an approximate width of 25 mm, however, the upper strap has an approximate width of 19 mm. The triangular region has a base of approximately 15.5 cm and two equal sides of approximately 11 cm. The upper and lower straps are approximately 192 mm apart. In addition, the headgear includes a quick release mechanism ( 110 ), as described in the pending U.S. patent application Ser. No. 09/482,718 (Lithgow, assigned to ResMed Limited). The quick release mechanism provides a “rip-chord” that can be pulled upon to separate the headgear and remove the mask in an emergency. When the headgear is positioned on the patient's head, the quick-release mechanism is situated at the back of the head and the chord runs through loops towards the front of the mask system. [0015] Patient interface arrangements include nasal masks, nose and mouth masks, nasal prongs and nasal pillows. In all forms of patient interface used with CPAP for treating sleep disordered breathing, there is a need to counterbalance the force of the pressurised air and to correctly position the interface. Since the patient must sleep with this interface, it is important that it be comfortable. From the manufacturing and distribution channel perspectives, it is advantageous if one size of headgear fits a large range of head shapes and sizes. [0016] It should be noted that while there are many mask and headgear arrangements available for ventilators, respirators, aviator masks and other breathing apparatus, in general, these may not be suitable for use in the treatment of sleep disordered breathing because they are not sufficiently comfortable to allow the patient to sleep. [0017] The present invention is directed towards providing headgear for holding and securing a mask for use in the treatment of sleep disordered breathing which improves patient comfort, is long lasting and fits a wide range of head shapes and sizes. SUMMARY OF THE INVENTION [0018] The invention provides headgear for securing and positioning a mask suitable for the treatment of sleep disordered breathing with the following advantageous combination of features: [0019] (i) Constructed from a composite including polyurethane foam [0020] (ii) Relatively narrow strap ends, [0021] (iii) Displaced lower strap, [0022] (iv) A quick release mechanism near the front of the face; and [0023] (v) Additional attached components to alter the elasticity and stiffness of the straps. BRIEF DESCRIPTION OF THE DRAWINGS [0024] [0024]FIG. 1 shows a front three-quarter view of a MIRAGE® full-face mask and prior art headgear system in position on a patient's head. [0025] [0025]FIG. 2 shows a rear three-quarter view of a MIRAGE® full-face mask and prior art headgear system on a patient's head. [0026] [0026]FIG. 3 shows a view of prior art full-face mask headgear laid flat. [0027] [0027]FIG. 4 shows a view of headgear according to an embodiment of the present invention. [0028] [0028]FIG. 5 shows a view of the quick release mechanism according to the present invention. [0029] [0029]FIG. 6 shows a view of mask headgear straps in accordance with the present invention laid flat. DETAILED DESCRIPTION OF THE INVENTION [0030] The invention provides headgear ( 10 ) for securing and positioning a mask suitable for the treatment of sleep disordered breathing. [0031] (i) Material [0032] The headgear is constructed from a composite of polyurethane foam, loop material and hook material whose shape includes a pair of upper straps ( 20 ) and lower straps ( 30 ) and a generally triangular back portion ( 40 ). A piece of hook material ( 22 ) is attached to the end of each of the four straps so that the straps may be secured to the attachment points on the mask. [0033] The composite has three layers. The first layer, which in use is positioned against the head of the patient, is constructed from polyester/nylon fabric. The second, middle layer is constructed from an hypoallergenic breathable polyurethane foam. The third layer is constructed from loop material. A suitable material for constructing the composite is BREATH-A-PRENE® manufactured by ACCUMED, New York, United States of America. The total thickness of the composite is approximately 2 mm. The upper and lower pairs of straps are approximately 150 mm apart when laid flat. The upper and lower straps have an approximate total length (from the left side to the right side) of 610 mm. [0034] The generally triangular back portion ( 40 ) of the headgear ( 10 ) is constructed and arranged to engage generally with the occiput of the patient's head in use. In use, the base of the triangle is positioned at the crown of the head, while the apex of the triangle lies generally just above the point of contact between the skull and the muscles of the neck. [0035] (ii) Relatively Narrow Strap Ends [0036] The headgear of the present invention is configured to minimize the discomfort associated with the use of hook material. In prior art headgear, that discomfort can arise where the hook material may be in contact with the patient's skin, say the cheek or neck regions, for extended periods of time. That undesirable contact will occur where the hook material, to some extent is not entirely located on the receiving loop material, but lies tangential to the loop material, and to some extent extends beyond the loop material and comes in contact with the patient's skin, either continuously while the headgear is in use or when it is compressed against the skin, as can occur when the patient head changes position during the sleep period. [0037] As shown in FIG. 4, the width of each lower strap is constant for approximately half their length, forming a relatively wide portion ( 24 ), and then over a relatively short distance, changes to a narrower width for the remaining half of their length, forming a relatively narrow portion ( 26 ), terminating at the point where the hook material ( 22 ) is joined to the composite material. A characteristic of this configuration is that the point of contact where the hook material detachably binds with the strap loop material is positioned on the wide portion ( 24 ) and is wider by approximately 1 cm than the width of the engaging hook material. By adopting this configuration, the target region for binding is relatively greater in area than is the case with prior art. Prior art headgear includes a tapered end hook section that is of narrower width than that of the intended contact loop section of the strap. However, the prior art hook section tapered end is less than one half the length of the hook section, that is, it does not represent the majority of the length of the hook section nor does its length represent the majority of the length of the intended corresponding contact loop section (i.e., the maximum extent of the loop section covered by the hook section). [0038] In contrast to the prior art, with the present invention the attachment of the hook material is facilitated, as relatively less precision is required in the placement of the hook section to achieve binding. This reduced dependence on precision is of advantage to all persons using the headgear and is of particular benefit to the user that may be trying to fit the headgear in a home environment and where it is not possible to directly sight the headgear components they are manipulating. Furthermore, compared to the prior art (where the hook material and the target region are of substantially the same width), this configuration reduces the chance of exposing some of the hook material to interfere with the wearer, causing discomfort and possibly skin irritation or abrasion. [0039] (iii) Displaced Lower Strap [0040] A length of each of the left and right lower straps is displaced vertically lower by approximately 1 cm ( 28 ). By adopting this configuration, it is possible to optimize the design of the base of the back portion so as to achieve the desired security of attachment but avoid compromising comfort in a situation where the lowest point of the headgear in the occiput region is extended to a position that is lower than is otherwise required in order to achieve a sufficiently lowest strap point. This approach avoids the prior art problem of having the headgear rear portion extending beyond what would otherwise be required and thereby engaging the sensitive area below the occipital lobe. [0041] (iv) Quick Release Mechanism [0042] Preferably the headgear of the present invention includes a quick release mechanism ( 50 ) (see FIG. 5), and this is especially so when the headgear is intended to be used with a mask that covers the patient's nose and mouth. [0043] The quick-release mechanism ( 50 ) suitable for incorporation into the preferred embodiment is constructed from a sub-assembly of three components: (i) a release loop of a cord material ( 52 ), (ii) a generally rectangular length of hook material ( 54 ), and (iii) a generally rectangular length of a composite fabric ( 56 ) which can bind to the hook material, as discussed above. The sub-assembly is generally rectangular in shape and in use forms an extension of one of the lower straps. Preferably the loop cord is constructed from braided cord about 17 cm long. The cord loop ( 52 ) is sewn to one end of the length of hook material ( 54 ). The hook material ( 54 ) and composite fabric ( 56 ) are joined at the other end of the hook material ( 54 ), preferably via a weld joint. In use, the end of the hook material ( 54 ), to which is connected the loop cord ( 52 ), is secured, using the hook and loop mechanism, to the end of a modified lower strap which, in contrast to the lower straps ( 30 ) shown in FIG. 4, does not contain hook material. The other end ( 56 ) of the quick release mechanism ( 50 ) is free to be connected to a headgear attachment point on the mask shell and releasably attached to an exposed portion of the hook material ( 54 ). If it is desired to use the quick-release mechanism ( 50 ), it is convenient for the patient to pull down on the loop of braided cord ( 52 ), thereby disengaging the lower strap from the mask shell and allowing the mask to then be readily removed from the patient's face. A quick-release mechanism of this configuration may be used on headgear that is fabricated of materials and in configurations that are different to those of the type described above and as such is an invention in its own right. [0044] (v) Altering the Stiffness and Extensibility [0045] In one form of the invention, the extensibility of the straps can be altered by attaching lengths of generally inextensible material ( 62 ) such as cotton or silk to the straps, as shown in FIG. 6 a. The effect of this arrangement is to make the headgear less extensible along the length of the straps than in a vertical direction. In a preferred embodiment, lengths of cotton are sewn to the straps. [0046] In another form of the invention, the stiffness of the straps can be altered by attaching stiffening material ( 64 ) to the top and bottom edge of the straps, as shown in FIG. 6 b. Alternatively, or in addition, the strap may be stiffened by any other suitable means including by adding stitching as lines, in a criss-cross pattern, or both. This makes the headgear less “floppy” and more convenient to put on the head of a wearer. [0047] In another form of the invention, the headgear is constructed from an anisotropic material that is more extensible in a first direction than in a direction at an angle of 90 degrees to the first direction. This enables the headgear to be cut from a single piece of composite material and yet have different extensibilities in different directions. Preferably, the headgear will be more extensible in a vertical direction than in a horizontal direction. Hence the upper and lower straps will be less extensible in a direction along their length than in a direction along their width. This means that the back portion of the headgear can be more extensible in a direction from the base of the skull to the crown, than in a direction at right angles to that direction.

Summary: A headgear for securing and positioning a mask suitable for the treatment of sleep disordered breathing is constructed from a composite including polyurethane foam. It includes a back portion ( 40 ) with upper and lower straps ( 20, 30 ) connected to the back portion. The straps have relatively narrow strap ends ( 26 ) the lower straps are displaced downward with respect to the back portion. A quick release mechanism ( 50 ) near the front of the face attaches the headgear to the mask. Additional components can be attached to the straps to alter their elasticity and stiffness.

big_patent

en

Summarize: Tweet with a location You can add location information to your Tweets, such as your city or precise location, from the web and via third-party applications. You always have the option to delete your Tweet location history. Learn more Bill Maher and Stan Lee (Photo: Photo by Chris Pizzello/Invision/AP, File) Bill Maher is standing by the controversial comments he made about the late Marvel Comics co-creator Stan Lee, in an interview with Larry King published Wednesday. "I’m agnostic on Stan Lee," Maher said. "I don’t read comic books, I didn’t read them as a child. What I was saying is, a culture that thinks that comic books and comic book movies are profound meditations on the human condition is a dumb (explicit) culture. And for people to get mad at that just proves my point." The new interview comes days after Maher wrote a blog post on his website over the weekend that many people called disrespectful to Lee, who died Nov. 12 at the age of 95. "America is in mourning. Deep, deep mourning for a man who inspired millions to, I don’t know, watch a movie, I guess," Maher wrote about the cultural icon responsible for many of Marvel’s most popular superheroes in comic books and movies. Lee's team at POW! Entertainment quickly fired back at the late-night host, calling his words about man "frankly disgusting." In an open letter, Lee's team said, "Countless people can attest to how Stan inspired them to read, taught them that the world is not made up of absolutes, that heroes can have flaws and even villains can show humanity within their souls." Maher's post continued, saying he has nothing "against comic books," but that when he was growing up "comics were for kids, and when you grew up you moved on to big-boy books without the pictures. "But then twenty years or so ago, something happened – adults decided they didn’t have to give up kid stuff," he said. "And so they pretended comic books were actually sophisticated literature." Then the late-night host brought politics into the mix, mentioning President Donald Trump. "I don’t think it’s a huge stretch to suggest that Donald Trump could only get elected in a country that thinks comic books are important," Maher wrote. The open letter from POW! Entertainment concluded: "Our shock at your comments makes us want to say ‘ ’Nuff said, Bill,' but instead we will rely on another of Stan’s lessons to remind you that you have a powerful platform, so please remember: 'With great power there must also come – great responsibility!' ” After Maher's post went online, Lee's fans jumped on social media to slam him. Comic book artist Greg Capullo tweeted, "I never speak on topics I know little or nothing about. Why? I never want to be the fool. In other words, I don’t wanna make a Bill Maher out of myself." I never speak on topics I know little or nothing about. Why? I never want to be the fool. In other words, I don’t wanna make a Bill Maher out of myself. 🤘🏻✏️🤘🏻 — Greg Capullo (@GregCapullo) November 17, 2018 "Bill Maher just took a dump on the comic book legend, universally beloved man - Stan Lee who just died, and by extension the whole community of readers and every single person who loved comics growing up," another Twitter user wrote. "On top of being a clueless Berniebro, Bill Maher is truly-a piece of trash." Bill Maher just took a dump on the comic book legend, universally beloved man - Stan Lee who just died, and by extension the whole community of readers and every single person who loved comics growing up. On top of being a clueless Berniebro, Bill Maher is truly-a piece of trash. — Artie 🥀 IS VOTING BLUE (@Artie_Pavlov) November 17, 2018 "Bill Maher’s trashy, pointless, and bitter sounding 'blog post' is no shock. He makes a living off criticizing and trashing other people‘s work. He’s a 'comic' that people laugh at and agree with and then fancy themselves smart & progressive," another wrote, adding #RIPStanLee. Bill Maher’s trashy, pointless, and bitter sounding “blog post” is no shock. He makes a living off criticizing and trashing other people‘s work. He’s a “comic” that people laugh at and agree with and then fancy themselves smart & progressive. #RIPStanLeepic.twitter.com/VeEylaEj0w — Daradol (@Daradol1) November 17, 2018 "I don't know and don't particularly care who Bill Maher is. I just know that anyone who pisses on people for mourning a man who helped make them happy is a titanic waste of space," another shared. I don't know and don't particularly care who Bill Maher is. I just know that anyone who pisses on people for mourning a man who helped make them happy is a titanic waste of space. — Mack (@SgtPepper1001) November 17, 2018 "I just read Bill Maher's latest blog," another tweeted along with a photo that illustrated their frustration. I just read Bill Maher's latest blog. pic.twitter.com/aqix3uKQsb — Daradol (@Daradol1) November 17, 2018 "Bill Maher sure didn’t mind taking that check to appear in Iron Man 3 tho," another pointed out. USA TODAY has reached out to Maher's representative for comment. More: Comic writers reflect on Stan Lee's take on race More: Private funeral held for Marvel Comics mogul Stan Lee, but more memorial plans in the works Read or Share this story: https://www.usatoday.com/story/life/people/2018/11/17/bill-maher-slammed-disrespecting-late-comic-book-writer-stan-lee/2037932002/ Tweet with a location You can add location information to your Tweets, such as your city or precise location, from the web and via third-party applications. You always have the option to delete your Tweet location history. Learn more TASK Comics Rule Everything Around Me(C.R.E.A.M.) Writer of Co-host on Stop putting pineapple on a pizza Icarus in Increments In the Middle of Little Italy Tweet with a location You can add location information to your Tweets, such as your city or precise location, from the web and via third-party applications. You always have the option to delete your Tweet location history. Learn more

Summary: "Don't speak ill of the dead" is apparently not advice Bill Maher lives by. The comedian wrote a blog post about Stan Lee after the Marvel Comics icon died last week, and it was not exactly respectful in tone. "America is in mourning. Deep, deep mourning for a man who inspired millions to, I don't know, watch a movie, I guess," Maher wrote. He went on to say that while he has nothing against comics, he's frustrated with the fact that over the past couple decades, they went from being strictly "kid stuff" to being considered "sophisticated literature." Adults these days, he writes, don't think they should have to give up childish things-and the result, in his view? "We're using our smarts on stupid stuff. I don't think it's a huge stretch to suggest that Donald Trump could only get elected in a country that thinks comic books are important." Needless to say, a whole legion of Lee fans was not amused, USA Today reports. Some pointed out that Maher actually appeared in a Marvel movie; others pointed out questionable stances Maher has taken in the past. "This same guy rushed to celebrate Hugh Hefner's legacy. Tells you what you need to know," tweeted Jonah Goldberg. Comic book artist Greg Capullo weighed in, tweeting, "I never speak on topics I know little or nothing about. Why? I never want to be the fool. In other words, I don't wanna make a Bill Maher out of myself." And many rolled their eyes as they noted Maher's past controversies. "Being a white man in America is not realizing that Bill Maher is a bigoted, soulless d--- until he s---s on Stan Lee," tweeted Andi Zeisler. Added Torraine Walker, "Bill Maher 'bout to be outta here. The white fanboys who tell Blacks, women, POC and muslims to get over his insults and slurs can't stand having their own culture mocked."

multi_news

en

Summarize: When their daughter was born without fingers on her left hand, David and Zania Fraser feared her disability would cast a shadow over her life. And as soon as five-year-old Hayley started school her self-consciousness was apparent – to the extent she would hide her left arm from her new friends. But now her embarrassment has turned to pride after she became the first child in Britain to receive an ultra-cheap prosthetic made on a 3D printer. Unlike conventional prosthetic limbs, the charity E-Nable make hands on 3D printers which intentionally stand out in a bid to make children proud of their differences. Unlike conventional versions, the £50 hands are deliberately bold and colourful to help make disabled children proud of being different. ‘It was all her dreams come true,’ said Mr Fraser, 36. ‘It’s the little things – she can hold her teddy, peel a banana and even paint her nails now. It has made a real difference to her – the philosophy behind the charity is amazing. ‘Children pick their own designs and colours, and they don’t look like you would expect a prosthetic to look. They make the kids feel really special, rather than being something to be embarrassed about.’ Hayley was born with symbrachydactyly – a congenital abnormality which left her with just a stump instead of fingers. Doctors only offered the family an operation to transplant a toe to her hand. ‘We didn’t make a big deal out of it, but if she would stand for a photograph, she would stand with her other hand over it, or behind her back,’ said her father, an Inverness-based electrical contractor. ‘We always said it’s just part of her but there was a stage when she was going to nursery and kids ask questions.’ The family found out about the not-for-profit group E-Nable, which introduced them to University of Wisconsin engineer Frankie Flood. After being put in touch with an expert through the charity, Hayley's parents David and Zania made a plaster cast at home and sent it to the professor. He then printed the parts on a 3D printer and posted the arm back. The Frasers made a plaster cast of Hayley’s arm and sent it to Professor Flood. He printed the parts on a 3D printer and six weeks later a pink and purple bionic arm arrived in the post. The simple device is controlled by the wrist and wiring. E-Nable has made around 40 superhero-style hands since it was formed a year ago. Some have flashing lights, others claws. Melina Brown, a volunteer at the charity, said: ‘When we started it was more about function, but now it is as much about self-esteem. ‘The hands are cool, so the kids go from being the one who maybe has an issue at school, to suddenly having a cool superhero arm that everybody wants.’ The charity was formed by US prop designer Ivan Owen and South African carpenter Richard van As, who lost his fingers in a mechanical saw

Summary: Five-year-old Hayley Fraser was born without any fingers on her left hand. Her parents were told the only option on the NHS was major surgery. Desperate for an alternative, they turned to the internet and found a charity. There, experts made Hayley a pretty 3D printed pink and purple robo-limb. Charity, E-Nable, has helped 40 kids in U.S. and wants to help more in UK.

cnn_dailymail

en

Write a title and summarize: The complement system consists of more than 40 proteins that participate in the inflammatory response and in pathogen killing. Complement inhibitors are necessary to avoid the excessive consumption and activation of this system on host cells. Leptospirosis is a worldwide zoonosis caused by spirochetes from the genus Leptospira. Pathogenic leptospires are able to escape from complement activation by binding to host complement inhibitors Factor H [FH] and C4b-binding protein (C4BP) while non-pathogenic leptospires are rapidly killed in the presence of fresh serum. In this study, we demonstrate that complement control protein domains (CCP) 7 and 8 of C4BP α-chain interact with the outer membrane proteins LcpA, LigA and LigB from the pathogenic leptospire L. interrogans. The interaction between C4BP and LcpA, LigA and LigB is sensitive to ionic strength and inhibited by heparin. We fine mapped the LigA and LigB domains involved in its binding to C4BP and heparin and found that both interactions are mediated through the bacterial immunoglobulin-like (Big) domains 7 and 8 (LigA7-8 and LigB7-8) of both LigA and LigB and also through LigB9-10. Therefore, C4BP and heparin may share the same binding sites on Lig proteins. Leptospirosis is a worldwide zoonosis caused by spirochetes from the genus Leptospira [1]. Rodents are the main reservoir of Leptospira, which can be excreted in animal urine [2]. The disease is transmitted by contact of abraded skin or mucosal membranes with water contaminated with infected urine and it presents a higher incidence in developing countries, which lack proper sanitation conditions. In developed countries, leptospirosis is more frequently associated with agriculture and aquatic sports. According to the World Health Organization [WHO], more than 500,000 cases of leptospirosis are diagnosed per year worldwide and the mortality rates reach 10% in some areas. Since 80–90% of the patients initially present nonspecific symptoms, such as headache, fever and joints pain that may disappear without any specific treatment, these epidemiological data may be underestimated [3–4]. So far, 13 pathogenic and 6 saprophytic species with more than 320 serovars (260 pathogenic and 60 saprophytic) of Leptospira species have been described [5]. Recent studies on the differences between pathogenic and saprophytic Leptospira have contributed to our knowledge concerning the mechanisms that allow survival of pathogenic strains inside the host. In 2004, Koizume and Watanabe described two surface proteins expressed only in pathogenic Leptospira: Leptospiral immunoglobulin-like A (LigA) and B (LigB) [6–8]. During the last decade several groups have been studying the functions of Lig proteins and their contributions to Leptospira infection. A well-established role for LigA and LigB is their capacity to interact with multiple extracellular matrix components such as fibrinogen, fibronectin [9] collagen [10] laminin and elastin [11]. Saprophytic Leptospira expressing recombinant LigA or LigB proteins present stronger adhesion to eukaryotic cells and to fibronectin in vitro [12]. A fragment of the LigA protein has been shown to be a promising vaccine candidate, conferring high-levels of protection in hamster models of leptospirosis [13–14]. Lig proteins have also been shown to contribute to pathogenic Leptospira immune evasion by binding to the complement system inhibitors Factor H (FH), FH-like 1 (FHL-1), FH-related 1 (FHR-1) and C4b-binding protein (C4BP) [15]. In addition, LcpA, another surface protein present exclusively in pathogenic Leptospira, binds to C4BP [16], FH and vitronectin [17]. The acquisition of such inhibitors on the bacterial surface potentially enables pathogenic Leptospira to down-regulate all pathways of this system. FH is a 150 kDa protein composed of 20 control complement protein (CCP) domains (also known as short consensus repeat (SCRs) [18–19]. CCPs 1–3 interact with C3b which is important for FH’s role as a cofactor in Factor I (FI) -mediated cleavage of C3b [19]. FH cofactor activity is maintained when bound to Lig proteins [15]. FH also inhibits the interaction of Factor B with C3b, accelerating decay of the C3 convertase of the alternative pathway [20]. FH binds to LcpA mainly by CCP 20 [17] and to Lig proteins through CCPs 5 and 20 [15]. C4BP is a 570-kDa glycoprotein and relatively abundant in plasma (200 μg/ml–500 μg/ml) [21]. The C4BP molecule is comprised of two different polypeptide chains: C4BP α chain (75 kDa) and C4BP β chain (45 kDa). In serum, three C4BP isoforms can be observed which differ in the stoichiometries of α and β chains: α7β1 (most common), α6β1 and α7β0 [22]. C4BP α chain contains eight CCPs and C4BP β chain contains three CCPs (Fig 1). C4BP inhibits the classical and the lectin pathways acting as a cofactor for the cleavage of C4b by FI. It also prevents binding of C2a to C4b and accelerates the decay of the C3 convertase (C4bC2a) of both pathways [23–25]. Binding sites for several ligands of C4BP have been localized using C4BP mutants. The alpha-chains CCP2 and CCP3 are crucial for the interaction with C4b [26–27] while binding to heparin requires CCPs 1–3 of the alpha chain [28]. The first three CCP domains of the alpha chain are also involved in interactions with several bacterial pathogens. C4BP also interacts with protein S through its beta-chain CCP1 [29–31]. In a previous study, we showed that LigA and LigB interact with C4BP in a dose-dependent manner and that bound C4BP remains functionally active, mediating degradation of C4b by FI [15]. In this study, we focused more closely on the interaction of Lig proteins with C4BP. Using a panel of C4BP mutants, we mapped the CCPs involved in the interaction with whole Leptospira and specific LigA and LigB domains. We show that ionic forces play a role in the binding of C4BP to Lig proteins and that the interaction is inhibited by heparin, a known C4BP ligand. All the experiments involving laboratory animals were evaluated by the “Ethics Committee for Animal Use” from Institute of Biomedical Sciences—University of São Paulo (our Institutional Animal Care and Use Committee) and approved under the protocol number06/10/CEUA/ICB and 99/2/CEUA/ICB. The procedures are according to the Brazilian National Law number 11794 from 10/08/2008, which regulates all research activities involving animal use in the country. L. interrogans serovar Kennewicki strain Fromm was cultured in EMJH medium [Difco] supplemented with 10% of bovine serum albumin (BSA) during 7 days at 29°C under aerobic conditions. The virulence of this strain was confirmed in vivo upon infection in hamsters at the Laboratory of Bacterial Zoonosis of the Faculty of Veterinary Medicine and Zootechny, University of São Paulo. Human purified C4BP (α7β1) was purchased from Complement Technology (Texas, USA). Recombinant wild type C4BP (rC4BP) and C4BP mutant α chains lacking single CCP domains α6β0 (Fig 1) were expressed in eukaryotic cells and purified by affinity chromatography as previously described [26,32]. To exclude the possibility that polyclonal rabbit anti-human C4BP (Calbiochem) used in this study would interact preferentially with the C-terminal rather than to the N-terminal region of C4BP, which could potentially interfere with the detection of C4BP lacking the CCPs localized in this region, an ELISA was performed to guarantee that the antibody could recognize equally all C4BP mutants. All mutants were specifically recognized by anti-human C4BP. LigA is composed of 13 bacterial immunoglobulin-like [Big] domain repeats while LigB consists of only 12 Big domains. The first six and a half domains of LigA and LigB are identical (residues 26–630). This recombinant fragment was expressed and named LigBN. Fragments corresponding to the C-terminal half of the 7th Big domain until 13th Big domains of LigA (residues between 631–1225) and LigB (residues between 631–1156) were named LigAC and LigBC. Cloning, expression, and purification of LigAC, LigBC, LcpA and LIC10301 (negative control) were described previously [15,16]. To pinpoint the C4BP binding sites on Lig proteins, a series of tandem Ig-like domains (also known as Big domains) of Lig proteins were expressed and purified as previously described [11]: LigA7-8, LigA8-9, LigA9-10, LigA10-11, LigA11-12, LigA12-13, LigA8-13 (or LigAC) (numbers correspond to Big domains of LigAC), or LigB7-8, LigB8-9, LigB9-10, LigB10-11, LigB11-12, LigB7-12 (or LigBC) (numbers correspond to Big domains of LigBC). Polyclonal mouse anti-LigA and anti-LigB antibodies were obtained in our laboratory after immunizing mice with 10 μg/each of purified recombinant proteins, using Al (OH) 3 as adjuvant. Two booster injections of the same protein preparation were given at 2-week intervals. One week after each immunization, animals were bled from the retro-orbital plexus and sera pooled. The titers of anti-LigA and anti-LigB were determined by enzyme-linked immunosorbent assay (ELISA). Secondary antibodies conjugated with peroxidase or FITC were purchased from KPL (Maryland, USA) and Abcam (Cambridge, UK), respectively. To map the regions of C4BP CCPα-chain which interact with LigAC, LigBC and LcpA, microtiter plates (Costar 3590) were coated with 1 μg of LigAC, LigBC, LcpA or BSA (negative control) overnight at 4°C. The wells were washed with PBS (137 mM NaCl, 2. 7 mM KCl, 10 mM Na2HPO4,1. 8 mM KH2PO4), blocked with PBS containing 3% BSA (PBS-BSA) for 2 h at 37°C, and incubated with 1 μg of each recombinant C4BP fragment (diluted in PBS) for 60 min at 37°C. After three washes with PBS containing 0. 05% Tween 20 (PBS-T), C4BP bound to L. interrogans recombinant proteins was detected with rabbit polyclonal anti-human C4BP (1: 2000 in PBS-T containing 1% BSA), followed by peroxidase-conjugated anti-rabbit IgG (1: 5000 in PBS-T 1% BSA). Substrate reaction was performed with o-phenylenediamine dihydrochloride (Pierce), and absorbance was measured at 492 nm. The interaction between L. interrogans recombinant proteins with recombinant wild-type C4BP (rC4BP WT) was considered 100% binding. To map the CCP alpha-chains of C4BP that interact with intact L. interrogans, bacteria were harvested at 10. 000 x g for 10 min, washed 2 times with PBS and suspended in 1 ml PBS. Suspensions were adjusted to 1x108 leptospires using a Petroff-Hausser chamber under dark-field microscopy (Nikon Eclipse 50). Suspensions of L. interrogans were incubated with 2 μg of each C4BP mutant or with PBS for 2 h at room temperature. After washing, bacteria were incubated with polyclonal rabbit anti-human C4BP (1: 150 in PBS/1% BSA; final volume: 40 μl), followed by FITC-conjugated anti-rabbit IgG (AbCam; 1: 200 in PBS/1% BSA). Geometric mean fluorescence intensity (GMFI) was measured and the binding of L. interrogans to rC4BP WT was set up as 100%. The auto fluorescence of Leptospira was discounted before plotting the data. It is worth to mention that Matsunaga and colleagues (2005) showed that the expression of LigA and LigB proteins by L. interrogans is determined by environmental signals [33]. Thus, to perform this experiment we used low-passage forms of L. interrogans obtained from hamster. Before we used we confirmed the expression of LigA and LigB proteins on L. interrogans by Western blot and flow cytometry. Microtiter plates were coated with 1 μg of each LigA or LigB fragment overnight at 4°C in PBS (130 mM NaCl, 7 mM Na2HPO4,3 mM NaH2PO4). After blocking with 3% BSA, C4BP (1μM—0. 0156 μM, 2 fold serial dilution) was then added to the plates for 1 h at 37°C. Between each step, plates were washed with PBS-T three times. Subsequently, mouse monoclonal anti-C4BP antibodies (1: 2000) (EMD Millipore) recognizing C4BP α- and β-chains were used as primary antibodies. Horseradish peroxidase (HRP) -conjugated rabbit anti-mouse IgG antibody (1: 2000) (Invitrogen) was used as secondary antibody. After washing three times with PBS-T, 100 μl of 0. 2 mg/ml 3,3’, 5,5’-tetramethylbenzidine (TMB) substrate (Kirkegaard & Perry Laboratories) was added to each well. Finally, after a 10 min-incubation the microtiter plates were read at 630 nm using an ELISA plate reader (Biotek EL-312). Each value represents the mean ± SE of three independent experiments, each performed in triplicate. To confirm the importance of the C4BP C-terminal region on the interaction with LigAC and LigBC proteins, we performed a competition assay with heparin, which interacts with C4BP CCP 1, CCP 2 and CCP 3 [28]. ELISA was performed as described above. Briefly, plates were coated with LigAC or LigBC proteins. After blocking and washing 1 μg of C4BP was mixed with different amounts of heparin and added to the reaction. C4BP bound to LigAC or LigBC proteins was detected using anti-C4BP. To verify if Lig proteins interact directly with heparin, microtiter plate wells were coated with 1 μg of heparin overnight. After washing and blocking, 1μg of LigAC or LigBC was added to the reaction. After three washes, LigAC and LigBC bound to heparin were detected using mouse anti-LigA or mouse anti-LigB, respectively, (1: 1000 in PBS-T containing 1% BSA) followed by peroxidase-conjugated anti-mouse IgG (1: 5000 in PBS-T 1% BSA). To identify which Big domains of LigA and LigB proteins interact with heparin, heparin-BSA conjugates were prepared as previously described [34]. Free BSA was separated from the heparin-BSA by Superdex-75 size exclusion column (GE Healthcare). Plates were coated with 1 μg of heparin-BSA or BSA (negative control) at 4°C overnight. After blocking with PBS-BSA for 2h, different concentrations of Lig protein constructs were applied to heparin-coated wells for 1h at 37°C. Between each step, the wells were washed with PBS-T three times. To evaluate the heparin binding ability of each Lig construct, mouse monoclonal antibodies (1: 1000) against Lig proteins were used as primary antibodies and HRP-conjugated rabbit anti-mouse IgG antibody (1: 2000) (Invitrogen) was used as secondary antibody with TMB as substrate. In order to examine if the C4BP binding sites on Lig proteins are located near the heparin binding regions, a competitive ELISA was performed. Firstly, Lig protein constructs, which can potentially interact with C4BP, were immobilized overnight on microtiter plates at 4°C. After blocking with PBS-BSA for 2h, 1 μg of C4BP mixed with different concentrations of heparin (0–10 mg/ml) were added to the plates. Between each step, the microtiter wells were washed with 0. 05% PBS-T for three times. Subsequently, mouse monoclonal anti-C4BP α/β chains antibodies (1: 2000) (EMD Millipore) and HRP-conjugated rabbit anti-mouse IgG antibodies (1: 2000) (Invitrogen) were used respectively as primary and secondary antibodies to detect the binding levels of C4BP to different Lig protein fragments. C4BP binding to each Lig protein fragment in the absence of heparin was set as 100%. To estimate binding affinities for the interaction between LigAC or LigBC with C4BP or with heparin, increasing concentrations of Lig proteins were incubated with a fixed amount of C4BP (1μg) or heparin (1μg). Using GraphPad Prism 5. 0 (GraphPad Software, Inc.), the dissociation constant (Kd) was estimated by nonlinear regression, using the equation Y = Bmax*X/ (Kd + X). To test if the interaction of C4BP with LigA, LigB and LcpA is dependent on ionic strength an ELISA assays [as described above] were performed in the presence of increasing amounts NaCl [0 to 600 mM] diluted in 10 mM Na2HPO4 and 1. 8 mM KH2PO4. GraphPad Prism 5. 0 (GraphPad Software, Inc.) was used for statistical analyses and ANOVA were used to analyze the data. We used recombinant fragments of the entire C-terminus regions of LigA and LigB to map their binding to specific C4BP CCPs. LcpA, a confirmed leptospiral ligand for C4BP [16], was included in this study as a positive control. Using the panel of C4BP mutants lacking single CCPs in the α-chain (Fig 1A and 1B), we observed that interaction with LigAC (Fig 2A), LigBC (Fig 2B) and LcpA (Fig 2C) was significantly reduced in the absence of CCP7 and CCP8. In addition, we observed that CCP4 of C4BP is also important for the interaction with LigAC (Fig 2A). The C4BP ΔCCP4 mutant also showed a tendency towards reduced binding to LigBC and LcpA, though this reduction was not statistically significant (Fig 2B and 2C). C4BP CCP4, CCP7 and CCP8 domains were also found to be important for the binding of this regulatory protein directly to whole L. interrogans cells. Interestingly, the binding of L. interrogans to the C4BP mutant lacking the CCP1 domain of the α-chain was 3 times greater than that observed for C4BP WT (Fig 2D). To investigate the C4BP binding sites on Lig proteins, wild type C4BP was added to microtiter plates coated with recombinant LigA and LigB truncations. Interaction of the variable C-terminus halves of both LigA (LigAC) and LigB (LigBC) with C4BP is significantly greater than that observed for the N-terminus region (LigBN, which is identical in both proteins) (Fig 3A). To further pinpoint the minimal C4BP binding sites on the two Lig proteins, a series of two-domain tandem Ig-like repeats (Big domains) across the variable C-terminus region of LigA and LigB were generated. The results indicate that all the LigA and LigB tandem repeats bind to C4BP but with different affinities. The major binding sites are located in fragments LigA7-8, LigA9-10, LigA10-11 (Fig 3B) and in fragments LigB7-8, LigB9-10 and LigB11-12 (Fig 3C). A minimal two-domain Ig-like repeat seems to be critical for the C4BP/Lig interaction since binding is significantly reduced when constructs containing only a single-Ig-like domain were used. We also observed that LigAC and LigBC affinities for C4BP are, respectively, Kd = 88. 8 +/- 7. 8 nM and Kd = 51. 6 = /- 5. 9 nM, (Fig 3D). From these results, we conclude that the variable regions of Lig proteins are the most important binding sites for C4BP, that the minimal binding motifs seem to be made up of pairs of Big domains and that the Big domains pairs displayed the strongest affinity for C4BP are domains 7–8,9–10,10–11 in LigA and domains7-8,9–10 and 11–12 in LigB. The results in Fig 2 suggest the C4BP N-terminus domains CCP1, CCP2 and CCP3 do not contribute to binding with LigA and LigB. To further test this hypothesis, we investigated this interaction in the presence of the anionic polysaccharide heparin. Heparin is a component of the extracellular matrix and it is known to interact with C4BP CCP1, CCP2 and CCP3 of the α-chain [28]. Recombinant L. interrogans proteins were incubated with recombinant C4BP WT in the presence of different concentrations of heparin. Surprisingly, we observed that heparin inhibited the interaction of C4BP with LigBC even at concentrations as low as 10-3 mg/ml while the interaction of C4BP with LigAC was inhibited with 0. 2 mg/ml of heparin (Fig 4A). We then investigated if the above phenomenon could be a result of heparin binding directly to LigA and LigB. According to Ching and colleagues [35], recombinant LigBC binds to heparin, and this interaction may help L. interrogans to invade host cells. In the present study, we confirmed these results and additionally observed that LigAC interacts with immobilized heparin as well (Fig 4B). In order to verify if heparin and C4BP would compete for the same binding sites on LigA and LigB, we performed heparin binding experiments using recombinant fragments corresponding to pairs of Big domains from the C-terminus halves of LigA and LigB. Fig 5A shows that Big domain pairs 7–8 of both LigA and LigB are the most important regions for the interaction with heparin. To test whether heparin and C4BP share binding sites on LigA and LigB proteins, a competition assay was performed using different LigA and LigB fragments. In the presence of the highest concentration of heparin used (10 mg/ml), the binding of C4BP to LigA7-8 and LigB7-8 was reduced by 50% and 45%, respectively. The interactions of C4BP with LigA10-11 and LigB9-10 were decreased by 35% and 27% (respectively) under the same conditions (Fig 5B). We also observed that LigAC and LigBC seem to have similar affinities for heparin (Kd = 0. 89 +/-0. 1 μM and Kd = 0. 91 +/- 0. 1 μM, respectively) (Fig 5C). Together, the above results suggest that there is significant overlap of the heparin and C4BP binding sites on LigA and LigB and that these shared binding regions include Big domains 7 and 8 from both leptospiral proteins. To further characterize the nature of the interaction of C4BP with LigA, LigB and LcpA, binding assays were performed using different concentrations of NaCl from 50 mM to 600 mM. As shown in Fig 6, the amount of LigAC and LigBC bound to C4BP is decreased by 45% at 150 mM NaCl while the amount of LcpA bound to C4BP decreased only 30% under these conditions. These results suggest that the interaction between C4BP and recombinant LcpA, LigAC and LigBC have a significant ionic component. The complement system plays an important role in the innate and acquired immune responses, contributing to pathogen elimination. In 1955, Lawrence published one of the first studies about the role of complement activation in leptospiral infection, concluding that complement does not contribute to leptospiral killing [36]. However, in the 1960s, Johnsons published a series of three studies showing that complement plays an important role in leptospiral infection and demonstrated that saprophytic leptospires are more susceptible to lysis mediated by the complement system than pathogenic leptospires [37–39]. Since then, several groups worldwide have been interested in understanding the immune evasion mechanisms acquired by pathogenic strains of leptospires. In 2005, Meri and colleagues [40] showed that FH maintains its regulatory activity when bound to pathogenic leptospires, but does not bind to saprophytic leptospires. A variety of pathogens bind to complement inhibitors to evade complement system activation: relapsing fever spirochete Borrelia recurrentis binds to FH [41], C4BP [41] and C1 inhibitor [42] and Neisseria gonorrhoeae [43–44], Streptococcus pyogenes [45–46], Haemophilus influenza [47–48], Moraxella catarrhalis [49–50], Bordetella pertussis [51–52], Escherichia coli [53–54] and Pasteurella pneumotropica [55] interact with C4BP and FH. Not only bacteria, but also fungi have been shown to interact with C4BP, for example, Candida albicans[56] and Aspergillus[57]. In 2009, our group was the first to describe the interaction of C4BP with pathogenic leptospires and to show that C4BP bound to the leptospire surface is able to interact with and cleave C4b, regulating complement system activation [58]. LigA and LigB are multi-functional molecules closely associated with host infection and capable of inducing specific antibody responses [59–61]. We have previously identified three L. interrogans surface proteins that bind to C4BP: LcpA, LigA and LigB [15,16]. In the present study, we mapped the binding sites of these proteins on the C4BP molecule using C4BP mutants lacking single CCPs of the α-chain. We observed that CCP4, CCP7 and CCP8 domains of C4BP α-chains are important for the interaction with LigAC and with intact L. interrogans whereas only CCP7 and CCP8 interact with purified LigBC and LcpA proteins, as summarized in Fig 7. Since the C4b binding site on C4BP is located on α-chain domains CCP1, CCP2 and CCP3 [28], C4BP bound to Leptospira probably retains cofactor activity. Such a strategy may help these spirochetes to regulate and inhibit the activation of the classical and lectin pathways inside the host. The same C4BP domains interact with Streptococcus pnemoniae [62], Salmonella [63], Yersinia [64], and Haemophilus influenzae [65]. Surprisingly, the interaction of C4BP with LigBC and with the leptospiral surface was increased in the presence of C4BP lacking CCP1 α-chain (Fig 2). One possible explanation is that C4BP lacking CCP1 may more easily adopt specific conformational states that yield tighter interactions with the leptospiral surface or LigBC. However, additional studies on the C4BP structure will be necessary to address this hypothesis. It is worth to mention that unexpected results have been also observed with Porphyromonas gingivalis, which display a stronger interaction with C4BP lacking CCP3 or CCP5 [66]. Next, we pinpointed the regions of LigA and LigB proteins capable of binding to C4BP. The conserved N-terminus region of LigA and LigB proteins does not interact significantly with C4BP compared to the C-terminus of LigA (LigAC) and LigB (LigBC) (Fig 3). Using a series of tandem Big domain constructs of Lig proteins, we observed that LigA7-8, LigA9-10 and LigA10-11 and LigB7-8, LigB9-10 and LigB11-12 are the main binding sites for C4BP on LigAC and LigBC, respectively. Several studies have used LigA and LigB constructs in order to map the regions of interaction with extracellular matrix components. Elastin and human tropoelastin bind to LigB7-8, LigB9 and LigB12 [11] while fibronectin binds to LigA7-8, LigA10, LigA11, LigA12, LigA13, LigB7-8, LigB9 and LigB12 domains [9,67]. So, it seems that one ligand may have multiple binding sites on LigA and LigB proteins. Unlike elastin, human tropoelastin and fibronectin, C4BP is not able to bind to recombinant fragments containing a single Big domain derived from LigA or LigB proteins. Although the binding sites of Lig proteins and heparin on the C4BP molecule do not overlap, binding of LigAC and LigBC to C4BP was inhibited by this highly sulphated glycosaminoglycan (Fig 4A) and we observed that both leptospiral proteins directly interact with heparin (Fig 4B). Using a series of tandem Big domain constructs of Lig proteins, we also observed that heparin binds preferentially to LigA7-8 and LigB7-8 (Fig 5A) and that heparin can inhibit the binding of LigA7-8, LigA10-11, LigB 7–8 and LigB9-10 fragments to C4BP (Fig 5B). Whether this inhibition is due to heparin binding to Lig proteins or to heparin binding to C4BP is not yet clear. However, since heparin´s interaction with C4BP may be stronger than its interaction with LigA and LigB we cannot rule out the possibility that heparin bound to C4BP CCPs 1–3 could interfere with or modify the binding of LigAC and LigBC to C4BP CCP4,7 and 8 by way of an allosteric mechanism. To date we still lack an efficient vaccine that protects people from different continents against leptospirosis. Lig proteins, notably LigA [13], have been shown to be the best vaccine candidates described so far. Unfortunately, they are not able to confer sterilizing immunity. A combination of different antigens, including Lig proteins, may eventually constitute an ideal vaccine against human leptospirosis. Understanding which regions of LigA and LigB are involved in the interactions with host´s complement regulators, such as C4BP, may contribute to the development of a human vaccine against the disease.

Title: Fine Mapping of the Interaction between C4b-Binding Protein and Outer Membrane Proteins LigA and LigB of Pathogenic Leptospira interrogans Summary: Leptospirosis is a neglected infectious disease of public health significance. It is one of the most important zoonosis worldwide, affecting at least 500,000 people each year of which approximately 10-20% of cases are fatal. Most of the cases occur in tropical developing countries which lack proper sanitation facilities. The complement system plays an important role to control this infection and pathogenic leptospires developed several strategies to escape from this system, for example, binding to complement regulatory proteins such as C4b binding protein (C4BP). In this work, we fine mapped the C4BP domains important for this evasion. We also mapped C4BP interactions with LigA and LigB, two surface proteins present in all pathogenic leptospires. The available leptospirosis vaccines are based on region-specific serovars and are not very protective. Consequently, the search of better vaccines is necessary and Lig A and Lig B represent promising vaccine candidates to immunize people worldwide. We believe that deeply understanding the interactions between C4BP with LigA and LigB could open new perspectives for immunotherapy and development of new drugs to be used during the first days of infection, when the production of specific antibodies is still low and the complement system plays an important role to control this infection.

lay_plos

en

Summarize: Background Approximately 8,500 projects that have been financed with Federal Housing Administration (FHA)-insured mortgages are also supported by project-based Section 8 housing assistance payments contracts. In 1996, a HUD contractor estimated that for approximately 63 percent of these multifamily projects, the rents are higher than those of comparable unassisted rental units in the same housing rental market, which increases the costs of the Section 8 program to the federal government. However, if the Section 8 assistance is reduced, owners of many of the FHA-insured housing projects are likely to default on their mortgage payments, resulting in substantial claims to the FHA General Insurance Fund. In addition to the cost of insurance claims, defaults on mortgage payments could leave tenants without adequate affordable housing. The original project-based Section 8 contracts that were entered into in the 1970s and 1980s were typically for 15, 20, or 40 years and began expiring in the early 1990s. The Congress and HUD have worked together to renew expiring contracts for 1 year. As its long-term Section 8 contracts expire and its 1-year contracts are renewed annually, HUD estimates that its annual renewal costs will increase steadily. For example, HUD estimated that if no actions were taken, the annual cost of renewing project-based Section 8 contracts would rise to over $7 billion—or approximately one-third of HUD’s current total budget—by 2007. To address these escalating costs, the Congress appropriated $30 million to conduct a mark-to-market demonstration program in fiscal year 1996. This demonstration was intended to test various methods of restructuring the financing of insured Section 8 properties, generally by adjusting rents to market levels and reducing the mortgage debt to reflect any decline in net operating income resulting from the rent adjustment. Near the end of fiscal year 1996, the Congress repealed the demonstration program but authorized a new demonstration for fiscal 1997. To deal with Section 8 contract expirations occurring in fiscal year 1999 and thereafter, the Congress legislated a permanent mark-to-market program in October 1997. This legislation also extended the fiscal year 1997 demonstration program through fiscal 1998 with modifications as a transitional program while HUD developed regulations to implement the permanent program. The intended goals of the permanent mark-to-market program are to reduce the costs of expiring Section 8 contracts, address financially and physically troubled projects, correct management and ownership deficiencies, and preserve the affordability and availability of low-income rental housing. (See app. I for an overview of the mark-to-market process.) The act directed HUD to select capable entities to carry out restructuring under the mark-to-market program on behalf of the federal government. These entities are referred to as participating administrative entities (PAE). Entities eligible to apply to become PAEs include public agencies, such as state housing finance agencies, local housing agencies, nonprofit organizations, and these entities in partnership with each other or with private entities. The act specifies selection criteria such as experience in working directly with tenant organizations and other community-based organizations; experience with multifamily housing financing and restructuring; a history of stable, financially sound, and responsible administrative performance; and financial strength. Staffing and Organizational Decisions Not Final Because of Delays in Appointing an OMHAR Director The act established OMHAR as an entity within HUD and required the Office to be under the management of a presidentially appointed and Senate-confirmed Director. Section 572(a) of the act specifies that not later than 60 days after its enactment (Oct. 27, 1997), the President should submit a nomination for the Director for OMHAR to the Senate. However, the Director was not nominated until September 29, 1998. The Senate confirmed the nomination on October 21, 1998. The act authorizes the Director to hire personnel to carry out OMHAR’s functions. However, because the Director was not appointed until October 21, 1998, HUD staff began formulating organization and staffing plans for OMHAR in the Director’s absence. HUD anticipates very targeted hiring of staff for OMHAR with expertise to carry out critical policy development, oversight, and decision-making functions. Section 574(a),(b) of the act allows the Director to pay OMHAR’s employees (1) without regard to certain provisions of pay schedules used to hire most federal employees and (2) comparably to the officers and employees of the Federal Deposit Insurance Corporation. In effect, this authority allows the Director to compensate OMHAR employees at a higher level than other HUD employees to obtain the skills and expertise needed to accomplish the program’s purposes. HUD plans to hire these staff in phases. OMHAR will have approximately 75 to 85 staff at its peak; however, this number may increase if additional hiring authority is obtained. Some HUD personnel are expected to be detailed to OMHAR, but according to mark-to-market officials, most will be hired from outside HUD. For the first quarter of fiscal year 1999, the 10 existing HUD staff working on the mark-to-market program will be detailed to OMHAR and additional support will be provided by HUD staff with collateral assignments. HUD envisions that these senior core staff will be assisted by 10 staff hired for 1-year terms. HUD intends on hiring additional staff with 4-year terms in three phases—at the end of October and December 1998 and the end of February 1999. Of the 75 additional staff expected to be hired during fiscal year 1999, approximately 15 will be distributed among five HUD field offices, and the remainder will be located in headquarters. Because mark-to-market is a relatively short-term effort—authority for both the program and OMHAR terminates on September 30, 2001—HUD plans to focus staff resources on inherently governmental functions and will generally not hire internal staff to carry out commercial functions that are readily obtainable through private-sector vendors. Instead, HUD expects to obtain capacity for such functions through contracts to support internal staff. While HUD’s plan to oversee the contractors is not yet final, HUD anticipates having several staff dedicated to managing the contractors. These staff would include the chief of a newly created office of contracts, compliance, and controls; three contract analysts/government technical representatives; a records management analyst; two internal review specialists; and a clerical support staff member. Figure 1 illustrates OMHAR’s proposed organizational structure. Housing experts involved with mark-to-market issues, including representatives of advocacy groups, whom we contacted were concerned that a Director of OMHAR had not yet been appointed at the time of our discussions. For example, one representative was concerned that the delay in the Director’s appointment limited the Director’s opportunity to participate directly in developing the program’s regulations. In addition, according to some representatives, the delay in appointing the Director and implementing the program sent a negative message to stakeholders about the administration’s support of the program. In response to this concern, HUD mark-to-market officials said that the administration has been supportive of the program and has provided access to any resources necessary to prepare for its implementation. HUD Has Made Progress in Preparing for Mark-To-Market Program, but Some Key Tasks Are Behind HUD’s Original Schedule As mandated in the act, HUD is required to implement the mark-to-market program for Section 8 contracts expiring in fiscal year 1999 (beginning Oct. 1, 1998) and thereafter. Despite delays in hiring a management studies contractor and a voluminous number of tasks to complete, HUD has made considerable progress toward this end. For example, HUD has published interim regulations for the mark-to-market program and is expecting to develop an operating procedures manual and to select its partners (the PAEs) to perform the restructurings in October 1998. However, in spite of HUD’s efforts, some of these tasks either have been or will be completed behind their original schedule. For example, in May 1998, HUD had planned to issue the program’s interim regulations by August and to have final regulations in place by October 1998. Now, HUD expects to have only the interim regulations in place by October 1998. Final regulations are to be developed 3 months after the OMHAR Director’s appointment. Also, while HUD originally planned to begin briefing PAEs on their responsibilities in September 1998, because of delays in selecting the PAEs, briefings are not scheduled to begin until October. Of eight key tasks, such as preparing briefing manuals and conducting technical assistance briefings for field office staff, HUD had completed one as of September 8, 1998, the most recent date for which this information was readily available. The remaining seven were in progress, although three of these were behind HUD’s original schedule. Appendix II provides a more detailed description of HUD’s progress in carrying out eight key tasks needed to implement the mark-to-market program. In addition to the operational tasks that HUD must perform, the act places some reporting and other requirements related to the mark-to-market program on HUD. For example, the act requires the OMHAR Director to report certain information to the Secretary of HUD and for the Secretary to submit information on OMHAR’s operations to the Congress and the Office of Management and Budget. (See app. III for information on the mark-to-market reporting requirements.) The act also requires that prior to issuing final regulations, HUD seek recommendations on the implementation of the mark-to-market program from individuals and organizations affected by the program and convene at least three public forums so that those individuals and organizations can express their views concerning the proposed disposition of the recommendations. This requirement is discussed in greater detail later in this report. While most representatives of the groups involved with mark-to-market issues whom we contacted were generally complimentary of mark-to-market officials’ efforts to implement the program, many expressed concerns about the delays HUD has experienced in issuing the program’s regulations and soliciting and selecting its administrative partners. For example, there were concerns that the delay in publishing the interim regulations could limit the time that affected parties have to review and comment on them before they become effective and that entities that are eligible to serve as PAEs might not be able to develop a sufficient understanding of the regulations before having to decide if they want to participate in the program. According to HUD mark-to-market officials, the public will have 45 days to comment on the interim regulations, which they believe is a sufficient amount of time. Although the regulations become effective 30 days after publication, which will be before the end of the comment period, these officials said that the comments received will be considered in developing the program’s final regulations. Furthermore, these officials said that the published notice soliciting PAEs contains an adequate description of the scope of work for entities to decide whether they want to participate. HUD’s Procedures to Oversee Mark-To-Market Program’s Implementation Are Under Development Because HUD is responsible for establishing effective management controls over the program’s implementation, the HUD officials developing the mark-to-market program were establishing or planning several procedures and systems to oversee its implementation. However, as of October 14, 1998, most of these procedures and systems were not yet in place, and many of the related details remained to be developed. HUD Is Developing Controls Over Program Operations and Compliance Among other things, management controls can include (1) controls over program operations, which are policies and procedures that management implements to reasonably ensure that a program meets its objectives, and (2) controls over compliance with laws and regulations, which are policies and procedures to reasonably ensure that resources are used consistent with laws and regulations. Because many of the functions necessary under the mark-to-market program will be carried out by the PAEs rather than by HUD, it will be particularly important for HUD to establish procedures ensuring that all the parties involved are carrying out their responsibilities in ways that meet the program’s objectives and are in compliance with the program’s requirements. To its credit, HUD has focused on developing oversight procedures prior to the program’s implementation. In general, to oversee the operations of the HUD field offices and PAEs in the mark-to-market program, HUD is developing a plan for centralized review and oversight. Within its general oversight system, HUD has either developed or is planning three key components to help ensure that field offices and PAEs carry out the program in a way that meets its objectives and is in compliance with requirements: (1) performance measures to judge the effectiveness of PAEs’ activities and a system of compensating PAEs, (2) an Internet-based tracking system to monitor and analyze actions taken by HUD field offices and PAEs in carrying out mark-to-market functions, and (3) an oversight and audit guide to test compliance with the program’s requirements and objectives. As of October 14, 1998, HUD was still in the process of developing all three of these components. The components and their status are presented in table 1. HUD Is Developing Procedures to Monitor Program’s Key Components In addition to the processes described in table 1 for HUD’s general oversight of field offices’ and PAEs’ performance under the mark-to-market program, HUD is responsible for monitoring several specific components of the program as they are implemented. These components include (1) screening owners and projects to determine their eligibility for restructuring, (2) setting projects’ rents, (3) determining projects’ rehabilitation needs, (4) restructuring projects’ mortgages, (5) recapturing Section 8 funds, (6) reviewing restructured properties, and (7) using technical assistance funds. As of October 14, 1998, HUD had developed procedures to oversee two of these components but was still in the process of developing oversight procedures for the other five. The program’s components and the description and status of HUD’s procedures to oversee their implementation are presented in appendix IV. Data on Completed Restructurings Are Limited, but Demonstrations Have Provided Information on Process HUD’s ability to evaluate the results of the various restructuring approaches allowed under the mark-to-market demonstration programs is limited because a relatively small number of demonstration transactions have been fully completed. The Congress authorized these demonstrations for fiscal years 1996-98 to explore approaches for restructuring the financing of and reducing the Section 8 assistance provided for properties eligible for the mark-to-market program. Despite the fact that relatively few transactions have been fully completed, HUD mark-to-market officials believe that the experience and process of carrying out the demonstrations have yielded information useful for implementing the permanent program. Demonstrations Were Established for Fiscal Years 1996-98 to Test Mark-To-Market Approaches In April 1996, the Congress passed legislation authorizing the fiscal year 1996 mark-to-market demonstration—a voluntary program. The repeal of this demonstration near the end of fiscal year 1996 did not nullify any agreements or proposals that had already been considered under the program, and HUD continued to process proposals that had been received prior to its termination. For project-based Section 8 contracts expiring in fiscal years 1997 and 1998, the Congress again authorized optional demonstration programs to explore approaches to restructuring the debt secured by these properties while minimizing adverse impacts on tenants, owners, and communities. As authorized by the legislation, restructuring transactions were performed by HUD field offices, by HUD in partnership with state and local housing finance agencies (HFA), and by HUD in joint ventures with nonprofit entities. As of October 2, 1998, the latest date for which information was readily available, HUD had executed contracts with 25 HFAs and entered into 4 joint venture agreements with nonprofit entities to restructure projects under the demonstrations. Relatively Few Demonstration Transactions Have Been Completed As of October 2, 1998, nearly 300 properties were participating in the demonstration programs. Restructuring had been completed for 42 of these properties, and all but 4 (which were processed under a joint venture arrangement) of these had been processed by HUD staff. None of the restructurings had been completed under HFA arrangements as of that date. Consequently, information that HUD could use to assess outcomes under the various restructuring approaches has been limited. Table 2 shows the number of projects participating in each component of the demonstrations and their status. Activities Under Demonstrations Have Provided Information on Mark-To-Market Process Despite the relatively few demonstration transactions that have been fully completed, according to HUD mark-to-market officials, they have used information from the demonstrations to identify, evaluate, and improve, as necessary, the processes used by HUD field offices and third parties in carrying out restructuring activities. Specifically, information from the demonstrations was used to help develop process flow charts and an operating procedures manual for the permanent mark-to-market program. These charts and the manual were compiled by mark-to-market officials, with assistance from HUD’s management studies contractor, by reviewing and documenting HUD’s policy and program requirements under the demonstrations, identifying weak policies and procedures in the process, and recommending improvements in the program’s design and delivery. In addition, a front-end risk assessment of the fiscal year 1997 demonstration program identified some concerns, which HUD mark-to-market officials told us that they had considered in establishing the permanent program. For instance, the front-end risk assessment noted that concerns over potential tax liabilities kept many owners from participating in the program, owing either to an inability or an unwillingness to handle the tax consequences or a resistance to participating until anticipated changes to the tax legislation became known. (See app. II for more information on resolution of the tax issue.) The 1997 front-end risk assessment also identified communication and the coordination of HUD’s functions as an area of concern. For instance, the risk assessment stated that HUD’s information technology staff ideally should have been involved in developing information systems for the fiscal year 1997 demonstration program earlier in the process to ensure that all departmental documentation and other information technology requirements were met. The risk assessment concluded that, in general, the program’s staff should be representative of all applicable areas of HUD or should involve appropriate personnel from the earliest stages of the process to avoid the need to substantially modify processes late in the program. According to HUD mark-to-market officials, they have applied this “lesson learned” by involving other areas within HUD’s Office of Multifamily Housing, such as Section 8 and Multifamily Claims staff, and other HUD offices, such as the Office of Policy Development and Research and the Office of General Counsel, throughout the development of the permanent program. According to mark-to-market officials, the demonstration programs also provided other information useful for working out the details of the permanent program. For instance, mark-to-market officials believe that their efforts in developing agreements with state and local HFAs laid the foundation for HFAs’ participation in the permanent program as PAEs. Similarly, issues raised by the nonprofit partners under the joint venture arrangements have been instructive as mark-to-market officials consider details and policies under the permanent program, such as issues related to adjusting rents to market levels without mortgage restructuring and the compensation structure for nonprofit partners. With respect to the lessons learned from the component of the demonstration program carried out by HUD field offices, mark-to-market officials said that they have compiled an ongoing question-and-answer document to respond to the issues raised by the field offices involved. These mark-to-market officials said that they have communicated with the field offices to discuss the advantages and disadvantages of certain approaches and to develop responses to the questions. According to these officials, this effort has assisted in developing the permanent program by giving them a better understanding of the potential effects of policy decisions on the participating field offices. HUD Has Obtained Input From Affected Parties and Developed Plans for Their Continued Involvement Under the mark-to-market legislation, HUD must establish procedures to provide an opportunity for parties affected by restructuring to participate in the process. The act also requires HUD to hold at least three public forums to obtain recommendations on the implementation of certain legislative provisions. In accordance with these requirements, HUD’s program guidance includes steps for involving affected parties in the restructuring process, and, on October 1, 1998, mark-to-market staff held the three required public forums. In addition, in preparing to implement the program, HUD has sought input from a variety of groups representing those affected by the program. Program’s Guidance Includes Opportunities for Participation by Affected Parties Section 514(f) of the act requires HUD to establish procedures to provide an opportunity for tenants, neighborhood residents, local government, and other affected parties to participate in the restructuring process. These procedures must require consultation with affected parties in connection with, at a minimum, a project’s mortgage restructuring and rental assistance sufficiency plan, any proposed sale or transfer of the project to another entity, and the rental assistance assessment plan developed to determine whether to renew the project’s Section 8 assistance with project-based or tenant-based assistance. The act further directs that, to the extent practicable and consistent with the need to accomplish the restructuring of Section 8 projects in an efficient manner, the procedures should give all such parties an opportunity to provide the PAE with comments in writing, in meetings, or in another appropriate manner. HUD has addressed this legislative requirement by outlining procedures in the program’s draft operating procedures manual for affected parties’ participation. The manual identifies several points when affected parties must be given the opportunity to participate. For instance, the manual requires a PAE to conduct at least one consultation meeting before a project’s physical needs assessment is completed. The consultation meeting is to provide the PAE with an opportunity to receive oral presentations and comments and respond to tenants’ and communities’ concerns regarding the mortgage restructuring and rental assistance sufficiency plan, the rental assistance assessment plan, and any proposed sale or transfer of the project. In addition, within 10 days of the PAE’s completion of the proposed rental assistance assessment plan, the owner must send a notice and provide an opportunity to comment to the project’s residents, a local government representative, a representative of the public housing authority, and representatives of neighborhood residents or other affected parties, as determined by the PAE. Section 514 of the act also authorized up to $10 million annually in funding for tenant groups, nonprofit organizations, and public entities for building the capacity of tenant organizations, technical assistance, and tenant services. HUD has designated a portion of these funds to enhance opportunities for affected parties to participate in the mark-to-market process through the Outreach and Training Grants (OTAG) program. Under the program, $6 million is available to provide technical assistance for tenants of eligible mark-to-market projects so that the tenants can (1) participate meaningfully in the mark-to-market program and (2) affect decisions about the future of their housing. Grant funds can be used for, among several other activities, organizing residents of eligible low-income housing so that tenants can effectively participate in the mark-to-market process. HUD Has Held Required Public Forums The act also specifically requires that, in addition to obtaining public comments before publishing the program’s final regulations, HUD seek recommendations from various parties on how it should implement the legislative provisions governing the selection of PAEs and requiring that certain Section 8 contracts be renewed as project-based assistance. To seek views concerning HUD’s proposed disposition of these recommendations, the legislation requires HUD to convene at least three public forums involving organizations representing state and local HFAs, other potential PAEs, tenants, project owners and managers, state and local governments, and mortgagees. HUD held these forums on October 1, 1998, in New York, Chicago, and San Francisco; these locations were selected because, in part, of the levels of contract expirations in these areas. However, when the forums were held, the process of selecting PAEs—one of the forum topics on which HUD was soliciting recommendations—was already under way. According to HUD mark-to-market officials, interested parties had extensive opportunities to provide input prior to the start of the PAE selection process. HUD Has Obtained Input From Affected Parties in Preparing to Implement the Program Going beyond these legislative requirements, on December 18, 1997, HUD’s Office of Multifamily Housing began a consultation process with representatives from a wide variety of national advocacy groups interested in HUD’s implementation of the permanent mark-to-market program. Organizations representing owners and managers of FHA-insured assisted housing, tenant groups, nonprofit organizations, lenders, coalitions of local and state government agencies, and other advocacy groups were invited to submit ideas and comments on developing the new program. HUD received concept papers from housing groups representing several interested parties and from February 2 through 27, 1998, held 13 full-day meetings to discuss various issues related to mark-to-market’s implementation. According to HUD mark-to-market officials, the information presented during these consultations was used in developing the mark-to-market program and considered by the Department in drafting the program’s interim regulations. In addition to the concept papers and meetings, mark-to-market officials have also coordinated separately with the National Council of State Housing Agencies and individual housing finance agencies to obtain feedback from them regarding HFAs’ involvement in the mark-to-market program. For instance, in May 1998, the mark-to-market official responsible for the HFA component of the 1997 and 1998 demonstration programs met with the Council to obtain HFAs’ views on the compensation structure for their participation in the program. According to mark-to-market officials, they have been meeting with HFAs on a continuing basis to discuss the program and hear their concerns because their involvement as PAEs is key to the program’s success. The representatives of groups involved with mark-to-market issues whom we contacted generally believed that HUD’s efforts to obtain input on the program’s implementation were productive. However, three of these representatives were concerned that, since the meetings in February, HUD had not given any indication of its tentative decisions on the issues discussed. Some of these representatives said that, without knowing HUD’s intentions prior to the Department’s publication of the interim regulations for public comment, their groups may be less able to provide meaningful input on the program’s implementation, particularly if the interim regulations govern the program for a period of time. According to HUD mark-to-market officials, it would have been inappropriate to solicit information from the public during the process of writing the regulations. Accordingly, at the meetings in February, mark-to-market officials notified participants that there would be no further discussions until the regulations were completed and that any further comments would have to be submitted during the comment period. Agency Comments We provided HUD with a draft of this report for its review and comment. HUD agreed that our report accurately described the Department’s efforts in developing and implementing the mark-to-market program. HUD stated that our review was helpful to the Department in confirming that it was focusing its attention and efforts on issues that needed to be addressed. HUD also noted that it had developed an extremely aggressive work plan to accomplish the development and implementation of the mark-to-market program and that while some key tasks were accomplished later than provided for in its original schedule, a small but efficient core group of mark-to-market staff members have accomplished several significant work items, even in the absence of a Director. HUD suggested some minor technical changes, which we have incorporated. The complete text of HUD’s comments appears in appendix V. Scope and Methodology Section 577 of the act requires us to audit the operations of OMHAR annually for the first 2 fiscal years following the date of enactment (Oct. 27, 1997). For this assignment, our work focused on the status of OMHAR’s development and HUD’s plans for implementing the permanent mark-to-market program. To carry out the assignment’s objectives, we interviewed the HUD officials responsible for mark-to-market operations and reviewed documentation related to their plans for developing OMHAR and implementing the program, including their work plans, time frames, and draft program guidance. We also discussed HUD’s efforts to develop OMHAR and prepare for the program’s implementation with representatives of groups involved with issues related to mark-to-market, including two independent housing consultants, the National Council of State Housing Agencies, the National Leased Housing Association, the National Housing Law Project, the National Alliance of HUD Tenants, and the National Housing Conference. Because OMHAR was not yet established and HUD’s plans for implementing the permanent mark-to-market program were still being developed, we did not attempt to evaluate the effectiveness of OMHAR’s operations or HUD’s implementation plans. We performed our work at HUD in Washington, D.C., from March through September 1998 in accordance with generally accepted government auditing standards. We are sending copies of this report to the Secretary of Housing and Urban Development. We will make copies available to others on request. Please call me at (202) 512-7631 if you or your staff have any questions. Major contributors to this report are listed in appendix VI. Overview of the Mark-To-Market Process As the Department of Housing and Urban Development (HUD) plans to implement it, the process to be used under the permanent mark-to-market program has nine phases: (1) screening owners and projects for eligibility, (2) assigning projects for restructuring, (3) preserving affordable housing, (4) collecting data, (5) underwriting, (6) approving the loan, (7) closing, (8) distributing postclosing documents, and (9) servicing and monitoring. This appendix describes the key activities that are to occur during each of the nine phases, as outlined in HUD’s draft operating procedures manual. 1. Screening Owners and Projects for Eligibility: The first phase of the restructuring process is determining a project’s eligibility. To be eligible to participate in the mark-to-market program, a project must be financed by a Federal Housing Administration (FHA)-insured or Secretary-held mortgage, receive project-based assistance, and have rents that exceed comparable market rents. HUD has established additional criteria for determining if a project is eligible to (1) renew its Section 8 contract at market rents and restructure the project’s debt, (2) renew its Section 8 contract at market rents without restructuring the project’s debt, or (3) renew its Section 8 contract at the lesser of the project’s current rents with an operating cost adjustment factor, budget-based rents with an operating cost adjustment factor, or base rents with an operating cost adjustment factor. HUD will extend the Section 8 contracts for projects with contracts that are due to expire while they are in the mark-to-market “pipeline,” such as projects undergoing eligibility determinations, or while they are participating in the development of a mortgage debt restructuring plan. Under these circumstances, a project’s Section 8 contract may be extended at the project’s current contract rent for up to 9 months, with the option of a further extension of 3 months. A project may not be restructured, and its contract may not be renewed if its owner has engaged in material adverse financial or managerial actions or omissions with regard to the project or other federally assisted, financed, or insured projects. Furthermore, a project may not be restructured if its condition is too poor to be rehabilitated at a reasonable cost or if the owner fails to comply with the requirements for restructuring. Such projects are to be directed into HUD’s enforcement program. 2. Assigning Projects for Restructuring: During the second phase of the mark-to-market process, HUD assigns multifamily projects to its administrative partners, who will actually perform the restructuring, which are referred to as participating administrative entities (PAE). Assets are first assigned to state and local housing finance agencies (HFA) that HUD has selected as PAEs. After this first round of assignments, non-HFA entities that HUD has selected to be PAEs can bid for the rights to restructure projects that remain. 3. Preserving Affordable Housing: One of the goals of the act is to preserve the affordability and availability of low-income rental housing through mortgage restructuring. As part of the restructuring process, a mortgage restructuring and rental assistance sufficiency plan is to be developed for each project. The development of this plan is expected to take, on average, 9 months. One element of the mortgage restructuring and rental assistance sufficiency plan is a rental assistance assessment plan, which the PAE develops to determine whether Section 8 assistance should be renewed as project-based or tenant-based assistance. The plan must also include a use restriction whereby the project’s owner agrees to maintain affordability for at least 30 years. Other elements required in the mortgage restructuring and rental assistance sufficiency plan, which will be developed in later phases, include a new rent subsidy level, a plan to restructure the debt, and a plan to finance the rehabilitation needs of the project. 4. Collecting Data: During the fourth phase of the process, the PAE collects and assesses project-specific data from project owners, lenders, servicers, or other third parties to be used during the underwriting and loan approval phases. The PAE is also to collect and analyze market studies, appraisals, and physical needs assessments to determine market rents, expenses, and the projects’ rehabilitation needs. 5. Underwriting: Once the data collection is complete, the fifth phase in the mark-to-market process is underwriting. During the underwriting phase, the size of the restructured first and the new second mortgage will be determined. The existing project mortgage will be restructured to provide a first mortgage that is sustainable at restructured market rents. The second mortgage may not exceed the difference between the restructured or new first mortgage and the current unpaid principal balance and must be an amount that can reasonably be expected to be repaid. The term of the second mortgage shall equal the term of the first mortgage. However, the only payments that need to be made on the second mortgage before repayment of the first are an amount equal to 75 percent of excess project income. 6. Approving the Loan: The sixth phase of the process is the loan’s approval. It is in this phase that the PAE reviews the mortgage restructuring and rental assistance sufficiency plan to ensure that all required HUD forms have been filled out completely and accurately and then delivers the plan to the OMHAR hub for approval.7. Closing: After the OMHAR hub grants approval of the plan, the seventh phase of the process is loan closing. Closing is the phase during which HUD, the PAE, the owner, and affected lenders or servicers fulfill the legal requirements for (1) executing the mortgage restructuring and rental assistance sufficiency plan, (2) restructuring the project’s debt, and (3) renewing the project’s Section 8 contract. 8. Distributing Postclosing Documents: During the eighth phase of the process, the postclosing documents are distributed to the parties (such as servicers, asset managers, and Section 8 contract administrators) who are responsible for loan servicing and asset management functions after restructuring. 9. Servicing and Monitoring: The ninth phase is loan servicing and monitoring. During this phase, servicers, asset managers, escrow agents, Section 8 contract administrators, and monitors have responsibilities to oversee the loans. The servicers of the first and second mortgages are responsible for the cash management function, which includes billing and collecting payments, and accurately accounting for and reporting payments. The asset managers of the first and second mortgages are responsible for ensuring that the underlying collateral is maintained in decent condition. The asset managers of the second mortgage are also responsible for ensuring that only eligible expenses have been deducted from project revenue to maximize excess project income, which can be used to pay off the second mortgage. The escrow agents are responsible for managing the accounts that will be used to finance the immediate rehabilitation needs of the projects, identified through the restructuring process. The Section 8 contract administrators are responsible for ensuring that the projects are maintained in decent, safe, and sanitary conditions by the projects’ owners. Monitors, referred to as restructuring use agreement monitors, are responsible for ensuring that the owners or future purchasers of the projects maintain the affordability and use restrictions agreed to during the restructuring process. Summary and Status of Operational Tasks Needed to Implement the Mark-To-Market Program Issue interim and final regulations To implement the mark-to-market program. The final regulations are required to be issued by the later of October 27, 1998, or 3 months after the Director of OMHAR has been appointed (§522(a)(1)(2)). Behind original schedule. The interim regulations were published September 11, 1998, and became effective 30 days later. HUD had originally expected to issue the interim regulations by August 1998 so that the final regulations could be issued in October 1998. According to mark-to-market officials, now the final regulations are not expected to be published until 3 months after the appointment of the OMHAR Director. To allow HUD to work with PAEs, which will actually restructure the mortgages and rental assistance payments of eligible multifamily projects (§513(a)(1)). Behind original schedule. HUD published the Request for Qualifications (RFQ) to solicit PAEs on August 17, 1998. HUD had originally planned to publish the RFQ in June 1998 in order to have the PAEs selected by August 1998. HUD will select the PAEs in two phases and, as of September 8, 1998, expected to complete the selection process by October 29, 1998. To familiarize the PAEs with the restructuring process and their responsibilities, which include determining owners’ eligibility, determining rent levels, restructuring loans, underwriting new or modified loans, managing the closing process, distributing documents after closing, and servicing the loans. Behind original schedule. The briefing sessions for PAEs will begin in October 1998. HUD had originally planned to begin briefing the PAEs in September 1998. To set forth a uniform process for restructuring FHA-insured Section 8 projects. As of September 8, 1998, the operating procedures manual was in draft form, but sections of the draft were expected to be ready for departmental clearance by September 11, 1998. (continued) To establish the obligations and requirements of the PAEs in developing mortgage restructuring and rental assistance sufficiency plans in accordance with the act (§513(a)(1)). Also, to identify the eligible multifamily housing projects for which a PAE is responsible and to clarify the duties that a PAE will typically perform. HUD will enter into portfolio restructuring agreements with the PAEs as soon as possible after they are selected. However, the time period for completing this process will depend on the length of time involved in negotiating the agreements. To instruct the field offices on their responsibilities, which include coordinating the flow of cases to PAEs and Section 8 contract administrators, determining projects with Section 516 violations that require enforcement action, and monitoring the performance of the PAEs. As of September 8, 1998, HUD expected the briefing manuals to be completed by the end of September, so that the briefing sessions could commence in October 1998, after the PAEs are selected. To obtain a favorable tax ruling regarding potential tax consequences for project owners whose mortgages are restructured. In late 1997, HUD initiated discussions with the Treasury Department to obtain a ruling on the proper income tax treatment of the components of the mortgage refinancing contemplated in section 517(a) of the act, which provides for a restructured or new first mortgage that is sustainable at market rents and a second mortgage that is an amount equal to the difference between the restructured first mortgage and the indebtedness under the existing insured mortgage. The act specifies that interest charged on the second mortgage cannot exceed the applicable federal rate (AFR). Since (1) section 7872 of the Internal Revenue Code, in general, defines a below-market loan as any loan on which the interest rate charged is less than the AFR and (continued) (2) section 7872(b) provides that the borrower of a below-market term loan is to be treated as having received cash from the lender in an amount equal to the excess of the amount loaned over the present value of all payments required under the loan, the ruling was required to determine if a project’s owner, whose second mortgage bears interest below the AFR, would be responsible for paying taxes on this amount. In August 1998, IRS ruled on this request, holding that the second mortgage loans made in accordance with the Multifamily Assisted Housing Reform and Affordability Act of 1997 are exempt from section 7872 of the Internal Revenue Code. In the ruling, IRS concluded that the legislative history of section 7872 indicates that most government-subsidized loans, such as government-insured residential mortgage loans, were intended to be exempted from section 7872 and that the factors justifying an exemption of second mortgages under the 1997 act were similar to the factors justifying the exemption of government-subsidized loans. Furthermore, IRS concluded that the interest arrangements of the second mortgage loans were not structured with a principal purpose of avoiding federal tax. To identify risks related to fraud, waste, and abuse of federal resources and to document both the existing program controls and management’s plans for implementing additional controls that mitigate the identified risks. HUD received proposals in response to the Request for Contract Services for the FERA on August 17, 1998. As of September 8, 1998, review of these proposals was complete, and the contract was expected to be awarded by September 11, 1998. The FERA was expected to be finished 60 days after the selection of a contractor. (Table notes on next page) Briefing sessions will be held for staff in the five OMHAR hubs. In addition, HUD scheduled a session for October 6, 1998, to discuss the Section 8 renewal policy with field office staff in its multifamily program centers and multifamily hubs. Summary of HUD’s Reporting Requirements for the Mark-To-Market Program The Multifamily Assisted Housing Reform and Affordability Act of 1997 (MAHRAA) requires the OMHAR Director to report certain information to the Secretary of HUD and requires the Secretary of HUD to submit information on OMHAR’s operations to the Congress and the Office of Management and Budget. Table III.1 provides a summary of the reports required by the legislation and the status of actions taken by HUD. For these mandated reports, it is HUD’s interpretation of the act that the reporting requirements become effective once the permanent mark-to-market program is operational. The table also includes information on three other required reports: one on equity-sharing partnerships and the two others on demonstration program activity. As the table shows, HUD is in the process of issuing a report on the possible ways that equity-sharing partnerships may be used as options in implementing the mark-to-market program and has submitted reports on the 1996 and 1997 demonstration programs. Table III.1: Summary of HUD’s Reporting Requirements for the Mark-To-Market Program OMHAR’s Director must submit a report to the Secretary of HUD regarding the activities, determinations, and actions of the Director. Semiannually (§573(b)) According to HUD’s interpretation of the act, this report will be initiated once the OMHAR Director is in place. The Secretary of HUD must report figures to the Congress identifying (1) each project for which the participating administrative entity has developed a rental assistance plan that determines that the tenants generally supported tenant-based assistance but under which the assistance was renewed with project-based assistance and (2) each project for which the participating administrative entity has developed a plan under which the assistance is renewed as tenant-based assistance. Semiannually, starting April 27, 1998, for 2 years and annually thereafter (§520(b)) According to HUD’s interpretation of the act, this reporting requirement becomes effective once the permanent mark-to-market program is operational, by the later of October 1998 or appointment of the OMHAR Director. To ensure compliance with the legislation, the Secretary of HUD must conduct reviews and report to the Congress on actions taken under the legislation and on the status of eligible multifamily housing projects. Annually (§520(a)) According to HUD’s interpretation of the act, this reporting requirement becomes effective once the permanent mark-to-market program is operational, by the later of October 1998 or appointment of the OMHAR Director. The Secretary of HUD must submit a copy of the financial operating plans and forecasts for OMHAR to the Office of Management and Budget. These annual plans and forecasts are supposed to be included in the federal budget and in HUD’s congressional justifications for each fiscal year. Annually, before the beginning of each fiscal year (§575(a)) HUD is planning to prepare this report for the beginning of fiscal year 1999 to be included in the federal budget for fiscal year 2000 and HUD’s congressional justifications. (continued) The Secretary of HUD must submit a report on the results of OMHAR’s operations to the Office of Management and Budget. Quarterly and at the end of each fiscal year (§575(b)) HUD is planning to prepare this report for the beginning of fiscal year 1999 to be included in the federal budget for fiscal year 2000 and HUD’s congressional justifications. The Secretary of HUD must submit a report to the Congress on possible ways that equity-sharing partnerships may be used as options in implementing the mark-to-market program if the prohibition is lifted. February 15, 1998 (directed by the conference report of P.L. 105-65) As of September 8, 1998, this report was circulating through the Department for concurrence and signature. In their formal comments on our report draft on October 2, 1998, HUD officials said that the internal clearance of the equity-sharing report had been completed and letters transmitting the report to the Congress were being prepared. The Secretary of HUD must submit reports to the Congress describing and assessing the status of the projects in the demonstration programs. Semiannually for the 1996 demonstration (P.L. 104-134, §210(g)); quarterly for the 1997 and 1998 demonstrations (P.L. 104-204, §212(m)(1)(A)) HUD issued reports for the 1996 and 1997 demonstrations through the fourth quarter of 1997. HUD submitted the last report, covering demonstration program activities through the fourth quarter of fiscal year 1997, on March 28, 1998. The Secretary of HUD must submit a final report on the demonstration programs upon their completion. Not later than 6 months after the end of the demonstration program (P.L. 104-134, §210(g); P.L. 104-204, §212(m)(1)(B)) HUD is planning to prepare these reports for the 1996 and 1997 demonstration programs. As of September 8, 1998, HUD was in the process of updating its data to obtain the information needed for these reports. HUD’s Procedures for Monitoring Key Components of the Mark-To-Market Program Explanation or related legislative provision(s) —It must have rents that, on an average per-unit or per-room basis, exceed the rents of comparable properties in the same market area. —It must have a HUD-insured or HUD-heldmortgage. HUD field offices initially screen projects to determine their eligibility on the basis of information provided by the owners, field office staff, third-party appraisers working for the field offices, and HUD’s Assessment and Enforcement Offices. Field offices are to make their screening determinations on the basis of legislative criteria, which are identified in HUD’s mark-to-market draft operating procedures manual. Field offices assign eligible projects to OMHAR, which will then assign the projects to PAEs for further processing. For projects with contract rents below the owners’ estimate of market rents, field offices are to review the owners’ estimate, based on their knowledge of the market area. Assistance from HUD appraisal staff or a third-party review should be obtained if there is any doubt as to the actual market rents. —Directors in HUD’s multifamily restructuring, a project must meet certain legislatively mandated criteria, including the following: hubs and program centers are required to authorize, by signature, the initial eligibility determination for each project. —It must consist of more than four dwelling units. —For projects identified as having below-market rents, field office supervisory review is required to confirm that contract rents are actually below market. —It must receive project-based Section 8 assistance. —For projects identified as potentially ineligible because of poor condition or adverse owner determination, the field offices and/or PAEs must recommend potential remedies to OMHAR; OMHAR makes determinations regarding whether to assign such projects to PAEs for restructuring or to deny the owners the right to restructure. In addition, under the legislation, a project is ineligible for restructuring if —the owner has engaged in material adverse financial or managerial actions or omissions or —Owners have 30 days to dispute decisions of the field offices regarding project eligibility with respect to poor condition or adverse owner determination. At the end of this period, OMHAR may affirm, modify, or reverse decisions. —the property is in poor condition that cannot be remedied in a cost-effective manner. HUD is to establish an administrative review process to appeal any final decision regarding rejection of an owner or project for restructuring. (§512(2), 516(a), 516(b)(2)(C)) (continued) Explanation or related legislative provision(s) The PAE, in consultation with the owner, determines whether to renew Section 8 assistance as project-based or tenant-based. On the basis of its assessment of comparable rents and input from an appraiser and the project owner, the PAE also determines restructured rent levels. If the PAE determines that a project would have negative net operating income at market-level rents, the PAE may issue a “Finding of Special Need” and calculate exception rents for the property. —After the PAE, in consultation renewed as either project-based or tenant-based. —Project-based renewals are mandatory for projects located in tight rental markets, that have a predominant number of units occupied by the elderly or disabled, or that are held by a nonprofit cooperative ownership housing corporation or trust. with the owner and lender, develops the draft mortgage restructuring and rental assistance sufficiency (MRRAS) plan for a project, including the determination of project-based or tenant-based Section 8 assistance and the restructured rent levels, the OMHAR hub must review the draft plan and will either approve or reject it. Restructured rents are to be based on equivalent market rents charged for at least two comparable properties in the same market area. If rents based on two comparable properties cannot be determined, rents can be set equal to 90 percent of the fair market rent (FMR). —According to mark-to-market officials, oversight of the exception rent authority is being worked on and will be addressed in the oversight and audit guide, which was still being developed as of October 14, 1998. —PAEs can approve exception rents up to 120 percent of FMR for no more than 20 percent of all units covered by the portfolio restructuring agreement between the PAE and HUD with contracts that expire in a fiscal year.(§515(c)(1), 515(c)(2)(A), 514(g)(1), 514(g)(2)) (continued) Explanation or related legislative provision(s) The owner or purchaser of a project must evaluate its rehabilitation needs and take actions as necessary to rehabilitate and maintain the project in decent, safe condition. The PAE, with support from a qualified inspector, must review the owner’s evaluation and conduct an independent assessment of the project’s rehabilitation needs. The PAE is ultimately responsible for determining the rehabilitation actions necessary to maintain the project in decent and safe condition, for determining their cost, and for identifying the source(s) of funding. HUD can delegate to state and local governments the responsibility for administering capital grants. —The PAE must submit a draft project must be evaluated. Rehabilitation may be paid from project accounts not required for project operations, increases in budget authority for Section 8 assistance contracts, capital grants, or through the debt-restructuring transaction. mortgage restructuring and rental assistance sufficiency plan, which includes the determination of a project’s rehabilitation needs, to the OMHAR hub. The OMHAR hub must review the draft plan and will either approve or reject it. —HUD may make grants for the capital costs of rehabilitation to owners of projects if the owners demonstrate that capital grant assistance is needed for rehabilitation of the projects and that project income is not sufficient to support such rehabilitation. —According to mark-to-market officials, details on capital grants will be generally discussed in the operating procedures manual. Instructions for the oversight of the grant funds will be addressed in the oversight and audit guide, which was still being developed as of October 14, 1998. Rehabilitation will be only for the purpose of restoring the project to a nonluxury standard adequate for the rental market intended at the original approval of the project-based assistance. Each owner or purchaser of a project to be rehabilitated under mark-to-market must contribute, from nonproject resources, at least 25 percent of the amount of rehabilitation assistance received. (§514(e)(3), 517(b)(7), 531) (continued) Explanation or related legislative provision(s) The PAE, in consultation with the owner and lender, determines the size of the restructured first mortgage and second mortgage. —a second mortgage no greater than the difference between the restructured or new first mortgage and the indebtedness under the existing mortgage, in an amount that can reasonably be expected to be repaid. The PAE submits the project’s mortgage restructuring and rental assistance sufficiency plan, which includes the PAE’s conclusions regarding the new first mortgage and second mortgage, to the OMHAR hub. Depending upon the details of the MRRAS plan, the OMHAR hub will perform either an administrative review or a technical review, after which it can accept or reject the plan. The size of a project’s restructured first mortgage and second mortgage must be determined. (§517(a)) HUD will recapture budget authority not required for contracts amended or terminated as part of restructuring and use it to provide housing assistance for the same number of families that were covered by that contract for its remaining term; any budget authority saved by shifting to project-based or tenant-based assistance will be rescinded. (§523(c)) Within HUD’s Office of Multifamily Housing, the Office of Program Management and Oversight will be responsible for administering recaptured Section 8 budget authority. officials, the procedures for monitoring this function will be defined in the oversight and audit guide, which was still being developed as of October 14, 1998. At least annually, PAEs qualified as Section 8 contract administrators must review the status of all restructured projects, including on-site inspections to determine compliance with housing codes and other requirements of the legislation and restructuring agreements. (§519(b)) PAEs that are qualified to be Section 8 contract administrators are responsible for annual project reviews. If a PAE is not qualified to be a Section 8 contract administrator, either HUD or a qualified state or local housing agency will be responsible for this required review. officials, these procedures will be addressed in the oversight and audit guide, which was still being developed as of October 14, 1998. In general, HUD currently intends to require the PAEs to submit monthly reports and to have HUD field staff conduct semiannual monitoring reviews. (continued) Explanation or related legislative provision(s) HUD can provide up to $10 million annually in funding to tenant groups, nonprofit organizations, and public entities for capacity-building and technical assistance in furthering the purposes of the mark-to-market program. (§514(f)(3)) HUD will select grantees on a competitive basis either to provide direct technical assistance or to act as intermediaries by administering a program of technical assistance grants to subrecipients. must submit quarterly performance reports to OMHAR. HUD will ensure that this reporting requirement is met by including provisions in the grant agreement and addressing this issue in the oversight and audit guide, which was still being developed as of October 14, 1998. Comments From the Department of Housing and Urban Development Major Contributors to This Report Housing and Community Development Issue Area Office of the General Counsel John T. McGrail The first copy of each GAO report and testimony is free. Additional copies are $2 each. Orders should be sent to the following address, accompanied by a check or money order made out to the Superintendent of Documents, when necessary. VISA and MasterCard credit cards are accepted, also. Orders for 100 or more copies to be mailed to a single address are discounted 25 percent. U.S. General Accounting Office P.O. Box 37050 Washington, DC 20013 Room 1100 700 4th St. NW (corner of 4th and G Sts. NW) U.S. General Accounting Office Washington, DC Orders may also be placed by calling (202) 512-6000 or by using fax number (202) 512-6061, or TDD (202) 512-2537. Each day, GAO issues a list of newly available reports and testimony. To receive facsimile copies of the daily list or any list from the past 30 days, please call (202) 512-6000 using a touchtone phone. A recorded menu will provide information on how to obtain these lists.

Summary: Pursuant to a legislative requirement, GAO reviewed the status of the Office of Multifamily Housing Assistance Restructuring's (OMHAR) development, focusing on: (1) its organization and staffing and how it relates to the Department of Housing and Urban Development's (HUD) overall structure; (2) whether it is on schedule to meet its key operational and reporting requirements; (3) the procedures and systems it will use to oversee the mark-to-market program's implementation; (4) the status of projects included in the three mark-to-market demonstration programs and how HUD is using information gathered from these programs; and (5) the actions it has taken to obtain information and feedback from parties that will be affected by the mark-to-market program. GAO noted that: (1) because a Director for OMHAR was not appointed until October 21, 1998, HUD had not made final decisions at the time of GAO's review on the Office's staffing and organization or on how the Office would relate to HUD's overall structure; (2) in addition to the 10 staff currently assigned to work on the mark-to-market program, HUD's preliminary plans call for hiring approximately 75 staff for OMHAR; (3) the Departments of Veterans Affairs and Housing and Urban Development, and Independent Agencies Appropriations Act of 1998, provides the Director special compensation authority to pay employees of OMHAR at a higher level than other employees in order to obtain the skills and expertise needed to accomplish the program's purposes; (4) HUD has made considerable progress toward meeting its key operational requirements for implementing the mark-to-market program; (5) because of delays in obtaining contract support and the sheer volume of tasks that HUD needs to complete, some of these tasks either have been or will be completed behind their original schedule; (6) the HUD officials responsible for the mark-to-market program are in the process of establishing or planning several procedures and systems designed to oversee the implementation of the program; (7) these include: (a) a system for measuring the performance of the entities responsible for carrying out restructuring transactions on HUD's behalf; (b) an Internet-based system to track the actions taken by these entities in carrying out mark-to-market functions; and (c) an audit guide to test these entities' compliance with the program's requirements and objectives; (8) as of October 14, 1998, most of these procedures and systems were still being developed; (9) in accordance with legislative requirements, HUD mark-to-market staff have taken actions to obtain information and feedback from affected parties; (10) specifically, they: (a) have developed program guidance that includes steps to involve affected parties including tenants and neighborhood associations, at various points in the restructuring process; and (b) have held three public forums to obtain recommendations from organizations representing affected parties on implementing certain legislative provisions; and (11) in addition to the legislatively required actions, HUD invited organizations representing project owners and managers, tenant groups, nonprofit organizations, lenders, coalitions of local and state government agencies, and other advocacy groups to submit ideas and comments on developing the program and to participate in meetings to discuss these issues.

gov_report

en

Summarize: Le luci illuminano la città in festa, un bambino giace in una mangiatoia e un Babbo Natale si arrampica su un balcone. Il Natale sta arrivando con il suo carico di emozioni e tanti buoni propositi da realizzare. Il pranzo di festa da condividere tutti insieme, i giochi da fare in famiglia, i regali da scartare sotto gli occhi di chi si ama. Ciò che più colpisce sta dentro ogni casa e non solo tra i presepi colorati e gli addobbi natalizi, ma soprattutto tra le mensole delle cucine, nei frigoriferi stracolmi e sulle tavole piene di farina bianca, di teglie e vassoi. Anche quest’anno il Natale sarà ricco di pietanze golose da assaggiare. Piatti della tradizione come il capitone o il cappone, piatti classici come i tortellini in brodo e le lasagne e piatti inconsueti. Il fatto è che le nonne sono impareggiabili quando si tratta di cucinare per la famiglia e quando si tratta di rendere la cucina una piazza d’armi… culinarie. Spesso le nonne si fanno prendere dall’entusiasmo o dall’ansia da prestazione e gli avanzi sembrano moltiplicarsi. Eppure ci sono persone e famiglie che non possono vivere questa dimensione di festa. Condividere, allora, con chi è meno fortunato questo momento speciale è quello che può rendere il Natale veramente Natale. Ecco che le nostre nonne spesso bistrattate per la loro esuberanza in cucina, quest’anno avranno la loro rivincita e non ci saranno nipoti o figli che le tratterranno dal mettere mano ai fornelli, ma anzi tiferanno per loro e li aiuteranno a darsi da fare per regalare una giornata speciale a chi non può vivere un Natale di festa. L’iniziativa è di Kraft e vuole diffondere l’atmosfera natalizia anche a chi è in difficoltà insieme alla onlus L’Albero della Vita, che si impegna da anni per la causa. Chi abita a Palermo potrà partecipare alla Cena più Buona del Mondo che si terrà il 21 dicembre. Le nonne di Palermo potranno dare una mano a realizzare questo momento speciale iscrivendosi all’iniziativa sul sito www.cenapiubuona.com.

Summary: Nei giorni che precedono il Natale, le cucine d'Italia risuonano come batterie scosse da musicisti stralunati tra milioni di padelle, mestoli, pentole e mattarelli che le nonne sfoderano per conquistare il sorriso di figli e nipoti. E Natale è ancora più Natale quando condividiamo con tutti la gioia di questa giornata, anche con le persone che vivono situazioni di difficoltà. A loro possiamo regalare un momento speciale, un giorno di Natale diverso grazie alle grandi mani e al grande cuore delle nostre nonne, capaci di diffondere la gioia ben oltre le mura delle loro case.

fanpage

it

Summarize: RELATED APPLICATIONS [0001] This application claims the benefit of U.S. provisional patent application Ser. No. 60/925,543; filed Apr. 21, 2007. TECHNICAL FIELD [0002] The instant invention relates to a composite moldable splint suitable for immobilization and support during neuromusculoskeletal tissue healing and rehabilitation. BACKGROUND OF THE INVENTION [0003] In the field of human and veterinary medicine, orthopedic splinting devices are formed to provide immobilization and support during neuromusculoskeletal tissue healing and rehabilitation. Traditional splinting techniques use a variety of materials including plaster, premolded polymers, and thermoplastic polymers. With the advent of custom formable thermoplastic synthetic materials, plaster is rarely used for conditions other than bone fractures. Thermoplastic splinting material can be heated and custom molded to the body part being treated. This method of splint fabrication conserves time and improves fit when compared to plaster casting. [0004] Thermoplastic material is available in sheet stock and can be cut to the desired shape and size required for treatment. Following a 3-5 minute water bath between 100 and 200 degrees Fahrenheit, the thermoplastic is rendered pliable and easily molded to the body part to be treated. Although the duration of its pliability is relatively brief, the material can still be shaped and trimmed depending on its thickness and degree of heat exposure. As the thermoplastic cools to room temperature, it regains its original rigid nature and sustains the shape of the custom formed splint. Cooling can be expedited via cold compresses, water, and aerosol coolants specifically designed for splint fabrication. [0005] In the field of rehabilitation, the art of splinting has expanded from basic immobilization and protection of injured structures to various dynamic applications. These applications include immobilization, therapeutic exercise, and neuromuscular reeducation. This new composite of the instant invention now affords dynamic splint designs that are adaptive in nature as well as restorative in regards to functional use. Examples of use include, by way of example and not limitation, a compensatory device to allow wrist and finger extension for peripheral or central nervous system disorders, dynamic traction of arthritic deforming forces in the hand while maintaining use, or as dynamic ankle-foot orthoses that facilitate a normalized gait pattern. SUMMARY OF INVENTION [0006] In its most general configuration, the present invention advances the state of the art with a variety of new capabilities and overcomes many of the shortcomings of prior devices in new and novel ways. In its most general sense, the present invention overcomes the shortcomings and limitations of the prior art in any of a number of generally effective configurations. The instant invention demonstrates such capabilities and overcomes many of the shortcomings of prior methods in new and novel ways. [0007] A composite moldable splint includes at least a first splinting member. While embodiments including one and two splinting members are also described, there is no absolute restriction on the number of splinting members that may be used, nor any necessary relationship among the sizes and positions of multiple splinting members. The first splinting member further includes a plurality of layers; including a first foam layer, a first thermoplastic layer and a first securing layer. [0008] These layers are bonded together, and the composite moldable splint is employed with the first foam layer nearest the intended user's skin, the first securing layer on the outside of the splint, and the thermoplastic layer lying between these two other layers. While the layers may be adhesively, or otherwise attached to one another, a preferred embodiment creates a heat weld, or fusion zone, between the layers that gives a strong unitary structure that is highly resistant to delamination. The first foam layer, preferably an elastomeric open-cell non-latex foam, provides a padded, moisture transmitting, non-migrating surface for user comfort. While many suitable elastomeric, non-migrating materials that are bondable to thermoplastic would be recognized by one skilled in the art; good results have been obtained using FABRIFOAM™ from Fabrifoam Products of Exton, Pa. Further, in a preferred embodiment, the first thermoplastic layer of the composite moldable splint further includes a thermoplastic pliable at temperatures between about 100 to 200 degrees Fahrenheit; and good results have been achieved using a gamma radiation cross-linked thermoplastic polymer including at least in part, poly (epsilon-caprolactone). [0009] The outside securing layer may be formed of any suitable material, as would be known to one skilled in the art, for covering the thermoplastic layer from the environment. In a preferred embodiment, the first securing layer has at least one section of loop fabric fastening on the first securing layer outer surface. In a preferred embodiment, the loop fabric covers at least 95% of the first securing layer surface area. This full, or substantially full coverage of the first securing layer outer surface with loop fabric fastening material confers important advantages. Retaining straps including at least a portion of a hook fastening material may be positioned at essentially any point on the first securing layer outside surface. Thus, different geometries in fastening may be employed by one skilled in the art to both secure the composite moldable splint and to create different force vectors applied by the composite moldable splint to the intended user. [0010] The composite moldable splint may be perforated to promote moisture transfer through the composite moldable splint, and composite moldable splints utilizing more than a single splinting member are discussed. [0011] Assembly of the composite moldable splint of the instant invention begins with assembling sheets of material for the first foam layer, the first thermoplastic layer, and the first securing layer; and then, in a preferred embodiment, heat welding these layers to form a unitary bonded splint assembly. After the bonded splint assemblies have cooled, a plurality of perforations communicating from the first securing layer outer surface to the first foam layer inner surface of the bonded splint assembly are punched in the bonded splint assemblies. [0012] Next, a technician would cut sections from the bonded splint assembly to size for physiologic use, and then warm one or more of the cut sections for application to an intended user. Gentle manual pressure and manipulation may be used to form a physiologically conforming bonded splint assembly on the body of an intended user, taking into account the individual characteristics of the intended user and the purpose for the splinting. The warmed bonded splint assembly remains elastic and pliable for several minutes at room temperature, generally long enough for one skilled in the art to form a physiologically conforming bonded splint assembly, but the material may be returned to the water bath, or other heat source, at any time to restore elasticity and prolong working time. [0013] When the technician is satisfied with the final shape and fit of the physiologically conforming bonded splint assembly, the composite moldable splint is cooled and completed by releasably securing the physiologically conforming bonded splint assembly with at least one retaining strap releasably attached to the first securing layer outer surface. [0014] In a preferred embodiment, the first securing layer outer surface is substantially covered by a continuous loop fabric suitable for hook and loop fastening. One or more retaining straps that utilize hook fastening material may be placed and secured at virtually any aspect of the securing layer outer surface of a splint covered with continuous loop fabric. This allows the technician to vary the intensity and force vectors of any retaining straps applied. [0015] The instant invention enables a significant advance in the state of the art. The instant invention is, in addition, widely applicable to a large number of applications. The various embodiments, as would be understood by one skilled in the art, would be suitable to any application requiring splinting of various types. These variations, modifications, alternatives, and alterations of the various preferred embodiments may be used alone or in combination with one another, as will become more readily apparent to those with skill in the art with reference to the following detailed description of the preferred embodiments and the accompanying figures and drawings. BRIEF DESCRIPTION OF THE DRAWINGS [0016] Without limiting the scope of the present invention as claimed below and referring now to the drawings and figures, all shown not-to-scale: [0017] FIG. 1 is an elevated perspective drawing of an embodiment of the instant invention; [0018] FIG. 2 is top plan drawing of a first foam layer, a first thermoplastic layer, and a first securing layer of the embodiment of FIG. 1 ; [0019] FIG. 3 is an exploded side view of the embodiment of FIG. 1, showing the relationship between layers in a first splinting member of the instant invention; [0020] FIG. 4 is an exploded side view of the embodiment of FIG. 1, showing the relationship between layers in a second splinting member of the instant invention; [0021] FIG. 5 is a side view of the embodiment of FIG. 1, showing a first foam layer, a first thermoplastic layer, and a first securing layer; after bonding, and demonstrating a first thermoplastic-securing layer bonding area and a first thermoplastic layer-foam bonding area; [0022] FIG. 6 is a side view of an embodiment of the instant invention, showing a second foam layer, a second thermoplastic layer, and a second securing layer; after bonding, and demonstrating a second thermoplastic-securing layer bonding area and a second thermoplastic layer-foam bonding area; [0023] FIG. 7 is a side view of the embodiment of FIG. 1, showing a first foam layer, a first thermoplastic layer, and a first securing layer; after bonding, and demonstrating a first thermoplastic-securing layer fusion area and a first thermoplastic layer-foam fusion area; [0024] FIG. 8 is a side view of an embodiment of the instant invention, showing a second foam layer, a second thermoplastic layer, and a second securing layer; after bonding, and demonstrating a second thermoplastic-securing layer fusion area and a second thermoplastic layer-foam fusion area; [0025] FIG. 9 is a top plan view showing an the embodiment of FIG. 1, ready for application to the palmar aspect of a human wrist and hand; [0026] FIG. 10 is a top plan view showing the embodiment of FIG. 1, applied to the palmar aspect of a human wrist and hand, and ready for manipulation into final shape; [0027] FIG. 11 is a top plan view showing the embodiment of FIG. 1, with directional arrows showing conformation of the instant invention to a palmar aspect of a human wrist and hand; [0028] FIG. 12 is a top plan view of the embodiment of FIG. 1, showing final application of the instant invention to a palmar aspect of a human wrist and hand; [0029] FIG. 13 is a side view of the embodiment of FIG. 1, showing final application of the instant invention to a palmar aspect of a human wrist and hand; [0030] FIG. 14 is a side view of an alternative embodiment the instant invention, showing final application of the composite moldable splint to a palmar aspect of a human wrist and hand; [0031] FIG. 15 is a side view of an alternative embodiment the instant invention, having a first splinting member and a second splinting member ready for final application to the palmar and dorsal aspects of a human wrist and hand; [0032] FIG. 16 is a side view of an alternative embodiment the instant invention, having a first splinting member and a second splinting member, shown in a final application position on the palmar and dorsal aspects of a human wrist and hand; [0033] FIG. 17 is a detail of an embodiment of a first thermoplastic layer according to the instant invention; and [0034] FIG. 18 is a detail of an embodiment of a second thermoplastic layer according to the instant invention. [0035] These drawings are provided to assist in the understanding of the exemplary embodiments of the invention as described in more detail below and should not be construed as unduly limiting the invention. In particular, the relative spacing, positioning, sizing and dimensions of the various elements illustrated in the drawings are not drawn to scale and may have been exaggerated, reduced or otherwise modified for the purpose of improved clarity. Those of ordinary skill in the art will also appreciate that a range of alternative configurations have been omitted simply to improve the clarity and reduce the number of drawings. DETAILED DESCRIPTION OF THE INVENTION [0036] The composite moldable splint of the instant invention enables a significant advance in the state of the art. The preferred embodiments of the device accomplish this by new and novel arrangements of elements and methods that are configured in unique and novel ways and which demonstrate previously unavailable but preferred and desirable capabilities. The detailed description set forth below in connection with the drawings is intended merely as a description of the present embodiments of the invention, and is not intended to represent the only form in which the present invention may be constructed or utilized. The description sets forth the designs, functions, means, and methods of implementing the invention in connection with the illustrated embodiments. It is to be understood, however, that the same or equivalent functions and features may be accomplished by different embodiments that are also intended to be encompassed within the spirit and scope of the invention. [0037] With regards to FIGS. 1-15, a composite moldable splint ( 10 ) is disclosed that includes at least a first splinting member ( 20 ), as seen well in FIG. 1. While embodiments including one and two splinting members ( 20, 30 ) are described, there is no absolute restriction on the number of splinting members ( 20, 30 ) that may be used, nor any necessary relationship among the sizes and positions of multiple splinting members ( 20, 30 ). The first splinting member ( 20 ) further includes a plurality of layers, as seen well in FIGS. 1-3. These layers will be described in part using the following conventions: aspects of the layers are indicated as “inner” if they are more proximal, or closer, to the skin of an intended user than those aspects identified as “outer,” which are more distal, or farther, from the skin of an intended user. Additionally, as seen well in FIGS. 6, 8 and 15 - 16, applications are described in which the composite moldable splint ( 10 ) of the instant invention includes a first splinting member ( 20 ) and a second splinting member ( 30 ); and one skilled in the art will be able to envision applications using even further splinting members ( 20, 30 ). The descriptors “first” and “second” are not meant to imply that the structures or compounds described as such are the same or different from each other. While any structure or compound described herein as a “first” may equally be formed in the same manner as a “second” structure or compound; one skilled in the art may envision applications where the “first” and “second” (or additional) compounds and structures are preferably the same, or equally, applications where they are preferably different. [0038] Therefore, as seen in FIGS. 1-3, the composite moldable splint ( 10 ) has a first foam layer ( 400 ) having at least a first foam layer outer surface ( 422 ), a first foam layer inner surface ( 424 ), and a first foam layer surface area ( 426 ). In keeping with the naming convention just discussed, the first foam layer inner surface area ( 424 ) is that aspect of the first foam layer ( 400 ) closest to the intended user's skin, while the first foam layer outer surface ( 422 ) is that aspect of the first foam layer ( 400 ) most distant from the intended user's skin. [0039] Moving outwards, or away from, the intended user's skin, and as seen well in FIG. 3, the composite moldable splint ( 10 ) includes a first thermoplastic layer ( 300 ) having at least a first thermoplastic layer outer surface ( 322 ), a first thermoplastic layer inner surface ( 324 ) and a first thermoplastic layer surface area ( 326 ). Again, the first thermoplastic layer inner surface ( 324 ) is that aspect of the first thermoplastic layer ( 300 ) closest to the intended user's skin, while the first thermoplastic layer outer surface ( 322 ) is that aspect of the first thermoplastic layer ( 300 ) most distant from the intended user's skin. The first thermoplastic layer ( 300 ) has a first thermoplastic layer surface area ( 326 ) and the first thermoplastic layer ( 300 ) is positioned between and in contact with a first outer securing layer ( 200 ) and the first inner foam layer ( 400 ). This first securing layer ( 200 ) includes the outermost layer of the composite moldable splint and has at least a first securing layer outer surface ( 222 ), a first securing layer inner surface ( 224 ), and a first securing layer surface area ( 226 ). [0040] As may be seen in FIG. 5, the first thermoplastic layer inner surface ( 324 ) is bonded to the first foam layer outer surface ( 422 ) in a first thermoplastic-foam layer bonding area ( 350 ) and the first thermoplastic layer outer surface ( 322 ) is bonded to the first securing layer inner surface ( 224 ) in a first thermoplastic-securing layer bonding area ( 250 ). This bonding between the layers ( 200, 300, 400 ) gives the composite moldable splint ( 10 ) a laminated unitary structure that is highly resistant to delaminating. As seen in FIGS. 7-8, the bonding zones ( 250, 350 ) may be fusion zones ( 251, 351 ). [0041] As seen well in FIGS. 12-14, the composite moldable splint ( 10 ) may be held in place by one or a plurality of retaining straps ( 500 ) releasably attached to the first securing layer outer surface ( 222 ). The mechanism and arrangement of the retaining straps ( 500 ) and their attachment to the securing layer ( 200 ) are a major advantage of the instant invention and will be discussed at length below. [0042] Bonding between the first foam layer ( 400 ) and the first thermoplastic layer ( 300 ) in the first thermoplastic-foam layer bonding area ( 350 ) and bonding between the first thermoplastic layer ( 300 ) and the first securing layer ( 200 ) in the first thermoplastic-securing layer bonding area ( 250 ) may be accomplished in many ways, as would be known to one skilled in the art. These methods may include chemical fusion, adhesives, mechanical bonds, and fusion by heat or other radiation forms. In a preferred embodiment, the first thermoplastic-foam layer bonding area ( 350 ) further comprises a first thermoplastic-foam layer fusion zone ( 351 ), and the first thermoplastic-securing layer bonding area ( 250 ) further comprises a first thermoplastic-securing layer fusion zone ( 251 ). A preferred method of forming these fusion zones ( 251, 351 ) will be discussed below. [0043] Various materials have been found advantageous in the formation of the composite moldable splint ( 10 ), and while only a few of these are discussed, one skilled in the art would recognize that a wide variety of materials are suitable for use. [0044] In a preferred embodiment of the composite moldable splint ( 10 ) the first foam layer ( 400 ) includes an open cell foam, and in a further preferred embodiment the first foam layer ( 400 ) further includes a non-latex, open cell, foam. [0045] An advantageous product for use in this layer is FABRIFOAM™ from Fabrifoam Products of Exton, Pa.; and certain embodiments of this material are described in U.S. Pat. No. 5,036,838. [0046] FABRIFOAM® is a composite material combining an open-celled, elastomeric, non-latex foam that is applied to specifically engineered fabrics; these fabrics displaying a “four way stretch” capacity, that is, the ability to stretch in all dimensions. This allows the fabric backed foam to stretch, and thereby conform to compound curves without wrinkling. Further, as one skilled in the art would know, FABRIFOAM® is breathable and resists migration, which is the tendency of elastic materials to “creep” on the surface of skin during an intended user's body movement. The product also tends to wick away perspiration or other moisture, while the fabric surface is hook receptive to hook and loop fastening, such as that seen in various hook and loop fastening systems, such as by way of limitation only, VELCRO® from Velcro Industries, BV; of the Netherlands Antilles. However, any suitable elastomeric non-migrating material that is bondable to thermoplastic may be utilized in the first foam layer ( 400 ). [0047] In an alternative embodiment, the first foam layer ( 400 ) is treated with an anti-microbial agent; which may include various silver compounds. [0048] In a preferred embodiment, the first thermoplastic layer ( 300 ) of the composite moldable splint ( 10 ) further includes a thermoplastic pliable at temperatures between about 100 degrees and 200 degrees Fahrenheit. One skilled in the art will realize that the thermoplastic may be formed from the group of thermoplastics consisting of poly(ethyleneadipate), poly(epsilon-capronolactone), polyvinyl stearate, cellulose acetate, butyratre and ethyl cellulose poly(propylene oxide) containing monomers, trans polyisoprene, cis polyisoprene, polycapronolactone, and transpoly isoprene, among others. [0049] In a preferred embodiment, an advantageous material for formation of the first thermoplastic layer ( 300 ) further includes a gamma radiation cross-linked thermoplastic polymer. A typically effective material formed at least in part of poly (epsilon-caprolactone) is disclosed in U.S. Pat. No. 5,540,876 to Larson. An effective commercial product for this application is the KLARITY™ splinting material available from Larson Medical Products, Inc. of Columbus, Ohio. [0050] In a preferred embodiment, seen in FIG. 17, the first thermoplastic layer is formed as a foraminous sheet, as illustrated in the teachings of Larson, having a first thermoplastic surface area ( 326 ). A first thermoplastic material ( 321 ) may be coated on a first netting ( 327 ), with the first thermoplastic material ( 321 ) coated around each strand. The utilization of a foraminous sheet structure lightens the overall weight of the composite moldable splint ( 10 ) and improves the transmission of moisture from the first foam layer outer surface ( 422 ) to the first securing layer inner surface ( 224 ). Comparable structure in a second thermoplastic layer ( 302 ) having a second thermoplastic surface area ( 336 ) are seen in FIG. 18, and include a second thermoplastic material ( 331 ) which may be coated on a second netting ( 337 ) [0051] The securing layer seen well in FIG. 1 may be formed of any suitable material, as would be known to one skilled in the art, for covering the thermoplastic layer ( 300 ) from the environment. By way of example only, the securing layer may be a thermoplastic or a fabric. As seen well in FIG. 12-14, in one embodiment, the composite moldable splint ( 10 ) may be retained in place on an intended user by having at least one retaining strap ( 500 ) releasably secured to the first securing layer outer surface ( 222 ) with at least one attachment device ( 600 ) that is releasably attached to the at least one retaining strap ( 500 ) and the first securing layer outer surface ( 222 ). This attachment device ( 600 ) may be any form of fastener, and in a preferred embodiment, is at least a section of hook fastening designed to cooperate with at least one section of loop fabric fastening on the first securing layer outer surface ( 222 ). In a preferred embodiment, the loop fabric covers at least 95% of the first securing layer surface area ( 226 ). [0052] This full, or substantially full coverage of the first securing layer outer surface ( 222 ) with loop fabric fastening material confers important advantages. Retaining straps ( 500 ) including at least a portion of a hook fastening material may be positioned at essentially any point on the first securing layer outside surface ( 222 ). Thus, different geometries in fastening may be employed by one skilled in the art to both secure the composite moldable splint ( 10 ) and to create different force vectors applied by the composite moldable splint ( 10 ) to the intended user. [0053] In some embodiments, seen well in FIG. 1, it has been found advantageous to perforate the composite moldable splint ( 10 ) with a plurality of perforations ( 50 ) communicating between the first securing layer outer surface ( 222 ) and the first foam layer inner surface ( 424 ) of the splint. Such perforations ( 50 ) tend to promote moisture transfer through the composite moldable splint ( 10 ), and it has been found that a relatively small number of perforations ( 50 ) are suitable to accomplish this, and do not appreciably weaken the composite moldable splint ( 10 ). In some embodiments, the plurality of perforations ( 50 ) comprises a perforation surface area in total of less than 5% of the first securing layer surface area ( 226 ). In other preferred embodiments, the plurality of perforations ( 50 ) comprises a perforation surface area in total of less than 1% of the first securing layer surface area ( 226 ). [0054] So far, this disclosure has only discussed a composite moldable splint ( 10 ) including a single, first splinting member ( 20 ). However, the instant invention is equally applicable to a composite moldable splint having a second ( 30 ), or even more than two, splinting members, as seen in FIG. 15-16. [0055] In such embodiments, the first splinting member ( 20 ) and second splinting member ( 30 ) are most frequently at least partially opposing, although they may also be placed in a non-opposing manner, as would be understood by one skilled in the art. In such an embodiment, the second splinting member ( 30 ) is structurally the same as the first splinting member ( 20 ), as may be seen in FIGS. 5-8. [0056] As seen well in FIG. 3, at least a first splinting member ( 20 ) includes a first securing layer ( 200 ) having at least a first securing layer outer surface ( 222 ), a first securing layer inner surface ( 224 ) and a first securing layer surface area ( 226 ). The first splinting member also has a first foam layer ( 400 ) having at least a first foam layer outer surface ( 422 ), a first foam layer inner surface ( 424 ) and a first foam layer surface area ( 426 ). The first splinting member also includes a first thermoplastic layer ( 300 ) having at least a first thermoplastic layer outer surface ( 322 ), a first thermoplastic layer inner surface ( 324 ) and a first thermoplastic layer surface area ( 326 ), where the first thermoplastic layer ( 300 ) is positioned between and in contact with the first securing layer ( 200 ) and the first foam layer ( 400 ). [0057] In this embodiment as well, as may be seen in FIG. 5, the first thermoplastic layer inner surface ( 324 ) is bonded to the first foam layer outer surface ( 422 ) in a first thermoplastic-foam layer bonding area ( 350 ) and the first thermoplastic layer outer surface ( 322 ) is bonded to the first securing layer inner surface ( 224 ) in a first thermoplastic-securing layer bonding area ( 250 ). [0058] As seen well in FIG. 4, a second splinting member ( 30 ) has similar structure, that is, it includes a second securing layer ( 202 ) having at least a second securing layer outer surface ( 232 ), a second securing layer inner surface ( 234 ) and a second securing layer surface area ( 236 ). The second splinting member ( 30 ) also includes a second foam layer ( 402 ) having at least a second foam layer outer surface ( 432 ), a second foam layer inner surface ( 434 ) and a second foam layer surface area ( 436 ). And again, the second splinting member ( 30 ) has a second thermoplastic layer ( 302 ) having at least a second thermoplastic layer outer surface ( 332 ), a second thermoplastic layer inner surface ( 334 ) and a second thermoplastic layer surface area ( 336 ), the second thermoplastic layer ( 302 ) positioned between and in contact with the second securing layer ( 202 ) and the second foam layer ( 402 ). [0059] As with the structure of the first splinting member ( 20 ), in the second splinting member ( 30 ), seen well in FIG. 6, the second thermoplastic layer inner surface ( 334 ) is bonded to the second foam layer outer surface ( 432 ) in a second thermoplastic-foam layer bonding area ( 352 ) and the second thermoplastic layer outer surface ( 332 ) is bonded to the second securing layer inner surface ( 234 ) in a second thermoplastic-securing layer bonding area ( 252 ). In a preferred embodiment, seen well in FIGS. 7-8, the bonding areas ( 250, 252, 350, 352 ) may be fusion zones ( 251, 253, 351, 353 ). [0060] The first splinting member ( 20 ) and the second splinting member ( 30 ), as well as any additional splinting members desired, are placed in physiologic position on an intended user, as seen well in FIGS. 15-16, and the at least first splinting member ( 20 ) is releasably attached to the at least second splinting member ( 30 ) by at least one retaining strap ( 500 ), seen in FIG. 16. [0061] The composite moldable splint ( 10 ) of the instant invention may be fabricated according to a number of methods and technologies, which would be known to one skilled in the art, and only a few of which are discussed herein. No limitation as to possible methods of fabrication are expressed or intended. [0062] In one embodiment of a method of fabrication, a method begins with assembling a splint assembly ( 11 ) for at least a first splinting member ( 20 ) having at least a first securing layer ( 200 ), a first thermoplastic layer ( 300 ), and a first foam layer ( 400 ). [0063] Assembly may begin with a first securing layer ( 200 ) having at least a first securing layer outer surface ( 222 ), a first securing layer inner surface ( 224 ), and a first securing layer surface area ( 226 ). In a preferred embodiment, this first securing layer is a sheet of continuous loop fabric, suitable for hook and loop fastening, and approximately 18×24 inches in size. [0064] Next, a first thermoplastic layer ( 300 ) of approximately the same size and having at least a first thermoplastic layer outer surface ( 322 ), a first thermoplastic layer inner surface ( 324 ) and a first thermoplastic layer surface area ( 326 ) is overlaid on the first securing layer ( 200 ). Then a first foam layer ( 400 ), again of approximately the same size, having at least a first foam layer outer surface ( 422 ), a first foam layer inner surface ( 424 ), and a first foam layer surface area ( 426 ) is overlaid on the first thermoplastic layer ( 300 ). One skilled in the art will realize that the order may be reversed, and a first foam layer ( 400 ) may be overlaid with a first thermoplastic layer ( 300 ) and then a first securing layer ( 200 ). Ultimately, it is only required that the first thermoplastic layer ( 300 ) be positioned between and in contact with the first securing layer ( 200 ) and the first inner foam layer ( 400 ). In those embodiments wherein the layers ( 200, 300, 400 ) of the splint assembly ( 11 ) are bonded by adhesive or the application of other substances to form a bonded splint assembly ( 12 ), it is necessary for these adhesives or other substances to be placed between the layers ( 200, 300, 400 ) during assembly of the layers ( 200, 300, 400 ). [0065] However, in a preferred embodiment, a bonded splint assembly ( 12 ) is formed by applying heat or other energy to the splint assembly ( 11 ) thereby bonding the first thermoplastic layer inner surface ( 324 ) to the first foam layer outer surface ( 422 ) in a first thermoplastic-foam layer bonding area ( 350 ) and bonding the first thermoplastic layer outer surface ( 322 ) to the first securing layer inner surface ( 224 ) in a first thermoplastic-securing layer bonding area ( 250 ). Typically, heat welding is used to form the splint assembly ( 11 ) into the bonded splint assembly ( 12 ). [0066] In a preferred and illustrative embodiment, the splint assembly ( 11 ), or plurality of splint assemblies ( 11 ) is placed in a VACUSEAL® 4468H Vacuum Press from Hunt Graphics Americas of Statesville, N.C. This is wide format laminator with a working capacity of 44″×68″ that can easily accommodate four 18×24 inch splint assemblies ( 11 ) simultaneously. A typical processing protocol calls for an application of heat to 185-250 degrees Fahrenheit, along with 13 pounds per square inch (psi) pressure, for between five and seven minutes. Following heat welding, the bonded splint assemblies ( 12 ) are cooled on aluminum cooling tables under approximately twenty pounds of pressure to control the rate of heat dissipation and to prevent warping. One skilled in the art will realize that these parameters are variable according to material compositions and thicknesses, and other factors, and require adjustment for specific applications. [0067] After the bonded splint assemblies have cooled, a plurality of perforations communicating from the first securing layer outer surface ( 222 ) to the first foam layer inner surface ( 424 ) of the bonded splint assembly ( 12 ) are punched in the bonded splint assemblies. In a preferred and illustrative embodiment, a CNC (Computer Numerically Controlled) turret punch press is used to perforate the sheets of bonded splint assemblies ( 12 ). [0068] Next, one forming a splint who may for purposes of identification only be deemed a “technician,” would cut sections from the bonded splint assembly ( 12 ) to size for physiologic use. These may range in size from quite small, possibly a square inch or smaller, to relatively large, possibly sufficient to cover a substantial part of a limb of an intended human or animal user. Hand shears can be used to cut the bonded splint assembly ( 12 ) and further trim it to approximate size and shape, according to the skill and experience of the technician. [0069] To form a physiologically conforming splint assembly ( 13 ) the technician next warms the section of bonded splint assembly ( 12 ) to induce elasticity. In some embodiments, the bonded splint assembly ( 12 ) may be exposed to microwave energy or other energy source to induce elasticity. In a preferred embodiment, the section of bonded splint assembly ( 12 ) may be placed in a closed plastic bag and immersed in a water bath of approximately 100 to 200 degrees Fahrenheit, preferably about 170 degrees Fahrenheit, until elastic, typically about three to five minutes. While the bonded splint assembly ( 12 ), in a preferred embodiment, is not harmed by water, heating the bonded splint assembly ( 12 ) in a closed plastic bag helps keep the bonded splint assembly ( 12 ) dry and more comfortable for the intended user, as well as easier to work with for the technician. [0070] Next, the technician manipulates the warmed bonded splint assembly ( 12 ) to form a physiologically conforming bonded splint assembly ( 13 ) on the body of an intended user, as may be seen in FIGS. 10-11. Gentle manual pressure may be used to form the bonded splint assembly ( 12 ) into the correct shape, taking into account the individual characteristics of the intended user and the purpose for the splinting. The warmed bonded splint assembly remains elastic and pliable for several minutes at room temperature, generally long enough for one skilled in the art to form a physiologically conforming bonded splint assembly ( 13 ), but the material may be returned to the water bath, or other heat source, at any time to restore elasticity and prolong working time. [0071] The physiologically conforming bonded splint assembly ( 13 ) may be allowed to cool in place on the intended user or may be removed once the technician ascertains that the level of elasticity has decreased sufficiently for the physiologically conforming bonded splint assembly ( 13 ) to hold its shape. Cooling can be expedited via cold compresses, cool water, and aerosol coolants specifically designed for splint fabrication. The physiologically conforming bonded splint assembly ( 13 ) is applied to the intended user and edges may be further trimmed with hand shears for final adjustment. Again, if the technician is unsatisfied with the shape of the physiologically conforming bonded splint assembly ( 13 ) at any time, it may be reheated to re-induce elasticity, and reworked. [0072] When the technician is satisfied with the final shape and fit of the physiologically conforming bonded splint assembly ( 13 ), the composite moldable splint ( 10 ) is completed on the intended user by releasably securing the physiologically conforming bonded splint assembly ( 13 ) with at least one retaining strap ( 500 ) releasably attached to the first securing layer outer surface ( 222 ), as seen in FIGS. 12-14. [0073] In a preferred embodiment, the first securing layer outer surface ( 222 ) is substantially covered by a continuous loop fabric suitable for hook and loop fastening. One skilled in the art will realize, as shown in FIGS. 12-14 and 16, that a retaining strap ( 500 ), or a plurality of retaining straps ( 500 ) that utilize hook fastening material, may be placed and secured at virtually any aspect of the securing layer outer surface ( 222 ). This allows the technician to vary the intensity and force vectors of any retaining straps ( 500 ) applied. [0074] In a preferred embodiment, retaining straps are formed of FABIRFOAM® material bonded to a hook receptive fabric. Sections of hook material, which are seen in FIG. 12, for purposes of illustration only as disc-shaped, may then be used to affix the retaining straps ( 500 ), foam side against the intended user's skin, in virtually any desired direction and under a wide range of tensions. Alternatively, retaining straps ( 500 ) may be formed which incorporate sections of hook material affixed to the retaining straps ( 500 ), such that the hook-containing portion of the retaining straps ( 500 ) may cooperate with the continuous loop fabric on the first securing layer outer surface ( 222 ). It is, of course, to be remembered that the hook and loop fastening method discussed above is only one alternative that would be understood by one skilled in the art, and that many other methods may be used to secure the composite moldable splint ( 10 ) in place on an intended user. [0075] One skilled in the art will also understand that for composite moldable splints ( 20 ) using a first splinting member ( 20 ) and a second splinting member ( 30 ), or additional splinting members ( 20, 20 ); similar fixation methods may be used. For example, as seen in FIGS. 15-16, an application using a generally opposing first splinting member ( 20 ) and a second splinting member ( 30 ) is shown; a retaining strap ( 500 ) such as that described above and incorporating a hook and loop fastening system may be attached by a first part to the first splinting member ( 20 ), tensioned as desired, and then attached by a second part to the second splinting member ( 30 ). This may be seen well in FIG. 16 and would form what might be deemed a “clam shell” splint that would splint an affected area from two sides. [0076] Numerous alterations, modifications, and variations of the preferred embodiments disclosed herein will be apparent to those skilled in the art and they are all anticipated and contemplated to be within the spirit and scope of the instant invention. For example, although specific embodiments have been described in detail, those with skill in the art will understand that the preceding embodiments and variations can be modified to incorporate various types of substitute and or additional or alternative materials, relative arrangement of elements, and dimensional configurations. Accordingly, even though only a few variations of the present invention are described herein, it is to be understood that the practice of such additional modifications and variations and the equivalents thereof, are within the spirit and scope of the invention as defined in the following claims. The corresponding structures, materials, acts, and equivalents of all means or step plus function elements in the claims below are intended to include any structure, material, or acts for performing the functions in combination with other claimed elements as specifically claimed.

Summary: A composite moldable splint having at least a first splinting member with an inner foam layer, an intermediate thermoplastic layer, and an external securing layer. The inner foam layer provides a soft, moisture transmitting, non-latex padding. The intermediate thermoplastic layer provides remoldable shape, and rigidity and strength after heat forming and cooling. The outer securing layer, preferably covered with continuous loop fabric suitable for hook and loop fastening, provides an essentially infinite plurality of attachment points for retaining straps including at least a section of hook fastening material for holding the splint in place. The layers of the composite moldable splint are preferably heat welded to form a strong unitary structure that is resistant to delamination. Composite moldable splints utilizing multiple splinting members are described.

big_patent

en

Summarize: I On my right hand there were lines of fishing stakes resembling a mysterious system of half-submerged bamboo fences, incomprehensible in its division of the domain of tropical fishes, and crazy of aspect as if abandoned forever by some nomad tribe of fishermen now gone to the other end of the ocean; for there was no sign of human habitation as far as the eye could reach. To the left a group of barren islets, suggesting ruins of stone walls, towers, and blockhouses, had its foundations set in a blue sea that itself looked solid, so still and stable did it lie below my feet; even the track of light from the westering sun shone smoothly, without that animated glitter which tells of an imperceptible ripple. And when I turned my head to take a parting glance at the tug which had just left us anchored outside the bar, I saw the straight line of the flat shore joined to the stable sea, edge to edge, with a perfect and unmarked closeness, in one leveled floor half brown, half blue under the enormous dome of the sky. Corresponding in their insignificance to the islets of the sea, two small clumps of trees, one on each side of the only fault in the impeccable joint, marked the mouth of the river Meinam we had just left on the first preparatory stage of our homeward journey; and, far back on the inland level, a larger and loftier mass, the grove surrounding the great Paknam pagoda, was the only thing on which the eye could rest from the vain task of exploring the monotonous sweep of the horizon. Here and there gleams as of a few scattered pieces of silver marked the windings of the great river; and on the nearest of them, just within the bar, the tug steaming right into the land became lost to my sight, hull and funnel and masts, as though the impassive earth had swallowed her up without an effort, without a tremor. My eye followed the light cloud of her smoke, now here, now there, above the plain, according to the devious curves of the stream, but always fainter and farther away, till I lost it at last behind the miter-shaped hill of the great pagoda. And then I was left alone with my ship, anchored at the head of the Gulf of Siam. She floated at the starting point of a long journey, very still in an immense stillness, the shadows of her spars flung far to the eastward by the setting sun. At that moment I was alone on her decks. There was not a sound in her--and around us nothing moved, nothing lived, not a canoe on the water, not a bird in the air, not a cloud in the sky. In this breathless pause at the threshold of a long passage we seemed to be measuring our fitness for a long and arduous enterprise, the appointed task of both our existences to be carried out, far from all human eyes, with only sky and sea for spectators and for judges. There must have been some glare in the air to interfere with one's sight, because it was only just before the sun left us that my roaming eyes made out beyond the highest ridges of the principal islet of the group something which did away with the solemnity of perfect solitude. The tide of darkness flowed on swiftly; and with tropical suddenness a swarm of stars came out above the shadowy earth, while I lingered yet, my hand resting lightly on my ship's rail as if on the shoulder of a trusted friend. But, with all that multitude of celestial bodies staring down at one, the comfort of quiet communion with her was gone for good. And there were also disturbing sounds by this time--voices, footsteps forward; the steward flitted along the main-deck, a busily ministering spirit; a hand bell tinkled urgently under the poop deck.... I found my two officers waiting for me near the supper table, in the lighted cuddy. We sat down at once, and as I helped the chief mate, I said: "Are you aware that there is a ship anchored inside the islands? I saw her mastheads above the ridge as the sun went down." He raised sharply his simple face, overcharged by a terrible growth of whisker, and emitted his usual ejaculations: "Bless my soul, sir! You don't say so!" My second mate was a round-cheeked, silent young man, grave beyond his years, I thought; but as our eyes happened to meet I detected a slight quiver on his lips. I looked down at once. It was not my part to encourage sneering on board my ship. It must be said, too, that I knew very little of my officers. In consequence of certain events of no particular significance, except to myself, I had been appointed to the command only a fortnight before. Neither did I know much of the hands forward. All these people had been together for eighteen months or so, and my position was that of the only stranger on board. I mention this because it has some bearing on what is to follow. But what I felt most was my being a stranger to the ship; and if all the truth must be told, I was somewhat of a stranger to myself. The youngest man on board (barring the second mate), and untried as yet by a position of the fullest responsibility, I was willing to take the adequacy of the others for granted. They had simply to be equal to their tasks; but I wondered how far I should turn out faithful to that ideal conception of one's own personality every man sets up for himself secretly. Meantime the chief mate, with an almost visible effect of collaboration on the part of his round eyes and frightful whiskers, was trying to evolve a theory of the anchored ship. His dominant trait was to take all things into earnest consideration. He was of a painstaking turn of mind. As he used to say, he "liked to account to himself" for practically everything that came in his way, down to a miserable scorpion he had found in his cabin a week before. The why and the wherefore of that scorpion--how it got on board and came to select his room rather than the pantry (which was a dark place and more what a scorpion would be partial to), and how on earth it managed to drown itself in the inkwell of his writing desk--had exercised him infinitely. The ship within the islands was much more easily accounted for; and just as we were about to rise from table he made his pronouncement. She was, he doubted not, a ship from home lately arrived. Probably she drew too much water to cross the bar except at the top of spring tides. Therefore she went into that natural harbor to wait for a few days in preference to remaining in an open roadstead. "That's so," confirmed the second mate, suddenly, in his slightly hoarse voice. "She draws over twenty feet. She's the Liverpool ship Sephora with a cargo of coal. Hundred and twenty-three days from Cardiff." We looked at him in surprise. "The tugboat skipper told me when he came on board for your letters, sir," explained the young man. "He expects to take her up the river the day after tomorrow." After thus overwhelming us with the extent of his information he slipped out of the cabin. The mate observed regretfully that he "could not account for that young fellow's whims." What prevented him telling us all about it at once, he wanted to know. I detained him as he was making a move. For the last two days the crew had had plenty of hard work, and the night before they had very little sleep. I felt painfully that I--a stranger--was doing something unusual when I directed him to let all hands turn in without setting an anchor watch. I proposed to keep on deck myself till one o'clock or thereabouts. I would get the second mate to relieve me at that hour. "He will turn out the cook and the steward at four," I concluded, "and then give you a call. Of course at the slightest sign of any sort of wind we'll have the hands up and make a start at once." He concealed his astonishment. "Very well, sir." Outside the cuddy he put his head in the second mate's door to inform him of my unheard-of caprice to take a five hours' anchor watch on myself. I heard the other raise his voice incredulously--"What? The Captain himself?" Then a few more murmurs, a door closed, then another. A few moments later I went on deck. My strangeness, which had made me sleepless, had prompted that unconventional arrangement, as if I had expected in those solitary hours of the night to get on terms with the ship of which I knew nothing, manned by men of whom I knew very little more. Fast alongside a wharf, littered like any ship in port with a tangle of unrelated things, invaded by unrelated shore people, I had hardly seen her yet properly. Now, as she lay cleared for sea, the stretch of her main-deck seemed to me very fine under the stars. Very fine, very roomy for her size, and very inviting. I descended the poop and paced the waist, my mind picturing to myself the coming passage through the Malay Archipelago, down the Indian Ocean, and up the Atlantic. All its phases were familiar enough to me, every characteristic, all the alternatives which were likely to face me on the high seas--everything!... except the novel responsibility of command. But I took heart from the reasonable thought that the ship was like other ships, the men like other men, and that the sea was not likely to keep any special surprises expressly for my discomfiture. Arrived at that comforting conclusion, I bethought myself of a cigar and went below to get it. All was still down there. Everybody at the after end of the ship was sleeping profoundly. I came out again on the quarter-deck, agreeably at ease in my sleeping suit on that warm breathless night, barefooted, a glowing cigar in my teeth, and, going forward, I was met by the profound silence of the fore end of the ship. Only as I passed the door of the forecastle, I heard a deep, quiet, trustful sigh of some sleeper inside. And suddenly I rejoiced in the great security of the sea as compared with the unrest of the land, in my choice of that untempted life presenting no disquieting problems, invested with an elementary moral beauty by the absolute straightforwardness of its appeal and by the singleness of its purpose. The riding light in the forerigging burned with a clear, untroubled, as if symbolic, flame, confident and bright in the mysterious shades of the night. Passing on my way aft along the other side of the ship, I observed that the rope side ladder, put over, no doubt, for the master of the tug when he came to fetch away our letters, had not been hauled in as it should have been. I became annoyed at this, for exactitude in some small matters is the very soul of discipline. Then I reflected that I had myself peremptorily dismissed my officers from duty, and by my own act had prevented the anchor watch being formally set and things properly attended to. I asked myself whether it was wise ever to interfere with the established routine of duties even from the kindest of motives. My action might have made me appear eccentric. Goodness only knew how that absurdly whiskered mate would "account" for my conduct, and what the whole ship thought of that informality of their new captain. I was vexed with myself. Not from compunction certainly, but, as it were mechanically, I proceeded to get the ladder in myself. Now a side ladder of that sort is a light affair and comes in easily, yet my vigorous tug, which should have brought it flying on board, merely recoiled upon my body in a totally unexpected jerk. What the devil!... I was so astounded by the immovableness of that ladder that I remained stock-still, trying to account for it to myself like that imbecile mate of mine. In the end, of course, I put my head over the rail. The side of the ship made an opaque belt of shadow on the darkling glassy shimmer of the sea. But I saw at once something elongated and pale floating very close to the ladder. Before I could form a guess a faint flash of phosphorescent light, which seemed to issue suddenly from the naked body of a man, flickered in the sleeping water with the elusive, silent play of summer lightning in a night sky. With a gasp I saw revealed to my stare a pair of feet, the long legs, a broad livid back immersed right up to the neck in a greenish cadaverous glow. One hand, awash, clutched the bottom rung of the ladder. He was complete but for the head. A headless corpse! The cigar dropped out of my gaping mouth with a tiny plop and a short hiss quite audible in the absolute stillness of all things under heaven. At that I suppose he raised up his face, a dimly pale oval in the shadow of the ship's side. But even then I could only barely make out down there the shape of his black-haired head. However, it was enough for the horrid, frost-bound sensation which had gripped me about the chest to pass off. The moment of vain exclamations was past, too. I only climbed on the spare spar and leaned over the rail as far as I could, to bring my eyes nearer to that mystery floating alongside. As he hung by the ladder, like a resting swimmer, the sea lightning played about his limbs at every stir; and he appeared in it ghastly, silvery, fishlike. He remained as mute as a fish, too. He made no motion to get out of the water, either. It was inconceivable that he should not attempt to come on board, and strangely troubling to suspect that perhaps he did not want to. And my first words were prompted by just that troubled incertitude. "What's the matter?" I asked in my ordinary tone, speaking down to the face upturned exactly under mine. "Cramp," it answered, no louder. Then slightly anxious, "I say, no need to call anyone." "I was not going to," I said. "Are you alone on deck?" "Yes." I had somehow the impression that he was on the point of letting go the ladder to swim away beyond my ken--mysterious as he came. But, for the moment, this being appearing as if he had risen from the bottom of the sea (it was certainly the nearest land to the ship) wanted only to know the time. I told him. And he, down there, tentatively: "I suppose your captain's turned in?" "I am sure he isn't," I said. He seemed to struggle with himself, for I heard something like the low, bitter murmur of doubt. "What's the good?" His next words came out with a hesitating effort. "Look here, my man. Could you call him out quietly?" I thought the time had come to declare myself. "I am the captain." I heard a "By Jove!" whispered at the level of the water. The phosphorescence flashed in the swirl of the water all about his limbs, his other hand seized the ladder. "My name's Leggatt." The voice was calm and resolute. A good voice. The self-possession of that man had somehow induced a corresponding state in myself. It was very quietly that I remarked: "You must be a good swimmer." "Yes. I've been in the water practically since nine o'clock. The question for me now is whether I am to let go this ladder and go on swimming till I sink from exhaustion, or--to come on board here." I felt this was no mere formula of desperate speech, but a real alternative in the view of a strong soul. I should have gathered from this that he was young; indeed, it is only the young who are ever confronted by such clear issues. But at the time it was pure intuition on my part. A mysterious communication was established already between us two--in the face of that silent, darkened tropical sea. I was young, too; young enough to make no comment. The man in the water began suddenly to climb up the ladder, and I hastened away from the rail to fetch some clothes. Before entering the cabin I stood still, listening in the lobby at the foot of the stairs. A faint snore came through the closed door of the chief mate's room. The second mate's door was on the hook, but the darkness in there was absolutely soundless. He, too, was young and could sleep like a stone. Remained the steward, but he was not likely to wake up before he was called. I got a sleeping suit out of my room and, coming back on deck, saw the naked man from the sea sitting on the main hatch, glimmering white in the darkness, his elbows on his knees and his head in his hands. In a moment he had concealed his damp body in a sleeping suit of the same gray-stripe pattern as the one I was wearing and followed me like my double on the poop. Together we moved right aft, barefooted, silent. "What is it?" I asked in a deadened voice, taking the lighted lamp out of the binnacle, and raising it to his face. "An ugly business." He had rather regular features; a good mouth; light eyes under somewhat heavy, dark eyebrows; a smooth, square forehead; no growth on his cheeks; a small, brown mustache, and a well-shaped, round chin. His expression was concentrated, meditative, under the inspecting light of the lamp I held up to his face; such as a man thinking hard in solitude might wear. My sleeping suit was just right for his size. A well-knit young fellow of twenty-five at most. He caught his lower lip with the edge of white, even teeth. "Yes," I said, replacing the lamp in the binnacle. The warm, heavy tropical night closed upon his head again. "There's a ship over there," he murmured. "Yes, I know. The Sephora. Did you know of us?" "Hadn't the slightest idea. I am the mate of her--" He paused and corrected himself. "I should say I _was_." "Aha! Something wrong?" "Yes. Very wrong indeed. I've killed a man." "What do you mean? Just now?" "No, on the passage. Weeks ago. Thirty-nine south. When I say a man--" "Fit of temper," I suggested, confidently. The shadowy, dark head, like mine, seemed to nod imperceptibly above the ghostly gray of my sleeping suit. It was, in the night, as though I had been faced by my own reflection in the depths of a somber and immense mirror. "A pretty thing to have to own up to for a Conway boy," murmured my double, distinctly. "You're a Conway boy?" "I am," he said, as if startled. Then, slowly... "Perhaps you too--" It was so; but being a couple of years older I had left before he joined. After a quick interchange of dates a silence fell; and I thought suddenly of my absurd mate with his terrific whiskers and the "Bless my soul--you don't say so" type of intellect. My double gave me an inkling of his thoughts by saying: "My father's a parson in Norfolk. Do you see me before a judge and jury on that charge? For myself I can't see the necessity. There are fellows that an angel from heaven--And I am not that. He was one of those creatures that are just simmering all the time with a silly sort of wickedness. Miserable devils that have no business to live at all. He wouldn't do his duty and wouldn't let anybody else do theirs. But what's the good of talking! You know well enough the sort of ill-conditioned snarling cur--" He appealed to me as if our experiences had been as identical as our clothes. And I knew well enough the pestiferous danger of such a character where there are no means of legal repression. And I knew well enough also that my double there was no homicidal ruffian. I did not think of asking him for details, and he told me the story roughly in brusque, disconnected sentences. I needed no more. I saw it all going on as though I were myself inside that other sleeping suit. "It happened while we were setting a reefed foresail, at dusk. Reefed foresail! You understand the sort of weather. The only sail we had left to keep the ship running; so you may guess what it had been like for days. Anxious sort of job, that. He gave me some of his cursed insolence at the sheet. I tell you I was overdone with this terrific weather that seemed to have no end to it. Terrific, I tell you--and a deep ship. I believe the fellow himself was half crazed with funk. It was no time for gentlemanly reproof, so I turned round and felled him like an ox. He up and at me. We closed just as an awful sea made for the ship. All hands saw it coming and took to the rigging, but I had him by the throat, and went on shaking him like a rat, the men above us yelling, 'Look out! look out!' Then a crash as if the sky had fallen on my head. They say that for over ten minutes hardly anything was to be seen of the ship--just the three masts and a bit of the forecastle head and of the poop all awash driving along in a smother of foam. It was a miracle that they found us, jammed together behind the forebitts. It's clear that I meant business, because I was holding him by the throat still when they picked us up. He was black in the face. It was too much for them. It seems they rushed us aft together, gripped as we were, screaming 'Murder!' like a lot of lunatics, and broke into the cuddy. And the ship running for her life, touch and go all the time, any minute her last in a sea fit to turn your hair gray only a-looking at it. I understand that the skipper, too, started raving like the rest of them. The man had been deprived of sleep for more than a week, and to have this sprung on him at the height of a furious gale nearly drove him out of his mind. I wonder they didn't fling me overboard after getting the carcass of their precious shipmate out of my fingers. They had rather a job to separate us, I've been told. A sufficiently fierce story to make an old judge and a respectable jury sit up a bit. The first thing I heard when I came to myself was the maddening howling of that endless gale, and on that the voice of the old man. He was hanging on to my bunk, staring into my face out of his sou'wester. "'Mr. Leggatt, you have killed a man. You can act no longer as chief mate of this ship.'" His care to subdue his voice made it sound monotonous. He rested a hand on the end of the skylight to steady himself with, and all that time did not stir a limb, so far as I could see. "Nice little tale for a quiet tea party," he concluded in the same tone. One of my hands, too, rested on the end of the skylight; neither did I stir a limb, so far as I knew. We stood less than a foot from each other. It occurred to me that if old "Bless my soul--you don't say so" were to put his head up the companion and catch sight of us, he would think he was seeing double, or imagine himself come upon a scene of weird witchcraft; the strange captain having a quiet confabulation by the wheel with his own gray ghost. I became very much concerned to prevent anything of the sort. I heard the other's soothing undertone. "My father's a parson in Norfolk," it said. Evidently he had forgotten he had told me this important fact before. Truly a nice little tale. "You had better slip down into my stateroom now," I said, moving off stealthily. My double followed my movements; our bare feet made no sound; I let him in, closed the door with care, and, after giving a call to the second mate, returned on deck for my relief. "Not much sign of any wind yet," I remarked when he approached. "No, sir. Not much," he assented, sleepily, in his hoarse voice, with just enough deference, no more, and barely suppressing a yawn. "Well, that's all you have to look out for. You have got your orders." "Yes, sir." I paced a turn or two on the poop and saw him take up his position face forward with his elbow in the ratlines of the mizzen rigging before I went below. The mate's faint snoring was still going on peacefully. The cuddy lamp was burning over the table on which stood a vase with flowers, a polite attention from the ship's provision merchant--the last flowers we should see for the next three months at the very least. Two bunches of bananas hung from the beam symmetrically, one on each side of the rudder casing. Everything was as before in the ship--except that two of her captain's sleeping suits were simultaneously in use, one motionless in the cuddy, the other keeping very still in the captain's stateroom. It must be explained here that my cabin had the form of the capital letter L, the door being within the angle and opening into the short part of the letter. A couch was to the left, the bed place to the right; my writing desk and the chronometers' table faced the door. But anyone opening it, unless he stepped right inside, had no view of what I call the long (or vertical) part of the letter. It contained some lockers surmounted by a bookcase; and a few clothes, a thick jacket or two, caps, oilskin coat, and such like, hung on hooks. There was at the bottom of that part a door opening into my bathroom, which could be entered also directly from the saloon. But that way was never used. The mysterious arrival had discovered the advantage of this particular shape. Entering my room, lighted strongly by a big bulkhead lamp swung on gimbals above my writing desk, I did not see him anywhere till he stepped out quietly from behind the coats hung in the recessed part. "I heard somebody moving about, and went in there at once," he whispered. I, too, spoke under my breath. "Nobody is likely to come in here without knocking and getting permission." He nodded. His face was thin and the sunburn faded, as though he had been ill. And no wonder. He had been, I heard presently, kept under arrest in his cabin for nearly seven weeks. But there was nothing sickly in his eyes or in his expression. He was not a bit like me, really; yet, as we stood leaning over my bed place, whispering side by side, with our dark heads together and our backs to the door, anybody bold enough to open it stealthily would have been treated to the uncanny sight of a double captain busy talking in whispers with his other self. "But all this doesn't tell me how you came to hang on to our side ladder," I inquired, in the hardly audible murmurs we used, after he had told me something more of the proceedings on board the Sephora once the bad weather was over. "When we sighted Java Head I had had time to think all those matters out several times over. I had six weeks of doing nothing else, and with only an hour or so every evening for a tramp on the quarter-deck." He whispered, his arms folded on the side of my bed place, staring through the open port. And I could imagine perfectly the manner of this thinking out--a stubborn if not a steadfast operation; something of which I should have been perfectly incapable. "I reckoned it would be dark before we closed with the land," he continued, so low that I had to strain my hearing near as we were to each other, shoulder touching shoulder almost. "So I asked to speak to the old man. He always seemed very sick when he came to see me--as if he could not look me in the face. You know, that foresail saved the ship. She was too deep to have run long under bare poles. And it was I that managed to set it for him. Anyway, he came. When I had him in my cabin--he stood by the door looking at me as if I had the halter round my neck already--I asked him right away to leave my cabin door unlocked at night while the ship was going through Sunda Straits. There would be the Java coast within two or three miles, off Angier Point. I wanted nothing more. I've had a prize for swimming my second year in the Conway." "I can believe it," I breathed out. "God only knows why they locked me in every night. To see some of their faces you'd have thought they were afraid I'd go about at night strangling people. Am I a murdering brute? Do I look it? By Jove! If I had been he wouldn't have trusted himself like that into my room. You'll say I might have chucked him aside and bolted out, there and then--it was dark already. Well, no. And for the same reason I wouldn't think of trying to smash the door. There would have been a rush to stop me at the noise, and I did not mean to get into a confounded scrimmage. Somebody else might have got killed--for I would not have broken out only to get chucked back, and I did not want any more of that work. He refused, looking more sick than ever. He was afraid of the men, and also of that old second mate of his who had been sailing with him for years--a gray-headed old humbug; and his steward, too, had been with him devil knows how long--seventeen years or more--a dogmatic sort of loafer who hated me like poison, just because I was the chief mate. No chief mate ever made more than one voyage in the Sephora, you know. Those two old chaps ran the ship. Devil only knows what the skipper wasn't afraid of (all his nerve went to pieces altogether in that hellish spell of bad weather we had)--of what the law would do to him--of his wife, perhaps. Oh, yes! she's on board. Though I don't think she would have meddled. She would have been only too glad to have me out of the ship in any way. The 'brand of Cain' business, don't you see. That's all right. I was ready enough to go off wandering on the face of the earth--and that was price enough to pay for an Abel of that sort. Anyhow, he wouldn't listen to me. 'This thing must take its course. I represent the law here.' He was shaking like a leaf. 'So you won't?' 'No!' 'Then I hope you will be able to sleep on that,' I said, and turned my back on him. 'I wonder that you can,' cries he, and locks the door. "Well after that, I couldn't. Not very well. That was three weeks ago. We have had a slow passage through the Java Sea; drifted about Carimata for ten days. When we anchored here they thought, I suppose, it was all right. The nearest land (and that's five miles) is the ship's destination; the consul would soon set about catching me; and there would have been no object in holding to these islets there. I don't suppose there's a drop of water on them. I don't know how it was, but tonight that steward, after bringing me my supper, went out to let me eat it, and left the door unlocked. And I ate it--all there was, too. After I had finished I strolled out on the quarter-deck. I don't know that I meant to do anything. A breath of fresh air was all I wanted, I believe. Then a sudden temptation came over me. I kicked off my slippers and was in the water before I had made up my mind fairly. Somebody heard the splash and they raised an awful hullabaloo. 'He's gone! Lower the boats! He's committed suicide! No, he's swimming.' Certainly I was swimming. It's not so easy for a swimmer like me to commit suicide by drowning. I landed on the nearest islet before the boat left the ship's side. I heard them pulling about in the dark, hailing, and so on, but after a bit they gave up. Everything quieted down and the anchorage became still as death. I sat down on a stone and began to think. I felt certain they would start searching for me at daylight. There was no place to hide on those stony things--and if there had been, what would have been the good? But now I was clear of that ship, I was not going back. So after a while I took off all my clothes, tied them up in a bundle with a stone inside, and dropped them in the deep water on the outer side of that islet. That was suicide enough for me. Let them think what they liked, but I didn't mean to drown myself. I meant to swim till I sank--but that's not the same thing. I struck out for another of these little islands, and it was from that one that I first saw your riding light. Something to swim for. I went on easily, and on the way I came upon a flat rock a foot or two above water. In the daytime, I dare say, you might make it out with a glass from your poop. I scrambled up on it and rested myself for a bit. Then I made another start. That last spell must have been over a mile." His whisper was getting fainter and fainter, and all the time he stared straight out through the porthole, in which there was not even a star to be seen. I had not interrupted him. There was something that made comment impossible in his narrative, or perhaps in himself; a sort of feeling, a quality, which I can't find a name for. And when he ceased, all I found was a futile whisper: "So you swam for our light?" "Yes--straight for it. It was something to swim for. I couldn't see any stars low down because the coast was in the way, and I couldn't see the land, either. The water was like glass. One might have been swimming in a confounded thousand-feet deep cistern with no place for scrambling out anywhere; but what I didn't like was the notion of swimming round and round like a crazed bullock before I gave out; and as I didn't mean to go back... No. Do you see me being hauled back, stark naked, off one of these little islands by the scruff of the neck and fighting like a wild beast? Somebody would have got killed for certain, and I did not want any of that. So I went on. Then your ladder--" "Why didn't you hail the ship?" I asked, a little louder. He touched my shoulder lightly. Lazy footsteps came right over our heads and stopped. The second mate had crossed from the other side of the poop and might have been hanging over the rail for all we knew. "He couldn't hear us talking--could he?" My double breathed into my very ear, anxiously. His anxiety was in answer, a sufficient answer, to the question I had put to him. An answer containing all the difficulty of that situation. I closed the porthole quietly, to make sure. A louder word might have been overheard. "Who's that?" he whispered then. "My second mate. But I don't know much more of the fellow than you do." And I told him a little about myself. I had been appointed to take charge while I least expected anything of the sort, not quite a fortnight ago. I didn't know either the ship or the people. Hadn't had the time in port to look about me or size anybody up. And as to the crew, all they knew was that I was appointed to take the ship home. For the rest, I was almost as much of a stranger on board as himself, I said. And at the moment I felt it most acutely. I felt that it would take very little to make me a suspect person in the eyes of the ship's company. He had turned about meantime; and we, the two strangers in the ship, faced each other in identical attitudes. "Your ladder--" he murmured, after a silence. "Who'd have thought of finding a ladder hanging over at night in a ship anchored out here! I felt just then a very unpleasant faintness. After the life I've been leading for nine weeks, anybody would have got out of condition. I wasn't capable of swimming round as far as your rudder chains. And, lo and behold! there was a ladder to get hold of. After I gripped it I said to myself, 'What's the good?' When I saw a man's head looking over I thought I would swim away presently and leave him shouting--in whatever language it was. I didn't mind being looked at. I--I liked it. And then you speaking to me so quietly--as if you had expected me--made me hold on a little longer. It had been a confounded lonely time--I don't mean while swimming. I was glad to talk a little to somebody that didn't belong to the Sephora. As to asking for the captain, that was a mere impulse. It could have been no use, with all the ship knowing about me and the other people pretty certain to be round here in the morning. I don't know--I wanted to be seen, to talk with somebody, before I went on. I don't know what I would have said.... 'Fine night, isn't it?' or something of the sort." "Do you think they will be round here presently?" I asked with some incredulity. "Quite likely," he said, faintly. "He looked extremely haggard all of a sudden. His head rolled on his shoulders. "H'm. We shall see then. Meantime get into that bed," I whispered. "Want help? There." It was a rather high bed place with a set of drawers underneath. This amazing swimmer really needed the lift I gave him by seizing his leg. He tumbled in, rolled over on his back, and flung one arm across his eyes. And then, with his face nearly hidden, he must have looked exactly as I used to look in that bed. I gazed upon my other self for a while before drawing across carefully the two green serge curtains which ran on a brass rod. I thought for a moment of pinning them together for greater safety, but I sat down on the couch, and once there I felt unwilling to rise and hunt for a pin. I would do it in a moment. I was extremely tired, in a peculiarly intimate way, by the strain of stealthiness, by the effort of whispering and the general secrecy of this excitement. It was three o'clock by now and I had been on my feet since nine, but I was not sleepy; I could not have gone to sleep. I sat there, fagged out, looking at the curtains, trying to clear my mind of the confused sensation of being in two places at once, and greatly bothered by an exasperating knocking in my head. It was a relief to discover suddenly that it was not in my head at all, but on the outside of the door. Before I could collect myself the words "Come in" were out of my mouth, and the steward entered with a tray, bringing in my morning coffee. I had slept, after all, and I was so frightened that I shouted, "This way! I am here, steward," as though he had been miles away. He put down the tray on the table next the couch and only then said, very quietly, "I can see you are here, sir." I felt him give me a keen look, but I dared not meet his eyes just then. He must have wondered why I had drawn the curtains of my bed before going to sleep on the couch. He went out, hooking the door open as usual. I heard the crew washing decks above me. I knew I would have been told at once if there had been any wind. Calm, I thought, and I was doubly vexed. Indeed, I felt dual more than ever. The steward reappeared suddenly in the doorway. I jumped up from the couch so quickly that he gave a start. "What do you want here?" "Close your port, sir--they are washing decks." "It is closed," I said, reddening. "Very well, sir." But he did not move from the doorway and returned my stare in an extraordinary, equivocal manner for a time. Then his eyes wavered, all his expression changed, and in a voice unusually gentle, almost coaxingly: "May I come in to take the empty cup away, sir?" "Of course!" I turned my back on him while he popped in and out. Then I unhooked and closed the door and even pushed the bolt. This sort of thing could not go on very long. The cabin was as hot as an oven, too. I took a peep at my double, and discovered that he had not moved, his arm was still over his eyes; but his chest heaved; his hair was wet; his chin glistened with perspiration. I reached over him and opened the port. "I must show myself on deck," I reflected. Of course, theoretically, I could do what I liked, with no one to say nay to me within the whole circle of the horizon; but to lock my cabin door and take the key away I did not dare. Directly I put my head out of the companion I saw the group of my two officers, the second mate barefooted, the chief mate in long India-rubber boots, near the break of the poop, and the steward halfway down the poop ladder talking to them eagerly. He happened to catch sight of me and dived, the second ran down on the main-deck shouting some order or other, and the chief mate came to meet me, touching his cap. There was a sort of curiosity in his eye that I did not like. I don't know whether the steward had told them that I was "queer" only, or downright drunk, but I know the man meant to have a good look at me. I watched him coming with a smile which, as he got into point-blank range, took effect and froze his very whiskers. I did not give him time to open his lips. "Square the yards by lifts and braces before the hands go to breakfast." It was the first particular order I had given on board that ship; and I stayed on deck to see it executed, too. I had felt the need of asserting myself without loss of time. That sneering young cub got taken down a peg or two on that occasion, and I also seized the opportunity of having a good look at the face of every foremast man as they filed past me to go to the after braces. At breakfast time, eating nothing myself, I presided with such frigid dignity that the two mates were only too glad to escape from the cabin as soon as decency permitted; and all the time the dual working of my mind distracted me almost to the point of insanity. I was constantly watching myself, my secret self, as dependent on my actions as my own personality, sleeping in that bed, behind that door which faced me as I sat at the head of the table. It was very much like being mad, only it was worse because one was aware of it. I had to shake him for a solid minute, but when at last he opened his eyes it was in the full possession of his senses, with an inquiring look. "All's well so far," I whispered. "Now you must vanish into the bathroom." He did so, as noiseless as a ghost, and then I rang for the steward, and facing him boldly, directed him to tidy up my stateroom while I was having my bath--"and be quick about it." As my tone admitted of no excuses, he said, "Yes, sir," and ran off to fetch his dustpan and brushes. I took a bath and did most of my dressing, splashing, and whistling softly for the steward's edification, while the secret sharer of my life stood drawn up bolt upright in that little space, his face looking very sunken in daylight, his eyelids lowered under the stern, dark line of his eyebrows drawn together by a slight frown. When I left him there to go back to my room the steward was finishing dusting. I sent for the mate and engaged him in some insignificant conversation. It was, as it were, trifling with the terrific character of his whiskers; but my object was to give him an opportunity for a good look at my cabin. And then I could at last shut, with a clear conscience, the door of my stateroom and get my double back into the recessed part. There was nothing else for it. He had to sit still on a small folding stool, half smothered by the heavy coats hanging there. We listened to the steward going into the bathroom out of the saloon, filling the water bottles there, scrubbing the bath, setting things to rights, whisk, bang, clatter--out again into the saloon--turn the key--click. Such was my scheme for keeping my second self invisible. Nothing better could be contrived under the circumstances. And there we sat; I at my writing desk ready to appear busy with some papers, he behind me out of sight of the door. It would not have been prudent to talk in daytime; and I could not have stood the excitement of that queer sense of whispering to myself. Now and then, glancing over my shoulder, I saw him far back there, sitting rigidly on the low stool, his bare feet close together, his arms folded, his head hanging on his breast--and perfectly still. Anybody would have taken him for me. I was fascinated by it myself. Every moment I had to glance over my shoulder. I was looking at him when a voice outside the door said: "Beg pardon, sir." "Well!..." I kept my eyes on him, and so when the voice outside the door announced, "There's a ship's boat coming our way, sir," I saw him give a start--the first movement he had made for hours. But he did not raise his bowed head. "All right. Get the ladder over." I hesitated. Should I whisper something to him? But what? His immobility seemed to have been never disturbed. What could I tell him he did not know already?... Finally I went on deck.

Summary: As dusk begins to fall, the unnamed narrator of the story stands on the deck of his ship, currently anchored at the mouth of the Meinam River in the Gulf of Siam. The narrator is the Captain of the ship who leaves the deck to eat supper with his mates. The time is approximately eight o'clock. At supper, the Captain remarks that he saw the masts of a ship anchored amongst some nearby islands. The Chief Mate explains that the ship to which the Captain is referring is probably another English one, waiting for the right moment to sail home with a favorable tide. The Second Mate elaborates: The ship is the Sephora, from Liverpool, and is bound home from Cardiff with a cargo of coal. The Captain makes a magnanimous gesture by offering to take the anchor watch himself until one o'clock, after which time he will get the Second Mate to relieve him. Again alone on deck, the Captain meditatively smokes a cigar and again considers his own "strangeness" to the ship and its command. The rest of the crew sleeps soundly. The Captain notices that the rope side ladder, hung over the side of the ship to accommodate the skipper of the tugboat, has not been brought in. As he begins to pull it, he feels a jerk at the other end and curious, looks over the rail into the sea. He sees a naked man floating in the water and holding the end of the ladder. The man introduces himself as Leggatt. He has been in the water since nine o'clock, which makes the Captain consider his strength and youth. Leggatt climbs up the ladder and the Captain rushes to his cabin to fetch him some clothes. The Captain learns that Leggatt was the chief mate of the Sephora and that he accidentally killed a fellow crewman. Although Leggatt unintentionally murdered the man, the Skipper stripped Leggatt of his title. The Captain tells Leggatt that they should retire to his cabin so as not to be discovered by the Chief Mate. The Captain hides Leggatt in his cabin, returns to the deck, summons the Chief Mate to take over the anchor watch, and returns to his cabin. Leggatt continues his story: After killing the man, he was placed under arrest and kept in his cabin for almost seven weeks. Approximately six weeks into his confinement, Leggatt asked to see the Skipper and asked him to leave his door unlocked that night, while the Sephora sailed through the Sunda Straits, so that he could jump off and swim to the Java coast. The Skipper refused. Three weeks later, the Sephora came to its present location, and Leggatt discovered that the ship's steward -- wholly by accident -- had left the door to his cabin unlocked. Leggatt wandered onto the deck and jumped off into the sea. He swam to a nearby islet while the Sephora's crew lowered a boat to search for him. Leggatt removed his clothes and sank them, determined never to return. He swam to another small island, saw the riding light of the Captain's ship, and swam to it. Eventually, he reached the rope ladder, completely exhausted after swimming over a mile. The Captain helps Leggatt into his bed, where he falls asleep immediately. The Captain eventually falls asleep himself; the next morning, the steward enters the Captain's cabin to bring him his morning coffee. The Captain becomes more paranoid that someone will discover Leggatt and decides that he must show himself on deck. The Captain learns that a ship's boat is coming toward their ship. He orders the ladder to be dropped over the side and leaves Leggatt to meet who he is sure will be the Skipper of the Sephora, searching for Leggatt.

booksum

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Intergenerational Financial Obligations Reform Act'' or the ``INFORM Act''. SEC. 2. DEFINITIONS. In this Act: (1) Fiscal gap.--The term ``fiscal gap'' means an economic analysis that-- (A) calculates the difference between the present value of all projected future Federal spending, including interest and principal payments on the initial outstanding debt, and the present value of all projected future Federal revenues, over an infinite time horizon; (B) calculates the permanent Federal revenue increases and spending reductions and identifies the combination of fiscal policy options starting in the budget year, and 5, 10, 15, and 25 years after the budget year, needed to eliminate the infinite horizon fiscal gap calculated as of the budget year; and (C) calculates the increases in the levels of annual rates of economic growth factors, including technological change, labor productivity, and capital deepening, starting in the budget year, and 5, 10, 15, and 25 years after the budget year, needed to eliminate the infinite horizon fiscal gap calculated as of the budget year. (2) Generation.--The term ``generation'' means a 1-year age cohort. (3) Generational accounting.--The term ``generational accounting'' means an economic analysis that calculates-- (A) the projected present value lifetime net Federal tax burden facing each living adult generation over 18 years of age; and (B) the present value lifetime net Federal tax burdens facing each current generation of children 18 years of age and under, as well as each future generation, assuming-- (i) the sum of all present value lifetime net Federal tax burdens facing each current generation of children 18 years of age and under, as well as each future generation, covers the present value of future discretionary spending, including interest and principal payments on the initial outstanding debt, less the sum of all present value lifetime net Federal tax burdens facing living adult generations over 18 years of age; and (ii) the lifetime net Federal tax burden of generations 18 years of age and under, as well as future generations, increases with year of birth at the projected growth rate of labor productivity. (4) Net federal tax burden.--The term ``net Federal tax burden'' means the difference between Federal taxes paid and transfer payments received. SEC. 3. THE CONGRESSIONAL BUDGET OFFICE REPORT. Section 202(e) of the Congressional Budget Act of 1974 is amended by inserting at the end the following: ``(4)(A) For any legislation or resolution considered in the Senate or the House of Representatives that would impact revenues or mandatory spending by greater than 0.5 percent of gross domestic product over the following 10-fiscal year period and upon request relating to such legislation or resolution by the Chairmen or Ranking Members of the Committees on the Budget of the House of Representatives or the Senate, the Congressional Budget Office shall be required to provide, with respect to such legislation or resolution-- ``(i) a fiscal gap and generational accounting analysis, including the change in the fiscal gap and generational accounting analysis relative to the baseline; and ``(ii) the Federal deficit, at current spending levels, in the fiscal year that is 75 years and the stock of the debt in the 75th year after the fiscal year in which the legislation is being considered. ``(B) In this paragraph-- ``(i) the term `fiscal gap' means an economic analysis that-- ``(I) calculates the difference between the present value of all projected future Federal spending, including interest and principal payments on the initial outstanding debt, and the present value of all projected future Federal revenues, over an infinite time horizon; ``(II) calculates the permanent Federal revenue increases and spending reductions and identifies the combination of fiscal policy options starting in the budget year, and 5, 10, 15, and 25 years after the budget year, needed to eliminate the infinite horizon fiscal gap calculated as of the budget year; and ``(III) calculates the increases in the levels of annual rates of economic growth factors, including technological change, labor productivity, and capital deepening, starting in the budget year, and 5, 10, 15, and 25 years after the budget year, needed to eliminate the infinite horizon fiscal gap calculated as of the budget year; ``(ii) the term `generation' means a 1-year age cohort; ``(iii) the term `generational accounting' means an economic analysis that calculates-- ``(I) the projected present value lifetime net Federal tax burden facing each living adult generation over 18 years of age; and ``(II) the present value lifetime net Federal tax burdens facing each current generation of children 18 years of age and under, as well as each future generation, assuming-- ``(aa) the sum of all present value lifetime net Federal tax burdens facing each current generation of children 18 years of age and under, as well as each future generation, covers the present value of future discretionary spending, including interest and principal payments on the initial outstanding debt, less the sum of all present value lifetime net Federal tax burdens facing living adult generations over 18 years of age; and ``(bb) the lifetime net Federal tax burden of generations 18 years of age and under, as well as future generations, increases with year of birth at the projected growth rate of labor productivity; and ``(iv) the term `net Federal tax burden' means the difference between Federal taxes paid and transfer payments received.''. SEC. 4. CBO ANNUAL REPORT. (a) In General.--The Congressional Budget Office shall produce an annual fiscal gap and generational accounting analysis within its annual ``Long-Term Budget Outlook''. (b) Public Report.--The Director of the Congressional Budget Office shall post the report described in subsection (a) on the Congressional Budget Office public website. SEC. 5. GAO ANNUAL REPORT. (a) In General.--The Comptroller General shall produce an annual fiscal gap and generational accounting analysis within its annual ``Long-Term Fiscal Outlook''. (b) Public Report.--The Comptroller General shall post the report described in subsection (a) on the General Accountability Office public website. SEC. 6. THE PRESIDENT'S BUDGET. Section 1105 of title 31, United States Code, is amended-- (1) in subsection (a), by-- (A) redesignating paragraph (37) following paragraph (38) as paragraph (39); and (B) adding at the end the following: ``(40) an analysis including-- ``(A) a fiscal gap and generational accounting analysis of the full budget proposal; ``(B) a fiscal gap and generational accounting analysis of specific policy changes that would impact revenues or mandatory spending by greater than 0.5 percent of gross domestic product over the following 10-fiscal year period; and ``(C) the Federal deficit, at current spending levels, in the fiscal year that is 75 years and the stock of the debt in the 75th year after the fiscal year in which the policy is being considered.''; and (2) by inserting at the end the following: ``(i) For purposes of subsection (a)(40)-- ``(1) the term `fiscal gap' means an economic analysis that-- ``(A) calculates the difference between the present value of all projected future Federal spending, including interest and principal payments on the initial outstanding debt, and the present value of all projected future Federal revenues, over an infinite time horizon; ``(B) calculates the permanent Federal revenue increases and spending reductions and identifies the combination of fiscal policy options starting in the budget year, and 5, 10, 15, and 25 years after the budget year, needed to eliminate the infinite horizon fiscal gap calculated as of the budget year; and ``(C) the increases in the levels of annual rates of economic growth factors, including technological change, labor productivity, and capital deepening, starting in the budget year, and 5, 10, 15, and 25 years after the budget year, needed to eliminate the infinite horizon fiscal gap calculated as of the budget year; ``(2) the term `generation' means a 1-year age cohort; ``(3) the term `generational accounting' means an economic analysis that calculates-- ``(A) the projected present value lifetime net Federal tax burden facing each living adult generation over 18 years of age; and ``(B) the present value lifetime net Federal tax burdens facing each current generation of children 18 years of age and under, as well as each future generation, assuming-- ``(i) the sum of all present value lifetime net Federal tax burdens facing each current generation of children 18 years of age and under, as well as each future generation, covers the present value of future discretionary spending, including interest and principal payments on the initial outstanding debt, less the sum of all present value lifetime net Federal tax burdens facing living adult generations over 18 years of age; and ``(ii) the lifetime net Federal tax burden of generations 18 years of age and under, as well as future generations, increases with year of birth at the projected growth rate of labor productivity; and ``(4) the term `net Federal tax burden' means the difference between Federal taxes paid and transfer payments received.''.

Title: INFORM Act Summary: Intergenerational Financial Obligations Reform Act or INFORM Act - Amends the Congressional Budget Act of 1974 to require the Congressional Budget Office (CBO) to provide certain information on any legislation or resolution considered in either chamber which would impact revenues or mandatory spending by greater than 0.5% of gross domestic product (GDP) over the following 10-fiscal-year period, and upon request by the Chairmen or Ranking Members of the congressional budget committees. Requires such information to comprise: a fiscal gap and generational accounting analysis, including any change in the analysis relative to the baseline; and the federal deficit, at current spending levels, in the fiscal year that is 75 years after the fiscal year in which the legislation is being considered, as well as the stock of the debt in that 75th year. Requires: (1) CBO to produce an annual fiscal gap and generational accounting analysis within its annual "Long-Term Budget Outlook" and post it on the CBO public website, and (2) the Comptroller General to produce a separate similar analysis within its annual "Long-Term Fiscal Outlook" and post it on the General Accountability Office (GAO) public website. Requires the President's budget submission to Congress to include: a fiscal gap and generational accounting analysis of the full budget proposal; the same kind of analysis of specific policy changes that would impact revenues or mandatory spending by greater than 0.5% of GDP over the following 10-fiscal year period; and the federal deficit, at current spending levels, in the fiscal year that is 75 years after the fiscal year in which the legislation is being considered, as well as the stock of the debt in that 75th year.

billsum

en

Summarize: Keith Richards is plotting a children's book, due out this fall. The Rolling Stones guitarist has inked a deal with Little, Brown Books for Young Readers to publish a picture book called "Gus & Me: The Story of My Granddad and My First Guitar." Little, Brown Books for Young Readers Due Sept. 9, the autobiographical book will feature illustrations by Richards' daughter Theodora Richards and was written in conjunction with Barnaby Harris and Bill Shapiro. The book was inspired by the rocker's childhood -- specifically his grandfather, Theodore Augustus Dupree (known as Gus), who was in a jazz big band. Richards' artist daughter was named after the grandfather, too. "I have just become a grandfather for the fifth time, so I know what I'm talking about," said Richards. who has five children. "The bond, the special bond, between kids and grandparents is unique and should be treasured. This is a story of one of those magical moments. May I be as great a grandfather as Gus was to me." This isn't Richards' first book. In 2010, he released his memoir, "Life." Gus & Me: The Story of My Granddad and My First Guitar was inspired by the rock god's own introduction to music Legendary Rolling Stones guitarist Keith Richards is to publish a children's book, with illustrations by his daughter. Gus & Me: The Story of My Granddad and My First Guitar is about Richards' grandfather, Theodore Augustus Dupree, who played in a jazz big band and introduced the young Keith to music. "I have just become a grandfather for the fifth time, so I know what I'm talking about," Keith Richards said. "The bond, the special bond, between kids and grandparents is unique and should be treasured. This is a story of one of those magical moments. May I be as great a grandfather as Gus was to me." Richards' daughter Theodora Dupree Richards, who is named after Gus, will be illustrating the book with pen and ink collages inspired by photographs of Richards' childhood. Detail from Theodora Richards' artwork for Gus and Me "When I found out they wanted me to be a part of this project, my immediate instinct was to say yes, and I am so happy I did," commented Theodora. "To be able to explore my father's relationship with his grandfather was a gift in itself." Gus & Me, written "with" Barnaby Harris and Bill Shapiro will also contain photos from the Richards family collection. Richards is not the first ageing musician to mellow into children's literature; in recent years, Bob Dylan, Madonna, Paul McCartney and Ringo Starr have all released picture books with varying degrees of success. Richards has dabbled with writing books before: the first 10 pages of his memoir, Life, reportedly netted him a US$7.3 million deal, and the book subsequently sold over 2m copies worldwide. One of the pivotal moments in Gus & Me, when Keith is handed his first guitar by his grandfather, also appears in Life. Gus & Me will be published as a hardcover and an e-book by Orion Children's Books in September.

Summary: Keith Richards is 70 now and a grandfather five times over, so maybe the idea of the Stones' guitarist writing a kids' book isn't as jarring as it once might have been. Richards is writing an homage to his own grandfather in Gus & Me: The Story of My Granddad and My First Guitar, reports the Guardian. As the title suggests, it's about how his grandfather, jazz musician Theodore Augustus Dupree, introduced him to music. Richards' daughter Theodora will do the illustrations for the book, which is due out in September. It follows the 2010 release of his autobiography, Life, notes CBS.

multi_news

en

Write a title and summarize: That the following sums are appropriated, out of any money in the Treasury not otherwise appropriated, for fiscal year 2015, and for other purposes, namely: DEPARTMENT OF JUSTICE Office of Justice Programs state and local law enforcement assistance For an additional amount for ``State and Local Law Enforcement Assistance'', $140,000,000, to remain available until September 30, 2016, of which-- (1) $115,000,000 is for the Edward Byrne Memorial Justice Assistance Grant program, of which $15,000,000 is for the Edward Byrne Memorial criminal justice innovation program; (2) $5,000,000 is for Drug Courts; (3) $5,000,000 is for mental health courts; (4) $10,000,000 is for competitive and evidence-based programs to reduce gun crime and gang violence; and (5) $5,000,000 is for a veterans treatment courts program. juvenile justice programs For an additional amount for ``Juvenile Justice Programs'', $10,000,000, to remain available until September 30, 2016, for community-based violence prevention initiatives, including for public health approaches to reducing shootings and violence. Community Oriented Policing Services community oriented policing services programs For an additional amount for ``Community Oriented Policing Services Programs'', $30,000,000, to remain available until September 30, 2016, of which-- (1) $15,000,000 is for competitive grants to State law enforcement agencies in States with high seizures of precursor chemicals, finished methamphetamine, laboratories, and laboratory dump seizures: Provided, That funds appropriated under this paragraph shall be utilized for investigative purposes to locate or investigate illicit activities, including precursor diversion, laboratories, or methamphetamine traffickers; and (2) $15,000,000 is for competitive grants to statewide law enforcement agencies in States with high rates of primary treatment admissions for heroin and other opioids: Provided, That these funds shall be utilized for investigative purposes to locate or investigate illicit activities, including activities related to the distribution of heroin or unlawful distribution of prescription opioids, or unlawful heroin and prescription opioid traffickers through statewide collaboration. INDEPENDENT AGENCIES Small Business Administration entrepreneurial development programs For an additional amount for ``Entrepreneurial Development Programs'', $4,000,000, to remain available until September 30, 2016. business loans program account For an additional amount for ``Business Loans Program Account'', $1,000,000, to remain available until expended, for the cost of direct loans. DEPARTMENT OF LABOR Employment and Training Administration training and employment services For an additional amount for ``Training and Employment Services'', $265,000,000, to remain available until September 30, 2016. DEPARTMENT OF HEALTH AND HUMAN SERVICES Health Resources and Services Administration maternal and child health For an additional amount for the Healthy Start Initiative under section 330H of the Public Health Service Act (42 U.S.C. 254c-8), $50,000,000, to remain available until September 30, 2016. Substance Abuse and Mental Health Services Administration substance abuse treatment For an additional amount for drug court grants as authorized under section 509 of the Public Health Service Act, $10,000,000, to remain available until September 30, 2016. DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT Public and Indian Housing choice neighborhoods initiative For an additional amount for ``Choice Neighborhoods Initiative'', $170,000,000, to remain available until September 30, 2016. Community Planning and Development community development fund (including transfer of funds) For an additional amount for ``Community Development Fund'', $500,000,000, to remain available until September 30, 2016, for necessary expenses related to emergency response, long-term recovery, restoration of infrastructure and housing, and economic revitalization in the most impacted and distressed areas resulting from sudden violence, civil unrest or other major disturbance affecting human life and safety in calendar year 2015, for activities authorized under title I of the Housing and Community Development Act of 1974 (42 U.S.C. 5301 et seq.): Provided, That funds shall be awarded to a State, tribe, or unit of general local government as a grantee at the discretion of the Secretary of Housing and Urban Development for distressed communities determined by the Secretary to be distressed due to insufficient capacity to respond to and recover from the unanticipated event and objectively measurable criteria such as high levels of racial or income segregation, or both, low levels of employment among 16 to 64 year olds, low levels of college enrollment or employment for low-income youth aged 17 to 25, concentrations of poor-performing schools, high rates of infant mortality, large numbers of vacant and abandoned homes, and low-income populations in close proximity to brownfields or other environmentally hazardous areas: Provided further, That prior to the obligation of funds, a grantee shall submit a plan to the Secretary for approval detailing the proposed use of all funds, including criteria for eligibility and how the use of these funds will address long-term recovery and restoration of infrastructure and housing and economic revitalization in the most impacted and distressed areas: Provided further, That the Secretary shall by notice specify the criteria for approval of such plans within 45 days of enactment of this Act: Provided further, That if the Secretary determines that a plan does not meet such criteria, the Secretary shall disapprove the plan: Provided further, That funds allocated under this heading shall not be considered relevant to the non-emergency formula allocations made pursuant to section 106 of the Housing and Community Development Act of 1974 (42 U.S.C. 5306): Provided further, That the Secretary shall provide grantees with training on grant management, including on the use of contracts and subrecipient agreements, and shall require grantees to incorporate performance requirements and penalties into any such contracts or subrecipient agreements: Provided further, That, in administering the funds under this heading, the Secretary may waive, or specify alternative requirements for, any provision of any statute or regulation that the Secretary administers in connection with the obligation by the Secretary or the use by the recipient of these funds (except for requirements related to fair housing, nondiscrimination, labor standards, and the environment) pursuant to a determination by the Secretary that good cause exists for the waiver or alternative requirement and that such action is not inconsistent with the overall purposes of title I of the Housing and Community Development Act of 1974 (42 U.S.C. 5301 et seq.): Provided further, That, notwithstanding any other provision of law, the Secretary may use up to 30 percent of these funds to supplement existing, competitively awarded agreements for technical assistance to provide immediate community response, recovery, and revitalization assistance to affected communities: Provided further, That, of the funds made available under this heading, up to $10,000,000 may be transferred to ``Program Office Salaries and Expenses--Community Planning and Development'' or to ``Department of Housing and Urban Development--Office of Inspector General'', for necessary costs, including information technology costs, of administering and overseeing funds made available under this heading. Office of Lead Hazard Control and Healthy Homes lead hazard reduction For an additional amount for ``Lead Hazard Reduction'', $30,000,000, to remain available until September 30, 2016. GENERAL PROVISIONS moving-to-work Sec. 101. The Secretary of Housing and Urban Development shall extend the current Moving-to-Work agreements of previously designated participating agencies until the end of each such agency's fiscal year 2028 under the same terms and conditions of such current agreements, except for any changes to such terms or conditions otherwise mutually agreed upon by the Secretary and any such agency and such extension agreements shall prohibit any statutory offset of any reserve balances equal to four months of operating expenses. Any such reserve balances that exceed such amount shall remain available to any such agency for all permissible purposes under such agreement unless subject to a statutory offset. In addition to other reporting requirements, all Moving-to-Work agencies shall report financial data to the Department of Housing and Urban Development as specified by the Secretary, so that the effect of Moving-to-Work policy changes can be measured. emergency designation Sec. 102. Each amount provided in this Act is designated by Congress as an emergency requirement pursuant to section 251(b)(2)(A)(i) of the Balanced Budget and Emergency Deficit Control Act of 1985, except that each amount shall be available only if the President subsequently so designates all such amounts and transmits such designations to the Congress. This Act may be cited as the ``Rebuilding Urban Inner Cities Is Long Overdue Act of 2015'' or the ``REBUILD Act''.

Title: REBUILD Act Summary: Rebuilding Urban Inner Cities Is Long Overdue Act of 2015 or the REBUILD Act Provides FY2015 supplemental appropriations for the Department of Justice (DOJ), the Small Business Administration (SBA), the Department of Labor, the Department of Health and Human Services (HHS), and the Department of Housing and Urban Development (HUD). Designates each amount provided by this bill as an emergency requirement, pursuant to the Balanced Budget and Emergency Deficit Control Act of 1985. Provides that the funds are only available if the President subsequently designates the amounts. (Emergency spending is exempt from discretionary spending limits and other budget enforcement rules.) Provides appropriations to DOJ for: the Office of Justice Programs, including State and Local Law Enforcement Assistance and Juvenile Justice Programs; and Community Oriented Policing Services (COPS). Provides appropriations to the SBA for Entrepreneurial Development Programs and the Business Loans Program Account. Provides appropriations to Labor for the Employment and Training Administration. Provides appropriations to HHS for the Health Resources and Services Administration and the Substance Abuse and Mental Health Services Administration. Provides appropriations to HUD for Public and Indian Housing, Community Planning and Development, and the Office of Lead Hazard Control and Healthy Homes. Requires HUD to extend current Moving to Work agreements of previously designated participating agencies until the end of FY2028, subject to specified requirements and restrictions. (Moving to Work is a demonstration program that provides HUD and local Public Housing Authorities flexibility to test alternative policies for providing housing assistance through the Section 8 Housing Choice Voucher program and the public housing program.)

billsum

en

Summarize: Chef Thomas Keller is known for amazing dishes at the three-Michelin-star Per Se in New York. The menu costs $325. Among the options: Oysters and pearls, a “Sabayon” of pearl tapioca with Island Creek oysters and white sturgeon caviar. Or how about the Wolfe Ranch white quail, with pumpkin purée, Medjool dates, English walnuts and toasted pumpkin seed jus at the French Laundry, in Yountville, California? To such fine creations, chef Keller has added something extra special. A new hot dog. The Thomas Keller Surf n' Turf will make its debut in December at Bubbledogs, a tiny London restaurant that serves Champagne and dogs. It's a frankfurter topped with minced Cornish lobster, dill pickle chips and celery. It will cost £12 ($14.60) and be available throughout the month. Thomas Keller. Photographer: Richard Vines/Bloomberg Bubbledogs owners Sandia Chang and James Knappett met while working at Per Se a decade ago, when he was a chef and she waited tables. They worked for Keller again when he opened the pop-up French Laundry at Harrods in London in 2011. The husband-and-wife team regularly invites chefs to create hot dogs for Bubbledogs. "We went Americana for this dog," Keller said. It combines an American hot dog and a New England lobster roll. "We start with a traditional buttered brioche, like you’d find in a New England lobster roll. We layer the bun with house-made dill pickles, and then, for the'relish,' we top the dog with chilled lobster salad and garnish it all with micro celery leaves. "I am a fan of both hot dogs and lobster rolls - childhood favorites, staples of sun-splashed picnics and afternoons spent at the ballpark." This isn't Keller's first dog. He has also developed the Yountwurst, which takes its name from the town of Yountville, home of the French Laundry as well as his Bouchon bakery and Ad Hoc casual restaurant. Chang said Keller has always been supportive, showing up within two weeks of Bubbledogs and its sister restaurant Kitchen Table opening in 2012. Other fans include Shake Shack founder Danny Meyer, who visits when in London. "I always do my best to support our alumni when they light out on their own," Keller said. Richard Vines is the chief food critic for Bloomberg. Follow him on Twitter @richardvines and Instagram @richard.vines. The lady had dropped her napkin. More accurately, she had hurled it to the floor in a fit of disillusionment, her small protest against the slow creep of mediocrity and missed cues during a four-hour dinner at Per Se that would cost the four of us close to $3,000. Some time later, a passing server picked up the napkin without pausing to see whose lap it was missing from, neatly embodying the oblivious sleepwalking that had pushed my guest to this point. Such is Per Se’s mystique that I briefly wondered if the failure to bring her a new napkin could have been intentional. The restaurant’s identity, to the extent that it has one distinct from that of its owner and chef, Thomas Keller, is based on fastidiously minding the tiniest details. This is the place, after all, that brought in a ballet dancer to help servers slip around the tables with poise. So I had to consider the chance that the server was just making a thoughtful accommodation to a diner with a napkin allergy. But in three meals this fall and winter, enough other things have gone awry in the kitchen and dining room to make that theory seem unlikely. Enough, also, to make the perception of Per Se as one of the country’s great restaurants, which I shared after visits in the past, appear out of date. Enough to suggest that the four-star rating it received from Sam Sifton in 2011, its most recent review in The New York Times, needs a hard look. With each fresh review, a restaurant has to earn its stars again. In its current form and at its current price, Per Se struggled and failed to do this, ranging from respectably dull at best to disappointingly flat-footed at worst. Chef Thomas Keller’s woes don’t seem to be abating. After a scathing New York Times review for his New York City restaurant Per Se in January (and a similar review from Eater), Keller, as well as The French Laundry in Napa Valley, and the Thomas Keller Restaurant Group are all being sued for pregnancy discrimination. Filed last month in Napa Superior Court, the Napa Valley Register reports that the lawsuit alleges that Vanessa Scott-Allen was prevented from working at The French Laundry because of her pregnancy. According to the Napa Valley Register, the complaint alleges that the restaurant group had approved a transfer of her job from Per Se to The French Laundry, but when TFL found out about her pregnancy, they terminated the offer — after she had left her five-year-old serving position at Per Se and moved her family out to California. According to the Napa Valley Register, Scott-Allen claims that after a visit to TFL in January when general manager Michael Minnillo (also named in the suit) told her that the restaurant “would love” to have her work there, she approached her Per Se manager Antonio Begonja about wanting to transfer, and notified him of her pregnancy. Reportedly, the managers worked out the transfer, and Scott-Allen said she was set to work at TFL starting on April 1, before which time she terminated her lease in New York, bought a car, and found a place to live in California. Scott-Allen’s start date was allegedly pushed back to April 4, when she claims that TFL manager Olivia Wallace asked her several questions about her pregnancy and plans for maternity leave, such as her due date, how long she would work until giving birth, and how long she planned for maternity leave. After that encounter, Scott-Allen was told the position was no longer available, nor was any other position (despite there being three positions open), according to the Napa Valley Register’s account of the lawsuit. The Napa Valley Register reports that on April 21, Scott-Allen filed a complaint with the California Department of Fair Employment and Housing and received a notice of case closure and right to sue, after which she filed the lawsuit in Napa Superior Court on September 26. The article states that she is seeking $5 million in damages for fraud and deceit, sex discrimination, violation of pregnancy disability leave law, negligent misrepresentation, breach of implied contract, wrongful termination, failure to prevent discrimination, and violations of labor codes and the California Family Rights Act. A case management conference is scheduled for March 7, 2017. Scott-Allen is reportedly demanding a jury trial. Eater SF has reached out to both The Thomas Keller Restaurant Group and Scott-Allen’s attorney for comment, with no immediate response. Stay tuned for more details. Close Get email notifications on Maria Sestito daily! Your notification has been saved. There was a problem saving your notification. Whenever Maria Sestito posts new content, you'll get an email delivered to your inbox with a link. Email notifications are only sent once a day, and only if there are new matching items.

Summary: California's French Laundry may have three Michelin stars, but it also has a discrimination lawsuit on its hands. The restaurant is accused of firing a server because she was pregnant, reports the Napa Valley Register. The suit also names chef Thomas Keller; the Thomas Keller Restaurant Group; and Keller's New York restaurant, Per Se. Server Vanessa Scott-Allen says she worked at Per Se for five years before she moved across the country to accept a gig at The French Laundry. But the job disappeared before she actually started, and Scott-Allen says that happened after a manager began asking her questions about how long she planned to be out on maternity leave. Scott-Allen is now seeking $5 million in damages for a slew of allegations, including fraud and deceit, and violation of the pregnancy disability leave law, according to her lawsuit filed last month in Napa County Superior Court. A rep for the Keller Restaurant Group says it doesn't comment on pending lawsuits. The suit comes at a rough time for Keller, notes Eater, given that a New York Times food critic delivered a scathing review of Per Se earlier this year. Bloomberg, meanwhile, notes that he's branching into fancy hot dogs in London.

multi_news

en

Summarize: Ew, Dad! That’s gross! With his two young daughters just feet away from him, Republican presidential contender Ted Cruz told the bizarre story of how he watched porn with Supreme Court Justice Sandra Day O’Connor. THE ONE TIME TED CRUZ TRIED TO BAN SEX TOYS IN TEXAS The Texas senator, his wife Heidi and their daughters — 8-year-old Caroline and 5-year-old Catherine — all took the stage at a CNN town hall Wednesday night, which also featured a strange story about Cruz's love of canned soup. Before discussing his relationship with his wife and Caroline’s upcoming birthday party, Cruz discussed how he once had to watch porn as part of his duties as a law clerk for the Supreme Court, a strange tale he first recounted in his 2015 memoir. Ted Cruz, his wife Heidi and their daughters spoke at a CNN town hall Wednesday night. (CNN) “The chapter begins with me watching pornography on the Internet with Sandra Day O’Connor, which was a bit of a bizarre experience,” he told Anderson Cooper, adding that the court librarians prepared a lesson for the justices and their clerks to demonstrate how the abundance of Internet porn ahead of a case considering the regulation of such graphic material. CRUZ CAMPAIGN RELEASES NEGATIVE RADIO AD TO RIP DE BLASIO The librarians switched off Internet filters and quickly found hardcore videos by searching the term “cantaloupe,” he said. “And Justice O’Connor — I still remember — she leaned forward, and she squinted, and she said, �?Oh, my!’” Cruz continued. New York Daily News front pages on the presidential election Little Caroline and Catherine were seated in the first row of the audience as their dad told the cringe-worthy story. The retelling wasn’t the only awkward moment: Cruz’s wife and daughters had more strange stories to share about the family patriarch. Heidi Cruz told the audience how her husband perplexingly bought 100 cans of soup after they returned from their honeymoon because he was afraid she wouldn’t cook. “I was completely shocked to see that he arrived back at our apartment with literally 100 cans of Campbell’s Chunky soup,” she said. “We had a tough conversation about it. I said, �?You don’t buy 100 of anything, much less canned soup. We can’t do this. I’ll be making things.’ He said, �?No, I know you. You won’t be making things.’” Cruz talked about the time he watched porn with Supreme Court Justice Sandra Day O'Connor. (T.J. Kirkpatrick/Getty Images) The newlywed wife promptly returned the stockpile of stews and called her mother to gab about her husband’s strange shopping spree — but her mom told her she should have let Cruz keep his coup. CRUZ RIPPED FOR HIS 'NEW YORK VALUES' INSULT IN THE BRONX “So when Ted opened the pantry, I had to quickly tell him that I would go back and buy those cans again,” she added. Cruz’s daughters also had some not-so-flattering stories about their dad. Heidi Cruz also told a strange story about how her husband once bought 100 cans of soup. (BILL WECHTER/AFP/Getty Images) Caroline — who turned 8 on Thursday — said she has a video of her dad in a pink feather boa and granny panties. The Texas dad put on the goofy getup as part of a dress up game at a father-daughter picnic, she said. “It was on a videotape the whole time,” the oldest Cruz daughter said. “And that was a class video that they’re sending out to all the parents.” Caroline also talked about her upcoming birthday party — a Build-a-Bear bash featuring a chocolate cake — and her love for Taylor Swift. Younger Catherine was mostly silent as she sat on her mom’s lap. Sign up for BREAKING NEWS Emails privacy policy Thanks for subscribing! Photo: Daniel Acker/© 2016 Bloomberg Finance LP Ted Cruz once argued that Americans have no constitutional right to bear dildos, that the government has a legitimate interest in discouraging “autonomous sex,” and that allowing the sale of sex toys is the first step on the road to legal incest. This history comes courtesy of Mother Jones’s David Corn, who went searching for skeletons in Cruz’s closet and stumbled across a bunch of dildo baggage instead. On Wednesday, the magazine published an exposé detailing Cruz’s defense of a ban on sex-toy sales while serving as the Texas solicitor general. Back in 2004, several adult-plaything providers challenged a Texas law that banned the sale and promotion of "obscene devices." At the time, only three other states had similar laws on the books. The plaintiffs founded their challenge on the Fourteenth Amendment’s right to privacy, arguing, among other things, that some couples are unable to engage in intercourse without the aid of sex toys, or else require them to avoid passing along contagious diseases such as HIV. A federal judge turned the company down, it appealed, and in 2007 it fell to Cruz’s legal team to keep dildos from undermining the fabric of Western civilization. In a 76-page brief calling on the U.S. Court of Appeals for the Fifth Circuit to stand with the lower court, Cruz’s office wrote that “any alleged right associated with obscene devices” is not “deeply rooted in the Nation’s history and traditions.” While Cruz acknowledged that, after Lawrence v. Texas overturned sodomy laws, the government could not ban the “private use of obscene devices,” it could ban their sale so as to uphold “public morals.” What’s more, while the government can’t forbid citizens from masturbating, it has a legitimate interest in “discouraging … autonomous sex.” Cruz’s team went on to declare, “There is no substantive-due-process right to stimulate one’s genitals for non-medical purposes unrelated to procreation or outside of an interpersonal relationship.” Ted Cruz thinks people don't have a right to "stimulate their genitals." I was his college roommate. This would be a new belief of his. — Craig Mazin (@clmazin) April 13, 2016 The appeals court disagreed in a 2–1 decision, which held that the government has no business encroaching on Americans’ most private of affairs. But Cruz and Texas attorney general Greg Abbott (who is now the state’s governor) battled on, filing a brief requesting a hearing before the full court of appeals, claiming the three-judge panel had overstepped the precedent set by Lawrence. Cruz’s office argued that the prior ruling would give all manner of deviants grounds to claim that “engaging in consensual adult incest or bigamy” must be legal as they have a right to “enhance their sexual experiences.” They lost the motion and ultimately chose not to bring the matter to the Supreme Court. Cruz has never discussed his views on dildo commerce during the 2016 campaign, and it’s unlikely that many of his supporters know his history on such matters. It’s difficult to gauge the effect this news will have on Cruz’s standing with the electorate, as exit polls neglected to ask Republican primarygoers about their affinity for sexual devices. Regardless, the American people deserve to know whether Cruz still holds such an expansive view of the government’s right to regulate public morality. There are undoubtedly no small number of patriots in this country who would tell President Cruz’s jackbooted thugs, “I’ll give you my dildo when you pry it from my cold, dead hands.” [There was a video here] Thanks to CNN’s town hall, America just got another glimpse into the waking hell that is Heidi Cruz’s daily life. Tonight’s entry into the Heidi Cruz catalogue of the macabre: A newlywed Ted Cruz celebrates by buying 100 cans of Campbell’s Chunky soup. The story defies any logical, human explanation, so I’ll let Heidi do the talking: When I married Ted, we got back from our honeymoon, and he went off to the store and came home by himself. And I was completely shocked to see that he arrived back at our apartment with literally 100 cans of Campbell’s Chunky soup. I never bought 100 of anything. This was shocking to me, so we had a tough conversation about it. I said, “You don’t buy 100 of anything, much less canned soup. We can’t do this. I’ll be making things.” He said, “No, I know you. you won’t be making things.” So the next morning, it was a weekend morning, I loaded up our car before he woke up and returned every single can. And when I got home, I called my mother just to make sure I’d done the right thing as a newlywed. And she emphatically disagreed with me. And so when Ted opened the pantry, I had to quickly tell him that I would go back and buy those cans again. Questions abound. First and foremost—why? What did this “tough conversation” consist of? Did Heidi really go back to the store to re-buy 100 cans of soup? Did she re-buy the soup in the same variety and quantity? How long does it take Ted to finish 100 cans of soup? Heidi, are you okay? You know you can tell us if you’re not okay? Also—why? We’ve reached out to Campbell’s and also deep within ourselves for comment, and will update if and when we hear back. Until then, if you have any information at all about what Ted Cruz did with 100 cans of Campbell’s Chunky™ soup, please do let us know.

Summary: Ted Cruz showed up Wednesday for a CNN town hall-or what Gawker frames as "another glimpse into the waking hell that is Heidi Cruz's daily life"-with his wife and two young daughters in tow, and Heidi offered up a personal, if bizarre, nugget of life with the GOP presidential candidate. She dished on what her husband did right after they got back from their honeymoon: bought 100 cans of Campbell's Chunky soup. "I never bought 100 of anything," she told moderator Anderson Cooper. "This was shocking to me, so we had a tough conversation about it. I said,"You don't buy 100 of anything, much less canned soup. We can't do this. "Heidi said that while Ted was sleeping, she brought all 100 cans back to the store, but after a panicked phone call to her mother"just to make sure I'd done the right thing as a newlywed, "she realized the soup should stay. As the New York Daily News notes, that wasn't the only odd revelation about Cruz that emerged during the town hall. The man who once fought against masturbation also relayed how he'd once watched porn with Supreme Court Justice Sandra Day O'Connor. And in what may be one of the more scandalous tidbits to arise in Election 2016, Cruz's daughter, Caroline, who just turned 8, revealed she's got tape of her dad dolled up in granny panties and a pink feather boa at a father-daughter picnic.

multi_news

en

Summarize: McDonald's believes it has the solution to declining sales —and it starts with warmer buns. The world's largest fast-food chain is "recommitting to hotter, tastier food," said CEO Steve Easterbrook, who launched a new strategic turnaround plan earlier this month. To make that happen, McDonald's will now toast its burger buns 5 seconds longer, thus making the bread 15 degrees warmer. It will also bring the heat to its burger patties. The chain will change the way it sears and grills its beef so it's juicier, though the company didn't elaborate on the details. Easterbrook, who took the helm in March after the former CEO stepped down, believes that every little bit counts and sums up "to a big difference for our customers," he said at a conference Wednesday morning, according to Buzzfeed. READ MORE: Can McDonald’s get its mojo back? This isn't the first time McDonald's has futzed with its toasting levels. In the 1990s, the chain gave up toasting its buns altogether in exchange for efficiency, but the quality decline didn't go over so well. By 1997, McDonald's changed its mind and required new stores to install toasting equipment at a cost of about $7,000 per location. Octavian Cantilli—Universal Orlando 17. The Krusty Burger The fictional Simpsons hangout was so popular, it became a real-life restaurant in 2013, when Universal Studios Orlando opened a Simpsons theme park. Ironically, menu staples like the Clogger Burger and the Mother Nature Burger—dismissed as gross on the cartoon—fetch over $10 in real life. Courtesy of Kuma 16. The Ghost Burger In October of 2014, Chicago heavy-metal-themed bar Kuma's Corner launched one of the most outrageous burgers to date: the Ghost Burger—it's named after Swedish metal band Ghost B.C.—was topped with an unconsecrated Communion wafer. The dish sold well, but angered Catholics (and garnered national headlines), prompting the owners to donate $1,500 to Catholic Charities of the Archdiocese of Chicago. Courtesy of Kayla Tausche—AP 15. The Varsity Burger The ordering lingo for this Atlanta staple, which debuted in 1928, is almost as delicious as the burger itself: you get it “all the way” in lieu of “with onions,” and “walk a steak” replaces “to-go.” These branding gimmicks were later replicated by burger chains like In-N-Out, whose secret menu (see: “animal style” and "protein style") has helped lure millions of customers. Patrick Fallon—Bloomberg/Getty Images 14. The Umami Burger Arguably the first “modernist cuisine” patty, the Umami Burger—unveiled by Adam Fleischman in 2009—is meant to taste like, well, umami (a savory taste embodied in MSG), incorporating such toppings as soy-roasted tomatoes, parmesan crisps and pickled ginger. The patty's success has fueled the opening of 21 additional locations. Kevin Lamarque—Reuters 13. The Ray's Hell Burger President Obama treated then-Russian President Dmitri Medvedev to one of these patties in Arlington in 2010—Obama’s was reportedly ordered plain, while Medvedev added jalapeños, mushrooms and onions. And the meal may have fostered intimacy between the two leaders: less than two years later, Obama was caught on a hot mic asking Medvedev for space on missile defense policy, explaining, “This is my last election. After my election I have more flexibility.” Medvedev was amenable. Courtesy of Keizo Shimamoto 12. The Ramen Burger This so-called hybrid burger—two parts ramen, one part beef patty—drew vast crowds at the Smorgasburg outdoor food market in Brooklyn throughout the summer of 2013 (mere months after the cronut craze). Soon, the Keizo Shimamoto creation had enough hype to debut in L.A. and even inspired a knockoff in the Philippines, cementing its status as a global obsession. Alas, there's no official ramen-burger restaurant yet—would-be tasters have to monitor its Facebook page to see where it'll be served next. Everett Kennedy Brown—EPA/Corbis 11. The MOS Burger The burger may be a mostly American creation, but many other countries have launched their own chains—and burger variants—to capitalize on its success. Among the most prominent: MOS (a.k.a. “Mountain Ocean Sun”) Burger, which opened in Japan in 1972. Although its signature patty mimics the U.S. classic, other items are designed around Japanese tastes; there’s a teriyaki burger and a grilled salmon rice burger. Similar tactics have worked in other regions, too: in India, Nirula's chain serves potato and mint patties in lieu of beef, and in Malaysia, Ramly Burger offers patties wrapped in an egg envelope inside the bun. Bruce Bisping—Minneapolis Star Tribune/ZUMA Press 10. The Jucy Lucy Although this twist on the cheeseburger—in which the cheese is melted inside the patty—was reportedly invented in the 1920s, when chefs were still experimenting with the burger, it gained national attention in 2008, thanks to a feud between two Minneapolis bars that both claim to have "invented" it. Since then, there have been numerous imitators, proving that a little innovation and a dash of hype is all it takes to reinvigorate enthusiasm for a classic. Correction: The original version of this story misstated the date of invention of the Jucy Lucy. It was put on the menu at Matt's in 1954. Simon Dawson—Bloomberg/Getty Images 9. The Lab-Grown Burger With global demand for meat expected to grow 60% by 2050, the amount of farmland and grain needed to feed those chickens, pigs and cows may be unsustainable. But this burger, which was unveiled last year by Mark Post of Maastricht University, has none of those hang-ups—it’s grown in a lab from cow stem cells, which means it may even be palatable for vegetarians. The only issue: for now, it carries a $325,000 price tag. Joshua Lott—Reuters 8. The Quadruple Bypass Burger Jon Basso, owner of The Heart Attack Grill, has drawn national attention (and outrage) for his gluttonous offerings since the restaurant first opened in 2005, offering free meals for those over 350 pounds. His most notorious dish is this behemoth, which layers eight slices of cheese between four half-pound patties and clocks in at nearly 10,000 calories. One regular customer, a kind of spokesman for the restaurant, actually died in front of the Las Vegas eatery in 2013. The burger became an exemplar of the more-is-more burger culture, preceding a series of other gluttonous dishes including Paula Deen's doughnut-encased Lady's Brunch Burger. Andrey Rudakov—Bloomberg/Getty Images 7. The ShackBurger The 2004 invention—topped with a tangy, secret-recipe ShackSauce—was the first burger to start a food craze, inspiring hordes of eaters to wait in lines that stretched throughout New York’s Madison Square Park. And Danny Meyer's decision to grind prime cuts of whole muscle, rather than scraps, completely transformed the way we think of burgers, according to Josh Capon, the four-time winner of New York’s Burger Bash. Coutesy of Gardenburger 6. The Gardenburger The original veggie burger was invented in 1981 at—go figure—the Gardenhouse, an Oregon vegetarian restaurant, and it consisted mainly of leftover vegetables and grains. Before long, it was the most popular item on the menu, living on even after the restaurant closed as a frozen-food item that was packaged and sold internationally. Today, the Gardenburger and its imitators, from MorningStar to Boca, have become mainstays at conscientious cook-outs nationwide. Burger King Corporation/PRNewsFoto/AP 5. The Burger King Whopper The quarter-pound patty, introduced in 1957, was the fast food industry’s first gimmick burger—developed as a premium alternative to McDonald’s, Wendy’s and others. Burger King’s stunt inspired its competitors to create their own “deluxe” versions. Among them: the McDonald’s Big Mac. Courtesy of '21' Club 4. The 21 Burger When the 21 Club introduced its gourmet burger in the late 1940s or early 1950s, New Yorkers were shocked that an upper-class establishment would offer something as lowly as the burger—and at the exorbitant price of $2.75, compared with McDonald's' 15 cents. Nevertheless, it was a hit. “The [higher quality] beef did make a difference,” says Andrew F. Smith, author of Hamburger: A Global History, “and it certainly was something very different than simply fast food.” The luxury burger has since become a mainstay at many higher-end restaurants, from Le Parker Meridien (a high-low offering in the lobby's Burger Joint) to db Bistro Moderne (the truffle, foie gras and short ribs DB Burger) to Hubert Keller’s (the foie gras-topped Fleur Burger, which costs $5,000 and is served with a bottle of 1995 Château Pétrus). Patrick T. Fallon—Bloomberg/Getty Images 3. The In-N-Out Burger Whereas McDonald’s focused on fast, In-N-Out focused on food—its signature burger, which debuted in 1948, was made from locally sourced ground beef and fresh vegetables. That approach may have prevented In-N-Out’s expansion (it has just 294 locations today, compared with McDonald’s 34,000-plus), but it certainly hasn’t dampened foodie enthusiasm: the In-N-Out burger routinely tops best-of burger lists, and has inspired the launch of other higher-end fast food chains, such as Five Guys. McDonald's 2. The McDonald's Burger Behold, the burger that Smith says “moved fast food from a small operation to a global operation.” The original McDonald’s patty, which debuted in San Bernardino, Calif., spawned an empire that now spans 118 countries—making the price of its beefier counterpart, the Big Mac, ubiquitous enough to serve as an informal measure of purchasing-power parity, as seen in The Economist’s Big Mac index. McDonald's is on a mission to get its business back in shape, and it's finally taking another look at its food. Chief executive Steve Easterbrook said at a conference Wednesday morning that as the company makes organizational changes--which were the focus of the new CEO's comments about the turnaround earlier this month--"At a more fundamental level we are recommitting to hotter, tastier food across the menu." With the burgers, McDonald's will change "the way we sear and then grill our beef so the patties come off juicier," Easterbrook said. The bread will get some more attention too. A burger bun at McDonald's may be impossibly smooth and round, but it may also seem light, fluffy, almost unremarkable. The company will start having restaurants toast them five seconds longer, which will make them 15 degrees warmer. It may even add some texture and toasty flavor. "It's the little things that add up to a big difference for our customers," said Easterbrook.

Summary: McDonald's has floated some pretty radical changes in its apparently relentless zeal to reboot, or as CEO Steve Easterbrook puts it, the chain's "recommitting to hotter, tastier food." The latest is literally "hotter," but not so radical: As Time reports, the chain will begin toasting its buns for an additional five seconds, thus warming them by about 15 degrees. It's also changing up "the way we sear and then grill our beef so the patties come off juicier," per Buzzfeed, though specifics of that tweak are apparently too sensitive to disclose. Easterbrook says these little changes will make "a big difference for our customers."

multi_news

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``National Nurse Act of 2006''. SEC. 2. AMENDING PUBLIC HEALTH SERVICE ACT WITH RESPECT TO THE OFFICE OF THE NATIONAL NURSE. Title XVII of the Public Health Service Act (42 U.S.C. 300u et seq.) is amended by adding at the end the following section: ``SEC. 1711. OFFICE OF THE NATIONAL NURSE. ``(a) Establishment of Office.--There is established within the Office of Public Health and Science an office to be known as the Office of the National Nurse, which shall be headed by an individual serving in a position to be known as the National Nurse. The Secretary shall appoint a registered nurse to serve in such position. The Secretary shall carry out this section acting through the National Nurse. ``(b) Duties.--The National Nurse shall-- ``(1) carry out activities to encourage individuals to enter the nursing profession, including providing education on the distinct role of nurses in the health professions and examining nursing issues that would increase public safety, such as issues relating to staff levels, working conditions, and patient input; ``(2) carry out activities to encourage nurses to become educators in schools of nursing; ``(3) carry out activities to promote the public health, including encouraging nurses to be volunteers to projects that educate the public on achieving better health; and ``(4) conduct media campaigns and make personal appearances for purposes of paragraphs (1) through (3). ``(c) Annual Priorities on Achieving Better Health.-- ``(1) In general.--Each fiscal year the National Nurse shall designate four methods of achieving better health that will be given priority by the National Nurse in carrying out subsection (b)(3) (referred to in this subsection as `annual health priorities'). The National Nurse shall designate such priorities in consultation with the Surgeon General of the Public Health Service, the heads of the agencies of such Service, the States, and organizations that represent health professionals. ``(2) Community-based projects.-- ``(A) In general.--In carrying out subsection (b)(3), the National Nurse shall make grants to nonprofit private entities to carry out projects for the purpose of educating the public on the annual health priorities, including outreach activities in settings such as schools, senior centers, and libraries. ``(B) State coordinators; nurse teams.--In making grants under subparagraph (A), the National Nurse shall provide for the following with respect to a State and particular communities in which activities under the grant will be carried out: ``(i) The designation of an individual to coordinate such activities within the State (referred to in this paragraph as the `State coordinator'). ``(ii) Under the guidance of the State coordinator, the formation of teams of nurses who volunteer to provide the education referred to subparagraph (A), which teams are diverse and representative in terms of educational level in the field of nursing and in terms of racial and ethnic minority groups. ``(iii) The collection in such communities, in accordance with criteria of the National Nurse, of data relating to the annual health priorities. ``(C) Media campaigns.--The National Nurse shall ensure that media campaigns under subsection (b)(4) include media campaigns regarding the annual health priorities. ``(D) Evaluations.--The National Nurse shall, directly or through awards of grants or contracts, evaluate projects under subparagraph (A) to determine the extent to which the projects have been successful in carrying out the purpose described in such subparagraph. ``(E) Dissemination of information.--The National Nurse shall-- ``(i) disseminate information obtained in the evaluations under subparagraph (D); and ``(ii) disseminate such other information obtained pursuant to projects under subparagraph (A) as the National Nurse determines to be appropriate. ``(d) Authorization of Appropriations.--For the purpose of carrying out this section, there are authorized to be appropriated such sums as may be necessary for each of the fiscal years 2006 through 2010.''.

Title: To amend the Public Health Service Act to establish an Office of the National Nurse Summary: National Nurse Act of 2006 - Amends the Public Health Service Act to establish the Office of the National Nurse within the Office of Public Health and Science to: (1) encourage individuals to enter the nursing profession; (2) encourage nurses to become educators in schools of nursing; and (3) promote the public health. Requires the National Nurse to: (1) designate four methods of achieving better health that will be given priority; and (2) make grants to nonprofit private entities to carry out projects for the purpose of educating the public on the annual health priorities.

billsum

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Farm Income and Trade Equity Act of 1999''. SEC. 2. TRANSITIONAL INTERNATIONAL MARKETING EQUITY PAYMENTS. Subtitle B of the Agricultural Market Transition Act (7 U.S.C. 7211 et seq.) is amended by adding at the end the following: ``SEC. 119. TRANSITIONAL INTERNATIONAL MARKETING EQUITY PAYMENTS. ``(a) In General.--Not later than September 30, 1999, an owner or producer subject to a contract that is actively engaged in farming may make a 1-time election for each of the 1999 and subsequent fiscal years to-- ``(1) receive a payment for a loan commodity under this section; ``(2) receive a marketing assistance loan for the loan commodity based on the loan rate established under section 132(g); and ``(3) forfeit contract payments and marketing assistance loans payable under other provisions of this subtitle and subtitle C. ``(b) Payment Amount.--Subject to subsection (f), the amount of a payment made to an owner or producer for a crop of a loan commodity under this section shall be equal to the product obtained by multiplying-- ``(1) the payment rate determined under subsection (c); by ``(2) the acreage base for the crop determined under subsection (d); by ``(3) the payment yield for the crop for the farm determined under subsection (e). ``(c) Payment Rate.-- ``(1) Wheat, feed grains, and oilseeds.-- ``(A) In general.--The payment rate for a crop of wheat, corn, barley, and oilseeds under subsection (b)(1) shall be equal to the difference between-- ``(i) the European Union support level for the crop determined under this paragraph; and ``(ii) the loan rate for a marketing assistance loan for the crop determined under section 132(g). ``(B) European union support level.--The European support level for a crop under subparagraph (A)(i) shall be equal to the sum of-- ``(i) the intervention price paid by the European Union for the crop (in United States dollars) determined under subparagraph (C); and ``(ii) the amount of compensatory payments paid by the European Union for the crop (in United States dollars) determined under subparagraph (D). ``(C) Intervention price.--The intervention price for a crop under subparagraph (B)(i) shall be determined by-- ``(i) multiplying-- ``(I) the European intervention price for the crop in euros per metric ton; by ``(II) the average European-United States exchange rate in dollars per euro during the immediately preceding 12 months; and ``(ii) dividing the product obtained under clause (i) by the number of bushels per metric ton for the crop. ``(D) Compensatory payments.--The amount of compensatory payments under subparagraph (B)(ii) shall be determined by-- ``(i) multiplying-- ``(I) the amount of compensatory payments made by the European Union for the crop in euros per metric ton; by ``(II) the average European-United States exchange rate in dollars per euro during the immediately preceding 12 months; and ``(ii) dividing the product obtained under clause (i) by the number of bushels per metric ton for the crop. ``(E) Other feed grains.--The payment rate for a crop of grain sorghum and oats, respectively, under subsection (b)(1) shall be established at such level as the Secretary determines is fair and reasonable in relation to the payment rate for corn under this paragraph, taking into consideration the feeding value of the commodity in relation to corn. ``(2) Cotton and rice.--The payment rate for a crop of upland cotton, extra long staple cotton, and rice, respectively, under subsection (b)(1) shall be established at such level as the Secretary determines is fair and reasonable in relation to the payment rate for wheat under this paragraph, taking into consideration the historical price relationship between the commodity and wheat (as determined by the Secretary). ``(3) Adjustment.--The Secretary may adjust the payment rate for a crop of a loan commodity under this subsection to provide support for owners and producers at a level that is consistent with the amount of compensatory payments made by the European Union for the loan commodity. ``(d) Acreage Base.--The acreage base for a crop of a loan commodity under subsection (b)(2) shall be 85 percent of the contract acreage. ``(e) Payment Yield.--The payment yield for a crop of a loan commodity under subsection (b)(3) shall be the farm program payment yield. ``(f) Maximum Amount of Payments and Loan Gains.-- ``(1) Limitation on payments.--For any fiscal year, the total amount of payments made under subsection (b)(1) to a person may not exceed $40,000. ``(2) Limitation on marketing loan gains.--For any crop year, the total amount of any gain realized by a person from repaying marketing assistance loans under subsection (a)(2) for 1 or more loan commodities at a lower level than the original loan rate established for the loan commodities under section 132 (other than subsection (g)) shall be $75,000. ``(3) Regulation.-- ``(A) In general.--The Secretary shall promulgate a regulation-- ``(i) defining the term `person' for purposes of this subsection that ensures, to the maximum extent practicable, that individuals of the same family, entities under the ownership or control of the same corporation, or other related parties do not receive multiple payments or marketing assistance loans under subsection (a); and ``(ii) prescribing such rules as the Secretary determines are necessary to ensure a fair and reasonable application of the limitations established under this subsection. ``(B) Related provisions.--The regulation shall be consistent with paragraphs (5) through (7) of section 1001 of the Food Security Act of 1985 (7 U.S.C. 1308).''. SEC. 3. NONRECOURSE MARKETING ASSISTANCE LOANS. Section 132 of the Agricultural Market Transition Act (7 U.S.C. 7232) is amended by adding at the end the following: ``(g) Alternative Loan Rate.--Subject to section 119(f), notwithstanding subsections (a) through (f), in the case of an owner or producer described in section 119(a), the loan rate for a crop of a loan commodity shall be 100 percent of the simple average price received by producers of the loan commodity, as determined by the Secretary, during the marketing years for the immediately preceding 5 crops of the loan commodity, excluding the year in which the average price was the highest and the year in which the average price was the lowest.''. SEC. 4. INCREASED AGRICULTURAL TRADE ASSISTANCE IN RESPONSE TO DIRECT EXPORT SUBSIDIES BY EUROPEAN UNION. Section 301(e) of the Agricultural Trade Act of 1978 (7 U.S.C. 5651(e)) is amended-- (1) in paragraph (1)-- (A) by striking ``The'' and inserting ``Subject to paragraph (3), the''; and (B) by striking subparagraph (E) and inserting the following: ``(E) $3,850,000,000 for fiscal year 2000;''; and (2) by adding at the end the following: ``(3) Response to direct export subsidies by european union.-- ``(A) Carryover.--Amounts made available under subparagraphs (E) through (G) of paragraph (1) shall remain available until expended. ``(B) Minimum funding levels.--Subject to paragraph (1) and subparagraphs (A) and (C), for each of fiscal years 2000 through 2002, the Commodity Credit Corporation shall make available to carry out the program established under this section and the dairy export incentive program established under section 153 of the Food Security Act of 1985 (15 U.S.C. 713a-14) an amount that is equal to the amount the Secretary determines the European Union will expend on direct export subsidies for that fiscal year. ``(C) Uruguay round trade agreement limitation.-- For each of fiscal years 2000 through 2002, if the Commodity Credit Corporation is unable to comply with subparagraph (B) as the result of a limitation imposed by the Uruguay Round Trade Agreement on Agriculture, the Secretary shall increase the amount of assistance made available to carry out title I of the Agricultural Trade Development and Assistance Act of 1954 (7 U.S.C. 1701 et seq.) by an amount that, when combined with assistance made available by the Corporation under subparagraph (B), is equal to the amount that the Secretary determines the European Union will expend on direct export subsidies for that fiscal year.''. SEC. 5. APPLICATION. (a) In General.--Except as provided in subsection (b), this Act and the amendments made by this Act shall apply beginning with the 1999 crop of a loan commodity (as defined in section 102 of the Agricultural Market Transition Act (7 U.S.C. 7202)). (b) Agricultural Trade Assistance.--The amendments made by section 4 shall apply beginning with fiscal year 2000.

Title: Farm Income and Trade Equity Act of 1999 Summary: Farm Income and Trade Equity Act of 1999 - Amends the Agricultural Market Transition Act to authorize agricultural owners or producers subject to production flexibility contracts to permanently elect to receive payments and marketing assistance loans which factor in European Union (EU) support levels in lieu of contract payments and marketing assistance loans under such Act. Sets forth payment rate and related provisions for: (1) wheat, feed grains, and oilseeds; and (2) cotton and rice. Sets forth alternative loan rate provisions for electing owners or producers. Amends the Agricultural Trade Act of 1978 to provide for increased funding (including situations affected by Uruguay Round Trade Agreement caps) for the export enhancement program and the dairy export incentive program (under the Food Security Act of 1985) equal to direct EU subsidies.

billsum

en

Summarize: A protective Nevada father who invited an accused molester and child porn criminal to numerous charity events he organized has attempted to attack the man in court. Rick Cedeno was sitting in the dock of Las Vegas Justice Court this week during the hearing for Christopher Sena, 48, who is facing 58 charges of sex abuse against children, including incest and bestiality, in what police have described 'one of the most horrific sex rings in memory'. Cedano told My News 3 of his outage over the case, having had Sena take photographs at several events he help plan for child-centric local charities. 'Just by looking at him i couldn't contain myself,' Cedano told the station. 'I was full of rage and anger. It took all my strength not to put my hands on him.' 'He betrayed us. He's a monster.' 'I couldn't contain myself': Rick Cedano (left) tried to approach Christopher Sena (sitting) Las Vegas Justice Court this week, but was restrained by police as he went to the dock. 'Get back': Police threatened the protective father with weapons to get him to leave. Cedano has had associations with Sena through local charities. Scared: Christopher Sena, appearing in court this week, looks frightened as Cedano comes at him. Accused: Christopher Sena, 47, allegedly sexually abused children for more than a decade. Rick Cedano (right), a local father, knew Sena through local charity organizations and tried to approach him in court. Sena, his wife, Deborah Sena, 50, and ex-wife, Terrie Sena, 43, who all lived together in a trailer in Las Vegas, are accused of abusing at least eight children over 13 years. Some victims were relatives, while Christopher Sena also encouraged his children to bring their friends over to the house so that he could abuse them, the Las Vegas Review Journal reported. He allegedly told one girl and one male victim to 'bring female friends over' and to make sure they wore bathing suits, according to the police report. Another female victim, who is now an adult, said she saw Christopher Sena take 'a number of her friends' into his office, police said. One woman who says she was sexually abused told investigators that she believes her high school friends were assaulted by Sena. Neighbors told the Review-Journal that he would seem 'excited' when his sons brought girlfriends over to the house. Others described the Sena property as the place many neighborhood kids would hang out. Christopher Sena would erect a projector screen in the yard and hold movie nights, they said. To stop his victims from speaking out about the abuse, he told at least two of them that he would kill them or break their legs if they spoke out, they told police. Arrests: He lived in a trailer with his wife Deborah Sena, 50, (left) and ex-wife, Terrie Sena, 43, (right). The women are also accused of engaging in sexual activity with children. Christopher Sena was arrested in September when Deborah, who recently split from him, another woman and a child told a family attorney about the alleged abuse. The attorney went to police, as is required by law, and a SWAT team stormed the house on September 18 to arrest Sena and seize his recording equipment. Authorities allegedly found videos showing all three adults engaging in sex acts with children, which led to the arrests of Deborah Sena and Terrie Sena last week. At least eight minors were involved and some encounters were filmed as part of a child porn operation, police said. One alleged victim told authorities that when Sena started abusing her as a child, the two women were not aware of it, but when she was 17, she was forced to engage in sexual activity with them. That victim started to strike her stomach with a piece of wood, fearful that he would fall pregnant with Sena's child, police said. Scene: After his wife told a lawyer about the abuse, Christopher Sena was arrested at their home (pictured) in September. Officers seized electronic equipment and allegedly found videos of the abuse. Some of the victims say they were abused for years; one boy said the abuse started when he was three and continued until he was a teen, while another woman said she was abused two or three times a week by Sena for more than a decade. But according to police he was not the only one carrying out the abuse. His ex, Terrie Sena, told police she was attracted to young male and female teens, and said it was'really enjoyable' when one of the boys started to look like Christopher Sena. But she told authorities that she later felt 'ashamed' and 'dirty'. Terrie and Christopher Sena had three sons and a daughter together before splitting in 1997. But after they split, Terrie continued to live with her ex and their children, even when he took a new wife. Authorities also allegedly found footage of Deborah Sena, who left her husband in August, involved in sexual acts with the family dog. Deborah Sena told police that there was 'fear and intimidation' involved when it came to dealing with her husband Christopher (pictured together in an old photo), whom she split from in August. Deborah says her husband said that, if she loved him, she would do what he wanted her to do. She claims her husband told her she would do what he wanted if she loved him. One of the seized recordings also allegedly shows two Sena children having sex with the family dog, The Daily Beast reported. Christopher Sena is facing 23 charges, including incest, bestiality and felony child abuse. Many of the charges carry a sentence up to life in prison. The women, who were arrested on December 11, together face 27 charges, including child abuse and neglect, sexual assault of a minor and incest. Police said they expect more charges to be brought against the trio. All three have been held without bail

Summary: Christopher Sena, 48, his wife, Deborah Sena, 50, and his ex-wife Terrie Sena, 43, have all been accused of sexually abusing children. They 'assaulted at least eight children over 12 years' All three live together in a trailer home, where the alleged abuse occurred. Local father Rick Cedano tried to approach the'monster' Sena in court this week but was restrained by police. Victims claim Christopher Sena threatened to break their legs or kill them if they spoke out about the abuse. He 'encouraged his children to bring over their high school friends so he could assault them'

cnn_dailymail

en

Summarize: PRIORITY CLAIM [0001] This application claims benefit of priority of U.S. Provisional Application No. 61/540,065 filed on Sep. 28, 2011. BACKGROUND OF THE INVENTION [0002] The present invention relates to a rotary pine cone gathering device and a method of manufacturing the device. In particular, a rotary pine cone gathering device is constructed having a wire basket with loose rotatable coverings over the wires or sets of wires for gathering pine cones or other objects lying on the ground. [0003] The primary purpose of this invention is to provide homeowners with an option for gathering pine cones without stooping and having to gather them by hand. While hand operated wire basket gathering devices are well known for manually harvesting nuts, such wire basket harvesting devices include narrow steel wires or cages that are not effective for gathering fragile and large options such as pine cones. Thus, wire basket nut harvesters have been avoided as far as gathering pine cones has been concerned. Finding a device for more effectively gathering pine cones is particularly important to our senior citizens who are often interested in gardening and landscaping. [0004] Manually operated pine cone gathering devices help individuals gather pine cones while standing erect and gather more than one could gather without such tools. Previously existing hand operated gathering devices have been either inefficient or cost prohibitive to manufacture, or both; as a result, an ongoing need exists for improved pine cone gathering devices. [0005] For example U.S. Pat. No. 5,168,692 to Dudley discloses a rolling nut harvesting apparatus that may also collect pine cones. The Dudley device includes a complex basket and hopper; this complex device is not cost effective to construct and less attractive to offer the general consumer as compared with the present invention. The present invention offers an elegant solution for collection and storage of pine cones in a single chamber that is simple to manufacture and cost effective. [0006] In another example of a prior pine cone retrieving device, U.S. Pat. No. 5,490,701 to Glass teaches a relatively more cost effective and simpler device than Dudley provided in the example above. The Glass device comprises an array of three flexible elongated tines. The tines taught by Glass converge to retrieve one pine cone at a time and may hold a few pine cones before requiring removal of the pine cones from the tines. The Glass device, while simple, is limited by speed of use, and does not include an efficient means for storing pine cones while at the same time gathering. [0007] Similarly, U.S. Pat. No. 7,490,879 to Seefeldt et al. discloses a pine cone collection tool comprising an elongate tubular body useful for both collection and storage. However, this tubular device still requires collection of one pine cone at a time and greater storage capacity would be desirable. As a result, a need still exists for a pine cone gathering device that is inexpensive to manufacture and has increased efficiency. [0008] U.S. Pat. No. 6,460,249 to Cecil Holt, Jr. provides a nut harvesting device to provide a chamber for collection of nuts that is partially constructed by several related steps to the present invention. Holt does not provide a means for collecting pine cones without damaging the pine cones or having them hang within the wires of the chamber previously though, and Holt does not previously teach a device having efficient and significant storage for collection of a significant plurality of pine cones. SUMMARY OF THE INVENTION [0009] The present invention provides a device for gathering pine cones and other large or irregular shaped objects that might lie on the ground. A method is provided for construction of the device. A plurality of wires of substantially equal length are provided and arranged substantially parallel with an open ended circular configuration having an outer periphery and an inner periphery. A washer is inserted on each end of the wires within the inner chamber formed by the wires. The chamber of the device is formed by pressing an inner sleeve into the inner periphery of the wires. Inserting the inner sleeve causes the inner sleeve and an outer sleeve to impinge against the wires. The wires are shaped using a dye inserted within the wires to bend the wires and begin the formation of an oval cylindrical chamber. [0010] A plurality of rotatable nylon tubes are placed over pairs of wires. The coverings slide over the wires from an unlocked end where the ends of the wires are exposed temporarily; the wires slide toward the locked end, after which the unlocked ends of the wires are secured together by an inner sleeve and outer sleeve pressed together holding the wires. The tubing is flexible and moves with the wires to form an ovoid chamber having a area for collecting a multitude of pine cones or other objects. [0011] A bolt is inserted through each of the inner sleeves and bears against the outer sleeve. A nut, metal washer, and rubber washer bearing against the inside of the wires is tightened on each end of the bolts causing the wires to form substantially flat ends of said chamber between the nuts and inner sleeves and outer sleeves. A bail attaches the chamber to a handle for use as a hand-held nut harvester that is effective, yet simple and inexpensive to construct. [0012] A first object of the present invention is to provide a device that retrieves pine cones or other objects into a storage chamber and operates more efficient than prior hand operating pine cone gathering devices. [0013] Another object is to provide a device that will retrieve pine cones and objects that are irregularly shaped and difficult to pick up by previous nut gathering devices. [0014] An object is to provide a gather device for retrieving pine cones that are many different sizes. [0015] As another object the device retrieves pine cones having barbs without hanging on wires. [0016] In a related object, the device retrieves pine cones that are fragile without causing the pine cones to crumble under too much force. [0017] The invention solves an ongoing and long felt need for a gathering device that is flexible enough to accommodate pine cones, as well as other similar sized objects. [0018] The invention provides a device that is adaptable and works for gathering both small and large pine cones and objects while being particularly effective for most all size of pine cones. [0019] These and other objects will be apparent to those skilled in the art, and the invention should be interpreted and defined in accordance with the claims that follow. BRIEF DESCRIPTION OF THE DRAWINGS [0020] FIG. 1 is a perspective view of the inner sleeve blank and first inner sleeve in combination with a sectional plan view of an arrangement of wires in accordance with a step for construction of the device with the first inner sleeve for insertion inside the wires on one end thereof. [0021] FIG. 2 is a perspective view of a first outside sleeve shown in combination with a sectional plan view of wires arranged in a step for construction of the device in combination with the first outside sleeve inserted over the outside of the wires near the end where the first inner sleeve is inserted. [0022] FIG. 3 is a perspective view of a washer shown in combination with a sectional plan view of wires arranged in a step for construction of the device in combination with the first washer inserted over the outside of the wires and abutting the first outside sleeve. [0023] FIG. 4 is a plan view of the inner sleeve blank in combination with a sectional assembly plan view of wires arranged in a step for construction of the device illustrating insertion of the temporary inner sleeve blank and removal of the blank for insertion of the first inner sleeve. [0024] FIG. 5 is a perspective view of wires arranged in a step for construction of the device illustrating the first inner sleeve being flush with one end of the wires. [0025] FIG. 6 is a sectional plan view perspective view of wires arranged in a step for construction of the device illustrating the step of moving the first outside sleeve over the first inner sleeve so as to impinge on the wires at the first end of the device. [0026] FIG. 7 is a perspective view of wires arranged in a step for construction of the device showing the wires on the first end of the device held between the first inner sleeve and the first outside sleeve. [0027] FIG. 8 is a perspective view of illustrating a dye for temporary insertion into the wires for bending the wires outward at an angle. [0028] FIG. 9 is a sectional assembly plan view of wires arranged in a step for construction of the device illustrating the dye in FIG. 11 being inserted into the wires to be pressed, a metal pipe to keep the wires from springing outward while the die is pressed by rod against a press. [0029] FIG. 10 is a sectional plan view of wires arranged in a step for construction of the device with the collar of FIG. 9 removed and illustrating the wires being bent outward. [0030] FIG. 11 is an assembly plan view of wires arranged in a step for construction of the device illustrating a tube placed over a set of the wires. [0031] FIG. 12 is a perspective view of wires arranged in a step for construction of the device showing tubes inserted over all of the wires and restrained inward by a rubber band. [0032] FIG. 13 is a perspective assembly view of wires and a second outside sleeve arranged in a step for construction of the device in combination with a second washer inserted over a second end of the wires opposite the first end. [0033] FIG. 14 is a perspective view of wires arranged in a step for construction of the device in combination with a rod used in the step of pressing the second inner sleeve into the second outside sleeve to impinge on the wires on the second end of the device. [0034] FIG. 15 is a perspective view of wires arranged in a step for construction of the device illustrating the step of pressing the second inner sleeve into the second outside sleeve to lock the wires in place. [0035] FIG. 16 is a perspective view of a device constructed in accordance with an embodiment of the invention connected to a handle for operation. DETAILED DESCRIPTION OF THE INVENTION [0036] Referring now to the drawings, a gathering device 2 and the process of manufacturing such device is shown. The device is constructed in a way that the device is effective for gathering fragile objects such as pine cones from the ground. As shown in FIG. 16, the completed device 2 includes a basket 4 comprised of a plurality of wires 10 that are combined in small sets of preferably two wires and sheathed in plastic tubes 12. In operation, the device rolls along the ground causing the wires to separate upon encountering a pine cone or object until the object enters the basket and the resilient wires 10 return to their normal position causing the object to be entrapped within the basket. During operation the tubes 12 roll about the wires to prevent damage to the objects entering the basket; further, the tubes hold sets of the wires together to permit larger openings between the wires upon encountering an object both in terms of the spacing between the sets of wires and the propensity for the wires to separate more easily for swallowing the objects. Once the basket is filled, the objects are emptied by separating the wires to form a gap and dispense the objects from the basket to some other container or location. [0037] The method for the manufacture of the device is taught by first referring to FIG. 1 in which the first of several steps is shown. The device is constructed in several steps as will be described herein. In a first step a plurality of wires 10 of substantially equal length are provided and these wires are grouped together. Once expanded, the wires form a chamber of the basket portion of the device. The wires, generally comprised of steel, are gathered in parallel arrangement with an open ended circular configuration. The circle of wires is wrapped around an inner sleeve blank 14 on one end of the inside of the wires, whereby the wires form a cylinder shape about the inner sleeve blank for further processing. [0038] The wires 10 should be flexible and resilient for the purpose of retrieving objects from the ground by separation of the wires through contact with an object; suitable wires have been used for nut harvesting devices comprised of 0.041 gauge music wire. The wires are cut longer than on a prior nut gathering device to provide increased capacity and flexibility found uniquely suitable for gathering pine cones. Whereas, the additional length of the wires would cause the device to be less effective in gathering smaller and firmer objects such as nuts, the wires on the present device have been found effective for pine cones. A preferred length of raw wire for manufacture of the device is 23 to 25 inches in length. [0039] In preparation for the next step of manufacture, the wires may be held and supported on the inner sleeve blank 14 by a rubber band 16 or other retention device. With the inner sleeve blank wrapped within the wires on one end, insert a first inner sleeve 18 that is shorter and smaller circumference than the inner sleeve blank within the opposing end of the wires as shown in FIG. 1. Slide the first inner sleeve within the wires to where it rests on top of or abutting the edge of the inner sleeve blank within the wire structure. At this point in construction, leave the first inner sleeve in abutting relation for inner sleeve blank for further processing. [0040] While the first inner sleeve 18 and the inner sleeve blank 14 remain within the wrapped wires 10, insert a first outside sleeve 20 over the opposing ends of the wires and, then, slide the first outside sleeve downwards or toward the first inner sleeve until the first outside sleeve will not slide any further down by hand or without additional force as in FIG. 2. Sliding the first outside sleeve over the wires begins the process of locking the wires into place between the first outside sleeve and the first inner sleeve. [0041] With the first outside sleeve 20 positioned over the wires 10, slide a washer 22 over the outside of the wires on the end opposing the first inner sleeve 18 in accordance with the illustration in FIG. 3. Slide the washer downward or toward the first outside sleeve until the waster touches the first outside sleeve or abuts against it. Next, remove the inner sleeve blank 14 using a knife or similar means inserted through the wires and by pressing downward on the inner sleeve blank to slide it out from within the wires as shown in FIG. 4. [0042] In FIG. 4, after removing the inner sleeve blank 14, slide the first inner sleeve 18 down to a position that is flush with the ends of the wires 10 at a first end of the device. Use a knife or like to move the first inner sleeve into position as needed. Flush the ends of the wires against a flat surface to ensure an even alignment of the wires and the first inner sleeve. After putting the first inner sleeve into position at the first end of the wires, push the first outside sleeve 20 and the washer 22 downward or toward the first inner sleeve until both the first outer sleeve and washer fit tight together and can no longer be moved downward by hand over the wires. Reinsert the inner sleeve blank above the washer for support of the wires during the construction process. Use a rubber band 16 or retention device to hold the wires and the inner sleeve blank together in place. [0043] FIG. 5 shows the alignment of the wires 10 on the first end of the device 2. Check the alignment and position of the wires about the first inner sleeve 18 and the inner sleeve blank 14. Ensure that all of the wires are both straight and level before locking the first outside sleeve 20 over the first inner sleeve by forcing the first outside sleeve over the wires and the first inner sleeve. [0044] To lock the wires 10 into place, firmly tap the washer 22 downward or toward the first inside sleeve 18 as shown in FIG. 6. During the tapping process, the peripherally arranged wires are pressed between the sleeves 18 and 20, and the wires will be compressed between the sleeves and impinged upon between the outer sleeve 20 and the inner sleeve 18. This same process of compressing the peripherally arranged wires between the inner and outer sleeves is repeated on the opposing second end of the wires. The inner and outside sleeves should be properly sized circumference to allow for a tight fit between the sleeves for the wires to be securely held. The ends of the wires may be positioned against a flat surface during forceful tapping of the outside sleeve over the inner sleeve and compression of the wires to keep the ends of the wires flush and provide a support against the force of tapping the washer. The washer pushes the outside sleeve over the smaller circumference inside sleeve. Thereby, the first outside sleeve locks the wires in place between the first outside sleeve and first inner sleeve through compression of the wires between the two sleeves. [0045] Once the washer 22 and first outside sleeve 20 have been forced into position over the first inner sleeve 18, the wires 10 will be flush on the end and tightly held within the sleeves similar to the illustration of FIG. 7. The friction between the wires and the sleeves will hold the wires and also cause the plurality of wires to separate slightly in the center. A dye 24 is used to further expand and separate the wires and form the chamber defined by the basket 4 in subsequent steps. [0046] Before proceeding to form the wires and lock the opposing second end of the wires, remove the inside sleeve blank 14 that was inserted before the process of locking the first outside sleeve 20 and first inner sleeve 18. The inner sleeve blank will be easy to remove by hand, as the wires 10 are spread on the end opposing the locked sleeves. Any retention device 16 or rubber band used on the wires during the prior steps of assembly can be removed to facilitate removal of the inside sleeve blank from the wires. The spread of the wires prepares the assembly for insertion of a small dye 24 that is illustrated in FIG. 8 inside the wires as shown in FIG. 9. [0047] To bend the wires on the first end, insert the small dye 24 into the open spread end of the wires 10 and move the dye downward into the secured end of the wires by hand as represented in FIG. 9. The circular dye in FIG. 8 will be used to bend the wires outward at an angle, which helps to form the chamber of the basket 4 for pine cone retrieval and storage with the device. [0048] Referring further to FIG. 9, the dye 24 is positioned by hand into the wires 10 as far as possible, and the dye is aligned into a position with the circumference of the dye contacting the inside surface of the wires within the chamber. This positions the dye for being pressed further downward or toward the locked first end of the wires where the first inner sleeve 18 and first outside sleeve 20 is positioned. An unlocked end of the wires that are situated at the opposite end of the wires opposing the locked end will naturally spread apart with the dye inserted. With the dye inserted into this position, a retention device 26 may be placed around the unlocked second end of the wires as in FIG. 9 to hold the wires closer together temporarily while pressing the dye toward the locked end. Pressing the dye will naturally cause the wires to expand if not retained by some means. Retaining the wires will provide a safe environment for pressing the wires, whereby the unlocked ends of the wires are not able to stab a person. [0049] Also shown in FIG. 9, the wires 10 are pressed by sliding the locked end of the assembly over the shaft of a press 28, the process begins by slightly pressing the wires to open the chamber and cause the dye 24 to slide further downward toward the locked end of the wires at the first inner sleeve 18 and first outside sleeve 20. The dye is then fully pressed into engagement with the first inner sleeve or so far toward the first inner sleeve as desirable, so as to deform and bend the wires to the extent specified for the final design and shape of the chamber to be formed. Pressing the dye toward the first inner sleeve, therefore, permanently deforms the wires and causes the wires to spring outward from the first locked end. The dye is then removed and the wires retain the deformed shape causing the wires to spring outward on the unlocked second end of the wires as shown in FIG. 10. [0050] Spreading the wires 10 prepares them for insertion of a rotatable covering or tubes 12 over sets of one or more of the wires. A retention device, such as a rubber band, may be used for safety to keep the wires closer together and less hazardous for accidental injury. Once the wires are prepared, a plurality of rotatable coverings or tubes 12 are placed over individual or groupings of wires as shown in FIG. 11. The coverings slide over the wires from the unlocked end and slide toward the locked end, thereby exposing the unlocked ends of the wires for further processing in manufacture of the device. In the preferred embodiment shown, the majority of the wires are paired in sets of two, and a covering is placed over each pair to provide a rotatable sheathing over the wires. Some individual wires may be stranded and can be covered individually by such covering if more precision is not required for the quality and application. [0051] The covering comprises flexible plastic tubing that is cut into tubes 12 ; the tubing is commonly used as a conduit for electrical wiring. The flexible tubing is flexible enough for the chamber to spread apart as the wires 10 spring into position and form an ovoid chamber having an area for collecting a multitude of pine cones or other objects. The flexible tubing is also durable enough for long lasting use in collecting objects such as pine cones while rolling the device on the ground. [0052] A typical flexible tubing section or tube 12 is shown in FIG. 11 and comprises conduit tubing or like tubing material as discussed above. Nylon provides both a flexible and durable material for the tubing; thus, nylon is a suitable material for the tubing. For a preferred size pine cone retrieval device 2, the wires 10 are manufactured to a specification desirable for use of 18 inch tubing sections. Thus, each tube is cut to a length of 18 inches prior to insertion onto the wires. In one embodiment, as the tubing is installed over the wires, a piece of tubing may be inserted over every two naked wires in series until all of the wires are covered in sets of two by a section of tubing. Referring to FIG. 12, once all of the wires are covered by tubing, the wires are brought closer together at the center of the length thereof and retained in close proximity by a retention device such as a rubber band 30 for work on the unlocked end of the wires. [0053] The process for locking the wires on the opposing end is very similar to the process for locking the first end. First as illustrated in FIG. 13, a second washer 32 like that on the first end of the wires is placed over the loose end of the wires by sliding the wires 10 through the aperture of the washer such that the wires are situated on the inside of the washer and run through with loose ends of the wires extending beyond the washer. [0054] Next, as depicted in the assembly of FIG. 13 and FIG. 14, a second outside sleeve 36 is then inserted over the loose ends of the wires that extend beyond the washer. The second outside sleeve slides over the wires 10 and then abuts the second washer 32. Then, in accordance with FIG. 15, the partially assembled device is then placed over a rod 38, whereby the rod is positioned on the inside of the chamber created by the wires. An end of the rod has a dye formed for pressing a second inner sleeve 34 into position inside of the wires and the second outside sleeve. Thus, the second inner sleeve is positioned onto the dye end of the rod, and the dye end of the rod is position into alignment with the unlocked end's outside sleeve and wires. [0055] The opposing end of the rod 38 is situated through the locked end within the chamber as shown in FIG. 15 for operation of the press 28. The second inner sleeve 34 is pressed down or into the second outside sleeve 36 on the unlocked second end of the wires to lock the wires 10 on the second end into place between the second outside sleeve and the second inner sleeve. The press may be operated by tapping the second inner sleeve into the second outer sleeve or by using a press machine. The enlarged portion of FIG. 15 shows the second end of the wires of the device showing the wires locked in place between the second inside sleeve and second outside sleeve; thereby, the wires on both ends of the chamber formed by the wires are then locked into place. [0056] The second end of the wires 10 is locked and prepared for removal of the press. The rod 38 used for the press 28 may then be pulled out and removed from the device, and the second end of the wires of the device is then ready for a dye to be inserted inside the chamber for expansion of the wires on the second end. Care is used not to injure the tubes 12 on the wires and the dye is pressed on the second end to expand the wires. The chamber is pressed causing the chamber to further enlarge into a generally oval shaped configuration. The wires are formed on each end to bend the wires slightly and form the basket 4 defined by the chamber. Next, the inner wall of the chamber is pressed causing deformations in the wires near the first and second ends of the chamber. The deformations are equally spaced from the washers 22 and 32 near each end of the wires of chamber. The deformations allow the plurality of wires 10 to bend toward a vertical orientation near the washers, such that the final structure of the chamber will appear as shown in FIG. 16 with the plurality of wires formed into a generally oval chamber having generally flattened ends. [0057] The device 2 is formed to include a basket 4 for retrieval of pine cones 40 as shown in FIG. 16. The device includes a means for attaching the device to a bail 42 and a handle 44 that are used during hand operated use of the device. In particular, after the deformations are pressed into the wires 10, bolts 46 are inserted through the inner sleeves 18, 34, and the heads 48 of the bolts bear against the outer and inner sleeves shown in FIG. 16. Rubber washers are disposed on the bolts 46 and against the inside of the ends of the chamber. Metal washers are disposed on the bolts against the rubber washers, such that both the metal washers and rubber washers are inner washers 50 within the chamber. Hex nuts 52 are threaded on the ends of bolts, whereby the nuts are tightened on the bolts 46. As the hex nuts are tightened on the bolts, the ends of the wires are clamped tightly between the inner washers 50 and the outer washers 22, 32, thereby deforming the wires further and thus causing the ends of the chamber to flatten and bowing the center portion of the chamber into a larger generally oval shaped configuration forming the basket 4. [0058] A small cavity 54 shown in FIG. 16 is drilled into the head 48 of each bolt 46 on both ends of the device 2 for receiving the bail 42. A handle 44 is attached to bail as shown in FIG. 16 by means of a wing nut 56 welded to said bail. The handle may be constructed of wood, plastic, fiberglass or suitable material depending on the qualities desired including cost and durability. A threaded bolt inserted through the wing nut tightens into a threaded receptacle of the handle. Thereby, the bail retains the basket 4 and allows the basket to roll as the device 2 is operated by the handle 44 to retrieve pine cones 40 as depicted in FIG. 16.

Summary: A rolling collection tool allows for retrieval of ground objects including pine cones by a user while standing erect. A method for construction of the device is provided in which a plurality of wires are formed into a generally oval shaped chamber and covered in a flexible covering in sets of two or more wires. The chamber is connected to a bail and handle and rolls to pick up and store objects in the chamber until emptied. The objects enter the chamber as the device rolls by temporary separation of the covered wires for the object, and the device retains the objects by resilient return movement of the covered wires to their original position. The flexible covering on the wires rotates around sets of the wires as the device retrieves objects.

big_patent

en

Summarize: Nonhuman primates, our closest biological relatives, play important roles in the livelihoods, cultures, and religions of many societies and offer unique insights into human evolution, biology, behavior, and the threat of emerging diseases. They are an essential component of tropical biodiversity, contributing to forest regeneration and ecosystem health. Current information shows the existence of 504 species in 79 genera distributed in the Neotropics, mainland Africa, Madagascar, and Asia. Alarmingly, ~60% of primate species are now threatened with extinction and ~75% have declining populations. This situation is the result of escalating anthropogenic pressures on primates and their habitats—mainly global and local market demands, leading to extensive habitat loss through the expansion of industrial agriculture, large-scale cattle ranching, logging, oil and gas drilling, mining, dam building, and the construction of new road networks in primate range regions. Other important drivers are increased bushmeat hunting and the illegal trade of primates as pets and primate body parts, along with emerging threats, such as climate change and anthroponotic diseases. Often, these pressures act in synergy, exacerbating primate population declines. Given that primate range regions overlap extensively with a large, and rapidly growing, human population characterized by high levels of poverty, global attention is needed immediately to reverse the looming risk of primate extinctions and to attend to local human needs in sustainable ways. Raising global scientific and public awareness of the plight of the world’s primates and the costs of their loss to ecosystem health and human society is imperative. Keywords Nonhuman primates (primates hereafter) are of central importance to tropical biodiversity and to many ecosystem functions, processes, and services. They are our closest living biological relatives, offering critical insights into human evolution, biology, and behavior and playing important roles in the livelihoods, cultures, and religions of many societies. Unsustainable human activities are now the major force driving primate species to extinction. Here, we combine the most frequently used standard for species conservation status [the International Union for Conservation of Nature (IUCN) Red List] with data from peer-reviewed scientific literature and from the United Nations databases to evaluate human-induced threats to primate survival. We examine trends in forest loss resulting from regional and global economic pressures and discuss the impacts of hunting, illegal trade, and other anthropogenic threats on primate populations. We also model agricultural expansion into the 21st century and identify expected spatial conflict within primate range areas. We assess the current level of scientific knowledge available for individual primate taxa, and we highlight the ecological, social, cultural, economic, and scientific importance of primates, as well as the global consequences of their population declines. We also consider future research needs and advances in technology for monitoring human-induced environmental changes that affect primate populations. Finally, we propose a conceptual model to guide the development of global, regional, and local approaches to promote primate conservation while at the same time attending to human needs. The goal of this review is not to produce a list of threats but rather to urge attention to the multiple global and regional anthropogenic factors that imperil primates worldwide and to encourage the development of sustainable and effective solutions that enhance primate survival in the medium and long term. Assessment of threat level is according to the IUCN Categories and Criteria VU (Vulnerable), EN (Endangered), and CR (Critically Endangered). Number in parentheses after each family indicates the number of species recognized in the family. Data for each species are indicated in tables S1 to S4. Notably, there are threatened species in all 16 primate families. Ten families have more than 50% of their species threatened (broken line at 50%). Note that the graph is only for the Threatened IUCN categories. Families not showing 100% values may have some species classified as Near Threatened (NT), Least Concern (LC), Data Deficient (DD), and Not Evaluated (NE) (see tables S1 to S3). Upon revision of the taxonomy of Malagasy lemurs, a number of taxa once thought to be widespread are now highly threatened; a similar scenario is envisioned for the galagids, where there appears to be a large number of newly recognized species with limited ranges. Taxonomy is based on previous works ( 1 – 3 ). Using information from the IUCN and our current assessment, we estimate that ~60% of primate species, from all 16 extant families, are threatened with extinction because of unsustainable human activities ( Figs. 1 and 2 and tables S1 to S4). Threats to primates are widespread: 87% of species in Madagascar are threatened, as are 73% in Asia, 37% in mainland Africa, and 36% in the Neotropics ( Fig. 1 and figs. S2B and S3A). The populations of 75% of primate species are decreasing globally ( Fig. 1 and fig. S3B). Considering the large number of species currently threatened and experiencing population declines, the world will soon be facing a major extinction event if effective action is not implemented immediately. Geographic distribution of primate species. Numbers in red by each region refer to the number of extant species present. The bars at the bottom show the percent of species threatened with extinction and the percent of species with declining populations in each region. Percentage of threatened species and percentage of species with declining populations in each region from tables S1 to S4. Geographical range data of living, native species from the IUCN Red List (www.iucnredlist.org) are overlaid onto a 0.5° resolution equal-area grid. In cases in which a species’ range was split into multiple subspecies, these were merged to create a range map for the species. Mainland Africa includes small associated islands. The order Primates is one of the most species-rich groups of mammals, surpassed only by the orders Chiroptera (bats, 1151 species) and Rodentia (rodents, 2256 species) ( 1, 2 ). The most recent taxonomic compilation (April 2016) lists 701 extant taxa belonging to 504 species from 79 genera and 16 families (tables S1 to S4 and Supplementary Text) ( 2 – 5 ). Primates occur in four regions—the Neotropics (171 species), mainland Africa (111 species), Madagascar (103 species), and Asia (119 species) ( Fig. 1 )—and are present naturally in 90 countries; however, two-thirds of all species occur in just four countries—Brazil, Madagascar, Indonesia, and the Democratic Republic of the Congo (DRC) (figs. S1 and S2A). These countries represent high-priority areas for primate conservation. The large majority of primates inhabit tropical moist lowland forests, but they also occur in tropical dry forests, mangrove vegetation above high-tide levels, moist montane forests, high-elevation (from 1000 to >4000 m) deciduous and broadleaf temperate forests, savannas, grasslands, inland wetlands, rocky areas, and even deserts ( 2, 4 ). The body mass of living primates ranges from 30 g in Madame Berthe’s mouse lemur (Microcebus berthae) to about 200 kg in male western and eastern gorillas (Gorilla gorilla and Gorilla beringei, respectively) (Supplementary Text) ( 2, 4, 5 ). FACTORS THAT THREATEN PRIMATE POPULATIONS The IUCN indicates that the main threats to primate species are loss of habitat due to agriculture (76% of species), logging and wood harvesting (60%), and livestock farming and ranching (31%), as well as direct loss due to hunting and trapping (60%) (fig. S4A). Other threats, such as habitat loss due to road and rail construction, oil and gas drilling, and mining, affect 2 to 13% of primate species, and there are also emerging threats, such as pollution and climate change (fig. S4B and table S5). Globally, agriculture is the principal threat, but secondary threats vary by region. For example, livestock farming and ranching negatively affect 59% of primate species in the Neotropics. In contrast, in mainland Africa, Madagascar, and Asia, hunting and trapping affect 54 to 90% of the species. Logging is the third greatest threat to primates in all regions (fig. S4A). Land-cover changes, global market demands, and industry-driven deforestation Global market demands for nonarboreal (for example, soybeans, sugar cane, and rice) and arboreal crops (for example, oil palm and natural rubber), livestock (particularly cattle), and tropical hardwoods have resulted in a process of rapid and widespread industry-driven deforestation in the Neotropics, mainland Africa, Madagascar, and Asia (Supplementary Text and fig. S5, A to F) (6). For example, between 1990 and 2010, agricultural expansion in primate range regions was estimated at 1.5 million km2 (an area three times that of France) and forest cover loss at 2 million km2 (Fig. 3 and fig. S6, A to C). Increasing global demand for oil palm products is a major driver of recent severe declines in Sumatran and Bornean orangutan (Pongo abelii and Pongo pygmaeus, respectively) numbers and a serious risk for African apes because large segments of existing populations occur outside protected areas (7–10). Moreover, future oil palm development is likely to threaten forested areas in South America and Africa (10), which is projected to result in severe negative consequences for primate populations in those regions (fig. S5C). The expansion of rubber plantations in southwest China has caused the near extinction of the northern white-cheeked crested gibbon (Nomascus leucogenys) and the Hainan gibbon (Nomascus hainanus) (11). Similarly, deforestation due to the establishment of rubber plantations in India is reported to have severely affected the Bengal slow loris (Nycticebus bengalensis), the western hoolock gibbon (Hoolock hoolock), and Phayre’s langur (Trachypithecus phayrei) (11, 12). Modeling the overlap between primate species’ distributions and forecasted future agricultural production for the 21st century indicates that regions predicted to undergo the greatest agricultural expansion over the next decades comprise 68% of the global area currently occupied by primates (Fig. 4). This will result in unprecedented spatial conflict with 75% of primate species worldwide (Supplementary Text). Therefore, the implementation of policies to divert agricultural expansion to areas where it is likely to result in the least environmental impacts is essential to reduce spatial conflicts between primate-rich areas and the expanding agricultural frontier (13). Fig. 3 Agricultural expansion and declines in forest cover for the period 1990–2010 in primate range regions. A rapid expansion of agriculture in primate range regions has been paralleled by a sharp decline in forest cover in the 20-year period considered. Trends for each individual region are shown in fig. S6 (A to C). Data for Africa include Madagascar (source of raw data, FAOSTAT: faostat.fao.org/site/377/DesktopDefault.aspx?PageID=377#ancor. Consulted June 2016). Fig. 4 Global patterns of forecasted agricultural expansion for the 21st century in primate range regions and estimated range contraction. (A) Estimated current global primate distributions. (B) The predicted 21st century expansion of agriculture estimates a spatial overlap with about 75% of primate species habitat worldwide. Red areas indicate higher spatial overlap between agricultural expansion and primate habitat. Blue areas indicate limited spatial conflict. Agricultural expansion represents a synthesis of the expected increase in the location and area devoted to agricultural production, according to the land-cover map produced by the Integrated Model to Assess the Global Environment and potential productivity obtained from the Global Agro-Ecological Zones (Supplementary Text) (13). (C) Estimated range contraction in primate distributions by the end of the 21st century under a worst-case scenario of agricultural expansion. See Supplementary Text for methods. Logging, mining, and fossil fuel extraction Globalized financial markets and a worldwide commodity boom have led to an ever-growing demand for tropical timber and a concomitant expansion of industrial logging, resulting in deforestation and creating a potent economic impetus for road building in forested areas (Supplementary Text) (14). Countries in primate range regions are responding to global market demands by expanding logging activities to increase economic growth. In 2010, the Neotropics accounted for 48% of the production of industrial hardwood, followed by Southeast Asia (23%), sub-Saharan Africa (16%), and South Asia (13%) (fig. S5E). In Madagascar, the large-scale harvesting of rosewood (Dalbergia) since 2009 has negatively affected several protected areas (15). The immediate and long-term effects of legal and illegal logging are a reduction of canopy cover, the destruction of forest undergrowth, and the decline of large tree species important to primates as sources of food and shelter (16). Mining for minerals and diamonds is also a growing threat to tropical ecosystems and their primates. Although it involves relatively small areas, mining contributes to deforestation, forest degradation, and the pollution and poisoning of streams and soil (17). In central Africa, the population densities of apes in mined forests [75.7 (45.35 to 126.33) nests/km2] are markedly lower than in forested sites where mining is absent [234 (185 to 299) nests/km2] (18). In Madagascar, illicit gold and sapphire mining by itinerant miners has affected many forests, including protected ones (19). Mining of gold, nickel, and copper on Dinagat island, in the Philippines, is endangering the survival of the Philippine tarsier (Carlito syrichta) (20). Bushmeat hunting associated with the mining of coltan, tin, gold, and diamonds in the DRC is the main threat to Grauer’s gorilla (G. beringei graueri) (21); recent surveys indicate a 77% decline in its numbers, from 17,000 in 1995 to just 3800 in 2014/2015 (22). In Perú, the mining of zinc and copper threatens the endemic and Critically Endangered yellow-tailed woolly monkey (Lagothrix flavicauda) (23). Development associated with fossil fuel extractions also jeopardizes primate survival. By 2035, global demand for oil and natural gas is projected to increase by >30 and 53% respectively, and primate-rich areas, such as the western Amazon and the western Pacific Ocean (Malaysia, Borneo) will be adversely affected. It is estimated that oil and gas concessions in the western Amazon, and in remote forested areas of Colombia, Ecuador, Brazil, Perú, and Bolivia, already cover about 733,414 km2 (twice the size of Germany) (24). Other anthropogenic stressors The expansion of industrialized agriculture, logging, mining, oil/gas extraction, and the building of dams and power-line corridors in tropical forest areas is expected to increase human transportation road networks by some 25 million km by 2050 (Supplementary Text) (25). Consequences of the unrestricted road and rail building include increased forest losses from human population migration, illegal colonization, and logging; increased bushmeat hunting; and the illegal wildlife trade (Supplementary Text) (26). The construction of conventional dams and megadams for generating electricity to attract energy-intensive industry and stimulate local productivity in the world’s most biodiverse river basins—the Amazon, Congo, and Mekong—also poses a severe threat to local primate persistence (27). For example, the development of 12 megadams in the state of Sarawak, Malaysia, is expected to result in the loss of at least 2425 km2 of forest cover, affecting populations of the Endangered Müller’s gibbon (Hylobates muelleri) (28). Currently, primates feeding on crops (commonly termed “crop raiding”) is not considered a major cause of global primate population declines by the IUCN because much of the conflict is local in its occurrence, impact, and the types of crops and primate species affected (9, 29–33). There are areas of the world, such as parts of North Africa and Asia, where humans tolerate primates as crop pests because of religious beliefs, cultural traditions, and economic benefit (29). For example, in the Lindu highlands and Buton island of Sulawesi, humans are tolerant of crop feeding macaques due to the role the macaques hold in the local folklore and because they can help in the harvesting of certain crops, such as cashews, where the monkeys eat only the fruit and let the nut fall to the ground to be collected by farmers (29). In other cases, crop feeding by primates (for example, howler monkeys) is tolerated without any economic reward (30). Where human and nonhuman primates come into more severe conflict due to crop raiding [for example, chimpanzees (Pan troglodytes), gorillas (Gorilla spp.), and baboons (Papio spp.) in Africa and orangutans (Pongo spp.) in Southeast Asia] (9, 31–33), culturally and economically appropriate management interventions can mitigate the impact (9, 33). Human-primate conflict due to primates feeding on crops remains a persistent problem and is likely to increase because primate-suitable habitat is converted into agricultural fields or gardens in response to local and global market demands (Fig. 4). Civil unrest also affects primate populations because of saturation bombing, the use of defoliating chemicals (34, 35), and the increase in bushmeat hunting. Poaching of bonobos (Pan paniscus) and gorillas, for example, markedly increased in the DRC and Rwanda as a result of ongoing civil wars (34). In Cambodia, armed conflicts have severely affected populations of the black-shanked douc (Pygathrix nigripes) (35). Land mines, the legacy of wars in the 1960s and 1970s, continue to endanger apes in Southeast Asia and Africa (34, 36). Forest fragmentation and degradation and the limited resilience of primates Long-term deforestation has resulted in the fragmentation of 58% of subtropical and 46% of tropical forests (37, 38), forcing primates to live in isolated forest patches, including protected areas. This has led to decreasing numbers, population restructuring, and the loss of genetic diversity, as shown for pied tamarins (Saguinus bicolor), northern muriquis (Brachyteles hypoxanthus), Udzungwa red colobus monkeys (Piliocolobus gordonorum), several species of Chinese colobines (Rhinopithecus and Trachypithecus), Cross River gorillas (G. gorilla diehli), and Bornean orangutans (39–45). Edge effects predominate in many areas of disturbed forests, exacerbating habitat degradation (37). Agricultural expansion as well as legal and illegal logging cause further desiccation of vegetation, and human-induced forest fires devastate large areas in primate range regions yearly, resulting in increased tree mortality and losses of up to one-third of canopy cover (46, 47). Although the effects of habitat loss, fragmentation, and degradation upon primates are mediated by variations in species-specific traits (rarity, trophic levels, dispersal mode, reproductive biology, life history, diet, and ranging behavior), the common response across taxa is population decline (Fig. 1). Some primates are more behaviorally and ecologically resilient than others when faced with habitat loss, fragmentation, and degradation. Bornean orangutans, for example, can survive, at least temporarily, in logged forests, Acacia plantations, and oil palm plantations (48). Baboons (Papio), Hanuman langurs (Semnopithecus), and macaques (Macaca) are particularly adaptable and can survive even in urban areas (49). Chimpanzees appear to evaluate risks when crop-foraging and adjust their foraging patterns in deciding whether to exploit fragmented forests near humans (50). Bonobos tend to avoid areas of high human activity, fragmented forests, or both, and although this may suggest flexibility, the presence of humans appears to significantly reduce their access to potentially available habitat (51). Still, persistence in isolated forest fragments, logged forests, agroecosystems, and urban areas is unlikely to be a sustainable option for most species due to hunting, further habitat reduction and fragmentation, reduced carrying capacity, parasite and disease transmission from humans and domestic animals, dog predation, human-primate conflict due to crop raiding, isolation, and continued changes in land use (52). Primates in degraded forests face nutritional shortfalls and lower gut microbial diversity (53–55). They also show an increased prevalence of parasites and pathogens. For example, the increased exposure of lemurs (Avahi laniger, Eulemur rubriventer, Hapalemur aureus, Microcebus rufus, Propithecus edwardsi, and Prolemur simus) and chimpanzees (P. troglodytes) to human populations has increased their risk of infection by diarrhea-causing enteric pathogens (56, 57). The close phylogenetic relationship between humans and other primates also creates an exceptionally high potential for pathogen exchange (58), as evidenced by disease emergence in humans as an unintentional effect of the hunting and butchering of wild primates (for example, human outbreaks of Ebola and the global HIV/AIDS pandemic) (59). In addition, exponential human population growth (fig. S7, A and B) and associated human-induced forest loss increase opportunities for wild primates to become exposed to human and domesticated animal pathogens (60). Primates escaping or released from the pet trade or sanctuaries can carry pathogens with a potential of transmission to resident populations (61). Moreover, ecotourism and research, despite contributing in positive ways to primate conservation, have the unintended consequence of exposing wild primates to human pathogens (62, 63). Hunting Human population growth and increasing per capita wealth have led to an increase in commercialized bushmeat hunting relative to subsistence hunting in many parts of the world. This has become a major driving force for primate population decline, especially in Africa and Southeast Asia (45, 64). Although bushmeat hunting is difficult to track, reports indicate that about 150,000 primate carcasses from 16 species were traded annually as bushmeat in urban and rural markets at 89 sites in Nigeria and Cameroon (Supplementary Text) (64). In Borneo, between 1950 and 3100 orangutans are estimated to be killed annually (including 375 to 1550 females), a level that far exceeds the maximum sustainable offtake for population viability (45). Because only a relatively small number of primates live inside protected areas [for example, 21 to 27.5% of all great apes (51, 65)], populations outside protected areas are declining rapidly; the consequent increase in rarity raises the price of primate meat, making it more worthwhile for poachers to risk encroaching into protected areas to hunt (66). Legal and illegal trade Many primate species are increasingly threatened by legal and illegal unsustainable trade. Primates are traded for consumption, biomedical research, and zoo and wildlife collections; as pets; for the sale of body parts (bodies, skins, hair, and skulls) used in traditional medicine; as talismans and trophies; and for magical purposes (67, 68). The Convention on International Trade in Endangered Species (CITES) database for 2005–2014 reported a global primate trade of some 450,000 live individuals plus an additional 11,000 individuals in the form of body parts. Asian species accounted for 93% of this trade (12 genera), Neotropical species for 4% (13 genera), and African species for 3% (33 genera) (table S6 and fig. S8, A to C). However, these figures are conservative because CITES only reports statistics formally provided by each country. For example, although CITES reported fewer than 400 night monkeys (Aotus) traded internationally between 2005 and 2014 (table S6), in the tri-border area between Perú, Brazil, and Colombia, it was estimated that ~4000 night monkeys (Aotus nancymaae, Aotus vociferans, and Aotus nigriceps) were traded to a single biomedical research facility between 2007 and 2008 alone, for a price of approximately $100,000 (69). The expansion of road networks in frontier forests facilitates the extraction and trade of primates to cities and beyond borders (25). Together with increasing opportunities from e-commerce, this has given suppliers and smugglers unprecedented access to new markets (70, 71). Wildlife laundering (mixing protected species with legal shipments of similar species) also occurs when wild-collected primates are passed off as captive bred (Supplementary Text) (72). Climate change Although empirical evidence for the impact of climate change on primates is scarce, a recent global assessment suggests that numerous primates will experience changing climatic conditions during the 21st century, with the Amazon, the Atlantic Forest of Brazil, Central America, and East and Southeast Asia being considered hotspots of climate change–induced primate vulnerability (73). Primate taxa with limited geographic distributions and species characterized by slow life history traits (for example, late age at first reproduction and long interbirth intervals) are highly vulnerable to shifting ecological conditions and are likely to be most affected (74, 75). Although some species may cope with these changes either by migrating to more suitable conditions or by adapting in situ, dispersal or range shift is not always possible and may have highly negative consequences (Supplementary Text) (76). Forest fragmentation induced by climate change can affect the availability of dispersal routes (77). Climate change may also force individuals out of protected areas, making them more vulnerable to hunting and other anthropogenic impacts (78), and range shifts among interacting species can affect food supplies and introduce new predators, pathogens, and/or competitors (79). Interactions between climate change and other extinction drivers also need to be considered. For instance, projections of land-cover change show that the Bornean orangutan might lose 15 to 30% of its habitat by 2080, mainly due to deforestation and oil palm agriculture, but when coupled with climate change, even more habitat is likely to become unsuitable (80). Additionally, more frequent and severe climate change can induce floods, droughts, fires, hurricanes, and El Niño–Southern Oscillation events (81) that can affect the food supply available to primate populations, with negative impacts on health, fertility, and mortality (82). “There are distinct species that have been around for millions of years, even though they look to our eyes very similar,” said Dr. Yoder. Unfortunately, she noted, new species revealed by DNA often turn out to exist in perilously low numbers. The new research was not all bad news for primates. “Some species are doing O.K.,” said Katherine C. MacKinnon, an anthropologist at Saint Louis University and a co-author of the study. “The ones that are doing O.K. are the ones that aren’t super-specialists, the ones that are most flexible.” But most species are not so flexible. Every species of ape (including gorillas, chimpanzees, bonobos, orangutans and 19 species of gibbons) is threatened, while 87 percent of lemur species are. Other species that are critically endangered include the brown-headed spider monkey of Ecuador, the Niger Delta red colobus, and the crested macaque, an Indonesian species famous for having taken a selfie with a photographer’s camera. “It’s worse than we thought 10 years ago,” Dr. MacKinnon said. She and her colleagues identified a number of human activities pushing primates to the edge, such as hunting. In West Africa, for example, there is a strong demand in local markets for primate meat. “The forests are still standing, but they’ve shot everything out of it,” said Dr. Rylands. The incentives to kill primates are not only local, though. A lot of primate meat is making its way to China, along with body parts falsely believed to have healing powers. “They’ll import enormous amounts from around Southeast Asia,” said Dr. Rylands. “They’re a driving force through the whole region.” Primates are also threatened by the wholesale destruction of forests to make way for agriculture. In the Amazon, the jungle is being converted to cattle ranches and soybean fields, while in Madagascar, rice paddies are taking the place of lemur forests. Conservation International/photo by Russell A. Mittermeier The majority of the world’s primates are in deep trouble. There are as few as 20 or 30 Hainan gibbons left in China, and the trapdoor of extinction is gaping for the Javan slow loris. Even numbers of Madagascar’s iconic ring-tailed lemur have slumped to around 2000. These could be the next primates to disappear from our planet. But overall, the picture is even bleaker, with 60 per cent of all primate species globally predicted to vanish within between 25 and 50 years. That’s the gloomy conclusion from the largest ever review of the survival prospects of the world’s 504 known species of non-human primate, 85 of them discovered since 2000. “This paper is a synthesis of the factors, at all scales, that are causing declines and extinctions,” says Anthony Rylands of Conservation International, joint lead author of the report. Advertisement The biggest harbinger of doom is clearance of forests for agriculture, both by local farmers and by big agro-industrial producers of commodities such as palm oil and rubber. Between 1990 and 2010, for example, agricultural expansion into primate habitats was estimated at 1.5 million square kilometres, an area three times that of France. Save our species “Our paper is a plea to address the consequences of destruction and degradation of primate habitats worldwide,” says Rylands. “Agriculture as a threat can only be dealt with at all scales, influenced as it is by global trends, by government policies, corporate practices and malpractices, and regional and local policies.” Much effort could focus on just four countries – Brazil, Indonesia, Madagascar and the Democratic Republic of the Congo – which host two-thirds of all primate species. Madagascar could be a good place to start as all 111 of its lemurs are unique to the island, and 94 per cent are threatened. “Madagascar is far and away the highest primate conservation priority, in a land area that’s less than 1 per cent of all known primate habitat, but which in Madagascar is already 90 per cent cleared,” says co-author Russell Mittermeier, also at Conservation International. “The most endangered there is the northern sportive lemur, down to just 50 individuals.” All 39 ape species and subspecies, including orangutans, are now ranked as threatened with extinction. All 19 colobus species in Africa are threatened, with 12 critically endangered or endangered. And all Asian lorises are in trouble, not just from habitat loss but also through poaching and trade in their body parts. Journal reference: Science Advances, DOI: e1600946 Read more: Last chance plan to save world’s rarest ape, the Hainan gibbon; On the trail of some of the world’s rarest monkeys

Summary: "It's worse than we thought 10 years ago," a researcher says following a "landmark" study on the world's primates that found many could go extinct in the next 50 years. Primatologists studied every primate species-all 504 of them-and found 75% are in decline, while about 60% are threatened with extinction, including every species of ape and 87% of lemurs, reports the New York Times. What's imperiling them: hunting (for food and body parts), mining (the search for coltan, an ore used in cellphones, is one factor), and deforestation (our appetite for palm oil is particularly troublesome). The Guardian reports deforestation is the biggest factor of the three: From 1990 to 2010, 580,000 square miles of primate habitats-an area more than twice the size of Texas-was destroyed due to agricultural growth. "The scale of this is massive," a researcher tells the Guardian, adding he was "horrified" by the report. "The world will soon be facing a major extinction event if effective action is not implemented immediately," reads the study, published Wednesday in Science Advances. New Scientist suggests conservation efforts could zero in on four key countries, which host two-thirds of our primate species: Brazil, Indonesia, Democratic Republic of the Congo, and Madagascar, which is down to the last 2,000 of its famed ring-tailed lemurs. Building fish farms in areas where hunting is common and protecting primate habitats might safeguard primates' roles in the ecosystem, including moving pollen from tree to tree and spreading seeds through their dung, researchers say. This could be our "one last opportunity."

multi_news

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATIONS [0001] The present application is a continuation-in-part patent application of, and claims priority under 35 U.S.C. §120 to, U.S. nonprovisional patent application Ser. No. 11/163,888, filed Nov. 2, 2005, which patent application is incorporated by reference herein. COPYRIGHT STATEMENT [0002] All of the material in this patent document is subject to copyright protection under the copyright laws of the United States and other countries. The copyright owner has no objection to the facsimile reproduction by anyone of the patent document or the patent disclosure, as it appears in official governmental records but, otherwise, all other copyright rights whatsoever are reserved. FIELD OF THE PRESENT INVENTION [0003] The present invention relates to methods and apparatus for creating an artistic work on a lawn and, in particular, to creating a team logo on a residential lawn in a show of support for the team to any passerby. BACKGROUND OF THE PRESENT INVENTION [0004] Methods and apparatus are known for marking surfaces to enhance special events. The surfaces that may be marked include parking lots, playgrounds, and sports fields. [0005] In one method that is used to create artwork on a sports field, a single stencil first is fastened to the desired area using weights or stencil anchors. Next, a pattern of small openings in the stencil are sprayed with an aerosol turf paint. Spraying of the small openings results in a pattern of dots on the turf. The stencil is then removed, and the aerosol turf paint, for example, is used to connect the dots. The large areas bounded by the connected dots then filled-in with bulk field paint. The method then ends with touch-up of the artwork as desired. [0006] In another similar method, a single stencil is used that includes a pattern of large openings. Spraying of the large openings results in at least an outline of a bounded area that then may be filled-in, for example, after the stencil is removed. This method obviates the connecting of the dots. [0007] A “paw stencil” is commercially available from Tru Mark Athletic Field Marker of Norfolk, Nebr., at www.athleticfieldmarker.com. The paw stencil is a single stencil made from a planar sheet of flexible film having a length of approximately fifteen and one-half feet and width of approximately seventeen and one-half feet and retails for $169. The stencil folds like a bed sheet into a two-foot by two-foot square for easy storage. [0008] Unrelated to the field of the present invention of creating a team logo on a residential lawn, Ogorzalek U.S. Pat. No. 5,460,087 (“Ogorzalek”) discloses a stencil kit for decorating architectural structures, i.e., walls, exterior surfaces of houses, and exterior surfaces of commercial buildings, using paint and stencil templates included in the kit. Ogorzalek notes that a common problem with conventional stencil kits for architectural structures is that the structure surfaces are vertical and therefore paint migrates under the stencil templates. To overcome this problem, the stencil template of Ogorzalek includes an adhesive backing so that the stencil template adheres to the surface being painted, and the stencil template includes a foam material layer that allows the surface of the stencil template to be deformed in order to conform with surface irregularities in the exterior surface of the architectural structure.” Nothing in Ogorzalek discloses or suggests that the stencil template might be secured to the surface being painted with stakes, nor does anything disclose or suggest the provision of stakes in the stencil kit. SUMMARY OF THE PRESENT INVENTION [0009] Aspects of the present invention include, inter alia, apparatus and methods for creating artistic works on a residential lawn. Kits for Creating Artistic Work on Residential Lawn [0010] In one such aspect, a kit for creating an artistic work on a residential lawn broadly includes: a lawn stencil; a container of paint; and a plurality of stakes. The stakes are used to anchor the stencil to the lawn and the paint is used to apply a layer of paint over the lawn stencil, which in turn applies a layer of the paint in a desired pattern on the lawn. In this regard, the lawn stencil includes a pattern of openings therein, which pattern corresponds to one or more design elements of the artwork to be applied to the lawn using the paint. The canister of paint preferably comprises an aerosol. [0011] In a feature of this aspect, the lawn stencil includes anchor openings each for receiving a stake, whereby the stencil is securely anchored to the lawn when the paint is used to apply a layer of paint. [0012] In another feature of this aspect, the kit includes first and second lawn stencils and first and second containers of paint of first and second colors. The first lawn stencil is used to apply a first design element of the artwork in the first color of the first container, and the second lawn stencil is used to apply a second design element of the artwork in the second color of the second container. The first design element is applied using the first lawn stencil and then the second design element is applied using the second lawn stencil. Additional lawn stencils and containers of paint also may be included in this aspect. [0013] Proper alignment and orientation of each of the first and second lawn stencils is important when applying the paint to create the respective design elements of the stencils, as the design elements work together to present the composite image representing the desired artwork. [0014] Accordingly, in a feature of this aspect, each lawn stencil preferably includes an indication of orientation that is arranged in the same manner for all of the lawn stencils. Preferably, such indication of origin can comprise, for example, the word “UP” and an arrow. The indication of orientation thereby is utilized to insure orientation of the pattern of a lawn stencil to the pattern of another lawn stencil. [0015] In a feature of this aspect intended to insure proper alignment of lawn stencils relative to one another when applying the paint, the first lawn stencil includes first and second alignment locations for alignment of the first lawn stencil when the first design elements are applied, and the second lawn stencil includes first and second alignment locations for alignment of the second lawn stencil when the second design elements are applied. Furthermore, the alignment locations of the lawn stencils preferably comprise anchor openings for receiving the stakes for anchoring of the stencils to the lawn. Because these anchor openings of the first and second lawn stencils are known, a pattern of the first lawn stencil can be manufactured relative to the alignment locations of the first lawn stencil, and a pattern of the second lawn stencil can be manufactured relative to the alignment locations of the second lawn stencil, thereby fixing the alignment of the patterns of the two lawn stencils relative to one another. [0016] In still yet another feature of this aspect, a stake includes a circumferential flange dimensioned such that, upon extension of the stake through an anchor opening of the lawn stencil, the stencil is retained between the circumferential flange and the lawn. The circumferential flange thereby tends to keep the stencil from lifting up off of the lawn when, for example, the stencil is being blown by the wind. A stake further may include one or more such circumferential flanges. [0017] In another feature of the present invention, a stake includes a top end thereof that is dimensioned for receipt of the palm of a hand for pushing of the stake into the lawn. In this regard, the top end is rounded and may comprise a semi-spherical or spherical design. [0018] In preferred embodiments of the kits, the artwork comprises an official emblem, mascot, or symbol of a sports team, such as a team logo of a college sports team, like the Georgia “G” or the Clemson tiger paw. In other preferred embodiments of the kit, the artwork comprises a team logo of a NASCAR racing team, like the Earnhardt “8”. In other preferred embodiments, the artwork relates to particular sporting events, such as a weekly games or seasonal playoffs or championships. [0019] Furthermore, each lawn stencil provided in the kit preferably includes a dimension no larger than about eight feet in height and about eight feet in length and, more preferably, a dimension no larger than about five feet in height and about five feet in length. Each lawn stencil also preferably comprises a flexible material having a width of about 2 to about 6 millimeters. The lawn stencils thereby are adapted for folding and convenient storage in a container intended for retail sale, storage, and transport by a consumer. Indeed, the kit preferably has a relatively small form factor that is dimensioned for point-of-sale display and purchase at retail stores by consumers. [0020] In this respect, the kit preferably includes a container in which are disposed all of the lawn stencils, containers of paint, and stakes that are necessary for creating an artistic work on a lawn, which artistic work preferably is represented on the outside of the kit. The lawn stencils preferably are individually folded and disposed within the kit. Furthermore, the dimensions of such a kit preferably are about eleven inches in length, about ten and one-half inches in height, and about five and one-quarter inches in width. As will be appreciated, the width and length dimensions of the artwork to be created using the kit are substantially larger than the dimensions of the kit itself. Method for Creating Artistic Work on Residential Lawn [0021] A second aspect of the present invention broadly includes a method using the kit and/or components thereof in accordance with the first aspect in creating an artistic work on a residential lawn. This method includes: anchoring a stencil to a lawn; and applying a layer of paint in a desired pattern on the lawn by spraying paint over a pattern of openings in the lawn stencil. In this regard, the pattern of openings in the lawn stencil corresponds to one or more design elements of the artwork to be applied to the lawn. [0022] In a feature of this aspect, the step of anchoring of the stencil to the lawn includes extending stakes through anchor openings of the lawn stencil. The stakes may be extended through the anchor openings by: first, laying the stencil upon the lawn, and then driving the stakes into the lawn through the anchor openings in the lawn stencil; and/or first driving the stakes into the lawn, and then sliding the lawn stencil over the stakes with the stakes extending through the anchor openings in the lawn stencil when positioning the stencil on the lawn. The stakes preferably are driven into the lawn by hand, and each stake preferably includes a top end thereof that is dimensioned for receipt of the palm of the hand for pushing of the stake into the lawn. In this regard, the top end is rounded and may comprise a semi-spherical or spherical design. [0023] In still yet another feature of this aspect, the step of extending stakes through anchor openings of the lawn stencil includes extending a stake such that the stencil is retained between a circumferential flange of the stake and the lawn. The circumferential flange is dimensioned to block the stencil from slipping off of the top of the stake without stretching the stencil. In this regard, the lawn stencil preferably is resilient and recovers, at least to some extent, upon being stretched over the circumferential flange. A stake further may include one or more such circumferential flanges. [0024] In another feature, the method includes: anchoring a first stencil to a lawn; applying a layer of paint of a first color in a first desired pattern on the lawn by spraying paint over a pattern of openings in the first lawn stencil; anchoring a second stencil to the lawn; and applying a layer of paint of a second color in a second desired pattern on the lawn by spraying paint over a pattern of openings in the second lawn stencil. [0025] In this method, the pattern of openings in each lawn stencil corresponds to one or more design elements of the artwork to be applied to the lawn. [0026] Additional lawn stencils and colors of paint also may be used in applying additional layers of paint in additional desired patterns in accordance with this method. [0027] Furthermore, it will be appreciated form above that the alignment and orientation of each lawn stencil is important when applying the respective paint to create the respective design elements of the artwork, as the design elements work together to present the composite image representing the desired artwork. [0028] Accordingly, in a feature of this aspect, the method includes positioning of the first lawn stencil and the later positioning of the second lawn stencil such that the indications of orientation are disposed in similar manner, e.g., each indication of orientation pointing in the same “UP” direction. [0029] In a related feature of this aspect, the method includes positioning of the first and second alignment locations of the first lawn stencil in first and second fixed locations relative to the lawn when the first lawn stencil is sprayed with paint, and positioning of the first and second alignment locations of the second lawn stencil in the same first and second fixed locations relative to the lawn when the second lawn stencil is sprayed with paint. Furthermore, anchor openings serve as the alignment openings in preferred lawn stencils. Method of Manufacturing Lawn Stencils [0030] Yet another aspect of the present invention includes a method of manufacturing lawn stencils, which method accommodates mass production of the lawn stencils in an “assembly line” manner. In this regard, a lawn stencil preferably is manufactured from a planar sheet of film by cutting the desired pattern in the planar sheet of film using a high pressure stream of water, e.g., water jet. [0031] Moreover, preferably a large plurality of the same lawn stencil, e.g., 200, are manufactured from a plurality planar sheets of film that are stacked on top of each other by cutting the desired pattern in all of the planar sheet of film using a high pressure stream of water that is capable of cutting through all of the stacked sheets. The film preferably is low density polypropylene (LEPP) or low density polyethylene (LDPE). It is believed that only water is required for cutting of the lawn stencils and that it would be unnecessary to include an abrasive component in the high pressure water stream for effective cutting of the lawn stencils. [0032] In a feature of this aspect, connecting members or “gates” are formed integrally with each lawn stencil, wherein each gate extends across an opening of the pattern formed in the lawn stencil. [0033] As noted above, proper alignment and orientation of each of the lawn stencils is important when applying the paint to create the respective design elements of the stencils, as the design elements work together to present the composite image representing the desired artwork. [0034] Accordingly, in manufacturing each lawn stencil of a kit, a pattern in each stencil preferably is cut relative to each of the other patterns of the stencils of the kit such that proper alignment and/or overlap of the differing design elements resulting from the stencils results in the intended artwork is created. This correspondence may be achieved by cutting each pattern of each stencil of the kit relative to predetermined anchor openings of the stencil, wherein such a predetermined anchor opening of each stencil of the kit is designed to receive the same stake of the kit there through. [0035] Furthermore, the alignment locations of the lawn stencils preferably comprise anchor openings for receiving the stakes for anchoring of the stencils to the lawn. Because these anchor openings of the first and second lawn stencils are known, a pattern of the first lawn stencil can be manufactured relative to the alignment locations of the first lawn stencil, and a pattern of the second lawn stencil can be manufactured relative to the alignment locations of the second lawn stencil, thereby fixing the alignment of the patterns of the two lawn stencils relative to one another. [0036] In a related feature of this aspect, an indication of orientation preferably is cut in, or otherwise formed in or created on, each of a plurality of lawn stencils of a kit, whereby each lawn stencil of the plurality may be properly oriented with regard to the other lawn stencils of the plurality. [0037] As a result of the ability to mass produce the lawn stencils, the lawn stencils and related kits are relatively inexpensive to produce and can be offered for sale at a price conducive to impulse purchases at or near point-of-sale locations, such as by the counters in hardware stores or other stores where home improvement or do-it-yourself products are sold. [0038] In addition to the aforementioned aspects and features of the present invention, the present invention further includes the various possible combinations of such aspects and features. [0039] One or more preferred embodiments of the present invention now will be described in detail with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS [0040] FIG. 1 is a perspective view of the components of a preferred embodiment of a kit. [0041] FIG. 2 is a top plan view of the lawn stencils of the kit of FIG. 1. [0042] FIG. 3 is a top plan view of lawn stencils for creating the Georgia “G”. [0043] FIG. 4 is a top plan view of lawn stencils for creating the “Earnhardt 8”. [0044] FIG. 5 is side elevational view of a preferred embodiment of a stake. [0045] FIG. 6 illustrates a step in a process of creating an artistic work on a lawn in accordance with an embodiment of the present invention, wherein a first lawn stencil has been anchored to the lawn using a plurality of stakes. [0046] FIG. 7 illustrates a step in a process of creating an artistic work on a lawn in accordance with an embodiment of the present invention, wherein paint of a first color is applied to the lawn using the first lawn stencil. [0047] FIG. 8 illustrates a step in a process of creating an artistic work on a lawn in accordance with an embodiment of the present invention, wherein a circular outline has been created by applying the first color to the lawn using the first lawn stencil as illustrated in FIG. 7. [0048] FIG. 9 illustrates a step in a process of creating an artistic work on a lawn in accordance with an embodiment of the present invention, wherein the circular outline of FIG. 8 is being filled in using paint of a second color. [0049] FIG. 10 illustrates a step in a process of creating an artistic work on a lawn in accordance with an embodiment of the present invention, wherein the circular outline of FIG. 8 has been filled in using the paint of the second color. [0050] FIG. 11 illustrates a step in a process of creating an artistic work on a lawn in accordance with an embodiment of the present invention, wherein a second lawn stencil has been anchored over the area of the lawn and wherein paint of a third color is being applied to the lawn using the second lawn stencil. [0051] FIG. 12 illustrates a step in a process of creating an artistic work on a lawn in accordance with an embodiment of the present invention, wherein the second lawn stencil has been removed and a G-shaped outline, created by applying the third color to the lawn using the second lawn stencil, is being filled-in with the paint of the third color. [0052] FIGS. 13 and 14 illustrates a step in a process of creating an artistic work on a lawn in accordance with an embodiment of the present invention, wherein touch-up work is performed to complete the creation of the artistic work. [0053] FIG. 15 illustrates three artistic works that have been created on a lawn using methods in accordance embodiments of with the present invention. [0054] FIG. 16 illustrates the components of a kit spread out on a floor in accordance with an embodiment of the present invention. [0055] FIG. 17 illustrates the kit of FIG. 16 wherein components of the kit have been placed in the container. [0056] FIG. 18 illustrates the container of FIG. 17 in a closed configuration. DETAILED DESCRIPTION [0057] As a preliminary matter, it will readily be understood by one having ordinary skill in the relevant art (“Ordinary Artisan”) that the present invention has broad utility and application. Furthermore, any embodiment discussed and identified as being “preferred” is considered to be part of a best mode contemplated for carrying out the present invention. Other embodiments also may be discussed for additional illustrative purposes in providing a full and enabling disclosure of the present invention. Moreover, many embodiments, such as adaptations, variations, modifications, and equivalent arrangements, will be implicitly disclosed by the embodiments described herein and fall within the scope of the present invention. [0058] Accordingly, while the present invention is described herein in detail in relation to one or more embodiments, it is to be understood that this disclosure is illustrative and exemplary of the present invention, and is made merely for the purposes of providing a full and enabling disclosure of the present invention. The detailed disclosure herein of one or more embodiments is not intended, nor is to be construed, to limit the scope of patent protection afforded the present invention, which scope is to be defined by the claims and the equivalents thereof. It is not intended that the scope of patent protection afforded the present invention be defined by reading into any claim a limitation found herein that does not explicitly appear in the claim itself. [0059] Thus, for example, any sequence(s) and/or temporal order of steps of various processes or methods that are described herein are illustrative and not restrictive. Accordingly, it should be understood that, although steps of various processes or methods may be shown and described as being in a sequence or temporal order, the steps of any such processes or methods are not limited to being carried out in any particular sequence or order, absent an indication otherwise. Indeed, the steps in such processes or methods generally may be carried out in various different sequences and orders while still falling within the scope of the present invention. Accordingly, it is intended that the scope of patent protection afforded the present invention is to be defined by the appended claims rather than the description set forth herein. [0060] Additionally, it is important to note that each term used herein refers to that which the Ordinary Artisan would understand such term to mean based on the contextual use of such term herein. To the extent that the meaning of a term used herein—as understood by the Ordinary Artisan based on the contextual use of such term—differs in any way from any particular dictionary definition of such term, it is intended that the meaning of the term as understood by the Ordinary Artisan should prevail. [0061] Furthermore, it is important to note that, as used herein, “a” and “an” each generally denotes “at least one,” but does not exclude a plurality unless the contextual use dictates otherwise. Thus, reference to “a picnic basket having an apple” describes “a picnic basket having at least one apple” as well as “a picnic basket having apples.” In contrast, reference to “a picnic basket having a single apple” describes “a picnic basket having only one apple.” [0062] When used herein to join a list of items, “or” denotes “at least one of the items,” but does not exclude a plurality of items of the list. Thus, reference to “a picnic basket having cheese or crackers” describes “a picnic basket having cheese without crackers”, “a picnic basket having crackers without cheese”, and “a picnic basket having both cheese and crackers.” Finally, when used herein to join a list of items, “and” denotes “all of the items of the list.” Thus, reference to “a picnic basket having cheese and crackers” describes “a picnic basket having cheese, wherein the picnic basket further has crackers,” as well as describes “a picnic basket having crackers, wherein the picnic basket further has cheese.” Preferred Kits for Creating Artistic Work on Residential Lawn [0063] Referring now to FIG. 1, the components of a preferred embodiment 10 of a kit in accordance with the present invention are illustrated. The illustrated kit comprises a kit for creating the Clemson tiger paw on a residential lawn. [0064] The kit 10 includes: a container comprising a box 12 ; a first lawn stencil 14 ; a second lawn stencil 16 ; a first container 18 of white paint; a second container 20 of orange paint; and a plurality of stakes 22. While the paint preferably is not permanent, the paint may be permanent, especially for use by fanatical sports fans. [0065] The box 12 preferably constitutes the retail packaging in which the kit is sold and includes a graphical representation thereon of the artwork that can be created using the kit. The graphical representation on the box 12 in FIG. 1 comprises the Clemson tiger paw. Easy-to-follow instructions for using the components of the kit to create the Clemson tiger paw also may be included on the exterior of the retail packaging and/or within the box. [0066] Each container of paint 18, 20 preferably comprises aerosol turf paint, which is made and intended for use on grass and does not chemically harm the grass. Such field paint is commonly available in various different colors and used, for example, in striping a sports field. Each container preferably includes a sufficient supply of paint to cover twenty-five square feet of grass, which is more than sufficient for applying a design element using, e.g., a stencil that is about five feet in length and about five feet in width. [0067] The plurality of stakes 22 are sufficient in number to securely anchor each of the lawn stencils to a lawn so that the lawn stencil does not substantially move while paint is being sprayed over the lawn stencil. An exemplary number of stakes is four, with each stake being used to secure one of four corners of an exemplary rectangular stencil. [0068] Each of the lawn stencils 14, 16 is disposed within the box 12 in a folded configuration as shown in FIG. 1. Alternatively, a lawn stencil may be disposed within the box of the kit in a rolled configuration (not shown). [0069] Each lawn stencil 14, 16 is shown in its unfolded configuration in FIG. 2 and is, for example, rectangular in shape. More particularly, each lawn stencil 14, 16 preferably is about five feet in length and about five feet in width, with each of the two lawn stencils 14, 16 shown in FIG. 2 spanning an area of about twenty-five square feet. [0070] Each lawn stencil 14, 16 further is preferably made of between 2 millimeter and 6 millimeter construction grade plastic, such as low density polypropylene (LDPP) or low density polyethylene (LDPE). Use of LDPP or LDPE makes the lawn stencil easy to fold and unfold while providing a sufficient degree of durability that enables several uses of the lawn stencil over time. [0071] Also as illustrated in FIG. 2, each lawn stencil 14, 16 preferably includes four anchor openings 24 in its four corners. Each anchor opening is dimensioned to receive there through one of the plurality of stakes 22 for fastening of the lawn stencil to the lawn. The stakes 22 are further described below with reference to FIG. 5. [0072] The orientation and alignment of each lawn stencil when fastened to the ground using stakes is important when creating the intended artwork. [0073] Accordingly, each lawn stencil of a kit should include an indication of orientation for properly orienting the lawn stencil relative to each lawn stencil of the kit during creating of the artwork. In the exemplary kit 10, each lawn stencil 14, 16 is provided with an orientation mark “UP” and an arrow that constitute the indication 27 of orientation, which are located in the upper right-hand corner of the lawn stencil for proper positioning on the ground. [0074] Each lawn stencil further includes alignment openings for proper alignment of the lawn stencil relative to other lawn stencils. In the exemplary kit 10, the anchor openings 24 serve as the alignment openings. [0075] Each lawn stencil 14, 16 includes a pattern of openings therein that collectively correspond to one or more design elements of the artwork to be applied to the lawn using the paint. The lawn stencil 14 includes a pattern of a single openings 26 that represents an overall outline of the Clemson tiger paw, and the lawn stencil 16 includes a pattern of five openings 28 that represents individual outlines of the five pads of the Clemson tiger paw. [0076] As will be appreciated from review of FIG. 2, the openings of the pattern in each lawn stencil 14, 16 are particularly large and represent a large portion of the area of the respective lawn stencil. In order to maintain the structural integrity of the stencil, and in order to distribute tension in the lawn stencil so that the lawn stencil lies taut and flat when fastened to the ground using the stakes, each lawn stencil 14, 16 preferably includes connecting members or “gates” 30, each of which extends across an opening of the pattern of the lawn stencil. [0077] As will be appreciated, these gates 30 serve to distribute tension through each lawn stencil 14, 16 so that each lawn stencil lies flat and the design elements created using the lawn stencil are not distorted when paint is sprayed over the lawn stencil. In particular, the gates 30 convey tension through the middle portions of the lawn stencils from one side to the other. Without the gates 30, the tension generally would be conveyed along the outer periphery of the lawn stencil causing the lawn stencil to warp or distort when stretched taut upon the ground. [0078] Moreover, as discussed below with regard to the preferred manufacturing method of lawn stencils, the gates preferably are formed as an integral part of the lawn stencil by cutting a plastic film 31 from which each lawn stencil is formed to include not only the respective pattern of openings therein but also the gates 30 extending there across. The gates thus are constructed from the same plastic film 31 from which the lawn stencil is constructed. Alternatively, the gates are attached to the stencil after cutting of the stencil from the plastic film using, for example, an adhesive, cohesive, or other means of bonding, including welding for fusing. [0079] Additional lawn stencils similar in construction to the lawn stencils 14, 16 of FIG. 2 are illustrated in FIGS. 3 and 4. [0080] In particular, the differences between these lawn stencils 14, 16 of FIG. 2 and those of FIG. 3 are that the lawn stencils 310, 320 of FIG. 3 are utilized to create the Georgia “G”, with the lawn stencil 310 including a pattern of a single opening 312 with four gates, and with the lawn stencil 320 including a pattern of a single opening 322 with four gates. [0081] The differences between the lawn stencils 14, 16 of FIG. 2 and those of FIG. 4 are that the lawn stencils 410, 420 of FIG. 4 are utilized to create the Earnhardt “8”, with the lawn stencil 410 including a pattern of a single opening 412 with no gates, and with the lawn stencil 420 including a pattern of three openings 422 with fifteen gates. [0082] Referring now to FIG. 5, an exemplary stake 500 of the plurality of stakes 22 of the kit 12 of FIG. 1 is illustrated. The stake 500 has an elongated shaft 510 comprising a proximal portion 520 and a distal portion 530. The proximal portion 520 comprises a rounded head 540 contoured to be comfortably received within the palm of a hand when the stake 500 is driven into the ground. The distal portion 530 is pointed and includes a shape for easy insertion of the stake 500 into the ground. [0083] A number of circumferential flanges 550 also are disposed along the shaft 510 in proximity to the proximal portion 520. Each circumferential flange preferably is dimensioned such that, upon extension of the stake through an anchor opening of a lawn stencil, the stencil is retained between the circumferential flange and another circumferential flange or, in the case of the most distal circumferential flange, between such circumferential flange and the lawn. The circumferential flanges serve to keep the lawn stencil from lifting up off of the lawn when, for example, the stencil is blown by the wind. Two or more lawn stencils also may be retained by a single stake, with each lawn stencil retained by a different one of the circumferential flanges. [0084] The stake 500 preferably includes a bright color, such as bright orange, which contrasts well with green grass. The stake 500 also preferably includes an area 575 at the proximal portion 520 whereupon a trademark may be placed for identifying the source of the lawn stencils and kits. Preferred Methods for Creating Artwork on a Lawn [0085] A preferred method of creating an artistic work of art on a lawn includes anchoring a stencil to a lawn and applying a layer of paint in a desired pattern on the lawn by spraying paint over a pattern of one or more openings in the lawn stencil. In this regard, the pattern of one or more openings in the lawn stencil corresponds to one or more design elements of the artwork to be applied to the lawn. [0086] For example, with regard to the exemplary kit 10 of FIG. 1 for creating a Clemson tiger paw in a residential lawn, the lawn stencil 14 is unfolded and positioned over the desired area of the lawn where the artwork is to be created. Four stakes 22 then are driven into the ground, each through a respective anchor opening 24 of the lawn stencil 14. [0087] The stakes preferably are driven into the lawn by hand, and each stake preferably includes a top end thereof that is dimensioned for receipt of the palm of the hand for pushing of the stake into the lawn. In this regard, the top end is rounded and may comprise a semi-spherical or spherical design. [0088] The container 18 of white paint then is utilized to spray white paint over the lawn stencil 14 thereby forming an outline of the overall tiger paw on the lawn via the opening 26. During the paint spraying, the lawn stencil 14 should be adequately stretched or taut so that the lawn stencil 14 lies substantially flat on the lawn. [0089] During this process, the indication 27 of orientation on the first lawn stencil 14 is noted by the person creating the artwork. [0090] The lawn stencil 14 preferably is left on the ground for approximately 5 to 7 minutes following paint spraying in order to allow for the paint to dry, after which the lawn stencil 14 is removed while the stakes are left in ground. In this respect, each of the four corners of the lawn stencil 14 preferably are stretched over the circumferential flanges 550 of the stakes 22. [0091] Additionally, following the removal of the first lawn stencil 14, the container 18 of white paint is utilized to touch-up the outlines of the pattern of the single opening 26 and to complete and fill-in the area of the outline that has been formed in the lawn using the first lawn stencil 14. [0092] Thereafter, the second lawn stencil 16 is placed in overlapping disposition over the area of the lawn that was covered by the first lawn stencil 14 by stretching the corners of the second lawn stencil 16 over the stakes 22. [0093] Specifically, the stakes are extended through the anchor openings 24 of the second lawn stencil 16, which also thereby serve as the alignment openings of the lawn stencil. The stakes 22 are extended through the anchor openings 24 without withdrawing the stakes 22 from the ground, thereby insuring proper alignment and overlap of the second lawn stencil 16 over the design elements that were applied using the first lawn stencil 14. [0094] Further to insure proper orientation of the second lawn stencil 16 on the lawn, the indication 27 of orientation of the second stencil 16 also is disposed in the same manner as the indication 27 of orientation of the first lawn stencil 14 was disposed, e.g., such that both pointed in the same direction “UP”. [0095] Following the proper alignment and orientation of the second lawn stencil 16 on the lawn, the second container 20 of orange paint then is utilized to spray orange paint over the second lawn stencil 16 thereby forming outlines of five individual pads of the tiger paw on the lawn via the openings 28. During the paint spraying, the second lawn stencil 16 should be adequately stretched or taut so that the lawn stencil 16 lies substantially flat on the lawn. [0096] The second lawn stencil 16 preferably is left on the ground for approximately 5 to 7 minutes following paint spraying in order to allow for the paint to dry, after which the second lawn stencil 16 is removed. [0097] Following the removal of the second lawn stencil 16, the container 20 of orange paint is utilized to touch-up the outlines of the pattern of the five openings 28 and to complete and fill-in the area of each such outline that has been formed in the lawn using the second lawn stencil 16. [0098] Additionally, the stakes 22 further are removed, as the second lawn stencil 16 is the last lawn stencil of the kit 10 that is used in creating the artwork. [0099] The lawn stencils 14, 16, the two containers 18, 20 of paint, and the stakes 22 are then placed back into the box 12 for storage of the kit 10 until the next time the Clemson tiger paw is to be created in the lawn. In this regard, the lawn stencils 14, 16 preferably are reusable. [0100] While the aforementioned method has been described with reference to two lawn stencils and two colors of paint, more than two colors and/or two lawn stencils can be used in accordance with the present invention, depending on the complexity of the design of the artwork to be created in the lawn. [0101] Moreover, preferred dimensions have been set forth, but different and various sizes of the lawn stencils may be utilized in accordance with kits of the present invention, so long as the components required to create the artistic works fit within the kits as shown, e.g., in FIG. 1. [0102] A subsequent lawn stencil also may be positioned for application of one or more design elements of the artwork to the lawn without first removing a precedent lawn stencil, in which case the subsequent lawn stencil is positioned over the precedent lawn stencil. Thus, for example, the area of the outline of the pattern of the opening in the lawn stencil 14 may be filled-in with white paint and then the second lawn stencil 16 positioned over the first lawn stencil 14 for applying the outlines of the pads of the tiger paw with orange paint without first removing the first lawn stencil 14. In this regard, the multiple circumferential flanges 550 of the stakes 22 retains the corners of both lawn stencils 14, 16 during the application of the design elements of the artistic work represented by the pattern of openings in the second lawn stencil 16. [0103] The artistic work, while preferably relating to a team logo, alternatively may relate to a season or holiday. For example, in October, the artistic work may comprise a “jack-o-lantern”, and in December, the artistic work may comprise a “Christmas Tree”, “Santa” or “Frosty the Snowman.” Preferred Methods for Manufacturing Lawn Stencil Kits [0104] The lawn stencils of the preferred kits of the present invention preferably are manufactured using water jet cutting, which is preferred over other alternative manufacturing methods, such as laser cutting, which is too hot, or blade cutting, which does not accommodate well the cutting of layered sheets of plastic. [0105] Such a manufacturing method accommodates mass production of the lawn stencils in an “assembly line” manner. In this regard, a lawn stencil preferably is manufactured from a planar sheet of film by cutting the desired pattern in the planar sheet of film using a high pressure stream of water, e.g., water jet. [0106] Water jet cutting machines are well-known, including those that include abrasive and non-abrasive water jet cutting. For example, a water jet cutting machine is disclosed and described in U.S. Pat. No. 4,728,379. As water jet cutting machines are well-known, such machines are not further described herein. Indeed, an aspect of the present invention only relates to use of such machines in manufacturing preferred lawn stencils of the present invention, and not to any particular detail of the water cutting machines themselves. [0107] Accordingly, in the preferred manufacturing process, preferably a large plurality of the same lawn stencil, e.g., 200 stencils, are manufactured from a plurality planar sheets of film that are stacked on top of each other by cutting the desired pattern in all of the planar sheet of film using a high pressure stream of water that is capable of cutting through all of the stacked sheets. During this cutting process, gates also preferably are integrally formed as part of the lawn stencil. [0108] The film preferably is low density polypropylene (LEPP) or low density polyethylene (LDPE). It is believed that only water is required for cutting of the lawn stencils and that it would be unnecessary to include an abrasive component in the high pressure water stream for effective cutting of the lawn stencils. [0109] As noted above, proper alignment and orientation of each of the lawn stencils is important when applying the paint to create the respective design elements of the stencils, as the design elements work together to present the composite image representing the desired artwork. [0110] Accordingly, in manufacturing a lawn stencil for a particular kit, a pattern preferably is cut relative to each of the other patterns of the lawn stencils of that kit such that proper alignment and/or overlap of the differing design elements resulting from the lawn stencils results in the intended artwork. To achieve this correspondence, the method preferably includes the cutting of each pattern in each stencil of the kit relative to predetermined anchor openings of the stencil, wherein a predetermined anchor opening of each stencil of the kit is designed to receive the same stake of the kit there through. [0111] In this regard, these predetermined anchor openings serve as alignment locations of the lawn stencils of the kit. Because these anchor openings of the lawn stencils of the kit are known at the time of manufacture, a pattern of the first lawn stencil can be cut relative to the anchor openings of the first lawn stencil, and a pattern of the second lawn stencil can be cut relative to the anchor openings of the second lawn stencil, thereby fixing the alignment of the patterns of the two lawn stencils relative to one another. [0112] In a related feature of this aspect, an indication of orientation also preferably is cut in each of the lawn stencils of the kit, whereby each lawn stencil of the kit may be properly oriented with regard to the other lawn stencils of the kit by similar disposition of the indications of orientation. Thus, as shown in the drawings, for example, each lawn stencil includes an “UP” arrow cut therein, which comprises the indication of orientation of the lawn stencil. [0113] As a result of the ability to mass produce the lawn stencils, the lawn stencils and related kits are relatively inexpensive to produce and can be offered for sale at a price conducive to impulse purchases at or near point-of-sale locations, such as by the counters in hardware stores or other stores where home improvement or do-it-yourself products are sold. The Illustrations of FIGS. 6 - 18 [0114] FIGS. 6-14 illustrates steps in a process of creating an artistic work on a lawn in accordance with an embodiment of the present invention. In FIG. 6, a first lawn stencil has been anchored to the lawn using a plurality of stakes, and in FIG. 7 red paint is applied to the lawn using the first lawn stencil. A red circular outline is thereby created, as shown in FIG. 8. [0115] In FIG. 9 the red circular outline is shown being filled in using white paint and, in FIG. 10, the circular outline is shown completely filled using the white paint. [0116] A second lawn stencil has been anchored over the area of the lawn in FIG. 11 and black paint is shown being applied to the lawn using the second lawn stencil. A black G-shaped outline is thereby created and, as shown in FIG. 12, the G-shaped outline is filled-in with the black paint. [0117] The artistic work is completed by touching it up as needed using the paint, as shown in FIGS. 13 and 14. [0118] FIG. 15 illustrates three artistic works that have been created on a lawn using methods in accordance embodiments of with the present invention. [0119] FIG. 16 illustrates the components of a kit spread out on a floor in accordance with an embodiment of the present invention. FIG. 17 illustrates the kit of FIG. 16 wherein components of the kit have been placed in the container, and FIG. 18 illustrates the container of FIG. 17 in a closed configuration. [0120] The descriptions set forth above are not intended, nor are to be construed, to limit the general breadth of the present invention or otherwise to exclude any such other embodiments, adaptations, variations, modifications and equivalent arrangements, the present invention being limited only by the claims appended in an issued patent therefor, and the equivalents thereof. [0121] Thus, while the preferred embodiments disclosed herein relate to creating artwork on a residential lawn, the present invention also may be utilized in creating artwork on other surfaces, such as parking lots, playgrounds, vehicles, and sports fields. The artwork also can be created on snow covered lawns and grounds, as well as on cement and other structural surfaces, such as the surface of a wall. [0122] Furthermore, while preferred embodiments of the present invention have been described with reference to containers comprising aerosols for spray-paint, it is contemplated that powders, liquids, and/or adhesive films could be used in creating one or more of the design elements of the artwork.

Summary: Components of a kit for creating an artistic work on a lawn include: first and second containers of paint of first and second colors; a plurality of stakes for anchoring lawn stencils to a lawn; and two single sheets of a flexible plastic film in each of which is defined a pattern of openings used to apply a design element to the lawn. Each sheet is about five feet in height and about five feet in length and has a thickness of between about two millimeters and about six millimeters. The components come in a box having a width, length, and height each of which is no greater than about twelve inches, whereby the container has a relatively small form factor that readily accommodates point-of-sale display and purchase at retail stores by consumers.

big_patent

en

Summarize: A law enforcement official in Washington said the two men arrested in Massachusetts are Pakistani and are believed to have sent money to Shahzad before he allegedly tried to detonate the car bomb on May 1. "One of the things we are going to be trying to determine" is whether the men knew they were supplying funds for an act of terrorism, Holder said. US Attorney General Eric Holder told reporters in Washington yesterday that authorities believe there is evidence that the three men arrested had given money to Shahzad. Bharara is leading the investigation into the alleged attempt on May 1 by Faisal Shahzad, a Pakistan-born former financial analyst from Bridgeport, Conn., to ignite a bomb in New York. The arrests in Massachusetts, and another of an unidentified individual in Maine, were part of a series of raids in half a dozen locations in the Northeast, including on Long Island and in New Jersey, according to authorities. Pir and Aftab Khan are distant relatives, a coworker of one of the men said; both were detained on what authorities said were immigration violations. The two men had been under surveillance for an unspecified period as a result of evidence gathered by the office of Preet Bharara, the United States attorney in Manhattan, according to Massachusetts State Police Colonel Marian McGovern. The men arrested were Pir Khan, 43, a taxi driver, and Aftab Khan, a gas station attendant in his 20s, both of whom live in the Waverley Avenue apartment in Watertown that was raided by the federal agents, according to a law enforcement official and several acquaintances. Two Pakistani men who authorities believe sent money to the suspect in this month's attempted car bombing in Times Square were taken into custody Thursday in Greater Boston after investigators searched a house in Watertown and a gas station in Brookline. Gail Marcinkiewicz, a spokeswoman for the FBI in Boston, said the Massachusetts arrests did not "relate to any known immediate threat to the public or any active plot against the United States." Massachusetts Governor Deval Patrick, who had been briefed on the raids beforehand, sought to reassure residents that there was ``no immediate threat to persons or property in Massachusetts.'' ``I know that people are concerned since the attempted bombing in Times Square and for that reason police have stepped up their surveillance and their vigilance in public facilities and in large crowds,'' Patrick said at a State House news conference. The two Massachusetts men were arrested early Thursday morning. One man, believed to be Aftab Khan, was seen being placed into an unmarked car outside a small white house at 39 Waverley Ave. in Watertown shortly after 20 federal agents with guns drawn raided the home around 6 a.m. The taxi driver, believed to be Pir Khan, was arrested around 7:30 a.m. by federal and state authorities, who pulled over the cab he was driving outside the Doubletree Guest Suites on Soldiers Field Road in Allston. Federal agents searched the Watertown house and a Mobil gas station at 198 Harvard St. in Brookline, and interviewed people who knew the men. The Khans were among several Pakistani men who lived on the first floor of the Watertown house. "He’s a good person," said an acquaintance of Pir Khan, who did not want to be identified. She said Pir Khan is married and has lived in the United States for more than a decade but does not have a green card and is apparently here illegally. Pir Khan listed himself as president of Swabi Cab on documents filed with Secretary of State William F. Galvin's office two years ago, but other documents show a different owner. An employee at the 7-Eleven store on Mt. Auburn Street in Watertown said Pir Khan worked the overnight shift at the store for a few weeks about a month or two ago, filling in for one of Khan's roommates, who was vacationing in Pakistan. Naseer Khan of Cambridge, a friend and former roommate of Pir Khan who is not related, said he was shocked to hear that Pir might have been arrested in connection to the attempted bombing. ``No, he is not this kind of person," he said. Naseer Khan said Pir is a taxi driver and has not returned to Pakistan since coming to the US about 15 years ago. Muhammad Hanif, the imam at the Allston Brighton Islamic Center, said that Pir Khan would come to the center on Fridays for prayer services. "He was a quiet person with a good personality. A calm person," Hanif said. "We are very astonished and surprised to hear such news about him." Fida Muhammad, a clerk and gas attendant at the Mobil station on Cypress Street in Brookline, said Aftab Khan worked at that station and the one on Harvard Street. Muhammad said he’s known Aftab Khan for about five months and that he was surprised to learn of his arrest. "He’s a good person," he said. "He came here on a visa, but the visa expired, and he was trying to apply to stay." In the Watertown arrest, neighbor Vincent Lacerra said he was watching television around 6 a.m. when he heard a commotion outside, and looked to see about 20 FBI agents with guns drawn approaching the white house across the street, yelling, ``FBI, don't move, put your hands up!'' "When I looked out the window, I saw tons of men with rifles or guns pointing to the house,'' said his wife, Barbara. ``They were surrounding it.'' Shortly afterward, an agent from US Immigration and Customs Enforcement walked a man in a gray shirt and handcuffs out of the house, placed him in a black unmarked car, and drove off. For much of the rest of the day, FBI crime scene workers were seen leaving the house with brown bags and boxes of potential evidence that they carried to two large trucks. Baij Joshi, who manages the Watertown property for his father, Shubh, said three Pakistani men lived on the first floor of the house and had been there for ``more than two to three years.'' He said some had spoken recently of taking a trip to Pakistan. Joshi said the men always paid their $1,100 rent by check, except for last month, when one of them, whom he identified as Pir Khan, paid with cash. Joshi said one of the men drove a taxi, another worked at a gas station in Brookline, and a third worked at a convenience store. Several Watertown police officers stood watch outside the Waverley Avenue house Thursday night out of concern for traffic and potential acts of ``retaliation,'' said Watertown Police Chief Edward P. Deveau. Bilal Kaleem, executive director of the Muslim American Society of Boston, said he received a lot of calls and emails from members of the Muslim community who were appalled by the attempted bombing in New York and upset after learning that people in this area may have been connected to it. In Brookline, federal agents descended on a popular Mobil station in Coolidge Corner around 6 a.m. As station owner Elias Audy, a longtime Brookline civic leader who immigrated from Lebanon in the 1960s, looked on, authorities searched the car-repair bays as well as examined cars parked near the gas pumps. Federal agents focused on a silver Honda, looking extensively in its trunk. Around 10:40 a.m., Audy left on foot along Harvard Street, accompanied by a woman, and the pair entered a waiting car a half-dozen blocks away. Audy declined comment. An employee of a second Brookline Mobil station owned by Audy -- located at Route 9 and Cypress Streets -- said federal officials questioned Audy because of a Pakistani worker who had been recently hired. Members of the Massachusetts congressional delegation expressed alarm at the prospect that Shahzad, who is said to be cooperating with investigators, may have had accomplices in the Boston area. "It is sobering to learn that some of those leads appear to have taken investigators into Watertown and Brookline,'' said US Representative Edward J. Markey, a Malden Democrat whose district includes Watertown. Boston Police Commissioner Edward Davis said that as soon as his department learned recently about a ``nexus to Boston" police stepped up security. "We put additional surveillance units on at any public gathering that was substantial,'' he said, including a recent series of events in Boston honoring Marines, and sporting events. Shahzad, 30, was arrested a little more than two days after a crude car bomb was found in a smoking car in Times Square. According to a criminal complaint filed by the FBI in U.S. District Court for the Southern District of New York, the naturalized citizen had returned to the United States on Feb. 3, telling immigration officials he had been visiting his parents for five months in Pakistan. He indicated he intended to stay at a motel in Connecticut while he looked for a place to live and for a job. On April 24, Shahzad allegedly met with the owner of a Nissan Pathfinder in a Bridgeport, Conn., supermarket parking lot, buying it for $1,300, paid in 13 $100 bills. The Pathfinder was found in Times Square a week later, loaded with propane tanks, gasoline canisters, and fertilizer, along with fireworks, clocks, wiring and other items, the FBI said. After being arrested, Shahzad allegedly admitted that he had recently received bomb-making training in Waziristan, Pakistan. The commander of US and allied forces in Afghanistan, General Stanley McChrystal, said Thursday that the widening investigation into the attempted bombing suggests a growing ability of terrorists and other radical groups in Pakistan to orchestrate attacks far from their base of operations. Michael Levenson, David Abel, Martin Finucane, Milton J. Valencia, Bryan Bender, Travis Andersen, Patricia Wen, and Kathy McCabe of the Globe staff, and Globe correspondent Sarah Thomas, contributed to this report. Pakistan has arrested a suspect linked to the Pakistani Taliban who said he helped the accused Times Square bomb plotter, The Washington Post reported on Thursday, citing U.S. officials. The suspect provided an "independent stream" of evidence that the Pakistani Taliban was behind the attack, the newspaper reported. The suspect also admitted helping Faisal Shahzad, the suspect in the attempted Times Square bombing, travel into Pakistan's tribal areas for bomb training, according to the report. Officials familiar with the probe cautioned that there have been inconsistencies in the two suspects' accounts, the Post said. The suspect in Pakistani custody "is believed to have a connection to the TTP (Tehrik-e-Taliban Pakistan)," a U.S. intelligence official was quoted as saying. The official was cited as saying that certain clues have added to authorities' understanding of the Times Square plot, but "what is definitely true is that a lot of this comes from the statements of people directly involved." Three held after U.S. raids Earlier Thursday, three Pakistani men suspected of providing money to Shahzad were arrested in raids across the Northeast, law enforcement officials said. Investigators said it was not yet clear whether the three men knew how the money was going to be used. The men — two seized in the Boston area, one in Maine — were arrested as federal authorities searched homes and businesses in a coordinated series of raids centered in the Boston suburbs, on New York's Long Island, and in New Jersey. They were arrested on immigration violations — administrative, not criminal, charges. They were not charged with any terrorism-related crimes. Their names were not released. The raids resulted from evidence gathered in the investigation into the Times Square bomb attempt two weeks ago. FBI spokeswoman Gail Marcinkiewicz gave assurances Thursday that there was "no known immediate threat to the public or any active plot against the United States." Holder: Uncertain of intent In Washington, Attorney General Eric Holder said investigators believe there is evidence that the men were providing Shahzad, a Pakistan-born U.S. citizen, with money, but they have yet to determine whether the men knew the funds might have been intended for a terrorist act. FBI investigators move between a van and a home at 39 Waverley Ave., in Watertown, Mass., on Thursday. A top Massachusetts law enforcement official, who spoke on condition of anonymity because the investigation is still going on, said investigators are not sure whether the two Boston-area men were witting accomplices or simply moving funds, as is common among people from the Middle East and Central Asia who live in the U.S. "These people might be completely innocent and not know what they were providing money for," the official cautioned, "but it's clear there's a connection." Authorities have been investigating whether Shahzad — who authorities say needed only a few thousand dollars to buy the used SUV and the bomb components used in the attempted May 1 attack — was financed from overseas. Muslim immigrants for years have used informal money transfer networks known as "hawalas" — which rely on wire transfers, couriers and overnight mail and are cheaper and quicker than banks — to send cash to their families overseas. But since the Sept. 11, 2001, attacks, authorities have worked to dismantle the system, fearing it allows terrorists to raise and launder money. Overstayed visas Two of the men under arrest overstayed their visas and the third is already in removal proceedings, said another law enforcement official, who was not authorized to discuss the ongoing investigation and spoke on condition of anonymity. Shahzad, 30, has waived his right daily to appear in court since his May 1 arrest on charges he tried to blow up a van packed with a gasoline and propane outside Times Square's busy restaurants and Broadway theaters, U.S. Attorney Preet Bharara said Thursday. He is continuing to provide investigators with information, Bharara said. Video: Three Pakistani men held "We are doing exactly what, I think, people want us to do, and that is to make sure we get all the information we can with respect to any associates he may have, and other information that would help us to prevent anything further from happening in the United States," the prosecutor said. Shahzad, a budget analyst who lives in Bridgeport, Conn., returned to the U.S. in February from five months in Pakistan, where authorities say he claims to have received training in making bombs. A law enforcement official called Thursday's raids "an evidence-gathering operation" and not a search for suspects. The official, speaking on condition of anonymity, said officials are investigating whether Shahzad got his cash through illegal money transfers. ‘FBI! Put your hands up!’ Authorities raided a home in Watertown and a Mobil gas station and a vehicle in Brookline, another Boston suburb; a condominium in Cherry Hill, N.J.; a print shop in Camden, N.J., and two Long Island homes, law enforcement officials said. Vinny Lacerra, 50, who lives across the street from the Watertown house, said he was in his living room about 6 a.m. when he heard somebody shout, "FBI! Put your hands up!" and saw 15 to 20 agents with guns drawn surrounding the house. Ashim Chakraborty, who owns a home raided in Centereach, N.Y., said FBI and police wanted to interview a Pakistani man and an American woman who live in the basement. The woman, who did not identify herself, was still in the basement Thursday afternoon, telling reporters only, "Drop dead. I'm an American." There was no immediate comment from Pakistan on the raids. Islamabad has said it was too early to say whether the Pakistani Taliban, which operates from the country's lawless northwest tribal region, was behind the Times Square plot, although the U.S. has said it found a definite link. Pakistan has detained at least four people with alleged connections to Shahzad. Information from the Washington Post, Reuters and The Associated Press is included in this report.

Summary: The FBI has raided a home in Watertown and a gas station in Brookline in connection with the attempted bombing in Times Square. Two people were taken into custody on immigration violations, the Boston Globe reports. An FBI spokeswoman says search warrants have been conducted at "several locations in the Northeast," but emphasized that "there's no immediate threat to the public or active plot against the United States." The searches came about because of evidence uncovered in the Times Square investigation; MSNBC reports that authorities are tracking down cash connections to the plot. A witness who lives across the street from the Watertown home says she saw 20 agents burst into the place at 6am. "They all had their guns drawn, pointed at the house." FBI agents were also spotted at a gas station in Brookline, but it's unclear if that raid was related.

multi_news

en

Write a title and summarize: Rhythmic activity in the theta range is thought to promote neuronal communication between brain regions. In this study, we performed chronic telemetric recordings in socially behaving rats to monitor electrophysiological activity in limbic brain regions linked to social behavior. Social encounters were associated with increased rhythmicity in the high theta range (7–10 Hz) that was proportional to the stimulus degree of novelty. This modulation of theta rhythmicity, which was specific for social stimuli, appeared to reflect a brain-state of social arousal. In contrast, the same network responded to a fearful stimulus by enhancement of rhythmicity in the low theta range (3–7 Hz). Moreover, theta rhythmicity showed different pattern of coherence between the distinct brain regions in response to social and fearful stimuli. We suggest that the two types of stimuli induce distinct arousal states that elicit different patterns of theta rhythmicity, which cause the same brain areas to communicate in different modes. Oscillatory brain activity, mostly categorized to the theta (3–12 Hz), beta (12–30 Hz), and gamma (30–80 Hz) bands, is thought to coordinate neural activity in vast neuronal assemblies dispersed over different brain regions (Buzsáki and Draguhn, 2004). This type of coordination may underlie high level cognitive functions, such as speech and social communication (Uhlhaas and Singer, 2006; Uhlhaas et al., 2009) that are impaired in autism spectrum disorders (ASD) (Geschwind, 2009). Increasing evidence suggest that individuals with ASD show deficits in long-range neuronal communication associated with low-frequency rhythms, such as the theta rhythm (Geschwind and Levitt, 2007; Rippon et al., 2007; Wass, 2011). Nonetheless, a clear connection between rhythmic brain activity and social behavior has not yet been established. Mammalian social organization depends on the ability to recognize and remember individual conspecifics (Wiley, 2013). This social recognition memory (SRM) can be assessed in rodents using their innate tendency to investigate novel conspecifics more persistently than familiar ones (Gheusi et al., 1994). In the SRM habituation–dishabituation test, social memory is assessed by the gradual reduction in the amount of time the animal spends investigating a particular social stimulus during consecutive encounters (Ferguson et al., 2002). This short-term memory was shown to be mediated mainly by chemical cues (semiochemicals) perceived via the main and accessory olfactory systems (Dulac and Torello, 2003). Upon binding of semiochemicals to the receptors expressed by the sensory neurons of the main olfactory epithelium and the vomeronasal organ, sensory information is conveyed to the main (MOB) and accessory (AOB) olfactory bulbs, respectively (Dulac and Wagner, 2006). Both bulbs then project, directly and indirectly, to the medial amygdala (MeA) (Pro-Sistiaga et al., 2007; Kang et al., 2011) that is thought to transfer the information to the hippocampus through the lateral septum (LS) (Bielsky and Young, 2004). The MOB projects also to several cortical areas comprising the primary olfactory cortex, of which the piriform cortex (Pir) is best characterized (Wilson and Sullivan, 2011) (Figure 1). 10. 7554/eLife. 03614. 003Figure 1. A simplistic scheme of sensory information flow in the network of brain regions thought to underlie social recognition memory. Social olfactory cues are detected by sensory neurons in the main olfactory epithelium (MOE) and vomeronasal organ (VNO). These neurons project to the main (MOB) and accessory (AOB) olfactory bulbs, which transmit information, either directly or indirectly (via the cortical nucleus of the amygdala—CoA) to the medial amygdala (MeA). The MOB also innervates the piriform cortex (Pir). The MeA projects to the lateral septum (LS), which innervates the hippocampus (Hip). DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 003 Here we hypothesized that social behavior is associated with an elevation of rhythmic activity in the network of brain areas that process social stimuli. To examine this hypothesis, we recorded electrophysiological activity from the brains of freely behaving adult male rats performing the SRM paradigm (Video 1). A telemetric system was used to record from wire electrodes chronically implanted in the five aforementioned brain regions: MOB, AOB, MeA, LS, and Pir (Dulac and Wagner, 2006). We found that social encounters were associated with enhancement of brain rhythmic activity, specifically at 7–10 Hz range, in all brain regions. This enhancement that was proportional to the degree of novelty of the social stimulus appeared to reflect an internal brain-state associated with social arousal. In contrast, a fear-conditioned tone, which is associated with fear arousal, induced rhythmicity in the low theta range (3–7 Hz) in the same network of brain regions. Moreover, social and fearful stimuli elicited different patterns of change in coherence between the distinct brain regions. We hypothesize that these two types of stimuli induce distinct arousal states in the animal, which are reflected by the different kinds of theta rhythmicity. We further suggest that the distinct types of theta rhythmicity support different modes of communication between the various brain areas. These in turn may modify cognitive processes such as memory acquisition and recall depending on the value and saliency of the stimulus by enhancing synchronous neuronal activity between remote neuronal assemblies. 10. 7554/eLife. 03614. 004Video 1. Social encounter between two adult male rats in the experimental arena. The recorded subject carries a black transmitter equipped with a flashing led light on its head. Frame number is shown in the right low corner. The graph below the video shows the LFP recorded in the AOB (blue), MOB (red), and MeA (green). The bottom graph shows raster plots of spikes detected from the recorded multi-unit activity signal. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 004 Electrophysiological recordings were carried out in the brains of freely behaving adult male rats performing the SRM habituation–dishabituation paradigm (Figure 2A). We first analyzed the dynamics of the local field potential (LFP) in the course of the behavioral paradigm. A highly rhythmic LFP was recorded in all brain areas during social encounters (Figure 2B). Power spectral density (PSD) analysis of the LFP showed a prominent peak at ∼8 Hz, typical for the high theta band (Buzsáki and Draguhn, 2004), in all areas (Figure 2C). The value of this peak, termed theta power (TP), was very low in the absence of a social stimulus (Base, Figure 2D–E) but increased profoundly during the first encounter (Enc. 1). It then gradually decreased during further encounters with the same stimulus (Enc. 2–4), but increased again when another novel stimulus was introduced (Enc. 5). These changes in theta power during SRM testing closely followed the changes in investigation time (IT) (Figure 2F), with both parameters appearing to correlate with the degree of stimulus novelty. 10. 7554/eLife. 03614. 005Figure 2. Theta rhythmicity in the rat brain is enhanced during social encounters, in correlation with the novelty of the social stimulus. (A) A scheme of the habituation–dishabituation SRM paradigm. (B) Examples of LFP traces recorded in the MOB, LS, and MeA during a social encounter. (C) Power spectral density (PSD) analyses of a 5-min LFP recording from all five brain areas during a social encounter. Gray bar represents the 7–9 Hz band. (D) Superimposed PSD analyses of LFP recordings from the MeA of one animal during the various stages of the SRM test. (E) As in D, zooming on the 4–10 Hz range. (F) The ∼8 Hz PSD peak (TP) and social investigation time (IT) for the same experiment as in D, plotted as a function of the encounter number. Encounter 0 represents no stimulus (Base). DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 005 We next analyzed the effect of social and non-social stimuli on the dynamics of investigation time and theta power in all recorded brain areas. As exemplified in Figure 3A (lower panel), exposure of an animal to either type of stimulus caused similar dynamics of the investigation time. However, there was a vast difference with regards to the theta power response to the social and non-social stimuli: whereas significant theta power modulation that was similar across all brain regions was observed with social stimuli, whether awake or anesthetized, object and odor stimuli did not cause such an effect (Figure 3A, upper panels). 10. 7554/eLife. 03614. 006Figure 3. Theta rhythmicity is modulated by the novelty of social, but not other tested stimuli. (A) TP for all brain areas (upper) as well as IT (lower) during the SRM test of one animal, using awake and anesthetized social stimuli as well as object and smell stimuli, all except smell tested with the same animal. (B) Mean TP for the various brain regions averaged (±SEM) and plotted as a function of the test stage, for social (blue, n = 8) and object (red, n = 6) stimuli. A significant difference was found between the various encounters in all brain regions for social stimuli (p < 0. 005, one-way repeated measures ANOVA, Figure 3—source data 1A), while no difference was found for object recognition (p > 0. 05, Figure 3—source data 1B). Post hoc paired t-test showed significant differences between Enc. 1 and Enc. 4 as well as between Enc. 4 and Enc. 5 (dashed lines) in all brain regions for social stimuli (*pcorr < 0. 05, Figure 3—source data 2). (C) As in B, for the IT of the social and object paradigms. Unlike the TP, both paradigms showed similarly significant modulation of the IT (Figure 3—source data 1–2). DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 00610. 7554/eLife. 03614. 007Figure 3—source data 1. Theta power (TP) modulation between encounters. One-way ANOVA (repeated measures) test was used to determine whether there is a significant difference between the mean ΔTP of all five encounters during either social (1a) or object (1b) recognition. The assumption of normality was assessed by Lilliefors and Shapiro–Wilk tests. Sphericity was assessed by Mauchly' s test. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 00710. 7554/eLife. 03614. 008Figure 3—source data 2. Statistical assessment of habituation and dishabituation. Paired t-tests were used for the social (2a) and object (2b) recognition paradigms, to examine if the differences between Enc. 1 and Enc. 4 (habituation), as well as between Enc. 4 and Enc. 5 (dishabituation) are statistically significant. Tests were one-sided and corrected for multiple comparisons using Bonferroni' s correction. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 008 Combined analyses of the modulation of both theta power and investigation time in animals exposed to social and object stimuli are presented in Figure 3B. Social stimuli caused a marked increase of mean theta power during Enc. 1 compared to Base, with the MOB and AOB showing the largest changes (6. 2 dB/Hz) and other areas showing more moderate ones (4. 0–5. 1 dB/Hz). In all regions tested, the theta power decreased gradually during the habituation phase (Enc. 1–4) but returned the values obtained in Enc. 1 after dishabituation (Enc. 5) (p < 0. 005 one-way repeated measures ANOVA, *pcorr < 0. 05 post-hoc paired t-test, Figure 3—source data 1–2). In contrast, object stimuli elicited a much weaker initial change from Base to Enc. 1 (1. 1–2. 7 dB/Hz) in all brain regions. Furthermore, the theta power showed modulation during the object paradigm similarly to the social paradigm only in the MOB, and even this change was not statistically significant (p > 0. 05, Figure 3—source data 1). In a sharp contrast to the theta power, comparison of the investigation time of the social and object paradigms showed a highly similar course and magnitude of habituation and dishabituation that were statistically significant in both cases (Figure 3C, Figure 3—source data 1–2). Taken together, these results show that in almost all recorded brain areas, theta power is modulated by the degree of novelty of social but not object stimuli. The lack of theta power modulation despite the clear investigation time modulation induced by object stimuli rejects the possibility that the theta rhythmicity is caused by the investigative behavior. We therefore reasoned that rather, theta power modulation may reflect processes that are either directly driven by the sensory input (Bottom-Up processes) or induced by an internal state of the brain that is modulated by the saliency of the social stimulus (Top-Down processes). In order to distinguish between these two possibilities, we continued our recordings for 5 min after the stimulus was removed from the arena (Post 1–5). As depicted in Figure 4A, the theta rhythmicity did not cease with the removal of the social stimulus following Enc. 1, but remained at a high level during most of the Post 1 period (for spectrograms of the full experiment, see Figure 4—figure supplements 1–5). Plotting the mean instantaneous theta power as a function of time, revealed that this was true for all encounters with a social stimulus. In contrast, encounters with object stimuli were followed by a sharp drop in the theta power to a low level almost immediately following stimulus removal (Figure 4B, for all other brain areas see Figure 4—figure supplements 6–7). This significant reduction in mean theta power between the Enc. and Post periods of the object paradigm was characteristic of all brain areas (Figure 4C, *p < 0. 05 paired t-test, Figure 4—source data 1). In contrast, high theta power levels were found in both these periods in the social paradigm (p > 0. 05). Moreover, all encounters with social stimuli showed a steep but gradual increase in theta power during the first 15 s in which the stimulus was being transferred into the arena (Figure 4A, D, gray bars). This rise in theta power probably reflects the subject' s anticipation for a social meeting, as there was no similar increase with object stimuli (Figure 4D). Altogether, these data suggest that the changes in theta power during the SRM test reflect a graded internal brain state of arousal that is proportional to the novelty of the social stimulus and slowly fades away after its removal. 10. 7554/eLife. 03614. 009Figure 4. Modulation of the theta rhythmicity by social stimulus novelty reflects an internal state in the brain. (A) Color-coded spectrograms of the LFP recorded in the MOB (upper), LS (middle), and MeA (lower) for 5 min before (Base), during (Enc. 1), and after (Post 1) the first encounter of the SRM test. All spectrograms are averages of five animals (4 animals for LS). Gray bar marks the 15 s needed for stimulus transfer to the arena. (B) Upper—instantaneous ΔTP (change from mean Base) in the LS averaged over four rats (±SEM) during the Enc. and Post periods of all trials (1-5), for social (left, n = 5) and object (right, n = 4) paradigms. The 15-min breaks between last Post and next Enc. periods are labeled with gray bars. Lower—mean (±SEM) values for the corresponding periods shown above. (C) Comparison of mean ΔTP averaged over all trials (1-5) for each brain area, between the Enc. and Post periods of the social and object paradigms (*p < 0. 05, paired t-test, Figure 4—source data 1). (D) Left—the instantaneous ΔTP shown in B, expanded to show the initial 50 s of all encounters. Gray area represents the 15 s needed for stimulus transfer to the experimental arena. Right—The same for object stimuli. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 00910. 7554/eLife. 03614. 010Figure 4—source data 1. Comparison of ΔTP between Enc. and Post periods. Paired t-tests were used to compare between the mean ΔTP across Enc. vs the mean ΔTP across Post periods. The assumption of normality was assessed by Lilliefors and Shapiro–Wilk tests. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 01010. 7554/eLife. 03614. 011Figure 4—figure supplement 1. Mean LFP spectrograms across the SRM paradigm for the AOB. Color-coded spectrograms (0–20 Hz) of the LFP recorded in the AOB during the SRM test. Gray bar marks the 15 s needed for stimulus delivery to the arena. Mean of five animals. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 01110. 7554/eLife. 03614. 012Figure 4—figure supplement 2. Mean LFP spectrograms across the SRM paradigm for the MOB. Color-coded spectrograms (0–20 Hz) of the LFP recorded in the MOB during the SRM test. Gray bar marks the 15 s needed for stimulus delivery to the arena. Mean of five animals. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 01210. 7554/eLife. 03614. 013Figure 4—figure supplement 3. Mean LFP spectrograms across the SRM paradigm for the MEA. Color-coded spectrograms (0–20 Hz) of the LFP recorded in the MEA during the SRM test. Gray bar marks the 15 s needed for stimulus delivery to the arena. Mean of five animals. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 01310. 7554/eLife. 03614. 014Figure 4—figure supplement 4. Mean LFP spectrograms across the SRM paradigm for the LS. Color-coded spectrograms (0–20 Hz) of the LFP recorded in the LS during the SRM test. Gray bar marks the 15 s needed for stimulus delivery to the arena. Mean of four animals. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 01410. 7554/eLife. 03614. 015Figure 4—figure supplement 5. Mean LFP spectrograms across the SRM paradigm for the Pir. Color-coded spectrograms (0–20 Hz) of the LFP recorded in the Pir during the SRM test. Gray bar marks the 15 s needed for stimulus delivery to the arena. Mean of five animals. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 01510. 7554/eLife. 03614. 016Figure 4—figure supplement 6. Comparison of mean instantaneous TP between social and object stimuli, for the AOB and MOB. Upper panels—instantaneous ΔTP (change from mean Base) in each brain area averaged over all animals (mean ± SEM) during the Enc. and Post periods of all trials (1–5), for social (left, n = 5 rats) and object (right, n = 4 rats) paradigms. The 15-min breaks between last Post and next Enc. periods are labeled with gray bars. Lower panels—mean (±SEM) values for the corresponding periods shown above. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 01610. 7554/eLife. 03614. 017Figure 4—figure supplement 7. Comparison of mean instantaneous TP between social and object stimuli, for the MeA and Pir. Upper panels—instantaneous ΔTP (change from mean Base) in each brain area averaged over all animals (mean±SEM) during the Enc. and Post periods of all trials (1–5), for social (left, n = 5 rats) and object (right, n = 4 rats) paradigms. The 15 min breaks between last Post and next Enc. periods are labeled with gray bars. Lower panels—mean (±SEM) values for the corresponding periods shown above. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 017 The theta rhythmicity recorded in the network may reflect a single rhythm originating from one source. In that case, the various brain regions are expected to display high correlation and similar dynamics of coherence in their rhythmicity. Alternatively, if it represents a combination of multiple independent rhythms arising from several sources, we expect low correlation and differential dynamics of coherence between various brain regions. To discriminate between these possibilities, we first examined the cross-correlation of the LFP, filtered in the theta range, between the MeA and the other brain areas. Despite the fact that both areas are directly connected to the MeA, the strongest correlation appeared with the LS and the weakest with the MOB (Figure 5A–D). Moreover, whereas the correlation between the MeA and LS was significantly higher during Enc. 1 (blue) compared to Base (red), the MOB showed consistently low correlation with the MeA during both periods. The presence of a social stimulus thus appears to differentially affect the correlation of theta rhythmicity between distinct brain areas. 10. 7554/eLife. 03614. 018Figure 5. Differential and dynamic correlation of theta rhythmicity between specific brain regions. (A) Upper—superimposed LFP traces (filtered 5–11 Hz) from the MeA (black) and LS (colored) of one animal during Base (left, red) and Enc. 1 (right, blue). Lower—cross-correlations between both regions for each of the 300 s recorded during the same periods, with peaks labeled by colored dots. (B) Same as A for the MeA and MOB. (C) Middle—distribution of the cross-correlation peaks for the data in A. Borders—histograms of the cross-correlation peaks in the correlation (right) and lag (bottom) axes. Mean ± SD are marked to the left (correlation) or above (lag) the histograms. (D) Same as C for the data in B. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 018 We next analyzed the coherence of the LFP signal among all brain areas during the Base, Enc. 1, and Post 1 periods of the SRM paradigm. As depicted in Figure 6A, the coherence between the MeA and the LS showed several prominent peaks, especially in the theta and gamma bands. Yet, while no change was recorded in the gamma band, the theta coherence showed a significant increase between the Base and Enc. 1. Furthermore, similarly to theta rhythmicity itself (Figure 4), the high coherence at theta range persisted during the Post 1 period despite the lack of a social stimulus (Figure 6A, C). In contrast, the coherence in theta band between the MeA and MOB remained low throughout all periods (Figure 6B, C). Analyses across all regions revealed a hierarchy in the theta coherence between the MeA and all other areas, ranging from a low level with the MOB and AOB, medium coherence with the Pir and high coherence with the LS (Figure 6D). This notion of functional hierarchy between brain regions is strengthened by the fact that despite their largest physical distance, the highest level of theta coherence was found between the MeAs in the two hemispheres (Figure 6—figure supplements 1,3). Furthermore, the theta coherence between the MeA and the higher brain centers (Pir, LS) significantly increased during Enc. 1 and Post 1 (*pcorr < 0. 05, paired t-test, Figure 6—source data 1), while no change was recorded between the MeA and both areas of the olfactory bulb (MOB, AOB, pcorr > 0. 05). This suggests the existence of at least two independent theta rhythms, one that governs the olfactory bulb and another that dominates higher brain structures. This conclusion is further supported by the findings that the MOB shows opposite relationships with all other brain areas; high coherence with the AOB and low coherence with the higher areas (Figure 6E, Figure 6—figure supplements 2,3). Moreover, a significant enhancement in theta coherence with the AOB was observed during Enc. 1 and Post1 (*pcorr < 0. 05, paired t-test, Figure 6—source data 1), while all other regions showed no change (pcorr > 0. 05, paired t-test). Interestingly, similar enhancement of theta coherence between the AOB and MOB was recorded with object stimuli, while these stimuli did not cause any enhancement of the coherence between the MeA and LS or Pir (Figure 6F, G, Figure 6—source data 1). Together, these data support multiple sources of theta rhythmicity in the network. 10. 7554/eLife. 03614. 019Figure 6. Theta coherence between specific brain regions increases during social encounter. (A) Mean (n = 10 animals) coherence (0–100 Hz) of the LFP signals recorded in the MeA and LS during Base, Enc. 1, and Post 1 periods. (B) Same animals, coherence analysis between the MeA and MOB. (C) Spectrograms (0–20 Hz) of the coherence analyses shown in A (between MeA and LS, upper panel) and B (between MeA and MOB, lower panel). (D) Mean coherence at 8 Hz between the MeA and all other areas (MOB, AOB n = 11; LS, Pir n = 10) during the Base, Enc. 1, and Post 1 periods of social encounter (*pcorr < 0. 05, paired t-test, Figure 6—source data 1A). (E) Same as D, for coherence of the MOB with all other areas (*pcorr < 0. 05, paired t-test, Figure 6—source data 1B). (F) Same as D, for object stimuli (Figure 6—source data 1C). (G) Same as E, for object stimuli (*pcorr < 0. 05, paired t-test, Figure 6—source data 1D). DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 01910. 7554/eLife. 03614. 020Figure 6—source data 1. Assessment of change in theta Coherence from Base to either Enc. 1 or Post 1. The change from Base to Enc. 1 (upper) and from Base to Post 1 (lower), in theta coherence during social recognition between the MeA and all other areas (1a) and between the MOB and all areas (1b), as well as during object recognition between the MeA and all other areas (1c), and between the MOB and all areas (1d), was statistically validated using paired t-tests, corrected for multiple comparisons (Bonferroni correction). The assumption of normality was assessed by Lilliefors and Shapiro–Wilk tests. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 02010. 7554/eLife. 03614. 021Figure 6—figure supplement 1. Mean spectrograms of coherence between the MeA and all other areas during trial 1 of the SRM paradigm. Color-coded spectrograms (0–20 Hz) of the mean LFP coherence (MOB, AOB—n = 11; LS, Pir—n = 10, cMeA—contralateral MeA—n = 3) between the MOB and all other brain areas, during the first trial of SRM test, each depicting continuous 15 min divided to the Base, Enc. 1, and Post 1 periods. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 02110. 7554/eLife. 03614. 022Figure 6—figure supplement 2. Mean spectrograms of coherence between the MOB and all other areas during trial 1 of the SRM paradigm. Color-coded spectrograms (0–20 Hz) of the mean LFP coherence (MeA, AOB—n = 11; LS, Pir—n = 10, cMeA—contralateral MeA—n = 3) between the MOB and all other brain areas, during the first trial of SRM test, each depicting continuous 15 min divided to the Base, Enc. 1, and Post 1 periods. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 02210. 7554/eLife. 03614. 023Figure 6—figure supplement 3. Mean theta coherence during trial 1 of the SRM paradigm. (A) Mean coherence at 8 Hz between the MeA and all other areas (MOB, AOB n = 11; LS, Pir n = 10, cMeA—contralateral MeA—n = 3) during the Base, Enc. 1, and Post 1 periods of the SRM paradigm. (B) Same as A, for coherence of the MOB with all other areas. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 023 Theta rhythmicity was previously found to be elicited in several brain regions during states of arousal, mainly in response to fearful stimuli (Knyazev, 2007). This phenomenon was best studied in the context of fear learning in a network of brain regions comprising the basolateral complex of the amygdala (lateral and basolateral amygdala), hippocampus, and medial prefrontal cortex (Pape and Pare, 2010). In this network, a recall of a fearful memory, induced by a fear-conditioned stimulus, elicits robust theta rhythmicity that shows high coherence between these brain regions (Paré and Collins, 2000; Pare et al., 2002; Seidenbecher et al., 2003; Pape et al., 2005; Popa et al., 2010). Here, we examined whether the brain state-induced theta rhythmicity during the SRM paradigm is similar to the fear-induced rhythmicity. To address this question, we compared the theta rhythmicity induced by a social encounter to that of a fear stimulus within the social network that we investigated. To that end, a new cohort of six animals was implanted with wire electrodes as before, with an additional electrode in the nucleus accumbens (NAcc), which was recently shown to be involved in social motivation (Dölen et al., 2013; Gunaydin et al., 2014). These animals were fear-conditioned by coupling a 40-s long tone to an electrical foot shock for five consecutive times separated by 180-s intervals (Figure 7—figure supplement 1A). A day later the electrical activity was recorded in two consecutive sessions, each following a 30 min of habituation to the arena. The first session was recorded during a recall of fear memory (FC experiment), and the second during a 5-min long encounter with a novel social stimulus (SR experiment). During the FC experiments (Figure 7—figure supplement 1B), introduction of the fear-conditioned tone caused animals to begin moving intensively, followed by immobility (freezing) towards the end of the tone, in anticipation of the foot shock. The freezing response was especially significant at the end of the first tone (Figure 7—figure supplement 1C). Thus, the fear-conditioned tone caused a robust arousal state that was associated with intense movement of the conditioned animals. We then compared the theta rhythmicity between the FC and SR experiments. A PSD analysis of the LFP signals recorded in the LS during 5 min prior to stimulus introduction (Base) yielded a similar profile in both cases (Figure 7A, red). However, the PSD was very different between the two types of stimuli during the first 15 s following stimulus introduction (Stimulus) (Figure 7A, blue). Whereas the fear stimulus caused a marked peak at the low theta range (3–7 Hz), the social stimulus resulted in a peak at the high theta range (7–10 Hz). This change is clearly observed when subtracting the Base PSD from the Stimulus profile (Figure 7B). These differences appeared in all recorded brain regions (Figure 7C) and Statistical analysis showed a highly significant interaction between the type of experiment (FC or SR) and theta band (Figure 7D) (**p < 0. 01, two-way repeated measures ANOVA, Figure 7—source data 1). Thus, we conclude that fearful and social stimuli cause changes in very different ranges of theta rhythmicity in the same limbic network of brain regions. We suggest that these different types of theta rhythmicity reflect distinct arousal states; the low theta reflects aversive arousal that is associated with fear while the high theta reflects appetitive arousal associated with a social encounter. 10. 7554/eLife. 03614. 024Figure 7. Distinct types of theta rhythmicity are induced by social and fearful stimuli. (A) PSD analyses (0–20 Hz) of LFP signal recorded in the LS of one animal, 5 min prior to stimulus introduction (Base, red) and 15 s following it (Stimulus, blue) during fear memory recall (left, FC) and social encounter (right, SR). (B) The change between Stimulus and Base PSD analyses (Stimulus minus Base) shown in A, for FC and SR, superimposed. (C) Mean change in PSD profile for all brain areas of the same six animals during the FC (continuous lines) and SR (dashed lines) experiments. (D) Mean (±SEM) values of the peak change in PSD in the low (4–8 Hz, red and blue) and high (8–12 Hz, pink and light blue) theta ranges for the FC (red and pink) and SR (blue and light blue) experiments (**p < 0. 01, experiment X theta range interaction, two-way repeated measures ANOVA, Figure 7—source data 1). DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 02410. 7554/eLife. 03614. 025Figure 7—source data 1. Comparison of change in theta power in low and high theta bands between social and fearful stimuli. Comparison of the change in theta power between social recognition (SR) and fear conditioning (FC) at high and low theta ranges, statistically validated using two-way repeated measures ANOVA (p—experiment X theta range interaction). The assumption of normality was assessed by Lilliefors and Shapiro–Wilk tests. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 02510. 7554/eLife. 03614. 026Figure 7—figure supplement 1. Arousal-driven locomotion during recall of fear memory. (A) A schematic drawing of the fear conditioning session, comprising five events of 40-sec tone (gray bar) followed by brief electrical foot shock (red bar). (B) Locomotion activity of one animal during the recall of fear memory, 1 day after fear conditioning, plotted as a function of the experimental stage. Gray bars represent the 40-sec long tone. Tone start is marked on the X-axis by T1…5 and tone end by S1…5. (C) Mean locomotion (n = 6 animals) during fear recall around the first tone, as a function of time. Tone started 15 sec from the beginning of the experiment and is marked by a gray bar. Note the intense locomotion of the animals during most of the tone, as opposed to their freezing at the end of it, when expecting the electrical foot shock. Black dashed line represents the 15-sec period during which theta activity was calculated. Error bars represent SEM. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 026 We next examined how the coherence between the various brain regions changes in response to the two types of arousing stimuli. Figure 8A depicts the coherence between the MeA and LS during Base and Stimulus periods of FC and SR experiments, respectively. The change in coherence of the two stimuli is presented in Figure 8B and reveals a positive peak at the high theta range for the social encounter, and at the low theta range for the fear memory recall. A quantitative analysis of all coherence changes within the network in both ranges showed that this tendency generally holds for all pairs of brain regions (Figure 8C). Accordingly, most pairs showed a statistically significant interaction between the type of experiment (FC or SR) and theta band (high or low) (*p < 0. 05, **p < 0. 01, two-way repeated measures ANOVA, Figure 8—source data 1). Nevertheless, the magnitude of changes was different between distinct pairs. For example, the changes in the coherence between the LS and NAcc were much smaller than those recorded between the Pir and NAcc and did not show any statistical significance. Moreover, the increases of coherence between the AOB-MOB and MOB-Pir pairs were much bigger in SR compared to the FC experiment. We conclude that the distinct arousal states are characterized by distinct patterns of coherence changes within that same network of brain regions (Figure 9). 10. 7554/eLife. 03614. 027Figure 8. Distinct changes in theta coherence between various brain regions are induced by social and fearful stimuli. (A) Coherence analyses (0–20 Hz) of LFP signal recorded in the LS and MeA of one animal, 5 min prior to stimulus introduction (Base, red) and 15 s following it (Stimulus, blue) during fear memory recall (left, FC) and social encounter (right, SR). (B) The change between Stimulus and Base coherence analyses (Stimulus minus Base) shown in A, for FC and SR, superimposed. (C) Mean (±SEM) values of the peak change in coherence between all possible couples of brain areas in the low (4–8 Hz, red and blue) and high (8–12 Hz, pink and light blue) theta ranges for the FC (red and pink) and SR (blue and light blue) experiments (*p < 0. 05, **p < 0. 01, experiment X theta range interaction, two-way repeated measures ANOVA, Figure 8—source data 1). DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 02710. 7554/eLife. 03614. 028Figure 8—source data 1. Comparison of change in coherence in low and high theta bands between social and fearful stimuli. Comparison of the change in coherence between social recognition (SR) and fear conditioning (FC) at high and low theta ranges (right), statistically validated using two-way repeated measures ANOVA (p—experiment X theta range interaction). The assumption of normality was assessed by Lilliefors and Shapiro–Wilk tests. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 02810. 7554/eLife. 03614. 029Figure 9. Different patterns of coherence change characterize the distinct arousal states. Graphical color-coded presentation of the mean changes in coherence for the FC and SR experiments. DOI: http: //dx. doi. org/10. 7554/eLife. 03614. 029 This study demonstrates that an encounter with a social stimulus causes increased LFP rhythmicity in the high theta range (7–10 Hz), in a network of limbic brain areas associated with social memory. Strikingly, the change in theta rhythmicity is directly proportional to the novelty of the social partner, and may thus be considered a neuronal correlate of short-term social memory (Liebe et al., 2012). Since the modulation of theta rhythmicity is observed even when anesthetized stimuli are used, we infer that it does not depend on the behavior of the social stimulus. Despite the similarity in investigative behavior, such modulation of theta rhythmicity is not observed with object stimuli, suggesting that it is social specific. Since the augmented theta rhythmicity and the associated increase in theta coherence persist beyond the removal of the social stimulus itself, we conclude that these parameters do not mirror sensory inputs but rather reflect a state of arousal that slowly fades away. This is in agreement with the fact that the increase in theta power occurs prior to the actual introduction of the social stimulus in the arena, suggesting increased arousal due to the anticipated social encounter. Finally, since the change in theta rhythmicity during the SRM test correlates with the novelty of the social stimulus, we posit that it reflects a graded level of arousal, which is proportional to the stimulus saliency. One of the questions that arise from the study is whether the social encounter-induced state of arousal is elicited by the ‘social’ quality of the stimulus or whether it simply results from the complexity of the stimulus. Notably, the social stimulus is much more complex than the single object or odor stimuli that we used as controls. It emits a complex mixture of odors and semiochemicals, and in addition to the main and accessory olfactory systems, it also stimulates the visual, auditory, and somatosensory systems. It is not likely that the full complexity of the social stimulus may be mimicked by the use of any artificial mixture of odors, hence the possibility that the arousal state results from the complexity of the stimulus cannot be excluded. On the other hand, at least as regards to fear-associated arousal, it is well documented (Takahashi et al., 2008) that a very simple cue is sufficient to evoke a state of arousal, such that is observed by the freezing of rodents in response to the pure odorant 2,3, 5-Trimethyl-3-thiazoline (TMT), a component of fox odor (Fendt et al., 2003), or to a pure tone in a fear conditioning paradigm (Rogan et al., 1997). This suggests that the factor that determines the state of arousal is not the complexity of the stimulus but rather the information it embodies with regards to the natural environment of the animal. Many studies, both in animals and humans, have linked brain theta rhythmicity to the processing of emotional cues (Sainsbury and Montoya, 1984; Sainsbury et al., 1987a; Sainsbury et al., 1987b; Aftanas et al., 2001; Balconi and Pozzoli, 2009; Knyazev et al., 2009; Maratos et al., 2009; Luo et al., 2013). In animals theta rhythmicity was mostly studied in the hippocampus (Buzsáki, 2002), where it was classified into two types, Type 1 and Type 2. The atropine-insensitive Type 1 theta rhythmicity shows higher frequency (8–12 Hz) and is thought to be associated mainly with voluntary movement. In contrast, atropine-sensitive Type 2 rhythmicity is characterized by lower frequency (4–8 Hz) and is thought to be linked to arousal during states of immobility (Bland, 1986; Sainsbury, 1998). Notably, Type 2 rhythmicity was mostly studied using states of fear and aversive stimuli and was shown to be induced by neutral stimuli if conditioned by fear or introduced in the presence of predators (Sainsbury and Montoya, 1984; Sainsbury et al., 1987a; Sainsbury et al., 1987b). The relationship of the two types of hippocampal theta rhythmicity and similar rhythms recorded from other brain regions, such as in our case, should be cautiously examined for several reasons. First, recent studies showed that in the hippocampus itself there are differences in the profile of theta rhythmicity between the earlier studied dorsal hippocampus and the more recently studied ventral hippocampus (Adhikari et al., 2010), the latter of which shows theta rhythmicity with stronger association to the one recoded in the mPFC (Jacinto et al., 2013), and may be dissociated from the dorsal hippocampus under certain conditions such as decision making (Schmidt et al., 2013). Second, even for the dorsal hippocampus the dichotomy between the two types of theta rhythmicity is far from being perfect with Type 2 rhythmicity reported to reach 12 Hz at some states and Type 1 rhythmicity reported to disappear during certain movements (Sainsbury, 1998). Interestingly, researchers reported that in cats the correlation between movement and Type 1 rhythmicity was good at the beginning of the experiments, when a lot of exploratory and object manipulation behavior was observed, but deteriorated towards the end of the experiments, when the animals were still moving but were uninterested in the task (Sainsbury, 1998). This might suggest that in the hippocampus too, high frequency Type 1 theta may be associated with sensory information processing during ‘positive’ arousal states associated with motivational voluntary movements, such as exploration, while low frequency Type 2 theta may be linked to ‘negative’ arousal states, such as those caused by fear, which is usually associated with freezing. Regardless of the nature of hippocampal theta oscillations, theta rhythmicity associated with emotional states was reported in several other brain areas (Bland et al., 1993; Bland and Oddie, 2001; Pignatelli et al., 2012). Of particular interest is the finding that theta rhythmicity in a limbic network that includes the hippocampus, medial prefrontal cortex and the basolateral complex of the amygdala (lateral and basolateral amygdala) is associated with fear memories. Importantly, the consolidation and recall of long-term fear memory was found to be associated with elevated coherence of the theta rhythmicity in this network (Paré and Collins, 2000; Seidenbecher et al., 2003; Pape et al., 2005; Popa et al., 2010; Lesting et al., 2013), while its extinction was associated with a decline in coherence, in a brain-region dependent manner (Narayanan et al., 2007). Moreover, interfering with theta coherence through local electrical micro-stimulation affected fear-memory recall and extinction depending on theta phase (Lesting et al., 2013). Thus, coordinated arousal-induced theta rhythmicity within this network seems to be involved in consolidation and recall of aversive memories (Popa et al., 2010; Lesting et al., 2013). Here, we demonstrated for the first time that similar phenomena occur in a distinct network of limbic areas that are linked to social memory, in the course of social encounters. Importantly, a comparison of the theta activity between social and fearful stimuli revealed that although both cause a state of arousal, the patterns of theta rhythmicity and coherence within the same network are completely different. First, in agreement with previous studies (Paré and Collins, 2000; Seidenbecher et al., 2003; Pape et al., 2005; Popa et al., 2010; Lesting et al., 2013), the recall of fear memory causes rhythmicity in the low theta range, while a social encounter elicits rhythmic activity in the high theta range. This suggests the existence of two types of arousal: fear-associated arousal and social-related arousal. Second, each of these conditions caused a distinct pattern of coherence changes between the same regions of the network. Given these results, we hypothesize that the distinct types of theta rhythmicity promote different communication protocols (Kepecs et al., 2006) for the coordination of neural activity in the network, which depends on the emotional state of the animal. Our results are in agreement with the hypothesis that theta rhythmicity facilitates cognitive processes such as memory formation that are associated with emotionally salient stimuli (Pelletier and Paré, 2004). The source and distribution of theta rhythms in the mammalian brain are not fully understood (Pignatelli et al., 2012). This issue was extensively studied in the hippocampus (Buzsáki, 2002), which was shown to have the capacity to self-generate theta rhythmicity (Goutagny et al., 2009). Yet, as described above theta rhythmicity also exists in various cortical and limbic areas, where it shows dynamic coherence with the hippocampal theta rhythm. One area shown to display robust theta rhythmicity is the olfactory bulb, where it follows the rhythm of respiration (‘sniff cycle’) (Rojas-Libano et al., 2014). Sniffing, similarly to whisking, is a sensory sampling activity, the rate of which dynamically changes throughout the theta band and is strongly influenced by internal arousal and motivational state of the animal (Clarke and Trowill, 1971; Chang, 1992). Specifically, high-frequency sniffing (8–12 Hz) develops in anticipation of reward delivery (Freeman et al., 1983; Monod et al., 1989; Kepecs et al., 2007; Wesson et al., 2008). The olfactory bulb theta rhythm and sniffing are not usually coherent with the hippocampal rhythm. However, in some odor-based learning tasks these rhythms do become transiently coherent (Macrides et al., 1982; Kay, 2005; Martin et al., 2007), a process that was suggested to be mediated by cholinergic neurons in the medial septum (Tsanov et al., 2014). Interestingly, whisking was shown to get occasionally phase locked with the sniff cycle (Cao et al., 2012; Ranade et al., 2013) or with the hippocampal theta rhythm (Komisaruk, 1970) during exploratory behavior. Thus, various generators of theta rhythmicity in the brain, such as those reflected by sniffing, whisking, or the hippocampal theta rhythm may become dynamically coupled by the brain neuromodulatory systems. While we did not monitor sniffing in our experiments, several recent studies reported changes in sniffing during both social interactions (Assini et al., 2013; Wesson, 2013) and fear conditioning (Shionoya et al., 2013). These studies showed that the sniff cycle adopt high-range theta rhythmicity during social interactions and low-range rhythmicity during fear conditioning. These differences are probably reflected by the distinct rates of theta rhythmicity that we record in the MOB and AOB during these conditions. This may explain our observation of high coherence between MOB-AOB and the low coherence each of them display with all other regions. Moreover, while the coherence between the MOB-AOB is increased during exploration of both social and object stimuli, the coherence between the LS–MeA increases only during social interactions. Thus, the theta rhythmicity displayed by the AOB and MOB probably emerges from a distinct generator, most likely the sniff cycle, that is separate from the one causing rhythmicity in higher brain areas. Furthermore, the significant differences in correlation and coherence dynamics between the various limbic areas suggest the involvement of distinct generators as well. For example, neither paradigm showed significant coherence changes between the LS-NAcc, as opposed to a significant increase in coherence between the LS-MeA or LS-Pir during social interactions. It should be noted that these differences cannot not be accounted for by local diffusion of LFP signals, since the LS is much closer to the NAcc than to the MeA or Pir. Direct synaptic connections cannot explain these differences either as the MeA shows very low coherence with the AOB, despite the strong bidirectional connections between them, but rather displays the highest coherence with the contralateral MeA, despite the lack of direct synaptic pathway (Canteras et al., 1995). Therefore, the differential coherence changes between distinct pairs of brain regions during the various conditions are most likely mediated by either a common input to these regions or via brain-region specific neuromudulatory systems. However, the arousal-driven modulation of theta rhythmicity which seems to be common to all brain regions is probably mediated by a general, brain-wide neuromodulatory mechanism such as neurohormonal activity (Lee and Dan, 2012; Marder, 2012). An ever growing body of evidence implies rhythmic brain activity in various cognitive processes, particularly in memory acquisition and recall (Fell and Axmacher, 2011; Buzsáki and Watson, 2012; Cannon et al., 2014). Specifically, slow frequency rhythms such as the theta rhythm, are hypothesized to mediate communication between brain regions and to promote the temporal binding of neural assemblies in these areas into coherent networks subserving specific cognitive processes (Buzsáki and Draguhn, 2004; Jutras and Buffalo, 2010; Benchenane et al., 2011; Fell and Axmacher, 2011). During the last decade, several prominent theories implied a disordered or weak communication among brain regions as a major deficit underlying ASD etiology and symptoms (Brock et al., 2002; Uhlhaas and Singer, 2006; Geschwind and Levitt, 2007; Kana et al., 2011; Wass, 2011). Indeed, multiple recent studies found reduction in the power and coherence of slow brain rhythms, such as the alpha and theta rhythms, in ASD individuals (Murias et al., 2007; Coben et al., 2008; Isler et al., 2010; Barttfeld et al., 2013; Doesburg et al., 2013; Machado et al., 2013; Kikuchi et al., 2015). In agreement with these findings, our results suggest that arousal-driven theta rhythmicity may help bind correlated neuronal assemblies in distinct brain areas participating in cognitive and emotional processes underlying social behavior. A disruption of the correlated neuronal activity associated with the theta rhythmicity is likely to impair these processes (Uhlhaas and Singer, 2006; Geschwind and Levitt, 2007; Buzsáki and Watson, 2012) resulting in atypical social behaviors. Sprague-Dawley (SD) male rats (5–6 weeks of age, 250–300 gr) served as subjects while SD or Wistar Hola/Hannover male rats (5–6 weeks of age, 250–300 gr) served as stimuli. All rats were purchased from Harlan Laboratories (Jerusalem, Israel) and housed in groups (2–5 per cage) in the SPF rat facility of the University of Haifa under veterinary supervision, food and water available ad libidum, lights on between 7: 00 and 19: 00. Experiments were performed in a strict accordance with the guidelines of the University of Haifa and approved by its Animal Care and Use Committee. We used home-made electrodes for implantation. Stimulating electrodes were prepared by twisting together two stainless steel wires (A-M Systems, Sequim, WA, USA) with bare diameter of 0. 005” (Coated-0. 008”). Recording electrodes were prepared from Tungsten wire (A-M Systems) with bare diameter of 0. 008” (Coated-0. 011”) soldered to stainless steel wire. For reference/ground wire, we used stainless steel wires attached to a small screw. The rats were anesthetized with subcutaneously injected Ketamine (10% 0. 09 cc/100 gr) and Medetomidine (0. 1% 0. 055 cc/100 gr). Anesthesia level was monitored by testing toe pinch reflexes and held constant throughout surgery with consecutive injections. The body temperature of the rat was kept constant at approximately 37°C, using a closed-loop temperature controller connected to a rectal temperature probe and a heating-pad placed under the rat (FHC, Bowdoin, MA, USA). Anesthetized rats were fixed in a stereotaxic apparatus (Stoelting, Wood Dale, IL, USA), with the head flat, the skin was gently removed, and holes were drilled in the skull for implantation of electrodes and for reference/ground screw connection. Stimulating electrodes were placed in the left AOB (A/P = +3. 0 mm, L/M = +1. 0 mm, D/V = −4. 0 mm at 50°) and MOB (A/P = +7. 08 mm, L/M = +1. 0 mm, D/V = −5. 5 mm). Recording electrodes were placed in antero-ventral area of the MeA (A/P = −2. 4 mm, L/M = +3. 18 mm, D/V = −8. 5 mm), LS (A/P = −0. 24 mm, L/M = +0. 4 mm, D/V = −4. 4 mm), and Pir (A/P = +3. 2 mm, L/M = +3. 5 mm, D/V = −5. 5 mm), as well as in the NAcc (A/P = +1. 2 mm, L/M = +1. 4 mm, D/V = −5. 8 mm) in later experiments. Each electrode location was verified by its typical field potential signal, evoked in the MeA and LS by AOB stimulation (Gur et al., 2014) and in the Pir by MOB stimulation (Cohen et al., 2013). Following verification implanted electrodes (one at a time) were fixed by dental cement (Stoelting). When all electrodes were in place, the free ends of the stainless steel wires (including one wire for each stimulation electrode) were wired up to a connector which was then connected to the skull by dental cement, followed by skin is suturing. To avoid a need of soldering, procedure that could damage brain tissue due to excessive heat, we used gold pins inserted to the connector holes under pressure which destroyed the wires isolation to create a contact between the wires and the pins. After surgery, Amoxicillin (15%, 0. 07 cc/100 gr) was injected daily (for 3 days) to prevent contamination. Rats allowed recovery for at least 7 days before experiments. All experiments were video-recorded from above the arena (see Video 1) by a CCD camera (Prosilica GC1290 GigE, Allied Vision Technology, Taschenweg, Germany). Electrophysiological recordings where made using an 8-channel wireless recording system (W8, Multi Channel Systems, Reutlingen, Germany). Recoded signals (sampled at 1 kHz, low-pass filtered at 0–300Hz) were synchronized with the video recordings by start signal sent through a digital to USB converter (NI USB-6008, National Instruments, Austin, TX, USA) controlled by a self-written LabVIEW program (National Instruments). The experimental arena comprised a three-layer box (inner dimensions: width—26 cm, length—28 cm, height—40 cm) with door on its front side. The inner layer was made of material (cloth) stretched on cuboid metal carcass to soften mechanical bumps of the recording system. The outer layer was made of adhesive black tape to prevent light entrance. A stainless steel net serves as a faraday cage in between these layers and the Multi-Channel wireless receiver was placed between it and the inner layer. During the experiment, the arena was illuminated by dim red light. We used a double floor made of two plastic slices that can be separately removed. Overall, we recorded from 22 animals, of them, 11 were tested with the social paradigm, 6 with the object paradigm (1 animal was tested with both) and 6 animals were tested with both fear conditioning and social encounter. Social recognition memory using anesthetized stimuli was performed in two animals and smell recognition was tested in three animals. The sample size is not always the same for all brain regions since in some of the recorded animals we lost the signals from specific electrodes due to various causes. At the beginning of each experiment, the tested rat was taken out of its home cage and the wireless transmitter was fastened to the connector on its head by a male-to-male Interconnect header (Mill-Max Mfg. Oyster Bay, NY, USA) with 18 pins. Following 0. 5–1 hr of habituation in the experimental arena, the rat was subjected to social, object, smell recognition test (Figure 2A), or fear conditioning test (Figure 7—figure supplement 1). Each encounter initiated by pressing ‘start’ button on LabVIEW virtual instrument that sends synchronizing start signal to the camera and the wireless system. Then, during a period of 15 s, the stimulus was removed from its cage and delivered into the experimental arena. At the end of each encounter following stimulus removal, the upper floor slice is taken out and thoroughly cleaned with 70% ethanol and water to remove any odors left by the stimulus. It was then put back below the other slice 5 min after stimulus removal. Rat stimuli were individually placed in clean covered plastic box and held in the experiment room throughout the experiment. The two stimulus animals used for each paradigm were always from different rat strains. Anesthetized animal stimuli were subcutaneously injected Ketamine (10% 0. 09 cc/100 gr) and Medetomidine (0. 1% 0. 055 cc/100 gr) 10 min prior to experiment. As object stimuli, we used clean metal office stapler and hole-puncher. For smell recognition, we used small metal-net balls filled with cloth soaked with artificial food smells of citrus and vanilla. The metal-net ball was attached to the cage floor by hot melt adhesive. It should be noted that obviously, both object and smell stimuli are much poorer sources of chemosignals that social stimuli. Fear conditioning took place in a Plexiglas rodent conditioning chamber with a metal grid floor dimly illuminated by a single house light and enclosed within a sound attenuating chamber (Coulbourn Instruments, Lehigh Valley, PA, USA). Rats were habituated to the chamber for 1 hr before fear conditioning. During fear conditioning rats were presented with five pairings of a tone (CS; 40 s, 5 kHz, 75 dB) that co-terminated with a foot-shock (US; 0. 5 s, 1. 3 mA). The inter-trial interval was 180 s. The fear recall experiments were conducted a day later in the experimental arena described above, using the same procedure without the electrical foot shocks. After completion of the experiments, the rats were anesthetized and killed with an overdose of Isoflurane (Abbott Laboratories, Chicago, IL, USA). The brains are removed and placed in PFA (4% in PBS) over night, followed by sectioning to 200-µm slices using vibrating slicer (Vibroslice, Campden Instruments, Lafayette, IN, USA). The locations of the implanted electrode tips were identified using binocular and compared to the Pexinos-Watson rat brain atlas (Paxinos and Watson, 2007). All analyses were done using self-written MATLAB programs (MathWorks, Natick, MA, USA). In all cases, when LFP signals were filtered we used band-pass filter between 5 and 11 Hz (high theta band) using MATLAB ‘fir1’ function. Statistical analyses were performed using MATLAB, except for repeated measures ANOVA analyses that were conducted using SPSS (IBM) statistical software. Each brain region was separately analyzed. Parametric t-test and ANOVA tests were used if data were found to be normally distributed (Lilliefors and Shapiro–Wilk tests). Bonferroni' s corrections were performed for multiple comparisons using t-test. One-sided t-tests were used when a change in specific direction was expected before the experiment.

Title: Different types of theta rhythmicity are induced by social and fearful stimuli in a network associated with social memory Summary: For the brain to function correctly, the activities of multiple regions must be coordinated. This coordination is thought to be carried out by waves of electrical activity in the brain. One of the most prominent signals within these waves is called the theta rhythm. The theta rhythm is thought to help coordinate neural activity between the regions of the brain that are involved in learning and memory. However, theta rhythms also appear when subjects encounter emotional stimuli, which suggests that they might have a role in social cognition. Consistent with this idea, theta rhythms are reduced in individuals with autism spectrum disorders, but the exact nature of the relationship between theta rhythms and social behavior has remained unclear. Tendler and Wagner have now addressed this question directly by implanting electrodes into five brain regions that are active when rats engage in social interactions. Exposing a rat to a social stimulus, such as an unfamiliar visitor rat, caused the intensity of theta rhythms to increase in this network. This change was temporary, with the theta rhythms gradually returning to normal as the novelty of the visitor wore off. An increase in the intensity of theta rhythms also occurred in the same network when the rats encountered a fearful stimulus, such as a tone that had previously signaled the delivery of a mild electric shock. Notably, however, the fearful stimulus led to an increase in low frequency theta rhythms, whereas the social stimulus led to an increase in high frequency theta rhythms. These results suggest that social and fearful stimuli give rise to two different forms of alertness or arousal, which are reflected by the two types of theta rhythms in this network within the brain. Tendler and Wagner also suggest that the distinct frequencies of theta rhythms might be used to support different forms of communication between various regions of the brain, depending on the emotional value of the stimuli (for example, are they social or fearful stimuli?) encountered by the animal. This means that emotional states might be dictating cognitive processes such as learning and memory.

lay_elife

en

Summarize: By. Daily Mail Reporter. and Associated Press. PUBLISHED:. 08:06 EST, 3 February 2014. |. UPDATED:. 05:32 EST, 4 February 2014. A winter storm dumped several inches of wet, heavy snow on parts of the eastern United States on Monday, snarling commutes and Super Bowl fans' trips home, closing schools and government offices, cutting power and delaying or canceling more than 7,000 flights across the country. Fat flakes fell in Philadelphia and New York, creating slushy sidewalks and streets and all but erasing all memory of Sunday's temperatures in the 50s. The storm began moving out of the region Monday afternoon, making way for another system expected to sweep in from the Plains with ice and snow late Tuesday and early Wednesday. The National Weather Service reported about 8 inches of snow near Frostburg, Md., while parts of southern Ohio and West Virginia got about 10 inches. Totals in the Philadelphia area ranged from 3 to 9 inches; New York saw as much as 7 inches by 3 p.m. SCROLL DOWN FOR VIDEO. Mess: More than 7,000 flights were delayed or cancelled Monday due to a brutal winter storm that left several inches of snow across the East Coast. Risky: Even after being de-iced, several airlines decided that flying in the storm would be too risky. LaGuardia: New York City was hit with up to nine inches of snow in some areas, including LaGuardia Airport in Queens. Government offices, courts and schools closed in parts of Connecticut, Delaware, Maryland, New Jersey, Ohio, Pennsylvania and West Virginia, and scattered power outages were reported throughout the region. Speed limits were reduced on many major highways. In New Jersey, Gov. Chris Christie declared a state of emergency with travel conditions hazardous. Nonessential government employees were dismissed early. By late afternoon, the flight-tracking website FlightAware reported more than 4,300 delayed flights and 1,900 canceled flights nationwide in cities including Philadelphia, Newark, N.J., and New York. Inbound flights to those airports were delayed one to three hours because of snow and ice. Russ Louderback, of Fishers, Ind., and his 11-year-old son Mason had gone to New Jersey to see the Super Bowl but suffered a triple whammy of bad luck: Their beloved Denver Broncos lost, they got stuck in an hours-long traffic jam leaving the stadium and their Monday afternoon flight home was canceled. 'It was so congested we couldn't get out of New Jersey, even though we left early because our team lost,' said Louderback, a hotel executive. Delayed: The flights that weren't cancelled due to snow were delayed, in some cases up to several hours. Super Storm: Many of those in New York to attend the Super Bowl on Sunday were stuck in the airport for hours waiting through flight delays. Arizona Gov. Jan Brewer was among the stranded travelers after her return flight to Phoenix was canceled Monday, a spokesman said. Brewer attended the big game as part of the ceremonial handoff of hosting duties; next year's Super Bowl is in Glendale, Ariz. Francois Emond, of Alma, Quebec, arrived at Newark Airport at 6 a.m. Monday to find his flight home had been canceled. Wearing a Seattle Seahawks championship hat and an ear-to-ear smile, he said he didn't care about the cancellation or the weather in light of Seattle's victory. He planned to spend an extra night at his hotel in New York. 'The night will be very short,' Emond said. 'When you win a Super Bowl for the first time, the night is very, very short.' In Connecticut, architect Frank Emery described messy conditions outside as he stopped at a coffee shop in New Haven. Repeat: Another storm is expected to hit the East Coast again sometime on Tuesday. 'A lot of people must have called in sick after the Super Bowl,' he said. 'It's not cleaned up as well as usual.' In Philadelphia, the airport experienced weather delays as long as four hours Monday morning. But the flight home for Seahawks fan George Shiley, of Snohomish, Wash., remained on schedule at midday. Shiley, a Seattle season ticket holder, had won a lottery for Super Bowl tickets. He and his buddy stayed in Philadelphia, about 85 miles southwest of the East Rutherford, N.J., stadium. 'It's been a great trip. I joked that `It's Always Sunny in Philadelphia' - and it was, until today,' said Shiley, referring to the FX sitcom. At least two deaths and one serious injury were blamed on the storm. In western Kentucky, where the snow began falling Sunday, a man died that night when his car skidded into a snowplow. On Monday, a New York City man was fatally struck by a backhoe that was moving snow. A 10-year-old girl was in serious condition after she was impaled by a metal rod while sledding north of Baltimore. Another storm is likely to hit the region beginning Tuesday night, bringing a combination of rain, freezing rain and snow, said Gary Szatkowski, a weather service meteorologist in Mount Holly, N.J. Perhaps residents shouldn't be surprised, considering groundhog Punxsutawney Phil on Sunday predicted six more weeks of winter. There's also a possibility for a storm this weekend, Szatkowski said. 'I like to say Punxsutawney Phil agrees with me,' he said. 'Winter's not over, that's for sure.' Chaos: Traffic crawls along Hudson Street in New York City on Monday as snow begins to fall again after several days of mild weather. It is the first of three winter storms expected to hit the U.S. this week. Winter wonderland: People walk along a snow-covered 5th Avenue by Central Park in Manhattan Monday. Staying warm: Angel Hetemaj, 5, celebrates with her mother Samantha, as their bus pulls into view in New London, Connecticut on Monday morning as sleet and snow threatens to fall all day. Covered: Plows clear runways as snow falls at Newark Liberty International Airport in Newark, New Jersey - the nearest airport to the Super Bowl stadium. Cancellations: United passenger Jan Cloos looks at her flights status at Newark Liberty International Airport. Lows: A weather map shows the chill and snow expected to fall across the country on Monday. Heavy snow: Parts of the Northeast could see as many as 12 inches of snow into Tuesday. Long lasting: The snow is expected to turn to rain in New York City later in the week. White out: People wait on a ferry boat in view of the Brooklyn Bridge during Monday's snow storm. Battling through: A woman carries one of her dogs through a snowy park in New York on Monday. Empty: A park employee carries a shovel through Bryant Park on 42nd Street in the snow on Monday. At least two deaths and one serious. injury were blamed on the storm. In western Kentucky, where the snow. began falling Sunday, a man died that night when his car skidded into a. snowplow. On Monday, a New York City man was fatally struck by a backhoe. that was moving snow. A 10-year-old girl was in serious condition after she was impaled by a metal rod while sledding north of Baltimore. Another. storm is likely to hit the region beginning Tuesday night, bringing a. combination of rain, freezing rain and snow, said Gary Szatkowski, a. weather service meteorologist in Mount Holly, N.J. Perhaps residents shouldn't be surprised, considering groundhog Punxsutawney Phil on Sunday predicted six more weeks of winter. There's also a possibility for a storm this weekend, Szatkowski said. 'I like to say Punxsutawney Phil agrees with me,' he said. 'Winter's not over, that's for sure.' Battle: A cyclist makes his way up the Hudson River Greenway as heavy snow falls on Monday in New York. Not happy: Snow collects on a dog's fur in Manhattan on Monday as as many as 8 inches begins to fall. Chill: The snow returned to New York City, pictured, after staying away for the Super Bowl this weekend. Bundled up: A woman walks through Union Square in New York City on Monday as snow falls around her. Delays: A jet is on the tarmac at Philadelphia Airport as flights were canceled across the U.S. Not in the moo-d: Snow gathers on a steer's head at Hancock Shaker Village in Pittsfield, Massachusetts. Danger: A police officer walks a woman to his vehicle after her she slid her car off the road in Pennsylvania. Crash: Traffic backs up as vehicles move around a three vehicle crash in Plains, Pennsylvania on Monday. Winter walk: Lisa Drobka walks her dogs Louis and CiCi through the snow ain State College, Pennsylvania. The second storm is expected to reach. further across the country, blanketing Chicago, Detroit, Kansas City and. St Louis with heavy snow. Snow,. freezing rain and sleet is also expected to hit north and west of. Washington and Baltimore on Tuesday, the Weather Channel reported,. before turning to rain into Wednesday. Snow will also blanket western, central. and Upstate New York and New England, covering Buffalo, Albany,. Burlington, Boston and Portland, Maine. Nebraska, Kansas, Illinois, Indiana. and Michigan could also get six or more inches of snow between Tuesday. and Wednesday, according to The Weather Channel, NBC reported. Snow. will later reach the Ohio Valley, central Appalachians and northwest. Texas, where winter weather advisories are already in place due to the. threat of freezing rain. On its way: A NOAA satellite image taken early Monday shows rain and snow across the Tennessee/Ohio Valley and Mid Atlantic regions as a winter storm descends on the country. Making the most of it: Two friends play in the snow at the Henderson golf course in Kentucky. Wrapped up: Tessa Moore makes her way to work in downtown New Bedford, Massachusetts Monday. Snow day: Bryan Walton pulls his sister, Camden, on a sled in Maysville, Kentucky, where 7 inches fell. Blanket: A woman takes photos of the snow on the New Haven Green, in New Haven, Connecticut. From. Tuesday, the ice could also spark power outages in western. Pennsylvania, western Maryland, northwest Virginia and eastern West. Virginia. Then the third winter storm is expected to hit the Rockies on Friday. 'We. don’t know the orientation or the path of the storm,' Walton said. 'There will likely be high impacts from the Midwest into the Northeast. and perhaps even the south Saturday and Sunday.' It comes just days after Atlanta was brought to a grinding halt by the snow to the South

Summary: New York City could was hit with seven inches of snow by 3 p.m. Monday. Nearly 7,000 flights have been delayed or canceled across the country. Newark Airport - the closest airport to the Super Bowl stadium - was hit with the brunt of delays and cancellations. New Jersey Governor Chris Christie declared a state of emergency. Winter storms expected to land throughout the week, bringing sleet, snow and ice from Texas to Maine.

cnn_dailymail

en

Summarize: Kristen Stewart, center, arrives at The Twilight Saga: New Moon premiere on Monday, Nov. 16, 2009, in Westwood, Calif. (AP Photo/Chris Pizzello) (Associated Press) LOS ANGELES _ Exactly 12 months ago, Kristen Stewart and Robert Pattinson were surprised to be greeted by throngs of eager fans of the novel "Twilight" at the premiere of the big-screen adaptation. What a difference a year makes. The actors unveiled the sequel _ "The Twilight Saga: New Moon" _ at the same location Monday night in the Westwood neighborhood of Los Angeles. But this time they knew what was coming. "I'm not as scared as I was last year," said Stewart, despite a brief touch-and-go moment as she signed autographs. "At some point, the security guy said, 'This is very unsafe.' And I was like, 'Uh.' Other than that, everything was cool." Pattinson, who plays vampire Edward Cullen in this latest adaptation of author Stephenie Meyer's popular series, said this year's crowd of thousands of screaming fans was larger than the 2008 turnout. "And it seems different to me because we have done this world tour in the last week and it has just been unbelievable in every single city," he said. "It is about 10 times bigger than any other city in the world." Some "twi-hards" __ as they call themselves __ arrived as early as Thursday afternoon to secure a place in line for tickets allowing them to watch the stars' arrivals on the red carpet. The 800 available tickets were all distributed by Monday morning, but the line still stretched for blocks well after lunchtime. Nicole Zamora, 36, was sixth in line after getting to Westwood on Thursday afternoon. She and her three sisters wore "New Moon" T-shirts they'd made for the occasion and said they spent the weekend "reading, listening to the iPod and trying to sleep _ anything to pass the time." Christina Fuentes and four of her friends traveled from New Jersey for the "New Moon" premiere. The 24-year-old wore vampire teeth ("They just clip on," she said) and carried a homemade sign that read, "We flew in from NJ! We've been camping out for three days just to see you!" She pasted her airline boarding pass to the poster as proof. Scores of other fans _ mostly young women _ crowded onto street corners near the Mann Village and Bruin theaters, site of the premiere. They sat on beach chairs, displayed homemade signs and wore T-shirts proclaiming their allegiance to either the handsome vampire played by Pattinson or his werewolf rival, Taylor Lautner. Lautner, who rises to headliner status in "New Moon," said he was also amazed by Monday's fan response. "It's the amount of passion," he said. "It's not normal." ___ Associated Press entertainment writer Sandy Cohen contributed to this story. Registering will give you a user profile and the ability to add other users as friends. To become a commenter, however, you need to audition. Want to know more? Consult the Comment FAQ and legal terms.

Summary: As thousands of fans mobbed last night's New Moon premiere (some had been waiting since Thursday afternoon, the AP reports), Gawker runs down the 14 craziest pieces of Twilight merchandise: Edward Cullen panties Edward Cullen sock puppet Jacob Black light switch cover Vampire sparkle dildo Edward Cullen sweatshirt that reads, "Edward can bite my pillows, break my headboard, and bruise my body any day." Cullen family toilet seat Vegan Twilight lip gloss Hand-painted Bella and Edward high-top sneakers Felt Bella womb with fetus Twilight-themed wedding Save the Date cards Baby Twilight onesie: "I'm the next Edward Cullen." For the complete list, click the link at right-or view the terrifying photos at left.

multi_news

en

Summarize: Background In the early 1990s, NASA was planning an infrastructure to support a projected annual budget of more than $20 billion and a civil service workforce of about 25,000 by the turn of the century. However, over the last several years, NASA has been directed by the Administration to reduce its future years’ budget levels. In the fiscal year 1994 budget request, NASA’s total funding for fiscal years 1994 through 2000 was reduced by 18 percent, or $22 billion. In the fiscal year 1995 budget request, total funding was reduced again by almost $13 billion, or an additional 13 percent. To absorb these major reductions, NASA focused on adjusting programs. For example, the Space Station program was restructured and given an annual budget ceiling of $2.1 billion. Similarly, the scope of the Earth Observing System program was reduced, and the program is being restructured once again. Also, funding was terminated for the Space Exploration Initiative, the National Launch System, and the National Aerospace Plane, and the Comet Rendezvous and Asteroid Flyby project was canceled. As part of the executive branch’s development of NASA’s $14.2-billion budget request for fiscal year 1996, NASA was directed once again to lower its projected budget through fiscal year 2000, this time by an additional 5 percent, or $4.6 billion. Rather than terminating or delaying core science, aeronautics, or exploration programs, NASA announced it would absorb this funding decrease by reducing infrastructure, including closing and consolidating facilities. NASA also said it would reduce its use of support contractors and decrease the size of its workforce to about 17,500 by the turn of the century—the lowest level since the early 1960s. While NASA’s actual and planned budgets and staffing levels have decreased sharply, the value of its facilities infrastructure has actually increased. From fiscal years 1990 through 1995, the current replacement value of NASA’s facilities increased by about 14 percent, not including inflation. At the end of fiscal year 1995, the agency’s facilities had an estimated current replacement value of $17 billion. The agency owned or leased about 3,000 buildings on nearly 130,000 acres of land at 71 locations. NASA’s facilities range in size from small buildings to large industrial plants. Appendix I provides information about facilities at NASA’s 10 field centers. As part of its infrastructure reduction efforts, NASA is also looking at ways to cut the cost of its field center support activities. Each NASA field center operates a wide range of such activities, with some support-unique missions at particular centers. Common activities include building maintenance, fire protection, security, printing, and medical services. NASA provides these services primarily through a combination of civil service employees, contractor labor, and arrangements with the Department of Defense (DOD) where facilities are collocated. Planned Facilities Reductions Will Not Achieve Large Cost Reductions NASA’s current facility closure and consolidation plans will not fully achieve the agency’s goal of decreasing the current replacement value of its facilities by about 25 percent (about $4 billion in 1994 dollars) by the end of fiscal year 2000. More importantly, these plans will not result in substantial cost reductions by that date. By the end of fiscal year 1997, NASA plans to have closed or converted facilities to cost-reimbursable status that have a current replacement value of $1.9 billion. Also, as of March 1996, planned reductions through fiscal year 2000 were $2.8 billion, or about 30 percent below NASA’s goal of reducing the current replacement value of its facilities by about $4 billion in 1994 dollars. Agency officials noted that the $4-billion reduction goal was a “stretch,” or aggressive goal, which they were never certain could be achieved. Additional reductions are unlikely in research and development facilities, but there may be opportunities for further reductions in office space, according to NASA officials. NASA classifies building space based on its primary use, such as office space. NASA was providing general purpose office space for about 53,000 civil service and contractor personnel at the end of fiscal year 1995. Agencywide, the average square feet of office space available per person, including substandard space, exceeded NASA’s standard by nearly 43 percent and the ceiling by over 25 percent. When substandard space is not included, this average exceeded the standard by over 27 percent and the ceiling by 12 percent. Future reductions in the number of on-site contractor personnel and NASA employees (almost 4,000) by fiscal year 2000 will make even more office space available. NASA estimates that the planned $2.8-billion reduction in the current replacement value of facilities will yield only about $250 million in cost reductions through fiscal year 2000. Although some of these cost reductions are from lowering facilities’ operations and maintenance costs, most result from four centers bringing contractor personnel from off-site leased space onto the centers to fill space left vacant because of reductions in NASA personnel and support contractors. Moreover, some cost reductions may be offset by increased costs in future years. For example, according to a NASA official, about three-quarters of NASA facilities are 30 or more years old and keeping these facilities operational may lead to higher operations and modernization costs. Problems in Evaluating Cost-Reduction Opportunities NASA has had problems in identifying, assessing, or implementing some cost-reduction opportunities. NASA personnel (1) did not thoroughly evaluate potential larger cost-reduction options, (2) limited the scope of consideration for consolidation, (3) performed questionable initial cost-reduction studies, (4) made inappropriate closure recommendations, and (5) substantially overstated cost-reduction estimates. Some of these problems resulted when NASA acted quickly in an attempt to achieve near-term cost reductions. NASA officials said that some cost-reduction estimates were “interim” estimates because NASA was pressured into prematurely providing what turned out to be imprecise savings estimates to Congress. Also, some NASA staff lacked experience in developing estimates, according to NASA officials. Although there were problems with some evaluations, which are discussed below, others appear to have been done better. For example, the Office of Space Flight reviewed in detail a proposed consolidation of automated data processing functions at a single location before developing a plan that offered several options. Concerns about closing facilities, relocating activities, and consolidating operations have sometimes been exacerbated by perceptions of the lack of fairness and impartiality in the decision-making process. In the past, we have expressed concerns about NASA’s ability to accurately and independently develop cost estimates to support its decisions on new and ongoing programs and projects. Just recently, the NASA Inspector Generaland NASA management have been discussing the structure required to meet NASA’s continuing need for independent, impartial, and technically credible systems analysis and program evaluation. Cost-Reduction Options for Telecommunications Networks Not Thoroughly Evaluated NASA did not thoroughly evaluate potential larger cost-reduction options for consolidating wide area telecommunications networks. NASA has five such networks operating or being developed, and they provide a variety of communications services among headquarters, field centers, major contractors, affiliated academic institutions, and international partners. Due to advances in technology, NASA no longer needs to operate multiple telecommunications networks, and consolidating network operations at a single site offers economies of scale, as well as reduced administrative overhead. Last year, NASA’s Zero Base Review team recommended that the field centers compete to determine which one could consolidate the five wide area networks most cost-effectively. Goddard Space Flight Center, Ames Research Center, and Marshall Space Flight Center prepared consolidation proposals. NASA’s Office of Space Communications, which oversees the two largest networks, decided against a competition and did not formally consider the proposals offered by Goddard and Ames. Instead, with the objective of obtaining some budget cost reductions in 1997, it endorsed the Marshall proposal without determining which of the three proposals was the most cost-effective. However, Marshall’s proposal did not project cost reductions in the near term as aggressively as the others. For example, Goddard’s proposal estimated potential cost reductions over the next 6 years totaling $94.5 million more than the reductions in the Marshall proposal. Earlier this year, we recommended that NASA conduct an objective review of network consolidation to determine whether its chosen approach should be modified to achieve greater cost reductions. NASA agreed with this recommendation and arranged for an independent group to conduct the review. It indicated the agency’s telecommunications experts were not participating in the review because they would have a “biased” perspective. The independent review is scheduled to be completed this month. NASA’s initial network consolidation efforts were hampered by the lack of clear direction within NASA to include all five wide area networks in the consolidation effort. The Office of Space Communications, which directed the consolidation effort at Marshall, does not have authority over three of the five networks. The agencywide telecommunications network consolidation or streamlining efforts did not have a strong central advocate. NASA’s Chief Information Officer, who would be a logical choice to fill this role, was not directly involved in this effort. Initial Limitations in Scope of Consideration for Supercomputer Consolidation NASA initially excluded almost 40 percent of its supercomputer systems, which were used mostly for research and development, from the scope of a supercomputer consolidation study. The agency uses supercomputers to support some space mission operations and a variety of research projects, including developing new supercomputer technologies. In March 1995, NASA began studying ways to cut its supercomputer costs by consolidating their management and operation. However, its initial studies considered only some of the agency’s supercomputers and focused on nonresearch and development supercomputing systems. Although NASA’s consolidation study team had identified 29 supercomputers, NASA management excluded 12 existing machines and some planned for future procurement from consideration because (1) some are being managed under existing contracts that could be affected by a consolidation decision and (2) others were used in research programs primarily to develop new supercomputer technologies. We spoke with NASA program, field center, and supercomputer consolidation study officials about the reasons for, and appropriateness of, limiting the scope of NASA’s consolidation study. During a series of discussions, NASA officials acknowledged our concerns about the study’s limitations and expanded its scope to a phased approach that will eventually consider all of the agency’s supercomputers. In commenting on a draft of this report, NASA said the review will be based on a top-down plan for agencywide management of supercomputing operations and will design an optimal supercomputer architecture as a basis for determining future directions in this area. Questionable Initial Studies of Aircraft Consolidation Options Questions about initial studies have delayed the decision-making process in NASA’s attempts to consolidate aircraft. Last year, the transfer of research and operational support aircraft from five NASA centers to the Dryden Flight Research Center was proposed. NASA headquarters tasked Dryden, the center that would gain from the consolidation, with planning and performing an aircraft consolidation study. In a recent report, the NASA Inspector General noted the Dryden study had estimated NASA could save $12.6 million annually by consolidating aircraft at Dryden. However, internal and external questions about the scope and quality of this study have slowed the decision-making process. Subsequent reviews of the costs and benefits of aircraft consolidation by both NASA management and the NASA Inspector General staff have resulted in much lower annual savings estimates. In light of the controversy that potentially accompanies any significant decision to consolidate, relocate, or close facilities, NASA would benefit from ensuring an adequate balance of expertise and interests for study teams, developing initial analyses that are objective and well-supported, and fairly and thoroughly considering reasonable alternatives before making decisions. In this way, NASA can develop defensible decisions that will withstand external scrutiny and can be implemented in a timely manner. Inappropriate Recommendations to Close Plum Brook Station Plum Brook Station was inappropriately recommended for possible closure twice. In February 1995, the NASA Federal Laboratory Review recommended reviewing the station for possible closure because it was being operated primarily for non-NASA users. At about the same time, NASA’s White Paper, formally titled A Budget Reduction Strategy, suggested that Plum Brook should be closed. NASA officials could not provide the rationale for the proposed action. The Laboratory Review report did acknowledge a problem concerning the existence of an inactive nuclear reactor at the station, and the Zero Base Review subsequently recommended retaining Plum Brook on a fully reimbursable basis because of the reactor. Plum Brook operates on a cost-reimbursable basis, with most of its operating cost covered by revenue from users of four test facilities at the station. Even if all four of the test facilities were closed, the operating cost would still be about $2 million, primarily because the Nuclear Regulatory Commission requires that the reactor be maintained in its current state. The only way to close the location and dispose of the property would be to dismantle the reactor. However, the cost for doing this would be prohibitively expensive—about $100 million in 1997 dollars, according to a 1990 estimate. In addition, there are no disposal sites to accommodate the radioactive waste that would be generated by the dismantling process. Overstated Cost Reductions for Some Options In some cases, NASA’s initial estimates of cost reductions were overstated. For example, the Zero Base Review estimated that $500 million or more could be saved through 2000 by commercializing the Tracking and Data Relay Satellite System. However, NASA later determined this approach could not be implemented and that none of the projected savings would materialize in the time frame targeted by the Zero Base Review. Also, the Zero Base Review claimed that consolidation of telecommunications networks would save between $350 million and $375 million. Subsequently, NASA officials acknowledged these cost reductions would not only be significantly lower, but the lower savings estimates had already been considered in the preparation of the networks’ future budget estimates. The estimated savings noted above were part of the total savings estimate that provided the basis for NASA’s claim that the fiscal year 1996 out-year budget reductions could be covered by infrastructure decreases. To the extent the estimates were overstated, additional pressure was placed on NASA program and field center officials to find efficiencies to supplant the overstated savings. For example, after NASA determined that commercializing the Tracking and Data Relay Satellite System would not reduce costs, it began aggressively negotiating a fixed-price contract for the purchase of three additional satellites needed for the system. However, NASA estimates that the fixed-price contract produced considerably less savings than the commercializing of the system. Environmental Cleanup Costs Could Affect Facility Disposition Efforts NASA’s future facility disposition decisions could be affected by environmental cleanup costs. Therefore, information about the extent and type of contamination, the cost of its cleanup, and the party who is financially responsible are relevant to such decisions. However, NASA officials do not yet fully know what the cleanup requirements will be and lack a policy for identifying other responsible parties and sharing cleanup costs. Currently, NASA officials are still working to identify all the challenges they face as a result of environmental contamination. NASA’s 1996 site inventory identified over 900 potentially contaminated sites, about half of which may require cleanup. At this time, according to NASA records, only 72 sites are classified as closed and, of these, only 15 required cleanup. Most sites are still in the early stages of the cleanup process, with almost 400 still being studied to determine the type and extent of contamination. NASA headquarters used selected portions of a DOD model to develop a preliminary cost estimate of $1.5 billion for cleaning up potentially contaminated sites over a 20-year period. Subsequently, NASA’s field centers, in response to our request, developed cost estimates totaling $636 million. This estimate excludes some sites that have not been studied and is a projection of cleanup cost for only the next 8 years or less. Although NASA field centers have not developed cleanup cost estimates for disposing of property in the future, officials at several centers believed the cost could be as much as two to five times higher than if NASA were to retain the property. The higher cost would occur if NASA cleaned up facilities to meet more stringent standards that might be required for disposal. Sharing cleanup costs with others could help NASA reduce its environmental cleanup costs. Environmental law holds owners, operators, and other responsible parties liable for correcting past environmental contamination. However, NASA has no policy on pursuing other responsible parties. It currently pays the cleanup costs for virtually all of its centers and other field locations, regardless of who was responsible for causing or contributing to the contamination. Although NASA has identified other responsible federal agencies, it has not generally tried to identify potentially responsible contractors or previous owners and pursue cost-sharing agreements with them. An ongoing facility reduction effort where cost sharing may be an issue involves land at NASA’s Industrial Plant in Downey, California. The city wants to acquire 166 acres of this property: 68 acres NASA has identified as excess to its needs and 98 acres it has identified as potentially excess. The city plans to use the land for economic development projects. An assessment of environmental contamination determined that 16 of the excess acres were free of contamination. Studies of the remaining excess acreage are underway. The eventual disposition of the remaining 98 acres of NASA-owned land is still unclear, and studies of their contamination status are still in the early stages. Before NASA took over the Downey facility, it was a DOD facility operated by the predecessor organization of the contractor currently operating the facility for NASA. NASA will have to decide which potentially responsible parties it will pursue in supporting any corrective actions that may be needed to meet applicable cleanup standards. However, NASA’s Johnson Space Center, which manages the Downey facility, has not yet begun to deal with the potential cost-sharing issue and, as noted above, there is no NASA-wide policy providing guidance on this issue. In commenting on a draft of this report, NASA stated it intends to complete a policy statement by the end of 1996 to address the issue of potential responsible parties at NASA facilities requiring environmental remediation. Efforts to Lower Support Costs Underway, but Little Progress Made in Sharing Facilities With DOD Among NASA’s initiatives to reduce its infrastructure are efforts to lower the field centers’ operations support costs. NASA spends over $1 billion annually to support maintenance and operations at field centers. Among the actions NASA is taking to reduce this cost is consolidating its payroll functions at one center to cut payroll-related civil service and contractor staffing by about 50 percent. It is also implementing a variety of initiatives to share resources and standardize processes at its principal aeronautics centers—Ames, Langley, Lewis, and Dryden. NASA estimates that this effort—known as Project Reliance—will reduce agency costs by about $36 million by fiscal year 2000. In June 1995, NASA expanded the scope of its cost-reduction search outside the agency; it teamed with DOD to study how the two agencies could significantly reduce their operations costs and increase mission effectiveness and efficiency through increased cooperation and sharing. Study teams, referred to as integrated product teams, began work in September 1995 in seven areas. We monitored three teams: major facilities, space launch activities, and base/center support and services. The objectives of the major facilities and space launch activities teams included assessing facilities’ utilization and recommending potential consolidations and closures. The major facilities team was responsible for (1) developing recommendations on test and evaluation and research facilities with unnecessary overlap or redundancy and (2) identifying and providing the rationale for consolidations, realignments, and reductions for specific facilities. The space launch activities team focused on increasing cooperation in its area, including range and launch facilities and infrastructure. Neither team recommended specific consolidations or closures or identified cost reductions in their final briefings to the Aeronautics and Astronautics Coordinating Board. Both teams did, however, identify barriers to increased cooperation and coordination between NASA and DOD, including differences in cost accounting systems, practices, and standards. More importantly, NASA and DOD officials noted a more general limitation: the “old paradigm”—that is, each NASA and DOD program protects its ability to maintain its own technical expertise and competence. The over- capacity situation in large rocket test facilities helps to illustrate this. Several years ago, the National Facilities Study concluded that there was excess large rocket test capacity and some facilities could be closed, but DOD and NASA officials involved in the study said no direction or funding was subsequently made available to pursue this recommendation. More recently, the major facilities team found that NASA and DOD each have excess large rocket test capacity based on both current and projected workloads. However, the team made no recommendation to consolidate facilities because comparable facilities’ cost data was not available. The team did recommend that a facility agreement in the area of rocket propulsion testing be established to identify areas where capability reductions and greater reliance between NASA and DOD would be possible in the future. While the issue of large rocket test capacity remains unresolved, some rocket test facilities are currently undergoing or being considered for modification. A rocket test complex at Edwards Air Force Base is being upgraded by DOD at an estimated cost of $15 million to $17 million. In addition, NASA plans to upgrade one of its rocket engine test facilities at Stennis Space Center for about $45 million. DOD and NASA officials believe that their respective upgrades are cost-effective, although they agreed that the agencies need to improve coordination to prevent further excess capacity. NASA believes that the rocket test facilities at Stennis and Edwards Air Force Base are not comparable. However, the National Facilities Study and the major facilities integrated product team raised the overall excess capacity issue, and it has not yet been resolved. Independent actions by DOD and NASA to upgrade their individual facilities potentially exacerbate the problem of overall excess capacity. NASA and DOD officials acknowledged that recommending sharing and increasing reliance on each other, including consolidating or closing facilities, was difficult. These officials pointed out that, in many cases, such actions are “too politically sensitive” or could result in near-term costs increases, rather than cost reductions. They noted that an external, independent process, similar to the one used by the Defense Base Closure and Realignment Commission, may be needed to overcome the sensitivity and cost issues. The base/center support and services team, which was responsible for recommending ways to increase cooperation in base/center support and services, examined existing and potential cooperative arrangements at eight NASA centers and one test facility collocated with or geographically near DOD installations. The team reported finding over 500 existing support arrangements and identified additional cooperative opportunities. The team identified changes to activities at several NASA locations, including having NASA’s Dryden Flight Research Center and the Air Force Flight Test Center jointly use space and combine certain operations; constructing one fuel facility for joint use by NASA’s Langley Research Center and Langley Air Force Base; and sharing use of contracts and services. Although the team expects such changes to lower the agencies’ costs by millions of dollars, it cited specific barriers to accomplishing more. For example, different negotiated wage rates for support service contractors could be a barrier, since consolidations would likely require paying the higher rate, thereby substantially or totally offsetting consolidation cost reductions. In other cases, merging certain activities could complicate existing procurements in small and disadvantaged business set-aside programs. However, the team said that many more sharing arrangements are possible and should be included in follow-on studies. In developing the follow-on process, this team recommended and then provided guidance on designating lead offices, establishing and updating metrics and milestones, and sharing information. NASA and DOD officials indicated that the work started by the integrated product teams would continue. A joint DOD-NASA report, which could be released later this month, will recommend that six alliances be established to continue the work initiated by the major facilities team, according to a NASA official. Only two of the alliances have been organized. The official also stated that four panels of the Aeronautics and Astronautics Coordinating Board are to be established to oversee the follow-on activities. However, three of the panels have been delayed due to personnel reorganizations affecting both DOD and NASA, and it is uncertain when they will be initiated, according to the NASA official. The only panel to be established to date is the Aeronautics Panel, which met in July 1996. The details of the follow-on processes for continuing the work of the integrated product teams have not yet been fully developed. One measure of the relevance and success of these processes will be how they handle an issue such as overcapacity in large rocket test facilities. In commenting on a draft of this report, NASA said that the NASA-DOD National Rocket Propulsion Test Alliance will strive for joint management of facilities so they can be brought on or offline and investments controlled for maximum benefit. NASA also said this alliance “will examine indepth the current and future projected workloads to achieve proper asset management and utilization of rocket test facilities.” NASA Faces Uncertainty in Achieving Further Workforce Reductions We recently reported that NASA does not yet have fully developed plans to reduce its personnel level by about 4,000 full-time equivalent employees to meet its overall goal of decreasing the size of its workforce to about 17,500 by fiscal year 2000. Also, it may not be able to do so without involuntarily separating employees. NASA projections show that voluntary attrition should meet the downsizing goal through fiscal year 1998, but will not provide sufficient losses by fiscal year 1999. Thus, NASA intends to start planning a reduction-in-force during fiscal year 1998, if enough NASA employees do not retire or resign voluntarily. NASA’s ability to reach its workforce reduction goal by the turn of the century is subject to major uncertainties, including the shifting of program management from headquarters to field centers and the award of a single prime contract for managing the space shuttle at Kennedy Space Center. We proposed that, in view of these uncertainties, Congress may wish to consider requiring NASA to submit a workforce restructuring plan for achieving its fiscal year 2000 personnel reduction goal. NASA estimates that civil service personnel reductions will save about $880 million from fiscal year 1996 through fiscal year 2000. Conclusions and Matters for Congressional Consideration NASA faces barriers to accomplishing additional consolidations and closures that it may not be able to overcome on its own. Closing facilities, relocating activities, and consolidating operations in fewer locations with fewer employees is not easy because of concerns about the effects of such actions on missions, personnel, and local communities. NASA and DOD officials have suggested that a process similar to the one used by the Defense Base Closure and Realignment Commission may ultimately be needed to adequately deal with the political sensitivity and cost issues that inevitably accompany consolidation and closure decisions. Given NASA’s limited progress to date, further opportunities to reduce infrastructure, and the agency’s lack of control over some barriers to further reductions, Congress may wish to adopt the idea of having such a process if NASA’s efforts fail to show significant progress in the near future in consolidating and closing facilities. To help determine the need for an independent process to facilitate closures and consolidations of NASA facilities, Congress may wish to consider requiring NASA to submit a plan outlining how it intends to meet its goals for a reduced infrastructure through fiscal year 2000. Such a plan should include estimated cost reductions resulting from specific facility closures and consolidations. Agency Comments In commenting on a draft of this report, NASA stated that it is committed to streamlining its workforce and supporting infrastructure and is continuing to make fundamental changes in the way it operates. NASA specifically noted that it intends to meet its fiscal and programmatic challenges through efficiencies, restructuring, privatization, commercialization, out-sourcing, and performance-based contracting. NASA commented on a number of areas discussed in the report, and it provided us with some additional or updated information and suggested changes to enhance the clarity and technical accuracy of the draft. We have incorporated the agency’s suggested changes in the final report where appropriate. NASA’s comments are reprinted in their entirety in appendix III, along with our final evaluation of them. Our scope and methodology is discussed in appendix IV. Unless you publicly announce this report’s contents, we plan no further distribution until 30 days from its issue date. At that time, we will send copies to other interested congressional committees, the Administrator of NASA, and the Director of the Office of Management and Budget. We will also provide copies to others upon request. Please contact me on (202) 512-4841, if you or your staff have any questions concerning this report. Major contributors are listed in appendix V. Summary of the National Aeronautics and Space Administration Field Center Facilities Net usable square feet (thousands) Dryden Flight Research Center is located on Edwards Air Force Base, California. Studies and Actions Related to NASA Facilities Infrastructure The Advisory Committee on the Future of the U.S. Space Program (Known as the Augustine Committee) The study’s purpose was to advise the NASA Administrator on the approaches the agency’s management could use to implement the U.S. space program in the coming decades. Of the 15 recommendations made, 2 related indirectly to facilities infrastructure. The study was completed in December 1990. Roles and Missions Study At the direction of the NASA Administrator, the agency’s Deputy Administrator reviewed NASA’s roles and missions and suggested ways to implement the Augustine Committee’s recommendations. The recommendations focused on NASA field centers’ missions and project management approaches. Of the 33 recommendations, 9 were related indirectly to facilities infrastructure. The study was completed in November 1991. Response to Roles and Missions Study With some modification, the NASA Administrator approved all recommendations from the Roles and Missions Study and called for implementation plans from the center directors and headquarters program offices. The recommendations were approved in December 1991. National Performance Review This federal governmentwide review examined cabinet-level departments and 10 agencies, including NASA. One of the 19 recommendations that focused on NASA was directly related to facilities. The review was completed in September 1993. Implementation of Roles and Missions Recommendations This document was issued in January 1994 by the Associate Administrator for Space Flight in response to the Administrator’s December 1991 call for implementation plans and the current Administrator’s renewed emphasis on roles and missions. It identified a number of recommendations to implement the roles and missions recommendations and assigned follow-up responsibilities. Of 38 recommendations, 15 related to specific facilities. National Facilities Study The study was initiated in 1992 by the NASA Administrator to develop a comprehensive long-range plan to ensure that research, development, and operational facilities were world-class and to avoid duplication of facilities. The study group was composed of representatives from NASA; the Departments of Defense (DOD), Transportation, Energy, and Commerce; and the National Science Foundation. Almost 200 recommendations were made, including 68 specifically related to NASA facilities. The study was completed in April 1994. National Research Council Review of the National Facilities Study (Space Facilities) Contracted by NASA and DOD, the National Research Council reviewed the findings in the National Facilities Study to evaluate the requirements presented in the national facilities plan for space and research and development operations. The Board made 11 recommendations, 4 of which related to facilities in general. None of the recommendations related to specific facilities. The review was completed in 1994. National Research Council Review of the National Facilities Study (Aeronautical Facilities) The Aeronautics and Space Engineering Board conducted this review at NASA’s request. The study’s purpose was to independently examine projected requirements for, and approaches to, the provision of needed aeronautical ground test facilities. The Board made 13 recommendations; 2 related to specific NASA facilities. The review was completed in 1994. Federal Laboratory Review Conducted under the auspices of the NASA Advisory Council, this study was tasked to evaluate and develop recommendations for improving the efficiency and effectiveness of the federal research and development investment in the NASA laboratory system. The review was also to consider possibilities for restructuring, consolidating, closing, or reassigning facilities. The Laboratory Review made 74 recommendations and 3 suggestions related to specific facilities. The review was completed in February 1995. NASA White Paper The White Paper, formally titled A Budget Reduction Strategy, was intended as a starting point for discussions on a proposed realignment of center roles and missions and reinvention in a constrained budget environment. The paper made about 40 recommendations total; 15 were related to facilities. The paper was issued February 1995. Zero Base Review This review was a NASA-wide effort to allocate reductions in the fiscal year 1996 President’s budget, set center role assignments, provide suitable guidance for the fiscal year 1997 budget, and change the way NASA conducted business. About 50 recommendations were made, of which 2 applied to specific facilities. The review was completed in June 1995. NASA-DOD Integrated Product Teams NASA teamed with DOD to study how the two agencies could significantly reduce their investment and operations costs and increase mission effectiveness and efficiency through increased cooperation at all organizational levels. Study teams, referred to as integrated product teams, began work in September 1995 in seven areas. Each team addressed facilities, as appropriate, in its assigned functional area. Teams reported their recommendation to the Aeronautics and Astronautics Coordinating Board in April 1996. Additional information on this effort is presented in the body of this report. Comments From the National Aeronautics and Space Administration The following are GAO’s comments on NASA’s letter dated September 6, 1996. GAO Comments 1. The language of the report was modified where appropriate. 2. NASA provided information on activities and initiatives that occurred after the issuance of our report on Telecommunications Network: NASA Could Better Manage Its Planned Consolidation (GAO/AIMD-96-33, Apr. 9, 1996). 3. Our description of the current situation at Downey is in the context of a potential, not a known, cost-sharing issue. 4. NASA provided information on two rocket propulsion test facilities and stated that they are not comparable. However, we made no comparison of these facilities. We merely pointed out that, while the issue of potential excess in large rocket engine test capacity remains unresolved, efforts are underway or planned to upgrade such facilities. As noted in the report, such independent actions potentially worsen the problem. The overcapacity issue could benefit from a thorough, governmentwide assessment. 5. The report discusses the possible future need for a process similar to the one used by the Defense Base Closure and Realignment Commission. Such a process could be applied to individual facilities, groups of facilities, or entire agencies. There is no reason to believe that the process would be appropriate only for DOD or for numerous locations. Scope and Methodology We reviewed the value of NASA’s facilities and its budgets and staffing; facility reduction plans; real property reports; utilization data and reports; studies, including the National Facilities Study and the NASA Federal Laboratory Review; environmental law, policies, and procedures; and reports by the NASA Inspector General. We interviewed officials at NASA field centers and in the Offices of Management Systems and Facilities, Headquarters Operations, Space Flight, Space Communications, Human Resources and Education, Environmental Management Division, and Inspector General at NASA headquarters. To discuss NASA-DOD coordination efforts, we interviewed NASA and DOD officials. We also spoke with officials from Rockwell International, Space Systems Division, about plans for the NASA Industrial Plant, Downey, California. We obtained information from all NASA field centers, including information on the value and utilization of facilities, plans for closing facilities and estimated savings through fiscal year 2000, facilities project budgets, and cleanup and cost-sharing activities. We also spoke with officials from other federal agencies, including the General Services Administration and the Environmental Protection Agency. We obtained electronic versions of NASA’s real property and major facility inventory databases and NASA’s potentially contaminated site inventory database, but did not independently verify the reliability of the data in the databases. Because the National Facilities Study included aircraft in its work, we included them in our review. We conducted our audit work at NASA headquarters, Washington, D.C.; Ames Research Center, Moffett Field, California; Goddard Space Flight Center, Greenbelt, Maryland; Wallops Flight Facility, Wallops Island, Virginia; Jet Propulsion Laboratory, Pasadena, California; Lyndon B. Johnson Space Center, Houston, Texas; NASA Industrial Plant, Downey, California; White Sands Test Facility, Las Cruces, New Mexico; John F. Kennedy Space Center, Florida; Langley Research Center, Hampton, Virginia; Lewis Research Center, Cleveland, Ohio; Plum Brook Station, Sandusky, Ohio; George C. Marshall Space Flight Center, Huntsville, Alabama; Michoud Assembly Facility, New Orleans, Louisiana; Santa Susana Field Laboratory, California; John C. Stennis Space Center, Mississippi; Phillips Laboratory, Edwards Air Force Base, California; and Vandenberg Air Force Base, California. We conducted our work from June 1995 through August 1996 in accordance with generally accepted government auditing standards. Major Contributors to This Report National Security and International Affairs Division, Washington, D.C. Uldis Adamsons Frank Degnan Raymond H. Denmark, Jr. Sandra D. Gove William E. Petrick, Jr. Atlanta Field Office Los Angeles Field Office Norfolk Field Office Accounting and Information Management Division, Washington, D.C. Denver Field Office Jamelyn A. Smith The first copy of each GAO report and testimony is free. Additional copies are $2 each. Orders should be sent to the following address, accompanied by a check or money order made out to the Superintendent of Documents, when necessary. VISA and MasterCard credit cards are accepted, also. Orders for 100 or more copies to be mailed to a single address are discounted 25 percent. U.S. General Accounting Office P.O. Box 6015 Gaithersburg, MD 20884-6015 Room 1100 700 4th St. NW (corner of 4th and G Sts. NW) U.S. General Accounting Office Washington, DC Orders may also be placed by calling (202) 512-6000 or by using fax number (301) 258-4066, or TDD (301) 413-0006. Each day, GAO issues a list of newly available reports and testimony. To receive facsimile copies of the daily list or any list from the past 30 days, please call (202) 512-6000 using a touchtone phone. A recorded menu will provide information on how to obtain these lists.

Summary: Pursuant to a congressional request, GAO reviewed the status of the National Aeronautics and Space Administration's (NASA) efforts to achieve reductions and efficiencies in key areas of its infrastructure. GAO found that: (1) NASA plans for a $2.8-billion reduction in the current replacement value of its facilities will yield only about $250 million in cost reductions through fiscal year (FY) 2000; (2) NASA has experienced problems in assessing cost-reduction opportunities because it did not thoroughly evaluate cost-reduction options, excluded many systems in its review of ways to cut supercomputer costs, performed questionable initial studies for aircraft consolidation, made inappropriate closure recommendations, and overstated cost-reduction estimates; (3) although environmental cleanup costs could affect facility disposition efforts, NASA lacks a policy for identifying other responsible parties and sharing cleanup costs; (4) a joint effort between NASA and the Department of Defense to study potential operation cost reductions through increased cooperation and sharing yielded no specific recommendations for closures, consolidations, or cost reductions but did identify barriers to sharing and increasing interagency reliance; and (5) NASA ability to reach its workforce reduction goal by 2000 is subject to some major uncertainties, and NASA may need to plan a reduction in force if enough employees do not retire or resign voluntarily.

gov_report

en

Summarize: Introduction and Issue Ten years after the 9/11 terrorist attacks, policymakers continue to grapple with the definition of homeland security. Prior to 9/11, the United States addressed crises through the separate prisms of national defense, law enforcement, and emergency management. 9/11 prompted a strategic process that included a debate over and the development of homeland security policy. Today, this debate and development has resulted in numerous federal entities with homeland security responsibilities. For example, there are 30 federal entities that receive annual homeland security funding excluding the Department of Homeland Security (DHS). The Office of Management and Budget (OMB) estimates that 48% of annual homeland security funding is appropriated to these federal entities, with the Department of Defense (DOD) receiving approximately 26% of total federal homeland security funding. DHS receives approximately 52%. Congress and policymakers are responsible for funding homeland security priorities. These priorities need to exist, to be clear and cogent, in order for funding to be most effective. Presently, homeland security is not funded on clearly defined priorities. In an ideal scenario, there would be a clear definition of homeland security, and a consensus about it; as well as prioritized missions, goals, and activities. Policymakers could then use a process to incorporate feedback and respond to new facts and situations as they develop. This report examines how varied, and evolving, homeland security definitions and strategic missions may affect the prioritization of national homeland security policy and how it may affect the funding of homeland security. To address this issue, this report first discusses and analyzes examples of strategic documents, their differing homeland security definitions, and their varying homeland security missions. Evolution of the Homeland Security Concept The concept of homeland security has evolved over the last decade. Homeland security as a concept was precipitated by the terrorist attacks of 9/11. However, prior to 9/11 such entities as the Gilmore Commission and the United States Commission on National Security discussed the need to evolve the way national security policy was conceptualized due to the end of the Cold War and the rise of radicalized terrorism. After 9/11, policymakers concluded that a new approach was needed to address the large-scale terrorist attacks. A presidential council and department were established, and a series of presidential directives were issued in the name of "homeland security." These developments established that homeland security was a distinct, but undefined concept. Later, the federal, state, and local government responses to disasters such as Hurricane Katrina expanded the concept of homeland security to include significant disasters, major public health emergencies, and other events that threaten the United States, its economy, the rule of law, and government operations. This later expansion of the concept of homeland security solidified it as something distinct from other federal government security operations such as homeland defense. Homeland security as a concept suggested a different approach to security, and differed from homeland defense. Homeland defense is primarily a Department of Defense (DOD) activity and is defined as "... the protection of US sovereignty, territory, domestic population, and critical defense infrastructure against external threats and aggression, or other threats as directed by the President." Homeland security, regardless of the definition or strategic document, is a combination of law enforcement, disaster, immigration, and terrorism issues. It is primarily the responsibility of civilian agencies at all levels. It is a coordination of efforts at all levels of government. The differences between homeland security and homeland defense, however, are not completely distinct. An international terrorist organization attack on and within the United States would result in a combined homeland security and homeland defense response, such as on 9/11 when civilian agencies were responding to the attacks while the U.S. military established a combat air patrol over New York and Washington, DC. This distinction between homeland security and homeland defense, and the evolution of homeland security as a concept, was reflected in the strategic documents developed and issued following 9/11. Evolution of Homeland Security Strategic Documents The evolution of this new and distinct homeland security concept has been communicated in several strategic documents. Today, strategic documents provide guidance to all involved federal entities and include the 2010 National Security Strategy and the 2011 National Strategy for Counterterrorism. There are also strategic documents that provide specific guidance to DHS entities and include the 2010 Quadrennial Homeland Security Review, the Bottom-Up Review, and the 2012 Department of Homeland Security Strategic Plan. Prior to issuance of these documents, national and DHS homeland security strategic documents included the 2002 and 2007 National Strategies for Homeland Security and the 2008 Department of Homeland Security Strategic Plan. All of these documents have varying definitions for "homeland security" and varying missions derived from these definitions. While the definitions and missions embodied in these strategic documents have commonalities, there are significant differences. Natural disasters are specifically identified as an integral part of homeland security in five of the seven documents, and only three documents—2008 and 2012 DHS Strategic Plans and the Bottom-Up Review —specifically include border and maritime security and immigration in their homeland security definitions. All of these mentioned issues are important and require significant funding. However, the lack of consensus about the inclusion of these policy areas in a definition of homeland security may have negative or unproductive consequences for national homeland security operations. A consensus definition would be useful, but not sufficient. A clear prioritization of strategic missions would help focus and direct federal entities' homeland security activities. Additionally, prioritization affects Congress's authorization, appropriation, and oversight activities. Effects on Congressional Responsibilities As deficit reduction causes demand for reduced federal spending, Congress may pay more critical attention to homeland security funding. With reduced funding comes the need for higher degrees of organization, focus, and clarity about the purpose and objectives of national homeland security policy. Limited resources heighten the importance of prioritization and need for efficient and effective federal spending. If homeland security policy priorities are unclear, Congress's ability to provide effective authorization, appropriation, and oversight may be hampered. Definitions and Missions as Part of Strategy Development Definitions and missions are part of strategy development. Policymakers develop strategy by identifying national interests, prioritizing missions to achieve those national interests, and arraying instruments of national power to achieve national interests. Strategy is not developed within a vacuum. President Barack Obama's Administration's 2010 National Security Strategy states that strategy is meant to recognize "the world as it is" and mold it into "the world we seek." Developing strategy, however, may be complicated if the key concept of homeland security is not succinctly defined, and strategic missions are not aligned and synchronized among different strategic documents and federal entities. Evolution of the Homeland Security Definitions and Missions Prior to 9/11, federal, state, and local governments responded to domestic terrorist attacks in an ad hoc manner. These terrorist attacks, and the governments' responses, however, did not significantly affect how policymakers perceived, defined, and prioritized security as related to the homeland. Two examples of these domestic terrorist attacks are the 1993 World Trade Center (WTC) and the 1995 Alfred Murrah Federal Building bombings. On February 26, 1993, radicalized Islamic terrorists detonated a bomb beneath the WTC. In response, President Clinton ordered his National Security Council to coordinate the bombings' response and investigation. The CIA's Counterterrorist Center and the National Security Agency, along with the FBI, were among the numerous federal agencies that participated in the investigation. This use of the National Security Council was an ad-hoc response specifically to this event, and it did not result in the development of strategic documents. On April 19, 1995, Timothy McVeigh exploded a bomb-laden truck in front of the Alfred P. Murrah Federal Building in Oklahoma City. Following this bombing, President Clinton directed the Department of Justice (DOJ) to assess the vulnerability of federal facilities to terrorist attacks or violence and to develop recommendations for minimum security standards. These standards, however, were not a wide-ranging strategy for U.S. homeland security strategy. It was the 9/11 terrorist attacks that initiated the debate and development of a broader homeland security strategy. The 9/11 terrorist attacks on New York City, Pennsylvania, and Washington, DC, were a watershed event. As with the 1993 WTC and 1995 Oklahoma City bombings, the federal, state, and local government's response to the 9/11 terrorists attacks was ad hoc. In New York City, first responders included such entities as the New York police and fire departments, and Port Authority and WTC employees. Following the attack, federal entities such as the FBI, DOD, and elements of the intelligence community (IC) coordinated their efforts in investigating and tracking down the responsible terrorists. However, following the 9/11 initial response and subsequent investigations, it was determined that there was a need to reorganize the government to prepare for, mitigate against, respond to, and recover from future attacks. This decision to reorganize the government resulted in an evolution of homeland security definitions and missions. The debate over and development of homeland security definitions persist as the federal government continues to issue and implement homeland security strategy. All of the strategic documents in this report define homeland security as security efforts, however, each one defines these efforts in different terms. 2002–2009 Strategic Document Evolution The first homeland security strategy document issued by the Bush Administration was the 2003 National Strategy for Homeland Security, which was revised in 2007. In 2008, DHS issued Strategic Plan— One Team, One Mission, Securing Our Homeland. The 2007 National Strategy for Homeland Security primarily focused on terrorism, whereas the 2008 Strategic Plan included references to all-hazards and border security. Arguably, the 2003 and 2007 National Strategies for Homeland Security addressed terrorism due to such incidents as the 9/11 terrorist attacks; and the attempted bombing of American Airlines Flight 63 on December 22, 2001. Whereas the 2008 Strategic Plan addressed terrorism and all-hazards due to natural disasters such Hurricane Katrina which occurred in 2005. These documents were superseded by several documents which are now considered the principle homeland security strategies. 2010–Present Document Evolution The White House and DHS are the principle source of homeland security strategies. The primary national homeland security strategic document developed by the White House is the 2010 National Security Strategy, which unlike the 2007 National Strategy for Homeland Security addresses all-hazards and is not primarily terrorism focused. DHS's strategic documents are the 2010 Quadrennial Homeland Security Review ; the 2010 Bottom-Up Review ; and the 2012 Strategic Plan. DHS states that these documents are nested in the 2010 National Security Strategy. At the national level, the 2010 National Security Strategy guides not just DHS's homeland security activities, but it also guides all federal government entity mission activities. One way to understand the breadth of these activities is to examine federal homeland security funding. Federal Homeland Security Mission Activities and Funding The strategic homeland security documents provide federal entities information on the national approach to homeland security. These documents are intended to identify federal entity responsibilities in the area of homeland security and assist federal entities in determining how to allocate federal funding for that purpose. In an effort to measure federal homeland security funding, Congress required OMB to include a homeland security funding analysis in each presidential budget. OMB requires federal departments, agencies, and entities to provide budget request amounts based on the following six 2003 National Strategy for Homeland Security mission areas: Intelligence and Warning; Border and Transportation Security; Domestic Counterterrorism; Protecting Critical Infrastructure and Key Assets; Defending against Catastrophic Threats; and Emergency Preparedness and Response. OMB, however, notes that the National Strategy for Homeland Security was revised in 2007, and that revision consolidated these six mission areas into three: (1) prevent and disrupt terrorist attacks; (2) protect the American people, critical infrastructure, and key resources; and (3) respond to and recover from incidents that do occur. The strategy also states that these original 2003 mission areas are still used to ensure "continuity and granularity." OMB does not address President Obama Administration's issuance of the 2010 National Security Strategy which supersedes the 2007 National Strategy for Homeland Security. In FY2012 appropriations and the FY2013 budget requests, 30 federal departments, agencies, and entities receive annual homeland security funding excluding DHS. OMB estimates that 48% of annual homeland security funding is appropriated to these federal entities, with DOD receiving approximately 26% of total federal homeland security funding. DHS receives approximately 52%. The following table provides FY2012 appropriations and FY2013 budget request homeland security mission amounts for all federal entities. This allocation of federal homeland security funding reveals that approximately 50% is not appropriated for DHS missions or activities. Additionally, it could mean that relying on detailed DHS strategies is insufficient and that a coordinating and encompassing national homeland security definition may be important to prioritizing homeland security activities and funding. The 2010 National Security Strategy states that homeland security is "a seamless coordination among federal, state, and local governments to prevent, protect against, and respond to threats and natural disasters." Homeland security requires coordination because numerous federal, state, and local entities have responsibility for various homeland security activities. The proliferation of responsibilities entitled "homeland security activities" is due to a couple of factors. One factor is that homeland security developed from the pre-9/11 concept of law enforcement and emergency management. Another factor is the continuously evolving definition of "homeland security." Some degree of evolution of the homeland security concept is expected. Policymakers respond to events and crises like terrorist attacks and natural disasters by using and adjusting strategies, plans, and operations. These strategies, plans, and operations also evolve to reflect changing priorities. The definition of homeland security evolves in accordance with the evolution of these strategies, plans, and operations. Definitions The following table provides examples of strategic documents and their specific homeland security definitions. Some common themes among these definitions are: the homeland security enterprise encompasses a federal, state, local, and tribal government and private sector approach that requires coordination; homeland security can involve securing against and responding to both hazard-specific and all-hazards threats; and homeland security activities do not imply total protection or complete threat reduction. Each of these documents highlights the importance of coordinating homeland security missions and activities. However, individual federal, state, local, and tribal government efforts are not identified in the documents. Homeland security—according to these documents—is preventing, responding to, and recovering from terrorist attacks, which is consistent with evolving homeland security policy after 9/11. The focus of the definition of homeland security communicated in these strategy documents differs in regard to two areas that may be considered substantive. Natural disasters are specifically identified as an integral part of homeland security in only four of the six documents, but are not mentioned in the 2007 National Strategy for Homeland Security and the 2011 National Strategy for Counterterrorism. Only one document—the Bottom-Up Review —specifically includes border and maritime security and immigration in its homeland security definition. The 2012 Strategic Plan uses the encompassing terms "other hazards" to define any threat other than terrorism. These issues are significant and call for substantial funding. An absence of consensus about the inclusion of these policy areas may result in unintended consequences for national homeland security operations. For example, not including maritime security in the homeland security definition may result in policymakers, Congress, and stakeholders not adequately addressing maritime homeland security threats, or more specifically being able to prioritize federal investments in border versus intelligence activities. The competing and varied definitions in these documents may indicate that there is no succinct homeland security concept. Without a succinct homeland security concept, policymakers and entities with homeland security responsibilities may not successfully coordinate or focus on the highest prioritized or most necessary activities. Coordination is especially essential to homeland security because of the multiple federal agencies and the state and local partners with whom they interact. Coordination may be difficult if these entities do not operate with the same understanding of the homeland security concept. For example, definitions that don't specifically include immigration or natural disaster response and recovery may result in homeland security stakeholders and federal entities not adequately resourcing and focusing on these activities. Additionally, an absence of a consensus definition may result in Congress funding a homeland security activity that DHS does not consider a priority. For example, Congress may appropriate funding for a counterterrorism program such as the State Homeland Security Grant Program when DHS may have identified an all-hazards grant program, such as Emergency Management Performance Grant Program, as a priority. It is, however, possible that a consensus definition and overall concept exists among policymakers and federal entities, but that it isn't communicated in the strategic documents. Finally, DHS Deputy Secretary Jane Lute recently stated that homeland security "... is operation, it's transactional, it's decentralized, it's bottom-driven," and influenced by law enforcement, emergency management, and the political environment. Conversely, DHS Deputy Secretary Lute stated that national security "... is strategic, it's centralized, it's top-driven," and influenced by the military and the intelligence community. Some see in these comments as a reflection of a DHS attempt to establish a homeland security definition that is more operational than strategic and an illustration of the complexity of a common understanding of homeland security and its associated missions. Missions Varied homeland security definitions, in numerous documents, result in all the homeland security stakeholders identifying and executing varied strategic missions. Homeland security stakeholders include federal departments and agencies, state and local governments, and non-profit and non-governmental organizations. The strategic documents in this report identify numerous homeland security missions such as terrorism prevention; response and recovery; critical infrastructure protection and resilience; federal, state, and local emergency management and preparedness; and border security. As noted earlier, none of these documents specifically tasks a federal entity with the overall homeland security responsibilities. The following table summarizes the varied missions in these strategic documents. These documents all identify specific missions as essential to securing the nation. All of the documents state that the nation's populace, critical infrastructure, and key resources need protection from terrorism and disasters. This protection from both terrorism and disasters is a key strategic homeland security mission. Some, but not all, of the documents include missions related to border security, immigration, the economy, and general resilience. Members of Congress and congressional committees, however, have sometimes criticized these documents. Senator Susan Collins—current ranking Member, Committee on Homeland Security and Governmental Affairs—expressed disappointment in the Quadrennial Homeland Security Review and Bottom-Up Review because it does not communicate priorities and stated that it does not compare favorably to the most recent Quadrennial Defense Review. The Quadrennial Defense Review identifies national security and U.S. military priorities and these priorities through a process "... from objectives to capabilities and activities to resources." Furthermore, the Quadrennial Homeland Security Review missions are different from the 2007 National Strategy for Homeland Security missions, and neither identifies priorities, or resources, for DHS, or other federal agencies. Since the National Strategy for Homeland Security and the Quadrennial Homeland Security Review missions are differing and varied, and because the Quadrennial Homeland Security Review does not specifically identify a strategic process to achieve the missions, one may assume that this document is solely operational guidance. Additionally, some critics found the Bottom-Up Review lacking in detail and failing to meet its intended purpose. Further congressional criticism includes an observation on the absence of a single DHS strategy. At a recent House Homeland Security Committee's Subcommittee on Oversight, Investigations and Management hearing, Chairman Michael McCaul stated that "... DHS needs a single strategic document which subordinate agencies can follow and make sure the strategy is effectively and efficiently implemented. This single document should conform to the National Security Strategy of the United States of America. If the agencies do not have a clearly established list of priorities, it will be difficult to complete assigned missions." Other criticism includes the Council on Foreign Relations' (CFR's) discussion of 2010 National Security Strategy (NSS). CFR states that the "... one thing that the NSS discussion of resilience omits, but which the Deputy National Security Adviser John Brennan has emphasized, is that despite all the homeland security precautions, there is likely to be a successful attack. When that happens, real resilience will entail a calm, deliberate response and confidence in the durability of the country's institutions." Multiple definitions and missions and an absence of prioritization result in consequences to the nation's security. Analysis and Considerations Policymakers are faced with a complex and detailed list of risks, or threats to security, for which they then attempt to plan. However, managing those risks 99% of the time with even a single failure may lead to significant human and financial costs. Homeland security is essentially about managing risks. The purpose of a strategic process is to develop missions to achieve that end. Before risk management can be accurate and adequate, policymakers must ideally coordinate and communicate. That work to some degree depends on developing a foundation of common definitions of key terms and concepts. It is also necessary, in order to coordinate and communicate, to ensure stakeholders are aware of, trained for, and prepared to meet assigned missions. At the national level, there does not appear to be an attempt to align definitions and missions among disparate federal entities. DHS is, however, attempting to align its definition and missions, but does not prioritize its missions; there is no clarity in the national strategies of federal, state, and local roles and responsibilities; and, potentially, funding is driving priorities rather than priorities driving the funding. DHS is aligning its definition and missions in the Quadrennial Homeland Security Review, the Bottom-Up Review, and the 2012 Strategic Plan ; however, DHS does not prioritize the missions. DHS prioritizes specific goals, objectives, activities, and specific initiatives within the missions, and prioritizes initiatives across the missions. There is still no single national homeland security definition, nor is there a prioritization of national homeland security or DHS missions. There is no evidence in the existing homeland security strategic documents that supports the aligning and prioritization of the varied missions, nor do any of the documents convey how national, state, or local resources are to be allocated to achieve these missions. Without prioritized resource allocation to align missions, proponents of prioritization of the nation's homeland security activities and operations maintain that plans and responses may be haphazard and inconsistent. Another potential consequence of the absence of clear missions is that available funding then tends to govern the priorities. Congress may decide to address the issues associated with homeland security strategy, definitions, and missions, in light of the potential for significant events to occur similar to the 9/11 terrorist attacks and Hurricane Katrina. Many observers assert that these outstanding policy issues result from the varied definitions and missions identified in numerous national strategic documents. Additionally, they note that these documents do not consistently address risk mitigation associated with the full range of homeland security threats. From this perspective one piece missing from these documents, and their guidance, is a discussion of the resources and fiscal costs associated with preparing for low risk, but high consequence threats. Specifically, Congress may choose to consider a number of options addressing the apparent lack of a consensus homeland security definition that prioritizes missions by requiring the development of a more succinct, and distinct, national homeland security strategy. One of these options might be a total rewrite of a national homeland security strategy. This option would be similar to the Bush Administration's issuance of national homeland security strategies in 2002 and 2007. Such a strategy could include a definitive listing of mission priorities based on an encompassing definition that not only includes DHS specific responsibilities, but all federal department and agency responsibilities. A strategy that includes priorities could improve Congress's and other policymakers' ability to make choices between competing homeland security missions. This option would also be a departure from the current Administration's practice of including national homeland security guidance in the National Security Strategy. Another option would be to build upon the current approach by requiring the Administration to develop the National Security Strategy that succinctly identifies homeland security missions and priorities. Alternatively, Congress may determine that the present course of including national homeland security guidance in the National Security Strategy is adequate, and may focus strictly on DHS activities. This option would entail DHS further refining its Quadrennial Homeland Security Review which it has begun to do with its 2012 Strategic Plan. It has been argued that homeland security, at its core, is about coordination because of the disparate stakeholders and risks. Many observers assert that homeland security is not only about coordination of resources and actions to counter risks; it is also about the coordination of the strategic process policymakers use in determining the risks, the stakeholders and their missions, and the prioritization of those missions. Without a general consensus on the physical and philosophical definition and missions of homeland security, achieved through a strategic process, some believe that there will continue to be the potential for disjointed and disparate approaches to securing the nation. From this perspective general consensus on the homeland security concept necessarily starts with a consensus definition and an accepted list of prioritized missions that are constantly reevaluated to meet risks of the new paradigm that is homeland security in the 21 st century. These varied definitions and missions, however, may be the result of a strategic process that has attempted to adjust federal homeland security policy to emerging threats and risks.

Summary: Ten years after the September 11, 2001, terrorist attacks, the U.S. government does not have a single definition for "homeland security." Currently, different strategic documents and mission statements offer varying missions that are derived from different homeland security definitions. Historically, the strategic documents framing national homeland security policy have included national strategies produced by the White House and documents developed by the Department of Homeland Security (DHS). Prior to the 2010 National Security Strategy, the 2002 and 2007 National Strategies for Homeland Security were the guiding documents produced by the White House. In 2011, the White House issued the National Strategy for Counterterrorism. In conjunction with these White House strategies, DHS has developed a series of evolving strategic documents that are based on the two national homeland security strategies and include the 2008 Strategic Plan-One Team, One Mission, Securing the Homeland; the 2010 Quadrennial Homeland Security Review and Bottom-Up Review; and the 2012 Department of Homeland Security Strategic Plan. The 2012 DHS strategic plan is the latest evolution in DHS's process of defining its mission, goals, and responsibilities. This plan, however, only addresses the department's homeland security purview and is not a document that addresses homeland security missions and responsibilities that are shared across the federal government. Currently, the Department of Homeland Security is developing the 2014 Quadrennial Homeland Security Review, which is due late 2013 or early 2014. Varied homeland security definitions and missions may impede the development of a coherent national homeland security strategy, and may hamper the effectiveness of congressional oversight. Definitions and missions are part of strategy development. Policymakers develop strategy by identifying national interests, prioritizing goals to achieve those national interests, and arraying instruments of national power to achieve the national interests. Developing an effective homeland security strategy, however, may be complicated if the key concept of homeland security is not defined and its missions are not aligned and synchronized among different federal entities with homeland security responsibilities. This report discusses the evolution of national and DHS-specific homeland security strategic documents and their homeland security definitions and missions, and analyzes the policy question of how varied homeland security definitions and missions may affect the development of national homeland security strategy. This report, however, does not examine DHS implementation of strategy.

gov_report

en

Summarize: Scaena Tertia. Enter with Drum and Colours, Bullingbrooke, Yorke, Northumberland, Attendants. Bull. So that by this intelligence we learne The Welchmen are dispers'd, and Salisbury Is gone to meet the King, who lately landed With some few priuate friends, vpon this Coast North. The newes is very faire and good, my Lord, Richard, not farre from hence, hath hid his head York. It would beseeme the Lord Northumberland, To say King Richard: alack the heauie day, When such a sacred King should hide his head North. Your Grace mistakes: onely to be briefe, Left I his Title out York. The time hath beene, Would you haue beene so briefe with him, he would Haue beene so briefe with you, to shorten you, For taking so the Head, your whole heads length Bull. Mistake not (Vnckle) farther then you should York. Take not (good Cousin) farther then you should. Least you mistake the Heauens are ore your head Bull. I know it (Vnckle) and oppose not my selfe Against their will. But who comes here? Enter Percie. Welcome Harry: what, will not this Castle yeeld? Per. The Castle royally is mann'd, my Lord, Against thy entrance Bull. Royally? Why, it containes no King? Per. Yes (my good Lord) It doth containe a King: King Richard lyes Within the limits of yond Lime and Stone, And with him, the Lord Aumerle, Lord Salisbury, Sir Stephen Scroope, besides a Clergie man Of holy reuerence; who, I cannot learne North. Oh, belike it is the Bishop of Carlile Bull. Noble Lord, Goe to the rude Ribs of that ancient Castle, Through Brazen Trumpet send the breath of Parle Into his ruin'd Eares, and thus deliuer: Henry Bullingbrooke vpon his knees doth kisse King Richards hand, and sends allegeance And true faith of heart to his Royall Person: hither come Euen at his feet, to lay my Armes and Power, Prouided, that my Banishment repeal'd, And Lands restor'd againe, be freely graunted: If not, Ile vse th 'aduantage of my Power, And lay the Summers dust with showers of blood, Rayn'd from the wounds of slaughter'd Englishmen; The which, how farre off from the mind of Bullingbrooke It is, such Crimson Tempest should bedrench The fresh greene Lap of faire King Richards Land, My stooping dutie tenderly shall shew. Goe signifie as much, while here we march Vpon the Grassie Carpet of this Plaine: Let's march without the noyse of threatning Drum, That from this Castles tatter'd Battlements Our faire Appointments may be well perus'd. Me thinkes King Richard and my selfe should meet With no lesse terror then the Elements Of Fire and Water, when their thundring smoake At meeting teares the cloudie Cheekes of Heauen: Be he the fire, Ile be the yeelding Water; The Rage be his, while on the Earth I raine My Waters on the Earth, and not on him. March on, and marke King Richard how he lookes. Parle without, and answere within: then a Flourish. Enter on the Walls, Richard, Carlile, Aumerle, Scroop, Salisbury. See, see, King Richard doth himselfe appeare As doth the blushing discontented Sunne, From out the fierie Portall of the East, When he perceiues the enuious Clouds are bent To dimme his glory, and to staine the tract Of his bright passage to the Occident York. Yet lookes he like a King: behold his Eye (As bright as is the Eagles) lightens forth Controlling Maiestie: alack, alack, for woe, That any harme should staine so faire a shew Rich. Wee are amaz'd, and thus long haue we stood To watch the fearefull bending of thy knee, Because we thought our selfe thy lawfull King: And if we be, how dare thy ioynts forget To pay their awfull dutie to our presence? If we be not, shew vs the Hand of God, That hath dismiss'd vs from our Stewardship, For well wee know, no Hand of Blood and Bone Can gripe the sacred Handle of our Scepter, Vnlesse he doe prophane, steale, or vsurpe. And though you thinke, that all, as you haue done, Haue torne their Soules, by turning them from vs, And we are barren, and bereft of Friends: Yet know, my Master, God Omnipotent, Is mustring in his Clouds, on our behalfe, Armies of Pestilence, and they shall strike Your Children yet vnborne, and vnbegot, That lift your Vassall Hands against my Head, And threat the Glory of my precious Crowne. Tell Bullingbrooke, for yond me thinkes he is, That euery stride he makes vpon my Land, Is dangerous Treason: He is come to ope The purple Testament of bleeding Warre; But ere the Crowne he lookes for, liue in peace, Ten thousand bloody crownes of Mothers Sonnes Shall ill become the flower of Englands face, Change the complexion of her Maid-pale Peace To Scarlet Indignation, and bedew Her Pastors Grasse with faithfull English Blood North. The King of Heauen forbid our Lord the King Should so with ciuill and vnciuill Armes Be rush'd vpon: Thy thrice-noble Cousin, Harry Bullingbrooke, doth humbly kisse thy hand, And by the Honorable Tombe he sweares, That stands vpon your Royall Grandsires Bones, And by the Royalties of both your Bloods, (Currents that spring from one most gracious Head) And by the buried Hand of Warlike Gaunt, And by the Worth and Honor of himselfe, Comprising all that may be sworne, or said, His comming hither hath no further scope, Then for his Lineall Royalties, and to begge Infranchisement immediate on his knees: Which on thy Royall partie graunted once, His glittering Armes he will commend to Rust, His barbed Steedes to Stables, and his heart To faithfull seruice of your Maiestie: This sweares he, as he is a Prince, is iust, And as I am a Gentleman, I credit him Rich. Northumberland, say thus: The King returnes, His Noble Cousin is right welcome hither, And all the number of his faire demands Shall be accomplish'd without contradiction: With all the gracious vtterance thou hast, Speake to his gentle hearing kind commends. We doe debase our selfe (Cousin) doe we not, To looke so poorely, and to speake so faire? Shall we call back Northumberland, and send Defiance to the Traytor, and so die? Aum. No, good my Lord, let's fight with gentle words, Till time lend friends, and friends their helpeful Swords Rich. Oh God, oh God, that ere this tongue of mine, That layd the Sentence of dread Banishment On yond prowd man, should take it off againe With words of sooth: Oh that I were as great As is my Griefe, or lesser then my Name, Or that I could forget what I haue beene, Or not remember what I must be now: Swell'st thou prowd heart? Ile giue thee scope to beat, Since Foes haue scope to beat both thee and me Aum. Northumberland comes backe from Bullingbrooke Rich. What must the King doe now? must he submit? The King shall doe it: Must he be depos'd? The King shall be contented: Must he loose The Name of King? o' Gods Name let it goe. Ile giue my Iewels for a sett of Beades, My gorgeous Pallace, for a Hermitage, My gay Apparrell, for an Almes-mans Gowne, My figur'd Goblets, for a Dish of Wood, My Scepter, for a Palmers walking Staffe, My Subiects, for a payre of carued Saints, And my large Kingdome, for a little Graue, A little little Graue, an obscure Graue. Or Ile be buryed in the Kings high-way, Some way of common Trade, where Subiects feet May howrely trample on their Soueraignes Head: For on my heart they tread now, whilest I liue; And buryed once, why not vpon my Head? Aumerle, thou weep'st (my tender-hearted Cousin) Wee'le make foule Weather with despised Teares: Our sighes, and they, shall lodge the Summer Corne, And make a Dearth in this reuolting Land. Or shall we play the Wantons with our Woes, And make some prettie Match, with shedding Teares? As thus: to drop them still vpon one place, Till they haue fretted vs a payre of Graues, Within the Earth: and therein lay'd, there lyes Two Kinsmen, digg'd their Graues with weeping Eyes? Would not this ill, doe well? Well, well, I see I talke but idly, and you mock at mee. Most mightie Prince, my Lord Northumberland, What sayes King Bullingbrooke? Will his Maiestie Giue Richard leaue to liue, till Richard die? You make a Legge, and Bullingbrooke sayes I North. My Lord, in the base Court he doth attend To speake with you, may it please you to come downe Rich. Downe, downe I come, like glist'ring Phaeton, Wanting the manage of vnruly Iades. In the base Court? base Court, where Kings grow base, To come at Traytors Calls, and doe them Grace. In the base Court come down: down Court, down King, For night-Owls shrike, where mou[n]ting Larks should sing Bull. What sayes his Maiestie? North. Sorrow, and griefe of heart Makes him speake fondly, like a frantick man: Yet he is come Bull. Stand all apart, And shew faire dutie to his Maiestie. My gracious Lord Rich. Faire Cousin, You debase your Princely Knee, To make the base Earth prowd with kissing it. Me rather had, my Heart might feele your Loue, Then my vnpleas'd Eye see your Courtesie. Vp Cousin, vp, your Heart is vp, I know, Thus high at least, although your Knee be low Bull. My gracious Lord, I come but for mine owne Rich. Your owne is yours, and I am yours, and all Bull. So farre be mine, my most redoubted Lord, As my true seruice shall deserue your loue Rich. Well you deseru'd: They well deserue to haue, That know the strong'st, and surest way to get. Vnckle giue me your Hand: nay, drie your Eyes, Teares shew their Loue, but want their Remedies. Cousin, I am too young to be your Father, Though you are old enough to be my Heire. What you will haue, Ile giue, and willing to, For doe we must, what force will haue vs doe. Set on towards London: Cousin, is it so? Bull. Yea, my good Lord Rich. Then I must not say, no. Flourish. Exeunt.

Summary: Bolingbroke arrives at Flint Castle and fortuitously discovers that Richard is hiding there with his followers. He sends Northumberland to the castle to ask Richard if he, Bolingbroke, may kneel before the royal throne, provided Richard revokes the banishment and restores his lands. Bolingbroke then marches directly up to the castle walls. Richard appears on the top of the walls, and Bolingbroke says, "See, see, King Richard doth himself appear, / As doth the blushing discontented sun. When he perceives the envious clouds are bent / To dim his glory and to stain the track". Northumberland informs Richard that Bolingbroke is there to reclaim his inheritance, and will only kneel before the king when his lands have been restored. Richard agrees to this arrangement, but turns to Aumerle and asks whether it would have been better to fight. Aumerle says, "No, good my lord, let's fight with gentle words". Northumberland goes away and speaks with Bolingbroke, and returns to inform Richard that Bolingbroke will meet with him in the courtyard. Richard comes down from the walls and makes his kneeling cousin get off the ground, saying, "Up, cousin, up", a sign that Bolingbroke is rising above Richard. Richard offers to step aside from the throne, and Bolingbroke gets ready to march to London.

booksum

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Jobs in America Act''. SEC. 2. STARTUP VISAS. (a) In General.--Section 203(b) of the Immigration and Nationality Act (8 U.S.C. 203(b)) is amended-- (1) by redesignating paragraph (6) as paragraph (7); and (2) by inserting after paragraph (5) the following: ``(6) Sponsored entrepreneurs.-- ``(A) In general.--StartUp visas shall be made available, from the number of visas allocated under paragraph (5), to qualified immigrant entrepreneurs-- ``(i)(I) who have proven that a qualified venture capitalist or a qualified super angel investor, as determined by the Secretary of Homeland Security, has invested not less than $100,000 on behalf of each such entrepreneur; and ``(II) whose commercial activities will, during the 2-year period beginning on the date on which the visa is issued under this subparagraph-- ``(aa) create not fewer than 5 new full-time jobs in the United States employing people other than the immigrant's spouse, sons, or daughters; ``(bb) raise not less than $500,000 in capital investment in furtherance of a commercial entity based in the United States; or ``(cc) generate not less than $500,000 in revenue; ``(ii)(I) who-- ``(aa) hold an unexpired H1-B visa; or ``(bb) have completed a graduate level degree in science, technology, engineering, math, computer science, or other relevant academic discipline from an accredited United States college, university, or other institution of higher education; ``(II) who demonstrate-- ``(aa) annual income of not less than 250 percent of the Federal poverty level; or ``(bb) the possession of assets equivalent to not less than 2 years of income at 250 percent of the Federal poverty level; and ``(III) who have proven that a qualified venture capitalist or a qualified super angel investor, as determined by the Secretary of Homeland Security, has invested not less than $20,000 on behalf of each such entrepreneur; or ``(iii) who have a controlling interest in a foreign company-- ``(I) that has generated, during the most recent 12-month period, not less than $100,000 in revenue from sales in the United States; and ``(II) whose commercial activities, during the 2-year period beginning on the date on which the visa is issued under this subparagraph, will-- ``(aa) create not fewer than 3 new full-time jobs in the United States that employ people other than the immigrant's spouse, sons, or daughters; ``(bb) raise not less than $100,000 in capital investment in furtherance of a commercial entity based in the United States; or ``(cc) generate not less than $100,000 in revenue. ``(B) Revocation.--If the Secretary of Homeland Security determines that the commercial activities of an alien who received a StartUp visa pursuant to subparagraph (A)(i)(II) fail to meet the requirements under such subparagraph, the Secretary shall, not later than 1 year after the end of the applicable 2-year period described in such subparagraph-- ``(i) revoke such visa; and ``(ii) notify the alien that he or she-- ``(I) may voluntarily depart from the United States in accordance to section 240B; or ``(II) will be subject to removal proceedings under section 240 if the alien does not depart from the United States not later than 6 months after receiving such notification. ``(C) Definitions.--In this paragraph: ``(i) Qualified super angel investor.--The term `qualified super angel investor' means an individual who-- ``(I) is an accredited investor (as defined in section 230.501(a) of title 17, Code of Federal Regulations); ``(II) is a United States citizen; and ``(III) has made at least 2 equity investments of not less than $50,000 in each of the previous 3 years. ``(ii) Qualified venture capitalist.--The term `qualified venture capitalist' means an entity that-- ``(I) is classified as a `venture capital operating company' under section 2510.3-101(d) of title 29, Code of Federal Regulations; ``(II) is based in the United States; ``(III) is comprised of partners, the majority of whom are United States citizens; ``(IV) has capital commitments of not less than $10,000,000; ``(V) has been operating for at least 2 years; and ``(VI) has made at least 2 investments of not less than $500,000 during each of the most recent 2 years.''. (b) Conditional Permanent Resident Status.--Section 216A of the Immigration and Nationality Act (8 U.S.C. 1186b) is amended-- (1) by striking ``Attorney General'' each place such term appears and inserting ``Secretary of Homeland Security''; (2) in subsection (a)-- (A) in paragraph (1)-- (i) by striking ``(as defined in subsection (f)(1))'' and inserting ``, sponsored entrepreneur''; and (ii) by striking ``(as defined in subsection (f)(2)) shall'' and inserting ``shall each''; and (B) in paragraph (2)(A), by inserting ``sponsored entrepreneur,'' after ``alien entrepreneur,''; (3) in subsection (b), by adding at the end the following: ``(3) Sponsored entrepreneurs.--The Secretary of Homeland Security shall terminate the permanent resident status of a sponsored entrepreneur and the alien spouse and children of such entrepreneur if the Secretary determines, not later than 3 years after the date on which such permanent resident status was conferred, that-- ``(A) the qualified venture capitalist or qualified super angel investor who sponsored the entrepreneur failed to meet the investment requirements under section 203(b)(6)(A)(i); or ``(B) the entrepreneur failed to meet the job creation, capital investment, or revenue generation requirements under section 203(b)(6)(A)(ii).''; (4) in subsection (c)-- (A) in paragraph (1)-- (i) in the matter preceding subparagraph (A), by inserting ``sponsored entrepreneur,'' after ``alien entrepreneur,''; and (ii) by striking ``alien entrepreneur must'' each place such term appears and inserting ``entrepreneur shall''; and (B) in paragraph (3)-- (i) in subparagraph (A)(ii), by inserting ``or sponsored entrepreneur'' after ``alien entrepreneur''; and (ii) in subparagraph (C), by inserting ``sponsored entrepreneur,'' after ``alien entrepreneur''; (5) in subsection (d)(1)-- (A) in the matter preceding subparagraph (A), by striking ``alien'' and inserting ``alien entrepreneur or sponsored entrepreneur, as applicable''; (B) in clause (i), by striking ``invested, or is actively in the process of investing,'' and inserting ``has invested, is actively in the process of investing, or has been sponsored by a qualified super angel investor or qualified venture capitalist who has invested,''; and (C) in clause (ii), by inserting ``or 203(b)(6), as applicable'' before the period at the end; and (6) in subsection (f), by adding at the end the following: ``(4) The term `sponsored entrepreneur' means an alien who obtains the status of an alien lawfully admitted for permanent residence under section 203(b)(6).''. SEC. 3. GOVERNMENT ACCOUNTABILITY OFFICE STUDY. (a) In General.--Not later than 2 years after the date of the enactment of this Act, the Comptroller General of the United States shall submit a report to Congress on the StartUp Visa Program, authorized under section 203(b)(6) of the Immigration and Nationality Act, as added by section 2. (b) Contents.--The report described in subsection (a) shall include information regarding-- (1) the number of immigrant entrepreneurs who have received a visa under the immigrant entrepreneurs program established under section 203(b)(6) of the Immigration and Nationality Act, listed by country of origin; (2) the localities in which such immigrant entrepreneurs have initially settled; (3) whether such immigrant entrepreneurs generally remain in the localities in which they initially settle; (4) the types of commercial enterprises that such immigrant entrepreneurs have established; and (5) the types and number of jobs created by such immigrant entrepreneurs.

Title: Jobs in America Act Summary: Jobs in America Act This bill amends the Immigration and Nationality Act to establish an employment-based, conditional immigrant visa (StartUp visa) for a sponsored alien entrepreneur: (1) with required amounts of financial backing from a qualifying investor or venture capitalist; and (2) whose commercial activities will generate required levels of employment, revenue, or capital investment. The Department of Homeland Security shall terminate the status of a sponsored entrepreneur (and the alien spouse and children of such entrepreneur) if not later than three years after the date on which such permanent resident status was conferred: (1) the sponsoring venture capitalist or investor fails to meet investment requirements; or (2) the entrepreneur fails to meet job creation, capital investment, or revenue requirements.

billsum

en

Summarize: Just after 8:30 last night, Miami Beach Police rushed to Española Way to find a woman who was eight months pregnant in distress. The woman told police she was having severe abdominal pain and contractions after another woman had beaten her in the stomach. Police quickly found her attacker: 26-year-old Ambar Pacheco, who works as a police officer in North Miami Beach. Pacheco didn't deny the brutal attack on a "visibly pregnant" woman, MBPD officers say in an arrest report. Pacheco told Miami Beach cops that the victim's boyfriend "kicked her sister in the face." And then Pacheco said, "I saw red and beat the shit out of her." MIAMI BEACH, Fla. - A North Miami Beach police officer was arrested Wednesday in Miami Beach after she kicked a pregnant woman in her stomach, police said. Ambar Pacheco, 26, faces one felony count of aggravated battery of a pregnant victim. According to a Miami Beach police arrest affidavit, Pacheco claimed that the victim's boyfriend kicked her sister in the face, so she saw the 27-year-old woman and "beat the s--- out of her." The victim was eight months pregnant. According to the affidavit, Pacheco later said she "doesn't know who, but she kicked somebody." Miami Beach police Officer Ernesto Rodriguez said the victim was taken to Mount Sinai Medical Center, where she gave birth to a healthy baby a short time later. North Miami Beach police said Pacheco has been relieved of duty pending the outcome of an internal affairs investigation. Copyright 2018 by WPLG Local10.com - All rights reserved. A rookie North Miami Beach Police officer has been relieved from duty and charged with aggravated battery after she allegedly kicked a woman 8 months pregnant in the stomach during an altercation on Miami Beach on Wednesday night, authorities said. After she was kicked, the victim, identified by ABC Miami affiliate WPLG as 27-year-old Evoni Murray, was in "severe pain" and began having contractions, according to an arrest report from the Miami Beach Police Department. She was then transferred to Mount Sinai Medical Center, where she gave birth shortly after arriving, the report states. The baby's due date had been set for Aug. 4, and Murray was described as "visibly pregnant," according to the police report. Officer Ambar Pacheco, 26, told police she retaliated after Murray's boyfriend allegedly kicked her sister in the face. "I saw red and beat the s--- out of her," Pacheco said, according to the arrest report. North Miami Beach Police Department Pacheco later told police that she "doesn't know who," but she kicked "somebody," the report states. Murray had been meeting up with her boyfriend on in Miami Beach on Washington Avenue and Espanola Way around 8:30 p.m. after he had just gotten out of work at a burger restaurant down the block, WPLG reported. In an interview with CBS Miami affiliate WFOR, Murray denied that her boyfriend, 40-year-old Joseph Predelus Jr., kicked Pacecho's sister. "Why would he kick a female for if she wasn't doing anything?" Murray said. "He was just trying to restrain the young ladies from doing anything to me or his child." Murray believes Pacheco and her sister thought she and Predelus were "talking about them," describing the women as "belligerent" and "loud." "They basically tried to jump me because they thought I said something," Murray told WFOR. WABC Predelus also told WFOR that the altercation was unprovoked. "We didn't have no problems with you," he said. After the alleged attack, the parents got to the hospital in the "nick of time," Predelus told WFOR. A healthy baby boy named Joseph Predelus III was born, Murray said. Jeffrey Greenberg/UIG via Getty Images Pacheco, who has been with the department for less than a year, was relieved of duty as of Thursday pending an internal affairs review and a decision from the state attorney's office on whether to file charges, Major Richard Rand, public information officer for the North Miami Beach Police Department, told ABC News. She will not be paid during that time, Rand said. The department will review in Pacheco's personnel records whether she disclosed that she had been arrested at 18 years old for petty theft and whether that charge had been cleared by the department when she was hired, WPLG reported. The petty theft charge was dismissed after Pacheco attended a pre-trial diversion program, according to WPLG. Murray said it "troubles" her that someone who's "supposed to be protecting and serving" was the person who hurt her. "No matter who you are, what occupation you have, battery, fighting, putting your hands on someone else should not be allowed," she told WFOR. ABC News could not immediately reach Pacheco for comment. It is unclear if she has retained an attorney. Follow CBSMIAMI.COM: Facebook Twitter MIAMI BEACH (CBSMiami) — A woman who says she was forced to give birth prematurely to her son after she was struck by a North Miami Beach police officer says she hopes that cop “gets the help that she needs.” In an exclusive interview with CBS4’S Peter D’Oench as she recovers at Mt. Sinai Hospital, the victim—-Evoni Murray—-said her son Joseph Predelus III was doing well. “I’m just happy he is a healthy baby,” she said. Murray, who is from N.W. Miami-Dade, said she was not expecting him until August 4th but her encounter with the officer—26-year-old Ambar Pacheco—-changed that. Pacheco is charged with aggravated battery on a pregnant woman and has been relieved of duty pending an internal affairs investigation. Murray said that she and her boyfriend Joseph Predelus Jr. were walking down Washington Avenue at Espanola Way just after 8:30 p.m. when they encountered Pacheco and her sister Mikaela. “We were walking down the sidewalk enjoying the night and we saw them,” she said. “These girls were crying. Then they thought we were talking about them which was not true. They got belligerent and tried to jump because they thought I said something. If it weren’t for Joseph it could have been a lot more serious.” According to a police report, Murray was struck in the stomach area. Pacheco claimed that Predelus Jr. kicked her sister in the face, which Murray denies. The 5’3”, 125-pound Pacheco reportedly said, “I saw red and beat the s… out of her.” Pacheco said she remembered kicking somebody but she did not know who that was. On the scene, police observed Murray to be in severe pain in the stomach area and was possibly having contractions. Miami Beach Fire Rescue transported her to Mt. Sinai Hospital where shortly after that she gave birth to her son. “I am pretty overwhelmed that the incident had to happen you know. We forgive but we never forget but we do forgive. I just hope that she gets her life together and gets the help that she needs,” said Murray. Murray said, “It kind of troubles me to know that the people who are supposed to be serving and protecting us are hurting us. I know it not all of them and one apple doesn’t spoil the bunch. It’s just that sometimes you get a bad seed.” “There is no way that my boyfriend kicked the officer’s sister in the face if she was not doing anything,” she said. “In fact, my boyfriend was trying to restrain the younger lady from doing anything to me or his child.” “I am pretty sure that the officer’s intentions were not to escalate it too far but a reprimand is necessary to show that no matter who you are, no matter what occupation you have, fighting and putting your hand on someone else should not be allowed,” said Murray D’Oench reached out to Pacheco’s family but there was no response. Aggravated battery on a pregnant woman is a 2nd-degree felony. The maximum sentence is 15 years in prison, 15 years probation and a $10,000 fine. The minimum sentence is 21 months unless there are reasons for a downward departure or a shorter sentence.

Summary: A North Miami Beach Police officer has been relieved from duty and faces criminal charges after she allegedly kicked a pregnant woman in the stomach, causing her to go into early labor. Per ABC News, Officer Ambar Pacheco has been charged with aggravated battery following the Wednesday fight with 27-year-old Evoni Murray. According to a police arrest affidavit obtained by WPLG, Pacheco told officers the victim's boyfriend kicked Pacheco's sister in the face, after which she "saw red and beat the s--- out of her," Pacheco said. Pacheco would reportedly later tell cops she knew she kicked someone, but didn't know precisely who. According to the Miami New Times, Pacheco has been a uniformed patrol officer for one year. Following the alleged assault, Murray reportedly felt "severe pain" and then began to have contractions. She was taken to Mount Sinai Medical Center, where she soon gave birth to a healthy baby, according to the police report. In interview with WFOR, Murray denied that her boyfriend kicked Pacheco's sister. "He was just trying to restrain the young ladies from doing anything to me or his child," she said.

multi_news

en

Write a title and summarize: Sekte (von lateinisch secta,Partei',,Lehre',,Schulrichtung') ist eine Bezeichnung für eine religiöse, philosophische oder politische Richtung und ihre Anhängerschaft. Die Bezeichnung bezieht sich auf soziale Gruppierungen, die sich durch ihre Lehre oder ihren Ritus von vorherrschenden Überzeugungen unterscheiden und oft im Konflikt mit deren Vertretern und Anhängern stehen. In erster Linie steht Sekte für eine von einer Mutterreligion abgespaltene religiöse Gemeinschaft. Der ursprünglich wertneutrale Ausdruck hat aufgrund seiner Geschichte und Prägung durch den kirchlichen Sprachgebrauch einen meist abwertenden Charakter erhalten und wird seit den 1960er Jahren verstärkt in negativem Sinn verwendet. In der modernen Religionswissenschaft und Soziologie werden statt des Begriffs Sekte neutrale, nicht wertende Bezeichnungen wie "religiöse Sondergemeinschaft", "neureligiöse Gemeinschaft" oder "neue religiöse Bewegung" verwendet. == Begriffsgeschichte === Antike In der Antike verwendete man im Griechischen das Wort a (hairesis), im Lateinischen secta. Das lateinische secta ist abgeleitet vom Verb sequi ("folgen", speziell: "Anhänger sein"). Erstmals ist das Wort im 3. Jahrhundert v. Chr. bei dem Dichter Gnaeus Naevius bezeugt. Als secta bezeichnete man wertneutral nicht nur eine philosophische Schule, sondern auch eine Schulrichtung in der Rechtswissenschaft oder die Anhängerschaft eines Politikers. Außerdem wurde hairesis latinisiert: Als Lehnwort aus dem Griechischen war das lateinische haeresis ein Synonym von secta. Etymologisch ist hairesis von haireomai ("sich nehmen", "auswählen", "vorziehen") abgeleitet und bedeutete ursprünglich "Wahl" sowie das, was man ausgewählt hat, wofür man sich entschieden hat (eine Partei, Meinung oder Überzeugung). Ab dem Zeitalter des Hellenismus bezeichnete man als hairesis eine philosophische Lehre sowie deren Anhängerschaft, beispielsweise die Stoiker, Peripatetiker oder Platoniker (Akademiker). Der Begriff wurde aber nicht nur in philosophischen oder weltanschaulichen Zusammenhängen verwendet. Im 2. Jahrhundert verfasste der berühmte Arzt Galen ein griechisches Werk über die drei wichtigsten damals bestehenden medizinischen Schulrichtungen, worin er für diese die Bezeichnung hairesis gebrauchte. Diese einflussreiche Schrift wird noch heute unter ihrem lateinischen Titel De sectis (wörtlich "Über die Sekten") zitiert. Im Judentum wurde der griechische Begriff hairesis übernommen und nicht nur für griechische Philosophenschulen, sondern auch für jüdische theologische Richtungen wie die Sadduzäer, Pharisäer und Essener verwendet. Auch hier war keine negative Konnotation damit verbunden; es gab keine Autorität, die in der Lage gewesen wäre, ein bestimmtes Dogma oder Bekenntnis verbindlich als "rechtgläubig" festzulegen und eine abwertende Bezeichnung für alle davon abweichenden Richtungen einzuführen. So schrieb der jüdische Historiker Flavius Josephus im 1. Jahrhundert, er habe sich in seiner Jugend für die hairesis der Pharisäer entschieden, die der philosophischen hairesis der Stoiker ähnlich sei. Im Sinne dieses Sprachgebrauchs wurden die ersten Christen als hairesis der "Nazarener" im Rahmen des Judentums bezeichnet. Im Gegensatz zur wertfreien jüdischen Begriffsverwendung erhielt bei den Christen hairesis von Anfang an eine negative Konnotation, die schon bei dem Apostel Paulus deutlich erkennbar ist. Zwar wurde der Ausdruck in der frühen christlichen Literatur gelegentlich noch im herkömmlichen Sinne als neutrale Bezeichnung verwendet, doch galt in den miteinander in Kommunion stehenden Gemeinden jede Parteiung unter Christen als unvereinbar mit dem Wesen der einen Kirche und ihrer verbindlichen Lehre und daher als skandalös. Hairesis bedeutete in der Alten Kirche Abweichung vom wahren Glauben und dadurch Trennung von der Gemeinde, "Häresie". Ab Beginn des zweiten Jahrhunderts ist hairesis als theologischer Fachbegriff in diesem Sinn bezeugt; in der Folgezeit dominierte der Wortsinn "Irrlehre", daneben wurde das Wort auch als Synonym von schisma ("Spaltung", "Abspaltung") gebraucht. Den als Häretiker Ausgegrenzten wurden die Bezeichnungen "Christen" und "Kirche" nachdrücklich verweigert. Es entstand eine häresiologische und häresiographische (Irrlehren beschreibende) kirchliche Literatur. Den ersten Häretikerkatalog erstellte Justin der Märtyrer im 2. Jahrhundert. Eine abwertende Begriffsverwendung kam auch in nichtchristlicher Literatur vor; so vertrat im späten 3. Jahrhundert der pagane Neuplatoniker Alexander von Lykonpolis die Ansicht, das Christentum habe einen Niedergang erlebt, denn es seien ehrgeizige und neuerungssüchtige, aber zu gedanklicher Klarheit unfähige Sektengründer aufgetaucht, von denen jeder eine neue hairesis eingeführt habe. Dies habe zu Verwirrung und vielfacher Aufspaltung geführt. === Mittelalter und Frühe Neuzeit Die lateinischen Begriffe haeresis und secta wurden im Mittelalter und in der Frühen Neuzeit weiterhin so wie in den Schriften der antiken Kirchenväter zur abwertenden Bezeichnung von "Irrlehren" und deren Anhängerschaft verwendet. So wurden die Protestanten als secta Lutherana bezeichnet. In der Ostkirche wurde der Islam als Variante des spätantiken Arianismus betrachtet und daher ab dem 8. Jahrhundert offiziell unter die Sekten eingereiht. Ins Mittelhochdeutsche entlehnt wurde das lateinische Wort in der zweiten Hälfte des 12. Jahrhunderts. Der älteste deutsche Beleg bezieht sich auf die damals als Häretiker verteufelten Arianer. Der deutsche Wortgebrauch im Spätmittelalter und in der Frühen Neuzeit entsprach im religiösen Kontext dem lateinischen; secte oder sec(k)t wurde mit Vorstellungen wie "Rotte", "Aufruhr", "Spaltung" und "Zwietracht" assoziiert. Nach der Reformation pflegte man in Deutschland religiöse Gruppen ohne reichsrechtliche Anerkennung Sekten zu nennen. Neben dem in der Regel abwertenden Wortgebrauch in religiösen Zusammenhängen gab es ab dem 16. Jahrhundert im Lateinischen und im Deutschen auch eine wertneutrale, aus antiken Texten übernommene Begriffsverwendung zur Bezeichnung philosophischer und medizinischer Schulrichtungen. === Moderne Während im Deutschen "Sekte" auch in der Moderne sehr häufig in einem negativen, oft stark abwertenden Sinn verwendet wurde und wird, hat das englische Wort sect einen eher wertneutralen Sinn. So wird in englischsprachiger buddhistischer Literatur sect als wertneutraler Ausdruck zur Bezeichnung von angesehenen Schulrichtungen verwendet. Dem deutschen pejorativen Ausdruck "Sekte" entspricht der englische Begriff cult als polemische Fremdbezeichnung. == Heutige Begriffsverwendung === Umgangssprachlicher Gebrauch Im landläufigen Sprachgebrauch werden als Sekten oft religiöse Gruppen bezeichnet, die in irgendeiner Weise als gefährlich oder problematisch angesehen werden oder die in orthodoxer theologischer Hinsicht als "Irrlehre" angesehen werden. Dies betrifft sowohl seit Langem bestehende christliche Gemeinschaften, die sich in Lehre oder Praxis vom Herkömmlichen unterscheiden, als auch neue Gruppen. Zu Letzteren zählen insbesondere solche, die in der zweiten Hälfte des 20. Jahrhunderts entstanden sind und damals als "Jugendreligionen" bezeichnet wurden, weil sie anfänglich viele junge Mitglieder hatten. "Sekte" wird heute oftmals als Kampfbegriff gebraucht. So wird sogenannten Sekten häufig vorgeworfen, sie würden sich vor allem aus wirtschaftlichen Gründen als religiöse Glaubensgemeinschaften ausgeben, um den besonderen Schutz des Staates, größere Freiheiten und Rechte sowie die Befreiung von Steuern zu genießen. Bekanntestes Beispiel dafür ist Scientology. In jüngerer Zeit wird der Terminus "Sekte" auch im säkularen Bereich verwendet, um beispielsweise Kritiker von vorherrschenden wissenschaftlichen Lehrmeinungen, sozialen Üblichkeiten oder Absplitterungen von politischen Parteien abwertend zu charakterisieren. Im Juni 2018 akzeptierte das OLG Frankfurt es als Teil der freien Meinungsäußerung, ein Unternehmen als "Sekte" zu bezeichnen. ==== Kontroversen Das Thema Sekten führt immer wieder zu Kontroversen, da mit dem Wort allgemein eine besondere Konfliktträchtigkeit assoziiert wird. Dabei stehen sich zwei Grundhaltungen gegenüber: Auf der einen Seite eine Betonung der Religionsfreiheit und der weltanschaulichen Neutralität des Staates. Hier wird Zurückhaltung bei der öffentlichen Bewertung religiöser und weltanschaulicher Positionen und bei Maßnahmen gegen missliebige Minderheiten empfohlen. Die gegenteilige Haltung nehmen diejenigen ein, die insbesondere neureligöse weltanschauliche Sondergruppen zum Teil scharf verurteilen und in manchen Fällen deren gesellschaftliche Ächtung anstreben. Im Einzelnen drehen sich die Kontroversen beispielsweise um mutmaßliche oder tatsächliche ==== Mediale Berichterstattung Beispiele für Gewaltaktionen von Sekten: === Staatliche Begriffsverwendung ==== Deutschland In Deutschland stellte die Enquete-Kommission "Sogenannte Sekten und Psychogruppen" 1998 fest, dass in der Umgangssprache der Begriff "Sekte" sich zunehmend auf Gruppen bezieht, denen vorgeworfen wird, in Lehre und Praxis systematisch gegen ethische Überzeugungen wie Menschenwürde, Menschenrechte, Freiheit, Toleranz, Selbstentfaltung oder Selbstverwirklichung zu verstoßen, statt Entfaltungsfreiheit Abhängigkeit zu produzieren, die Menschen zu entwürdigen und zur Intoleranz anzuleiten. Der umgangssprachliche Sektenbegriff leide damit an einer erheblichen inhaltlichen Undifferenziertheit; er sei in hohem Maße kritikwürdig und werde von der Kommission daher nicht verwendet. Für die Zwecke der neutralen Beschreibung sei die Bezeichnungen "neue religiöse und ideologische Gemeinschaften und Psychogruppen" zutreffender. Das Grundgesetz kenne nur Religionen, Religionsgesellschaften und Religionsgemeinschaften; staatsrechtlich gebe es mithin keinen Unterschied zwischen Kirche und "anderen religiösen Organisationsformen". Der Begriff der Kirche ist dadurch auch nicht mehr geschützt, sodass sich nun jede Organisation als Kirche bezeichnen und ihn irreführend verwenden könne. Allerdings stellte das Bundesverfassungsgericht im Juni 2002 fest, dass die staatliche Anwendung der Begriffe "Sekte", "Jugendreligion", "Jugendsekte" und "Psychosekte" auf die Osho-Bewegung verfassungsrechtlich unbedenklich gewesen sei, da sie nicht den Schutzbereich der Glaubens- und Gewissensfreiheit berührt habe. Mit Blick auf den Bericht der Enquete-Kommission empfahl das Gericht gleichwohl, staatliche Stellen sollten diese Begriffe, auch wenn sie verfassungsrechtlich unbedenklich seien, nicht mehr verwenden. ==== Frankreich Anlässlich der Aktivitäten der Vereinigungskirche seit den 1970er Jahren wurde von staatlicher Seite verstärkt gegen Sekten vorgegangen. 1995 veröffentlichte eine parlamentarische Kommission eine Liste von 173 Organisationen, die als Sekte bezeichnet wurden. Die Gesamtzahl der Mitglieder dieser Organisationen wurde auf 400.000 geschätzt. Der staatliche Runderlass betont bei der Begriffsdefinition den ausbeuterischen Charakter einer Sekte. In diesem Zusammenhang stehen auch Einrichtungen weltanschaulicher Gruppierungen unter Beobachtung, die sich in anderen Ländern frei entfalten können, wie etwa die Waldorfschulen. ==== Schweiz 1998 hatte der Bundesrat bei einer Anfrage im Nationalrat festgehalten, dass es keinen juristischen Begriff der "Sekte" gibt. Die Bundeskanzlei hat den Auftrag, für das Thema zu sensibilisieren, kann in Sachen Beratungsstelle aber höchstens koordinierend wirken. Alle Beratungsstellen zu Sektenfragen in der Schweiz sind private oder kirchliche Institutionen. === Wissenschaftlicher Gebrauch Im theologischen, rechtlichen und soziologischen Kontext wird der Begriff "Sekte", wenn überhaupt, dann unter Berücksichtigung seiner Problematik eingesetzt. ==== Theologischer Gebrauch Die Abwehr theologischer Abweichungen von der kirchlichen Lehre spielt für Theologen in der neueren Auseinandersetzung mit dem Thema "Sekten" kaum noch eine Rolle. Beachtet werden mögliche negative Folgen für den Einzelnen und für seine Umgebung, die sich aus der Zuwendung zu einer problematischen religiösen Gruppe ergeben können. Bedenkliche Eigenheiten können etwa sein: ein ethischer Rigorismus, Überlegenheitsbewusstsein, Heilsversprechen speziell für die exklusive Elite der Zugehörigen, hoher Gruppenbinnendruck, erschwerte Austrittsmöglichkeit. Die Darlegung solcher Eigenheiten ist gepaart mit Selbstkritik: "Viele sektenhafte Züge finden sich auch innerhalb der Kirche". Die kirchliche Beschäftigung mit Sondergemeinschaften bewegt sich weiterhin in dem Spannungsfeld Warnen vor Irrwegen oder Selbsthinterfragen als Kirche. ==== Rechtswissenschaftlicher Gebrauch Das Münchner Rechtslexikon schreibt zum Beispiel, der Begriff "Sekte" habe in staatsrechtlicher Hinsicht seine Bedeutung verloren, da er eine negative theologische Beurteilung enthalte. Die früher als "Sekten" bezeichneten Gruppen werden heute meist unter weniger vorbelasteten Bezeichnungen wie "Neue religiöse Bewegungen" oder "Alternativreligionen" zusammengefasst. Kleinere spirituelle Gruppierungen und Einzelpersonen werden bisweilen auch als "Anbieter am Lebenshilfemarkt" bezeichnet. ==== Soziologische Definitionen Für die soziologische Definition haben sich folgende drei Ansätze herausgebildet: In der deutschsprachigen Soziologie ist - erstens - Max Webers Sektenkonzept am bekanntesten. Weber unterscheidet Sekten von Kirchen anhand ihrer Rekrutierungsmechanismen: Sekten seien voluntaristische Gemeinschaften, in die man aufgrund einer persönlichen Entscheidung und nur nach eingehender Prüfung durch die Sekte aufgenommen werde. Im Gegensatz dazu sind Kirchen für Weber Anstalten, in die man hineingeboren würde. Der protestantische Theologe Ernst Troeltsch (1865-1923) benutzte den Begriff in Anschluss an Weber in seiner Typologie christlicher Gemeinschaftsbildung: Im Unterschied einerseits zu Kirche, andererseits zur Mystik zeichne sich die Sekte durch verhältnismäßig kleine Mitgliederzahl aus, durch die angestrebte "persönlich-innerliche Durchbildung" des Glaubens sowie eine enge, persönliche Verbindung der Mitglieder untereinander. Typisch sei in diesen Laienchristentum, die Forderung nach persönlichen ethisch-religiösen Leistungen und einem persönlichen Verhältnis zu Gott, sowie die radikale religiöse Gleichheit und Brüderlichkeit innerhalb der Gruppe. Eine Sekte stelle sich gegen die Hierarchien und die kanonischen Verrechtlichungen der Kirchen. Es gebe drei Haupttypen von Sekten: Dem stellte der Religionssoziologe Paul Honigsheim (1885-1963) noch neuere amerikanische Sekten an die Seite, die angesichts der verbreiteten religiösen Toleranz in den Vereinigten Staaten keine Verfolgungserfahrungen hätten, Sekten der Afroamerikaner, die auf den verbreiteten Rassismus reagierten, indem sie die "Rassensuperiorität ihrer Mitglieder betonen", sowie schließlich religiös kollektivistische Sekten. Die Abgrenzung des Sektenbegriffs zu dem der Denomination sei oft nicht trennscharf zu ziehen. Ein anderer, zweiter, Ansatz von Peter L. Berger sieht in einer Sekte ein Organisationsmodell für den Selbstschutz weltanschaulicher Minderheiten. Ihre Basis sei eine Orthodoxie, die von einem ontologischen Wahrheitsbegriff (Niklas Luhmann) ausgehe, d. h., eine voraufgeklärte Orientierung, in der das Sein als unwandelbar und unvergänglich und nicht als kontingent (auf Wahrnehmung begründet) erkannt werde. Eine kommunikative Verständigung über die Grundlagen des Lebens gilt ihr als blasphemisch und gefährlich. Zur Vermittlung der "wahren Lehre" benötige sie organisatorisches Handeln und präge über die indoktrinierende Institution nicht nur das Weltbild der einzelnen Menschen, sondern auch deren Sprache in einer Weise, die die Verständigung mit Außenstehenden erschwere. Ein dritter verwendeter, einflussreicher Ansatz, entwickelt von Bainbridge und Stark, unterscheidet Sekten und Kulte von Kirchen auf der Basis ihrer Ideologien. Kirchliche Ideologien stünden dabei nicht im Konflikt mit ihrer gesellschaftlichen Umgebung, sondern affirmierten diese. Sekten und Kulte wichen dagegen ideologisch deutlich von ihrer gesellschaftlichen Umgebung ab. Zwischen Sekten und Kulten wird in diesem Ansatz auf der Basis des Entstehens der ihnen zugehörigen Ideologien unterschieden: Während Sekten, die aus bestehenden Religionsorganisationen hervorgehen, lange bestehende Glaubensbekenntnisse modifizieren würden, schüfen Kulte völlig neue Glaubenssysteme. H. Richard Niebuhr machte die Beobachtung, dass Sekten, entstanden als schismatische Bewegung von großen Kirchen, die Tendenz hätten, ihrerseits Kirchen zu werden, womit sie aber viele Bedürfnisse ihrer Mitglieder nicht mehr erfüllen könnten, was zu erneuten Abspaltungen führen würde. Auf dieser Feststellung aufbauend, konstatiert dieser dritte Ansatz ein Spannungsverhältnis zwischen Sekten und Gesellschaft, bei dem sich aber beide Pole ständig in Bewegung befänden, was zu einer gesellschaftlichen Etablierung vorher bewusst minoritärer Gruppen führen könne. Die Übergänge zwischen "Sekte" und "Kirche" sind in diesem Modell fließend. "Kulte" haben im Unterschied zu "Sekten" eigene religiöse Wurzeln. Bainbridge und Stark unterscheiden drei Arten von Kulten: Die Gruppen werden in diesem Ansatz nach Art der angebotenen Kompensatoren unterschieden: "Magische" oder spezielle Kompensatoren versprächen die Manipulation der Umwelt für eigene Ziele, "religiöse" oder allgemeine Kompensatoren böten ein universales Welterklärungsmodell an. Diese Unterscheidung geht im Grundsatz auf Emile Durkheim zurück: Magie floriere, wenn wissenschaftliche Mittel zu ihrer Überprüfung fehlen oder nicht akzeptiert werden. Sie könne aber keine Organisation aufrechterhalten. Auf Magie basierende Kulte können sich allerdings zu Kultbewegungen mit universalem Welterklärungsanspruch entwickeln, so ging Scientology z. B. aus einem psychotherapeutischen Selbsthilfesystem (Dianetik) hervor. Kultbewegungen provozieren allerdings, so Bainbridge und Stark, anders als unorganisierte Kulte, Widerspruch im gesellschaftlichen Umfeld. == Literatur Nachschlagewerke Begriffsgeschichtliche Untersuchungen Christlich Nicht religiös Sozialwissenschaftlich Juristisch

Title: Sekte Summary: Eine Sekte ist eine Gruppe von Menschen, die Anhänger einer bestimmten Idee oder Lehre sind. Dabei glauben die Mitglieder der Sekte an etwas, das sie vom Rest der Menschheit abschneidet. Oft handelt es sich um eine Art von Religion. Menschen haben sich schon immer um die richtige Religion gestritten. "Sekte" war dabei ein Schimpfwort. Heutzutage verwenden Wissenschaftler den Ausdruck Sekte deshalb nicht gerne. Für neue Religionen sagen sie lieber zum Beispiel "neue religiöse Bewegung". Bei einer Sekte denkt man vor allem an eine Gruppe, die ganz anders sein will als alle anderen Menschen. Sie hält sich für auserwählt, dazu bestimmt, etwas besonderes zu erleben oder für die Menschheit zu tun. Die Mitglieder der Sekte haben deshalb nichts mehr mit anderen zu tun, sie halten ihre Sekte für wichtiger als Familie und Freunde. Eine andere Meinung lassen sie gar nicht zu. Typisch für Sekten ist es auch, dass sie ein Oberhaupt haben. Dieser Chef oder diese Chefin spricht für sie im Namen Gottes. Was er oder sie sagt, ist für die Anhänger der Sekte wie ein Gesetz. Oft sagt das Oberhaupt voraus, dass bald die Welt untergehen wird. Angeblich werden dann nur die Anhänger der Sekte gerettet. Es ist oft verboten, aus der Sekte auszutreten. Wer es trotzdem tut, mit dem wollen die Anhänger nichts mehr zu tun haben. Wer austritt, steht dann ganz allein da. Manche Sekten bestrafen einen dann, einige ermorden ihre Gegner sogar.

klexikon_de

de

Summarize: Court documents show Michael Estes is a convicted felon in Swain County for assault with the intent to cause serious bodily injury. He has also been found guilty of breaking and entering in Swain County. (Photo credit: WLOS staff) The man accused of leaving an explosive device at Asheville Regional Airport on Friday has a criminal background. Court documents show Michael Estes is a convicted felon in Swain County for assault with the intent to cause serious bodily injury. He has also been found guilty of breaking and entering in Swain County. Estes waived his right to a preliminary hearing, and an arraignment is set to happen next — a date for that has not been announced. News 13 also learned more about his connection with the airport bomb scare Friday. Airport police discovered the device and called in the FBI, along with Asheville Police Department's bomb squad. Investigators found a mason jar with ammonium nitrate, nails and a shotgun cartridge. They said the jar had an alarm clock and matches taped to it. Officers said Estes admitted to leaving the explosive at the airport and claimed he was getting ready to "fight a war on U.S. soil" but said he did not set the alarm clock. "In of quantity, and in the hands of someone who knows what they're doing, that could cause quite a bit of damage," Bill Wysong, vice president of Tactical Training Black Wolf Protective Services, said. Wysong said the explosive device at the airport is very common. "A fairly substantial explosive device that has been relied upon many times the world over,” Wysong said. The components in that device were fairly common to buy. "We find that many times. Most explosive devices are fairly simple in their construction and fairly devastating in their consequence," Wysong said. News 13 reached out to Estes’ attorney, but she did not return the phone call by the time this article was published. The Department of Justice also could not comment any more on the investigation. This past Friday morning, at 12:39 a.m., security footage from the Asheville Regional Airport in North Carolina showed a man walking through the front doors wearing black clothing and a black cap, while carrying a bag. “Based on a review of the video, the individual walked near the entrance to the terminal, went out of sight momentarily, and was then seen departing the area without the bag,” according to the criminal complaint. It’s strange how some things really catch on and go viral, and others don’t. These days, nothing quite makes a story blow up — no pun intended — like the president’s fixation with it. That’s why it’s so peculiar that what sure looks like an attempted terrorist attack was narrowly thwarted at an American airport this past Friday without so much as a peep from Donald Trump about it. No tweets. No nicknames for the alleged would-be terrorist. Nothing. You’ll see why in a minute. What investigators eventually found in the bag was AN/FO (ammonium nitrate/fuel oil) explosives that, according to the criminal complaint, have been used “in a number of terrorist-related incidents around the world. When AN/FO comes into contact with a flame or other ignition source, it explodes violently. Nails or ball bearings are often items added to the device so as to increase the devastation inflicted by the explosion.” Following the Transportation Security Administration’s protocols, airport security allowed a bomb dog to sniff the bag for explosives, and the dog signaled to the team the presence of dangerous materials in the bag. The concourse was then shut down. The street leading to the airport was shut down. And Asheville Regional Airport officials found themselves in a dangerous emergency situation. In fact, sharp nails and bullets were found in this improvised explosive device. Whoever built it designed the bomb to cause horrific bodily harm. Before disarming it, authorities discovered that the alarm attached to it was scheduled to go off at 6:00 that morning just as a fresh round of travelers was scheduled to arrive at the airport. The man who planted it, it turns out, openly admitted to authorities that he was “preparing to fight a war on U.S. soil” and that this bomb was but one part of that war. Little Fanfare I bet you never heard about it. I keep an eye on these types of incidents closely, and I didn’t hear about it. Someone who follows me online who happens to live in Asheville sent me the story this morning — shocked that it hadn’t gotten any play at all beyond a few mentions in the local paper and some isolated pickup by a few national outlets. As soon as I clicked on the article, it all made perfect sense. The story didn’t go viral and Trump didn’t tweet about it because the bomb was not placed by an immigrant, or a Muslim, or a Mexican. It was placed there by a good ol’ white man, Michael Christopher Estes. Unlike the Las Vegas shooter, Stephen Paddock, whose motive is still hard to discern, Estes wanted to be very clear that his ultimate goal was to accelerate a war on American soil. Sorry if it sounds like you’ve heard this story before. I’m as tired of writing it as you are reading it, but you know good and well that if Estes was a young Muslim — hell, if he had ever even visited a mosque in the past 25 years — that Trump would be tweeting about him right this very moment to tout how essential a Muslim ban is for American safety. A Muslim attacker’s mugshot would become a meme across the conservative media. Mainstream American outlets would be covering the heroic bravery of those who thwarted the terrorist plot. We’d all be seeing footage of the perpetrator being walked from the police car to the jail and from the jail to the court room. Out loud, people would talk and tweet about the man’s family and friends and networks — wondering where he was radicalized, and if anyone else feels the way he does. In this case, though? Crickets. We hear nothing at all — almost exclusively because the man who planted an improvised explosive device, just like ones that have been used to murder and maim people all over the world, was white. His guilt starts and stops with him. His actions aren’t an indictment of his whole faith, political outlook, and race. White people aren’t, thanks to Estes, suddenly labeled terrorists or seen as a threat to American safety in the way that would almost certainly happen had it been anybody other than a white man. This isn’t me calling for all of those things that happen to Muslims and immigrants every single day to now happen to Estes and white people all over the country. It’s me saying that the fundamentally bigoted double standard by which it is done to virtually everyone except for Michael Christopher Estes and other white men has to stop. Suspect In Would-Be Airport Bombing Nabbed With Help From REI Enlarge this image toggle caption AP AP Someone left a bomb at the Asheville Regional Airport. That much was clear. The question was, who? The airport in Asheville, N.C., serves tens of thousands of people every month. According to an affidavit, federal marshals called the FBI on Oct. 6 to report the presence of an improvised explosive device. Bomb technicians neutralized the device, which was packed inside a glass jar. Bomb dogs indicated the presence of explosive material. Analysts determined that the bomb was powered by ammonium nitrate, packed with nails to serve as shrapnel, and set to go off on a timer — an alarm clock, minus its bells, set to 6 o'clock. As for the man who dropped it off, FBI investigators had surveillance footage — a white male wearing black clothes, with a black cap. He'd walked in after midnight and left a bag inside the building. They also found a brand-new backpack in the woods near the airport — REI's "Traverse 70" brand. Inside the bag were gloves, a fuel source, a roll of Gorilla Tape, and "what appeared to be an alarm clock bell," Agent James Anderson writes, "consistent with the bell missing from the clock" in the bomb. Plus there was a spoon — gray, polymer. FBI agents also tracked down surveillance footage of a white male apparently purchasing some of those materials, as well as other bomb-making supplies, at a Walmart and Lowe's in Arden, N.C. But he paid cash at both venues, and the FBI still didn't have a name. Then they found an REI, an outdoor goods store, in Asheville where a man had recently purchased a new backpack. A Traverse 70. He also bought a spoon — gray, polymer. There was no video footage this time. And again, the man paid cash. But, Anderson writes, "the individual... used an REI membership number when paying." An REI membership entitles a customer to 10 percent back on purchases every year. In this case, it also gave the FBI a name — Michael Estes. After releasing a still photo from the surveillance footage, authorities found Estes in downtown Asheville. He was arrested on Oct. 7. Estes told authorities that he created the bomb and placed it at the airport but said he did not actually set it to go off, the FBI says. Estes said he was prepared to "fight a war on U.S. soil." The suspect has been charged with multiple federal crimes and is currently in custody. For the first few days, this story received little attention outside of North Carolina. Now, it has been brought to the national spotlight, largely because Shaun King, a columnist for the Intercept, wrote about Estes on Wednesday. King pointed out the particulars of the story — an improvised weapon, planted at an airport, by a man who said he was declaring war. King asked what would happen if the attacker were "an immigrant, or a Muslim, or a Mexican... Mainstream American outlets would be covering the heroic bravery of those who thwarted the terrorist plot.... in this case, though? Crickets." Every year, law enforcement officers in America make multiple arrests over improvised explosive device plots or incidents in which no one was actually injured. The level of news coverage, as King notes, can vary enormously. Here's a sample of such incidents from this year: In February, Adam Hayat allegedly made several explosive devices and left them at a hotel in downtown Denver, scrawling "explosives" on a closet door mirror. He was later arrested in Los Angeles. His federal case is ongoing. Also in February, a Florida man named Mark Barnett allegedly created improvised explosives to plant in Target stores along the East Coast as part of a profit-driven bomb plot. Someone he allegedly attempted to recruit to his plot turned Barnett into authorities and he was charged in federal court; his federal case is ongoing. In July, Luke Mullen was arrested after allegedly making bomb threats against the Colorado Springs Airport; police say he had four explosive devices and a machete inside his vehicle. Also in July, a blast outside the Bixby Air Force Recruitment Office in Oklahoma caused property damage but no injuries. Benjamin Roden, a former airman, was arrested and is facing federal charges in connection with the incident. In August, Elijah Blankenship in Ohio was arrested and charged with creating multiple homemade explosives. His arrest came shortly before an anti-racist vigil in honor of the victims of the Charlottesville, Va., attack, but court records don't indicate whether there was a connection to the event. In September, the Georgia Bureau of Investigation announced that Douglas Kennedy of Tifton, Ga., was charged with manufacturing explosive devices after a bomb went off in the parking lot of the Tift Regional Medical Center; no one was injured. Kennedy had allegedly constructed and detonated at least three other bombs, none of which hurt anybody. Earlier this month the FBI unsealed charges against three alleged ISIS supporters accused of plotting attacks in New York City in the summer of 2016. The alleged plot, which involved improvised explosive devices, was foiled by law enforcement, the FBI says. In each of those instances, an apparent plot was never carried out to completion; if a bomb did go off, no one was hurt. None of those stories made headlines here at NPR.org. Barnett's Target scheme, the Bixby recruiting station blast and the foiled ISIS plot were covered in many national outlets. Hayat, who is of Pakistani descent, received relatively little coverage in the national press but was featured on multiple right-wing websites, including Breitbart News. Other incidents, including the arrests of Mullen, Blankenship and Kennedy, were covered almost exclusively on the local level.

Summary: The glass mason jar found Oct. 6 inside Asheville Regional Airport in North Carolina held ammonium nitrate and nails, NPR reports. According to WLOS, it also held a shotgun cartridge and was equipped with matches and an alarm clock set for 6am. Authorities say the man who allegedly left the improvised explosive device wanted to "fight a war on US soil." But it was his desire to get 10% back at REI that led to his arrest. Surveillance footage from the airport shows a man walking in after midnight and leaving a bag. Police found a new REI backpack containing tape, fuel, gloves, a piece of an alarm clock, and a gray spoon in the woods near the airport. Surveillance footage from Walmart and Lowe's showed a man buying most of those items, but he used cash so there was no name. A man also used cash to buy a backpack and gray spoon at REI. Notably, he also used an REI membership under the name Michael Estes, and Estes was arrested in downtown Asheville on Oct. 7. The FBI says Estes admitted to leaving the bomb in the airport but claims he never set it to go off. He's had past convictions for assault and breaking and entering. Despite authorities noting that the type of bomb allegedly left by Estes has been used "in a number of terrorist-related incidents around the world," the story didn't get much attention nationally until four days later. Shaun King at the Intercept says there's a good reason an apparent attempted terrorist attack in the US hasn't made headlines or been the subject of a Trump tweet: "The bomb was not placed by an immigrant, or a Muslim, or a Mexican. It was placed there by a good ol' white man."

multi_news

en

Summarize: Background FAA’s ATC network is an enormous, complex collection of interrelated systems, including navigation, surveillance, weather, and automated information processing and display systems that reside at, or are associated with, hundreds of ATC facilities. These systems and facilities are interconnected by complex communications networks that separately transmit both voice and digital data. As stated in our 1997 report on high-risk issues, while the use of interconnected systems promises significant benefits in improved government operations, it also increases vulnerability to anonymous intruders who may manipulate data to commit fraud, obtain sensitive information, or severely disrupt operations. Since this interconnectivity is expected to grow as systems are modernized to meet the projected increases in air traffic and to replace aging equipment, the ATC network will become even more vulnerable to such network-related threats. The threat to information systems is also growing because of the increasing availability of strategies and tools for launching planned attacks. For example, in May 1996 we reported that tests at the Department of Defense showed that Defense systems may have experienced as many as 250,000 attacks during 1995, about 65 percent of these succeeded in gaining access, and only about 4 percent were detected. Since intruders can use a variety of techniques to attack computer systems, it is essential that FAA’s approach to computer security be comprehensive and include (1) physical security of the facilities that house ATC systems (e.g., locks, guards, fences, and surveillance equipment), (2) information security of the ATC systems (e.g., safeguards incorporated into computer hardware and software), and (3) telecommunications security of the networks linking ATC systems and facilities (e.g., secure gateways, firewalls, and communication port protection devices). For years, the need for federal agencies to protect sensitive and critical, but unclassified, federal data has been recognized in various laws, including the Privacy Act of 1974, the Computer Security Act of 1987, and the Paperwork Reduction Act of 1995, and was recently reemphasized in the Clinger-Cohen Act of 1996. The adequacy of controls over computerized data is also addressed indirectly by the Federal Managers’ Financial Integrity Act (FMFIA) of 1982 and the Chief Financial Officers Act of 1990. For example, FMFIA requires agency managers to evaluate their internal control systems annually and report to the President and the Congress any material weaknesses that could lead to fraud, waste, and abuse in government operations. In addition, a considerable body of federal guidance on information security has been developed by both the Office of Management and Budget (OMB) and the National Institute of Standards and Technology (NIST). Objectives, Scope, and Methodology The objectives of our review were to determine (1) whether FAA is effectively managing physical security at ATC facilities and systems security for its current operational systems, (2) whether FAA is effectively managing systems security for future ATC modernization systems, and (3) the effectiveness of FAA’s management structure and implementation of policy for computer security. To determine whether FAA is effectively managing physical security at ATC facilities, we reviewed FAA Order 1600.6C, Physical Security Management Program, to determine ATC facility security inspection and accreditation requirements; reviewed data from FAA’s Facility Inspection Reporting System (FIRs) to determine the accreditation status of category I and II towers, terminal radar approach control (TRACON) facilities, and air route traffic control towers (en route centers) and their last inspection date; verified the accuracy of the FIRs accreditation data with each of the nine regional FIRs program managers by requesting accreditation reports for each facility that FIRs reported as being accredited; for those facilities that were not accredited, requested dates of their initial comprehensive physical security inspection and follow-up inspections from each of the nine regional FIRs program managers to determine why ATC facilities were not accredited; verified the initial and follow-up inspection dates by requesting and reviewing documentation for each inspection conducted from April 16, 1993, to July 31, 1997, and then provided our analyses to Office of Civil Aviation Security Operations officials, who in turn verified it with each region; reviewed the Department of Justice’s June 28, 1995, report, Vulnerability Assessment of Federal Facilities, to identify new physical security requirements for federal facilities; reviewed physical security assessments for three locations to determine FAA’s ATC compliance with Department of Justice blast standards and to identify additional physical security weaknesses at key ATC facilities; reviewed the Facility Security Risk Management Mission Need Statement for Staffed Facilities, Number 316, June 23, 1997, to determine physical security deficiencies and FAA’s plans to improve physical security; and interviewed officials from the Offices of Civil Aviation Security, Operations and Policy and Planning, and Airways Facility Services to determine physical security requirements, to determine whether FAA is in compliance with 1600.6C, to identify reasons for noncompliance, and to identify who develops, implements, and enforces ATC physical security policy. To determine whether FAA is effectively managing systems security for its current operational systems, we reviewed federal computer security requirements specified in the Computer Security Act of 1987 (Public Law 100-235); Paperwork Reduction Act of 1995 (Public Law 104-13), as amended; OMB Circular A-130, appendix III, “Security of Federal Automated Information Resources;” the 1996 Clinger-Cohen Act; and An Introduction to Computer Security: The NIST Handbook to identify federal security requirements; reviewed FAA Order 1600.54B, FAA Automated Information Systems Security Handbook, and FAA Order 1600.66, Telecommunications and Information Systems Security Policy, to determine ATC system risk assessment, certification, and accreditation requirements; reviewed Volpe National Transportation Systems Center NAS AIS Security Review, October 1, 1996, to determine how many ATC operational systems were assessed, certified, and accredited as of October 1, 1996; requested and reviewed accreditation reports, security certification reports, risk assessments, contingency plans, and disaster recovery plans for six operational ATC systems; reviewed the White House Commission on Aviation Safety and Security’s final report to the President, February 12, 1997, to determine recommendations to improve ATC computer security; reviewed the Federal Aviation Administration Air to Ground Communications Vulnerabilities Assessment, June 1993, to determine ATC communication systems vulnerabilities; reviewed the Report to Congress, Air Traffic Control Data and Communications Vulnerabilities and Security, Report of the Federal Aviation Administration Pursuant to House-Senate Report Accompanying the Department of Transportation and Related Agencies Appropriations Act, 102-639, June 1, 1993, to determine what ATC security vulnerabilities FAA disclosed to the Congress in 1993; interviewed the telecommunications integrated product team to determine what operational communication systems have been assessed, certified, and accredited and reviewed the team’s 1994 and 1997 strategic plans to determine communication system risks and planned security improvement initiatives; interviewed the Director of Spectrum Policy and Management to determine the extent to which intruders are accessing ATC frequencies; interviewed FAA’s Designated Approving Authority (DAA) to determine FAA’s policy for accrediting ATC systems; and interviewed the Office of Civil Aviation Security Operations officials and Airways Facilities Services officials to determine who develops, implements, and enforces ATC operational systems security policy and to determine whether an incident reporting and handling capability exists. To determine whether FAA is effectively managing systems security for future ATC modernization systems, we requested and reviewed risk assessments and acquisition specifications for six ATC systems that are being developed to determine if security requirements based on detailed assessments existed;interviewed three integrated product teams (IPT) to determine what security policy/guidance each follows in developing ATC systems; reviewed the NAS Information Security Mission Need Statement, April 22, 1997, to determine information security deficiencies, future system vulnerabilities, and FAA’s plans to improve information security; interviewed the NAS Information Security (NIS) group to determine its plans to improve ATC information security and reviewed its NAS Information Security Action Plan; and reviewed the President’s Commission of Critical Infrastructure Protection’s (PCCIP) final report, Critical Foundations, Protecting America’s Infrastructures, October 1997, and its supplemental report, Vulnerability Assessment of the FAA National Airspace Systems (NAS) Architecture, October 1997, to determine future ATC systems security vulnerabilities. To determine the effectiveness of FAA’s management structure and implementation of policy for computer security, we reviewed FAA Order 1600.6C, Physical Security Management Program (dated April 1993), Order 1600.54B, FAA Automated Information Systems Security Handbook (dated February 1989), and Order 1600.66, Telecommunications and Information Systems Security Policy (dated July 1994), to determine what organizations are assigned responsibility for developing, implementing, and enforcing ATC computer security policyand interviewed officials from the Offices of Civil Aviation Security, Air Traffic Services, and Research and Acquisitions to determine what organizations are responsible for developing, implementing, and enforcing ATC computer security policy. In addition, we interviewed the Associate Administrators for Civil Aviation Security and for Research and Acquisitions and the Director of Airway Facilities under the Associate Administrator for Air Traffic Services to determine why ATC computer security policies have not been adequately implemented and enforced. We performed our work at FAA headquarters in Washington, D.C., from April 1997 through January 1998 in accordance with generally accepted government auditing standards. ATC Physical Security Management and Controls Are Ineffective ATC systems used to control aircraft reside at, or are associated with, a variety of ATC facilities including towers, TRACONs, and en route centers. FAA policy, dated April 1993, required that these facilities be inspected by April 1995 and that annual or triennial follow-up inspections be conducted depending on the type of facility to determine the status of physical security at each facility. These inspections determine whether the facility meets the physical security standards established in FAA policy and are the basis for accrediting ATC facilities (i.e., concluding that they are secure). FAA is not effectively managing physical security at ATC facilities. Known physical security weaknesses exist at many ATC facilities. For example, an inspection of a facility that controls aircraft disclosed 26 physical security findings including (1) fire protection systems that failed to meet minimum detection and suppression standards and (2) service contract employees that were given unrestricted access to sensitive areas without having appropriate background investigations. FAA recently confirmed its physical security weaknesses when it performed detailed assessments of several key ATC facilities following the Oklahoma City bombing to determine physical security risks and the associated security measures and costs required to reduce these risks to an acceptable level. For example, an assessment of a facility that controls aircraft concluded that access control procedures are weak to nonexistent and that the center is extremely vulnerable to criminal and terrorist attack. In addition, FAA is unaware of physical security weaknesses that may exist at other FAA facilities. For example, FAA has not assessed the physical security controls at 187 facilities since 1993 and therefore does not know how vulnerable they are. Until FAA inspects its remaining facilities, it does not know if they are secure and if the appropriate controls are in place to prevent loss or damage to FAA property, injury to FAA employees, or compromise of FAA’s capability to perform critical air safety functions. ATC Operational System Security Is Ineffective and Systems Are Vulnerable FAA policy requires that all ATC systems be certified and accredited. A risk assessment, which identifies and evaluates vulnerabilities, is a key requirement for certification and accreditation. We recently reported that leading information security organizations use risk assessments to identify and manage security risks confronting their organizations. FAA has not assessed, certified, or accredited most operational ATC systems. A review conducted for FAA’s Office of Civil Aviation Security in October 1996 concluded that FAA had not conducted risk assessments on 83 of 90, or over 90 percent, of all operational ATC systems. FAA officials told us that this assessment is an accurate depiction of the agency’s knowledge regarding operational systems security. As a result, FAA does not know how vulnerable these operational ATC systems are and consequently has no basis for determining what protective measures are required. Further, the review concluded that of the 7 systems assessed, only 3 resulted in certifications because 4 systems did not have the proper certification documentation. Accordingly, less than 4 percent of the 90 operational systems are certified. In addition, FAA has not assessed most ATC telecommunication systems. For example, FAA’s officials responsible for maintaining the nine FAA-owned and leased communication networks told us that only one has been assessed. Such poor security management exists despite the fact that FAA’s 1994 Telecommunications Strategic Plan stated that “vulnerabilities that can be exploited in aeronautical telecommunications potentially threaten property and public safety.” FAA’s 1997 Telecommunications Strategic Plan continues to identify security of telecommunication systems as an area in need of improvement. Office of Civil Aviation Security officials told us that they were not aware of a single ATC system that was accredited. We found similar results when we reviewed six operational systems to determine if they were assessed, certified, or accredited. Risk assessments had been conducted and certification reports written for only two of the systems, while none of the systems had been accredited. The Associate Administrator for Civil Aviation Security, who is responsible for accrediting systems, told us that FAA has decided to spend its limited funds not on securing currently operating systems, but rather on developing new systems and that FAA management is reluctant to acknowledge information security threats. FAA claims that because current ATC systems often utilize custom-built, 20-year-old equipment with special purpose operating systems, proprietary communication interfaces, and custom-built software, the possibilities for unauthorized access are limited. While these configurations may not be commonly understood by external hackers, one cannot conclude that old or obscure systems are, a priori, secure. In addition, the certification reports that FAA has done reveal operational systems vulnerabilities. Furthermore, archaic and proprietary features of the ATC system provide no protection from attack by disgruntled current and former employees who understand them. FAA Is Not Effectively Managing Security for New ATC Systems Essential computer security measures can be provided most effectively and cost efficiently if they are addressed during systems design. Retrofitting security features into an operational system is far more expensive and often less effective. Sound overall security guidance, including a security architecture, security concept of operations, and security standards, is needed to ensure that well formulated security requirements are included in specifications for all new ATC systems. FAA has no security architecture, security concept of operations, or security standards. As a result, implementation of security requirements across ATC development efforts is sporadic and ad hoc. Of the six current ATC system development efforts that we reviewed, four had security requirements, but only two of the four developed their security requirements based on a risk assessment. Without security requirements based on sound risk assessments, FAA lacks assurance that future ATC systems will be protected from attack. Further, with no security requirements specified during systems design, any attempts to retrofit security features later will be increasingly costly and technically challenging. An FAA June 1993 report to the Congress on information security states that because FAA lacks a security architecture to guide the development of ATC security measures, technical security requirements will be retrofitted or not implemented at all because the retrofit “could be so costly or technically complex that it would not be feasible.” In April 1996, the Associate Administrator for Research and Acquisitions established the National Airspace Systems (NAS) Information Security (NIS) group to develop, along with other security initiatives, the requisite security architecture, security concept of operations, and security standards. The NIS group has developed a mission need statement that asserts that “information security is the FAA mission area with the greatest need for policy, procedural, and technical improvement. Immediate action is called for, to develop and integrate information security into ATC systems throughout their life cycles.” FAA has estimated that it will cost about $183 million to improve ATC information security. The NIS group has developed an action plan that describes each of its proposed improvement activities. However, over 2 years later it has not developed detailed plans or schedules to accomplish these tasks. As FAA modernizes and increases system interconnectivity, ATC systems will become more vulnerable, placing even more importance on FAA’s ability to develop adequate security measures. These future vulnerabilities are well documented in FAA’s information security mission need statement and also in reports completed by the President’s Commission on Critical Infrastructure Protection. The President’s Commission summary report concluded that the future ATC architecture appears to have vulnerabilities and recommended that FAA act immediately to develop, establish, fund, and implement a comprehensive systems security program to protect the modernized ATC system from information-based and other disruptions, intrusions, and attacks. It further recommended that this program be guided by the detailed recommendations made in the NAS vulnerability assessment. FAA’s Management Structure Is Not Effectively Implementing and Enforcing Computer Security Policy FAA’s management structure and implementation of policy for computer security has been ineffective: the Office of Civil Aviation Security has not adequately enforced the security policies it has formulated; the Office of Air Traffic Services has not adequately implemented security policy for operational ATC systems; and the Office of Research and Acquisitions has not adequately implemented policy for new ATC systems development. For example, the Office of Civil Aviation Security has not enforced FAA policies that require the assessment of physical security controls at all ATC facilities and vulnerabilities, threats, and safeguards for all operational ATC computer systems; the Office of Air Traffic Services has not implemented FAA policies that require it to analyze all ATC systems for security vulnerabilities, threats, and safeguards; and the Office of Research and Acquisitions has not implemented the FAA policy that requires it to include, in specifications for all new ATC modernization systems, requirements for security based on risk assessments. FAA established a central security focal point, the NIS group, to develop additional security guidance (i.e., a security architecture, a security concept of operations, and security standards), to conduct risk assessments of selected ATC systems, to create a mechanism to respond to security incidents, and to provide security engineering support to ATC system development teams. The NIS group includes members from the Offices of Civil Aviation Security, Air Traffic Services, and Research and Acquisitions. Establishing a central security focal point is a practice employed by leading security organizations. In order to be effective, the security focal point must have the authority to enforce the organization’s security policies or have access to senior executives that are organizationally positioned to take action and effect change across organizational divisions. One approach for ensuring that a central group has such access at FAA would be to place it under a Chief Information Officer (CIO) who reports directly to the FAA Administrator. This approach is consistent with the Clinger-Cohen Act, which requires that major federal departments and agencies establish CIOs who report to the department/agency head and are responsible for implementing effective information management. FAA does not have a CIO reporting to the Administrator. Although the NIS group has access to certain key Associate Administrators (e.g., the Associate Administrator for Civil Aviation Security and the Associate Administrator for Research and Acquisitions), it does not have access to the management level that can effect change across organizational divisions (e.g., FAA’s Administrator or Deputy Administrator). Thus, there is no assurance that the NIS group’s guidance, once issued, will be adequately implemented and enforced, that results of its risk assessments will be acted upon, and that all security breaches will be reported and adequately responded to. Until existing ATC computer security policy is effectively implemented and enforced, operational and developmental ATC systems will continue to be vulnerable to compromise of sensitive information and interruption of critical services. In addition, OMB Circular A-130, Appendix III, requires that systems, such as ATC systems, be accredited by the management official who is responsible for the functions supported by the systems and whose mission is adversely affected by any security weaknesses that remain (i.e., the official who owns the operational systems). At FAA, this management official is the Associate Administrator for Air Traffic Services. However, FAA’s ATC systems authorizing official is the Associate Administrator for Civil Aviation Security, who does not own the operational ATC systems. Conclusions Since physical security is the agency’s first line of defense against criminal and terrorist attack, failure to strengthen physical security controls at ATC towers, TRACONs, and en route centers places property and the safety of the flying public at risk. Information system security safeguards, either those now in place or those planned for future ATC systems, cannot be fully effective as long as FAA continues to function with significant physical security vulnerabilities. Also, because FAA has not assessed physical security controls at all facilities since 1993, it does not know how vulnerable they are. Similarly, FAA does not know how vulnerable its operational ATC systems are and cannot adequately protect them until it performs the appropriate system risk assessments and certifies and accredits ATC systems. In addition, FAA is not effectively incorporating security controls into new ATC systems. FAA has taken preliminary steps to develop security guidance by forming the NIS group and estimating the cost to fill this void. However, until this group develops the guidance and the ATC development teams apply it, new ATC system development will not effectively address security issues. Until FAA’s three organizations responsible for ATC system security carry out their computer security responsibilities adequately, sensitive information is at risk of being compromised and flight services interrupted. Moreover, central security groups assigned to assist these organizations can only be successful if they have the authority to enforce their actions or a direct line to top management to ensure that needed changes can be implemented across organizational divisions. At FAA this central security group has neither. Finally, FAA’s designated ATC system accrediting authority is inconsistent with federal guidance and sound management practices since this designee is not responsible for the daily operations of ATC systems. Recommendations Given the importance of physical security at the FAA facilities that house ATC systems, we recommend that the Secretary of Transportation direct the FAA Administrator to complete the following tasks: Develop and execute a plan to inspect the 187 ATC facilities that have not been inspected in over 4 years and correct any weaknesses identified so that these ATC facilities can be granted physical security accreditation as expeditiously as possible, but no later than April 30, 1999. Correct identified physical security weaknesses at inspected facilities so that these ATC facilities can be granted physical security accreditation as expeditiously as possible, but no later than April 30, 1999. Ensure that the required annual or triennial follow-up inspections are conducted, deficiencies are promptly corrected, and accreditation is kept current for all ATC facilities, as required by FAA policy. Given the importance of operational ATC systems security, we recommend that the Secretary of Transportation direct the FAA Administrator to complete the following tasks: Assess, certify, and accredit all ATC systems, as required by FAA policy, as expeditiously as possible, but no later than April 30, 1999. Ensure that all systems are assessed, certified, and accredited at least every 3 years, as required by federal policy. To improve security for future ATC modernization systems, we recommend that the Secretary of Transportation direct the FAA Administrator to ensure that specifications for all new ATC systems include security requirements based on detailed security assessments by requiring that security requirements be included as a criterion when FAA analyzes new systems for funding under its acquisition management system and the NIS group establishes detailed plans and schedules to develop a security architecture, a security concept of operations, and security standards and that these plans are implemented. We further recommend that the Secretary report FAA physical security controls at its ATC facilities, operational ATC system security, and the lack of information security guidance (e.g., a security architecture, a security concept of operations, and security standards) as material internal control weaknesses in the department’s fiscal year 1998 FMFIA report and in subsequent annual FMFIA reports until these problems are substantially corrected. Finally, we recommend that the Secretary of Transportation direct the FAA Administrator to establish an effective management structure for developing, implementing, and enforcing ATC computer security policy. Given the importance and the magnitude of the information technology initiative at FAA, we are expanding on our earlier recommendation that a CIO management structure similar to the department-level CIOs as prescribed in the Clinger-Cohen Act be established for FAA by recommending that FAA’s CIO be responsible for computer security. We further recommend that the NIS group report to the CIO and that the CIO direct the NIS group to implement its plans. In addition, we recommend that the CIO designate a senior manager in Air Traffic Services to be the ATC operational accrediting authority. We made two additional recommendations pertaining to operational ATC systems security in our “Limited Official Use” report. Agency Comments and Our Evaluation The Department of Transportation provided written comments on a draft of our “Limited Official Use” report. In summary, the department recognized that facility, systems, and data security are critical elements in FAA’s management of the nation’s ATC systems and that adequate physical security controls are important to ensure the safety of employees and ATC systems. The department agreed that required FAA inspections should be completed and said that immediate action had been directed to inspect and, where appropriate, accredit the 187 facilities identified in the draft report, that inspections had already been completed for about 100 of these facilities, and that completion of the remaining inspections was expected by June 1998. However, the department did not state what, if any, specific action it would take on the remaining 14 recommendations. Further, while the department did not dispute any of the facts presented, it offered alternative interpretations of some of them. For example, the department did not agree that FAA’s management of computer security has been inappropriate or that ATC systems are vulnerable to the point of jeopardizing flight safety. In addition, the department stated that the report does not present a complete picture regarding decisions guiding FAA resource allocation in that it does not recognize the basis for FAA decisions to allocate resources to other concerns facing FAA, rather than to correcting computer security vulnerabilities. We do not agree with these alternative interpretations. As discussed in the report, FAA’s management of facility, systems, and data security is ineffective for the following reasons: Known physical security weakness persist at many ATC facilities, and FAA is unaware of weaknesses that may exist at another 187 facilities. FAA has not analyzed the threats and vulnerabilities, or developed safeguards to protect 87 of its 90 operational ATC computer systems and 8 of its 9 operational ATC telecommunications networks. FAA does not have a well-defined security architecture, a security concept of operations, or security standards, and does not consistently include well formulated security requirements in specifications for new ATC systems. None of the three organizations responsible for ATC security have discharged their respective security responsibilities effectively: the Office of Civil Aviation Security has not adequately enforced FAA policies that require the assessment of (1) physical security controls at all ATC facilities and (2) vulnerabilities, threats, and safeguards of all operational ATC computer systems; the Office of Air Traffic Services has not implemented FAA policies that require it to analyze all ATC systems for security vulnerabilities, threats, and safeguards; and the Office of Research and Acquisitions has not implemented FAA policy that requires it to formulate requirements for security in specifications for all new ATC modernization systems. FAA has recognized for several years that its vulnerabilities could jeopardize, and have already jeopardized, flight safety. In its 1994 Telecommunications Plan, FAA states that vulnerabilities that can be exploited in aeronautical telecommunications potentially threaten property and public safety. Vulnerabilities that have jeopardized flight safety are discussed in our “Limited Official Use” report. Finally, making judicious decisions regarding resource allocation requires a thorough understanding of relative levels of risk, as well as reliable estimates of costs. As we have reported, FAA has not fully assessed its security vulnerabilities and threats and does not understand its security risks. Further, since it has not formulated countermeasures, it cannot reliably estimate the cost to mitigate the risks. As a result, FAA has no analytical basis for its decisions not to allocate resources to security. In recent years, FAA has invested billions of dollars in failed efforts to modernize its ATC systems while critical security vulnerabilities went uncorrected. The department’s comments and our detailed evaluation of them are presented in our “Limited Official Use” report. As agreed with your office, unless you publicly announce the contents of this report earlier, we will not distribute it until 30 days from its date. At that time, we will send copies to the Secretary of Transportation; the Director, Office of Management and Budget; the Administrator, Federal Aviation Administration; and interested congressional committees. Copies will be available to others upon request. If you have any questions about this report, please call me at (202) 512-6253. I can also be reached by e-mail at willemssenj.aimd@gao.gov. Major contributors to this report are listed in appendix I. Major Contributors to This Report Accounting and Information Management Division, Washington, D.C. Dr. Rona B. Stillman, Chief Scientist for Computers and Telecommunications Keith A. Rhodes, Technical Director Randolph C. Hite, Senior Assistant Director Colleen M. Phillips, Assistant Director Hai V. Tran, Technical Assistant Director Nabajyoti Barkakati, Technical Assistant Director David A. Powner, Evaluator-in-Charge Barbarol J. James, ADP/Telecommunications Analyst The first copy of each GAO report and testimony is free. Additional copies are $2 each. Orders should be sent to the following address, accompanied by a check or money order made out to the Superintendent of Documents, when necessary. VISA and MasterCard credit cards are accepted, also. Orders for 100 or more copies to be mailed to a single address are discounted 25 percent. U.S. General Accounting Office P.O. Box 37050 Washington, DC 20013 Room 1100 700 4th St. NW (corner of 4th and G Sts. NW) U.S. General Accounting Office Washington, DC Orders may also be placed by calling (202) 512-6000 or by using fax number (202) 512-6061, or TDD (202) 512-2537. Each day, GAO issues a list of newly available reports and testimony. To receive facsimile copies of the daily list or any list from the past 30 days, please call (202) 512-6000 using a touchtone phone. A recorded menu will provide information on how to obtain these lists.

Summary: Pursuant to a congressional request, GAO reviewed the Federal Aviation Administration's (FAA) computer security practices, focusing on: (1) whether FAA is effectively managing physical security at air traffic control (ATC) facilities and systems security for its current operational systems; (2) whether FAA is effectively managing systems security for future ATC modernization systems; and (3) the effectiveness of FAA's management structure and implementation of policy for computer security. GAO noted that: (1) FAA is ineffective in all critical areas included in GAO's computer security review--facilities physical security, operational systems information security, future systems modernization security, and management structure and policy implementation; (2) in the physical security area, known weaknesses exist at many ATC facilities; (3) FAA is similarly ineffective in managing systems security for its operational systems and is in violation of its own policy; (4) an October 1996 information systems security assessment concluded that FAA had performed the necessary analysis to determine system threats, vulnerabilities, and safeguards for only 3 of 90 operational ATC computer systems, or less than 4 percent; (5) FAA officials told GAO that this assessment is an accurate depiction of the current state of operational systems security; (6) according to the team that maintains FAA's telecommunications networks, only one of the nine operational ATC telecommunications networks has been analyzed; (7) without knowing the specific vulnerabilities of its ATC systems, FAA cannot adequately protect them; (8) FAA is also not effectively managing systems security for future ATC modernization systems; (9) it does not consistently include well formulated security requirements in specifications for all new ATC modernization systems, as required by FAA policy; (10) it does not have a well-defined security architecture, a concept of operations, or security standards, all of which are needed to define and ensure adequate security throughout the ATC network; (11) FAA's management structure and implementation of policy for ATC computer security is not effective; (12) security responsibilities are distributed among three organizations, all of which have been remiss in their ATC security duties; (13) the Office of Civil Aviation Security is responsible for developing and enforcing security policy, the Office of Air Traffic Services is responsible for implementing security policy for operational ATC systems, and the Office of Research and Acquisitions is responsible for implementing policy for ATC systems that are being developed; (14) the Office of Civil Aviation Security has not adequately enforced FAA's policies that require the assessment of physical security controls at all ATC facilities and vulnerabilities, threats, and safeguards for all operational ATC computer systems; and (15) the Office of Research and Acquisitions has not implemented the FAA policy that requires it to formulate requirements for security in specifications for all new ATC modernization systems.

gov_report

en

Summarize: BACKGROUND OF THE INVENTION [0001] 1. Technical Field [0002] The present invention relates generally to a veterinary bathing station and, particularly, to such a station having an improved means for the ingress and egress of an animal to be bathed or groomed. [0003] 2. Description of the Related Art [0004] In veterinary medicine, the traditional areas of practice are divided into large animal practice dealing with, e.g., cows and horses, and small animal practice dealing with, e.g., dogs and cats. In the discussion which follows, the expression “small animal” will be understood to mean, for example, a dog which is to be bathed or groomed, even if the dog in question weighs upward of 50 pounds and is of considerable size. Often, in while in the care of a veterinarian, such small animals must be washed, brushed, clipped and otherwise groomed for health and hygiene reasons. Veterinarian and professional groomers generally have specialized bathing stations for use in washing and grooming small animals. The bathing stations are often raised above the surrounding support surface, i.e., the floor of the building, to approximately waist height to make it easier to wash and groom the animal. Typically, the bathing stations have high sides to prevent splashing and to keep the animal from escaping. When washing a large dog, it is difficult to lift the dog into the washing station. Back strains or other injuries can occur if the animal is heavier than expected or if the animal begins to squirm or to resist being lifted. [0005] Thus, there is a need for an improved veterinary bathing station that is more convenient and comfortable to use with small animals such as larger dogs. BRIEF SUMMARY OF THE INVENTION [0006] It is an object of the present invention to provide a veterinary bathing station that is more convenient and comfortable to use and yet which is relatively economical to manufacture. [0007] It is another object of the present invention to provide a veterinary bathing station which provided improved ingress and egress for a small animal such as a larger dog. [0008] It is yet another object of the present invention to provide a veterinary bathing station that will reduce the risk of injury to the user. [0009] The above objects are achieved by providing a veterinary bathing station including a washing stall having a bottom wall and surrounding side walls, at least one of the surrounding side walls having an opening of sufficient size to allow an animal to pass through. A plurality of leg elements are provided for elevating the bottom wall of the washing stall above a surrounding support surface a selected distance, wherein an open space is created between the bottom wall and the surrounding support surface. The stall also includes a ramp having an inclined ramp surface defined between a top end and a bottom end of the ramp for allowing ingress and egress of an animal from the surrounding support surface through the wall opening without the necessity of lifting the animal. A rotatable coupling attaches the top end of the ramp to the bottom wall of the washing stall, whereby the ramp is rotatable about a vertical axis between a retracted position and an extended position into and out of the open space created under the bottom wall of the stall. The extended position serves to align the ramp with the wall opening to thereby allow the animal ingress and egress through the wall opening. [0010] Additional objects, features and advantages will be apparent in the written description which follows. BRIEF DESCRIPTION OF THE DRAWINGS [0011] The novel features believed characteristic of the invention are set forth in the appended claims. The invention itself however, as well as a preferred mode of use, will best be understood by reference to the following detailed description of an illustrative embodiment when read in conjunction with the accompanying drawings, wherein: [0012] [0012]FIG. 1 is a perspective view of the veterinary bathing station of the present invention showing an animal to be groomed in phantom lines within the stall enclosure of the station. [0013] [0013]FIG. 2 is a simplified top view of the veterinary bathing station of FIG. 1 showing the extended and retracted positions of the rotatable ramp. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT [0014] With reference to FIG. 1, a veterinary bathing station 102 for washing a small animal such as a large dog is shown. The bathing station 102 comprises a washing stall 104 having an initially open interior 116 defined by a side walls 106, 108 and 110 and front washing wall 112. A bottom wall 202 having a top planar surface 208 and a bottom planar surface 210 complete the enclosure. The entire bathing station 102 can be made of any conveniently available water resistant material that is structurally sound but is preferably made of stainless steel. A particularly preferred material is 16 gauge type 304 stainless steel. While the bathing station 102 has been shown as a generally rectangular enclosure, it will be understood that other wall configurations might be utilized as well, such as, for example, an oval configuration. [0015] In the case of the bathing station illustrated in FIG. 1, the stall bottom wall or floor 202 measures approximately 4-6 feet in length by 1-3 feet in width such that there is sufficient room to turn a large dog around to reach the dog&#39;s hind quarter. Walls 108 and 110 are approximately 1-3 feet in width and match the width of the bottom wall 202. The side wall 106 and washing wall 112 are approximately 4-6 feet in length and also match the dimensions of the stall floor 202. The washing wall 112 is approximately 3-5 feet in height in order to contain splashes and splatters and to help prevent against water damage to the surrounding areas but is low enough to allow the user to easily reach the stall interior in order to place an animal within the enclosure. The overall dimensions of the bathing station 102 may be roughly 60″W×66″H×29″D. [0016] The edges and corners of the washing stall 104 and in particular the exposed portions of the washing wall 112 are rounded and may be covered with a cushioning type of material such as a rubber sleeve or coating to help prevent an animal or user from coming into contact with the corner regions. The walls and floor of the washing stall may be welded, forged, or otherwise formed into the enclosed shape illustrated in FIG. 1. [0017] The front portion of the stall interior contains a bathing faucet 140 of conventional design. The bathing faucet 140 preferably has a swing nozzle or utility spray that allows the user to reach the full span of the stall. The utility spray may have a flexible stainless steel hose, typically about 72 inches in length. The front portion 124 may also include a wall hook for hanging the hose when not in use. [0018] The stall floor 202 has a drain port 204 (FIG. 2). The drain port 204 in the illustrated embodiment is located in the front interior region of the stall floor and is centered along a central axis 206 of the floor 202. The floor 202 preferably slopes to the drain port 204, the slope being in the range from about 0° to about 5° such that water or other material will flow towards the drain but not such a slope that a wet animal would have difficulty standing on the slick, wet surface and be unable to gain a secure footing. A “star” break centered around the drain port 204 may help prevent water from collecting in the corners of the stall 104. [0019] As seen in FIG. 1, the stall is supported by leg elements support members 136. The leg elements 136 are preferably provided with adjustable feet 138 to compensate for uneven flooring or to adjust the height of the stall 202 to approximately 2-4 feet from the ground. The support members 136 themselves may also be adjustable. In addition, the feet 138 may include mounting plates to secure the bathing station 102 to the surrounding support surface of flooring. [0020] The washing wall 112 has an opening 114 of sufficient size to allow an animal ingress and egress to the stall interior. The opening 114 illustrated in FIG. 1 is approximately 2 feet wide and extends from the top edge 142 of the washing wall 110 to about 0.5-3 inches from the bottom 144 of the washing wall 110. Thus, the opening does not extend down the entire height of the washing wall 112 to the floor 202, but rather produces a lip 146. The lip 146 helps prevent water from being splashed outside the stall 104 when the animal exits and generally obviates the need to seal the bottom of the opening 114. The opening 114 may have a hinged or sliding door 118 that can be secured by latch 120, a hook, or some other means such as a magnet that can secure the door 118 in an open or closed position. The door 118 may be designed such that a lip seal is formed when the door 118 is shut or it may have a rubber lining that allows for the door 118 to be reasonably sealed with the washing wall 112 when in the closed position. The door 118 illustrated in FIG. 1 is mounted on hinges 122 which allow the door to swing open towards the interior of the stall. When closed, the door should be flush with the wall so a relatively smooth side is produced on both the inner portion 116 and outer portion of the washing basin 104. [0021] A rotatable coupling or swivel 130 is located on the bottom planar surface of the floor 210 of the stall. The coupling is located on the centerline 206 shown in FIG. 2. The rotatable coupling 130 is capable of rotating at least 90° about a vertical axis 131 located on the centerline 206. The rotatable coupling supports a ramp 128. The ramp 128 is generally between about ½ and 2 feet wide and has an inclined ramp surface defined between a top end 130 and a bottom end 131. The ramp surface allows ingress and egress of an animal from the surrounding support surface through the wall opening without the necessity of lifting the animal. The rotatable coupling thus attaches the top end 130 of the ramp to the bottom wall 202 of the washing stall, whereby the ramp is rotatable about the vertical axis 131 into and out of the open space created under the bottom wall of the stall between a retracted position and an extended position. The extended position illustrated in solid lines in FIGS. 1 and 2 serves to align the ramp with the wall opening to thereby allow the animal ingress and egress through the wall opening. [0022] Preferably, the ramp bottom end 131 is solely supported by ball bearing swivel casters 134 which allow the bottom end 131 of the ramp 128 to slide, glide, or roll across the floor. The slope of the ramp 128 is steep enough so that it can slide under the washing basin 104 when not in use and still provide a means for easy access to the opening 114 but does not an unreasonable large pitch making walking up the ramp difficult. The ball bearings casters 134 allow the ramp 128 to move with very little applied force. The ramp may also be provided with a lock or soft stop which holds the ramp 128 in the extended position so there is very little movement when the animal is using the ramp 128. The ramp 128 may be covered with a rubber matt or some other non-slip type surface. [0023] An invention has been provided with several advantages. The bathing station of the invention provides a water tight enclosure with ease of access for a small animal, including large dogs which would otherwise be difficult to lift and maneuver. The animal can be easily led up the ramp 128, through the opening 114 and into the stall 104. Once the animal is in the stall 104, the door 118 may be closed and latched so a reasonably water tight seal is created around the stall enclosure. The ramp 128 is moved by the user to a position underneath the stall 104. Because the ramp 128 is connected to the stall by a rotatable connection, the user can simply pushing the ramp in the direction underneath the washing basin 104 by using the foot or leg. Once the animal is bathed, the ramp is moved from underneath the washing basin 104 to a position that will allow the animal to walk down the ramp. The ramp can then again be moved to the retracted position underneath the bottom wall of the stall. Because the animal does not have to be lifted over the side walls to an elevated position, the user is spared the likelihood of potential injuries. [0024] It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that structures and methods within the scope of these claims and their equivalents be covered thereby.

Summary: A veterinary bathing station for washing animals is shown which includes a stall having a bottom wall and enclosing sidewalls. One of the sidewalls has a door opening for ingress and egress of an animal to be bathed or groomed. A ramp is connected to the stall bottom wall by a rotatable coupling and can be rotated between a retracted and extended positions which allow the ramp to easily rotate in and out of the open space created under the bottom wall of the washing stall to thereby allow the animal ingress and egress through the wall opening.

big_patent

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims priority to the following U.S. Provisional Patent Application: Provisional Patent Application No. 62/022650, entitled “Utility Device,” filed on Jul. 9, 2014 the entire contents of which is hereby incorporated by reference. Field [0002] The present invention relates generally to a single, compact device comprising a comb and at least one additional tool such as a screwdriver, wrenches, a chip clip, a bottle opener, a storage portion, or a stand used for propping up a personal device for viewing. BACKGROUND [0003] Human beings have been using combs for more than 5,000 years. In fact, combs are among the oldest tools found by archeologists, having been discovered in very refined forms from settlements dating back to 5,000 years ago. Combs come in all manner of sizes and uses, e.g., for combing human hair, pet hair, fibers, etc. They are often adorned with decorations such as jewels or carvings. A small, portable version of a comb is known as a pocket comb. [0004] Pocket combs have the advantage of being compact, which makes them perfect for transport in one&#39;s pocket. In order for the pocket comb to withstand the various flexion forces placed on it during an average day spent in an individual&#39;s pocket, however, these combs must be designed to withstand bending that will occur by virtue of being placed in an individual&#39;s back pocket. [0005] Viewed independently, a comb is a tool capable of performing a single function—combing. For reasons of efficiency, it is sometimes desirable to combine multiple tools into a single housing. One of the reasons why designers seek to create a single tool having more than one functionality is to reduce the number of tools an individual needs to have in order to perform more than one function. Combination tools are more efficient than having to have numerous individual tools to perform numerous functions. Moreover, combining tools into a single tool body reduces the amount of space needed to store or transport the tools. [0006] An example of a combination tool can be found in U.S. Pat. No. 4,007,928, entitled “Golfer&#39;s Combination Tool,” which combines a shoe horn with a divot repair device. Similarly, U.S. Pat. No. 5,495,630 entitled “Dart Tool,” allows users to perform many functions associated with playing darts such as: extracting a broken dart tip from a target, tightening or loosening a connection between a dart tip and its barrel, and loosening a flight lock on the dart. [0007] The idea of combining different functions within a comb is also known in the art. For example, U.S. Pat. No. 4,709,475, entitled “Combination Comb, Hair Trimmer, and Safety Razor,” combines several functions, which allow a user to perform hygienic maintenance functions such as hair cutting, hair styling, hair trimming, and shaving. Similarly, U.S. Pat. No. 5,884,633, entitled “Combination Comb, Brush, and Teaser Apparatus,” combines a multitude of hair styling tools into a single device. Although these combing devices provide additional functions beyond simply combing, the additional functions they facilitate are limited to personal hygiene. [0008] It is also desirable to reduce the size of pocket combs so that they take up less space in one&#39;s pocket or wallet. In reducing the size, it is important to note that pocket combs must still maintain structural integrity so that they do not snap or bend when placed under various flexion forces as part of their normal wear and tear. In the spirit of reducing the overall size of the pocket comb, U.S. Pat. No. 4,513,842, entitled “Credit Card Hair Comb,” discloses a “hair comb sized similar to a credit card and structured to meet the flexion requirements of being housed in a wallet or credit card holder.” Id. at Abstract. [0009] Combining the notion of a compact comb with the desirability of having a comb that can perform multiple grooming functions, U.S. Pat. No. 6,206,010, entitled “Credit Card Shaped Grooming Device,” discloses a flexible sheet approximately the size of a credit card comprising a comb, minor, nail file, and pick. Again, this multipurpose combing device is limited to performing grooming functions. [0010] Although it is advantageous to have a single, compact comb that can perform more than one grooming task, it is desirable to have a compact comb that can perform grooming tasks, as well as additional functions, such as, tightening or loosening a screw, bolt, or nut, opening a bottle, acting as a storage space for hair bands, or being capable of being used as a stand for a personal device, such as a mobile phone or tablet. SUMMARY OF THE INVENTION [0011] The invention disclosed herein overcomes some of the shortcomings of the prior art by disclosing a compact comb that additionally includes tools capable of performing functions unrelated to personal grooming Specifically, the embodiments disclosed herein are comprised of a compact comb combined with at least one additional tool chosen from the group consisting of: a screwdriver, a wrench, a bottle opener, a chip clip, a retention device and a positioning device. In this way, a user is able to comb his/her hair or the hair of another individual, pet, or fiber as well as perform additional functions such as tightening or loosening a screw, bolt, or nut; opening a bottle; storing elastic bands, hair bands, ear buds and the like; or creating a stand for a personal device, such as a phone or tablet. [0012] In one embodiment, the inventors disclose a compact, multifunctional tool comprising a substantially flat, monolithic tool body wherein the monolithic tool body is further comprised of: a comb; and at least one tool formed in or on the monolithic tool body by a cutout or contour, wherein the at least one tool is chosen from the group consisting of a screwdriver, a wrench, a chip clip, a bottle opener, a retention device and a positioning device. [0013] In an alternate embodiment, the monolithic tool body of the multifunctional tool of is formed of metal, plastic, wood, ceramic, carbon fiber, or rubber. [0014] In yet an alternate embodiment, the monolithic tool body of the multifunctional tool is hardened. [0015] In an alternate embodiment, the dimensions of the monolithic tool body of the multifunctional tool are less than about one and one half of the size of a credit card. In still another embodiment, the dimensions of the monolithic tool body of the multifunctional tool are less than about the size of a credit card. [0016] In an additional embodiment, the comb is further comprised of a plurality of teeth, wherein the teeth have at least two different lengths. [0017] In yet another embodiment, the comb is further comprised of a plurality of teeth, wherein the teeth are tapered such that at least two teeth are wider at a base than at a tip. [0018] In an additional embodiment, the comb is further comprised of a plurality of teeth, wherein a first radius of curvature of one end of the teeth is different than a second radius of curvature at t second end of the teeth. [0019] In still another embodiment, a configuration of the screwdriver is chosen from the group consisting of Phillips, slotted, quadrex, Pozidriv, square recess, square recess tamper resistant, Torx, tamper resistant Torx, Torx plus, tamper resistant Torx plus, hexagonal, tamper resistant hexagonal, Tri-Wing, Spanner, and one way removal tool. [0020] In an additional embodiment, there is a first and a second wrench, wherein the first and second wrenches are of differing sizes. [0021] In an alternate embodiment, a cutout formed in the monolithic tool body is of a size designed to accommodate a personal device. [0022] In a different embodiment, the cutout is further comprised of an edge having a material chosen to enhance the coefficient of friction between the edge and the personal device. [0023] In an additional embodiment, the chip clip is designed so that a retention slot narrows at an upper end. [0024] In an alternate embodiment, the chip clip is designed so that a lower portion of the retention slot is wider than the upper portion of the retention slot. [0025] An additional embodiment encompasses a method for forming a compact, multifunctional tool from a substantially flat monolithic body comprising using a cutting tool to cut a comb tine and at least one at least one tool formed in or on the monolithic tool body by a cutout or contour, wherein the at least one tool is chosen from the group consisting of a screwdriver, a wrench, a chip clip, a bottle opener, a retention device and a positioning device. BRIEF DESCRIPTION OF THE DRAWINGS [0026] FIG. 1A is a front view of an embodiment of a compact multifunctional comb showing dimensional measurements of an embodiment. [0027] FIG. 1B is a side view of a compact multifunctional comb showing a dimensional measurement. [0028] FIG. 2 is a front view of a compact multifunctional comb showing various tools that could be combined with the comb to form a panoply of embodiments disclosed herein. [0029] FIG. 3 is a perspective view of a compact multifunctional comb showing various tools that could be combined with the comb to form a panoply of embodiments disclosed herein. [0030] FIG. 4 is a perspective view of a compact multifunctional comb showing an embodiment having a chip clip. [0031] FIG. 5 is a perspective view of an embodiment of a compact multifunctional comb wherein the multifunctional comb comprises a positioning device. GLOSSARY OF REFERENCE NUMBERS [0032] The following table contains a list of reference numbers used in the figures and specification attendant to the various embodiments of the present invention. [0000] Reference Number Aspect of Embodiments 200 multi-functional tool 202 monolithic tool body 204 comb teeth 206 outer comb tooth 208 inner comb tooth 210 base of comb tooth 212 tip of comb tooth 220 screwdriver 222 first interior cutout 224 second interior cutout 226 chip clip 228 bottle opener 232 first notch 234 second notch 310 first flat edge 312 second flat edge 410 bag of chips 510 personal device DETAILED DESCRIPTION [0033] Those of skill in the art will recognize throughout this specification that when like terms are used to describe features and functionalities of various portions of a particular embodiment, those same features and functionalities could be present in additional embodiments having aspects with like terms. [0034] FIG. 1A shows an embodiment of the present invention wherein some of the dimensions of the compact, multifunctional tool are shown. In embodiments, the height, A, could vary from 40 mm to 68 mm, and the length, B, could range from 63 mm to 107 mm In preferred embodiments, the height and width could be less than the dimensions of a standard credit card, e.g., a credit card that complies with the ISO/IEC 7810 ID-1 standard. According to present size criteria for credit cards complying with ISO/IEC 7810 ID-1 standard, the dimensions of a standard credit card are 85.60×53.98 mm Embodiments of the present invention could, therefore, be less than 85.60×53.98 mm in length, B, and height, A. [0035] FIG. 1A also shows a first radius of curvature R 1 for the upper portion of the comb, and a second radius of curvature R 2 for the base of the comb. In some embodiments, the first radius of curvature R 1 is greater than the second radius of curvature R 2. In these embodiments, it is desirable for the comb to be comfortable to the user. As such, R 1 should match the curvature of the average user&#39;s scalp. Whereas R 2 should be large enough to maintain strength in the body of the tool. Also in some embodiments, the tip of the comb teeth should have as large a radius of curvature as possible. To be most effective, the comb should have a high linear tooth density. Also, the teeth should have increasing thickness toward the base of the tooth in order for the tooth extrusion to be as strong in bending as possible. These factors dictate having a smaller radius of curvature between teeth at the base of the teeth, R 2, than at the tip of the teeth, R 1. [0036] As can be seen from FIG. 1B, the compact, multifunctional tool is generally flat. Additionally, the thickness of the tool, shown as C in FIG. 1B, can vary from 0.5 mm to 2.0 mm Most preferably the thickness of the tool is approximately the same thickness as a standard credit card, specifically in the range of 0.8 mm to 1.3 mm [0037] In certain embodiments, the compact, multifunctional tool could be made of metal (for example and without limitation, stainless steel, ferromagnetic steel, other purpose steels, gold, silver, copper, titanium, or aluminum), wood, plastic, ceramic, carbon fiber, or rubber. Some of these materials could in additional embodiments be subjected to treatment, such as hardening to further strengthen the compact tool. For example, certain forms of both stainless and general purpose steel can be heat treated by tempering the metal in a furnace to the critical temperature to change the molecular structure and then quenching to quickly cool the material and retain the modified molecular structure. In these embodiments, it is desirable to anneal the metal at a lower temperature in the furnace shortly after quenching to restore a certain amount of toughness and reduce the brittleness of the material. [0038] In alternate embodiments, the metal can be “cold” worked, such as cold rolling sheet metal, to impart stress into the bulk of the material, which acts similarly to heat treatment in modifying the physical properties of the material. Proper selection of material is important so that the multifunctional tool can be used for the intended functions without sustaining plastic deformation, as is the case when the applied stress exceeds the yield strength of the material. Hardening the metal, such as with the techniques described above, can help by increasing the yield strength of the material. [0039] FIG. 2 shows an embodiment of the compact, multifunctional tool 200 comprising a comb 204 and a plurality of additional tools formed in or on the tool body 202. Previous attempts at making multifunction tools that include a comb required assembly of parts constructed using various manufacturing techniques, for instance, plastic injection molding and sheet metal stamping. This assembly increases cost, which can make the tool difficult to successfully retail, and reduces product strength, because the union between materials is inherently either weak or bulky. [0040] The present embodiments overcome these previous limitations in the design of multifunction tools 200 that include a comb 204 by applying the construction concept of a monolithic body 202. This monolithic construction allows for the application of tools that require high-strength construction, such as a bottle opener 228, a wrench 222, 224, or a screwdriver 220, while keeping a low profile so that the multifunction tool 200 is easy to carry. It is inherently difficult to manufacture comb teeth 206, 208 where the spacing between teeth is small enough for the comb 204 to be highly functional, but yet not exceed the limits of the desired manufacturing process. For example, sheet metal stamping typically requires the geometry being removed to be a least twice the thickness of the sheet metal. This means there is either too great a distance between comb teeth 206, 208 for optimal use or the multifunction tool 200 is too weak for the other intended functions. [0041] In one embodiment, the application of fine processes, such as laser cutting, allow for the present invention to achieve the desired balance between maximizing product strength and minimizing comb teeth spacing. In alternate embodiments, the cutting tool could be an electrical discharge machining (EDM), electro-chemical erosion, water jet cutting, or similar techniques known to those skilled in the art. In an alternate embodiment, the compact, multifunctional tool could be created by using a fine blanking stamping die to punch parts out of the sheet metal. In these embodiments, and others that are similar and known to those of skill in the art, the application of fine processes allows for precision edges, shapes, sizes, contours, and notches to be created thereby facilitating the operational and structural capabilities of the tools discussed herein. [0042] Accordingly, in a method embodiment of the present invention, the method is comprised of forming a compact, multifunctional tool from a substantially flat monolithic body comprising using a cutting tool to cut a comb tine and at least one at least one tool formed in or on the monolithic tool body by a cutout or contour, wherein the at least one tool is chosen from the group consisting of a screwdriver, a wrench, a chip clip, a bottle opener, a retention device and a positioning device. In alternate methods, any of the multifunctional tools claimed herein could also be made by the using a cutting tool to cut any of the various tools, edges, cutouts, notches, or enclaves discussed n this specification and in the claims. [0043] In terms of the sizing of the teeth, the outer teeth 206 are longer than the inner teeth 208 in some embodiments. This variation in size allows the comb 204 to flow smoothly over the rounded contours of people&#39;s heads. In alternate embodiments, perhaps designed for combing rugs or animals, the length of the outer teeth 206 could be substantially equally to the length of the inner teeth 208. In alternate embodiments, the teeth 206, 208 could be staggered to facilitate combing of wet, snarled, and/or pet hair. In these embodiments, every other tooth in the comb 204, for example, could be approximately half or three quarters of the height of an adjacent tooth. [0044] Moreover, the base of the teeth 210 is wider than the tip of the teeth 212, which allows for great stability for each of the teeth 206, 208. In addition, the tip of the teeth 212 could be rounded or contoured in some other fashion in order to provide for a smooth and comfortable flow of the comb teeth 206, 208 through an individual&#39;s hair. [0045] In some embodiments, the spacing between the comb teeth 206, 208 could vary depending upon whether the intended recipient of the combing function had thick hair, thin hair, or a coarse or fine weave between fibers. In some embodiments, spacing could be a function of the number of overall teeth 206, 208 in the comb 204, whereas in alternate embodiments spacing between the teeth 206, 208 could be a function of the width of the teeth 206, 208 and the overall length of the compact, multifunctional tool 200. [0046] In addition to the comb 204, the compact, multifunctional tool also includes at least one tool formed in or on the tool body by a cutout or contour, wherein at least one tool is chosen from the group consisting of a screwdriver 220, a wrench 222 or 224, a chip clip 226, a bottle opener 228, a phone or tablet stand, a retention device that can be formed with a first notch 232 and a second notch 234. Embodiments of the compact, multifunctional tool could include a comb 204 and only one of the additional tools listed above. For example, an embodiment of the compact, multifunctional tool could include comb 204 and screwdriver 202. An alternate embodiment could include comb 204 and wrench 222. An alternate embodiment could include comb 204 and wrench 224. An alternate embodiment could include comb 204 and chip clip 226. An alternate embodiment could include comb 204 and wrench 222 or 224, wherein the wrench 222 cutout is customized to facilitate use of the cutout as a stabilizing plane for holding a personal device. An alternate embodiment could include comb 204 and bottle opener 228. An alternate embodiment could include comb 204 and retention device created by a first notch 232 and a second notch 234. Alternate embodiments could have any or all combinations of these tools formed on or in the tool body 202. [0047] In terms of the tools shown in FIG. 2, in alternate embodiments, the screwdriver could have any one of the following head types as well as additional head types known to those of skill in the art: Phillips, slotted, alien key, quadrex, Pozidriv, square recess, square recess tamper resistant, Torx, tamper resistant Torx, Torx plus, tamper resistant Torx plus, hexagonal, tamper resistant hexagonal, Tri-Wing, Spanner, and one way removal tool. The size of the screwdriver head could also vary in alternate embodiments ranging from a very small screwdriver head designed to work with eyeglass screws to a much larger screwdriver head designed to accommodate household, car, bicycle, motorcycle, electronics, or any machine sized screw. [0048] The wrenches 222 or 224 could be open-ended, as shown in FIG. 2, or closed-ended in alternate embodiments. In addition, the sizes of the wrenches 222, 224 could vary from embodiment to embodiment and the sizing could be metric, standard, or a combination thereof if a particular embodiment had two wrenches 222, 224. [0049] The chip clip 226 is essentially a clip that can be used to keep the contents of a bag fresher than would otherwise be the case without a clip to keep the open edges of the bag tightly folded. These types of items are well known by consumers and those skilled in the art and are often referred to as “chip clips” even though they can be used as a clip on a bag of fruits, vegetables, meats, cheeses, pastries, cookies, sandwiches, and so forth. FIG. 4 shows the compact, multifunctional tool being used as a chip clip 226 to securely close a bag of opened chips. Those of skill in the art will appreciate that the chip clip 226 of the present invention could be used to close a bag containing any type of goods, food or otherwise. For example, the chip clip 226 could be used to fasten a bag containing loose screws, paper clips, hardware of any sort, knobs, make-up, all manner of items that one may enclose within a bag. Accordingly, in alternate embodiments, the sizing of the chip clip 226 could vary to accommodate different bag types, for example bags made of: canvas, paper, cloth, vinyl, thin plastic, and so forth. In alternate embodiments, an adhesive or sticky material such as rubber could be placed inside of the chip clip 226 to enhance the ability of the chip clip 226 to form a tight seal when proximal to a bag. [0050] In some embodiments, there may be a bottle opener 228. The bottle opener 228 could be formed on one end by the foot of an animal and on the other by the animal&#39;s chin In FIG. 2, the bottle opener 228 is formed by the foot and chin of a hedgehog. In alternate embodiments, the animal could vary and could for example, without limitation, be a porcupine, an echidna, a wolf, a fox, a tiger, a dog, a peacock, a flamingo, a bear, or any other two or four legged animal, or even human being. [0051] In some embodiments, it may be desirable to personalize the compact, multifunctional tool 200 by having the face of the tool be a particular person, celebrity, super hero, historical figure, cartoon, avatar, movie character, or the like. [0052] A retention device could also be included in alternate embodiments. With reference to FIG. 2, a retention device is created by a first notch 232 and a second notch 234. The retention device could be used to hold an item or a plurality of items in place. By way of example, the retention device could be used to hold hair bands, keys that are on an elastic band, ear buds, a charging cord, a work or other badge on a lanyard, a whistle, and the like. If the item contained elastic properties, a user could simply wrap the elastic around the first notch 232 and the second notch 234 until the elastic tightened thereby securing the item. If, however, the item did not have elastic properties, for example ear buds, the user could wrap the ear buds around the first notch 232 and the second notch 234 in the same way that one roles up a hose until the ear buds were completely wrapped around the first notch 232 and the second notch 234. The user could secure the ear buds by tucking one or both of them into the wrapped wire as s/he secured the ear buds to the monolithic tool body 202. Alternatively, the user could slide the ends of the ear buds between the comb teeth 204 and pull down until the friction between the sides of the teeth 204 and the cord was sufficient to pinch and hold the end firmly in place. [0053] FIG. 3 depicts a perspective view of an embodiment of the invention. In this embodiment, the compact, multifunctional tool 200 includes a plurality of tools, e.g., a screwdriver 220, a first wrench 222, a second wrench, 224, a chip clip 226, a bottle opener 228, and a retention device formed by first notch 232 and second notch 234. FIG. 3 also shows a first flat edge 310 and a second flat edge 312. When the compact, multifunctional tool is rotated counterclockwise 90° and these flat edges 310, 312 are proximal to a solid surface of the compact, multifunctional tool 200, the compact multifunctional tool 200 can also be used as a stand for a personal device. [0054] FIG. 5 depicts this aspect of the present invention. As can be seen in FIG. 5, when the first flat edge 310 and the second flat edge 312 are proximal to a flat surface, a stand is created wherein the stand can steadily secure a device 510. The device could be a mobile telephone, a tablet, a book, a magazine, or any other object for which it would be beneficial for the user to prop up for viewing, reading, drawing, editing, and the like. In embodiments of this nature, the cutouts could be specifically sized to accommodate various different devices or objects as mentioned above. [0055] The cutouts could also include rubber edges or some other type of material affixed to the edges to better secure the specific device/object. If for example, a user desired to secure a hardcover book on a stand, the cutout could be deep enough to be able to accommodate a book. It may also include a small lip to help stabilize the book as well as rubber edges to help prevent slipping. In an alternate embodiment, designed to create a mobile phone stand, the cutout may be narrower in width and may include a rubber edge on all three sides to enhance stability of the contact point between the compact, multifunctional tool 200 and the mobile phone. [0056] The articles “a” and “an” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to include the plural referents. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. [0057] The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention also includes embodiments in which more than one or the entire group of members is present in, employed in or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the listed claims is introduced into another claim dependent on the same base claim (or, as relevant, any other claim) unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. [0058] Where elements are presented as lists, (e.g., in Markush group or similar format) it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity those embodiments have not in every case been specifically set forth in so many words herein. It should also be understood that any embodiment or aspect of the invention can be explicitly excluded from the claims, regardless of whether the specific exclusion is recited in the specification. The entire contents of all of the references (including literature references, issued patents and published patent applications and websites) cited throughout this application are hereby expressly incorporated by reference. [0059] Numerous modifications and alternative embodiments of the present invention will be apparent to those skilled in the art in view of the foregoing description. Accordingly, this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the best mode for carrying out the present invention. Details of the structure may vary substantially without departing from the spirit of the present invention, and exclusive use of all modifications that come within the scope of the appended claims is reserved. Within this specification embodiments have been described in a way which enables a clear and concise specification to be written, but it is intended and will be appreciated, that embodiments may be variously combined or separated without departing from the invention. It is intended that the present invention be limited only to the extent required by the appended claims and the applicable rules of law.

Summary: This invention is directed toward a compact, multifunctional tool and a method of making the compact, multifunctional tool. The embodiments disclosed include a comb and a variety of additional tools including a screwdriver, a wrench, a chip clip, a bottle opener, a retention device for storing headbands, elastics, ear buds, and the like, and a stand for propping up a mobile phone, tablet, book, magazine, and the like. The compact, multifunctional tool is preferably made of a monolithic, substantially flat body having cutouts or contours. The overall size of the compact, multifunctional tool, in a preferred embodiment, is less than the size of a standard credit card. This small size allows users to easily transport the tool in their wallet or pocket. By combining so many tools, each performing a different task, into a monolithic flat, compact body, this invention allows users to carry one small device that enables them to perform a wide variety of functions.

big_patent

en

Summarize: PRIORITY CLAIM [0001] This application is a continuation of U.S. application Ser. No. 10/759,310, now U.S. Pat. No. 6,821,263, filed Jan. 16, 2004, which is a continuation-in-part of U.S. application Ser. No. 09/894,564, now U.S. Pat. No. 6,682,499, filed on Jun. 28, 2001, the entirety of which are hereby incorporated herein by reference. FIELD OF THE INVENTION [0002] The field of this invention is cardiac bypass surgery and cardiopulmonary bypass. BACKGROUND OF THE INVENTION [0003] During cardiac surgery for procedures such as coronary artery bypass grafting, heart valve repair or replacement, septal defect repair, pulmonary thrombectomy, atherectomy, aneurysm repair, aortic dissection repair and correction of congenital defects, cardiopulmonary bypass and cold cardiac ischemic arrest are often required. Typically, a cooled cardioplegia solution, a solution containing elevated levels of potassium, for example, is administered in the antegrade direction (in the direction of normal blood flow) through the patient&#39;s aorta and into the coronary arteries. The cold (2 to 3 degrees centigrade) cardioplegia solution stops the heart from beating and reduces its temperature to minimize damage to the heart during surgery. The cardioplegia solution exits the coronary circulation through the coronary veins at the coronary sinus, where it empties into the right atrium. Cardiopulmonary bypass maintains the peripheral circulation of oxygenated blood to all body organs except the heart during the period of cold, cardioplegic, ischemic arrest. [0004] For some patients, such as those suffering from critical coronary artery stenosis and aortic valve disease, antegrade perfusion may be difficult, inefficient and incomplete. Retrograde (in the direction opposite of normal blood flow) cardioplegia, using current technology, may be administered via the coronary sinus into the coronary circulation using devices, which cannulate the coronary sinus. Such cannulation of the coronary sinus by prior art devices requires inserting a catheter into the coronary sinus and perfusing cardioplegia into the sinus. Drainage of cardioplegia solution is accomplished into the coronary ostea located at the base of the aorta. The problem with prior art methods is that either the right or left heart will be perfused, but not both, since the right coronary veins come off the coronary sinus at an angle and are not cannulated by current catheters that cannulate the left coronary veins. Thus, incomplete perfusion of segments of the heart muscle, primarily the right heart and septum, will occur since the right coronary veins frequently come off near the coronary sinus ostea or within the right atrial wall proper. The right coronary veins are not perfused by prior art retrograde cardioplegic catheters. [0005] Currently surgeons performing cardiac bypass surgery use one or more cannulae for venous drainage and an additional cannula for retrograde perfusion. The multiple cannulae are obstacles and restrict visibility in the surgical arena. Placement of the cardioplegia cannula into the coronary sinus is a semi-blind procedure performed through an additional purse-string suture-closed access port via the right atrium. The retrograde cannula may be improperly positioned within the coronary sinus, which results in critical coronary vessels being inadequately perfused. Typically, placement of currently available retrograde cardioplegia cannula within the coronary sinus results in retrograde perfusion of the left heart but inadequate retrograde perfusion of the right heart because of cannula obstruction of the right coronary ostea as they arise from the coronary sinus. Thus the tissue of the left heart is perfused, in a retrograde direction, with cardioplegia solution but the right heart is perfused with a diminished, or no, supply of cardioplegia solution since the right coronary veins are generally a side-branch of the left coronary veins at the coronary sinus and the right coronary veins are blocked by the cannula. Poor right heart retrograde perfusion occurs because, most-frequently, anatomic variations of the right coronary sinus and veins cannot be properly perfused with the currently available cannula. [0006] New devices and methods are needed, which facilitate cold cardioplegic arrest, yet limit the number of cannulae required to isolate the heart and coronary blood vessels from the peripheral vasculature, arrest the heart, protect all the coronary blood vessels, protect all or most of the myocardium, and drain venous blood from the inferior and superior vena cava. Furthermore, it would be advantageous to the diseased myocardium being subjected to ischemic arrest if a retrograde cardioplegia perfusion cannula could perfuse the coronary vasculature of both the right and left heart simultaneously. SUMMARY OF THE INVENTION [0007] This invention relates to a balloon, or tourniqueted, catheter or cannula useful in the retrograde administration of cardioplegia through the coronary sinus and simultaneous venous drainage during cardiac bypass surgery without the need to cannulate the coronary sinus. [0008] The invention is a cannula for performing venous drainage and retrograde perfusion of the heart during cardiac bypass surgery. A single multi-lumen cannula of the present invention can perform the same function as multiple cannulae currently used. The cannula of the invention for cardioplegic administration can improve the protection of a heart during periods of ischemia such as occurs during open-heart surgery. The cannula is preferably fabricated from materials, which are biocompatible for the intended use. [0009] One embodiment of the invention is a multi-lumen cannula with occlusive structures for the superior and inferior vena cava, a protection structure, cardioplegia infusion channel, a pressure monitoring port, and venous drainage ports. Occlusion structures may include devices such as, but not limited to, balloons, umbrellas, structures that draw a vacuum against a wall of the heart, externally applied tourniquets, umbrellas with rim-seal balloons, or the like. In a preferred embodiment, the occlusion structures are balloons constructed of elastomeric materials or vacuum-assisted walled structures. [0010] In one embodiment, a first lumen of the cannula is connected to the cardioplegia infusion system and provides cardioplegia solution to arrest the heart. A second cannula lumen is connected to the venous drainage system. The drainage ports are located in the second lumen. A third lumen is connected to the balloon inflation system, which provides inflation fluids, such as water, isotonic saline or cardioplegia solution, under controlled pressure or volume to inflate the occlusion balloons. The pressure of the occlusion balloons and right atrium may also be monitored through additional lumens. The occlusion balloons isolate the heart from the peripheral vasculature by occluding the inferior and superior vena cava just proximal to the right atrium. The inferior and superior vena cava balloons utilized to direct flow into the extracorporeal circuit are optionally movable to accommodate anatomic variability. Additional lumens may be utilized for inflation of multiple balloons, pressure monitoring, flow monitoring, drainage of cardioplegia, fluid and drug infusion and the like. Since it is useful to measure cardioplegic perfusion pressure, a pressure transducer or pressure measuring lumen may, for example, be provided at or near the distal end of the cardioplegia perfusion lumen for this purpose. [0011] The cannula may be placed into the vena cava, for example, via a route through the internal jugular vein, cranial vena cava, femoral vein, or brachial vein. A smaller diameter cannula may be placed through any of the smaller venous access ports. The use of smaller venous access ports may be enabled by use of a pump or vacuum powered venous drainage system, typically external to the cannula. In one embodiment, the catheter or cannula combines the functions of several catheters currently used in cardiac surgery. A single catheter, rather than multiple catheters, facilitates the surgery and improves the surgical field because extra cannulae do not obstruct the operative field. In addition, the number of individual catheters is reduced, providing a more cost effective method for cardiac surgery. Most importantly, improved cardiac protection is achieved compared to that of standard retrograde perfusion cannulae. [0012] In yet another embodiment, a single-function venous drainage cannula comprising occlusion balloons, a cannula, a drainage lumen and ports, and a balloon inflation lumen and ports is provided for access through any percutaneous access point and is routed to the right atrium through the venous system. This embodiment would be very useful for emergency cardiac assist. [0013] The cannula of the present invention provides for venous drainage and simultaneous retrograde cardioplegia delivery into the coronary sinus of the heart so that the myocardium of both the right and left heart is perfused. In doing so, the coronary sinus is pressurized. Optionally, some or all of the right atrium is pressurized. Since such pressurization is unnatural for the thin walls of the right atrium, the catheter or cannula, in one embodiment, provides structures that protect the walls of the right atrium from the high perfusion pressures and minimize the risk of wall rupture. These protective structures include double wall balloons that inflate to approximate the interior of the right atrium. The space between the inner wall and the outer wall is ribbed or channeled so that gaps are maintained when a vacuum is drawn in the space between the outer wall and the inner wall of the balloon. The vacuum is drawn through the cannula by a vacuum applied at the proximal end of the cannula by way of a connector. The venous drainage cannula runs through the center of the balloon and allows for venous blood drainage from both the superior and inferior vena cava. The balloon further comprises a walled off region that is disposed laterally relative to the venous drainage cannula and permits pressurization of the coronary sinus with cardioplegia solution which is introduced at the proximal end of the cannula and which flows through a lumen in the cannula to reach the walled-off region. In one embodiment, the protection structure eliminates the need for the occlusive balloons in the vena cava. [0014] In yet another embodiment, the balloon does not require pulling a vacuum but simply inflates to seal off or isolate the walls of the vena cava relative to the walled-off region in which pressurized cardioplegia solution is infused. Seals or gaskets are provided to ensure that such pressure seal is optimized. In yet another embodiment, the vacuum system further comprises an external collection reservoir and plumbing that returns any blood or bodily fluids captured by the vacuum system, to the external cardiopulmonary circuit. [0015] Since the cardioplegia cannula does not cannulate the coronary sinus, it will perfuse both the left and right side of the heart. Perfusion of the right heart may be very important in obtaining optimal patient outcomes following cardiopulmonary bypass. In addition, cold cardioplegic solution will bathe the endomyocardium of the right ventricle aiding in myocardial protection of the right heart. [0016] In one embodiment, a venous cannula is adapted for retrograde administration of cardioplegia solution to a heart and simultaneous venous drainage from a vena cava during cardiopulmonary bypass comprising a cardioplegia solution infusion mechanism, wherein the cardioplegia solution infusion mechanism receives pressurized cardioplegia solution and routes the pressurized cardioplegia solution into a coronary sinus, located in a right atrium of a heart, without cannulating the coronary sinus. The venous cannula further comprises a venous blood drainage mechanism, wherein the venous blood drainage mechanism drains venous blood from a superior and an inferior vena cava. The cannula further comprises a vena cava occlusion mechanism, wherein the vena cava occlusion mechanism occludes the vena cava from the right atrium to prevent pressurized cardioplegia solution from entering the vena cava. The venous cannula further comprises a protection device, wherein the protection device limits pressurization of the right atrium by the pressurized cardioplegia solution. [0017] One aspect of the invention is a method of cannulating a patient&#39;s heart during cardiopulmonary bypass comprising the steps of inserting a cannula into a venous system of a patient and then positioning the cannula so that said cannula traverses a right atrium and extends into both a superior and an inferior vena cava. The method further comprises enabling an occlusion device in each of the superior and inferior vena cava and draining venous blood from the vena cava. The method further comprises inflating a protection balloon within the right atrium and infusing cardioplegia solution, in the retrograde direction, into a coronary sinus of the heart, without cannulating the coronary sinus, wherein the cardioplegia solution is infused through the cannula into the coronary sinus. [0018] In another embodiment of the invention, a venous cannula is adapted for retrograde administration of cardioplegia solution to a heart during cardiopulmonary bypass and comprises a length of axially elongate multi-lumen tubing with a proximal end and a distal end, wherein at least one of the lumens is a cardioplegia solution infusion lumen, and a cardioplegia solution infusion annulus located near the distal end of the multi-lumen tubing the infusion annulus being operably connected to the cardioplegia solution infusion lumen. The venous cannula further comprises an annular seal ring surrounding the cardioplegia solution infusion annulus, wherein a vacuum lumen in the multi-lumen tubing is operably connected to the annular seal ring. The venous cannula also comprises a cardioplegia solution infusion mechanism, wherein the cardioplegia solution infusion mechanism receives pressurized cardioplegia solution from an external cardioplegia solution infusion source and delivers it to the cardioplegia solution infusion lumen. [0019] For purposes of summarizing the invention, certain aspects, advantages and novel features of the invention are described herein. It is to be understood that not necessarily all such advantages may be achieved in accordance with any particular embodiment of the invention. Thus, for example, those skilled in the art will recognize that the invention may be embodied or carried out in a manner that achieves one advantage or group of advantages as taught herein without necessarily achieving other advantages as may be taught or suggested herein. [0020] These and other objects and advantages of the present invention will be more apparent from the following description taken in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS [0021] A general architecture that implements the various features of the invention will now be described with reference to the drawings. The drawings and the associated descriptions are provided to illustrate embodiments of the invention and not to limit the scope of the invention. Throughout the drawings, reference numbers are re-used to indicate correspondence between referenced elements. [0022] FIG. 1 illustrates a longitudinal cross-section of the cannula of the present invention comprising a distal tip, a proximal end, and a connecting tube according to aspects of an embodiment of the invention. External systems provide for venous drainage, cardioplegia infusion, and balloon inflation; [0023] FIG. 2 illustrates a lateral cross-section of a multi-lumen axially elongate tube for construction of the cannula according to aspects of an embodiment of the invention; [0024] FIG. 3 illustrates, in detail, a longitudinal cross-section of the distal tip of the cannula of FIG. 1 according to aspects of an embodiment of the invention; [0025] FIG. 4 illustrates, in detail, a longitudinal cross-section of the proximal end of the cannula of FIG. 1 according to aspects of an embodiment of the invention; [0026] FIG. 5 shows the placement of the cannula of the present invention in the heart for venous drainage and retrograde perfusion according to aspects of an embodiment of the invention; [0027] FIG. 6 illustrates, in exterior view, another embodiment of the cannula comprising multiple balloons to accommodate various anatomic differences according to aspects of an embodiment of the invention. Cutouts on the balloons show features on the cannula surface that would normally be hidden by the balloons; [0028] FIG. 7 illustrates a lateral cross-section of a multi-lumen tube for construction of the cannula of FIG. 6 according to aspects of an embodiment of the invention; [0029] FIG. 8 illustrates a longitudinal cross-section of a cannula comprising a balloon to protect the walls of the vena cava from high pressure during retrograde cardioplegia infusion, according to aspects of an embodiment of the invention; [0030] FIG. 9 illustrates a lateral cross-section of an axially elongate, multi-lumen tube for use in a cannula comprising a balloon to protect the walls of the vena cava from high pressure during retrograde cardioplegia infusion, according to aspects of an embodiment of the invention; [0031] FIG. 10 illustrates a longitudinal cross-section of the distal end of a cannula comprising a laterally directed retrograde cardioplegia delivery annulus and a seal system surrounding the cardioplegia delivery annulus, according to aspects of an embodiment of the invention; and [0032] FIG. 11 illustrates a longitudinal cross-section of a distal end of a cannula comprising a forward directed retrograde cardioplegia delivery annulus, a seal system surrounding the cardioplegia delivery annulus, and a steering mechanism, according to aspects of an embodiment of the invention. DETAILED DESCRIPTION OF THE INVENTION [0033] As used herein the terms distal and proximal are used to clarify the location of various points along the axial length of the venous drainage and retrograde perfusion catheter or cannula. Points are defined with respect to the end grasped by the user and the end that is inserted in the patient in the same manner as would one skilled in the art of medical device catheter construction. The proximal end of the catheter or cannula is defined as that end closest to the user or operator of the catheter or cannula while the distal end of the catheter or cannula is defined as that end that is inserted into the patient. [0034] FIG. 1 illustrates a catheter, tube or cannula 10 of an embodiment of the invention connected to a cardioplegia infusion system or set 12, a venous drainage collection system 14 and an occlusion enabling system 16. In this preferred embodiment, the occlusion enabling system 16 is a balloon inflation system. The catheter 10 comprises a distal tip 18, a proximal end 20, and a length of multi-lumen connection tubing 22. The proximal end 20 comprises a manifold or hub 23. The manifold 23 comprises a cardioplegia infusion adapter or fitting 24, a venous drainage collection adapter or fitting 26, and an occlusion adapter 28. In a preferred embodiment, the occlusion adapter 28 may be a balloon inflation adapter, quick-connect, bayonet, luer fitting, or the like. The manifold 23 is typically molded from materials such as, but not limited to, polymers such as polyvinyl chloride, polycarbonate, ABS, polyimide, poly methyl-methacrylate, or the like. [0035] The cardioplegia infusion adapter 24 is connected to the cardioplegia infusion system 12. The cardioplegia infusion adapter 24 may be any fluid-tight fitting, such as, for example, a luer adapter, quick-connect, or other fluid-tight fitting, suitable for use with the cardioplegia infusion set 12. The standard cardioplegia system 12 generally comprises a pressurized or non-pressurized bag of cardioplegia solution, a roller pump or similar pressurizing system, a length of tubing and a plurality of connectors. Standard cardioplegia solutions include those comprising water, electrolytes such as but not limited to potassium, crystalloid solutions, blood, and the like. [0036] The venous drainage collection adapter 26 is connected to the venous drainage collection system 14. The drainage collection adapter 26 is typically larger in diameter than the balloon inflation fitting 28 or cardioplegia infusion fitting 24. The drainage collection adapter 26 should be capable of being connected to the gravity fed, pump driven or vacuum fed drainage system 14 and is, for example, a ⅜ inch to ½ inch diameter hose barb but could be as small as ⅛ inch in diameter. Standard venous drainage systems 14 generally comprise a connector, a length of tubing and a venous reservoir. Optionally, a vacuum pump may be connected to the venous reservoir. [0037] The balloon inflation adapter 28 is connected to the balloon inflation system 16. The balloon inflation adapter 28 is typically a female luer fitting but may be any fluid-tight fitting suitable for use with an inflation syringe or the like. The standard balloon inflation system 16 comprises a syringe, a volume of balloon inflation fluid such as saline or radiopaque media, and a valve or stopcock associated with each balloon inflation adapter 28. Additionally, the balloon inflation system 16 could comprise a device, such as, for example, a jackscrew, which is a threaded rod moved longitudinally by a longitudinally affixed but rotatable nut, or a pressurized hydraulic cylinder, to advance or withdraw a plunger on the syringe using mechanical advantage. [0038] FIG. 2 shows the cross-section of the connection tubing 22. The connection tubing 22 may be a length of multi-lumen tubing comprising an infusion lumen 30, a venous drainage lumen 32, an inflation lumen 34, and a wall 31. The connection tubing 22 is preferably made from a polymeric material such as polyvinyl chloride, polyethylene, polypropylene, polyurethane and the like. In a preferred embodiment, the tubing 22 is transparent. [0039] FIG. 3 illustrates the distal tip 18 of the catheter 10 of FIG. 1 in detail. The distal tip 18 is an extension of the connecting tubing 22 and comprises the infusion lumen 30, the venous drainage lumen 32 and the inflation lumen 34. Additionally, the distal tip 18 comprises a plurality of venous drainage ports 36, a distal or first occlusion device 39, a plurality of cardioplegia infusion port or ports 42, and a proximal or second occlusion device 45. The distal tip 18 further comprises an inflation lumen plug 48 and an infusion lumen plug 50. A cardioplegic drainage lumen may likewise be utilized to adjust cardioplegic perfusion pressures, if needed. [0040] In an embodiment, the first occlusion device 39 comprises a first balloon 38 and a plurality of first balloon inflation ports 40. The second occlusion device 45 comprises a second balloon 44 and a plurality of second balloon inflation ports 46. [0041] The venous drainage ports 36 are openings in the drainage lumen 32 and connect the venous drainage lumen 32 with the exterior of the cannula 10. There is no communication between the venous drainage lumen 32 and the other cannula lumens 30 and 34. The venous drainage ports 36 are preferably located more proximally than the second balloon 44 and/or more distally than the first balloon 38 on the cannula 10. [0042] The balloon inflation ports 40 and 46 are located on the inflation lumen 34. The inflation lumen 34 is isolated from the other cannula lumens 30 and 32. The first balloon 38 and the second balloon 44 are located over the first balloon inflation ports 40 and the second balloon inflation ports 46, respectively. When the balloon inflation fluid flows through the inflation ports 40 and 46 from the inflation lumen 34, the balloons 38 and 44 inflate. [0043] The cardioplegia infusion port(s) 42 are openings on the infusion lumen 30. The infusion lumen 30 is isolated from the other lumens 32 and 34. The cardioplegia infusion ports 42 are located between the balloons 38 and 44 such that cardioplegia solution is infused between the balloons 38 and 44 and is directed into the right atrium and ventricle of the heart where it subsequently passes into the coronary arteries by way of the coronary sinus. [0044] FIG. 4 shows the proximal end 20 of the cannula 10 of FIG. 1 in detail. The proximal end 20 is an extension of the connecting tube 22 and comprises the cardioplegic infusion lumen 30, the venous drainage lumen 32, and the inflation lumen 34. The proximal end 20 additionally comprises the manifold 23, which comprises the cardioplegia infusion adapter 24, the venous drainage collection adapter 26 and the balloon inflation adapter 28. The cardioplegia infusion adapter 24 connects to the infusion lumen 30. The venous drainage collection adapter 26 connects to the drainage lumen 32 and the balloon inflation adapter 28 connects to the inflation lumen 34. [0045] FIG. 5 illustrates the placement of the cannula 10 of the present invention in a heart 100 during retrograde perfusion. The heart 100 comprises a left ventricle 102, a right ventricle 104, a coronary sinus 108, a right atrium 110, an inferior vena cava 112, and a superior vena cava 114. [0046] During normal operation of the heart, or during the normal cardiac cycle, blood returning from the tissues of the body passes through peripheral veins into the superior 114 and inferior vena cava 112 and into the right atrium 110. The coronary sinus 108 is the region of the heart 100 where blood exits the coronary vascular circuit and passes back into the right atrium 110. The coronary sinus 108 is located in close proximity to the inferior vena cava&#39;s entry into the right atrium 110. Blood leaving the coronary circulation by way of the coronary sinus 108 joins the venous blood from the vena cava 112 and 114 in the right atrium 110. The venous blood flows from the right atrium 110 into the right ventricle. Venous blood is pumped by the right ventricle 104 into the lungs where it is oxygenated and where carbon dioxide is removed. The oxygen-rich blood then passes into the left atrium and left ventricle 102 where it is then pumped into the systemic circulation to nourish the organs and tissues of the body. The coronary ostea, or entrance to the coronary arteries, are located at the root of the aorta, just downstream of the aortic valve. [0047] When the heart 100 is placed on cardiopulmonary bypass, blood is removed from the venous circulation at the inferior vena cava 112 and superior vena cava 114 and is routed to an oxygenator that adds oxygen and removes carbon dioxide. The oxygenated blood is pumped back into the patient&#39;s systemic circulation so tissues can be perfused while the heart is being surgically repaired. [0048] in an embodiment, the cannula 10 serves the triple function of blocking venous blood from entering the right heart during surgery, removing the venous blood from the vena cava so that it may be extracorporeally oxygenated and pumped back to the patient, and infusing cardioplegia solution into the heart in a retrograde direction during the surgical repair procedure. [0049] Referring to FIGS. 1, 3, 4,and 5, the physician makes an incision in the jugular vein, for example, and inserts the distal tip 18 of the catheter or cannula 10 into the incision. The catheter 10 is threaded into the vein, advanced into the vena cava 112 and 114, and positioned, with the aid of fluoroscopy, for example, such that the balloons 38 and 44 are located in the inferior vena cava 112 and superior vena cava 114, respectively. The cardioplegia infusion ports 42 are located at the entrance to, or inside of, the right atrium 110 and the drainage ports 36 are located in the superior vena cava 114 and inferior vena cava 112, proximal or upstream of the balloons 38 and 44. In one embodiment, the superior and inferior vena cava obstructive balloons 38 and 44 can be adjusted to an appropriate position within the respective vena cava 112 or 114. [0050] Next, the balloon inflation system 16 is activated. Balloon inflation is accomplished by driving balloon inflation fluid from the balloon inflation system 16, through the balloon inflation adapter 28, into the balloon inflation lumen 34, through the balloon inflation ports 40 and 46 and into the balloons 38 and 44. The inflation lumen plug 48 prevents the balloon inflation fluid from escaping from the distal end of the inflation lumen 34. This infusion of balloon inflation fluid causes the balloons 38 and 44 to inflate and occlude the entrance of the right atrium 110 from the superior vena cava 114 and the inferior vena cava 112. Because of this occlusion, blood is prevented from flowing from the superior vena cava 114 and the inferior vena cava 112 into the right atrium 110 of the heart 100, and must exit via the drainage ports 36 of the cannula 10. The blood passes through the cannula 10 and on into the venous reservoir of the cardiopulmonary bypass system, also known as a circuit. [0051] The cardioplegia solution flows from the cardioplegia infusion system 12, through the cardioplegia infusion adapter 24, into the infusion lumen 30, through the cardioplegia infusion ports 42, and into the right atrium 110 where, under a moderate pressure of 120 mm Hg or less, the cardioplegia solution enters the coronary sinus 108 and the right ventricle 104. In order for cardioplegic solution to enter the coronary sinus 108 in a retrograde fashion, the right atrium 110 and ventricle 104 must be pressurized, which necessitates occlusion of the pulmonary artery root. The pulmonary artery thus is typically cross-clamped, for example, to prevent perfusion of the lungs during surgery. The infusion lumen plug 50 prevents the cardioplegia solution from escaping from the distal end of the infusion lumen 30. The cardioplegia solution arrests the beating of the heart 100 by interfering with the sodium potassium cycle of the cardiac muscle cells. [0052] In addition, the venous drainage collection system 14 is activated. Any blood in the superior vena cava 114 and inferior vena cava 112 flows through the drainage ports 36, into the drainage lumen 32, through the drainage collection adapter 26, and into the drainage collection system 14. The drainage collection system 14 collects the venous blood. This blood is, in most cases, routed to a venous reservoir of a cardiopulmonary bypass system. The blood then passes into an oxygenator where it undergoes removal of carbon dioxide and addition of oxygen. The blood also passes through a heat exchanger where it undergoes heat transfer, either heating or cooling. The oxygenated and cooled, or warmed, blood is pumped back into the patient&#39;s systemic circulation via an arterial cannula placed in a systemic artery distal to the aortic valve. [0053] The surgeon can now perform the prescribed heart surgery. A single cannula of the present invention provides the infusion, inflation, and drainage functions, which eliminates the need for the multiple cannulae currently used for open-heart procedures. [0054] Referring to FIG. 5, patients have different spacing between the entrance of the inferior vena cava 112 into the right atrium 110 and the entrance of the superior vena cava 114 into the right atrium 110. A one-size-fits-all catheter 10 may not be optimum for use in all patients. FIG. 6 shows a more preferred embodiment of the catheter, which compensates for anatomic differences between patients. The operations of cardioplegia infusion and drainage collection are the same as that described earlier for the cannula 10. [0055] Referring to FIG. 6, the catheter or cannula 52 comprises a plurality of first balloons 54, a second balloon 56, a plurality of first balloon inflation port sets 58, a plurality of second balloon inflation ports 60, and a length of connecting tubing 62. The catheter 52 also comprises a manifold 64, which comprises a plurality of first balloon inflation adapters 66 and a second balloon inflation adapter 68. The catheter is connected to the cardioplegia infusion system 12, the venous drainage collection system 14, and the balloon inflation system 16. [0056] FIG. 7 illustrates a cross section of multi-lumen connection tubing 62 for the construction of the catheter 52 of FIG. 6. The tubing 62 comprises a plurality of first balloon inflation lumens 70, a second balloon inflation lumen 72, the infusion lumen 30, the drainage lumen 32, and the wall 31. [0057] Referring to FIGS. 6 and 7, the balloon inflation system 16 connects to the catheter 52 through the first balloon inflation adapters 66 and the second balloon inflation adapter 68. Each first balloon inflation adapter 66 connects to one first balloon inflation lumen 70. The second balloon inflation adapter 68 connects to the second balloon inflation lumen 72. Each set of first balloon inflation ports 58 is located on one first balloon inflation lumen 66. The second balloon inflation ports 60 are located on the second balloon inflation lumen 72. Each first balloon 54 is positioned over one set of first balloon inflation ports 58, such that when inflation fluid is injected through the selected first balloon inflation ports 58, only the first balloon 54 over the selected first balloon inflation ports 58 is inflated. The second balloon 56 is positioned over the second balloon inflation ports 60 such that when balloon inflation fluid is injected through the second balloon inflation ports 60, the second balloon 56 is inflated. Each first balloon inflation adapter 66 has a corresponding first balloon inflation lumen 70, as shown in FIG. 7, a corresponding set of first balloon inflation ports 58, and a corresponding first balloon 54. [0058] Referring to FIGS. 5 and 6, the physician places the catheter 52 into the right atrium 110. The physician places the second balloon 56 in the entrance of the superior vena cava 114 and the series of first balloons 54 line up in the right atrium 110 and into the inferior vena cava 112. The second balloon 56 is inflated to occlude the superior vena cava 114. Only the first balloon 54 in the plurality of first balloons 54, which is in the entrance of the inferior vena cava 112, corresponding to the correct spacing for the patient&#39;s heart, is inflated to occlude the inferior vena cava 112. Balloons 54 and 56 to be inflated are connected to the balloon inflation system 16 through their balloon inflation lumen 70 and 72. The balloon inflation lumen 70 of the balloons 54 selected for non-inflation is simply not connected to the balloon inflation system 16. In this manner, the catheter 52 is optimized for the individual patient&#39;s anatomy. The better fit minimizes the chance of the balloons 54 and 56 slipping out of position and leaking venous blood into the heart, with potentially severe complications for the surgery patient. [0059] Preferably, the plurality of balloons are located on the distal end of the catheter&#39;s cardioplegia infusion ports 42, although multiple balloons proximal to the cardioplegia inflation ports 42 would also be acceptable. Only the balloons that are spaced correctly to occlude the patient&#39;s superior 114 and inferior 112 vena cava are inflated. [0060] In another embodiment for multiple balloon inflation selection, a single balloon inflation lumen may be connected to all of the balloons and to a control rod that selectively opens balloon inflation ports to the correct balloon or balloons. Such a control rod would typically be an axially elongate, torqueable structure running the length of the cannula tubing. By rotating or axially moving the control rod by grasping a projection at the proximal end of the cannula, inflation ports would be selectively opened between the balloon inflation lumen and the balloon to be inflated. Markings on the control rod would indicate which balloons were being inflated or which spacing was being chosen. Again, only the balloons correctly spaced to occlude the patient&#39;s vena cava are inflated. Other balloons would not be inflated because their ports would not have been selectively opened. [0061] In yet another embodiment of the cannula 10, the distal tip 18 comprises an accordion-like or telescoping structure between the occlusion devices 39 and 45, and a control rod. The accordion-like or telescoping structure allows the length of the cannula 10 to be adjusted so that the occlusion devices 39 and 45 fit the spacing between the patient&#39;s superior vena cava 114 and inferior vena cava 112. This accordion-like structure is a longitudinally flexible area of the cannula 10 with corrugations to allow for compression or expansion in length. The control rod extends from the distal tip 18 of the cannula 10 to the proximal end 20. The control rod is linked to the cannula 10 such that pushing or pulling the control rod relative to the proximal end 20 increases or decreases the length of the cannula 10. The control rod is locked into place with a locking device when the correct spacing between the occlusion devices 39 and 45 is achieved. A telescoping structure could be used in place of the accordion-like structure to allow for cannula length adjustment using the control rod. [0062] In yet another embodiment, the balloon inflation adapter 28 is connected to the cardioplegia infusion system 12. In this embodiment, the cardioplegia solution is used in the cardioplegia infusion system 12 to arrest the heart and in the balloon inflation system 16 to inflate the balloons 38 and 44 or 54 and 56. Typically, cardioplegia solution is infused at a pressure of around 20 mmHg. The balloons 38, 44, 54, and 56 may be inflated with an internal pressure of 20 mmHg and this pressure may be derived from the pressure of the cardioplegia solution. This embodiment has the advantage of reduced complexity and simplified pressure limiting. [0063] The balloons 38 and 44 are only one way of occluding the vena cava 112 and 114. Another embodiment of the occlusive structures 39 and 45 comprises one or more external tourniquets. One or more tourniquets may be applied external to the vena cava 112 and 114 to seal the vena cava 112 and 114 to the cannula 10 and prevent cardioplegia solution from escaping the environs of the right atrium entry 110 to the coronary sinus 108. [0064] A further embodiment of the occlusive structures 39 and 45 comprises umbrella mechanisms, which open up to occlude the vena cava. Opening and closing of the umbrellas, optionally with toroidal edge-seal balloons, would be accomplished using a control rod extending along the length of the catheter and out the proximal end of the catheter where it could be grasped. [0065] FIG. 8 illustrates a longitudinal cross-sectional view of the distal end of a catheter or cannula 120 of the present invention, comprising a length of cannula tubing 122, a distal occlusion balloon 124, a proximal occlusion balloon 126, a plurality of distal drainage ports 128, a plurality of proximal drainage ports 130, a protection balloon 132, an occlusion balloon pressurization or inflation lumen 134, a drainage lumen 136, a vacuum lumen 138 (not shown), a plurality of vacuum ports 140, a plurality of protection balloon perforations 142, and a walled-off cardioplegic delivery annulus 144. The protection balloon 132 further comprises an inner protection balloon layer 146, a protection balloon outer layer 148, a vacuum channel 150, one or more occlusion balloon inflation lumens 152, a plurality of protection balloon inflation ports 154, one or more cardioplegia delivery ports 156, and a cardioplegia delivery lumen 158, a protection balloon pressurization or inflation lumen 160, a plurality of occlusion balloon inflation ports 162, a cardioplegia delivery annulus wall 164, and a radiopaque marker 166. FIG. 8 further illustrates the cannula 120 in situ in the heart 100 further comprising the left ventricle 102, the right ventricle 104, a plurality of coronary veins 106, the coronary sinus 108, the right atrium 110, the inferior vena cava 112, and the superior vena cava 114. [0066] Referring to FIG. 8, the protection balloon 132 may be either symmetric or asymmetrically disposed about the length of cannula tubing 122. The protection balloon 132 is sealably affixed to the cannula tubing 122. The protection balloon 132 is affixed to the cannula tubing such that a vacuum channel 150 exists between the inner protection balloon layer and the outer protection balloon layer 148. The vacuum channel 150 is in fluid communication with the vacuum lumen 138 in the cannula tubing 122 by way of vacuum ports 140. The vacuum lumen 138 is in fluid communication with a connector (not shown) on the proximal end of the cannula 120. The walled-off cardioplegic delivery annulus 144 is a feature in the protection balloon 132 that directs cardioplegia from the cardioplegia delivery lumen 158 through cardioplegia delivery ports 156 and on into the coronary sinus. The walled-off cardioplegic delivery annulus 144 is sealed from the rest of the vena cava and right atrium by the protection balloon 132. [0067] A vacuum being drawn through the vacuum channel 150 seals the protection balloon 132 through the protection balloon perforations 142 in the protection balloon outer layer 148. Ridges or indentations (not shown) in the vacuum channel 150 allow the vacuum to be maintained even though the outer protection balloon wall 148 is drawn against the inner protection balloon wall 146 by the vacuum. In this way, pressurized cardioplegia solution can be directed at the coronary sinus 108 and on into the coronary veins 106 without causing excessive pressure on the walls of the right atrium 110 and vena cava 112 and 114. The cardioplegia delivery channel or annulus 144 is directed at and is operably in fluid communication with the coronary sinus. Blood is drained through the drainage lumen 136 by way of the drainage ports 128 and 130 to the proximal end of the cannula 120 where it is routed to a collection device or cardiopulmonary bypass system. As shown in FIG. 8, in a preferred embodiment the protection balloon inflation lumen 160 and the occlusion balloon inflation lumen 134 are the same channel. The protection balloon 132 is inflated by the protection balloon inflation lumen 160 through protection balloon inflation ports 154 while the occlusion balloons 124 and 126 are inflated by the occlusion balloon inflation lumen 134 through the occlusion balloon inflation ports 162. The cardioplegia delivery lumen 158 is preferably asymmetric on the cannula 120 so radiopaque markers 166 are preferred to show the asymmetry and allow correct alignment of the cannula with the heart under fluoroscopy. [0068] Referring to FIG. 8, the cannula tubing 122, comprises an affixed, optional radiopaque marker 166 or plurality of radiopaque markers 122 to allow visibility under fluoroscopy of the position of key elements of the tubing and to delineate the rotational orientation of the tubing 122. The radiopaque (RO) marker 166 is asymmetrically configured circumferentially, in a preferred embodiment, so that under fluoroscopy, the RO marker 166 orientation and the orientation of the tubing 122 can be determined under said fluoroscopic evaluation. Examples of asymmetrical RO markers include, but are not limited to, arrows, rectangles with one rounded side, triangles, and the like. In another embodiment, a plurality of radiopaque markers 166 are asymmetrically arranged to provide the user with cannula tubing 122 rotational information when viewed in two-dimensional projection as is typical with fluoroscopic visualization. An example of a preferred embodiment of multiple radiopaque markers 166 include, but are not limited to two markers 166 that are asymmetric in shape, are located 180-degrees apart on the circumference of the tubing 122 or other cannula structure, such as the protection balloon 132, and each comprises a fenestration or hole that is aligned with a hole on the opposing radiopaque marker 166 to ensure exact rotational orientation of the cannula 120. Such rotational orientation is complimentary to the longitudinal or axial positioning or orientation of the cannula 120. [0069] FIG. 9 illustrates a lateral cross section of a length of cannula tubing 122. The cannula tubing comprises a tube wall 170, a vacuum lumen 138, a drainage lumen 136, one or more occlusion balloon inflation lumens 134, a cardioplegia delivery or infusion lumen 158, and a protection balloon inflation lumen 160. [0070] Referring to FIGS. 8 and 9, the cannula tubing 122 is preferably flexible but has column strength and torqueability. The cannula tubing 122 diameter ranges from 5 mm to 20 mm. Preferably the cannula tubing 122 diameter ranges from 8 mm to 15 mm. The cannula tubing 122 is preferably fabricated by extrusion. The cannula tubing 122 may also be fabricated by winding a wire or polymer coil or a wire or polymer braid around a mandrel. The cannula tubing 122 may be poured or dipped or extruded over this braid or coil to provide additional torqueability, kink-resistance, and the like. The cannula tubing 122 is typically fabricated from polymers such as, but not limited to, PEBAX, polyurethane, silicone, poly vinyl chloride, polyethylene, polypropylene, polyimide, polyamide, and the like. The braid or coil used to reinforce the cannula tubing 122 is preferably fabricated from wire such as, but not limited to, round or rectangular cross-sections of stainless steel, nitinol, Kevlar, polyimide, polyester, and the like. The radiopaque markers 166 may be comprised of metals such as platinum, tantalum, gold, and the like or they may be additives of barium sulfate and the like, formed as attached rings, extruded stripes, or other shapes. [0071] FIG. 10 shows yet another embodiment of a venous cannula 200 adapted for retrograde administration of cardioplegia solution to a heart during cardiopulmonary bypass. The venous cannula 200 comprises a length of multi-lumen tubing 202 with a proximal end and a distal end, a cardioplegia solution infusion lumen 204, a cardioplegia solution infusion annulus 206 affixed at or near the distal end of the cannula 200, an annular seal ring 208 affixed to the distal end of the cannula 200 surrounding the cardioplegia solution infusion annulus 206, a vacuum lumen 210 operably connected to the vacuum or sealing annulus 220 of the annular seal ring 208, a cardioplegia solution infusion port 212 (not shown) affixed at the proximal end of the cannula 200, and a vacuum port 214 (not shown) affixed at the proximal end of the cannula 200. The annular seal ring 208 of the cannula 200 further comprises an optional inner wall 216, an outer wall 218, and a sealing annulus 220. The cannula 200 further comprises an optional inflation lumen 222 and an inflation port 224 (not shown), which are affixed to each other and operably connected to the sealing annulus 220. The outer wall of the cardioplegia solution infusion annulus 206 is, in one embodiment, the same as the inner wall of the sealing annulus 220. Webs or attachments (not shown) connect the inner wall of the sealing annulus 220 to the outer wall 218 of the annular seal ring 208 but permit application of a vacuum to tissue where the sealing annulus 220 touches said tissue. Expansion or movement of the outer wall 218 moves the inner wall of the sealing annulus 220 correspondingly. [0072] Referring to FIG. 10, the cardioplegia solution infusion port 212 comprises an attachment to a cardioplegia infusion system, which preferably comprises a reservoir of cardioplegia solution and a pump. The annular seal ring 208 comprises the inner wall 216 and the outer wall 218 and the sealing annulus 220. The annular seal ring 208 controllably seals to the right atrial wall around the coronary sinus by way of a vacuum drawn through the vacuum lumen 210 by way of the vacuum port 214. The annular seal ring 208, when attached to the atrial wall by vacuum, prevents or minimizes the escape of cardioplegia solution from the cardioplegia solution infusion annulus 206 into the right atrium. In a preferred embodiment, the annular seal ring 208 is an expandable structure that can be inserted endovascularly and routed to the right atrium. The annular seal ring 208 is then expanded and placed against the tissue surrounding the coronary sinus. The interior most lumen of the annular seal ring 208 is the cardioplegia solution infusion annulus 206. Such expansion of the annular seal ring 208 is, in one embodiment, accomplished by providing an inflation lumen 222 within the tubing 202 and an inflation port 224 at the proximal end of the tubing 202, the inflation port 224 operably connects to the inflation lumen 222. Pressurized fluid such as air, saline, or radiopaque liquid is infused under pressure and inflates the annular seal ring, which consists of multiple walls. A vacuum is then drawn through the vacuum lumen 210 as described earlier while cardioplegia solution is infused into the coronary sinus through the cannula 200 via a retrograde approach. In one embodiment, the cannula 200 further comprises the integral venous drainage system shown in FIG. 8. In another embodiment, the cannula 200 does not require a venous drainage system. The materials and methods used for manufacture of this embodiment, are the same as or similar to those used to manufacture the cannula of FIG. 8. [0073] In one embodiment, the annular seal ring 208 and the cardioplegia solution infusion annulus 206 are affixed to the cannula tubing 202 substantially at a direction perpendicular to the longitudinal axis of the cannula tubing 202. Thus, the annular seal ring 208 projects sideways, or is laterally directed, and toward the coronary sinus while the main axis of the cannula 200 is longitudinally located within the vena cavae. In a preferred embodiment, the annular seal ring 208 and cardioplegia solution infusion annulus 208 are controllably extendable in the direction lateral to the longitudinal axis of the cannula tubing 202. The expansion may be controlled from the proximal end of the cannula 200 by way of pull wires running through lumens in the tubing 202 or by inflation of balloon structures through inflation lumens in the tubing 202. [0074] FIG. 11 illustrates another embodiment of the cannula 250, wherein the annular seal ring 258 and the cardioplegia infusion annulus 256 are disposed concentrically with the axis of the tubing 252 so that the distal tip of the cannula 250 opens to form the cardioplegia solution infusion annulus 256. In this embodiment, steering apparatus is disposed within the cannula 250 to bend, steer, or articulate the distal end of the cannula tubing 252 and allow the annular seal ring 258 to be mated or docked with the tissue surrounding the coronary sinus 108. The steering apparatus comprises, in one embodiment, one or more pull-wires 260 slidably disposed within lumens 264 in the tubing 252. The pull-wire lumens 264 are preferably located at 90 -degree or 120 -degree interval spacing about the cannula tubing 252. For clarity, FIG. 11 shows only one pull-wire lumen 264. The pull-wire 260 associated with the illustrated pull-wire lumen 264 is also shown exiting the cannula tubing 260 cutaway. Additional pull-wires 260, whose pull-wire lumens 264 are not shown, are shown exiting the tubing 252 cutaway more proximally. The pull-wires 260 are terminated at the proximal end of the cannula 250 with grips or knobs (not shown) that allow manual or power-assisted tension to be applied to the pull-wires. The pull-wires 260 are terminated and affixed at the distal tip of the cannula 250 into attachment points 262 on the distal end of the tubing 252. The pull-wires 260 are preferably disposed on opposite circumferential sides of the tubing 252 so that tension on one pull-wire 260 causes the tubing 252 to bend to that side on which the pull-wire 260 is located. A minimum of one pull-wire 260 is required but more pull-wires 260 are desirable. In a preferred embodiment, three or more pull-wires 260 are comprised by the cannula 250 to provide full X-Y orientation and articulation. The pull-wires 260 are fabricated from polyimide, polyester, stainless steel, nitinol, or other material with suitable tensile strength and biocompatibility. The pull-wire 260 may be either monofilament or multifilament with a braided structure. The pull-wire 260 may further be coated with polytetrafluoroethylene or other fluoropolymers to minimize friction. In yet another embodiment, the pull-wire 260 is shape-memory nitinol and is selectively or controllably heated by application of electrical energy across its length to achieve contraction of the pull-wire 260. Such electrical energy is applied to electrical leads (not shown) that run longitudinally through the cannula tubing 252 from the proximal end to the distal end and can provide a complete circuit to any component comprised by the cannula 250. [0075] Referring to FIG. 11, in one embodiment, the tubing 252 is more flexible in a region 262 just proximal to the distal tip of the cannula 250. This region of increased flexibility 268 allows the cannula tubing 252 to bend preferentially at that flexible region 268 upon application of tension in the pull-wires 260. In yet another embodiment, the steering apparatus comprises microactuators such as those fabricated from shape memory metals and Ohmic heating elements or from electromechanical actuators. Exemplary shape-memory microactuators include those described in U.S. Pat. No. 6,447,478 to Ronald Maynard, entitled Thin-Film Shape Memory Alloy Actuators and Processing Methods, the entirety of which is included herein by reference. Electrical energy, provided at the proximal end of the cannula 250 and transmitted by electrical cabling within lumens in the tubing 252, provide the power and control for the microactuators. The control unit, which supplies the electrical energy to the microactuators minimally comprises a power supply and an on-off switch for each microactuator. The control unit may, in other embodiments, comprise computer systems or other types of logic circuitry to control the power to the microactuators. The microactuators are preferably affixed longitudinally across the area of increased flexibility near the distal end of the cannula 250 and are disposed on opposing sides of the tubing to provide counter-motion since these actuators generally only work in tension, not expansion. [0076] Referring to FIG. 11, the lateral cross-sectional shape of the annular seal ring 258 is generally or substantially circular but may be oval or any other appropriate shape. The annular seal ring 258 is, in a preferred embodiment, a double wall structure that permits a vacuum to be applied to a vacuum annulus 254 between the walls to hold the annular seal ring 258 against the cardiac tissue with a high level of force. Vacuum is drawn at the proximal end of the cannula 250 and is transmitted to the vacuum annulus 254 by way of vacuum lumens in the cannula tubing 252 which are operably connected to the vacuum annulus 254 and the applied vacuum at the proximal end of the cannula 250. The cardioplegia infusion annulus 256 is a region interior to the inner wall of the annular seal ring 258, which further permits and guides the infusion of cardioplegia solution, in a non-cannulating fashion, to the coronary sinus 108. In one embodiment, the annular seal ring 258 is of constant, non-tapering cross-section. In a preferred embodiment, the annular seal ring 258 comprises an elastomeric wall and an inflatable or expandable structure 266 at the distal tip to provide for diametric or radial expansion to a size greater than that of the cannula 250. In one embodiment, the expandable structure 266 comprises a ring of shape-memory nitinol that expands under application of electricity which results in Ohmic heating of the nitinol to a temperature above its austenite finish temperature (A f ). The nitinol expandable ring 266 may be a simple split ring or it may be a pattern of diamonds, “W” s or “Z” s or other typical cardiovascular stent shapes known in the art that are capable of diametric expansion. The cannula 250 may further comprise a plurality of slats or longitudinal elastomeric elements 272, which serve as a strain relief and permit smooth tapering of the tip when the expandable ring 266 is activated. These separated longitudinal elastomeric elements 272 are fabricated from stainless steel, nitinol, polyester, cobalt nickel alloys or other materials with high strength in the form of leaf springs. In a preferred embodiment, the longitudinal elastomeric elements 272 are fabricated from shape-memory nitinol and, upon application of electrical energy, are heated to above their austenitic finish temperature and expand to a pre-determined shape. In all embodiments, electrical energy is supplied at the proximal end of the cannula 250 and is routed to the distal tip of the cannula 250 by electrical leads (not shown) longitudinally disposed within lumens or co-extruded within the tubing 252. These electrical leads are electrically connected to both ends of the nitinol itself or to high resistance heating elements disposed in proximity of the shape-memory nitinol. Removal of the electrical energy results in cooling and restoration of the non-expanded configuration of the longitudinal elastomeric elements 272. In another embodiment, the annular seal ring 258 further comprises an expandable structure 266, which is a toroidal or annular balloon that expands under pressure applied at the proximal end of the cannula 250 and transmitted through the length of the cannula tubing 252 by a pressurization lumen to the balloon, the interior of which is in fluid communication with the pressurization lumen. The balloon may be either an elastomeric balloon or an inelastic angioplasty type balloon and is pressurized with water, saline, radiopaque contrast media, gas, or other material. The annular seal ring 258 preferably has a smooth distal edge that is capable of sealing to cardiac tissue without causing damage or trauma. Radiopaque markers 166 are, in a preferred embodiment, affixed to the distal end of the cannula 250 to assist with visualization and orientation of the cannula 250 distal tip under fluoroscopy. The radiopaque markers 166 are fabricated from material such as, but not limited to, platinum, gold, iridium, tantalum, and the like. [0077] The device or apparatus for such retrograde cardioplegia delivery is directed to a method for retrograde delivery of cardioplegia without cannulating the coronary sinus. Embodiments of the apparatus of the present invention permit the entire coronary sinus and coronary venous circuit to be perfused, and therefore, both the right and left coronary veins are perfused. Referring to FIG. 11, perfusion is, in a preferred embodiment, performed by sealing the catheter around the entrance to the coronary sinus 108 but not inserting a catheter into the coronary sinus 108. In one embodiment, the preferred method comprises inserting a catheter into the right atrium and inflating a protection balloon, which seals to the region around the coronary sinus. The protection balloon prevents high-pressure cardioplegia solution from over-inflating the right atrium or surrounding structures. Once the catheter or cannula seals to the region around the coronary sinus, any air or gas is removed from the perfusion lumen and infusion of cardioplegic solution is initiated. At the conclusion of the procedure, cardioplegia solution infusion terminates, the vacuum terminates, and the surgeon, robot, or operator withdraws the cannula from the patient with any access sites being sealed by appropriate surgical, least invasive, or minimally invasive techniques. [0078] The catheter, cannula, device, or apparatus, all of which are used herein interchangeably, further comprises a cardioplegia delivery channel that is oriented toward the coronary sinus and sealed against the tissue around the coronary sinus. Such guiding or orientation is done either under direct visualization or by fluoroscopic, MRI, or ultrasonic guidance. Fiuoroscopic orientation and guidance is accomplished by visualizing radiopaque markers or structures on the catheter. The radiopaque markers or structures permit evaluation of orientation of the cannula since they are, in a preferred embodiment, asymmetrically placed about the cannula. The step of sealing is performed by drawing a vacuum on the protection device or balloon to pull surrounding tissue against the balloon or protection device, thus sealing the region around the coronary sinus. In another embodiment, the sealing is performed by inflating a sealing structure into the right atrium or by opening an umbrella-type structure, optionally comprising an inflatable toroidal edge sealing balloon, to occlude and seal off parts of the right atrium. Cardioplegia solution is then infused into the coronary sinus through infusion ports on the cannula. With this method, the use of occluding balloons is optional and may not be needed since the protection balloon seals the coronary sinus from the rest of the circulation. Venous drainage is optionally performed by the same cannula as that used for the cardioplegia delivery and the drainage ports are preferably positioned within the superior and inferior vena cava. In another embodiment, cardioplegia is infused through a catheter that is inserted into the coronary sinus 108, but which is perforated so that cardioplegia solution can flow into the coronary veins 106 of both the right heart and the left heart. This system does not cannulate the coronary sinus 108 at the region of the coronary veins 106. In yet another embodiment, the cannula is inserted surgically into the right atrium through an opening in the right atrium or vena cava, rather than being routed endovascularly to the right atrium from a remote access site. [0079] The present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. The described embodiments are to be considered in all respects only as illustrative and not restrictive. The scope of the invention is therefore indicated by the appended claims rather than the foregoing description. All changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope.

Summary: A system is disclosed for cannulating the vena cava of a patient during cardiopulmonary bypass procedures. Such cannulation is necessary for drainage of venous blood from the patient so that it may be oxygenated and pumped back to the patient to perfuse tissues during cardiac surgery and, more specifically, during periods of ischemic cardiac arrest or dysfunction. The device of the present invention not only provides venous drainage for cardiopulmonary bypass, but also performs the function of routing cardioplegic solution through the heart in the retrograde direction. Such cardioplegia provides protection to the heart during periods of ischemic cardiac arrest. This invention replaces a plurality of cannulae currently used for open-heart surgery, thus simplifying the surgical field and improving visibility of the heart. The device allows for the delivery of retrograde cardioplegia to the coronary circulation of both the right and the left side of the heart. The device further includes protection mechanisms to prevent overinflation or excessive pressurization of the right atrium during retrograde delivery of cardioplegia solution.

big_patent

en

Write a title and summarize: Gammaherpesviruses chronically infect their host and are tightly associated with the development of lymphoproliferative diseases and lymphomas, as well as several other types of cancer. Mechanisms involved in maintaining chronic gammaherpesvirus infections are poorly understood and, in particular, little is known about the mechanisms involved in controlling gammaherpesvirus reactivation from latently infected B cells in vivo. Recent evidence has linked plasma cell differentiation with reactivation of the human gammaherpesviruses EBV and KSHV through induction of the immediate-early viral transcriptional activators by the plasma cell-specific transcription factor XBP-1s. We now extend those findings to document a role for a gammaherpesvirus gene product in regulating plasma cell differentiation and thus virus reactivation. We have previously shown that the murine gammaherpesvirus 68 (MHV68) gene product M2 is dispensable for virus replication in permissive cells, but plays a critical role in virus reactivation from latently infected B cells. Here we show that in mice infected with wild type MHV68, virus infected plasma cells (ca. 8% of virus infected splenocytes at the peak of viral latency) account for the majority of reactivation observed upon explant of splenocytes. In contrast, there is an absence of virus infected plasma cells at the peak of latency in mice infected with a M2 null MHV68. Furthermore, we show that the M2 protein can drive plasma cell differentiation in a B lymphoma cell line in the absence of any other MHV68 gene products. Thus, the role of M2 in MHV68 reactivation can be attributed to its ability to manipulate plasma cell differentiation, providing a novel viral strategy to regulate gammaherpesvirus reactivation from latently infected B cells. We postulate that M2 represents a new class of herpesvirus gene products (reactivation conditioners) that do not directly participate in virus replication, but rather facilitate virus reactivation by manipulating the cellular milieu to provide a reactivation competent environment. Plasma cells, which are the cellular factories that produce secreted antibody, play a critical role in mounting an effective immune response to many pathogens. Early plasma cell responses to foreign antigens can be divided into two phases: (i) differentiation of short-lived plasma cells arising from naïve marginal-zone and mature follicular B cells, which secrete low affinity antibodies that have not undergone somatic mutation and are thought to provide an initial rapid response to the invading pathogen; and (ii) differentiation of follicular B cells upon encountering antigen and receiving T cell help, leading to the formation of germinal centers, several rounds of B cell proliferation, affinity maturation, class-switching, and ultimately the development of memory B cells and plasma cells that serve to sustain humoral immune responses [1]. Although the signal (s) that initiate plasma cell differentiation remain controversial, recent progress has identified several critical transcriptional regulators of plasma cell differentiation - including B lymphocyte induced maturation protein 1 (Blimp-1), interferon regulatory factor-4 (IRF-4) and XBP-1s [2], [3], [4], [5], [6]. Crawford and Ando [7] provided early evidence that Epstein-Barr virus (EBV) replication-associated antigens were present in Burkitt' s lymphoma cells that exhibited a plasma cell phenotype – providing the first evidence that plasma cell differentiation is associated with virus reactivation from latency. More recently this observation has been extended to show that plasma cell differentiation is associated with reactivation of both EBV and Kaposi' s sarcoma-associated herpesvirus (KSHV). Induction of EBV and KSHV replication in latently infected B cells appears to be driven by the plasma cell-specific transcription factor XBP-1s, which activates transcription of the viral immediate-early genes encoding the critical transcriptional activators that trigger the EBV and KSHV replication cascades (BZLF1 and BRLF1/gene 50 in the EBV genome and gene 50 in the KSHV genome) [8], [9], [10], [11], [12]. Whether plasma cell differentiation leading to virus reactivation is a common strategy utilized by B cell-tropic gammaherpesviruses remains to be determined. Murine gammaherpesvirus 68 (MHV68) infection of mice provides a tractable small animal model to investigate basic issues of gammaherpesvirus pathogenesis. Previous characterizations of MHV68 latency in mice have shown that B cells, as well as some populations of macrophages and dendritic cells, harbor latent virus - with B cells appearing to represent the major long term latency reservoir [13], [14], [15], [16], [17]. Analyses of virus latency in the spleen have shown that during the establishment of latency MHV68 is found in naive, germinal center and memory B cells [14], [18]. However, latency in naive and germinal center B cells wanes with time and at late times post-infection MHV68, like EBV, is predominantly found in memory B cells [14], [18]. Recently, we have also identified MHV68 in plasma cells at the peak of virus latency in the spleen [19]. The latter observation raises the possibility that, like EBV and KSHV, plasma cell differentiation may be associated with MHV68 reactivation. Here we demonstrate that plasma cell differentiation is linked to MHV68 reactivation from latency. In addition, we provide evidence that a MHV68 encoded gene product, M2, plays a seminal role in virus gaining access to plasma cells. We have previously shown that the MHV68 M2 protein, which is expressed in a subset of infected B cells at the peak of viral latency [20], plays critical roles in both the establishment of latency as well as virus reactivation from latently infected B cells - phenotypes that are influenced by both route and dose of virus inoculation [18], [21]. Additionally, efficient transition of latently-infected B cells from the germinal center reaction to the memory B cell reservoir appears to be stalled in the absence of M2, suggesting M2 may manipulate B cell signaling or differentiation to facilitate establishment of long-term latency in the memory B cell pool [18], [22]. Importantly, M2 is dispensable for virus replication in permissive fibroblasts in vitro or during acute virus replication in the lungs following intranasal inoculation [21]. Thus, M2 appears to have a specialized role during establishment of latency and reactivation. M2 contains several SH3 domain docking sites, along with 2 functionally important tyrosine residues that are targets for phosphorylation, and is thought to function as a molecular scaffold that modulates B cell signaling pathways [23], [24]. Notably, M2 has been shown to target phosphorylation of the guanosine nucleotide exchange factors Vav1 and Vav2, and more recently has been shown form a trimolecular complex with Vav1 and the Src family tyrosine kinase Fyn [24] - although the functional consequences of these interactions remain unclear. Here we focus on the role of M2 in virus reactivation from B cells. To begin characterizing the role that M2 plays in virus reactivation from latently infected B cells, we initially determined whether a requirement for M2 in MHV68 reactivation from latently infected B cells could be recapitulated in a tissue culture B cell latency model. Utilizing the murine M12 B lymphoma cell line, we generated a number of clonal cell lines harboring either a recombinant wild type MHV68 containing a hygromycin-GFP fusion protein expression cassette, or a M2-null MHV68 mutant (M2. Stop) on the same genetic background (Fig. 1A). Stable cell lines were generated using hygromycin selection, and then analyzed for virus reactivation following stimulation with the phorbol ester TPA. Notably, TPA treatment induced significant virus reactivation in all the M12 clones infected with wild type MHV68 - as shown by both immunoblot analyses of expression of MHV68 replication-associated antigens (Fig. 1B) and increased titers of infectious virus in the tissue culture supernatants (Fig. 1C). In contrast, TPA treatment of M12 cell lines infected with the M2. Stop virus resulted in little increase in virus replication (Fig. 1B and 1C). Similarly, treatment with either 5-azacytidine or trichostatin A was able to induce reactivation of the wild type MHV68 M12 cell lines, but not the M2. Stop infected clones (data not shown). Importantly, ectopic expression of M2 rescued virus reactivation from the M2. Stop infected M12 cell lines (Fig. 1D) - indeed, expression of M2 alone in the absence of TPA induction resulted in a significant increase in the expression of replication-associated viral antigens from both wild type and M2. Stop infected M12 cell lines. The ability of ectopic M2 expression to drive MHV68 reactivation was not limited to the latently infected M12 cell lines, but independently observed with latently infected murine A20 B lymphoma cell lines (data not shown). The latter results suggest a direct link between M2 expression and MHV68 reactivation from latently infected B cells. Although M2 is completely dispensable for MHV68 replication in permissive cell lines [18], [21], we next assessed whether it might play a B cell-specific role in activating transcription from the immediate-early gene 50 promoter which encodes the essential lytic switch protein RTA. To assess whether M2 could directly activate the immediate-early gene 50, we used reporter constructs in which the proximal gene 50 promoter was cloned upstream of a firefly luciferase reporter gene. We have previously shown that the proximal gene 50 promoter is required for reactivation of MHV68 from latently infected B cells [25]. Notably, M2 expression (in the absence of other viral proteins) could only weakly upregulated (<3-fold) gene 50 promoter activity (data not shown), indicating that the role of M2 in virus reactivation from the latently infected M12 B cell lines is unlikely to be via direct targeting/regulation of gene 50 transcription. As such, we turned our attention to further investigating the impact of loss of M2 expression on virus infection in vivo. To track MHV68 latently infected B cell populations in vivo, we generated a recombinant MHV68 harboring an enhanced yellow fluorescent protein (eYFP) transgene under the control of the HCMV immediate-early promoter and enhancer (MHV68-YFP) [19]. We have extensively characterized the MHV68-YFP recombinant virus and have shown that it behaves like wild type virus and is able to efficiently mark latently infected cells at the peak of viral latency (days 16–18 post-infection) [19]. For our studies on M2 function we generated an M2 null MHV68 harboring the eYFP expression cassette (M2. Stop-YFP), which is described below, as well generating and characterizing a recombinant MHV68 with an AU1 epitope tag fused to the C-terminus of M2 [MHV68-YFP (M2. AU1) ]. To ensure that insertion of the eYFP expression cassette did not adversely impact the M2 null virus phenotype, we compared infection of mice with either the previously characterized M2. Stop mutant virus [18], the M2. Stop-YFP virus, or MHV68-YFP virus, followed by analysis of establishment latency and reactivation at day 16 post-infection. In addition, since the analyses of M2 function discussed above used an M2 expression vector in which an AU1 epitope tag was inserted at the C-terminus of M2, we also generated and characterized a recombinant MHV68 in harboring the AU1 epitope tagged M2 [MHV68-YFP (M2. AU1) ]. These analyses demonstrated that the phenotype of the eYFP expressing M2 null virus was indistinguishable from the well characterized M2. Stop mutant virus (Fig. 2A and 2B). In addition, the insertion of an AU1 epitope tag did not appear to have any impact on the phenotype of the MHV68-YFP virus (Fig. 2A and 2B). We next sought to characterize and compare B cell populations harboring wild type or M2 null MHV68 (M2. Stop) in infected mice. The infected spleens were harvested at day 16 post-infection and the presence of virus in distinct B cell populations was assessed by flow cytometry. Analyses of total splenoctyes revealed equivalent levels of marginal zone B cells (CD21hiCD23lo) in infected and naïve mice, but slightly lower levels of follicular B cells (CD21hiCD23hi) coupled with a slight increase in newly formed B cells (CD21loCD23lo) in mice infected with either wild type or M2 null MHV68 compared to naïve mice (Fig. 2C). Analysis of the distribution of virus in these B cell populations revealed that M2 null virus infection, like wild type MHV68, was present in each of these B cell populations (Fig. 2D). However, the M2 null virus was diminished in marginal zone B cells and elevated in follicular B cells compared to wild type MHV68 (Fig. 2D). As we have previously noted [19], the pattern of CD21 and CD23 surface expression on MHV68 infected cells is somewhat distinct from that observed in naïve mice. Indeed, it has been shown that both CD21 and CD23 expression can be modulated by EBV, KSHV and MHV68 [26], [27] (C. M. Collins and S. H. Speck., unpublished data). Thus, some caution must be taken in interpreting the distribution of wild type and M2 null MHV68 in these splenic B cell populations. Finally, although we observed decreased levels of activated B cells (CD19+CD69hi) in the spleens of mice infected with the M2 null virus compared to wild type MHV68-YFP infected mice (which correlates with a less robust establishment of splenic latency in M2. Stop infected mice), a similar percentage (ca. 40%) of virus infected B cells (YFP+) exhibited an activated phenotype in M2. Stop-YFP and wild type MHV68-YFP infected mice (Fig. 2E). Comparing establishment of B cell latency in the spleen using wild type MHV68-YFP and M2. Stop-YFP recombinant viruses, we observed a smaller germinal center response in mice infected with the M2. Stop-YFP virus at day 16 post-infection (Fig. 3A and 3B). However, even though there was a diminished germinal center response (coupled with a lower frequency of M2. Stop-YFP infected B cells compared to MHV68-YFP infected mice), when we examined the distribution of virus infected cells we observed that a very similar percentage of wild type and M2. Stop virus infected B cells exhibited a germinal center phenotype (GL7+/CD95+) (Fig. 3C and 3D). This substantiates earlier analyses demonstrating the ability of M2 null viruses to form and expand within germinal centers [18], [22]. Examination of immunoglobulin isotype class switching in the spleens of MHV68-YFP and M2. Stop-YFP infected mice revealed a significant difference in the presence of B cells that had switched to IgG2a, the predominant IgG subtype observed following MHV68 infection (unpublished data) as well as many other viral infections [28]. While approximately 6% of splenic B cells were IgD−/IgG2a+ following MHV68-YFP infection, <1% had switched to IgG2a following infection with the M2. Stop-YFP virus (Fig. 3E). Furthermore, approximately 50% of wild type MHV68-YFP was found in IgG2a+ B cells while <10% of M2. Stop-YFP virus was in IgG2a+ B cells (Fig. 3F). These results are consistent with our previous analyses indicating that the M2. Stop virus is impaired in gaining access to isotype switched B cells [18]. These results implicate a role for M2 in modulating immunoglobulin isotype class switching. Based on the recently established link between plasma cell differentiation and gammaherpesvirus reactivation [8], [9], [10], [11], [12], we assessed the presence of MHV68 in plasma cells at the peak of splenic latency (days 16–18 post-infection). We analyzed individual mice infected with wild type MHV68-YFP or M2. Stop-YFP for the presence of virus infected plasma cells (YFP+/B220lo/−/CD138+). Consistently, in mice infected with MHV68-YFP, approximately 8% of virus infected B cells were plasma cells at day 16 post-infection (Fig. 4A and 4C). In stark contrast, ≤1. 5% of M2. Stop-YFP virus infected B cells were plasma cells (Fig. 4A and 4C). Notably, analysis of bulk splenocytes revealed that the frequency of plasma cells in the spleens of wild type and M2 null virus infected mice were relatively comparable (approximately 1. 5%), and slightly higher than the levels observed in naive mice (about 0. 5%) (Fig. 4B). Finally, we used a functional assay to directly assess the presence of wild type MHV68 in plasma cells. YFP+ splenocytes were isolated by flow cytometry and analyzed by ELISPOT to determine the frequency of antibody secreting cells (ASC). As expected, the YFP+ cell population recovered from mice infected with the wild type MHV68-YFP virus was substantially enriched for plasma cells compared to unfractionated splenocytes (Fig. 2D). Because we have previously shown that dose of M2. Stop virus can impact the phenotype observed [18], we assessed whether increasing the dose of M2. Stop from 100 to 1,000 pfu would lead to detectable M2. Stop virus infection of plasma cells. Notably, even following intranasal inoculation with 1,000 pfu of M2. Stop-YFP we failed to observe any YFP+ plasma cells (data not shown). Thus, we conclude that a significant percentage of MHV68 infection at the peak of viral latency is present in plasma cells, and that this population is largely absent in mice infected with the M2 null virus (M2. Stop-YFP), indicating a critical role for M2 in plasma cell differentiation during MHV68 chronic infection. We noted that the percentage of virus infected splenocytes that were plasma cells (see Fig. 4C) correlated closely with the percentage of infected splenocytes that spontaneously reactivate MHV68 upon explants [13]. To assess whether MHV68 reactivation is linked to plasma cell differentiation, we purified plasma cells from mice infected with wild type MHV68-YFP and simultaneously isolated plasma cell-depleted splenocytes (Fig. 5A and 5B). Subsequent ELISPOT analyses of the purified populations confirmed appropriate enrichment or depletion of plasma cells (Fig. 5D). To determine the frequency of cells in each population harboring viral genome (a surrogate measure of the frequency of latently infected cells), the plasma cell enriched and depleted populations, along with unfractionated splenocytes, were analyzed for the presence of MHV68 infection using a limiting dilution nested PCR analysis [13] (Fig. 5C, left panel). This analysis revealed that there was a slightly higher frequency of viral genome positive cells in the plasma cell population (approximately 1 in 100 plasma cells) than in either total splenocytes or plasma cell depleted splenocytes (approximately 1 in 300 cells). Virus reactivation was examined using a limiting dilution analysis in which splenocyte populations were plated onto permissive monolayers of mouse embryo fibroblasts and virus reactivation scored 2 to 3 weeks post-plating by the appearance of viral cytopathic effect (cpe) [13]. Notably, this reactivation analysis revealed a profound difference between the plasma cell enriched and depleted populations (Fig. 5C, right panel). Approximately 50% of MHV68 infected plasma cells spontaneously reactivated virus in this assay (approximately 1 in 200 plasma cells reactivated virus compared to 1 in 100 plasma cells which harbor viral genome), while only approximately 1% of the virus infected non-plasma cell population reactivated virus (approximately 1 in 25,000 non-plasma cells reactivated virus compared to 1 in 300 in this population that harbor viral genome). As expected, approximately 10% of unfractionated splenocytes spontaneously reactivated virus (approximately 1 in 3,000 splenocytes reactivated virus compared to 1 in 300 harboring viral genome) (Fig. 5C, right panel). Thus, even though the frequency of infected cells is roughly the same in the plasma cell and non-plasma cell splenocyte populations, the frequency of plasma cells reactivating virus is ca. 100-fold higher than the non-plasma cell fraction. These results are consistent with recent studies characterizing EBV and KSHV reactivation that have linked plasma cell differentiation to virus reactivation [8], [9], [10], [11], [12]. In light of these results, the nearly complete absence of the M2 null mutant (M2. Stop-YFP virus) in splenic plasma cells correlates with the B cell reactivation defect observed with this mutant virus. To determine whether M2 plays a direct role in driving plasma cell differentiation, we utilized the BCL-1 B lymphoma cell line which can be induced to differentiate into plasma cells by various stimuli [3], [29]. Transient transfection of murine stem cell virus (MSCV) vectors containing either M2 or a negative control (MSCV harboring the M2. Stop expression cassette) into the BCL-1 cell line resulted in an M2-dependent change in cell morphology (Fig. 6A). M2 expression (monitored by GFP expression) led to acquisition of a plasmacyte morphology (Fig. 6A), which could be detected by flow cytometry as an increase in both size and granularity of the cells (Fig. 6B). We extended this analysis to examine changes in the expression of genes associated with the plasma cell differentiation program. Compared to M2. Stop transfected cells, there was a significant induction in the levels of transcripts encoding several plasma cell-associated factors (XBP-1s, Blimp-1, J chain and IRF-4); changes that were also observed upon LPS stimulation of the BCL-1 cell line (Fig. 6C). Notably, we repeatedly observed, following transfection with the M2. Stop vector, lower levels of these plasma cell-associated transcripts than was observed in untreated BCL-1 cells – suggesting that the transfection protocol leads to selective loss of those cells in the starting BCL-1 cell population that have spontaneously differentiated to plasma cells during normal passage in culture (Fig. 6C). Finally, analysis of the levels of secreted IgM in the tissue culture supernatants at 48 hours post-treatment or transfection demonstrated higher levels of secreted IgM in the M2 expressing and LPS treated cultures than in either the M2. Stop (vector) or untreated cultures (Fig. 6D). Thus, we conclude that M2 alone is able to drive plasma cell differentiation of the BCL-1 cell line. We have shown here that MHV68 reactivation from splenic B cells is linked to M2-driven terminal differentiation of B cells to plasma cells in vivo, supporting previous data that terminal differentiation into plasma cells is linked to reactivation of the human gammaherpesviruses KSHV and EBV [8], [9], [10], [11], [12]. Our previous studies have demonstrated that M2 expression in primary murine B cells in tissue culture was able to drive B cell differentiation along a path toward plasma cells, although during their limited time survival in culture these cells only reached a phenotype referred to as pre-plasma memory B cells [30]. Previous studies on the function of M2 suggest a possible mechanism (s) to drive plasma cell differentiation (Fig. 6E). Madureira et al. [31] and Rodrigues et al. [23] demonstrated that three PXXP motifs located in the C-terminal half of M2 play a role in binding Vav1 and Vav2, and that M2 induces phosphorylation of Vav leading to downstream Rac1 stimulation. Additionally, the M2 protein harbors 2 tyrosine residues that are predicted to be potential phosphorylation sites and have been shown to be essential for the formation of a trimolecular complex with Vav1 and the Src family kinase Fyn [31]. Notably, it has been shown that Vav knockout mice have very low levels of serum immunoglobulin and a severe defect in the induction of Blimp-1 expression [32]. Thus, it seems likely that under some conditions M2 activation of Vav may lead to Blimp-1 expression and entry into the plasma cell program (Fig. 6E). In addition, we have previously shown M2 expression in primary murine B cells leads to high level IL-10 expression [30]. We have proposed to M2-driven IL-10 expression plays a role in both driving expansion of latently infected B cells, as well as suppressing the host immune response during the establishment of latency [30]. However, it is also possible that M2-driven IL-10 expression plays a direct role in facilitating plasma cell differentiation. The latter is based on studies that have shown a role for IL-10 in plasma cell differentiation using model systems employing human B cells [33], [34], [35], [36]. Finally, as we have shown here, M2 also upregulates the expression of IRF4 [we have observed both M2-driven upregulation of IRF4 transcripts (Fig. 6C) and IRF4 protein (data not shown) in BCL-1 cells]. Induction of IRF4 is of significant interest because it has been shown to play critical roles in both isotype switching during the germinal center reaction, and plasma cell differentiation [2], [37]. We propose that entry into the plasma cell program results in the induction of the MHV68 immediate-early transcriptional activator RTA and subsequent activation of the virus replication cycle (Fig. 6E). The latter steps are based on the observed ability of the plasma cell-associated factor XBP-1s to transactivate the critical viral promoters involved in driving expression of the EBV and KSHV lytic switch genes [8], [9], [10], [11], [12]. Does M2-driven plasma cell differentiation play a role in MHV68 reactivation from latently infected M12 B lymphoma cells (see Fig. 1)? We hypothesized that the role of M2 in facilitating TPA reactivation of the latently infected M12 B cell lines could reflect TPA induction of M2 expression, leading to sufficient levels of M2 protein to drive plasma cell differentiation and virus reactivation. This would be consistent with our observation that ectopic expression of M2 alone is sufficient to drive MHV68 reactivation from either wt or M2. Stop infected M12 B cell lines (see Fig. 1D). We have attempted to assess this following TPA stimulation of wild type MHV68 infected M12 cells and have been unable to document any hallmarks of plasma cell differentiation, with the exception of a modest increase in the levels of secreted IgG (XL and SHS, unpublished data). This could reflect insufficient sensitivity of the assays employed – the increased levels of secreted IgG would be consistent with this interpretation, suggesting that a small percentage of cells in the culture differentiate to plasma cells, secrete IgG and then perhaps rapidly disappear due to virus induced cytopathic effect. Alternatively, these results may point to an independent function of M2 that is also involved in promoting virus reactivation from latently infected B cells under some conditions. With respect to the latter possibility, it is clear that plasma cell differentiation is not the only pathway for gammaherpesvirus reactivation from latently infected B cells – other stimuli such as DNA damage can also trigger MHV68 reactivation [38]. A role for M2 in these responses remains to be determined. It is notable that loss of M2 leads to alterations in immunoglobulin isotype switching in infected B cells (see Fig. 3E and 3F). These results are consistent with our previous observation that M2 null mutants exhibited a significantly slower decay in naïve B cells (CD19+/IgD+) compared to wild type MHV68 [18], suggesting that M2 is involved in driving the differentiation of naïve B cells. Similarly, Simas and colleagues noted that the absence of M2 led to a prolonged persistence of virus infected B cells in germinal centers [22]. Taken together, these data implicate a role for M2 in facilitating B cell differentiation through the germinal center reaction and perhaps directly impacting immunoglobulin isotype switching. Among the genes that were upregulated upon expression of M2 in the BCL-1 B lymphoma cell line was the cellular transcription factor IRF4 (Fig. 6C, and unpublished data), which has been shown to be required for both isotype switching as well as plasma cell differentiation [2]. As such, it is possible that M2 modulation of the levels of IRF4 may account for the apparently distinct roles of M2 in immunoglobulin isotype switching and plasma cell differentiation. This will require further investigation to identify the relevant cellular pathways that are manipulated by M2. Previous studies have demonstrated that M2 is completely dispensable for virus replication in permissive cell lines, as well as in the lung following intranasal inoculation [18], [39]. However, we have shown a more rapid clearance of M2 null virus replication in the spleen following high dose intraperitoneal inoculation (equivalent replication of wild type and M2 null viruses at day 4 post-infection, and a >20-fold decrease in virus titer of M2 null mutants compared to wild type MHV68 at day 9 post-infection) [21]. The basis for the acute replication defect in the spleen is unknown, but based on a requirement for B cells to seed splenic latency following intranasal virus inoculation (but not following intraperitoneal inoculation) [13], [40], we have postulated a role for virus reactivation from latently infected B cells playing a role in seeding acute virus replication in the spleen. Thus, while high dose intraperitoneal inoculation bypasses the requirement for B cells to seed initial acute MHV68 replication in the spleen at day 4 post-infection [13], virus reactivation from MHV68 infected plasma cells may play a role in driving the sustained virus replication observed in the spleen at day 9 post-intraperitoneal inoculation (levels of virus in the spleen at days 4 and 9 post-infection are equivalent). If so, then the B cell reactivation defect observed in M2 null virus infected mice would translate as a late stage acute virus replication defect in the spleen. Regardless, there is no evidence that M2 plays a direct role in virus replication. As such, M2 appears to play a specialized role to facilitate virus reactivation from latently infected B cells. An alternative model that is worthy of consideration relates to the impact of M2-driven IL-10 expression on virus-specific CD8+ T cell responses. We have previously shown that loss of M2 leads to increased levels of virus-specific CD8+ T cells, as assessed using tetramers to two distinct viral epitopes (ORF6486–498 and ORF61524–531) expressed during MHV68 replication [30]. Thus, enhanced CD8+ T cell responses directed against MHV68 replication-associated antigens in M2. Stop infected mice may result in the rapid clearance of virus infected plasma cells expressing replication-associated viral antigens - leading to the observed absence of infected plasma cells at the peak of viral infection in the spleen. As such, in this model, M2 would not be expected to be playing a direct role in driving plasma cell differentiation. We believe that this model is unlikely to account for the absence of MHV68 infected plasma cells based on the observed role of M2 in virus reactivation from the MHV68 M12 infected cell lines (see Fig. 1B and 1D), as well as the ability of M2 to drive terminal differentiation of the BCL-1 cell line in culture (Fig. 6). However, we clearly cannot dismiss a role for enhanced antiviral CD8+ T cell responses in M2. Stop infected mice in controlling the frequency of virus infected plasma cells. Based on the analysis of M2 function, we propose that M2 falls into a new class of herpesvirus genes that do not directly impact virus replication, but rather facilitate virus reactivation from latency by manipulating cellular differentiation/activation leading to a reactivation competent cellular environment. We have adopted the term reactivation conditioner for such genes. In the case of viruses that establish latency in memory lymphocytes, it is attractive to speculate that it may be necessary to encode functions that drive quiescent memory B or T cells into a state which is more conducive to virus replication. With respect to latency established in memory B cells, plasma cells would appear particularly well suited to support herpesvirus replication. As such, we hypothesize that manipulation of plasma cell differentiation leading to virus reactivation from latently infected memory B cells is relevant to reactivation of the human gammaherpesviruses. Although there is no obvious M2 homolog in either EBV or KSHV, there are several well documented examples of conserved functions encoded by gammaherpesvirus latency-associate gene products that lack obvious sequence homology [41]. Indeed, our previous observation that M2 expression in primary murine B cells triggers IL-6 and IL-10 expression [30], recapitulates functions modulated by both EBV and KSHV [42], [43], and provides further evidence of pathogenic strategies that are conserved among this family of viruses. Importantly, our studies provide the impetus to identify viral gene products encoded by EBV and/or KSHV that manipulate plasma cell differentiation, which may ultimately provide new targets for the development of antiviral therapies against these chronic infections. The recombinant viruses, generated as described below, were passaged and titered as previously described [44]. Murine NIH 3T12 fibroblast cells were cultured in Dulbecco' s modified Eagle medium supplemented with 10% fetal cal serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamine. The M12 B lymphoma cell line was generously provided by Dr. David Schatz (Yale University School of Medicine, New Haven, CT), and was cultured in RPMI 1640 medium supplemented with 10% fetal cal serum, 100 U/ml penicillin, 100 µg/ml streptomycin and 50 µM 2-mercapto-ethanol. Female C57Bl/6 mice 6 to 8 weeks of age were purchased from the Jackson Laboratory. Mice were sterile housed and treated according to Emory University School of Medicine (Atlanta, GA) guidelines and all animal studies were approved by the Emory University Institutional Animal Care and Use Committee. Following sedation, mice were infected intranasally with 100 pfu of either MHV68-YFP or M2stop-YFP viruses in 20 µL of cMEM. Mice were allowed to recover from anesthesia before being returned to their cages. The recombinant hygromycin–EGFP-expressing MHV68M2. Stop viruses (M2. Stop-HE) were generated by allelic exchange using a previously described MHV68-BAC containing a hygromycin-EGFP fusion gene under the control of the HCMV immediate-early promoter in the ORF27/29b locus (MHV68-HE BAC) [38] and a targeting vector containing the M2 gene with a translation stop and frame shift incorporated at bp 4,559 of the viral genome (pGS284/M2stop) as previously described [45]. To establish MHV68 latently infected M12 cell lines, M12 cells were infected with WT-HE or M2stop-HE viruses by spinoculation at 1,800 rpm for 90 min and then subjected to hygromycin (400 µg/ml) selection. The individual clonal cell lines were established by limiting dilution cloning, and the presence of episomal copies of the MHV68 genome confirmed by Gardella gel electrophoresis [46]. Cells were lysed with RIPA buffer (150 mM NaCl, 20 mM Tris. Cl, 2 mM EDTA, 1% NP-40 supplemented with EDTA-free protease inhibitor) (Roche). The whole cell lysates were resolved by SDS-PAGE gel electrophoresis, transferred to nitrocellulose membranes and immunoblotting with chicken anti-ORF59 or rabbit anti-MHV68 antiserum [38]. Plaque assays were performed in NIH3T12 fibroblast cells as previously described [38]. Briefly, cells and supernatants were collected at various times post-induction with TPA (20 ng/ml) and frozen at −80°C. Samples were then subjected to two cycles of freezing and thawing, and virus titers were quantitated by plaque assay on NIH 3T12 fibroblasts. Total RNA was isolated from untreated or treated cells using TRIzol per manufacturer' s protocol (Invitrogen). 2 µg RNA was used for first-strand cDNA synthesis (Invitrogen), followed by PCR amplification using the appropriate oligonucleotide primers as previously described [38]. The primers used for the detection of plasma cell-associated transcripts in BCL-1 cells were as follows; specific spliced XBP-1 (s): 5′-GTAGCAGCGCAGACTGCTCGAGATAG-3′ and 5′-GAGGTGCACATAGTCTGCACCAGC-3′, unspliced XBP-1 (u): 5′-GTAGCAGCGCAGACTGC TCGAGATAG-3′ and 5′-AGTGCTGCGGACTCAGCAGACCCGGC-3′, J chain: 5′-ATGAAGACC CACCTGCTTCTC-3′ and 5′-GTCAGGGTAGCAAGAATCGG G-3′, IRF4: 5′-ATGAACTTGGA GACGGGCAGCCGGGGC-3′ and 5′-TCACTCTTGGA TGGAAGAATGACGGAGGGA-3′, Blimp-1: 5′-GGAGGATCTGACCCGAATCA-3′ and 5′-CTCCACCATGGAGGTCACATC, M2: 5′-ATGG GCCCAACACCCCCACAAGGAAAG-3′ and 5′-TTACTCCTCGCCCCACTCCACAAAACC-3′, actin: 5′-TAAGTGGTTACAGGAA G-3′ and 5′-AGCCTTCATACATCAAG-3′. All primers employed were designed to amplify spliced gene products and, as such, any products arising from contaminating DNA would run at a larger size (not detected). The frequency of MHV68 genome-positive cells was determined using a previously described nested PCR assay (LD-PCR) [13]. Briefly, cells were counted, resuspended in an isotonic solution, and diluted into a background of 104 uninfected NIH 3T12 cells. Following cell lysis with proteinase K, two rounds of nested PCR were performed on each sample to detect the presence of the MHV68 ORF50. To ensure sufficient sensitivity of the nested PCR reaction, 10,1, or 0. 1 copies of a gene 50 containing plasmid (pBamHI N) were diluted into a background of 104 uninfected cells and analyzed in parallel with the experimental sample. The frequency of MHV68 reactivation from latency was also detected as previously described [13]. Briefly, cells were plated in a series of twofold dilutions onto MEF monolayers in 96-well tissue culture plates. After 21 days, wells were scored microscopically for the presence of viral cytopathic effect (CPE). To detect preformed infectious virus, parallel samples were subjected to mechanical disruption as previously described [13], a process that kills >99% of cells without affecting the preformed MHV68 virions [13]. Disrupted cells were plated in a similar series of twofold dilutions. Flow cytometry analyses for murine splenic cells were done as previously described [30] with the following antibodies: GL-7-Biotin, Stratavidin-APC, CD95-PE, CD138-PE, B220-Pacific Blue (CALTAG Laboratories), CD19-FITC, CD3e-PerCP, IgG2a-Biotin (BD Pharmingen, except where noted). The data were collected on a LSRII flow cytometer (BD Biosciences). For purification of plasma cells, single-cell suspensions were isolated from infected spleens at day 16 post-infection with 100 pfu of the MHV68-YFP recombinant virus administered via intranasal inoculation. The cells were labeled with CD138-PE and B220-Pacific Blue on ice for 20 min, followed by washing with 1% BSA/PBS. The stained cell populations were then sorted on either a FACSVantage or FACSAria™ II flow cytometer (BD Biosciences). For purification of YFP+ cell populations, the single cell suspensions were directly subjected to separation on a FACSVantage and FACSAria™ II flow cytometer (BD Bioscience). ELISA for IgM secretion was performed as per manufacturer' s protocol (Bethyl Laboratory). To analyze antibody secretion from sorted YFP+ or plasma cell populations, mouse IgG capture antibodies were coated onto a PVDF-backed microplate. The sorted cell populations were plated onto blocked plates at serial dilution and incubated in a humidified 37°C CO2 incubator for overnight. The wells were washed and bound antibodies were detected with anti-mouse IgG antibodies. The spots were counted using automated ELISPOT reader.

Title: Gammaherpesvirus-Driven Plasma Cell Differentiation Regulates Virus Reactivation from Latently Infected B Lymphocytes Summary: Gammaherpesviruses are associated with the development of lymphomas, particularly in immunosuppressed individuals, as well as several other types of cancers. Like all herpesviruses, once a host is infected these viruses cannot be cleared and, as such, infected individuals harbor these viruses for life. One of the important strategies utilized by herpesviruses to chronically infect their host is their ability to establish a largely quiescent form of infection referred to as latency, in which no progeny virus is produced. Importantly, all herpesviruses have the capacity to emerge from latency and replicate, a process referred to as reactivation. Gammaherpesviruses largely persist in a population of white blood cells called B lymphocytes which, upon differentiation into plasma cells, produce antibodies in response to infection. Notably, it has been recently shown for the human gammaherpesviruses, Epstein-Barr virus and Kaposi' s sarcoma-associated herpesvirus, that virus reactivation from latently infected B lymphocytes involves differentiation of the infected B lymphocytes to plasma cells. Here, using a small animal model of gammaherpesvirus infection, we show that plasma cell differentiation is also associated with reactivation of murine gammaherpesvirus 68. Furthermore, we show that this requires a protein encoded by the virus which is able to drive plasma cell differentiation. Thus, our studies not only confirm the importance of plasma cell differentiation in gammaherpesvirus reactivation from B lymphocytes, but also provide evidence that this process is controlled by a viral protein.

lay_plos

en

Write a title and summarize: Salmonella enterica serovar Enteritidis is a cause of both poultry- and egg-associated enterocolitis globally and bloodstream-invasive nontyphoidal Salmonella (iNTS) disease in sub-Saharan Africa (sSA). Distinct, multi-drug resistant genotypes associated with iNTS disease in sSA have recently been described, often requiring treatment with fluoroquinolone antibiotics. In industrialised countries, antimicrobial use in poultry production has led to frequent fluoroquinolone resistance amongst globally prevalent enterocolitis-associated lineages. Twenty seven S. Enteritidis isolates from patients with iNTS disease and two poultry isolates, collected between 2007 and 2015 in the Ashanti region of Ghana, were whole-genome sequenced. These isolates, notable for a high rate of diminished ciprofloxacin susceptibility (DCS), were placed in the phyletic context of 1,067 sequences from the Public Health England (PHE) S. Enteritidis genome database to understand whether DCS was associated with African or globally-circulating clades of S. Enteritidis. Analysis showed four of the major S. Enteritidis clades were represented, two global and two African. All thirteen DCS isolates, containing a single gyrA mutation at codon 87, belonged to a global PT4-like clade responsible for epidemics of poultry-associated enterocolitis. Apart from two DCS isolates, which clustered with PHE isolates associated with travel to Spain and Brazil, the remaining DCS isolates, including one poultry isolate, belonged to two monophyletic clusters in which gyrA 87 mutations appear to have developed within the region. Extensive phylogenetic diversity is evident amongst iNTS disease-associated S. Enteritidis in Ghana. Antimicrobial resistance profiles differed by clade, highlighting the challenges of devising empirical sepsis guidelines. The detection of fluoroquinolone resistance in phyletically-related poultry and human isolates is of major concern and surveillance and control measures within the region’s burgeoning poultry industry are required to protect a human population at high risk of iNTS disease. Nontyphoidal Salmonella (NTS) are a leading cause of bloodstream infection in sub-Saharan Africa (sSA), a clinical syndrome referred to as invasive nontyphoidal Salmonella (iNTS) disease. iNTS disease in sSA is most commonly caused by Salmonella enterica serovars Salmonella Typhimurium or Salmonella Enteritidis, and predominantly affects children <3 years and adults with advanced HIV infection, with a case fatality rate of 19% [1]. The most recent global estimate for iNTS disease was 3. 4 million cases in 2010, the majority of which (58%) were in sSA [2,3]. The lack of a human vaccine against NTS places a primary importance on interruption of transmission and the availability of effective antibiotics to reduce iNTS-related morbidity and mortality. The strains circulating in sSA are, however, frequently multidrug resistant (MDR; defined in this study as resistant to three or more antimicrobial classes), leaving third-generation cephalosporins and fluoroquinolones as the key agents in treating iNTS disease [4–6]. The emergence of both fluoroquinolone resistance mutations and extended spectrum beta-lactamase production amongst NTS in recent years could therefore lead to cases that are untreatable with currently available antibiotics in resource-poor settings [4,7]. Whilst the prevalence of fluoroquinolone resistance amongst African salmonellae is still relatively low in comparison to other regions, such as Asia, this is expected to change as these agents become more widely available [4,7–12]. There have been several reports of novel lineages of NTS associated with invasive disease in Africa [5,6, 13,14]. A study of S. Enteritidis provided evidence for the recent emergence of two novel clades of this serovar, one geographically restricted to West Africa and the other to Central/East Africa [13]. Both clades differ substantially from the clade causing the global epidemic of poultry- and enterocolitis-associated S. Enteritidis. In common with S. Typhimurium multi-locus sequence type ST313 [5], the novel clades of S. Enteritidis both have distinct prophage repertoires, harbour an expanded multidrug-resistance plasmid and exhibit genomic degradation similar to that seen in host-restricted typhoidal salmonellae, which have a more invasive pathotype. Although Salmonella enterica in Europe has historically remained susceptible to most antibiotics, resistance to ciprofloxacin is now significant (13. 3% amongst human NTS isolates in 2015) and these figures are largely driven by S. Enteritidis [15] and consumption of poultry products contaminated with resistant strains [16,17]. Similarly, nalidixic acid (NA) resistance (a marker for diminished ciprofloxacin susceptibility, DCS), conferred by single point mutations in the gyrA gene at codons 83 or 87, has been found in as many as 50% of human S. Enteritidis isolates in European studies [16,18,19]. We recently reported a high prevalence of DCS amongst iNTS disease-associated isolates collected in the Ashanti region of Ghana between 2007 and 2012, particularly amongst S. Enteritidis, with 10/19 (53%) having reduced susceptibility compared to only 2% (3/129) of S. Typhimurium [20]. The underlying epidemiology of DCS amongst NTS strains in Africa remains poorly described. The increasing global trade in poultry and the high levels of ciprofloxacin resistance amongst NTS strains in food animals in high-income countries [15,21,22] support a possible role for importation of resistant strains. In particular, Ghana imports large volumes of live birds and poultry meat from abroad (https: //comtrade. un. org). Alternatively, less regulated use of antibiotics in animal husbandry combined with a growth in intensive farming practises may promote the local emergence of resistance. S. Enteritidis displays niche plasticity, with distinct clades that enable it to become a prominent cause of gastroenteritis globally in association with the industrial production of eggs and poultry, and of multidrug-resistant, bloodstream-invasive infection in Africa [13]. Ghana has both a human population at risk of iNTS disease and an expanding poultry industry. We therefore performed whole genome sequencing of iNTS disease-associated S. Enteritidis isolates from Ghana found to have a high rate of the DCS phenotype, as well as poultry isolates from the same region, in order to understand whether DCS was associated with African or global clades of S. Enteritidis, as control measures are likely to be different. Blood cultures were collected as part of hospital surveillance studies for bloodstream infections conducted between September 2007 and April 2015 at the Inpatient Department of Agogo Presbyterian Hospital and the Outpatient Department of St Michael’s Hospital, Pramso, both located in the Ashanti Region in central Ghana [10,20,23,24]. All children ≥30 days and ≤15 years of age presenting with either a temperature of ≥37. 5°C or reported fever within the past 72 hours were enrolled in the study. One to three milliliters of blood was taken from each child following local antisepsis protocols and inoculated into a paediatric blood culture bottle (BACTEC Peds Plus/F, Becton Dickinson) and processed using a BACTEC 9050 blood culture system (Becton Dickinson). During 2010, recruitment took place and blood cultures were performed on the adult ward of the Agogo Presbyterian Hospital. Both local and imported poultry meat was purchased between May to December 2015 from retailers and open markets within Kumasi, the capital of the Ashanti region. 15g of each meat sample was immediately placed in sterile homogeniser bags and transported refrigerated to the laboratory. Ethical approval was granted by The Committee on Human Research, Publications and Ethics, School of Medical Science, Kwame Nkrumah University of Science and Technology in Kumasi, Ghana (CHRPE/AP/427/13; CHRPE/101/09), the International Vaccine Institute, South Korea (IVI IRB#2008–002,2011–001) and the Ethics Committee of the Medical Association Hamburg, Germany (PV4592). Written informed consent was obtained from adults or the parents or guardian of study children prior to enrolment. Methods for the identification of Salmonella from blood culture have been described previously [20,24]. In brief, positive blood cultures were subcultured on Columbia blood agar, chocolate agar, and MacConkey agar (Oxoid, UK). Salmonella isolates were identified biochemically by API 20E tests (bioMérieux, France) and serotyped following the White–Kauffmann–Le Minor scheme. Ground meat samples were incubated overnight in Selenite broth (Oxoid) and subsequently cultured on Xylose Lysine Deoxycholate agar (Oxoid). Identification was performed as for blood culture isolates. Ciprofloxacin minimum inhibitory concentrations (MICs) were determined by Etest (Oxoid) according to the European Committee for Antimicrobial Susceptibility Testing (EUCAST) guidelines [25]. Isolates were classed as ciprofloxacin susceptible (MIC ≤0. 06 μg/mL), intermediate/diminished susceptibility (MIC >0. 06 and <1 μg/mL) or resistant (MIC ≥1 μg/mL). DNA was extracted using the QIAamp DNA Mini-kit (Qiagen, Germany) according to the manufacturer’s instructions. Sequencing of extracted DNA from isolates 1–21 was performed by the Wellcome Trust Sanger Institute using the Nextera XT library preparation kit on the Illumina HiSeq 2000 (Illumina, USA) yielding 100bp paired-end reads. Extracted DNA from isolates 22–29 was sequenced by the Public Health England (PHE) Genome Sequencing Unit using the Nextera XT library preparation kit on the Illumina HiSeq 2500 (Illumina, USA) run in fast mode according to the manufacturer’s instructions, which yielded 2x 100bp paired end reads (see S1 Table for individual isolate details and accession numbers). Multi-locus sequence typing (MLST) analysis was performed using MOST [26]. Identification of antimicrobial resistance determinants (ARD) was performed as previously described [27]. Quality trimmed Illumina reads were mapped to the Salmonella enterica Enteritidis reference genome P125109 (GenBank: AM933172) using BWA-MEM [28]. Single nucleotide polymorphisms (SNPs) were then identified using GATK2 [29] in unified genotyper mode. Core genome positions that had a high quality SNP (>90% consensus, minimum depth 10x, GQ> = 30) in at least one strain were extracted and RaxML v8. 17 [30] used to derive the maximum likelihood phylogeny of the isolates under the GTRCAT model of evolution. Support for the maximum likelihood phylogeny was assessed via 100 bootstrap replicates. Single linkage SNP clustering of the isolates within the PHE S. Enteritidis (eBurst Group 4) database, consisting primarily of clinical isolates from routine surveillance in the UK, but also sequences obtained from public databases, was performed as previously described [31]. FASTQ reads from all sequences in this study can be found at the PHE Pathogens BioProject at the National Center for Biotechnology Information (Accession PRJNA248792). The temporal signal for a given phylogenetic tree was determined using TempEst v1. 5. 1 [32], using the tree and tabulated sample dates as input data. The presence and absence of the MDR virulence plasmid, pSEN-BT (GenBank accession: LN879484), and a reference plasmid, pSENT (GenBank accession: HG970000), not associated with MDR, was determined by mapping (>90% consensus, minimum depth 10x, GQ> = 30) short reads from each isolate to the two plasmids using BWA-MEM [28] and plotting the depth coverage. A coverage threshold of > 90% was used to score the presence or absence of the virulence and reference plasmids. MDR was defined in this study as resistance to ≥ 3 antimicrobial classes. Twenty nine S. Enteritidis isolates were collected between 2007 and 2015; twenty five from children (median age 24 months, IQR 12–36 months), two from adults and two from poultry meat in 2015 (S1 Table). One poultry isolate originated from fresh slaughtered local meat while the other originated from imported (USA) frozen meat. Of the 27 individual patients only one had a suspected admission diagnosis of gastroenteritis recorded (Table 1). The majority (21/27,77. 8%) had a non-focal febrile illness, such as malaria or sepsis, recorded. All Ghanaian isolates had Sequence Types (STs) within S. Enteritidis eBurst Group 4; 25/29 were ST11, and the remaining four were distinct single locus variants of ST11. When the isolates were placed in the context of the PHE surveillance isolates and a recently published global collection [13], a considerable amount of strain diversity was revealed (Fig 1). Fifteen isolates (14/27 human and 1/2 poultry) belonged to a ‘global epidemic clade’ containing isolates of multiple phage types (PT), including PT4 and PT1 [13], which have been linked to the global human epidemic of poultry-associated enterocolitis [33]. Six isolates (five human and one poultry) belonged to a lineage associated with shell egg outbreaks and egg-producing industries in North America [34]. Five human isolates belonged to the recently described West African clade and one human isolate clustered within the Central/East African clade, both associated with iNTS disease. The remaining two human isolates represented newly identified diversity in the S. Enteritidis population structure. Thirteen isolates contained a single gyrA mutation at codon 87, corresponding with a DCS phenotype by Etest (MIC >0. 06 and <1 μg/mL), and all belonged to the global epidemic clade. The majority of global epidemic clade isolates (13/15,86. 7%) contained the gyrA mutation, including the poultry isolate from this clade, which was obtained from a locally slaughtered bird. No other fluoroquinolone resistance determinants, including plasmid-mediated qnr genes, were detected amongst any of the isolates. Apart from the gyrA 87 mutation, the most commonly identified resistance determinants were as follows: eleven isolates contained sulphonamide (most commonly sul-2), ten isolates streptomycin (strA and strB) and nine isolates tetracycline (most commonly tet (A) ) resistance genes (S1 Table). Eleven isolates were MDR (10/27 human and 1/2 poultry). These comprised 7/15 (46. 7%) of global epidemic clade isolates and 4/5 (80%) of West African clade isolates. The previously described MDR phenotype in African S. Enteritidis is conferred by an expanded MDR pSENT virulence plasmid (pSEN-BT) [13] of incFII/incFIB type. In this study, West African clade isolates harboured a different expanded MDR pSENT virulence plasmid of incompatibility type incI1. The majority (10/15) of the global epidemic clade isolates, including the poultry isolate (SRR7072859), clustered into a monophyletic clade with substantial diversity (max SNP distance of 92) (Ghana Clade 1 in Figs 1 and 2). The clade has a strong temporal correlation (root-to-tip R2 = 0. 8) suggesting this clone has been present in Ghana for over twenty years. Clade 1 also contained ten isolates from human clinical cases from the UK, of which five reported recent travel to Ghana, as well as two isolates from human clinical cases from France. The French isolates were obtained in 2016 from stool samples from two children with gastroenteritis, returning from Ghana’s neighbouring countries, Togo and Cote D’Ivoire. Within Clade 1 9/10 Ghanaian isolates, 4/10 UK isolates and 2/2 French isolates harboured the same gyrA 87: D-G mutation. The tree topology reveals that this gyrA mutation likely evolved on two independent occasions within this region of West Africa (supported by 100% bootstrap values for these bifurcating nodes). Similarly, within this clade there have been multiple acquisitions of resistance determinants to sulphonamides, streptomycin and tetracycline. A smaller monophyletic cluster within the global epidemic clade comprised three Ghanaian isolates and four UK clinical isolates (Ghana Clade 2 in Figs 1 and 3). Metadata associated with three of the UK isolates had travel to Ghana recorded. Six out of seven isolates contained the gyrA 87: D-N mutation and an IS6-flanked integron containing catA-1, tet (A), strA, strB, sul-2, sul-1 and dfrA-1 genes. Within Clade 2, both emergence of the gyrA mutation and acquisition of the MDR locus has apparently occurred within the region (supported by 100% bootstrap values). One isolate (ERR1010141) had also acquired β-lactamase TEM-123. A single Ghanaian isolate (ERR1010036), containing the gyrA 87: D-Y mutation, was found to be related (36 SNPs to closest isolate) to a large sub-clade of PHE isolates strongly associated with travel to Spain, all of which contained the same gyrA mutation (Fig 4). The remaining Ghanaian global epidemic clade isolate (ERR1010101) clustered with a PHE isolate associated with travel to Brazil (22 SNPs to PHE isolate), and both contained a gyrA 87: D-N mutation. No other resistance determinants were present in these two Ghanaian isolates. Six out of the twenty nine Ghanaian isolates, including one poultry isolate, clustered within a lineage historically associated with North American poultry and shell egg outbreaks [34] (Fig 1). Related PHE isolates were overwhelmingly associated with travel to the Caribbean while the Ghanaian poultry isolate was obtained from frozen meat imported from the USA. No antimicrobial resistance (AMR) determinants were identified in the six isolates. Half (4/8,50%) of the isolates obtained in the last two years of sampling (2013–2015) belonged to this lineage. We report extensive diversity amongst S. Enteritidis isolated from bloodstream infections in the Ashanti region of Ghana, with four recently described, major clades [13] represented and distinct clusters identifiable within a global poultry- and enterocolitis-associated epidemic clade. In this study, the majority (15/29,52%) of isolates belonged to this global epidemic clade, whereas in other studies, African clades of S. Enteritidis have been the predominant cause of iNTS disease [12]. Despite the strong association between African clades and invasive disease [13], the considerable contribution of global clades to iNTS disease in this study is perhaps unsurprising given the importance of host risk factors in iNTS disease [35] and the recent expansion in intensive poultry farming in Ghana. It is also consistent with the experience in Malawi where both global and Central/ East African strains cause significant iNTS disease [13]. The diversity of AMR profiles between different clades of Salmonella and across sSA [this study, 12,13] highlights the challenges of implementing WHO IMCI/IMAI guidelines for the empirical management of sepsis and the importance of improving access to diagnostic microbiology facilities in low-income countries. In this study, almost half the global epidemic clade isolates were MDR (7/15,47% compared to 4/5,80% of West African clade isolates). The MDR phenotype has been shown to be strongly associated with the expansion of African NTS lineages and sequential iNTS epidemics, as well as the re-emergence of S. Typhi, in sSA [4,6, 36]. Furthermore, MDR strains have been found to be strongly associated with NTS bacteremia compared to NTS diarrhoea [37]. The region may therefore be at risk of an iNTS epidemic due to MDR global strains. Thirteen out of twenty nine (44. 8%) isolates in this study contained a fluoroquinolone resistance mutation, specifically a gyrA 87 mutation, and all belonged to the global epidemic clade. This clade is transmitted through eggs and poultry, in settings with established industrialised poultry farming where fluoroquinolone resistance rates of around 10% are frequently observed amongst S. Enteritidis [15,22]. Currently, Ghana is both rapidly expanding its domestic poultry industry [38,39] and importing a significant quantity of live fowl and poultry meat from abroad (https: //comtrade. un. org). Our analysis of global epidemic clade isolates in this study provides evidence of both local emergence of gyrA 87 mutations and importation of DCS S. Enteritidis. A DCS isolate carrying the gyrA 87: D-Y mutation was related to a large sub-clade associated with travel to Spain in the PHE collection, raising the possibility that this strain was imported from Europe. 2. 3 million kg of poultry meat was imported to Ghana from Spain in 2012 (https: //comtrade. un. org). A further Ghanaian isolate, related to a PHE isolate with reported travel to Brazil, may also represent importation of the gyrA mutation. Brazil, along with the US and EU, exports large quantities of day old chicks and hatching eggs to Ghana [39]. The majority of DCS isolates however, appeared to originate from strains in which the mutation has likely emerged locally. The isolate from locally slaughtered poultry, containing the gyrA 87: D-G mutation, is related to a large monophyletic cluster of Ghanaian human bloodstream isolates. Within this cluster, the gyrA 87: D-G mutation appears to have evolved independently at least twice. These results are consistent with the emergence of the mutation in response to fluoroquinolone use in domestic poultry industries. Interestingly, two French isolates within the cluster were associated with travel to Togo and Cote D’Ivoire, which may represent trade in poultry between Ghana and its neighbours or wider circulation of the strain. A second cluster of Ghanaian isolates demonstrates gyrA 87: D-N mutation emergence and MDR locus acquisition within the region. A recent cross-sectional survey found over 10% of poultry farms in the Ashanti region of Ghana, where the largest poultry farms in the country are located [39], reported fluoroquinolone use [40]. Indeed, the most common resistance determinants detected in the current study (other than the gyrA gene), conferring resistance to tetracyclines, sulphonamides and streptomycin, reflect the most commonly used antimicrobials in the Ghanaian poultry industry [40,41]. The global epidemic isolate from local poultry (both DCS and MDR) may therefore have originated from an intensive production background. The second poultry isolate (antimicrobial susceptible), which clustered within a lineage associated with North American poultry and shell egg outbreaks, was obtained from imported meat from the US, where broiler flock vaccination coverage is low [42]. Selection pressure arising from antimicrobial use within the region’s expanding poultry industry may be promoting the emergence of multidrug-resistant NTS disease-causing strains. The global epidemic of poultry- and egg-associated S. Enteritidis that began in the 1970s, and resulted in the collapse of national egg-producing industries, was eventually brought under control in European countries in the 2000s through a raft of farming hygiene measures as well as vaccination of poultry flocks [43]. The growing Ghanaian poultry industry may be facing the same challenges that the European industry faced during the 1980s and 1990s. Our study is limited by its single site nature and analysis of a greater number of isolates from multiple sites would allow for a fuller understanding of S. Enteritidis dynamics in the region. Poultry sampling was conducted over a short period after completion of the hospital surveillance studies and only two isolates were obtained. However, both isolates clustered within monophyletic clades containing significant numbers of our bloodstream isolates, thus providing a link between poultry production and trade and human iNTS disease in the region. Amongst global epidemic clade strains, a high rate of DCS may be developing in response to drug selection pressure within the region. Indeed, DCS strains that are likely circulating in Ghana’s expanding poultry industry appear to be responsible for a significant proportion of the S. Enteritidis invasive disease burden. Importantly, NTS disease and AMR patterns linked to poultry production are currently vaccine preventable problems, through a poultry rather than human vaccine. Surveillance and control measures within the burgeoning poultry industry, as well as a ‘one health’ approach, are required to protect a human population at high risk of iNTS disease.

Title: Emergence of phylogenetically diverse and fluoroquinolone resistant Salmonella Enteritidis as a cause of invasive nontyphoidal Salmonella disease in Ghana Summary: Salmonella enterica serovar Enteritidis is both a prominent global cause of zoonotic gastroenteritis, in association with the industrial production of eggs and poultry, and of bloodstream-invasive infection in sub-Saharan Africa, a clinical syndrome referred to as invasive nontyphoidal Salmonella (iNTS) disease. African epidemic iNTS strains are frequently multi-drug resistant, leaving fluoroquinolone antibiotics as key agents in reducing iNTS-associated morbidity and mortality. We analysed the genomes of S. Enteritidis collected in Ghana from patients with iNTS disease to investigate the emergence of fluoroquinolone resistance in the region. Extensive phylogenetic diversity was present, however, fluoroquinolone resistance was confined to a single clade causing global epidemics of poultry-associated gastroenteritis. This resistance has predominantly emerged locally, rather than being imported. We found that antimicrobial resistance patterns differed by S. Enteritidis clade, highlighting the challenges of devising empirical sepsis treatment guidelines in the absence of diagnostic microbiology facilities to monitor changes in resistance profiles. Furthermore, we detected fluoroquinolone resistance in closely related poultry and human isolates, suggesting a role of antimicrobial use within the growing local poultry industry in driving the emergence of resistance and a need for surveillance measures within this industry to protect a human population at high risk of iNTS disease.

lay_plos

en

Summarize: MADRID (AP) — A woman in Spain may be fined under the country's public security law for carrying a bag bearing the initials A.C.A.B., which police interpreted to stand for "All Cops Are Bastards" and not "All Cats Are Beautiful," as was written on the bag. A spokesman said Tuesday the type and coloring of the lettering are traditionally associated with the insult to police. He spoke on condition of anonymity in keeping with police regulations. The police department later issued a statement saying it had decided to further investigate the matter given the circumstances of the incident and the possible "ambivalence" of the initials. The fine of between 100 and 600 euros ($112-672) was proposed under the 2015 Public Security Law nicknamed the "gag law," which has been criticized by opposition parties, United Nations experts and journalists' and rights groups, who say it curtails free assembly and expression. Opposition parties say they will ditch the law if they get into government. The woman told several Spanish news outlets that police stopped her Sunday in Madrid. She said she explained to them that the bag made no mention of police. The online newspaper Eldiario.es and others showed photographs of the bag and the police complaint reportedly posted on the woman's Twitter account. It was not immediately possible to obtain comment from the woman. The A.C.A.B. slogan has long been used to insult police on T-shirts and graffiti, while the cat wording is seen by some as a way of concealing it. The "gag law" allows the expulsion of migrants illegally entering Spain's two North African enclaves, sets stiff fines for protests outside Parliament or strategic installations and allows authorities to fine journalists and media organizations who distribute unauthorized images of police. In this case, the alleged offense was a lack of respect for police. The measure was drawn up following a wave of anti-government protests in 2012 as Spain was in the throes of the financial crisis. The Madrid police force has decided to take no further action against a young woman who was reported by riot officers for carrying a bag they claimed was a deliberate insult against law enforcement officers. Belén Lobeto turned to social media to complain about the incident, which took place on Sunday near the Vicente Calderón soccer stadium. Her tweet about what happened was shared more than 20,000 times, eliciting numerous responses from internet users. According to her version of events, two riot officers – on duty in the area because of the Kings Cup final between Barcelona and Sevilla – approached her and asked about her black-and-white bag, which depicted a cat’s face, the acronym ACAB in gothic letters and the phrase “All Cats Are Beautiful.” The officers said that ACAB really stood for “All Cops Are Bastards,” a well-known anti-police slogan popularized in the 1980s by British punk band 4 Skins and adopted by many soccer hooligans. Police officials said this decision was made in view “of the circumstances” surrounding the incident and “the ambivalence” of the acronym The Madrid police commissioner has decided to drop all action against Lobeto, who was facing a fine of anywhere between €100 and €600 for an offense included in the controversial Citizen Safety Law. Police officials said this decision was made in view “of the circumstances” surrounding the incident and “the ambivalence” of the acronym. In the meantime, the department will further investigate the matter. The Citizen Safety Law, introduced by the Popular Party (PP), went into effect on July 1, 2015 and has drawn much criticism from the opposition for its crackdown on the right to public assembly, among other things. This piece of legislation is popularly referred to as the Gag Law, and other parties have stated that they will repeal it if they win the upcoming general elections of June 26. There are precedents for police and court action against the ACAB acronym, in Spain and elsewhere. A similar incident was reported in Alicante in 2015, and a year earlier two German courts handed down convictions against individuals who displayed ACAB and the numbers 1312, where the latter were understood to stand for the same letters. English version by Susana Urra. The offending bag and the fine issued over it. Photo: Bélen Lobeto A Spanish woman has been fined by police in Spain for walking through the streets of Madrid carrying a bag that declared "All Cats Are Beautiful". While the bag may not be to everyone’s taste and certainly won’t appeal to those who prefer dogs, Belén Lobeto, a graphic designer living in Madrid was surprised to discover that her handbag choice proved so offensive. As she walked home on Sunday night she was pulled to one side by policemen and given an on the spot fine for the fashion article. Despite the fact that the bag carried an image of a cat and the phrase "All Cats Are Beautiful" beneath the letters ACAB, the police insisted it was an acronym for the punk phrase "All Cops Are Bastards". She was therefore fined under the controversial Citizens Security Law - or Gag Law as it has been dubbed by its critics - for disrespecting the police. READ MORE: The ten most repressive points of Spain's Gag Law The fine was issued on Sunday evening in a street near the Calderón stadium where there was a heavy police presence due to the Copa del Rey final between Barcelona and Sevilla. La @policia me acaba de denunciar enfrente de mi casa (cerca del Calderón) por llevar este bolso. #NoALaLeyMordaza pic.twitter.com/0DqjjvGBi1 — Belén Lobeto (@LobetoVonKatzen) May 22, 2016 "I was going quietly to my house when suddenly two officers ran up to me and asked for my ID and said they would issue a fine because I was carrying this bag," Lobeto explained in a detailed Facebook post. "I asked why and expressed doubt that my bag was attracting any attention much less causing a crime and told them they should take me in front of a judge to explain," she continued. The woman said she tried to make the police see reason but "changing their mind was impossible and if I didn’t shut my mouth I would have been taken away". "I asked them if there wasn’t more important things to worry about," she added before ending her post with: "What a bloody disgusting country. But well, ALL CATS ARE BEAUTIFUL and anyone who says otherwise is lying." The woman also tweeted about the incident in a post that went viral and has been shared more than 13,000 times since it was posted at 6pm on Sunday. "All Cops Are Bastards" and the acronym A.C.A.B. is an internationally recognised anti-police slogan dating to the 1970s and made famous by the 4-Skins British punk band.

Summary: Maybe the officers were dog people? The Local reports a woman in Madrid was fined by police Sunday for carrying a bag that read "All Cats Are Beautiful." The two riot officers that stopped graphic designer Belén Lobero claimed the acronym on the bag-despite the drawing of a cat and aforementioned phrase-actually stood for "All Cops Are Bastards," according to El País. That meaning of the acronym dates back to the 1970s, was made famous by a British punk band, and is frequently used by soccer hooligans. A police spokesperson tells the AP the lettering on the bag is similar to that used in anti-cop tattoos and graffiti. Officers hit Lobero with a fine of up to $670 under Spain's Public Security Law, which-among other things-makes "disrespecting the police" illegal. Lobero took to social media to complain about the fine. "What a bloody disgusting country," the Local quotes one of her Facebook posts as saying. "But well, ALL CATS ARE BEAUTIFUL and anyone who says otherwise is lying." Her tweet about the incident was shared more than 20,000 times. After that, the Madrid police commissioner decided to drop the fine against her, citing the bag's "ambivalence." The Public Security Law went into effect last July. Critics-including the UN, rights groups, and journalists-call it the Gag Law. Opponents are vowing to repeal it contingent on the outcome of elections next month.

multi_news

en

Summarize: Elon Musk announced that his Boring Company is “almost done” with its first test tunnel under Los Angeles and they plan to open the project to the public around December 10. At this point, the startup has several projects underway in Los Angeles and in other regions of the country, like in Chicago and Maryland. The company said that it expects its first full system demonstration will be a short new tunnel and ‘loop’ to get to Dodger Stadium in 4 minutes. But they have another demonstration tunnel under Hawthorne. It starts in a parking lot on Crenshaw Boulevard on the other side of SpaceX’s headquarters and the tunnel follows 120th street. When we visited the tunnel this summer, it was about 3/4 of mile long. The company has been talking about making it a mile long. Now Musk announced that it is ‘almost done’ and it should open on December 10: Opens Dec 10 — Elon Musk (@elonmusk) October 22, 2018 Musk specified that they plan an “opening event” for that night and that the tunnel will be opened for free rides to the public the next day. Based on my understanding, those rides won’t be for transportation but to help the public understand the tunnel boring and loop transportation technologies that they are developing. The startup is developing its electric skate system to move people inside the tunnel. Musk said that 155 mph (250 km/h) is going to be the top speed inside the test tunnel, which they also eventually want to use for the SpaceX hyperloop pod competition. Earlier this year, they released a video of a Tesla Model X accelerating on rails inside the tunnel. The CEO also said that Tesla will build the ‘pods’ for the Boring Company’s Loop system, like the ones they plan to deploy in tunnels under Los Angeles, starting with the ‘Dugout loop’ to the Dodger Stadium, and the one between the Chicago Airport and downtown Chicago. The startup started building the first test station for its tunnel: O’Leary Station taking shape pic.twitter.com/O25AhFBnxA — The Boring Company (@boringcompany) October 19, 2018 Several of the company’s full-scale projects are starting to take shape, but it looks like December 10 might be the first chance for the public to experience what it would be like to travel in a Boring Company loop. Elon Musk says his first Boring Company tunnel is almost done, and it’ll open to the public on Dec. 10. The tunnel beneath the L.A. suburb of Hawthorne acts as a proof of concept for the Boring Company’s proposed loop system. It originates at a property owned by SpaceX, one of Musk’s other ventures, and runs about two miles under city streets. Originally called a test tunnel, Musk said Sunday on Twitter that it’ll soon be ready for prime time. Opens Dec 10 — Elon Musk (@elonmusk) October 22, 2018 The Boring Company has set out to prove that superfast public travel is not a futuristic fantasy. The tunnels proposed and tested by the company are outfitted with electromagnetic pods that carry passengers at speeds up to 150 miles per hour. While larger scale proposals in Los Angeles, such as high-speed connections to Dodger Stadium and LAX, are on hold, at least one project has been green-lit: the Boring Company got the go-ahead to build a tunnel that will bring passengers from downtown Chicago to O’Hare Airport in a mere 12 minutes, and the whole thing will be privately funded. While Angelenos may be stuck waiting for the useful routes Musk envisions, they can take courage from the fact that Musk is keeping at least one of his promises: He’ll be offering the public free rides in the Hawthorne tunnel on Dec. 11.

Summary: Elon Musk thinks he can transform public transportation with speedy underground hyperloops, and he says the public will get its first real look at what he means in December. In a tweet, Musk said the first tunnel built by his Boring Company will open Dec. 10. This particular tunnel, however, is more of a demonstration tunnel than one designed to solve big traffic problems. The loop starts near SpaceX headquarters in the LA suburb of Hawthorne and runs under city streets for about two miles, reports Fortune. Musk said the company plans an opening celebration on the 10th, then public rides the following day. "Based on my understanding, those rides won't be for transportation but to help the public understand the tunnel boring and loop transportation technologies that they are developing," writes Fred Lambert at Electrek. Riders can expect to travel up to 155mph, according to Musk. CNET points out that the CEO often misses deadlines that he sets for his companies, noting that one person asked him if the December date was "real time or Elon time." His response: "I think real."

multi_news

en

Summarize: BACKGROUND OF THE INVENTION This invention relates generally to systems for connecting implements to tractors and deals more particularly with a system which allows mounted implements utilizing rear wheel lift assist units to interface with a three point hitch of a tractor in a way which prevents damage to the three point hitch. A variety of systems for connecting implements to a tractor have been developed in which the implement is connected to the tractor by way of a conventional three point hitch. In a three point hitch, the two lower links or arms are driven by the hydraulic system of the tractor to provide operator controlled lifting and lowering movement of the lower links and, likewise, to the associated implement connected to the lower links. The single, upper or stabilizing link of a three point hitch typically is used to maintain a particular horizontal pitch orientation of an implement or to transmit a positive down pressure force to tillage tools mounted on the frame portions of the attached implement. During the use or transportation of an implement, a number of forces can be developed on the three point hitch, the implement and the implement lift support structure. The three point hitch can provide upward lift by actuating the power lift features of the two lower support arms of the hitch. For example, the upward force is utilized for lifting and carrying an implement during transport from one location to another. During usage of a tillage implement, the two lower lift arms of the hitch and the upper top link operate in concert to orient the implement to ensure proper ground penetration of the tillage tools. Because of the size and weight of many implements, they cannot, in practice, be totally disengaged from the ground simply by utilizing the upward force of the two bottom links of the three point hitch and an attempt to lift such an implement will result in damaging the tractor hydraulic lift circuit and/or impeding tractor stability. Thus, when using particularly heavy implements, it would be impractical or even impossible to carry the full weight of the implement in cantilever fashion on the three point hitch. Such an attempt, in certain combinations of tractors and implements, would simply act to raise the front wheels of the tractor off of the ground while leaving the implement fully in contact with the ground. In such systems where the three point hitch of the tractor is ineffective for disengaging the implement from the ground, a trailing lift assist support system is typically used to support the main frame of the implement. The lift assist system typically employs one or more ground engaging wheels which are designed to, during lift and transport, contact the ground and carry some of the load of the implement. A power lift means, such as a hydraulic lift cylinder, is normally included for actuation from the hydraulic system of the tractor when it is desired to transfer a portion of the weight of the implement to the ground engaging wheel of the trailing support system. Thus, the cooperation between the wheeled lift assist support system and the three point hitch system acts to provide lifting of the implement. The use of the rear wheel lift assist system is not limited to merely transporting the implement, but is also used when an implement is to be lifted clear of the ground such as for turning at the end of a field and the like. It is to be appreciated, however, that when the weight of the implement is supported, in part, by the rear wheel trailing support system, the entire system of the tractor and the trailing lift support members acts as a rigid, fixed body with the implement being carried thereby. During transport of the implement in this lifted position, the tractor may be tilted in pitch with respect to the rear lift support system, as the combination of the two pass over uneven terrain. The system must accommodate this difference in pitch between the tractor and the trailing support system in order to avoid damage to the three point hitch upper link due to excessive compression loads between the tractor and the trailing support system. Various arrangements of linkages have been proposed for providing yieldable interconnections between three point hitches and the trailing frames of implements; however, most such systems are not adapted for tool bar type implements (i.e. where a plurality of relatively independent tool gangs are attached to a transversed tool bar and are vertically movable relatively independent of one another within the range of their operative engagement with the soil). Such tool gangs typically trail the tool bar and have integrated down pressure means on each gang unit. Such gang units typically comprise cultivators, rotary hoes, planters and the like. Application of orientation forces on the tool bar from the tractor remains desirable in many instances to control and selectively increase or decrease the effective down pressure forces across all of the individual gang units. However, there is no integrated frame rearward of the tool bar for transmitting such forces to the units. Therefore, the forces must be applied through the tool bar itself. At such time, stress relief must be provided for the hitch linkages to avoid damage due to excessive compressive loads exerted on the three point hitch by the upper link trailing support system. Thus, it can be seen in U.S. Pat. No. 4,903,781 that a system is set forth for flexibly mounting agricultural implements. Although the system set forth in the &#39;781 patent does appear to be effective for the above stated purpose, it is generally believed that the mechanism set forth therein to accomplish the flexing between the tractor and the rear lift support system is more complicated, and accordingly, more costly than need be. Thus, it is an object of this invention, to provide an implement which is capable of isolating the three point hitch of a tractor from excessive compressive loads which would otherwise damage the three point hitch, the tractor or the implement. SUMMARY OF THE INVENTION The implement of the present invention generally comprises a frame which is adapted to engage a three point hitch mechanism of a vehicle. The frame is adapted to support a plurality of tool gangs which are attached to the frame, each of the gangs being movable vertically independent of the other gangs. The frame has a longitudinal member extending generally directly away from the vehicle. A first link is pivotally connected to the longitudinal member. A pivotal anchor is pivotally connected to at least one of the longitudinal member or the first link. A resilient yielding means is disposed between the longitudinal means and the pivotal anchor member. A hydraulic cylinder is disposed between the pivotal anchor member and the first link for raising and lowering a lift assist wheel. When the first link is acted upon by forces which cause the link to exert a stress on the three point hitch of the vehicle, the resilient yielding means yields way and allows the first link to pivot about the longitudinal member thereby reducing the stress on the three point hitch. The frame preferably includes a tool bar and the implement preferably includes a second link which is pivotally connected to the longitudinal member. In its most preferred embodiment, the implement preferably includes a lift assist wheel connected to the first and second links. Other advantages and meritorious features of the present invention will become more fully understood from the following description of the preferred embodiments, the appended claims and the drawings, a brief description of which follows. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a isometric view of an embodiment of the trailing implement of the present invention. FIG. 2 is a partial top view of the mounted implement of FIG. 1. FIG. 3 is a side view of the mounted implement of FIG. 1 showing the rear assist wheel raised off of the ground. FIG. 4 is an isometric view of the pivotal anchor mechanism of the present invention. FIG. 5 is a side view of the mounted implement of FIG. 1 showing the rear assist wheel in its ground engaging position. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Now referring to FIG. 1, implement 10 of the present invention is comprised of tool bar 12 which is adapted to engage a standard three point hitch of a tractor (three point hitch not shown in FIG. 1). The upper link of the three point hitch is adapted to engage and be retained in hole 18 of plate 19. The two lower links of the three point hitch are adapted to engage holes in a respectively associated lower plate 21, 23 (see FIG. 2 for lower plates 21, 23). Lower plates 21, 23 transmit draft or towing forces to tool bar 12. Plates 21, 23 are also pivoted (by way of lower links of the three point hitch) in a vertical plane by the hydraulic system of the tractor for positioning purposes and for providing lift and lowering forces in the conventional manner. Tool gangs 14 are provided at various locations along tool bar 12. Each gang may include a subframe which carries suitable tillage tools, guides or gauge wheels, shields and the like typically by way of parallelogram linkage. Thus, each gang unit floats vertically substantially free of each other unit when in operation. Means such as tension springs in the parallelogram linkage (tension springs not shown) transmit down pressure forces from the tool bar to the subframe of the respective gang. Thus, each gang unit floats vertically substantially free of each other gang unit when in operation while yet still receiving general down forces from the common tool bar 12. Longitudinally extending members 22, 24 are rigidly fixed, at one end, to tool bar 12. The longitudinally extending members 22, 24 are preferably generally parallel, and extend generally perpendicular away from tool bar 12. Longitudinally extending member 22 is pivotally connected to first and second links 26, 27 and longitudinally extending member 24 is pivotally connected to first and second links 26&#39;, 27&#39;. Each link 26, 26&#39;, 27, 27&#39; is pivotally connected to rear lift assist wheel assembly 34 whereby links 26, 26&#39;, 27, 27&#39; form a parallelogram linkage assembly. Pivotal anchor mechanism 30 is freely pivotal about axis 36. Axis 36 is preferably the same axis whereby first link 26 and first link 26&#39; pivot about their respectively associated longitudinally extending members 22, 24 respectively. Cushion springs 28 are disposed between longitudinally extending members 22, 24 and first end 38 of pivotal anchor mechanism 30. Lift assist cylinder 32 is disposed between at least one of links 26, 26&#39;, 27, 27&#39; and a second end 40 of pivotal anchor mechanism 30. The first and second ends 38, 40 of pivotal anchor mechanism 30 are generally on opposing sides of axis 36. The remaining drawings, will now be used to illustrate how the aforementioned system is operable to prevent damage to the three point hitch of a tractor during transport of the implement. Now referring to FIGS. 2 and 3, when implement 10 of the present invention is used in its nontransport mode, cylinder 32 is retracted by way of controls from a hydraulic power circuit of the tractor (controls not shown). By retracting lift assist cylinder 32, pivotal anchor mechanism 30 freely pivots about axis 36 until it contacts forward stop 42. After contacting forward stop 42, pivotal anchor mechanism 30 cannot rotate any further about axis 36 and any further contraction of cylinder 32 acts to raise parallel linkage 26, 27 thereby raising rear lift assist wheel assembly 34. The system is preferably designed such that once rear wheel 37 has been raised to a sufficient height, cylinder 32 holds pivotal anchor mechanism 30 firmly against forward stop 42 and thus, as seen in FIG. 3, upon lifting rear wheel 37 from the ground, rear lift assembly 46 does not interfere with the operation of tool gangs 14. Now referring to FIGS. 4 and 5, when it is desired to manipulate implement 10 from the use position (shown in FIG. 3) into the transport (or non-use or storage) position (shown in FIG. 5), cylinder 32 is extended such that wheel assembly 34 is lowered until it engages the ground. If cylinder 32 is extended past the point where wheel 37 engages the ground (and the hydraulics associated with three point hitch are operated to lift longitudinally extending members 22, 24) then tool gangs 14 will be lifted from engagement with the ground thereby placing them above the ground and in position for transport. As seen in FIG. 5, as hydraulic cylinder 32 is extended, first end 38 of pivotal anchor mechanism 30 is pivoted downward 48 thereby compressing cushion springs 28. As long as second end 40 of pivotal anchor mechanism 30 is not in contact with rearward stop 43, springs 28 by virtue of being linked to pivotal anchor mechanism 30 are effective for cushioning or yielding to any pivotal motion between links 26, 26&#39;, 27, 27&#39; and longitudinally extending members 22, 24. Thus it can be easily seen that if a tractor is transporting tool gangs 14 in the manner depicted of FIG. 5 and suddenly a ground contour is encountered whereby an increased upward force is exerted against rear wheel 37, cushion springs 28 will be compressed and effectively absorb any pivotal motion of links 26, 26&#39;, 27, 27&#39; until second end 40 of pivotal anchor mechanism 30 contacts rearward stop 43. In a preferred embodiment, conventional adjustment mechanisms are used to adjust the force exerted upon anchor 30 by cushion springs 30. Now referring to FIG. 4, pivotal anchor mechanism 30 is constructed of a rigid body comprising two first end portions 38 and second end portion 40. First end portions 38 are adapted to engage cushion springs 28 via notches 52 and second end 40 is adapted to engage one end of lift assist cylinder 32. First end and second end 38, 40 of pivotal anchor mechanism 30 are fixed to central pivoting cylinder 54. Central pivoting cylinder 54 is fitted with central aperture 56 which passes therethrough thereby enabling cylinder 54 to freely pivot about axis 36. The only factor which limits the extent to which cylinder 54 can pivot about axis 36 is the engagement between pivotal anchor mechanism 30 and forward and rearward stop 42, 43 respectively. As can be seen from FIG. 5, in the transport position, with the gangs 14 raised and the assist wheel engaging the ground, pivotal anchor 30 is left free to rotate about axis 36 thereby compressing cushion springs 28 upon the event that wheel 37 encounters uneven ground conditions. There is an additional advantage of the present invention in that any vibration or small bumps encountered by wheel 37 is, likewise, reflected onto cushion springs 28 which accordingly absorbs such vibrations and cushion the reflected load on the tractor thereby allowing for a smoother ride. The foregoing detailed description shows that the preferred embodiments of the present invention are well suited to fulfill the objects of the invention. It is recognized that those skilled in the art may make various modifications or additions to the preferred embodiments chosen here to illustrate the present invention, without departing from the spirit of the present invention. Accordingly, it is to be understood that the subject matter sought to be afforded protection hereby, should be deemed to extend to the subject matter defined in the appended claims, including all fair equivalents thereof.

Summary: A agricultural implement incorporates a frame which is adapted to engage a three point hitch of a tractor. The frame employs a longitudinally extending member which is pivotally connected to a link member. A resilient yielding assembly is disposed between the longitudinally extending member and the link member to absorb forces exerted from the link member onto the longitudinally extended member. Accordingly, when the link is acted upon by forces which cause the link to exert a stress on the three point hitch of a tractor, the resilient yielding assembly allows the first link to pivot about the longitudinal member thereby reducing compressive loads exerted on the upper link of the tractor&#39;s three point hitch.

big_patent

en

Summarize: CROSS REFERENCES TO RELATED APPLICATIONS This invention draws upon provisional application No. 60/996,560 filed Nov. 26, 2007. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention is not related to a federally sponsored research or development project. THE NAMES OF THE PARTIES TO A JOINT RESEARCH AGREEMENT This invention is not the output of a joint research action or agreement. REFERENCES TO APPENDICES ON A COMPACT DISC AND AN INCORPORATION-BYREFERENCE OF THE MATERIAL ON THE COMPACT DISC This application does not include compact discs or related files. FIELD OF THE INVENTION A multi-use adjustable bellows-shaped aperture strap for use in securing the heel of a user to an open-heeled swim fin using a mounting system (boss button and boss post). These multi-use adjustable tapered aperture straps have alternative embodiments for other diving or swimming equipment or appliances such as masks, goggles and the like having a seat adapted to be engaged by or onto a part of the user&#39;s body (foot-face). Further alternative embodiments use said multi-use adjustable tapered aperture straps for securing gear. Still further embodiments use the multi-use adjustable bellows-shaped aperture strap as an elastic belt for divers. The multi-use adjustable bellows-shaped aperture strap is comprised of an elongated multi-use adjustable bellows-shaped aperture strap body with an aperture system (a series of bellows-shaped aperture assemblies comprising tapered apertures connecting to raised arches) creating a bellows shaped form, asymmetrical top and bottom sides, and a first end tab and a second end tab additionally with tab center pulls preferably (although they are optional). BACKGROUND OF THE INVENTION Swimming is more efficient for people when swim fins are used and swimming and diving have developed into sports, occupations, and also as a military activity. Devices have been developed through the years to improve the use of swim fins. Swim fins are an effective device for improving a user&#39;s speed and power in traveling through the water. Open heeled fins are predominantly used by high end user&#39;s within the dive community, and for top level snorkeling and swimming with fins. One major advantage of the open heeled fin is that it is more adjustable than other fins by the means of a heel strap that usually incorporates the use of one or two buckles to adjust it because the strap is usually not very elastic. Since the strap must withstand serious pressures that might tear about softer more flexible materials when used in a more elastic strap. Open heeled fins are propelled by means of a variety of blade embodiments independent of the heel strap and they allow the user to more easily wear protective foot gear, booties. These booties allow the use of the fins in colder water with booties comprising thicker insulation or in warmer water with thinner booties. Most of these fins use a boss comprising a boss button and boss post integrally affixed on the outer surface of either side of the foot pocket. The heel strap is generally held in place by a buckling mechanism (or in alternative embodiments stainless steel springs or elastic fibers may be held in place by respective securing plates). Beyond the strap&#39;s adjustability, the straps can be replaced if broken to keep the fin in service. Securing devices such as buckles or securing plates can damage the strap, spring or elastic fibers, and can also malfunction or break themselves rendering the fin inoperable. Many complicated forms of straps, springs, elastic fibers, buckles and securing plates have been developed through the years by many different inventors. Past inventions in the prior art are clearly and substantially disclosed by U.S. Pat. No. 6,923,697 of Wagner. U.S. Pat. No. 6,923,697 of Wagner is the closest prior art to the present invention, and relates directly to open heeled swim fins with a heel strap secured to both sides of the foot pocket, and relates more particularly to orifices cut directly through the strap with end tabs appropriately sized so that they can be uniquely secured within the orifice to form a loop. Said orifices may be secured over the boss button of a fin, but must also be of a substantially solid materially enough so as to not break during normal use and strong enough to withstand the pressure of the tab trying to pull back through the orifice when it is coupled to the orifice to form a loop. The elongation capability in our tests of the straps taught by Wagner allowed the strap to stretch to 134 percent of its original size which is typical for elastomeric straps in which the need to keep the strap from breaking exceeds the need for elasticity in the strap. With limited elongation properties and the desire to couple with the tab, the orifices when small enough to stay under the boss button are difficult to place over the boss button. When the orifices are large enough to easily pass over the boss button, they are then large enough to easily ride back off the boss button during normal use. The device taught by Wagner does not incorporate any of the unique features of the multi-use adjustable bellows-shaped aperture strap, but concentrates on orifices and tabs that can form loops when coupled. Additionally, other prior art swimming strap structures do not offer adequate elongation properties to allow for the changes in the dimensions of various boss posts and boss buttons. If the buckle, securing plate, or strap with orifices has holes that are too small to pass over the boss button or boss post, the buckle, securing plate or strap may not work properly. If the securing plate, the buckle or orifice taught by Wagner is too large, the strap may come off the boss during normal use, during storage or when the fin is in transit. Under many conditions, this is inconvenient and it is always undesirable. The boss post and boss button have fixed diameters, and if the securing holes for the buckles, securing plates and straps have fixed diameters or diameters with little elongation capabilities, they offer a problem in that they may not match and seat together properly with the boss buttons and boss posts. Additionally, straps that are used generally in securing the heel, or securing the head of the user or securing the gear of the user, or as an elastic belt for the use must be substantially of a material that will not break under normal use in order to handle the stresses placed on it by normal use in diving and swimming and when on a boat. At present, these stronger materials do not lend themselves to substantial elongation. A strap elongation of 150 percent increase in its elongation size is considered excellent. Typical strap elongations of 135 percent of their original size are normally found. This limited elongation capability limits the effective use of such straps for heel straps, for straps to help hold on goggles, or masks, and for straps that are used for securing gear on the diver, swimmer or on a boat or as an elastic belt for the diver or swimmer. SUMMARY OF THE INVENTION The object of the present invention is to overcome the above drawbacks, and namely to provide an improved multi-use adjustable bellows-shaped aperture strap of the above-referenced type whose aperture assemblies (comprising tapered apertures and raised arches) combine to form an aperture system that allows unexpected elongation of the elastomeric material while maintaining structural integrity and strength. Through the deformation of the bellows-shaped structure of the aperture assembly, the aperture assembly elongates substantially 280 percent of its original length in our testing while maintaining higher than normal integral strength to help keep the strap from breaking. The number of aperture assemblies in the aperture system therefore affects the overall elongation capabilities of the strap with a higher number of assemblies contributing to a greater elongation potential. Being a simple strap to manufacture and with no need of buckles or securing plates, the multi-use adjustable bellows-shaped aperture strap is a simple elastomeric device with unexpected elongation properties that can be made from a variety of thermo-plastic elastomers, rubber compounds, urethanes, or other flexible rubber-like materials while conforming in its production to a variety of conventional-forms of manufacturing like injection molding or a casting process. The asymmetry of the aperture assembly from the bottom side of the multi-use adjustable bellows-shaped aperture strap to the top side of the multi-use adjustable bellows-shaped aperture strap has an unexpected bellows-effect in allowing the material to elongate like the bellows of an accordion through the deformation of said aperture assemblies in the aperture system. The aperture assembly deforms and spreads the tension forces in multiple-directions and in multiple-dimensions instead of the more normal linear mono-direction running along the elongated axis of the material, the strap thus has a greater flex and modulus than is found in prior art using similar elastomeric materials and more particularly in straps as taught by Wagner. These improved multi-use adjustable tapered aperture straps adjust to serve a larger number of people through their increased elongation capabilities. In our tests, a multi-use adjustable bellows-shaped aperture strap was tested against an almost identical strap that was made with the same overall dimensions, same material, but with simple straight-through-the-strap orifices (as taught by Wagner and as found in other prior art straps) instead of the bellows-shaped aperture assembly. When tested, the difference between their elongation capabilities was substantial in that the multi-use adjustable bellows-shaped aperture strap had 3 times more elongation than its counterpart with simple straight-through-the-strap orifices as taught by Wagner. The simple straight-through-the-strap orifice version had a 37 percent stretch increase from its original size and the multi-use adjustable bellows-shaped aperture strap had a 111 percent increase from its original size. Considering that both straps had the same dimensions, had the same number of orifices/apertures of the same basic size, and were made of the same material at the same factory using an identical manufacturing process, the elongation difference is remarkable due to the bellows-shaped aperture assemblies. Since prior art straps as taught by Wagner and of this nature tested with an elongation of substantially 133 percent of their original size and since the strap of the present invention tested with an elongation of 211 percent of its original size, the elongation increased from 33 percent in prior art straps to 111 percent in straps of the present invention above their original respective sizes. This increase in the elongation of the multi-use adjustable bellows-shaped aperture strap allows the user to stretch it further if desired to encompass larger shapes and allows for a broader range of adjustment as needed by the user for the amount of desirable tension on the strap. In the preferred embodiment, the multi-use adjustable bellows-shaped aperture strap will have center tabs near the heel to help pull the strap on and off the user, but in alternative embodiments the multi-use adjustable bellows-shaped aperture strap could have a seated area near the center of the strap for the back of the head of the user. In still another alternative embodiment of the multi-use adjustable bellows-shaped aperture strap, there may be no center tabs at all when used predominantly for securing gear or when used as a an elastic belt for a diver. The bellows shaped aperture assemblies running the majority of the length of the strap can be likened to the bellows section of an accordion. The number of aperture assemblies (tapered apertures and raised arches) used in the aperture system dramatically affect the overall flex and modulus of the device. Even though the materials used in the bellows of an accordion are substantially solid, the geometric shape of the bellows section allows the materials to move in concert to allow the elongation of the bellows section and then the contraction of said section. Within the simplicity of this unique device, the tapered nature of the tapered apertures in a series on a first side of the strap run through the strap to a series of respectively much smaller apertures on a second side of the strap creating a series of multiple bellow shapes apertures within the structure of the strap to allow a relatively solid elastomeric material to elongate with unexpected ability. The tapered apertures are preferred in a conical form, but may be in a number of different geometric forms to include rectangular, star, spherical, triangular and elliptical forms. The same variety of shapes can be used with the raised arch section of the aperture assembly. A further object of the present invention is to provide an improved multi-use adjustable bellows-shaped aperture strap of the above-referenced type whose compliant geometric construction allows unexpected superior flexibility of the elastic material of the strap without jeopardizing the strap&#39;s structural integrity because the geometric construction spreads the forces in a diverse non-linear manner through unique deformation of the aperture assembly which enable superior elongation of the strap and allows for a wider range of adjustment in the tension on the user&#39;s heel. Another object of the invention is to provide a multi-use adjustable bellows-shaped aperture strap as a device that can be manufactured easily as a single unit with no additional parts and can be vacuum-wrapped on small display cards with the manufacturing materials substantially made from elastromeric rubbers or a variety of thermo-plastic elastomers, urethanes, or other flexible rubber-like materials conforming to a variety of conventional forms of manufacturing. A further object of the invention is to provide an improved multi-use adjustable bellows-shaped aperture strap of the above-referenced type which, can in the tapered aperture bottom side of the strap, have a number of different geometric shapes, rectangular, spherical, elliptical or triangular as long as the tapered aperture is substantially larger than the boss button in use thereof, and that the aperture of the raised arch is substantially smaller and closer to the size of the boss post so that raised arch goes into compression under when stressed in normal use to strengthen and secure its position under the boss button. Another further object of the invention is to provide an improved multi-use adjustable bellows-shaped aperture strap in which the larger size of the aperture of the tapered aperture allows the aperture assembly to pass over the button boss while the smaller size of the aperture of the raised arch keeps the strap securely tightened against the boss button post for a wide range of boss button and boss post dimensions respectively. These and further objects are achieved according to the invention, but virtue of the fact that an improved adjustable strap for diving and swimming equipment of the type set-forth at the beginning is primarily characterized in that it is formed by two distinct aperture elements, the tapered aperture and the raised arch, forming the aperture assembly, each of which is connected to each other from their respective sides of the strap. Accordingly, said strap has asymmetrical top and bottom sides, said bottom side and said top side that are connected through the aperture system. In an alternative embodiment, the raised arch may comprise an arch that reduces the aperture smaller than the smallest aperture of the tapered aperture but positioned as to not be raised above height of the body of the strap instead of standing above the body of the strap as in the preferred embodiment. According to the preferred embodiment of the invention, end tab pulls are located at the distal ends of the strap to allow the user an easier grip in which to pull the strap to stretch it along its longer axis and in alternative embodiments have end anchor tab assemblies in which to secure themselves into the aperture assembly. Preferably the strap also has dual center opposing tab pulls, alternative embodiments may have the end anchor tab assemblies with no opposing center pull tabs. The ends of all the prior-art straps are not adapted to pass through an orifice in the strap and secure itself thereat with the exception of Wagner. Only Wagner&#39;s strap has the structure and features for this purpose. However, the ends of Wagner are not useable on the aperture assemblies as taught in the present invention. Because of the outstanding flex and modulus produced by the bellows-shaped aperture assembly, the end taught by Wagner would simply pull back through. Without the extra catching ability of the end anchor tab assembly being larger and encompassing the width of the strap, the end of the strap would pull through the aperture assembly. Only the applicant&#39;s end anchor tab assembly has the structure and features for this purpose. Alternatively embodiments may have a single center pull tab or dual tabs that are angled away from the heel of the user or may have a ring shaped pull to assist in putting on or taking off the dive fins or other swim related equipment. Similar ring pull tabs or angled pull tabs may be located at the distal ends of each side of the improved strap. Additionally, alternative embodiments can be made of different colors and can have padded shapes to diffuse the pressure of the strap on the head or heel of the user. In further alternative embodiments, the present device may have no center pulls. The improved adjustable strap and additional embodiments endeavor to eliminate the use of the common buckling system of length adjustment and to create a device in its most simple state, a device with unexpected elastromeric qualities due to its bellows shaped aperture system enabling the use of wider range of adjustment, a device that attaches to the fin mounting system or other swim apparatus mounting systems easily because of the wide aperture of the tapered aperture, a device that remains more successfully connected to the mounting system during normal use because of the reduce size of the raised arch aperture, and a device that offers the convenience of being a spare to many fins on the market today. The strap according to the invention is applicable in a particularly advantageous way to open heel diving fins, but can be equally usefully employed in the case of other diving and swimming equipment, such as masks and goggles, such as elastic storage straps, or as securing straps or belts. Several objects of this invention include, but are not limited to: a. Supply the market with high quality improved multi-use adjustable tapered aperture straps with bellows-effect aperture system for use as dive fin straps. b. Supply the market with high quality improved multi-use adjustable tapered aperture straps with bellows-effect aperture system for use in swimming equipment such as goggles or masks. c. Supply the market with high quality improved multi-use adjustable tapered aperture straps with bellows-effect aperture system for use in stowing equipment using an integrated means of attachment at the distal ends of the strap. d. Supply the market with high quality improved multi-use adjustable tapered aperture straps with bellows-effect aperture system for use in stowing equipment using a secondary means of attachment at the distal ends of the strap. e. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system that can be used for either the right foot or left foot in diving interchangeably. f. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system that can be used for either for a mask or goggles interchangeably. g. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system that allows users to more easily adjust their straps with less effort and with more control through the use of compliant geometry allowing heavy duty elastic materials to stretch with less effort while maintaining structural integrity and reliability. h. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system that allows users to secure the strap onto a boss or mounting system with greater ease. i. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system that allows users more latitude in the angle of pulling that the strap can be drawn without dislodging it from the mounting system. j. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system with bellows-effect aperture system that uses compression to spread the load when under stress so as to better resist tearing and so as to maintain a better secure position when used. k. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system that can be removed easily when desired, but remains secure attached during normal use. l. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system for many different diving and swimming uses that does not use a buckle system. m. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system that can easily be made in many bright colors and varying shapes. n. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system that alternatively can function in the same manner as a fixed-heel strap style of fin. o. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system that can more easily adjust to the users needs for both cold water or warm water use by being more flexible through the use of compliant geometry and allowing a wider range of sizes of users to use a wider range of boots. p. Create a multi-use adjustable bellows-shaped aperture strap with bellows-effect aperture system that attaches to boss buttons on a shoe for easy adjustment to loosen or tighten the fit for the user as needed for multiple uses. q. Provide a multi-use adjustable tapered aperture strap (an elastomeric strap) with bellows-effect aperture system that does not involve buckles and therefore facilitates easier replacement. The present invention accomplishes these desired objects by providing a new an improved multi-use adjustable bellows-shaped aperture strap that will fit a variety of diving and swimming equipment, has no buckles, has greater stretching ability through the use of compliant geometry from the aperture system of the strap comprising bellows-shaped aperture assemblies and is therefore more adjustable and more easily attached— While remaining more securely attached to the mounting system of the fin through the compression of the raised arch when under normal stress. The invention will now be disclosed in detail with reference to the accompanying drawings, related to application of the improved strap, wherein: BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings, which are incorporated in and form a part of this specification, illustrate embodiments of the invention and together with the description, serve to explain the principals of the invention. FIG. 1 depicts a perspective view of an open heeled swim fin with a standard mounting system and a strap attached to the mounting system on one side of the fin. (Parts list: 2 open heeled swim fin; 3 foot pocket of said open heeled swim fin; 4 mounting system; 6 boss button; 8 boss post; 10 an improved strap.) FIG. 2 is a perspective view of two sides of the preferred embodiment of the present invention with the first view showing the bottom side (side A), the tapered aperture side of the strap, and a second view (side B) showing the top side, the raised arch side of the strap. (Parts list: 12 elongated strap body; 13 first side of the strap body; 14 raised arch; 15 second side of the strap body; 16 reduced diameter aperture; 18 dashed line denoting the center line of the elongated aspect of the strap body; 20 small dashed line denoting cut away section of strap extending to the center line; 22 first center tab pull; 24 second center tab pull; 26 first end tab at one distal end of the elongated strap; 28 second end tab at the other distal end of the elongated strap; 29 raised center support on the; 30 top side of the strap body; 31 taper of the aperture; 32 the tapered aperture on the; 33 aperture assembly comprising said tapered aperture and raised arch; 34 bottom side of the strap body.) FIG. 3 is a side elevation depiction of the call out drawing from said cut away section of FIG. 2. (Parts list: 36 dotted line showing upper level of the top side of the strap; 38 dotted line showing the limit of the bottom side of the strap; 40 is the thickness of the strap between the top side and the bottom side, not including the raised arch.) FIG. 4 depicts a perspective view of the cut away of FIG. 2 in which the cut away drawing allows the merging of the tapered aperture into the raised arch to be seen better forming the aperture system. FIG. 5 depicts a perspective view of the cut away of FIG. 2 with the mounting assembly of the swim fin in relation to the aperture system of the strap. FIG. 6 is a side elevation depiction of the cut away view of FIG. 2 with the mounting boss of the swim fin pushing top against the aperture system and arrows representing the vector forces created in the aperture system by the boss button element of the mounting system. (Part list: 48 arrows showing top vector forces exerted on the aperture assembly when the mounting system is pushed from the bottom side towards the top side of the strap.) FIG. 7 is a side elevation depiction of the cut away of FIG. 2 with the aperture system secured by the boss button of the mounting system with dotted arrows showing vector forces exerted down onto the aperture system by the boss button. (Part list: 50 dotted line arrows showing down vector forces of compression on the raised arch.) FIG. 8 depicts a perspective view of the cut away view of FIG. 2 with the aperture system secured by the boss button of the mounting system with dashed arrows showing the bulging vector force on the aperture system from the mounting system. (Part list: 52 dashed line arrows showing the bulging vector forces causing the aperture system to bulge when surrounding the mounting system.) FIG. 9 is a side perspective view of an alternative embodiment of the strap with anchor tab assemblies comprising anchors and tangs. (Parts list: 53 alternative embodiment strap; 54 second end anchor tab assembly; 56 second end tang; 58 second end anchor; 60 first end anchor tab assembly; 62 first end tang; 64 first end anchor.) FIG. 10 is a side perspective view of another alternative embodiment of the strap with anchor tab assemblies comprising anchors and tangs with extra aperture assemblies 33 in the strap 10 using no center tab pulls. (Part list: alternative no-center-tabs embodiment strap 65.) FIG. 11 is a plan view of the strap of FIG. 9 in which the second end anchor tab assembly has passed through the aperture assembly of the alternative embodiment of the strap to form a loop. (Part list: 66 loop.) FIG. 12 is a side perspective view of an additional alternative embodiment of the strap with an attachment means. (Parts list: 67 second end attachment means; 68 second end “S” hook; 70 second end tab attachment; 72 first end attachment means; 74 first end “S” hook; 76 first end tab attachment; 77 alternative attachment means embodiment strap.) DETAILED DESCRIPTION OF THE INVENTION It is well known that open heeled swim fins 2 have a foot pocket 3 with a mounting system 4 laterally mounted on opposing sides of said foot pocket 3. Said mounting system 4 comprises a boss button 6 and a boss post 8. The improved adjustable strap 10 is often used in securing the heel of a user to an open-heeled swim fin 2 with a mounting system 4. The strap 10 is described in detail in the following paragraphs and with particular reference to the drawings. It should be understood the strap 10 is usable with any open-heeled swim fin 2 having a foot pocket 3 and a mounting system 4 in which the foot pocket can receive a forward part of the foot regardless of the swim fin&#39;s propulsion blade design. The foot of the user is normally covered by a protective bootie (well known within the art but not shown in FIG. 1 ), though there are water conditions where the bootie is not required and can be omitted. This strap 10 has alternative embodiments for other diving or swimming equipment or appliances such as masks, goggles and the like having a seat adapted to be engaged by or onto a part of the user&#39;s body (foot-face) to be discussed later. With reference to FIG. 1, the heel strap 10 of the invention is attached to an open heel swim fin 2 only the right side of the foot pocket 3. The strap 10 hangs free on the left side of the foot pocket 3 near the mounting system 4. As best seen in FIG. 2, the strap 10 is a one piece article with an elongated strap body 12 employing a unique raised arch 14 with a reduced diameter aperture 16 to better close around said aforementioned boss post 8. By having a reduced diameter aperture 16 that is approximately the same diameter as the boss post 8 or slightly smaller, the smaller aperture 16 closes around the boss button 6 of the mounting system 4 and is held there by elastic tension. This also allows for a number of various boss post 8 diameters to be serviced without inhibiting the ability of the raised aperture 14 from passing over the larger boss button 6. The dashed line denoting the center line 18 of the elongated strap body 12 is intersected by a small dashed line 20 to denote a cut away section of the strap 10 to be better described in FIG. 3. The first center tab pull 22 is opposite the second center tab pull 24 in the center of said strap 10. Said center tab pulls are used for pulling the strap onto and off of the user. In other alternative embodiments, these tabs may be have the shape of a ring, or angled tab (not shown here but well known in the art and may have only one tab or no tabs instead of the two tabs as shown in the preferred embodiment in FIG. 1.) The first end tab 26 at one distal end of the elongated strap, and the second end tab 28 at the opposing end of the elongated strap 10 help the user pull the strap 10 over the boss button 6 both for coupling the strap 10 to the mounting system 4 of the fin 2 and for uncoupling the strap 10 as needed. A raised center support 29 runs between the center tab pulls 24 and 26 respectively to give the strap 10 strength when being pulled on and off of the user. This center support 29 is only located on the top side 30 of the strap 10. The opposing side of the strap, the bottom side 31, shares the center tab pulls 22 and 24, and end tabs 26 and 28. The bottom side 31 also has the novel elements of tapered apertures 32 which merge into the raised arches 14 to form the aperture assembly 33. In the preferred embodiment illustrated by the cut away drawing of FIG. 3, the aperture assembly 33 is shown merging its component parts, the tapered aperture 32 and the raised arch 14. These two respective parts of the aperture assembly 33 form a bellows like shape that allows the strap 10 to stretch further without breaking than would otherwise be expected. The dotted line 36 shows the level of the top side 30 of the strap body 12 and is located above the dotted line 38 showing the level of the bottom side of the strap body 12. Together they help to define the height 40 of the body of the strap 12. As can be seen in this illustration, the raised arch 14 rises above the body of the strap 12 in this preferred embodiment. This does not preclude possible alternative embodiments in which the raised arch 14 does not rise above the dotted line 30 and remains within the height 40 of the body of the strap 12. The perspective drawing of FIG. 4 helps to illustrate the wavy up and down nature of the aperture system 42 which comprises the series of aperture assemblies 33 of said strap 10. When stretched, the raised arch 14 lowers itself near or below the dotted line 36 denoting the top level of the body of the strap 12. The tapered apertures 32 work together with the raised arch 14 to allow the strap 10 to stretch further thus offering more adjustment possibilities to the user. This accordion bellows effect causes a compliant geometry in the strap 10 that offers more material for the user to stretch without placing any particular part of the strap under undue stress to where it would break in normal use. Please note that even further undulation in both the raised arch and the tapered aperture or an increase in the number of the aperture assemblies 33 would offer even more material for stretching without over burdening the established elasticity of the material used for the strap and could be found in alternative embodiments. With the introduction of the mounting system 4 in FIG. 5, the second major reason for having this particular form of aperture assembly is shown. As the boss button 6 seats against the tapered aperture 32, the larger size of the bottom side 31 of the strap 10 is larger than the largest boss button commonly known in the art. The extra larger diameter of this part of the tapered aperture 32 helps to center the boss button 6 in the tapered aperture 32. The aperture assembly 33 has a larger diameter aperture in this portion of the tapered aperture 32 but has a reduced aperture 16 that has a possibly smaller diameter than the boss post 8 or is substantially the same. Because the raised arch 14 is unsupported by the strap body 12 as illustrated in FIG. 6, the solid line arrows 48 show the top vector forces exerted on the aperture assembly 33 when pushed by the boss button 6. The forces on the aperture assembly 33 are multi-dimensional and multi-directional when the strap 10 is stretched because the support for the strap shifts horizontally, vertically and from sides to side instead of being a linear set of forces as would be found on a rope as they are in normal strap construction. In addition to allowing the material to have a greater flex and modulus, the aperture assemblies also allow the boss button 6 to penetrate the aperture assembly 33 more easily. After the boss button 6 has penetrated the reduced aperture 16 of the aperture assembly 33 as is illustrated in FIG. 7, the raised arch 14 reduces in size conforming to the size of the boss post 8 and being put under compression by the boss button 6. Now the forces from the boss button 6 are pushing down on the aperture assembly 33 and in particular on the raised arch 14 of the strap 10 to form down vector forces 50 shown as dotted line arrows. This places the raised arch 14 under compression which helps to it to stay coupled with the mounting system 4 when under normal use. A certain amount of bulging takes place in the aperture system 33 and is illustrated in FIG. 8 by dashed arrows 52 representing these bulging vector forces. These bulging vector forces 52 help to spread the raised arch 14 of the aperture assembly 33 to help spread the load when under stress from normal use. This assists in keeping the strap 10 coupled to the mounting system 4 even when the strap is pulled at an angle that is up to forty-five degrees from the line presented by the boss post 8. By spreading the load, the incidence of tearing the strap 10 is also reduced to make the strap 10 more reliable while allowing unusually large elasticity to aid the user in adjusting strap size and pressure. An alternative embodiment of the strap 53 is illustrated by FIG. 9 with a second end anchor tab assembly 54 comprising a second end tang 56 and a second end anchor. On the opposing distal end of the strap 10 is the first end anchor tab assembly 60 comprising the first end tang 62 and the first end anchor 64. The unexpected elastic quality of the aperture assembly 33 portion of the strap 53 allows the second end anchor 58 to be pulled through any aperture assembly 33 of the strap 53 until the entire anchor 58 extends through the aperture assembly 33 which then surrounds the second end tang 56. Because of the unexpected elasticity of the aperture assembly 33 an anchor shaped end is necessary to trap the edges of the strap 10 to help keep the second end anchor 58 trapped by the aperture assembly. The end tabs taught by prior art are not of a sufficient size or shape to perform this function. The width A of the first and second end anchors, 64 and 58 respectively, must be greater than the width W of the body of the strap 53. The larger width A of the anchors 64 and 58 help to ensure that the anchors will not inadvertently pass back through the aperture assembly 33. The alternative embodiment strap 53 of FIG. 9 becomes an alternative no-center-tabs embodiment strap 65 as shown in a perspective view in FIG. 10. The down side 32 of the strap 65 is seen and the major difference between strap 53 and 65 is the absence of center tabs 22 and 24 in said strap 65 along three additional aperture assemblies 33 located in the center of the strap 65. The additional aperture assemblies 33 enable said strap 65 to elongate to a longer length than strap 53. The strap 65 would be more likely used for securing gear only instead of the preferred strap 10 which is more likely used for securing the heel of a user into a fin 2. FIG. 11 is the plan view of the strap 53 of FIG. 9 in which the second end anchor 58 of said second end anchor tab assembly 54 has passed through the aperture assembly marked by the lines and W&#39;s and is overlapping the strap 53 while forming the loop 60. In addition to being able to form a loop 60, the anchors 58 and 64 can pass through any appropriately sized aperture assembly 33 of any strap 10 or 53 or 65 or like straps to chain the straps 10 and/or 53 and/or 65 together for use in storing gear for example. As an alternative to the first and second end anchor tab assemblies 54 and 60, a first and second end attachment means may be used as found illustrated in FIG. 12 in a perspective drawing of an alternative attachment means embodiment strap 77. Strap 77 uses in this embodiment a second end attachment means comprising a second end “S” hook attached to the strap 77 at the second end tab attachment. On the opposite distal end of strap 77 is the first end attachment means 72 comprising a first end “S” hook attached to the strap 77 at the first end tab attachment 76. These “S” hooks 68 and 72 respectively can pass through any aperture assembly 33 to hook the aperture assembly 33 in such a manner as to form a loop (not shown in FIG. 12 ) in the strap 77. The “S” hooks 68 and 72 respectively can also hook onto each other to form a larger loop and to possibly chain other like straps together to secure larger gear on the diver or on a boat. It must be made clear that any number, any geometric sizes or shapes of the tapered apertures, for the means of attachment, may be located along any portion of either end of the improved strap, and the strap may or may not have the same orifices symmetrically located on either end of the center tab pulls of the strap as well as the raised arch extending beyond the height of the body of the strap or being contained within in it and still be within the scope of this patent. Having described the invention in the preferred embodiment, it should be clear that modifications can be made without departing from the spirit of the invention. It is not intended that the words used to describe the invention nor the drawings illustrating the same be limiting on the invention. It is intended that the invention only be limited by the scope of the claims. LIST OF PARTS 2 open heeled swim fin; 3 foot pocket of said open heeled swim fin; 3 foot pocket; 4 mounting system; 6 boss button; 8 boss post; 10 an improved strap; 12 elongated strap body; 14 raised arch; 16 reduced diameter aperture; 18 dashed line denoting the center line of the elongated aspect of the strap body; 20 small dashed line denoting cut away section of strap extending to the center line; 22 first center tab pull; 24 second center tab pull; 26 first end tab at one distal end of the elongated strap; 28 second end tab at the other distal end of the elongated strap; 29 raised center support on the; 30 top side of the strap body; 32 the tapered aperture on the; 33 aperture assembly comprising said tapered aperture and raised arch; 34 bottom side of the strap body; 36 dotted line showing upper level of the top side of the strap; 38 dotted line showing the limit of the bottom side of the strap; 40 is the thickness of the body of the strap between the top side and the bottom side, not including the raised arch; 42 aperture system which comprises the series of aperture assemblies in the strap 48 solid line arrows showing top vector forces exerted on the aperture assembly when the mounting system is pushed from the bottom side towards the top side of the strap 50 dotted line arrows showing down vector forces of compression on the raised arch; 52 dashed line arrows showing the bulging vector forces causing the aperture system to bulge when surrounding the mounting system; 53 alternative embodiment strap 54 second end anchor tab assembly; 56 second end tang; 58 second end anchor; 60 first end anchor tab assembly; 62 first end tang; 64 first end anchor 65 alternative no-center-tabs embodiment strap 66 loop 67 second end attachment means; 68 second end “S” hook; 70 second end tab attachment; 72 first end attachment means; 74 first end “S” hook; 76 first end tab attachment; 77 alternative attachment means embodiment strap.

Summary: A strap with tapered-apertures for open-heeled swim fins is stretched from a first end connection to a conventional boss-button and boss-post structure, whereby the strap will apply a desired level of force as a holding-pressure against the heel of a swimmer. The strap&#39;s tapered-apertures are cast to link the tapered dimensions of aperture walls to an easy passage of the strap over the boss button and to a highly resistant passage of the strap-top to a designed seat against the top&#39;s raised arches. The manufactured formation of the unique aperture shapes result in an unexpected elasticity of the strap. The combination of aperture structure within the raised arches guide the orifice walls of the aperture into compression, instead of tension, greatly resisting forces to release the strap from the boss-posts and buttons.

big_patent

en

Summarize: Lo scorso dicembre abbiamo riportato la notizia riguardante il mostruoso regime censorio che la delibera 668/2010 di Agcom ha deciso di imporre al paese a partire dal prossimo 6 luglio; sovvertendo ogni regola, in barba a qualunque tentativo di mediazione e nonostante le asperrime parole di sdegno che arrivano da più parti. A partire dalla prossima settimana, lo scenario che contraddistinguerà il web italiano potrà essere riassunto in poche battute: saranno cancellati o inibiti tutti i siti, i portali, blog, strumenti di condivisione di file in rete, banche dati, siti privati che siano sospettati di contenere anche un solo file in grado di violare il diritto d’autore. Senza alcuna distinzione tra siti pubblici e privati, tra siti che divulgano contenuti a scopo di lucro e quelli che lo fanno a titolo amatoriale o personale. Nulla. Nada. Nichts. Tutti nello stesso calderone, tutti oscurati. E tutto pur di proteggere i poteri forti, i proprietari dei diritti d'autore, quelli che hanno paura del web in quanto possibile soppiantatore dei vecchi media, quelli che lo temono per ragioni squisitamente politiche, quelli che (insomma) muovono le fila e fanno ballare i burattini sulle note che preferiscono. Dal 6 luglio in poi, infatti, con "la scusa" del copyright potranno essere chiusi tutti i siti sospettati di violare il diritto d'autore (e non si parla solo di musica e film, ma di tutte le opere d'intelletto definite dagli articoli 1 e 2 della legge sul diritto d'autore, ovvero la qualunque). Quanto all'utente oggetto del provvedimento, gli viene concessa una tempistica ridicola per "rimediare alla violazione" ma non gli viene concessa nessuna possibilità di contestarla. Infatti, come tempo fa scrisse Fulvio Sarazana per la nostra testata: Il titolare del sito dovrà cancellare i file sospetti (senza alcuna verifica sulla legittimità o meno del contenuto) nel giro di 48 ore. Dopodiché avrà 5 giorni di tempo per difendersi davanti all’AGCOM. E questo sia in caso di siti italiani che esteri. Dopo 5 giorni, i contenuti saranno cancellati dall’Autorità o inibiti dai provider per ordine della stessa. L’utente non potrà dimostrare di essere legittimato ad inserire quel file né si potrà difendere in alcun modo. L’AGCOM non prevede, una volta che sarà entrata a regime, alcuna indagine sulla possibile colpa di chi ha inserito il file. Il sistema di cancellazione o inibizione funzionerà in maniera automatica, senza alcuna verifica. L’utente, inoltre, non potrà rivolgersi ad un giudice per evitare la cancellazione dei contenuti. L’intera procedura è gestita dall’AGCOM, su ricorso dei privati o delle organizzazioni a tutela del diritto d’autore, e si conclude in 5 giorni, senza alcuna consultazione o interazione con l’Autorità giudiziaria. Questa delibera ridicola e pretestuosa, con tutta probabilità, attirerà sul nostro paese le critiche, l'ilarità, l"incredulità della comunità internazionale e dei media stranieri che ormai non riescono più a star dietro alle storture e agli abomini democratici che il nostro paese continua a produrre, rendendo gli italiani sempre più zimbelli del mondo.

Summary: L'Agcom accelera l'approvazione di una delibera che rischia di seppellire il web italiano. La risposta di Anonymous è immediata, attacca il sito l'Agcom e divulga un comunicato: "L'Agcom vorrebbe istituire una procedura veloce e puramente amministrativa di rimozione di contenuti online considerati in violazione della legge sul diritto d'autore. L'Autorità potrebbe sia irrogare sanzioni pecuniarie molto ingenti a chi non eseguisse gli ordini di rimozione, sia ordinare agli Internet Service Provider di filtrare determinati siti web in modo da renderli irraggiungili dall'Italia. Il tutto senza alcun coinvolgimento del sistema giudiziario, che dovrebbe essere un passo indispensabile". La rete è in fermento, ormai prossima alla bufera.

fanpage

it

Summarize: × Teen Faces Deportation for Sale of Pot Brownies YUBA CITY- The girl who was arrested for selling marijuana-laced brownies to classmates to raise money for a prom dress, is facing possible further punishment. Saira Munoz, 19, was sentenced to four years probation and nine days in jail on drug charges earlier this week; but with time already served, she did not have to go back to jail. Now it turns out she may be in this country illegally and could be deported. Immigration officials say they are reviewing the case and have yet to file deportation proceedings. Last fall, Munoz enlisted the help of a classmate to help her sell the brownies. A customer who was acting erratically after eating one of the brownies on campus was taken to a hospital in an ambulance for observation. Investigators found cannabis in the brownies. It was the talk of the campus at Yuba City’s River Valley High School when she was arrested on drug charges and for recruiting a minor to help her sell the brownies. “I mean we have 12-, 13-year-old freshmen, so that’s bad,” student body Vice President Diojot Shergill said. But Shergill also said deportation was too harsh of an outcome. Classmates feel it was more in-line with a student prank, even though Munoz did it for cash. “It’s too much trouble to deport somebody for that,” student James Steerstold FOX40. Given the high school climate these days, some felt deportation doesn’t fit the crime. “She should not be deported for making weed brownies. I know lots of students who do that,” Dursimrim Kalar said. While it’s not known if federal immigration will take action, the terms of her probation state that if deported, she will not be allowed back into the country unless she gets legal status first. That is not likely if she’s listed as a drug offender. The Sutter County Probation Department says should the Immigration Service find that Munoz is not a citizen and is in this country legally, the conviction would jeopardize her legal status and she could still be deported. Munoz is deferring to her attorney who undoubtedly is looking at all avenues to keep her in the country. YUBA CITY (CBS13) — A Yuba City teenager is in danger of being deported after she tried to raise money for a prom dress by selling pot-laced brownies. Saira Munoz wanted to go to prom, but when she didn’t have money for a dress, she became an entrepreneur. “People make mistakes,” said Carlos Robles, a friend of the teen. But this mistake landed the River Valley High School student in handcuffs. Munoz, 18 at the time, decided to put on a school bake sale. There was an extra ingredient in her brownies: marijuana. She hired a fellow student to sell her brownies. Her pot ploy fell apart when a student got sick and needed to be rushed to the hospital by ambulance. “I was hurt, because she got arrested, and nobody wanted to see somebody we cared about go away,” Robles said. Because Munoz hired a fellow student, she was charged with employing a minor to sell marijuana—a felony. Robles went to school with Munoz at River Valley High and remains friends with her. “She was just a very positive person,” he said. “I just don’t like the turnout of this,” he said. A judge sentenced her to four years probation on Monday and nine days in jail with credit for time served. But that’s not all. Munoz also learned during her sentencing that she could be heading back home to Mexico. She came to the United States with temporary permission in 2000. After the Sutter County Probation Department called the feds about her conviction, she could now be deported. “No, there’s people that deserve to be deported, and she just wasn’t one of them,” Robles said. “There’s people that do way worse.”

Summary: Saira Munoz needed to make enough money to buy a prom dress. What to do? The then-18-year-old high school student chose quite possibly the worst course of action: She baked pot brownies, then hired another student to sell them at her high school in Yuba City, California. When one of the students who ate a brownie got sick, Munoz got caught, and on Monday she was sentenced to nine days in jail and four years' probation for employing a minor to sell marijuana. The good news: Due to time served, she didn't actually have to go back to jail, Fox 40 reports. The very, very bad news: The crime is a felony, and Munoz, who came to the US from Mexico with temporary permission in 2000, now faces deportation, CBS Sacramento reports. The probation department did reveal her conviction to the federal immigration authorities, but there's no word yet on her fate.

multi_news

en

Write a title and summarize: La couverture de "Monsieur Meurtre", de Jean Vautrin, illustré par Baru. Le Monde Quand vous sortez de prison après dix-huit ans d'incarcération, la chasse à l'espoir n'est pas forcément un chemin jonché de roses. François Javadère, matricule 405114 division B, du haut de ses 45 ans et de son 1,78 m, en sait quelque chose. Le sang et les embrouilles, voilà à quoi semble se résumer son destin de schizo qui, ado, a assassiné sa mère, aux moeurs légères, et son chien. La Faculté l'a certes diagnostiqué guéri, mais cela ne l'empêche pas d'avoir du mal à estourbir son chagrin. Est-il vraiment coupable? Pour en avoir le coeur net, direction Bordeaux et la maison familiale. Sa demi-soeur, Love Azur, qui a un nom de danseuse du Crazy Horse et le physique qui va avec, y vit encore… Tout cela ne va être que l'amorce d'une immense pétaudière. Dès son premier roman, A bulletins rouges, en 1973, à la "Série noire", Jean Vautrin a raconté avec une ironie féroce le spectacle offert par la vie de tous les jours. D'abord cinéaste (Adieu l'ami, 1968 ; Jeff, 1969), sous le nom de Jean Herman, ce bon vivant à l'humour corrosif, est ensuite devenu, avec Jean-Patrick Manchette, un des tenants d'une nouvelle génération d'auteurs de polars pour qui cette littérature directe et populaire doit avant tout permettre une critique du monde actuel. Illustration de Baru pour "Monsieur Meurtre". Le Monde Le registre de Manchette était dénonciateur, celui de Vautrin repose plus sur la dérision, le pessimisme et le pied de nez. Il a été influencé tout autant par la langue d'un Raymond Queneau (Billy-ze-Kick, 1974, est un clin d'oeil à Zazie dans le métro) que par la verve sudiste d'un Charles Williams (l'auteur américain de Fantasia chez les ploucs) ou les dialogues pétillants de Michel Audiard. Du coup, ses romans (Typhon Gazoline, Bloody Mary, Canicule, etc.) s'appuient sur de belles inventions verbales et d'impressionnants dons de conteur pour raconter les aventures de minables, qui se débattent avec la misère et la mort. En quittant les rives du polar, ce styliste hors pair remporta le prix Goncourt en 1989 avec Un grand pas vers le Bon Dieu. Deux recueils de nouvelles (Patchwork et Baby Boom) témoignent de son appétence pour ce format. Monsieur Meurtre permet de découvrir son talent à nous emporter dans une histoire à désespérer non seulement Billancourt, mais toutes les banlieues de France et de Navarre. L'immense Baru s'est chargé des illustrations. Ce n'est pas un hasard : ils viennent d'adapter ensemble Canicule en BD… Y. P. Retrouvez les "Petits Polars du Monde" sur la boutique en ligne du Monde Retrouvez l'adaptation radiophonique des "Petits Polars du Monde, avec SNCF" chaque samedi de 21 heures à 22 heures, du 29 juin au 28 septembre, sur France Culture. A réécouter et podcaster sur Franceculture.fr Jean Vautrin et Baru, par Baru. Le Monde L'auteur: Jean Vautrin Né en 1933, Jean Vautrin, pseudonyme de Jean Herman, est d’abord un homme d’images avant de se consacrer à l’écriture. Après avoir fait l’Idhec, il devient assistant de Roberto Rosselini, de Vincente Minelli et de Jacques Rivette, puis il passe à la réalisation : Adieu l’ami, avec Charles Bronson et Alain Delon (en 1967), Jeff (en 1968). Il est également le scénariste de Flic ou voyou (1978), Garde à vue(1981), Rue Barbare (1983), adaptant aussi ses propres romans comme Canicule (1983) et Billy-ze-Kick (1985). C’est en 1973 qu’Herman, devenu Vautrin, se tourne vers l’écriture avec A bulletins rouges, roman très noir et politique qui se déroule à Sarcelles en période d’élections législatives. En hommage à Zazie dans le métro, de Raymond Queneau, Vautrin écrit Billy-Ze-Kick et imagine une enquête meurtrière. Viendront alors Bloody Mary, adapté en bande dessinée par Jean Teulé, puis Typhon Gazoline et Canicule. Qu’il situe ses histoires dans des banlieues HLM ou dans le fin fond de la Beauce, Vautrin se distingue par une écriture inventive, volontairement chaotique. Parallèlement à ses écrits noirs, Vautrin entame avec Dan Frank un roman-feuilleton dont le héros, Boro, est reporter-photographe. Le premier, La Dame de Berlin, paraît en 1987, et la série se poursuit aujourd’hui. La nouvelle est également l’un de ses domaines de prédilection, avec des recueils comme Patchwork et Baby Boom, qui obtient le prix Goncourt de la nouvelle en 1985. En 1989, il recevra aussi le prix Goncourt pour son roman Un grand pas vers le bon dieu. Vautrin est donc un touche-à-tout qui s’essaie à tous les genres : la photo et le cinéma, la fiction courte, le roman noir, mais aussi l’adaptation en bande dessinée. A commencé une longue collaboration avec Jacques Tardi sur Le Cri du peuple, roman sur la Commune de Paris devenu une somptueuse bande dessinée. Récemment, c’est Baru a adapté son roman Canicule (chez Casterman). Chr. F. L'illustrateur: Baru Surnommé Baru dès son enfance en Meurthe-et-Moselle, Hervé Baruléa est né en 1947 à Thil, près de Villerupt. Professeur de sport, il publie ses premiers dessins dans Téméraire, journal fondé avec des amis de Nancy. Déjà, dans ce magazine éphémère, il veut s’ancrer dans la réalité, celle des cités ouvrières de Lorraine, qu’il connaît bien. En 1982, il entre dans le monde plus officiel de la bande dessinée quand le journal Pilote publie ses premières planches. Et, en 1985, il reçoit sa première récompense, l’Alfred du meilleur album au Festival d’Angoulême pour le premier tome de la série Quéquette Blues (Casterman). L’ouvrage dépeint la vie d’une bande d’adolescents dans une cité ouvrière. Baru y décrit ses années soixante, le coin de la rue, les copains, les samedis dans les bals, les semaines à rêver de filles inaccessibles à l’ombre des usines. En 1991, nouvelle récompense avec l’Alph’Art du meilleur album pour Le Chemin de l’Amérique. Cette fois, c’est la boxe qui intéresse le dessinateur avec l’histoire de Said Boudiaf, garçon doué mais poursuivi par l’histoire, au moment de la guerre d’indépendance en Algérie. En 1996, il reçoit une deuxième fois l’Alph’Art avec L’Autoroute du Soleil. Publié sous la forme d’un manga (Casterman Signatures), ce roman graphique avant l’heure ressemble plutôt à un road movie sans exotisme dans une France profonde du nord au sud. C’est ultra-réaliste, drôle et politiquement incorrect. De nouveau à travers la boxe (avec L’Enragé en 2003) et la réalité quotidienne d’un enfant d’ouvrier (Les Années Spoutnik ), Baru parle de sa génération élevée entre le café du Stand, son juke-box et son flipper. Mais il est aussi un enfant du rock lorsqu’il dessine ses héros en blouson et banane dans un monde de scooters déglingués. En 2010, au Festival d’Angoulême, Baru a reçu le Grand Prix de la Ville pour l’ensemble de son œuvre. Mais pas question de se reposer, puisqu’il vient de publier l’adaptation de Canicule avec Jean Vautrin (Casterman). Un polar explosif, dans un monde rural admirablement rendu par le trait de cet artiste inspiré.Chr. F. Yann Plougastel et Christine Ferniot

Title: "" "Monsieur Meurtre" ", de Jean Vautrin, illustré par Baru Summary: Les petits polars du Monde. Présentation de la troisième nouvelle de la saison 2013 des "Petits polars du Monde", disponible dans tous les kiosques jusqu'au 4 juillet (64 pages, 2 euros, en partenariat avec SNCF). Accompagné de la bio de l'auteur et de l'illustrateur.

mlsum_fr

fr

Summarize: FIELD OF THE INVENTION [0001] The present invention relates generally to surgical devices and methods. The invention relates specifically to a system for surgical treatment of urinary incontinence and its method of use. BACKGROUND OF THE INVENTION [0002] Urinary incontinence (UI) can range in severity from partial to complete loss of bladder control, and patients afflicted with UI can experience varying degrees of unintentional urine leakage. Incontinence conditions may change over time; and patients with light incontinence, for example, may experience minimal leakage during the occurrence of a provocative event, such as laughing or coughing, while those with heavy incontinence may experience continuous urine leakage. [0003] Generally, UI is not considered a disease, but rather a symptom or side effect of another medical condition. Some causes of UI include prostate surgery and in particular total prostatectomies (in men), head and spinal cord injuries, infections, certain toxins such as excessive alcohol consumption, certain medications such as sedatives, and certain diseases such as cancer, Parkinson&#39;s disease, and multiple sclerosis. Indeed, incontinence can be caused simply by virtue of aging processes or even emotional distress. [0004] As known to those in the urologic arts, there may be several types of UI and various treatments. Stress urinary incontinence, which is a common type of incontinence, may be characterized as urine leakage during a provocative event such as sneezing, laughing, lifting heavy objects, or when the patient engages in any type of exercise that puts pressure on the bladder. Urge urinary incontinence occurs when the patient wants to urinate but is incapable of exercising restraint until reaching a restroom. Additional types of incontinence may include overflow incontinence, which occurs when the quantity of urine exceeds the capacity of the patient&#39;s bladder, and functional incontinence, which occurs when the patient has knowledge of the need to urinate but simply cannot access a restroom quickly enough due to a physical obstruction or debilitation. [0005] To treat UI, several options may be available. These treatments may include behavioral techniques, such as biofeedback, bladder training, and pelvic muscle exercises; and modifications of the patient&#39;s diet and fluid intake. With respect to the latter, it is known that eliminating or reducing intake of certain types of substances, such as caffeine and alcohol, may help to alleviate incontinence. There are, additionally, medications available such as dicyclomine (Bentyl), flavoxate (Urispas), hyoscyamine sulfate (Anaspaz), imipramine (Tofranil), oxybutynin [0006] (Ditropan), tolterodine (Detrol), and propantheline (Pro-Banthine), phenylpropanolamine (Dexatrim), and pseudoephedrine (Sudafed), that may be helpful in controlling UI. [0007] Surgery may additionally be an option to treat UI. Examples of commercially available surgical devices include suburethral slings such as the “InVance” device produced by American Medical Systems, Inc. (AMS) of Minneapolis, Minn. The “InVance” suburethral sling device is intended to provide structural support to the urethra for the treatment of stress urinary incontinence, thereby acting to retain urine within the bladder and not permit leakage through the urethra. Such “first generation” suburethral slings may not be easily used by urologists of ordinary skill in the art. For example, there may be problems with patients not being fully continent postoperatively due to the slings being anatomically fixated too loosely. Alternatively, there may also be problems with patients being put into retention postoperatively due to the devices being anatomically fixated too tightly. [0008] Several companies have made attempts to progress the art of suburethral slings and their methods of use by providing so-called “minimally invasive” slings, which may utilize one or more mesh materials. One such company is Johnson &amp; Johnson (J&amp;J) which developed a sling known as “TVT-Secur” (TVT-S). It may be surgically implanted using only a single vaginal incision. The mesh sling is approximately 8 cm in length and has fixation tips fabricated from polyglactin 910 and polydioxanone suture yarn. The fixation tips of a TVT-S device may act to secure the mesh sling until tissue in-growth may occur along the length of the mesh—when the patient&#39;s anatomical tissues propagate within, through, and thus around pores of the mesh as is known with implantable mesh materials. To implant a TVT-S sling, a standard vaginal dissection and two small paraurethral dissections are performed. The sling has pre-attached introducers that may assist in placement to near a desired location within the two previously performed dissections. Near the desired location, the introducer may be detached from the sling and the other side of the sling may be placed. The sling may be placed in a “U” or “hammock” configuration. The incision may then be closed in standard fashion. Another “minimally invasive” suburethral sling is commercially available from the aforementioned AMS company. Its “Mini-Arc” suburethral sling device is approximately 8 cm in length with barb-like elements at each end. The barb-like elements may hold the sling in place until tissue in-growth occurs. Like the TVT-S device, a standard vaginal dissection and two small paraurethral dissections may be performed to place the sling. A trocar-like instrument may be attached to each barb-like element, to assist in placement near a correct tissue plane. After placement, the trocar may be released from the barb-like element; placement may then be made in the patient&#39;s contralateral side. The incision may then be closed in standard fashion. [0009] As with the aforementioned “first generation” devices for treatment of UI, problems may also occur with use of “minimally invasive” slings. The J&amp;J TVT-S devices, for example, may experience several problems. Its two aforementioned pre-attached introducers have rather bulky and sharp elements, which may cause excessive bleeding and hematomas—thereby making a procedure styled as “minimally invasive” in fact more invasive due to such complications. Also, fixation methods of TVT-S devices may be inadequate in that physicians may be unable to achieve continence in their patients due to faulty anchoring of the aforementioned fixation tips. The AMS “Mini-Arc” devices may function better than the J&amp;J TVT-S devices; however, there may be two main drawbacks to these devices. First, the “Mini-Arc” device is relatively short which may impede a physician&#39;s ability to aim for a bony landmark as desired during implantation surgery. Desired repeatability of the surgical procedure from patient to patient may thereby diminished since anatomical landmarks may not be confidently or repeatably targeted, and instead the physician may need to rely upon experience and subjective judgment to place the barb-like elements near correct tissue planes. Second, anchoring and tensioning functions in the “Mini-Arc” device may be, disadvantageously, coupled. That is, in placing a second anchor, the physician might need to anticipate with nearly impossible foresight or luck that the desired anchor placement location will ultimately result in desired tensioning of the sling. [0010] Aside from the aforementioned TVT-S and “Mini-Arc” devices, several attempts may have been made at providing “minimally invasive” UI sling-type systems. For example, U.S. Pat. No. 6,960,160 (Ser. No. 10/398,992) discloses an “apparatus and method for treating female urinary incontinence” that may require significant dissection and relatively invasive creation of a passage or tunnel in the patient&#39;s internal anatomical space to accommodate the device. U.S. Pat. No. 7,163,506 (Ser. No. 10/413,470) discloses a “device for the treatment of urinary incontinence” that may require a valve and conduit that are fluidly connected to an inflatable balloon for sling fixation. U.S. Pat. No. 7,229,404 (Ser. No. 10/524,861) discloses a “surgical prosthesis-forming device used to implant an organ support in a mammal” that may utilize a relatively long sling, coupled to a pulley-like device. Use of an invasive penetrating trocar or introducer may be required for implantation of the device. U.S. Pat. Applic. Pub. No. 2007/0162120 (Ser. No. 11/615,144) discloses a “surgical device forming a surgical prosthesis” that may use “bunched up” mesh—or a “ball of mesh”—as an anchoring means within tissue to which the device may be fixed, via tissue in-growth as aforedescribed. Consequently, this device may require use of a relatively large, hollow trocar device to surgically place the “bunched up” mesh anchor. PCT Pat. Applic. Pub. No. WO 2007/059199 (serial no. PCT/US06/044315) discloses a “sling anchor system” that may provide tensioning adjustment adjacent to the sling itself, relatively proximal to near the patient&#39;s anatomy to be supported rather than distally near the non-expandable anchor. PCT Pat. Applic. Pub. No. WO 2007/149555 (serial no. PCT/US07/014553) discloses “adjustable tension incontinence sling assemblies” that may rely upon anchors like those of the aforementioned “Mini-Arc” device and may require superficial exit points at a level of the patient&#39;s skin. [0011] Regardless of construction, mode of operation, or invasiveness, various examples of suburethral sling devices, components, and methods of manufacture and use, may be described in (a) U.S. Pat. No. 6,626,916 (Ser. No. 09/445,011), U.S. Pat. No. 6,638,211 (Ser. No. 10/092,069), U.S. Pat. No. 6,960,160 as aforementioned (Ser. No. 10/398,992), U.S. Pat. No. 7,229,404 as aforementioned (Ser. No. 10/524,861), U.S. Pat. No. 7,285,086 (Ser. No. 11/190,295), and U.S. Pat. No. 7,297,102 (Ser. No. 11/190,601); (b) U.S. Pat. Applic. Pub. Nos. 2005/0043820 (Ser. No. 10/492,473), 2006/0030884 (Ser. No. 10/914,059), 2006/0041185 (Ser. No. 11/199,601), 2006/0058578 (Ser. No. 10/510,488), 2006/0205995 (Ser. No. 11/324,028), 2007/0162120 as aforementioned (Ser. No. 11/615,144), and 2007/0299300 (Ser. No. 11/854,049); and (c) PCT Pat. Applic. Pub. Nos. WO 2007/059199 as aforementioned (serial no. PCT/US06/044315), WO 2007/097994 (serial no. PCT/US07/004015), WO 2007/149348 (serial no. PCT/US07/014120), WO 2007/149555 as aforementioned (serial no. PCT/US07/014553), and WO 2007/149593 (serial no. PCT/US07/014780). [0012] In general, several drawbacks may be experienced in utilizing suburethral slings per se to treat UI. For example, securing suburethral sling devices into position may require use of known anchoring devices such as, for example, bone screws, which could be difficult and time consuming to deploy, and which could result in significant patient discomfort—especially within a first few weeks following surgery. In this regard, it might be recognized among surgeons who perform implant procedures that sutures attached to bone anchors or bone screws, which are utilized to secure the devices into position, may break and that additional bone anchors or screws may be needed to secure the devices into position. In fact, sutures attached to bone anchors and bone screws may need to be individually re-tensioned several times before optimal device positioning and desired structural support to the urethra is achieved. In addition, surgical procedures and methods for implanting suburethral sling devices for treatment of UI utilizing known anchoring devices may lead to difficulties in positioning and fixation with desired anatomical tensioning. [0013] The suburethral sling art might also be viewed as moving away from such invasive anchoring devices, to relatively less invasive fixation via tissue in-growth. The art might further be viewed as moving toward shortened sling lengths with, optionally, elimination of skin exit points above the patients&#39; pubic anatomy—all in an effort to be less invasive or “minimally invasive”. [0014] At present, so-called “minimally invasive” slings might have minimized sling lengths, but unfortunately they might have not led to lower trauma rates or increased out-patient use as desired. Such known “minimally invasive” slings may still require use of relatively large introducers and relatively large anatomical dissections. In some cases, placement of such slings may lead to even higher complication rates when compared to older, “first generation” slings. [0015] Further, implantation of known suburethral sling devices—whether first generation or “minimally invasive”, may be complex and time consuming, and may produce unacceptable clinical outcomes. [0016] Accordingly, there may be a need in the art for a system for surgical treatment of urinary incontinence of the present invention that might alleviate difficulties in placement, positioning, fixation, and anchoring, with desired anatomical tensioning when compared to known devices. Also, there may be a need in the art for a system for surgical treatment of urinary incontinence of the present invention that might be relatively less invasive when compared to known devices. Additionally, there may be a need in the art for a system for surgical treatment of urinary incontinence of the present invention that might be associated with lower trauma or complication rates while potentially increasing out-patient use. Further, there may be a need in the art for a system for surgical treatment of urinary incontinence of the present invention that might be implanted without complex or time consuming surgical procedures, and that might produce acceptable clinical outcomes. SUMMARY OF THE INVENTION [0017] In accordance with basic aspects of the present invention, a system for surgical treatment of urinary incontinence could comprise an implantable material to support a urethra, having a first end portion, a central portion, and a second end portion. A first tensioning member could be connected to the first end portion of the implantable material, and a second tensioning member could be connected to the second end portion of the implantable material. A first elongated fixation member could be connected to the first tensioning member, and a second elongated fixation member could be connected to the second tensioning member. A first anchor could be connected to the first elongated fixation member and a second anchor could be connected to the second elongated fixation member. [0018] Also in accordance with basic aspects of the present invention, a method of manufacturing an anchor for use in a system for surgical treatment of urinary incontinence could comprise steps of making a mold in a shape of an anchor, filling the mold with a selected semi-liquid material and curing it, and then removing the anchor thereby created from the mold. [0019] Further in accordance with basic aspects of the present invention, a method of using a system for surgical treatment of urinary incontinence could comprise steps of providing (i) an implantable material to support a urethra, having a first end portion, a central portion, and a second end portion, (ii) a first tensioning member and a second tensioning member, (iii) a first elongated fixation member and a second elongated fixation member, (iv) a first anchor and a second anchor, and (v) an introducer. An anatomical dissection could be made in a patient to access internal anatomical space near both obturator foramen of the patient. The first anchor could be removably secured to the introducer, with (a) the first anchor connected to the first elongated fixation member, (b) the first elongated fixation member connected to the first tensioning member, and (c) the first tensioning member connected to the first end portion of said implantable material. The introducer, with the first anchor, the first elongated fixation member, the first tensioning member, and the first end portion of the implantable material, could be placed through the anatomical dissection in the patient, thereby entering the internal anatomical space near an obturator foramen of the patient with the first anchor and the first elongated fixation member. The introducer, with the first anchor, could be advanced into and through obturator tissue in the obturator foramen of the patient and deployed. The introducer could be removed from the first anchor, and withdrawn from the internal anatomical space and the anatomical dissection in the patient. The foregoing steps could be repeated with respect to placement of the second anchor, the second elongated fixation member, the second tensioning member, and the second end portion of the implantable material. The central portion of the implantable material could be manipulated for placement near a urethra of the patient. Optionally and individually, the first tensioning member connected to the first end of the implantable material, and the second tensioning member connected to the second end of the implantable material, could be manipulated to achieve desired tensioning of the implantable material near the urethra of the patient. The anatomical dissection in the patient could then be closed. BRIEF DESCRIPTION OF THE DRAWINGS [0020] FIG. 1 is a schematic illustration of an example of a system for surgical treatment of urinary incontinence of the present invention, placed in a patient during implantation surgery. [0021] FIG. 2 is an illustration of an example of tensioning components of the system depicted in FIG. 1. [0022] FIG. 3 is an illustration of an alternative example of tensioning components of the system depicted in FIG. 1. [0023] FIG. 4 is an illustration of an example of an anchor of the system shown in FIG. 1, depicting an un-deployed state. [0024] FIG. 4 a is an illustration of the example of an anchor shown in FIG. 4, depicting a deployed state. [0025] FIG. 5 is an illustration of an alternative example of an anchor of the system shown in FIG. 1, depicting an un-inflated state. [0026] FIG. 5 a is an illustration of the example of an anchor shown in FIG. 5, depicting an inflated state. [0027] FIG. 6 is an illustration of another alternative example of an anchor of the system shown in FIG. 1, depicting an un-deployed state. [0028] FIG. 6 a is an illustration of the example of an anchor shown in FIG. 6, depicting a deployed state. DETAILED DESCRIPTION OF THE INVENTION [0029] Illustrated in FIG. 1 is an example of a system for surgical treatment of urinary incontinence 10 (hereinafter, “system 10 ”) of the present invention. In this example, system 10 could include an implantable material 100 to support a urethra U, having a first end portion 102, a central portion 104, and a second end portion 106. System 10 could also include a first tensioning member 110 connected to first end portion 120 of implantable material 100, and a second tensioning member 112 connected to second end portion 106 of implantable material 100. System 10 could additionally include a first elongated fixation member 120 connected to first tensioning member 110, and a second elongated fixation member 122 connected to second tensioning member 112. System 10 could further include a first anchor 130 connected to first elongated fixation member 120 and a second anchor 132 connected to second elongated fixation member 122. [0030] As illustrated in FIGS. 2 and 3, first and second tensioning members 110 and 112 could, individually or in combination, comprise a knot assembly 200 or a zip tie-like assembly 300. It is to be understood that although only tensioning member 112 is depicted in FIGS. 2 and 3, the example assemblies 200 and 300 as will be described could similarly be employed with opposite tensioning member 110. Thus, in FIG. 2, knot assembly 200 could include an end portion 122 e or 120 e of elongated fixation members 122 or 120 (not illustrated), respectively, that could be placed through an aperture 106 a or 102 a (not illustrated) in end portion 106 or 102 (not illustrated), respectively. Then, as will be described in use of system 10, end portion 122 e or 120 e could be tied into any desired knot when material 100 is approximately at a desired tension near urethra U, thereby tending to hold such tension in system 10 as desired. In FIG. 3, zip tie-like assembly 300 could include a relatively flat toothed or notched end portion 122 e or 120 e of elongated fixation members 122 or 120 (not illustrated), respectively. Toothed or notched end portion 122 e or 120 e (represented by teeth or notches 310 in the drawing) could be configured to be capable of being placed through an indexing aperture 106 a or 102 a in end portion 106 or 102 (not illustrated), respectively, that itself could have a complementary interior indexing surface 312 that is capable of incrementally advancing and securing teeth or notches 310 of end portion 122 e or 120 e, respectively, therewithin in “zip tie” fashion. Then, as will be described in use of system 10, end portion 122 e or 120 e could be placed within indexing aperture 106 a or 102 a, respectively, and pulled into successive engagement between notches 310 and complementary interior indexing surface 312 to approximately achieve a desired tension of material 100 near urethra U—thereby tending to hold such tension in system 10 as desired. [0031] As may be desired for a particular system 10, elongated fixation members 120 and 122 could, individually or in combination, comprise a suitable medical grade mesh material or a medical grade suture material. Such a medical grade mesh material could be as described below, as an example of implantable material 100. [0032] Turning now to FIGS. 4-6 a, first and second anchors 130 and 132 could comprise, individually or in combination, for example, an expandable needle-like element ( FIGS. 4 and 4 a ), an expandable balloon-like element ( FIGS. 5 and 5 a ), or an expandable segmented element ( FIGS. 6 and 6 a ). [0033] In the example shown in FIGS. 4-4 a, anchor 130 / 132 could be an expandable needle-like element 400 that could have a generally cylindrical or conical body 402. Body 402 could be further defined, lengthwise, by a relatively pointed tissue penetrating end 410 and an introducer receiving end 420. Body 402 could include a channel (not illustrated) in introducer receiving end 420 for removably securing a tip of an introducer (also not illustrated) therewithin as will be described relative to use of system 10. Body 402 could also include a slot 430 for placement and securing of portions of elongated fixation members 120 or 122 therethrough, as will also be described relative to use of system 10. Body 402 could further include one or more apertures to accommodate one or more deployable barbs 440 for immobilizing and fixing expandable needle-like element 400 in anatomical tissue, as will also be described relative to use of system 10. Any suitable means (not illustrated) for deploying barbs 440 may be utilized upon placement of element 400 in a desired anchoring location, such as by, for example, mechanical or electro-mechanical actuation. Dimensions of expandable needle-like element 400 could be, for example, 0.300 inches (0.76200 cm) in length by 0.062 inches (0.15748 cm) in diameter, while the channel in introducer receiving end 420 could be 0.045 inches (0.1143 cm) to 0.050 inches (0.1270 cm) in diameter; and slot 430 could be 0.110 inches (0.2794 cm) in length by 0.020 inches (0.0508 cm) in width. Element 400 could be constructed using any suitable techniques as will be described below. [0034] In the example shown in FIGS. 5-5 a, anchor 130 / 132 could be an expandable balloon-like element 500 that could have a generally cylindrical body 502 and tissue penetrating end portion 510 in an un-inflated state as shown in FIG. 5. Body 502 could be further defined, lengthwise, by an introducer receiving end 520. Body 502 could include a channel (not illustrated) in introducer receiving end 520 for removably securing a tip of an introducer (also not illustrated) therewithin as will be described relative to use of system 10. As will also be described relative to use of system 10, body 502 could also include a slot 530 for placement and securing of portions of elongated fixation members 120 or 122 therethrough. After penetrating anatomical tissue in which anchor 130 / 132 is to be fixed, expandable balloon-like element 500 could be inflated as shown in FIG. 5 a such that anchor 130 / 132 could be immobilized and fixed in the anatomical tissue thereby. Any suitable means (not illustrated) for inflating expandable balloon-like element 500 could be utilized upon placement of element 500 in a desired tissue anchoring location, such as by, for example, pneumatic, electro-pneumatic, hydraulic, or electro-hydraulic actuation. Dimensions of expandable balloon-like element 500 could be, for example, 0.300 inches (0.7620 cm) in length by 0.085 inches (0.2159 cm) in diameter, while the channel in introducer receiving end 520 could be 0.045 inches (0.1143 cm) to 0.050 inches (0.1270 cm) in diameter; and slot 530 could be 0.110 inches (0.2794 cm) in length by 0.020 inches (0.0508 cm) in width. Element 500 could be constructed using any suitable techniques as will be described below. [0035] Lastly, in the example shown in FIGS. 6-6 a, anchor 130 / 132 could be an expandable segmented element 600 that could have a generally cylindrical body 602. Body 602 could be further defined, lengthwise, by a relatively pointed tissue penetrating end 610 and an introducer receiving end 620. Body 602 could include a channel (not illustrated) in introducer receiving end 620 for removably securing a tip of an introducer (also not illustrated) therewithin as will be described relative to use of system 10. Body 602 could also include a slot 630 for placement and securing of portions of elongated fixation members 120 or 122 therethrough, as will also be described relative to use of system 10. Body 602 could further include a slidable cuff 640 and one or more expandable body segments 642 connected proximally to cuff 640 and distally to tissue penetrating end 610, for immobilizing and fixing expandable segmented element 600 in anatomical tissue as will also be described relative to use of system 10. Element 600 could remain in a generally cylindrical configuration until desired deployment, whereupon movement of cuff 640 toward end 610 could cause one or more expandable body segments 642 to bend or otherwise expand outwardly in explosive-like fashion—thereby effectively forming a disc-type anchor while in a deployed state. Any suitable means (not illustrated) for deploying segments 642 may be utilized upon placement of element 600 in a desired anchoring location, such as by, for example, a physician&#39;s manipulation of cuff 640 or even mechanical or electro-mechanical actuation of cuff 640. Dimensions of expandable segmented element 600 could be, for example, 0.300 inches (0.76200 cm) in length by 0.085 inches (0.2159 cm) in diameter, while the channel in introducer receiving end 620 could be 0.045 inches (0.1143 cm) to 0.050 inches (0.1270 cm) in diameter; and slot 630 could be 0.110 inches (0.2794 cm) in length by 0.020 inches (0.0508 cm) in width. Element 600 could be constructed using any suitable techniques as will be described below. [0036] It is to be understood that, as shown particularly in the example of FIG. 1, a system for surgical treatment of urinary incontinence of the present invention could advantageously employ a relatively short length of implantable material 100, relatively thin elongated fixation members 120 and 122, and relatively remote placement of anchors 130 and 132, as may be appreciated with respect to use of the system of the present invention as described below. [0037] Although not illustrated, it is to be understood that certain components of a system for surgical treatment of urinary incontinence of the present invention, such as anchors 130 or 132, could be manufactured using any suitable materials (e.g., semi-liquid materials and metals such as stainless steel and Nitinol) and fabrication techniques. For example, a mold could be made in a shape of anchor 130 as embodied in expandable balloon-like element 500, most notably including body 502, tissue penetrating end portion 510, introducer receiving end 520 including the aforementioned channel, and slot 530. The mold could be filled with a selected semi-liquid material. The semi-liquid material could then be cured or cooled (hereinafter, individually or collectively, referred to as “cured” or “curing”) and expandable balloon-like element 500 thereby created could then be removed from the mold. Alternatively, a mold could be made in a substantially solid shape of, for example, body 400 of expandable needle-like element 400. Then, the channel in introducer receiving end 420, slot 430, and the apertures for deployable barbs 440 could be formed by any suitable technique such as by machining, drilling, or milling processes; and provision of barbs 440 could be made by constructing a spring-loaded or electro-mechanical sub-assembly incorporated into body 400. The semi-liquid material could be, as desired or suitable for a particular manufacturing process, any suitable medical grade thermoplastic/thermoset and/or polymer-like material, of desired durometer for desired hardness, such as, for example, polyolefin, polypropylene, polyethylene, polyurethane, polycarbonate, polysulfone, so-called “ABS” polymer material, nylon material, or silicone; or combinations of these materials. Curing (or “cycle”) times and temperatures, along with a particular selection of the material or materials, could determine optimal characteristics of thickness, hardness, and durability of anchors 130 or 132. It is to be understood that a particular embodiment of anchors 130 or 132, such as the examples of expandable needle-like element 400, expandable balloon-like element 500, and expandable segmented element 600, could be produced using any suitable materials and fabrication techniques as aforementioned, depending upon particular requirements and configurations of each. As such, suitable materials and fabrication techniques could employ several different materials (e.g., polyethylene, nylon, and silicone) and several different fabrication steps (e.g., molding, machining, and construction of a spring-loaded sub-assembly) for production of an anchor 130 or 132. It is to be appreciated that, although again not illustrated herein, anchors 130 or 132 could also be manufactured using any suitable fabrication techniques such as transfer molding or injection molding. [0038] With reference now to all of the drawings, an example of a method of using a system for surgical treatment of urinary incontinence of the present invention, in a female patient, may include the following steps. [0039] First and second anchors 130 and 132 (e.g., 400, 500, or 600 ) could be provided to a physician, along with a suitable implantable material 100 and a suitable introducer. Implantable material 100 could have a first end portion 102, a central portion 104, and a second end portion 106. Material 100 could have a length of about 4 cm and a width of about 11 mm. Suitable implantable material and a suitable introducer could be, for example, ARIS® brand suburethral sling material and an ARIS® brand curved introducer that are both commercially available from Coloplast A/S. The physician could then make vaginal dissection (or “midline dissection”; not illustrated) in the female patient to access internal anatomical space near the patient&#39;s obturator foramen OF (as shown in FIG. 1 ). [0040] Referring to FIG. 2 and, alternatively, FIG. 3, a selected portion of first elongated fixation member 120 could then be placed through slot ( 430, 530, or 630 ) of first anchor 130 ( 400, 500, or 600 ) such that elongated fixation member 120 is secured within slot ( 430, 530, or 630 ). An opposite portion of first elongated fixation member 120 could then be connected to first tensioning member 110 (e.g., 200 or 300, as illustrated in FIGS. 2 and 3 relative to similar, opposing second tensioning member 112 and second elongated fixation member 122 ) thereby connecting first tensioning member 110 to first end portion 102 of implantable material 100. Although not shown in the drawings, the introducer could be removably coupled to anchor 130 by way of pushing a tip of the introducer into the channel of anchor 130 at introducer receiving end ( 420, 520, or 620 ). The introducer—with anchor 130 coupled to it and sequentially connected first elongated fixation member 120 and first end portion 102 of material 100 via first tensioning member 110 as aforedescribed—could then be placed through the vaginal dissection so that the introducer, anchor 130, and material 100 could all enter the internal anatomical space near the patient&#39;s obturator foramen OF. The introducer, with anchor 130 and a portion of first elongated fixation member 120 connected to anchor 130 at slot ( 430, 530, or 630 ), could then be advanced into and through obturator tissue OT in the obturator foramen OF adjacent to a posterior side of an ischiopubic ramus. Commonly, an audible and/or tactile “pop” is noticed when obturator tissue is so penetrated. The physician could then cause anchor 130 to deploy (e.g., FIG. 4 a ), inflate (e.g., FIG. 5 a ), or expand outwardly (e.g., FIG. 6 a )—collectively, “deploy”—thus tending to inhibit movement of anchor 130 back through penetrated obturator tissue OT and thereby effectively anchoring a portion of first elongated fixation member 120 adjacent to anchor 130 in obturator foramen OF. The introducer could then be removed by pulling its tip outwardly from the channel in introducer receiving end ( 420, 520, or 620 ) of anchor 130 ; and subsequently the introducer could be withdrawn from the internal anatomical space and the vaginal dissection in the patient. The aforedescribed steps could then be repeated on the patient&#39;s contralateral side with respect to placement of second anchor 132 as illustrated in FIG. 1. Central portion 104 of material 100 could then be manipulated by the physician through the vaginal dissection to ensure placement of central portion 104 near a urethra U of the patient so that urethra U may be supported or even compressed as may be necessary for a particular UI treatment. Optionally and individually, the physician could also manipulate first and second tensioning members 110 and 112 (e.g., assemblies 200 or 300 ) to achieve desired tensioning of implantable material 100 near urethra U. Finally, the vaginal dissection could be closed by any suitable surgical technique such as suturing, thereby concluding the implantation surgery. [0041] It is to be appreciated that although this example of a surgical method utilizing system 10 has been described relative to female patients, it could of course also be performed in male patients with corresponding and/or alternative surgical steps (e.g., a perineal incision in place of a vaginal dissection). [0042] It is to be also appreciated that the aforedescribed example of a method utilizing the system for surgical treatment of urinary incontinence of the present invention is intended to be a “minimally invasive” treatment. In this method it is to be understood, with particular reference to FIG. 1, that material 100 could “cradle” the patient&#39;s urethra U. Elongated fixation member 120 could be effectively fixed in one obturator foramen OF, via one anchor 130 that penetrates obturator tissue OT and traverses the patient&#39;s internal anatomical space to first tensioning member 110. Central portion 104 of material 100 could then be manipulated to be approximately under urethra U. On a contralateral side, elongated fixation member 122 could then be effectively fixed in the obturator foramen OF via the other anchor 132 that penetrates obturator tissue OT and traverses the patient&#39;s internal anatomical space to second tensioning member 112. Central portion 104 of material 100 could then again be manipulated to be approximately under urethra U. Thus, material 100 could effectively reside between urethra U and the patient&#39;s anterior vaginal wall adjacent to the vaginal dissection performed by the physician. This “cradle” of material 100 could serve to support urethra U in response to, for example, a stress event such as coughing or laughing, thereby tending to prevent, for example, stress UI. [0043] Material 100 could have an ability, with respect to use of zip tie-like assembly 300, for example, to be tensioned as aforementioned by carefully and incrementally advancing toothed or notched end portion 122 e and/or 120 e in corresponding indexing aperture 106 a and/or 102 a. With reference to a side of system 10 corresponding to anchor 132, as notched end portion 122 e is so advanced within indexing aperture 106 a, a length of elongated fixation member 122 between anchor 132 and tensioning member 112 decreases, which thereby could provide desired increased tension against, or increased lifting force under, urethra U. Of course, this tensioning process could be performed on each side of system 10 corresponding to anchors 132 and 130, either alone, consecutively, or concurrently with respect to each other. It is to be understood that material 100 could also have an ability to be similarly tensioned with respect to use of example knot assembly 200, as aforementioned. Further, it is to be understood that knot assembly 200 could be employed on one side of a particular system 10 and that zip tie-like assembly 300 could be employed on a contralateral side of that same system 10, depending upon a physician&#39;s preference. [0044] Also, it has been discovered that upon occurrence of so-called “tissue in-growth” of material 100 after the surgery is completed and during the patient&#39;s healing process, anchors 130 and 132 might then be not needed to fix material 100 in the patient; and therefore anchors 130 and 132 could be made of a suitable medical grade bioresorbable material. [0045] It is to be additionally appreciated that the foregoing example of a method to treat UI provides an anchor placement step that, notably unlike the AMS “Mini-Arc” device, is intentionally “decoupled” from tensioning of the suburethral sling material. In the foregoing example, both anchors could be placed and checked for desired positioning. Thereafter, when the anchors are in desired positions, tensioning of the sling material could then be performed. In the “Mini-Arc” device, however, tensioning is in fact “coupled” to anchor fixation—distal or proximal placement of a second anchor with respect to the urethra dictates the tension of the sling material. [0046] It is to be further appreciated and understood that the foregoing example of a method to treat UI could provide an ability for the physician to place the anchors near discrete “bony landmarks”. This ability could be another distinguishing factor from the AMS “Mini-Arc” device, which intentionally utilizes a relatively short length of sling material and thereby impedes a physician from placing anchors near such “bony landmarks”. Rather, a physician implanting an AMS device must find a suitable location for anchor placement by subjective reliance on past surgical experience. Also, unlike the TVT-S device which could embody a relatively large configuration, it is also to be appreciated and understood that the system of the present invention could have an ability to minimize dissection and trauma to pelvic tissues by employing expandable tissue anchors that could be attached via small diameter and variable length fixation members to a relatively small length of implantable material that could support or compress the urethra. The attachment of the fixation members to the implantable material could provide length adjustment for tensioning via the tensioning members as aforesaid. The anchors could be placed by a relatively small diameter introducer that minimally penetrates through anatomical tissue to a desired location for fixation of each anchor. Once at the desired location, the anchors could be deployed such that expansion thereof could immobilize them. Since the anchors could be expandable, damage to tissue could thus be minimized by use of such small anchors and introducer that are not expanded until in the correct location. Additionally, the fixation members that attach to the anchors could be of even smaller diameter than the introducer, thereby causing no additional tissue trauma during implantation surgery. A length of the implantable material could then be reduced to support just a space near the urethra. As such, the dissection could be performed to be only large enough to accommodate the reduced material length that actually cradles the urethra. The relative dissection size could thus be decreased since relatively long fixation arms or relatively large anchor barbs—as utilized in other devices—do not require accommodation in the system of the present invention. [0047] Although not illustrated in the drawings, it is to be appreciated that an anchor provided in accordance with the present invention could have a hole or aperture in its penetrating end so that a tip of an introducer could protrude therefrom (e.g., through a channel that could be provided completely through the anchor&#39;s body). [0048] It is to be appreciated from the foregoing disclosure that the present invention uniquely and advantageously satisfies the long-felt need for a system for surgical treatment of urinary incontinence that may be easier to surgically implant and secure into position than known devices, and that may be simply constructed, manufactured at relatively low cost, and easy to use when compared to known devices. [0049] It will be appreciated by those in the surgical arts that novel aspects of the tensioning members and anchors of the present invention could be capable of use in, and beneficial to, virtually any anatomical tensioning and anchoring per se—even outside of UI treatment technologies. [0050] While the present invention has been particularly shown and described with reference to the accompanying specification and drawings, it will be understood however that other modifications thereto are of course possible; and all of which are intended to be within the true spirit and scope of the present invention. It should be appreciated that (i) components, dimensions, shapes, and other particulars of example embodiments of the invention aforedescribed may be substituted for others that are suitable for achieving desired results, (ii) various additions or deletions may be made thereto, and (iii) features of the foregoing examples may also be made in combinations thereof. It is also to be understood in general that any suitable alternatives may be employed to provide the system for surgical treatment of urinary incontinence of the present invention, its manufacturing method, and its method of use. [0051] Lastly, of course, the choice of compositions, sizes, and strengths of various aforementioned elements of the present invention are all a matter of design choice depending upon intended uses thereof. [0052] Accordingly, these and other various changes or modifications in form and detail of the present invention may also be made therein, again without departing from the true spirit and scope of the invention as defined by the appended claims.

Summary: A system configured to treat urinary incontinence includes an implant configured to support a urethra, a tensioning member connected to the implant, an elongated fixation member connected to the tensioning member, and an anchor connected to the elongated fixation member. The anchor includes a body extending between a penetration end and an introducer end, a cuff configured to slide relative to the body, and a plurality of expandable body segments coupled between the cuff and the penetration end. Movement of the cuff toward the penetration end radially expands the expandable body segments.

big_patent

en

Summarize: A police K9 has successfully tracked down a five-year-old boy who was kidnapped by his father and threatened with death. Richard Mamales, 44, allegedly snatched his young son, Derek, following an argument with the boy's mother at his home in Tooele, Utah, on Friday night. He reportedly threatened to kill the entire family - starting with Derek - before grabbing his son's hand and disappearing for the night. Scroll down for video. Heroic: This police K9, named Max, successfully tracked down 'endangered' child Derek Mamales yesterday. 'Kidnapping': Richard Mamales (left), 44, allegedly snatched his five-year-old son, Derek (right), following an argument with the young boy's mother at his home in East Vine Street in Tooele, Utah, on Friday night. '(Mamales) had made a threat that he should kill the whole family and that he may just start with (Derek), as he grabbed the boy and left,' said Tooele Police Captain, Paul Wimmer. Police launched a search for the 'endangered and missing child', which saw the activation of Utah's Child Response Abduction Response Team and an 'amber alert' issued. But now, Derek has been found and reunited with his mother and sisters after a police K9 tracked him and Mamales to a shed near the house in East Vine Street. The bloodhound, named Max, had been dispatched with trainer Alan Honsaker, a member of South Salt Lake's K9 unit, as part of the rescue attempt. Thankful: In emotional scenes yesterday, Derek's sisters were seen weeping with emotion as they greeted their younger brother, with one covering him in a blanket and scooping him up in her arms (pictured) Dispatched: Police launched a search for the'missing child', which saw the activation of Utah's Child Response Abduction Response Team and an 'amber alert' issued. Above, Max and trainer Alan Honsaker. He was given a paper bag to sniff to learn the missing boy's scent, before tracing it to the shed, where Mamales was hiding with Derek, at around midday yesterday. 'Max was able to walk into the track at that point and take me to where the suspect was hiding,' Mr Honsaker told Fox 13. Following the discovery, Mamales was promptly arrested, while Derek, who was found in 'a good condition' and eating candy, was returned to his family. In emotional scenes yesterday, Derek's sisters were seen weeping with emotion as they greeted their younger brother, with one covering him in a blanket and scooping him up in her arms. Tracking down the suspect: Max was given a paper bag to sniff to learn the missing boy's scent, before tracing it to the shed (pictured), where Mamales was hiding with Derek, at around midday yesterday. Hunt: 'Max was able to walk into the track at that point and take me to where the suspect was hiding,' Mr Honsaker (right) said. Derek (left), who was found in 'a good condition', was later taken home. Max, who has been finding missing children in Utah for more than eight years, was later given 'a big handful of juicy treats and a lot of attention' for his efforts. Mamales, who shares custody of Derek, often brings the boy to the house he shares with his daughters - Tiffany and Samantha - at weekends. But on Friday night, the boy's mother tried to take him home after deciding Mamles was behaving 'erratically', police said. The suspect, described as'very toxic' by his daughter Samantha, is alleged to have a history of drug abuse and bipolar disorder. Rewarded: Max, who has been finding missing children in Utah for more than eight years, was later given 'a big handful of juicy treats and a lot of attention' for his efforts. Above, Mr Honsaker pats him on the head. Another daughter Lindsi Mamales told KSL.com: 'I know he loves us, he just gets off his rocker without his meds.' Mamales was arrested ye By Saturday evening, police were still in the process of booking him into the Tooele County Jail. Police said they are unsure of the charges Mamales may face as the investigation is still ongoing

Summary: Richard Mamales, 44, had argument with son Derek's mother on Friday. He then allegedly threatened to kill five-year-old, before kidnapping him. Police launched a search for 'endangered' child and issued amber alert. K9, named Max, and his trainer Alan Honsaker were dispatched to help. They tracked down pair to a shed near Mamales's home in Tooele, Utah. Mamles has now been arrested by police, but charges remain unknown.

cnn_dailymail

en

Write a title and summarize: Ascaris lumbricoides and Necator americanus are soil-transmitted parasites with global geographic distribution, and they represent some of the most common and neglected infections in the world. Periodic treatment with mass drug administration (MDA) in endemic areas is the recommended action put forth by the World Health Organization. However, MDA can cause the selection of subpopulations that possess the genetic ability to overcome the mechanism of drug action. In fact, beta-tubulin gene mutations (codons 167,198 and 200) are correlated with benzimidazole resistance in nematodes of veterinary importance. It is possible that these SNPs also have strong correlation with treatment resistance in the human geohelminths A. lumbricoides, Trichuris trichiura and hookworms. Here, we aimed to investigate the presence of some of these canonical molecular markers associated with parasite resistance to benzimidazole in N. americanus and A. lumbricoides collected from six Brazilian states. Nested-PCR and PCR-RFLP were used to detect mutations at codons 167 and 198 in 601 individual eggs of A. lumbricoides collected from 62 human stool samples; however, no mutations were found. Codons 198 and 200 were tested in 552 N. americanus eggs collected from 48 patients using the same methodology, which presented a relative frequency of 1. 4% and 1. 1%, respectively. The presence of these SNPs in N. americanus eggs is an important finding, indicating that with high benzimidazole drug pressure there is potential for benzimidazole resistance to be selected in this hookworm. However, at these low frequencies it does not indicate that there is at present any benzimidazole resistance problem. This is the first systematic study performed in South America, and the study yielded a landscape of the genetic variants in the beta-tubulin gene and anthelmintic resistance to soil-transmitted parasites detected by a simple, rapid and affordable genotyping assay of individual eggs. Soil-transmitted helminth infections represent important, neglected, tropical diseases that affect approximately one-fourth of the global population. Notably, 820 million people are infected with Ascaris lumbricoides, and 439 million people are infected with hookworms (Necator americanus or Ancylostoma duodenale) [1,2]. These parasites can cause abdominal pain, colic, diarrhea, nausea, vomiting and, in more severe cases, death of the host. Hookworm infection is the most common cause of iron deficiency anemia and protein-energy malnutrition in children living in developing countries [3]. The standard approach for geohelminth control, including hookworms and A. lumbricoides, is large-scale preventive chemotherapy predominantly using benzimidazoles through mass drug administration (MDA), based on the drug’s performance in overall reductions in prevalence and reductions in the extent and severity of infection [4]. Nevertheless, this inexpensive and highly effective strategy can potentially select subpopulations of parasites that become resistant to treatment. Single nucleotide polymorphisms (SNPs) in the beta-tubulin gene at codons 167 (TTC, TTT/Phenylalanine → TAC, TAT/Tyrosine), 198 (GAG, GAA/Glutamic acid → GCG, GCA/Alanine) and 200 (TTC/ Phenylalanine → TAC/Tyrosine) have been linked to benzimidazole resistance in several helminths [5–7]. SNPs at codons 198 [8] and 200 [9,10] have been reported in hookworms. These common resistance-associated polymorphisms are not frequently found in those populations that did not respond to treatment [9,11]. Conversely, a mutation at codon 167 was detected at high frequencies in A. lumbricoides samples [9], while mutations at codon 198 and 200 have never been described for this species. Brazil is a tropical developing country with high incidence of geohelminths infection. It is estimated that 10,448,507 pre-school-age and school-age children require preventive chemotherapy [12]. MDA has been performed by the government, according to the free attendance health policy guidelines [13]. Nonetheless, there is a lack of studies that have investigated the presence of molecular markers related to parasite resistance to the available drugs. Here, we evaluate the frequency of some of the canonical codons in N. americanus and A. lumbricoides that are involved in the process of benzimidazole resistance in specimens from six Brazilian states. To our knowledge, this is the first systematic study performed in South America that examines SNPs present in soil-transmitted helminth human infections associated with benzimidazoles resistance. This work is approved by the Comitê de Ética em Pesquisa—COEP (CAAE 61047216. 7. 0000. 5149) from Universidade Federal de Minas Gerais (UFMG). As we had used human feces obtained from commercial laboratories performing pathology analysis, an informed consent document was not required. We did not obtain any subject identification and the data were analyzed anonymously. Human coproparasitological collection and screening analysis was performed in six Brazilian states. Positive samples for A. lumbricoides and N. americanus were stored in 10% formaldehyde for later molecular analysis. The initial isolation of eggs was performed according to Ritchie (1948) with modifications [14]. In summary, 2 ml of stool suspension was homogenized, filtered through gauze and transferred to a 15ml tube. Five ml of sulfuric ether was added and to the suspension and then stirred vigorously, followed by 1 minute centrifugation at 14,000 x g. The supernatant was discarded. Eggs were washed with in a new step by adding 500 μl of 1. 0% and 5. 0% of hypochlorite for 10 minutes to the N. americanus and A. lumbricoides samples, respectively. The material was centrifuged at 14,000 x g, and the supernatant was discarded. The eggs were washed again using 500 μl of ultrapure water, followed by centrifugation at 14,000 x g. The supernatant was then discarded. The pellet was resuspended in 100 μl of ultrapure water for N. americanus. A. lumbricoides eggs processing included the additional steps of a) incubation at 30 °C in 500 μl of 0. 2 N sulphuric acid for 30 days (for larvae development), b) centrifugation at 14,000 x g and discard of the supernatant, c) washing (resuspension in 500 μl of ultrapure water, centrifugation at 14,000 x g and discard of the supernatant), d) incubation with 500 μl of 1. 0% hypochlorite up to the point at which the outerlimiting membrane dissolved using a microscope for visual confirmation, e) repetition of steps a-c followed by the addition of 100 μl of ultrapure water. For DNA extraction, the eggs from both N. americanus and A. lumbricoides were observed under an optical microscope, individually pipetted into a volume of 1 μl and transferred to a 500 μl microcentrifuge tube containing 10 μl of buffer, as described by Lake and colleagues [15] and modified by Diawara and colleagues [9]. In total, 864 A. lumbricoides eggs from 64 patients and 552 N. americanus eggs from 48 patients, collected in six Brazilian states, were analyzed. None of these samples came from polyparasited patients. Table 1 shows the collection sites, as well as the number of patients and eggs of A. lumbricoides and N. americanus collected from each state. All primers were designed using Primer3 (http: //bioinfo. ut. ee/primer3-0. 4. 0/) based on beta-tubulin nucleotide sequences for N. americanus (EF392851. 1) and A. lumbricoides (EU814697. 1) from GenBank and WormBase ParaSite (N. americanus: PRJNA72135, Assembly GCA_000507365. 1; A. lumbricoides: PRJEB4950, Assembly GCA_000951055. 1) (Table 2). Controls were constructed for the absence (wild-type) and presence of the mutation for each codon for each species. To construct a wild-type control allele for codons 198 and 200 (N198/200Na), PCR amplification was performed with the primers Fa198/200Na + Rab198/200Na (325 bp) and genomic DNA from N. americanus. The primers AltubF + AltubR (596 base pairs, bp) and DNA collected and pooled from A. lumbricoides eggs were used to construct the wild-type control allele for both codons 167 (N167Al) and 198 (N198Al). PCR amplifications for the wild-type controls were performed using GoTaq Green Master Mix (Promega, USA), with a final concentration of 0. 2 μM for each primer, according to the following program: 95°C for 5 min, 30 cycles at 95°C for 30 s, 60°C for 45 s, 72°C for 60 s and a final step of 72°C for 8 min. To construct the mutated controls for codons 167 (M167Al for A. lumbricoides), 198 (M198Na for N. americanus; M198Al for A. lumbricoides) and 200 (M200Na for N. americanus), site-directed mutagenesis was performed using the Megaprimer-PCR technique. First, for N. americanus the wild-type N198/200Na was used as a template for codons 198 and 200 with the primer combinations Fm198Na + Rab198/200Na (263 bp) and Fm200Na + Rab198/200Na (263 bp), respectively. For A. lumbricoides, the wild-type N167Al DNA template was used to perform the megaprimer-PCR for mutated codon 167 with the primers AlMega167R + AltubF (146 bp), while AlMega198F + AltubR was used to perform megaprimer for mutated control 198 (94 bp). The Fm198Na, Fm200Na, AlMega167R and AlMega198F primers were designed to introduce a mismatch that mimics the mutated sequence corresponding to each codon (Table 2). The site-directed mutagenesis was performed using Kapa HiFi polymerase (Kapa Biosystems, USA) following the manufacturer instructions, and a final concentration of 0. 2 μM for each primer, with cycling conditions of 95°C for 3 min, 30 cycles at 98°C for 20 s, 50°C for 45 s, 72°C for 45 s and a final step of 72°C for 8 min. The reaction products were subjected to electrophoresis on 1. 0% agarose gels (w/v) (Midsci, USA) stained with GelRed (Biotium, USA). The fragments were excised from the gel, purified (Illustra GFX PCR DNA and Gel Band Purification Kit, GE Healthcare, UK), and measured for concentration. Approximately 20 ng of the first reaction product was used as a megaprimer in combination with 1 μM final concentration of the primers Fa198/200Na for mutated M198Na and M200Na (respectively mutated codon 198 and 200,325 bp each) for N. americanus, 1 μM of primer AltubR and 1 μM of AltubF for M167Al and M198Al, respectively (596 pb each), using Kapa HiFi polymerase (Kapa Biosystems, USA) according to the manufacturer instructions with cycling conditions of 95°C for 3 min, 30 cycles at 98°C for 20 s, 60°C for 45 s, 72°C for 45 s and a final step of 72°C for 8 min. The fragments were subsequently cloned using the pGEM-T Easy Vector System (Promega, USA), transformed into XL1-blue cells (Phoneutria, Brazil) and recovered via miniprep (Wizard Plus Miniprep DNA Purification System, Promega, USA). The clones were sequenced, and the absence/presence of the mutations was successfully confirmed. In silico analysis of A. lumbricoides and N. americanus beta-tubulin nucleotide sequences retrieved from GenBank and WormBase ParaSite databases were performed using the NEBcutter V2. 0 tool (http: //www. labtools. us/nebcutter-v2-0/) in order to search for restriction sites that could be used to distinguish between the mutated and the wild type alleles (of 198 and 200 for N. americanus; and 167 and 198 for A. lumbricoides) so that a PCR-RFLP approach could be employed. The enzymes RsaI (Promega, USA) and BmsI (Thermo Fisher Scientific, USA) were chosen to differentiate between mutated and unmutated codons 167 and 198 of A. lumbricoides. Sites for enzymes Alw26I and HpyAV (Thermo Fisher Scientific, USA) were present in the N. americanus sequence and therefore used to distinguish between mutated and unmutated alleles for the codons 198 and 200 of N. americanus, respectively. A suitable enzyme that could differentiate between mutated and unmutated codon 200 of A. lumbricoides was not found. This same situation was observed for codon 167 of N. americanus. For N. americanus, an initial PCR was performed using one primer pair to amplify the codons 198 and 200 (Fa198/200Na + Rab198/200Na; 325 bp) using GoTaq Green Master Mix (Promega, USA), with 0. 2 μM of each primer and 4. 2 μl of the buffer containing the DNA of a single egg. The cycling conditions followed the same parameters as described for the wild-type control synthesis. A semi-nested PCR was performed using 1 μl from the first PCR reaction employing primers Fb198/200Na + Rab198/200Na (315 pb), using the same PCR conditions as described above. One μl of the products from the second reaction was digested at 37°C for 1 hour with 1 unit of enzyme (Alw26I and HpyAV for the codons 198 and 200) in a total volume of 15 μl. The products were subjected to electrophoresis in a 6. 0% polyacrylamide gel (w/v) stained with GelRed (Biotium, USA). For A. lumbricoides, an initial PCR was performed using one primer pair to amplify the codons 167 and 198 (AltubF + AltuR; 596 bp). One μl of the PCR product was used as a template for a nested PCR with Al167F + Al98R (608 pb). The second reaction showed a larger amplicon because the primers had M13 adapters (Table 2). The PCRs and digestions performed for A. lumbricoides were performed at the same volumes and conditions as used for N. americanus, except for the enzymes used. The enzymes RsaI and BmsI were used for digestion of codons 167 and 198, respectively. The products were subjected to electrophoresis in a 1. 5% agarose gel (w/v) stained with GelRed (Biotium, USA). The expected fragment sizes after the digestion of each genotype of each codon are listed in Table 3. Samples with positive PCR-RFLP mutations were sequenced for confirmation. A negative control sample was included in all amplification runs. Extreme care was taken to avoid contamination with another sample and/or with the control plasmids. Tubes containing the control plasmids were handled in a different room where the DNA samples were manipulated, and filter tips were used in all procedures. Fig 1 shows the methodological scheme adopted for the analysis of all the SNPs in this work. We analyzed a total of 1153 geohelminths individual DNA samples from eggs belonging to 110 independent human feces samples collected from six Brazilian states. No mutations were detected in all 601 A. lumbricoides eggs analyzed for codons 167 and 198 of beta-tubulin gene. Mutation at codon 198 of N. americanus was observed in three localities: 1) Ceará, with 3. 0% positivity (3/100): one homozygous and two heterozygous eggs from the same patient; 2) Minas Gerais, with 3. 75% positivity (3/80): one patient had one heterozygous and one homozygous egg (nine eggs evaluated), and another patient had one heterozygous egg (18 eggs analyzed); and 3) Bahia, with 2. 0% positivity (2/101): one patient with one homozygous and one heterozygous egg (20 eggs analyzed). Considering all the regions analyzed, 1. 4% (8/552) of the eggs examined were found to have the mutation at codon 198. The tests performed examining codon 200 of N. americanus showed the presence of the mutation in two states. In Maranhão there was 3. 6% (4/111) positivity: one homozygous egg from one patient who had 12 eggs evaluated; another homozygous egg from one patient who had 11 eggs evaluated, and two homozygous eggs from one patient with 10 genotyped eggs. In Bahia there was 2% (2/101) positivity: two heterozygous eggs, one of which was also heterozygous at codon 198, from a patient with 20 eggs evaluated. Therefore, the percentage of examined eggs positive for the mutation at codon 200 was 1. 1% (6/552). It is noteworthy that beta-tubulin gene from an egg (from a Bahia patient) was heterozygous for codon 198 and codon 200. S1 Fig shows a representative image of polyacrylamide gel of the PCR-RFLP for N. americanus. S2 Fig shows a representative image of agarose gel of the PCR-RFLP for A. lumbricoides. Fig 2 illustrates the genotypes found for codons 198 and 200 in 552 N. americanus egg samples collected from six Brazilian states. Treatment with benzimidazoles is the foremost approach for soil-transmitted helminth control; however, the indiscriminate use of these drugs in a target population selects naturally resistant parasites capable of surviving exposure to the drug and can produce resistant offspring [4,16,17]. This selective pressure has been associated with the occurrence of SNPs in codons 167,198 and 200 of the beta-tubulin gene of several helminths [5,18]. We evaluated the frequency of some of these canonical SNPs in A. lumbricoides and N. americanus collected from six Brazilian states by PCR- RFLP technique. Mutations related to resistance to benzimidazoles have been detected by diverse techniques for helminths [10,19] and fungi [20]. In the present work, a PCR- RFLP molecular screening test was performed to detect mutations in the beta-tubulin gene of A. lumbricoides and N. americanus, and controls were synthesized for absence and presence of each SNP analyzed in both species. The PCR- RFLP technique requires the creation or disruption of a restriction endonuclease’s cleavage site by the mutation. In some cases, however, commercially endonucleases are not capable to detect the nucleotide change, as observed for the codons 167 of N. americanus and 200 of A. lumbricoides. A wide range of molecular techniques may be employed for the analysis of these SNPs. Methodologies based on qPCR and sequencing have been described for analysis of SNPs in the beta-tubulin gene [19,21]. Rashwan and colleagues [8] developed a genotyping assay of SNPs on the N. americanus beta-tubulin gene using the SmartAmp2 method. We therefore aim to overcome this limitation by analyzing these SNPs using ARMS-PCR or tetraprimer ARMS-PCR, as performed by our group for A. caninum [10,22,23]. None of the individual DNA samples of A. lumbricoides presented mutation at codon 167. This mutation was initially described in Haemonchus contortus and later reported in Teladorsagia circumcincta, cyathostomes, Haemonchus placei and Trichuris trichiuria [24]. Notably, a mutation at codon 167 with a distinct elevated frequency was detected in A. lumbricoides collected from different endemic areas [9]. This finding was not replicated for codon 167 [25] or for any of the three canonical codons in an expanded drug-resistant sampling in Africa [26]. Schwenkenbecher and colleagues [19] detected a very-low-frequency mutation at codon 167 and 200 in hookworms collected from children who received treatment periodically, suggesting that these data may be associated with possible qPCR experimental error. Ishii and colleagues [27] detected a high frequency (61. 2%) of this mutation in cyathostomines from Paraná, Brazil. Contrary to the results for most species, polymorphisms at codon 167 were more frequent than mutations at codon 200 in cyathostomes [28]. Analysis of 110 feces samples from patients from Sri Lanka infected with N. americanus also showed positive results for the mutation at codon 198, but the frequency per helminth was not detected due to the approach of pooling larvae samples instead of searching for SNPs individually [8]. A. caninum adults and eggs collected from dogs in the United States showed no mutation at codon 198 [29]; similarly, no mutation was observed in a large number of A. caninum (327 adult worms) obtained from two different states in Brazil [10]. A lack of investigation at codon 198 of the beta-tubulin gene may lead to an underestimation of the reported frequencies. Therefore, it is likely that this mutation has not been extensively described in human hookworms because of the scarcity of available data, rather than being absent in these worms. The mutation at codon 200 in N. americanus presented a relative frequency of 1. 1% in the Brazilian samples. A frequency of 2. 3% of individual eggs analyzed in this species was detected in patients from Kenya; but not detected in samples from Haiti, Panama [9] and Sri Lanka [8]. The highest frequency of this SNP was reported in 36% N. americanus samples from Haiti where patients had been submitted to MDA [30]. N. americanus Brazilian population showed homozygous and heterozygous alleles for codons 198 and 200. Curiously, one egg showed mutation in both codons demonstrating compound heterozygosity. None of the samples evaluated in this study exhibited concurrently homozygous mutations at both codons, as observed for other helminths. [31,32]. Eighty nine eggs of N. americanus and 163 eggs of A. lumbricoides did not result in PCR amplifications (results not counted in the sampling number). Three hypotheses might may have accounted for the amplification failure: 1) another mutation (not related to resistance) at the primer’s sequence preventing its annealing and further amplification; 2) sample loss during egg transfer into the lysis buffer; and 3) damage of samples conserved with formaldehyde. The third hypothesis appears to be more likely, since the degradation of DNA in the presence of this preservative has been reported [33,34]. The medical records of the patients used in the present study were not available, which was a limitation in our analysis. Information regarding the presence of anthelmintic treatment and the drug periodicity would potentially clarify the correlation between SNPs in beta-tubulin gene and benzimidazole resistance in those humans. The absence and low frequency of the selected mutations herein raises the hypothesis that the studied populations did not undergo a mass treatment, or if they did, the periodicity of the chemoprophylaxis was not enough to confer high levels of mutated alleles. The PCR-RFLP approach, largely used in multi-organism DNA genotyping for decades, has proved to be an affordable, easy and high-throughput screening assay to detect mutations in a substantial number of individual helminths eggs. A. lumbricoides individual samples showed no mutations at the tested beta-tubulin codons 167 and 198. Low frequencies of mutations at codons 198 and 200 of N. americanus individual eggs were observed. In a scenario of highly indiscriminate use of albendazoles, the establishment of drug resistance in N. americanus populations might likely arise. We suggest the inclusion of a comprehensive number of samples encompassing additional geographical regions, to investigate the genetic landscape of those mutations in populations subjected to MDA. The understanding of the genetic components in the dynamics of drug resistance is essential: early monitoring increases the likelihood of delaying the establishment of resistant parasites in the populations.

Title: PCR-RFLP screening of polymorphisms associated with benzimidazole resistance in Necator americanus and Ascaris lumbricoides from different geographical regions in Brazil Summary: The soil-transmitted helminths Ascaris lumbricoides and the hookworms (Necator americanus and Ancylostoma duodenale) are the most prevalent intestinal helminths of humans. The standard approach for geohelminth control is large-scale preventive chemotherapy predominantly using benzimidazoles through mass drug administration. Nevertheless, this inexpensive and highly effective strategy can potentially select subpopulations of parasites that become resistant to treatment. In veterinary parasites, intensive reliance on the same anthelmintics has led to the emergence of benzimidazole resistance, but this is not yet proven to helminth parasites of humans. Here we describe a PCR-RFLP approach for single nucleotide polymorphisms (SNPs) detection at codons 167 and 198 in the beta-tubulin gene of A. lumbricoides, and SNPs at codons 198 and 200 in the beta-tubulin gene of N. americanus of Brazilian populations. A. lumbricoides samples showed no mutations in any codons, and mutation at codons 198 and 200 were observed at low frequencies in N. americanus. The observed data posit important public health issues: the mutations are a substrate for selective pressure and a long-term mass drug administration could allow to the selection of parasites resistant to benzimidazole in Brazil.

lay_plos

en

Summarize: Greeneville, Tenn. - UPDATE: More Content Greeneville Police Detective Captain Tim Davis said all three kids are alert and talking. One person who said he watched it unfold said it started out with seemingly innocent horseplay. Dakota Ragan was standing nearby when the Ferris Wheel caught his eye. "I saw the kids, they were just rocking the thing, which I didn't think was such a big deal, most people rock it anyway," Ragan said. "But they were rocking it hard." That's when the unthinkable happened, he said the the basket the three kids were rocking hit another basket and got stuck upside-down. "They hit and I guess the force just brought them back and they went right over," he said, describing the three fall to the ground. Captain Davis said investigators can't say for sure yet what happened. "We're considering that and treating it like a crime scene at this point until we can determine whether there was any malfunction, make sure there was no foul play, that it was just an accident," said Davis. All of the rides were closed after the incident. A third party inspector must check each one for safety. Until then, all of the rides must remain closed. Fairground officials are expected to release more information Tuesday morning during a press conference. ---------------------------------------------------------- Greeneville Police Detective Captain Tim Davis told News 5 three kids fell 30 to 45 feet from a Ferris Wheel at the Greene County Fair. Authorities have yet to release their names and conditions, but we do know the oldest is 16 years old. Two children were flown to the Johnson City Medical Center. The other was transported by ambulance. Details are limited, but crews are on the scene now. It happened just after 6:30 p.m. on Monday. All rides at the fair we remain closed until after a third party inspection. We have a crew there, and will update you with more information as it comes in. A 6-year-old girl suffered a traumatic brain injury after falling 35 to 45 feet to the ground in a Ferris wheel accident Monday night, officials said today. The Ferris wheel's cabin tipped over around 6:15 p.m. at the Greene County Fair in Tennessee, sending the 6-year-old, her 10-year-old sister and a 16-year-old girl to the ground. The 10-year-old is in stable condition with forearm injuries, according to the Johnson City Medical Center and Niswonger Children's Hospital. The teenager was initially listed in critical condition but is now considered stable, the officials said today. A preliminary report shows mechanical failure as the cause of the accident, officials said today, adding that they are still waiting on the complete reports. No seatbelts are on this ferris wheel, an inspector said. The inspector added that no serious problems were found with any ride today. ABC News Authorities said today that inspections could take a few days. Fairground officials said today they do not know when the ride was last inspected. "We would like to extend our thoughts and prayers for those injured tonight at the fair. We are deeply shocked and saddened," the Greene County Fair said in a statement. "All rides have been shut down until further notice." The fair, which began Aug. 7, runs through Aug. 13. ABC News' Steve Osunsami, Brandon Baur and Rachel Katz contributed to this report. Members of the Greeneville Fire Department help people off the ferris wheel at the Greene County Fair in Greeneville, Tenn., Monday, Aug. 8, 2016. A few people who fell 30 to 45 feet from a Ferris wheel in Tennessee were responsive and answering questions Monday night, police said. (O.J. Early/The Greeneville Sun via AP) SHARE Emergency crews unload the ferris wheel at the Greene County Fair in Greeneville, Tenn., Monday, Aug. 8, 2016. A few people who fell 30 to 45 feet from a Ferris wheel in Tennessee were responsive and answering questions Monday night, police said. (Dale Long/The Greeneville Sun via AP) By News Sentinel Staff Three girls were injured after they fell from a Ferris wheel at the Greene County Fair on Monday evening. Around 6:15 p.m., one of the Ferris wheel's baskets overturned and dumped the three children out, Greeneville police captain Tim Davis said. The children fell 35 to 45 feet, Davis said. Two of the children were transported by helicopter, and the third, via ambulance, to the Johnson City Medical Center, Davis said. All three children were awake, alert and coherently answering questions at the hospital on Monday night. The oldest of the three children is 16. The mechanical rides at Greene County Fair have been shut down and will remain closed until an inspection conducted by a third-party confirms the rides are safe, Davis said. The food vendors and smaller games will be allowed to stay open. The president of the Greene County Fair board will release a statement Tuesday morning on the accident, which remains under investigation. More details as they develop online and in Tuesday's News Sentinel.

Summary: Reports are conflicting as to what caused a Ferris wheel car to overturn at eastern Tennessee's Greene County Fair on Monday night: ABC News reports police aren't sure why the basket flipped, dumping the three girls riding in it onto the ground. An accident report filed by Family Attractions Amusement states the car caught on a bar, causing it to upend, which conflicts with an initial witness statement that suggested the car was being rocked. Whatever the cause, the Knoxville News Sentinel reports the trio fell 35 to 45 feet and survived, though WBIR reports one of the girls, a 6-year-old, suffered a traumatic brain injury and is intubated. At a Tuesday press conference, Greeneville Police Detective Capt. Tim Davis offered an apology for initial police reports that said all three girls were "responsive," reports the Greeneville Sun. The young girl's 10-year-old sister is in stable condition, having injured her arm. Doctors expect to downgrade the oldest to fall, a 16-year-old, from critical to stable condition. The Sun reports the Ferris wheel was last inspected June 21. All mechanical rides at the fair are currently shut down pending an inspection.

multi_news

en

Summarize: Posted: 5:29 pm PDT August 18, 2011 The Bad Hair Bandit won't be getting out of jail anytime soon, after a California judge increased her bond Thursday to $500,000. Detectives on this case asked for the judge to increase her bond from $50,000 to $500,000 because they don't want Cynthia Van Holland going anywhere. The FBI believes Van Holland is responsible for 20 bank robberies since last December. She was arrested Monday in northern California after allegedly robbing a bank. Her husband, 26-year-old Christopher Alonzo was also arrested. The FBI says Alonza was Van Holland's getaway driver. Alonzo has no bail because he's being held on a warrant out of Idaho. The couple is now charged with robbery and conspiracy, but it's likely they will face a laundry list of federal charges for bank robberies in Washington, Oregon and Montana. The FBI says her signature wigs quickly dubbed her the Bad Hair Bandit and made Van Holland one of America's Most Wanted. KXLY.com. All rights reserved. This material may not be published, broadcast, rewritten or redistributed without prior permission. © 2011. All rights reserved. This material may not be published, broadcast, rewritten or redistributed without prior permission. Van Holland worked as a contract nurse at the Kootenai County Jail for several months this past spring. Like their male counterparts, women who rob banks are often driven by a drug or gambling addiction, Mr. Bryant said, but unlike men, they prefer nonviolent methods. “We see a lot fewer instances in which the female bank robber will display a weapon,” he said. “Women are more likely to do what we call a note job or to just make an oral demand to the teller.” Photo The suspect in the robbery— who was first spotted on a surveillance tape at a US Bank in Tacoma, Wash., on Dec. 22, her blond hair pulled up into a black baseball cap — would stand in the bank line and then hand the teller a note saying that she was armed and demanding money. She is suspected of having robbed at least 17 banks during the next seven months, popping up in towns all along the Puget Sound — including Tumwater, Spanaway, Bellevue and Moses Lake — wearing a series of raggedy black, blond, red and brown wigs. In July, the suspect robbed a Key Bank in Oregon. By mid-August, she went east to Montana, hitting the Bank of Butte a few days before the last robbery in California. Ms. Van Holland, if she is indeed the robber, appears to have avoided Idaho, where she lived and worked as a licensed nurse for Correctional Healthcare Companies, a contractor for the Idaho Department of Correction, from April 27 to Aug. 10, according to Larry Wolk, a spokesman for Correctional Healthcare. Lt. Stu Miller, of the Kootenai County Jail in Idaho, said Ms. Van Holland dispensed medication and provided minor medical treatment at the jail during that time. Photo “It’s unsettling that somebody would be robbing banks and also working for a facility that’s housing inmates,” Lieutenant Miller said. Advertisement Continue reading the main story It may have been her prison work that brought Ms. Van Holland, who lists “cuddling” as an activity she likes on her Facebook page, into contact with Christopher Alonzo. The couple married in Coeur d’Alene in March. Mr. Alonzo was wanted for a parole violation in Idaho when he was arrested. He had served time in prison for fraud involving credit card forgery and for escaping from a work release program in January 2008. He was released on parole in October 2010. On Monday, stepping into line at the Bank of the West, she had apparently decided to leave her wigs behind, appearing in a white shirt with her blond hair down and topped with a brown canvas cap. “If she’d known it was her last one, maybe she would have dressed better,” Ms. Erwin said.

Summary: Once she was a jailhouse nurse; now she's known simply as the "Bad Hair Bandit." Alongside her husband, Cynthia Van Holland is being held for allegedly robbing 20 banks while wearing chintzy wigs. After she was caught this week in northern California, authorities want to make sure she sticks around-so they've raised her bail from $50,000 to $500,000, KXLY.com reports. Her husband, Christopher Alonzo, who at 26 is more than two decades her junior, was reportedly her getaway driver. The two were arrested after a witness spotted her running to her car following a theft, the New York Times reports. The car also contained a cat with "a litter box, toys and all the things a cat would need," police said. The couple is likely to face a raft of federal charges over heists in Washington, Oregon, and Montana; the cat has not been charged.

multi_news

en

Summarize: UKIP is on course to crush the Conservatives in the Rochester and Strood by-election, according to a new poll last night. The Survation poll for the Unite trade union gave Ukip candidate Mark Reckless a 15-point lead over his former party. The lead has widened by six points since an identical poll last month, and suggests that a huge Tory effort to hold the seat is failing to gain traction. Former Conservative MP Mark Reckless is on course to win the Rochester and Strood by-election. The poll puts support for Ukip on 48 per cent, with the Conservatives on 33, Labour, who came second in 2010, on 16 per cent, the Greens on two percent and the Lib Dems on just one per cent. Ukip’s vote has risen by eight points since last month, while the Tories and Lib Dems have both fallen by two points and Labour’s support has slumped by nine. The development is a serious setback to David Cameron, who has pledged to ‘throw the kitchen sink’ at the attempt to hold the seat, in a bid to halt the Ukip surge. It comes amid warnings that the Prime Minister could face a leadership challenge if the Conservatives fail to win. Former leadership contender David Davis was yesterday reported to be taking soundings about a possible plot to depose Mr Cameron if the seat is lost. Mr Davis, who could not be contacted for comment yesterday, is said to have told fellow MPs that there is a ‘window’ of opportunity to organise a vote of no confidence in Mr Cameron between the 20 November by-election and Christmas, if rebels act quickly. Mr Cameron yesterday tried to steady the ship by summoning his MPs to an away day in Oxfordshire to discuss how to get back on the front foot. MPs were told that George Osborne plans to use next month’s Autumn Statement to ram home the Tories successful record on the NHS. It comes amid warnings the Prime Minister could face a leadership challenge if the Conservatives fail to win. And Tory strategist Lynton Crosby told MPs that the party could still win next year because of Ed Miliband’s unpopularity. But one MP who stayed away, warned that the Tory leadership was underestimating the threat posed by the current situation. ‘I didn’t go, because I thought I was better off putting in a day’s campaigning. The message is always the same – Labour are so hopeless that we are going to somehow pull things out of the fire. It’s just like 1996.’ The Prime Minister was rocked earlier last month by the Clacton by-election, where Tory defector Douglas Carswell crushed his former party to become Ukip’s first elected MP. A second defeat by Ukip would be a body blow to Mr Cameron just six months out from the General Election. Ukip leader Nigel Farage is predicting that more MPs will defect to the anti-EU party if Mr Reckless wins, sparking further debilitating by-elections. Mr Reckless enraged the Tory leadership when he defected to Ukip on the eve of the Conservative Party conference. Senior Tories were initially confident they could hold the seat, and Tory MPs were ordered to campaign in the Kent constituency at least five times. At the 2010 election Mr Reckless took Rochester and Strood for the Conservatives with a majority of almost 10,000 over Labour. Ukip did not stand in the seat last time. Tory sources acknowledge they have flooded the constituency with leaflets since Mr Reckless quit. This has included a personal letter from Mr Cameron to every home in the constituency inviting voters to take part in an ‘open primary’ election to select Tory candidate Kelly Tolhurst. But Ukip has also piled huge resources into the fight and appears to be picking up votes from across the political spectrum

Summary: UKIP on course to defeat the Conservatives in by-election on November 20. Candidate Mark Reckless has a 15-point lead over his former party. UKIP's vote has increased by eight points since last month. Despite Prime Minister David Cameron pledging to 'throw the kitchen sink' at the attempt to hold the seat. Warnings that Mr Cameron could face a leadership challenge if the Conservatives fail to win the seat.

cnn_dailymail

en

Write a title and summarize: The inhibitor of apoptosis protein (IAP) family has been implicated in immune regulation, but the mechanisms by which IAP proteins contribute to immunity are incompletely understood. We show here that X-linked IAP (XIAP) is required for innate immune control of Listeria monocytogenes infection. Mice deficient in XIAP had a higher bacterial burden 48 h after infection than wild-type littermates, and exhibited substantially decreased survival. XIAP enhanced NF-κB activation upon L. monocytogenes infection of activated macrophages, and prolonged phosphorylation of Jun N-terminal kinase (JNK) specifically in response to cytosolic bacteria. Additionally, XIAP promoted maximal production of pro-inflammatory cytokines upon bacterial infection in vitro or in vivo, or in response to combined treatment with NOD2 and TLR2 ligands. Together, our data suggest that XIAP regulates innate immune responses to L. monocytogenes infection by potentiating synergy between Toll-like receptors (TLRs) and Nod-like receptors (NLRs) through activation of JNK- and NF-κB–dependent signaling. The inhibitor of apoptosis (IAP) family of proteins plays a key role in cellular signaling, such as apoptosis, by binding to pro-apoptotic proteins, interrupting the intrinsic programmed cell death pathway and activating anti-apoptotic mechanisms [1]–[3]. In addition to modulating apoptosis, recent genetic studies have revealed that a Drosophila IAP protein, diap2, acts as a regulator of anti-microbial immunity [4]–[7]. Innate immune signaling pathways are well conserved from Drosophila to humans, suggesting that IAP proteins may also play a role in mammalian innate immunity [8]. This hypothesis is consistent with a study demonstrating that cIAP2 exacerbates endotoxic shock in mice by controlling macrophage apoptosis [9]. Furthermore, a cohort of patients with X-linked lymphoproliferative syndrome (XLP) were found to have mutations in the gene encoding XIAP, resulting in a primary immunodeficiency [10]. XIAP, also known as BIRC4 and hILP, contains three baculoviral IAP repeat (BIR) domains, the characteristic protein-protein interaction domain of the IAP family [11]. XIAP also has a carboxy-terminal RING domain with E3 ubiquitin ligase activity that directs proteasomal degradation of target proteins [12]. Multiple signaling pathways can be modulated by XIAP, including NF-κB, MAP kinase and TGFβ signaling [13]–[16]. Moreover, XIAP can integrate cellular responses to diverse stimuli by interacting directly with ligands such as copper to regulate copper homeostasis [17]. XIAP has been predominantly characterized as an inhibitor of apoptosis, and interacts with many known mediators of programmed cell death, such as JNK, TAK1, TAB1, TRAF6, and caspases-3, -7, and -9 [3], [13], [18], [19]. However, XIAP-deficient mice do not appear to have striking defects in apoptosis, thus the role of XIAP in vivo is not yet clearly understood [20]. The innate immune response protects host organisms against invading pathogens prior to the onset of adaptive immunity. Pathogens stimulate innate immune signaling through pattern recognition receptors (PRR), which recognize well-conserved pathogen-associated molecular patterns (PAMPs) [21]. PAMPs are detected at the host membrane by TLRs, and in the cytosol by the NLR and the RIG-I-like helicase (RLH) sensors [22], [23]. Stimulation of either extracellular or intracellular PRR can result in activation of NF-κB and MAP kinase signaling pathways, leading to production of inflammatory mediators such as cytokines and costimulatory molecules [24]. Activation of TLRs and NLRs together can induce synergy between the signaling pathways, resulting in enhanced activation of innate and adaptive immunity [25], [26]. Listeria monocytogenes is a cytosolic bacterial pathogen used extensively to probe aspects of innate and adaptive immunity [27]. L. monocytogenes is recognized by TLRs expressed on the surface of phagocytes [27]. After phagocytic uptake, L. monocytogenes escapes from host vacuoles by secreting a pore-forming toxin, listeriolysin O (LLO) [28]. Once in the cytosol, L. monocytogenes can trigger oligomerization and signaling by NOD1 and other NLRs [29]. Here we show that XIAP plays a protective role during infection by L. monocytogenes. We present evidence that amplifying JNK activation and subsequent pro-inflammatory cytokine production in response to cytosolic bacteria is one mechanism by which XIAP modulates innate immunity. We first tested the hypothesis that XIAP contributed to anti-microbial immunity by infecting xiap+/y and xiap−/y mice with 1×105 L. monocytogenes and determining survival over time (Figure 1A). At 7 dpi (days post infection), 60% of the XIAP-deficient mice had succumbed to infection, whereas all wild-type mice survived. Similarly, at higher doses of L. monocytogenes more xiap−/y than xiap+/y mice succumbed to infection, although some xiap+/y mice also became moribund (unpublished data). Depending upon the inoculum, morbidity and mortality of xiap−/y animals occurred between 2 and 5 dpi, prior to peak development of adaptive immunity, suggesting that XIAP had a protective effect during the innate response to bacterial infection. To better define the role of XIAP during innate immunity to intracellular bacterial infection, we infected wild-type and XIAP-deficient mice intraperitoneally with 5×105 L. monocytogenes, and harvested spleen and liver to enumerate bacterial burden at 24,28 and 72 hpi (Figure 1B). By 48 h, xiap−/y mice had approximately 10-fold more L. monocytogenes in liver and spleen at 48 hpi compared to the xiap+/y mice, consistent with our observation of their decreased survival. At 72 hpi, the difference between the xiap+/y mice and the xiap−/y was even more pronounced, with the xiap−/y mice supporting 100-fold greater bacterial numbers. These results indicate that XIAP mediates innate resistance to L. monocytogenes infection. Mutations in XIAP have been associated with the human immunodeficiency syndrome, XLP [10]. One feature associated with this disease is an abnormally low number of natural killer T-cells (NKTCs), although it is not yet clear how much this phenotype contributes to immunodeficiency. To determine if mice lacking XIAP exhibit a similar phenotype to XLP patients, we quantitated the percentage of NKTCs in the spleen of xiap+/y and xiap−/y mice (Figure 1C). No significant difference in the number of splenic NKTCs was observed between xiap+/y and xiap−/y mice, indicating that survival of NKTCs in uninfected mice is not affected by a deficiency in XIAP, consistent with a previous report [10]. To determine if NKTC survival or activation was dependent on XIAP during L. monocytogenes infection, we infected animals and determined the number of splenic NK1. 1+CD3+ NKTCs that expressed CD69, a marker of activation (Figure 1D). We observed similar numbers of activated NKTCs in xiap+/y and xiap−/y mice. These data suggest that XIAP does not play an important role in NKTC survival or activation in a murine model of listeriosis. We then tested the role of XIAP during infection of primary macrophages, an innate immune effector cell and a well-characterized host for L. monocytogenes replication. We infected unactivated bone marrow derived macrophages (BMDMs), BMDMs activated with LPS and IFNγ or peritoneal macrophages with L. monocytogenes and measured intracellular bacterial growth over time (Figure 2). All types of xiap+/y and xiap−/y macrophages controlled L. monocytogenes infection equally well. We conclude from these data that XIAP does not contribute directly to restriction of L. monocytogenes growth in macrophages, even though XIAP-deficient mice exhibited an increased bacterial burden compared to wild-type mice. Taken together, our results demonstrate that XIAP is required for a protective immune response to L. monocytogenes infection in vivo. XIAP can activate NF-κB–dependent transcription in response to apoptotic stimuli [14]. In addition to regulating apoptosis, the canonical NF-κB p50/p65 heterodimer has a well-established role in proinflammatory cytokine transcription stimulated by TLR and NLR signaling [21]. Expression profiling of unactivated macrophages infected with L. monocytogenes did not reveal reproducible differences between wild-type and XIAP-deficient macrophages (unpublished data). We then reasoned that activated macrophages might be a more relevant environment for studying XIAP function. We therefore investigated whether XIAP regulated NFκB-dependent processes during L. monocytogenes infection in activated macrophages by measuring translocation of p50 to the nuclear compartment. Activated BMDM were infected with wild-type L. monocytogenes, and translocation of the p50 subunit of NF-κB was analyzed by immunoblot (Figure 3A). As early as 0. 5 hpi, p50 was detected in the nuclear fraction of both xiap+/y and xiap−/y cells; however, in the presence of XIAP there was substantially more p50 in the nuclear fraction over time. We also measured DNA binding activity of the p65 subunit of the p50/p65 heterodimer in the nuclear fraction of uninfected and L. monocytogenes infected activated macrophages (Figure 3B). At 1 and 2 hpi, infected xiap+/y macrophage nuclear lysates contained significantly more NF-κB DNA binding activity than infected xiap−/y nuclear lysates, suggesting that XIAP might enhance signaling of NF-κB–dependent pathways stimulated by bacterial infection. In some contexts, XIAP-dependent NF-κB activation can protect against apoptotic stimuli; therefore we tested if XIAP modulated apoptosis during L. monocytogenes infection. We first examined apoptosis in activated macrophages during L. monocytogenes infection by flow cytometry of infected cells using Annexin V (AnnV), an indicator of apoptosis (Figure 3C). A modest but reproducible increase in apoptosis was observed by 3 hpi in XIAP-deficient macrophages compared to wild-type macrophages, which remained consistent throughout infection (Figure S1A). We also examined apoptosis in infected liver and spleen at sites of L. monocytogenes replication 48 hpi by performing TUNEL staining (Figure 3D). Although the extent of apoptosis at foci of infection were heterogeneous, there did not appear to be any notable difference in the number or distribution of apoptotic cells per focus in xiap+/y compared to xiap−/y livers or spleens. We did not observe any XIAP-dependent difference in the numbers of AnnV+ T or B cells present in the spleens of mice at 48 hpi (Figure S1B). In addition, caspase-3 cleavage in infected activated macrophages was not significantly altered (unpublished data). While the infected xiap−/y macrophages exhibited a modest increase in cell death, we found no striking evidence for regulation of apoptosis by XIAP in the context of L. monocytogenes infection in vivo. Thus, XIAP regulates NF-κB activation during L. monocytogenes infection, but may enhance innate immunity by modulating cellular responses other than apoptosis in infected macrophages. In addition to NF-κB activation, TLR and NLR sensing of microbial infection stimulate MAP kinase phosphorylation, leading to activation [30]. Previous reports suggested that XIAP can promote JNK phosphorylation via interaction with TAB1 and the MAP3K, TAK1 [14], [16], [31]. To determine if XIAP affected JNK phosphorylation during L. monocytogenes infection, we performed immunoblot analysis of infected lysates from xiap+/y and xiap−/y activated macrophages using a phospho-JNK specific antibody (Figures 4A and S2A). Upon infection with wild-type L. monocytogenes, JNK phosphorylation occurred as early as 0. 5 hpi in both xiap+/y and xiap−/y cells. In the xiap−/y macrophages, JNK phosphorylation peaked at 0. 5 hpi. However, in the presence of XIAP, enhanced JNK activation was prolonged up to 6 h. This suggests that XIAP augments JNK signaling during wild-type L. monocytogenes infection. To determine the contribution of XIAP to cytosol-specific signaling, we compared wild-type L. monocytogenes infection with a strain deficient in LLO or heat-killed L. monocytogenes (HKLM), which both remain trapped in the vacuole. The LLO− bacteria and HKLM induced JNK phosphorylation at 0. 5 hpi similarly to infection by wild-type bacteria, suggesting that this early JNK phosphorylation was linked to signaling from the vacuole, most likely through TLRs. However, JNK phosphorylation in response to vacuolar bacteria quickly diminished after 30 min, in contrast to the extended XIAP-dependent JNK activation observed during wild-type bacterial infection. To confirm that enhanced JNK phosphorylation in xiap+/y activated macrophages resulted in downstream signaling, we examined phosphorylation of c-jun, a target of JNK, by immunoblot (Figures 4B and S2B) [32]. Upon infection by wild-type L. monocytogenes, c-jun phosphorylation was prolonged in xiap+/y but not xiap−/y cells, similarly to JNK phosphorylation. Moreover, activation of c-jun upon infection by LLO− bacteria was considerably decreased compared to wild-type bacteria. To determine if XIAP also stimulated activation of other MAP kinase family members, we analyzed phosphorylation of p38 and ERK by immunoblot of infected macrophage lysates (Figures 4C, 4D, S2C, and S2D). ERK1 and ERK2 were phosphorylated equivalently in xiap+/y and xiap−/y macrophages in response to infection by all L. monocytogenes strains. As previously shown, p38 phosphorylation was decreased during infection by vacuole-restricted bacteria compared to wild-type bacteria [33]. Phosphorylation of p38 upon infection with wild-type L. monocytogenes was not significantly affected by XIAP. These data demonstrate that XIAP prolongs JNK activation specifically in response to cytosolic L. monocytogenes. Since XIAP modulated JNK and NF-κB signaling in the context of infection, we hypothesized that induction of proinflammatory cytokines through these pathways would also depend on XIAP. Activated macrophages were infected with L. monocytogenes for 3 h, and RNA was analyzed by qRT-PCR to determine the expression of a subset of genes involved in innate immunity (Figures 5A and S3). Transcription of il6, tnf, il10, mip2, and kc was strongly upregulated upon infection in the presence of XIAP, while induction of ifnb, il1b, ido, and inos was not significantly altered. To assess if XIAP-dependent gene expression correlated to increased protein production, we compared the secretion of IL-6 and TNF from uninfected and infected activated macrophages (Figure 5B and 5C). Upon infection by wild-type L. monocytogenes, IL-6 and TNF secretion was induced to a greater extent in xiap+/y macrophages than in xiap−/y macrophages, while infection with the LLO− mutant induced little IL-6 and TNF secretion by either genotype. To determine if JNK activation was required for induction of IL-6 gene expression and secretion in response to wild-type L. monocytogenes infection, we treated activated macrophages with the JNK inhibitor SP600125 (Figure 5D). IL-6 secretion by infected macrophages was markedly diminished by JNK inhibition, indicating that JNK activation is required for IL-6 induction by L. monocytogenes. Moreover, since LLO− mutant bacteria stimulated robust but temporally limited JNK phosphorylation and little IL-6 secretion, we infer that prolonged JNK activation is necessary for maximal IL-6 production during intracellular infection by L. monocytogenes. When L. monocytogenes infected cells were treated with an ERK-specific inhibitor, IL-6 secretion was similar to the untreated infected control cells. These results collectively suggest that the presence of XIAP enhances JNK activation in response to cytosolic bacteria, resulting in increased production of proinflammatory cytokines. To determine if XIAP enhanced proinflammatory gene expression in vivo, we performed qRT-PCR analysis on splenic RNA. RNA was isolated from splenocytes harvested from uninfected animals or animals infected with L. monocytogenes for 48 h (Figure 6). We examined the expression of several proinflammatory cytokines including IL-6, TNF, and IFN-γ, produced during the innate immune response that are critical for clearing L. monocytogenes infection [34]–[36]. The expression of il6 and ifng were significantly enhanced in the presence of XIAP during infection, while expression of tnf and ifnb were not altered. We also examined the expression of il17, a cytokine known to enhance expression of il6; we observed no reproducible differences in the expression of il17 [37]. These data confirm the results from our in vitro macrophage model; that XIAP promotes the expression of proinflammatory cytokine genes in response to L. monocytogenes infection. Innate immune signaling mediated by pattern recognition receptors, located on cellular membranes or in the host cytosol, stimulates transcription and secretion of proinflammatory cytokines. We used purified TLR and NLR ligands to better define a role for XIAP in innate immune signaling. Wild-type and XIAP-deficient activated macrophages were treated with TLR ligands, and secretion of IL-6 and TNF was measured after 24 h (Figure 7A and unpublished data). While some PAMPS, such as the lipoprotein Pam3CSK4, could induce high levels of IL-6 and TNF, we found no XIAP-dependent differences in proinflammatory cytokine induction. These results suggest that XIAP does not contribute to cytokine output in response to TLR stimulation alone. During a physiological infection, intracellular pathogens activate both extracellular and cytosolic innate immune pathways resulting in a coordinated immune response [27]. One well-characterized consequence of microbial sensing by cytosolic NLR proteins is activation of caspase-1, which cleaves pro-IL-1β into its mature form [38]. Since XIAP can regulate the activity of some caspases, we tested whether XIAP contributed to IL-1β production, measured by ELISA, as an indicator of caspase-1 activation (Figure 7B). Consistent with previous reports, IL-1β production was induced by cytosolic L. monocytogenes, but was not dependent upon XIAP [39]. We next examined the activation of NLR signaling using MDP, a ligand for NOD2 (Figure 7C–7E). No differences in cytokine secretion were observed by treatment with MDP alone, however, during a physiological infection bacteria likely present both TLR and NLR ligands to an infected host cell. PAMPs contained by L. monocytogenes include lipoprotein, muramyldipeptide, bacterial DNA and flagellin [27]. To determine if XIAP enhanced synergy between TLRs and NLRs, we examined IL-6, TNF and IL-1β secretion from xiap+/y and xiap−/y activated macrophages in response to the lipopeptide Pam3CSK4, the NOD2 ligand MDP, or both (Figure 7C–7E). When Pam3CSK4 and MDP were used in combination, we saw a substantial increase in IL-6 and TNF secretion by xiap+/y but not xiap−/y activated macrophages. We did not see any XIAP-dependent enhancement of IL-1β secretion in response to Pam3CSK4 and MDP in combination. To better deconstruct how XIAP might participate in integrating TLR and NLR signaling, we analyzed transcription of the il6 gene from xiap+/y and xiap−/y activated macrophages treated with MDP, Pam3CSK4, or both ligands (Figure 7F). Pam3CSK4 induced expression of the il6 gene in an XIAP-independent manner. Upon treatment with MDP, xiap+/y but not xiap−/y macrophages, responded by upregulating il6 transcript levels approximately 5-fold. When macrophages were treated with both ligands, xiap+/y macrophages exhibited enhanced expression of il6 compared to treatment of Pam3CSK4 alone, but xiap−/y macrophages did not. These results demonstrate that XIAP promotes synergy between the TLR and NLR pathways, resulting in increased production of pro-inflammatory cytokines. Here we show that XIAP can regulate innate immunity to the bacterial pathogen, L. monocytogenes by modulating JNK and NF-κB signaling, resulting in enhanced cytokine production. We found little evidence to suggest that XIAP regulated apoptosis of bacterially infected cells in vitro or in vivo, but instead found that XIAP promoted synergistic inflammatory cytokine expression induced by extracellular and cytosolic innate immune signaling upon bacterial infection of activated macrophages. Specifically, XIAP amplified the cytosolic response to MDP or wild-type L. monocytogenes. These data identify XIAP as a regulator of cytosolic innate immune signaling. Notably, another IAP family member NAIP5 was found to mediate caspase-1 activation in response to cytosolic bacterial flagellin [40]–[42]. NAIP5 function in innate immunity could be attributed to the atypical domain structure of this IAP protein that exhibits similarities to the NLR family of cytosolic sensors [43]. However, these data taken together with our results lead us to speculate that regulation of innate immune signaling is an important role of mammalian IAPs. The IAP family appears to play multiple roles in mammalian biology, including protecting cells from apoptotic stimuli, regulating the cell cycle and modulating innate immune signaling. As a whole, these studies are consistent with genetic evidence in Drosophila demonstrating that dIAP1 primarily protects insect cells from programmed cell death, while dIAP2 is required for anti-microbial function of the Imd pathway [4]–[7]. The Imd pathway in Drosophila is activated by peptidoglycan recognition proteins (PGRPs), while functionally analogous innate immune sensing of peptidoglycan in mammalian cells occurs in the cytosol by NOD1, NOD2, and NALP3 [44]. The Imd protein in Drosophila shares sequence homology with the mammalian RIP proteins, and a mammalian paralog, RIP2, is an essential signaling adaptor for the cytosolic peptidoglycan sensors, NOD1 and NOD2 [8], [45]–[47]. Thus, the Imd/RIP innate immune signaling module appears to have been co-opted for mammalian cytosolic surveillance for peptidoglycan. Genetic epistasis experiments in Drosophila place dIAP2 in parallel to TAK1 upstream of JNK and NF-κB signaling pathways [4]. Similarly, in mammalian cells, XIAP can modulate JNK and NF-κB signaling through TAK1 in endothelial cells and fibroblasts [13], [48]. Activation of either NOD1 or NOD2 activates TAK1, leading us to hypothesize that during bacterial infection, XIAP may facilitate this key association, linking cytosolic sensors to downstream signaling mediators [49], [50]. During infection, microbial pathogens present multiple PAMPs recognized by the innate immune system, eliciting a coordinated protective response. This concept is illustrated by the paradigm of IL-1β processing, where TLRs mediate transcription of pro-IL-1β; however, cleavage and secretion are dependent upon activation of the caspase-1 inflammasome by cytosolic PAMPs [51]. However, IL-1β deficient mice are as resistant to L. monocytogenes infection as wild-type mice, suggesting that other inflammatory cytokines mediate innate immune control of this infection [52]. In contrast, IL-6-, TNF- and IFNγ-deficient mice are more susceptible to L. monocytogenes infection at 48 hpi than wild-type mice, demonstrating a requirement for IL-6, TNF, and IFNγ in protection from this particular pathogen [34]–[36], [53], [54]. IFNγ is largely produced by innate immune effector cells other than macrophages, thus our observation that ifng transcription is decreased in the spleens of L. monocytogenes-infected XIAP mutant mice must be due to either a XIAP-dependent cell autonomous defect in a different cell type or a non-autonomous defect in an IFNγ producing cell resulting from a defect in macrophages [55]. Since XIAP is expressed in many different tissues, it is reasonable to suppose that XIAP may have pleiotropic effects in the innate immune response to L. monocytogenes [56]. However, macrophages are primary producers of IL-6 and TNF, and notably, NOD2 signaling is known to stimulate production of IL-6 and TNF [45], [57]. The deficit in IL-6 and TNF production we observed in infected xiap−/y activated macrophages, and the defect in gene expression in vivo likely contributes to the enhanced susceptibility of XIAP-deficient animals to L. monocytogenes infection. Recent reports indicate that macrophages treated with LPS become tolerized to re-stimulation with TLR ligands [58], [59]. Additionally, when macrophages are tolerized by LPS, the role of NOD1 and NOD2 in cytosolic surveillance becomes more critical during infection [60]. In our model, macrophages are activated with LPS and IFNγ prior to infection. When activated macrophages are infected with L. monocytogenes, the induction of proinflammatory cytokines is XIAP-dependent, indicating that XIAP plays a more critical role in regulating the innate immune response to cytosolic pathogens in macrophages where the TLR pathway may be tolerized and an inflammatory gene expression program initiated. We use these data to integrate XIAP into a cytosolic surveillance model whereby upon recognition of microbial ligands in the cytosol by innate immune sensors such as NOD2, XIAP enhances association and function of signal transducers such as TAK1 and JNK [13], [18]. Recruitment of signaling molecules by XIAP upon NLR stimulation would potentiate signaling pathways activated by TLRs, leading to maximal proinflammatory cytokine production. Apoptotic and microbial stimuli activate similar signaling pathways, but may lead to different outcomes. Macrophages as innate immune effector cells can control microbial infection by secreting cytokines and other pro-inflammatory molecules or by carrying out programmed cell death [61]. It has been hypothesized that when macrophages receive a strong inflammatory stimulus, they undergo apoptosis rather than secreting cytokines as a means of protecting the host [40], [62], [63]. Although previous data implicated XIAP in modulating apoptosis, our data demonstrate that XIAP also has an important role in proinflammatory cytokine production. However, we suggest that these two functions for XIAP may not be completely distinct, as the outcome of XIAP-dependent modulation of JNK and NF- κB pathways may depend on the quality and intensity of the stimulus [31]. Additionally, the ability of XIAP to regulate innate immunity is likely cell type and context dependent, as we did not see reproducible XIAP-dependent transcriptional regulation in unactivated macrophages. Future studies will determine which aspects of XIAP function contribute to immune signaling and elucidate the complex role of XIAP in the mammalian immune response. Mice deficient in XIAP (accession #U88990) were generated on a 129/Sv×129/SvJ background as previously described [20]. The XIAP-deficient mice were backcrossed onto the C57Bl/6 background for more than 10 generations. Six- to 12-week-old male XIAP-deficient mice or wild-type littermate controls were used for infection experiments. All animals received humane care as outlined by the Guide for the Care and Use of Laboratory Animals (University of Michigan Committee on Use and Care of Animals). For cell culture infections, Listeria monocytogenes strains 10403S (wild-type) and hly− (LLO−) were inoculated into liquid brain-heart infusion (BHI) broth and incubated at 30°C overnight without shaking[64]. Prior to infection, L. monocytogenes cultures were washed and resuspended in PBS. HKLM was prepared by incubating bacteria at 70°C for 1 h. For animal infections, L. monocytogenes was grown to log-phase in BHI and aliquots were stored at −70°C. For each experiment, a vial was back-diluted and allowed to grow to OD600 0. 5. The bacteria were washed in PBS and diluted before injection. Mice were injected intraperitoneally with 5×105 L. monocytogenes equivalent to 0. 5 LD50 for infection by the intraperitoneal route in C57Bl/6 mice [65]. The number of viable bacteria in the inoculum and organ homogenates was determined by plating 10-fold serial dilutions on Luria broth (LB) agar plates. For evaluation of survival, animals were infected with 1×105 or 5×105 L. monocytogenes, and observed every 24 h post-infection. For histology, the spleen and liver from infected mice were harvested at 48 hpi and fixed in 10% neutral buffered formalin. Paraffin sections were prepared and stained with ApopTag by the Cancer Center Research Histology and Immunoperoxidase Lab at the University of Michigan. Bone marrow macrophages were differentiated in DMEM supplemented with 20% heat inactivated FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 0. 1% β-mercaptoethanol, and 30% L929 conditioned medium. Bone marrow cells were cultured at an initial density of 107 cells per 150 mm non-tissue culture treated dish for 6 d, with fresh medium added at day 3. Cells were harvested with cold PBS without calcium and magnesium. BMDM were activated overnight in 10 ng/ml LPS (Sigma #L6143) and 10 ng/ml (100 U/ml) interferon-γ (Peprotech #315-05). Activated macrophages were infected with L. monocytogenes at an MOI of 10, such that bacteria were observed in the cytosol in approximately 99% of the macrophages. Peritoneal macrophages were harvested by peritoneal lavage. Cells were pooled from two mice prior to plating. For L. monocytogenes growth curves, cells were plated on coverslips at a density of 1. 7×105 cells/ml in 24-well plates. Macrophages were infected with L. monocytogenes for 0. 5 h, washed 3 times with PBS, followed by addition of fresh medium with 50 µg/ml gentamicin. At each time point, 3 coverslips were lysed in water and plated on LB agar plates for to determine CFU. IL-6 (R&D Systems), IL-1β (R&D Systems), and TNF (University of Michigan Cellular Immunology Core) in the culture medium were measured by ELISA. Where indicated, cells were treated for 30 min with TLR ligands as follows: MDP 10 µg/ml (Bachem #4009623), Pam3CSK4 2 µg/ml (Invivogen #tlrl-pms), poly (I: C) 10 µg/ml, LPS 10 ng/ml (Sigma #L6143), flagellin 10 ng/ml (Invivogen #tlrl-flic), imiquimod 5 µg/ml (Invivogen #tlrl-imq), CpG DNA 1 µg/ml (IDT CpG F [5′-TCCATGACGTTCCTGACGTT], CpG R [5′-AACGTCAGGAACGTCATGGA]). At 8 and 24 h post-treatment, supernatants were harvested for measurement of cytokines by ELISA. Inhibition experiments were conducted as described above, except cells were treated with 20 µM JNK inhibitor, SP600125 (Sigma #S5567), or 10 µM ERK inhibitor U0126 (Cell Signaling #9903) for 1 h prior to infection. For nuclear and cytoplasmic fractionation, cells were lysed in NP-40 lysis buffer (50 mM Tris pH 8. 5 mM EDTA pH 8,150 mM NaCl, 0. 05% NP-40 [Igepal], EDTA-free protease inhibitor cocktail [Roche]). Nuclei were pelleted by centrifugation at 1,000 rpm for 5 min; the cytosolic fraction was further clarified by centrifugation at 14,000 rpm for 10 min. Nuclei were washed and either resuspended in 2× SDS-PAGE lysis buffer for immunoblot or lysed for NF-κB ELISA by resuspension in nuclear lysis buffer (20 mM HEPES pH 7. 9,400 mM NaCl, 1 mM EDTA, 10% glycerol, 0. 1 mM DTT, EDTA-free protease inhibitor cocktail [Roche]) and incubated at 4°C for 30 min. Nuclei were flash frozen and used for NF-κB p65 ELISA analysis (Stressgen EKS-446). BMDM were plated and activated overnight in 10 ng/ml LPS and 10 ng/ml interferon-γ. Cells were infected for 30 min at an MOI of 10, bacteria were removed by 3 washes with PBS, and fresh medium containing 50 µg/ml gentamicin added. At 3 hpi, the medium was removed and spun to collect any non-adherent cells; the remaining cells were removed from the dish by incubating with ice-cold PBS without calcium and magnesium for 20 min at 4°C. Cells were stained with Annexin V and propidium iodide according to the manufacturer' s protocol (BD Biosciences #556420). Splenocytes were harvested from uninfected or L. monocytogenes infected mice. BMDM were harvested from plates with ice cold PBS without Ca+ or Mg+. Cells were blocked with Fc block (BD Pharmingen 553142) for 15 min on ice. Cells were incubated in staining buffer (PBS, 10% FBS) with the indicated antibodies for 20 min on ice, followed by 3 washes in staining buffer. When necessary cells were incubated with secondary antibodies in staining buffer on ice for 20 min, and washed 3 times in staining buffer. Flow cytometric acquisition was performed on a FACSCanto. The data was analyzed using FlowJo software. The following antibodies were used: from BD Pharmingen; B220-PE (553089), NK1. 1-biotin (553163), CD69-PE (553237); from Southern Biotech CD3 (1530-02), Streptavidin-APC (7100-11L). Whole cell lysates were generated by adding 2× SDS-PAGE sample buffer directly to cell monolayers. Protein samples were separated by SDS-PAGE and transferred to PVDF. Blots were blocked in 5% BSA, incubated with primary antibodies, followed by a horseradish peroxidase conjugated secondary antibody. The following antibodies were used: β-actin (Sigma #A5441), NF-κB p50 (Santa Cruz Biotechnology #8414), USF-1 (Santa Cruz Biotechnology #8983), Phospho-JNK (Cell Signaling 9251), JNK1 (Santa Cruz Biotechnology #571), Phospho-p38 kit (Cell Signaling 9210), Phospho-c-jun (Santa Cruz Biotechnology #822), Phospho-ERK (Cell Signaling 4377), ERK-1 (Santa Cruz Biotechnology #94), goat anti Rabbit IgG-HRP (MP Biomedical #67438), goat anti-mouse IgG-HRP (MP Biomedical #67429). For RT-PCR, total RNA was harvested from infected or treated cells at 3 hpi with the RNeasy Mini Kit (Qiagen). The RNA was used in a reverse transcriptase (RT) reaction with Moloney murine leukemia virus (MMLV) RT (Invitrogen). cDNA obtained from the RT reaction was used for qRT-PCR amplification and quantitation by SYBR Green (Stratagene MX3000p). Data was analyzed using the ΔΔCt method (ΔΔCt = 2 (ΔCt sample−ΔCt normalizer) ) with β-actin used as a normalizer for in vitro experiments and gapdh used as a normalizer for in vivo experiments. Sequences for qRT-PCR primers are described in Table S1. A two-tailed t-test was used for statistical analysis; p values of ≤0. 05 were considered significant, while p≤0. 001 were considered highly significant.

Title: XIAP Regulates Cytosol-Specific Innate Immunity to Listeria Infection Summary: During a bacterial infection, the innate immune response plays two critical roles: controlling early bacterial replication and stimulating the adaptive immune response to clear infection. Host recognition of bacterial components occurs through pathogen sensors at the cell surface or within the host cell cytosol. Inhibitor of apoptosis proteins (IAPs) have been recently implicated in immune regulation, but how IAPs contribute to immunity is incompletely understood. Here, we show that X-linked IAP (XIAP) protects against infection by the cytosolic bacterial pathogen, Listeria monocytogenes, which causes severe disease in neonates and immunocompromised individuals. We found that XIAP enhanced MAP kinase signaling in L. monocytogenes infected macrophages, a key innate immune effector cell. Additionally, XIAP enabled synergy between cell surface and cytosolic bacterial sensors, promoting increased gene expression of proinflammatory cytokines. Our findings suggest that IAPs are integral regulators of innate immune signaling, coordinating extracellular and intracellular responses against microbial components to control bacterial infection.

lay_plos

en

Summarize: After months of waiting and hoping, panda lovers' dreams were dashed again. There will be no baby panda at the National Zoo this year – mama bear was faking her pregnancy. Zookeepers called off the pregnancy watch after noticing that the prospective panda mother's hormone levels were back to normal, and that there were no signs of a fetus during an ultrasound. Until now, the female had appeared for all the world as if she was carrying a baby panda: She had elevated levels of the hormone progesterone; she lost her appetite and slept a lot; and she even built bamboo nests and cradled objects as if they were cubs. Yet no one could be sure she was with-panda, because it is often difficult to identify a panda fetus through an ultrasound. And female giant pandas regularly undergo pseudo-pregnancies, which mimic the real thing to a tee, sans the developing infant. Repeat performance This is the fifth time Mei Xiang (May Shee-ahng), one of two giant pandas who live at the Smithsonian's National Zoo in Washington, D.C., has undergone a false pregnancy. She gave birth to one panda cub, the male Tai Shan, in 2005. Zookeepers have been hoping for a repeat performance since then, and inseminated her again this year with sperm from her male companion at the zoo, Tian Tian (T-yen T-yen). Pandas only have one shot to get pregnant every year – females can ovulate once a year, and are fertile for about two days. After that, the resulting pregnancy – or pseudo-pregnancy – generally lasts between three to six months. Scientists don't know why pseudo-pregnancies happen, or if they have evolved for an evolutionary purpose. "In a sense there's no answer, but there is speculation that perhaps pandas' bodies just rehearse pregnancy all the time," Lisa Stevens, curator of primates and pandas at the zoo, told LiveScience. In the case of pandas, she said, some researchers think the phenomenon could be related to the fact that the bears have evolved to survive on a very low-energy diet. They eat almost nothing but bamboo, which contains barely more energy than it takes to consume it. But giant pandas aren't the only ones that experience false pregnancies. Many animals, especially carnivores and other bears, can go through the same thing. Even humans can have symptoms associated with a pregnancy, without carrying an actual baby. It's just that in most species, especially humans, it's easier to tell for sure with an ultrasound. National Zoo's panda -- not pregnant By Washington Post editors The National Zoo announced Wednesday morning that its female giant panda, Mei Xiang, is not pregnant. The conclusion was reached, the zoo said, after experts studied an array of physical, behavioral, and chemical clues. “Based on current hormone analyses, and not having seen a fetus during the ultrasound exams, Zoo researchers have determined that Mei Xiang experienced a pseudopregnancy,” the zoo said in a statement issued about 9:30 a.m. The zoo had placed the panda on 24-hour pregnancy watch on Friday, and officials had high hopes that Mei might be pregnant. She was artificially inseminated twice in January. Although indications were trending against pregnancy, zoo officials still held out hope Tuesday. “There’s still a smidge of hope,” zoo spokeswoman Pamela Baker-Masson said Tuesday. But zoo scientists realized later Tuesday that Mei was not pregnant, the announcement said. The chief clue was the level of the hormone progesterone, which rises during the bear’s pregnancy cycle then falls steeply back to “baseline.” Once it falls back to baseline and stays there, scientists expect to see the birth of a cub within a day or so. If there is no cub, the pregnancy is declared over. Mei’s hormone levels dropped to baseline late last week, and when no cub appeared, the zoo realized she was not pregnant. Pandas go through a pregnancy cycle whether or not they are actually pregnant. The disappointment comes in the wake of the departure in February of the zoo’s giant panda favorite, Tai Shan, who was born at the zoo in 2005. Tai was sent to join a breeding program in China. In addition, the zoo faces the possibility that Mei Xiang and her mate, Tian Tian, may also soon depart. Baker-Masson, the zoo spokeswoman, said: "We're hugely disappointed. It's a very significant, collaborative effort...My colleagues go through herculean efforts when it comes to panda reproduction, so it's very puzzling and extremely disappointing that we didn't have a cub this year." The adult giant pandas are here on a 10-year lease from China that expires in December. Mei Xiang has had numerous pseudopregnancies in the past, and in ten years has produced one cub, Tai Shan. “It’s a disappointment for all of us,” said zoo reproduction physiologist Pierre Comizzoli. “We are obviously disappointed. But we just keep trying.” -- Michael E. Ruane

Summary: Mei Xiang's latest pregnancy has turned out to be another fake, disappointed zookeepers at the National Zoo say. The panda showed all the signs of pregnancy-including elevated hormone levels, building bamboo nests, and cradling objects as if they were cubs-but tests have revealed that she isn't really pregnant, LiveScience reports. This is Mei Xiang's fifth false pregnancy. Pandas, for reasons scientists don't fully understand, often go through "pseudo-pregnancies" after their once-a-year ovulation. "We're hugely disappointed," a zoo spokeswoman tells the Washington Post. "My colleagues go through herculean efforts when it comes to panda reproduction, so it's very puzzling and extremely disappointing that we didn't have a cub this year."

multi_news

en

Summarize: CROSS REFERENCE TO RELATED APPLICATIONS [0001] This application is a divisional of co-pending U.S. patent application Ser. No. 13/236,449 filed on Sep. 19, 2011, which claims the benefit under 35 U.S.C. 119 of U.S. Provisional Patent Application No. 61/384,800, filed Sep. 21, 2010, the full disclosures of which are incorporated herein by reference. BACKGROUND OF THE INVENTION [0002] 1. Field of the Invention [0003] The present invention relates generally to medical devices and methods. More particularly, the present invention relates to the use of an expandable scoring cage for disrupting stenotic deposits in cardiac valves. [0004] Stenosis of the aortic and other cardiac valves occurs when the valve annulus narrows restricting the flow of blood through the valve when open. This is a particular problem with aortic valve stenosis where the flow of oxygenated blood from the left ventricle to the rest of the body is limited. When the aortic valve is obstructed, the heart must pump at a higher pressure to overcome the increased resistance which can weaken the heart and lead to various symptoms, such as fatigue, chest pain, heart palpitation, heart murmur, and ultimately heart failure. The traditional treatment for aortic valve stenosis has been heart valve replacement through open chest, stopped heart procedures. Recently, percutaneous heart valve replacement has become available. For many patients, however, heart valve replacement is not a realistic choice. Some patients are too weak or ill to undergo such procedures. Other patients are at the beginning stages of valve stenosis where performing a valve replacement procedure might not be justified. [0005] For such patients, it would be desirable to provide alternative therapeutic procedures. Valve angioplasty is one such alternative procedure. A balloon catheter is introduced to the aortic valve, typically through an aortic arch approach, and the balloon inflated within the heart valve to disrupt and loosen stenotic material located on the valve leaflets and in the valve annulus. While such procedures have been clinically employed, they suffer from a number of shortcomings. The principal shortcoming is a lack of effectiveness in some patients. The radial pressure applied by the balloons is not always directed symmetrically, and the balloons can often slip from their original placement within the valve annulus. Both these circumstances limit the effectiveness of conventional valvuloplasty therapy. Moreover, the valvuloplasty balloons must be very large (in order to accommodate the valve annulus), thus requiring a relatively long deflation period. Since the aorta can only be blocked for a short period of time, the need to provide for a lengthy deflation time limits the treatment time in which the balloon can be fully inflated. Additionally, the deflation of such large balloons often leaves a very uneven profile with flaps and portions of the balloon extending radially outwardly. The removal of such structures from the valve annulus can damage the fragile valve leaflets as well as the vasculature through which the catheter is removed. Additionally, valvuloplasty has generally been limited to the treatment of aortic valves. [0006] For these reasons, it would be desirable to provide improved apparatus and methods for performing cardiac valve angioplasty. It would be particularly useful if the methods and apparatus provided for more effective treatment of cardiac valve stenoses, not only in the aorta but in other cardiac valves as well, such as the mitral valve and the pulmonary valve. It would be further desirable to provide valvuloplasty balloons which are capable of applying force symmetrically about their perimeter in order to more effectively treat and fracture stenotic material surrounding the valve annulus. It would be still further desirable if the valvuloplasty balloons were able to resist slippage while inflated, thus improving effectiveness and reducing the risk of left ventricular perforations. It would be still further useful if the valvuloplasty balloons were adapted for rapid deflation so that the period of inflation intended to treat the valve could be prolonged. Additionally, it would be useful if the valvuloplasty balloons folded in a regular manner with a low profile to facilitate removal of the balloons and reduce the risk of trauma to the valve leaflets or other harder vascular structures. At least some of these objectives will be met by the invention as described herein below. [0007] 2. Description of the Background Art [0008] Catheters for treating cardiac valve stenoses are described in the following U.S. Pat. Nos. 4,986,830; 5,443,446; 6,746,463; 7,029,483; 7,455,652; and Published Applications: US 2005/0137690; and 2006/0074484. Commonly owned patents and pending applications which relate to the invention herein include: U.S. Pat. Nos. 7,686,824; 7,691;119; 2004/0243158; 2005/0021071; 2005/0021070; 2006/0259005; 2006/0085025; 2009/0105687; and 2010/0121372, the full disclosures of which are incorporated herein by reference. BRIEF SUMMARY OF THE INVENTION [0009] The present invention provides improved apparatus and methods for performing valvuloplasty of the aortic and other cardiac valves, such as the pulmonary valve and the mitral valve. Valvuloplasty is the treatment of stenotic cardiac valves by balloon expansion within the valve annulus. Such balloon expansion can open the valve and increase the area available for blood flow by fracturing and displacing stenotic material, such as calcified plaque, which covers the valve leaflets and/or the valve annulus. Such stenotic valves become stiff such that functioning of the valve leaflets deteriorates, including a reduced opening of the leaflets available to allow blood flow during ventricular systole. [0010] The present invention provides for placement of scoring elements over the exterior surface of a balloon or other expansible shell. The scoring elements, which typically number from six to twenty, are preferably uniformly distributed over the outer surface of the balloon so that they concentrate forces uniformly over the circumference of the valve annulus when the balloon is inflated. Such uniformly concentrated forces are able to effectively fracture and displace the stenotic material to increase the area of the annulus available for blood flow and often to improve the ability of the valve leaflets to function. Additionally, when the scoring elements are incorporated in a self-closing elastic cage which is placed over the balloon, the cage is able to improve balloon deflation characteristics so that the balloon deflates both more rapidly and more uniformly so that balloon flaps and other elements are not exposed during withdrawal of the balloon from the valve annulus and vasculature. The scoring elements also help to stabilize the balloon within the valve annulus during balloon inflation to inhibit slippage which can both reduce the effectiveness of the treatment and expose the valve annulus and surrounding tissue to damage. [0011] In a first aspect of the present invention, a method for treating for cardiac valve stenoses comprising positioning an expansible shell inside a stenosed cardiac valve annulus. The shell is expanded to engage a plurality of scoring elements present on an external surface of the shell against the annulus. The shell expansion is maintained for a time sufficient for the scoring elements to disrupt the stenoses, after which time the shell is contracted and removed from the valve annulus together with the scoring elements. [0012] Positioning the expansible shell typically comprises advancing a catheter which carries the expansible shell and scoring elements over the aortic arch and into the aortic valve annulus. The shell expansion will typically be maintained in a period of time from 1 second to 10 seconds, usually from 1 second to 4 seconds, typically for about 2 seconds. When using an inflatable balloon, expanding the shell comprising expanding the balloon, and the scoring elements are typically provided as axial struts in an elastic metal cage surrounding but unattached to the inflatable balloon. The cage is elastically biased to close over the balloon as the balloon is inflated, thus both decreasing the deflation time and improving the rewrap characteristics of the balloon over the placement catheter. In the exemplary embodiments, the balloon is non-distensible and inflated to a pressure in the range from 1 atmosphere to 12 atmospheres, preferably from 4 atmospheres to 12 atmospheres, typically about 8 atmospheres. The balloon will usually carry from six to twenty scoring elements and will be inflated to a diameter in the range from twenty millimeters to thirty millimeters, depending on the size of the valve annulus being treated. [0013] In a second aspect, the present invention provides devices for treating cardiac valve stenoses. The devices comprise a shaft having a proximal end and a distal end and an expansible shell carried on a distal region of the shaft. A plurality of scoring elements are carried by the expansible shell, typically over its exterior surface. The expansible shell typically has a length and expanded diameter selected to fully occupy an adult human cardiac valve annulus, typically the aortic valve annulus, and said scoring elements have flat radially outward surfaces for engaging the stenotic material when inflated within a stenosed cardiac valve. [0014] The shaft may be adapted to be introduced over the aortic arch to position the expansible shell in the aortic or other cardiac valve annulus. The expansible shell is preferably a non-distensible inflatable balloon having an inflated diameter (when fully inflated) in the range from twenty millimeters to thirty millimeters. The length of the inflatable balloon will be relatively short, typically in the range from two centimeters to four centimeters. Such a short length may be used because the balloon with the scoring elements thereon is much less likely to be axially displaced when inflated than is a bare balloon. The balloon will typically carry from six to twenty scoring elements, preferably from eight to sixteen scoring elements, which scoring elements extend from a proximal end to a distal end of the balloon and are evenly circumferentially spaced-apart over an exterior surface of the balloon. [0015] The scoring elements are typically formed as axial struts in an elastic metal cage structure. The cage structure is coupled to the catheter shaft but not attached to the expansible balloon. The cage is elastically biased to close to a diameter in the range from three millimeters to seven millimeters when the shell is unexpanded. [0016] In an exemplary embodiment, the elastic metal cage structure comprises a plurality of circumferentially arranged, axially elongated hexagonal cells, where each cell has a proximal connection point and a distal connection at longitudinally opposed ends of the cell. Axial struts are connected to each of the connection points, and the struts are used to connect the cage structure to the catheter shaft. At the distal end, the axial struts are connected directly to the catheter shaft. In contrast, at the proximal end, the axial struts are connected to a compliance tube, where the compliance tube is disposed coaxially over the catheter shaft and attached to the catheter shaft only at a proximal end of the compliance tube. The axial connector links at the proximal end of the elastic metal cage structure are attached to a distal end of the compliance tube. In this way, the compliance tube can accommodate both axial foreshortening of the cage as the balloon is radially expanded as well as to accommodate any rotational, torsional forces experienced by the cage structure as the balloon is expanded. [0017] The scoring elements have dimensions particularly selected to score stenotic material present on cardiac valves. Typically, the scoring elements have rectangular cross-sections with a height (thickness) in the radial direction in the range from 0.1 millimeters to 0.4 millimeters, usually 0.15 millimeters to 0.25 millimeters, and a width in the circumferential direction in the range from 0.25 millimeters to 0.5 millimeters, preferably from 0.3 millimeters to 0.4 20 millimeters. BRIEF DESCRIPTION OF THE DRAWINGS [0018] FIG. 1 is a prospective view of a valvuloplasty catheter constructed in accordance with the principals of the present invention. [0019] FIGS. 2A and 2B illustrate an expansible shell of the valvuloplasty catheter of FIG. 1 carrying a self-closing elastic cage comprising a plurality of scoring elements, where the balloon and cage are in their contracted configuration in FIG. 2A and in their expanded configuration in FIG. 2B. [0020] FIG. 2C is a cross-sectional view of an individual scoring element of the cage of FIGS. 1, 30 2 A, and 2 B. [0021] FIGS. 3 and 4 illustrate alternative self-closing cage configurations in accordance with the principals of the present invention. [0022] FIGS. 5-8 and 7 A illustrate use of the valvuloplasty catheter of FIG. 1 in treating an aortic valve in accordance with the principals of the present invention. DETAILED DESCRIPTION OF THE INVENTION [0023] A valvuloplasty catheter 10 constructed in accordance with the principals of the present invention is illustrated in FIGS. 1, 2 A, and 2 B. The valvuloplasty catheter 10 comprises a shaft 12 having a compliance tube 14 coaxially disposed over a distal portion thereof. A proximal hub 16 includes an axial guide wire port 16 a and a side balloon inflation port 16 b. The guide wire port 16 a attaches to a guide wire lumen which extends axially over the entire length of catheter shaft 12. The balloon inflation port 16 b connects to an inflation lumen, typically formed in a wall of the shaft 12. [0024] An expansible shell 18 is located at the distal end of the catheter shaft 12 and connected to receive inflation medium from the inflation lumen in the shaft which is connected to port 16 b. In this way, the balloon can be inflated from a contracted or non-inflated configuration, as shown in FIG. 2A, to a fully inflated configuration, as shown in FIG. 2B. [0025] An expansible metal cage 20 is mounted over the expansible shell (typically an inflatable balloon) 18 so that it expands with the inflated shell or balloon 18, as shown in FIG. 2B, and self-closes over the balloon, as shown in the contracted configuration of FIG. 2A. The elastic metal cage is typically formed from a highly elastic metal, such as nitinol or spring stainless steel, and may typically be formed by laser cutting of a nitinol or stainless steel hypo tube. [0026] In a preferred configuration, the elastic metal cage will comprise hexagonal cells which extend over the middle of the expansible shell when inflated, as best seen in FIG. 2B. The hexagonal cells comprise parallel (axially aligned) scoring elements 22 which are the components which engage and score the stenotic material in the valve annulus when the shell 18 is expanded, as will be described in more detail with FIGS. 6-8 below. In order to maintain an equal circumferential spacing of the scoring elements 22, each end of the scoring element is connected at a connection point 28 to points on a zig zag ring 29 which are in turn connected to distal connecting links 24 at the distal end of the cage and proximal connecting links 26 at the proximal end of the cage. The distal connecting links 24, in turn, are attached to the catheter shaft 12 by a distal collar 30, while the proximal connector links 26 are connected to the compliance tube 14 by a proximal collar 32. The compliance tube 14 is unattached to the catheter shaft 12 except for an attachment point 34 at its proximal end. In this way, when the expansible shell 18 is inflated or otherwise radially expanded, the compliance tube 14 can elongate (in the direction of the linear arrow in FIG. 2B ) to accommodate any foreshortening and can also torque or rotate, as shown by the circular arrow in FIG. 2B. [0027] Although the illustrated structure of elastic metal cage 20 is presently preferred as it effectively maintains equal circumferential spacing of the scoring elements 22 as the shell 18 is inflated or otherwise expanded, other shell designs could be employed, such as those having helical scoring elements, as illustrated in FIGS. 3 and 4. In FIG. 3, a cage 40 comprising six helical scoring elements 42 disposed over an inflatable balloon 44. The construction of the catheter which carries balloon 44 and cage 40 will generally be the same as that described with respect to the catheter of FIG. 1. FIG. 4 also describes an expansible cage 50 having a plurality of helical scoring elements 52 where the principal difference is that cage 50 includes twelve scoring elements in contrast to the six scoring elements of cage 40 of FIG. 3. [0028] Referring now to FIGS. 5-8, use of the valvuloplasty catheter 10 of FIG. 1 in treating a stenosed aortic valve will be described. The stenosed aortic valve NAV is illustrated in FIG. 5, where the stenotic material SM is present on both the valve leaflets and the valve annulus. While the valve can function, the ability of the valve leaflets to fully open and close is hindered, limiting the blood flow through the open valve and/or allowing leakage through the closed valve. The aortic valve NAV is at the base of the aortic arch AA and adjacent to the Sinus of Valsalva SV. The coronary arteries open off the coronary ostia CO, and the valve NAV opens to permit blood flow from the left ventricle LV into the aortic arch. [0029] Referring now to FIG. 6, the valvuloplasty catheter 10 is introduced so that the elastic metal cage 20 carried on the expansible shell/balloon 18 is introduced through the valve leaflets into the annulus of the aortic valve NAV. After the catheter 10 is properly positioned, as shown in FIG. 7, the expansible shell 18 is inflated to engage the individual scoring elements 22 against the stenotic material SM around the valve annulus, as shown in FIG. 7A. Note that the cross-sections of the scoring elements 22 are not shown to scale and are actually smaller relative to the expansible shell 18 than illustrated. [0030] After inflating the balloon for a desired period of time, typically from 1 second to 10 seconds, usually from 1 second to 4 seconds, the balloon is rapidly deflated so that the elastic metal cage closes over the balloon, rewrapping the balloon in a compact package, as shown in FIG. 8. Catheter 10 may then be withdrawn and the treatment is completed. [0031] While the above is a complete description of the preferred embodiments of the invention, various alternatives, modifications, and equivalents may be used. Therefore, the above description should not be taken as limiting the scope of the invention which is defined by the appended claims.

Summary: A valvuloplasty catheter comprises a balloon or other expansible shell which carries a plurality of scoring elements, typically formed in an elastic, self-closing metal cage. The expansible shell and scoring elements are positioned inside an aortic or other cardiac valve, and the shell expanded to engage the scoring elements against stenotic material which covers the valve leaflets and valve annulus. The scoring elements uniformly distributed force to break up the stenotic material, and the cage further contributes to rapid balloon deflation allowing shortening of the treatment time.

big_patent

en

Write a title and summarize: In Human African Trypanosomiasis, neurological symptoms dominate and cardiac involvement has been suggested. Because of increasing resistance to the available drugs for HAT, new compounds are desperately needed. Evaluation of cardiotoxicity is one parameter of drug safety, but without knowledge of the baseline heart involvement in HAT, cardiologic findings and drug-induced alterations will be difficult to interpret. The aims of the study were to assess the frequency and characteristics of electrocardiographic findings in the first stage of HAT, to compare these findings to those of second stage patients and healthy controls and to assess any potential effects of different therapeutic antiparasitic compounds with respect to ECG changes after treatment. Four hundred and six patients with first stage HAT were recruited in the Democratic Republic of Congo, Angola and Sudan between 2002 and 2007 in a series of clinical trials comparing the efficacy and safety of the experimental treatment DB289 to the standard first stage treatment, pentamidine. These ECGs were compared to the ECGs of healthy volunteers (n = 61) and to those of second stage HAT patients (n = 56). In first and second stage HAT, a prolonged QTc interval, repolarization changes and low voltage were significantly more frequent than in healthy controls. Treatment in first stage was associated with repolarization changes in both the DB289 and the pentamidine group to a similar extent. The QTc interval did not change during treatment. Cardiac involvement in HAT, as demonstrated by ECG alterations, appears early in the evolution of the disease. The prolongation of the QTC interval comprises a risk of fatal arrhythmias if new drugs with an additional potential of QTC prolongation will be used. During treatment ECG abnormalities such as repolarization changes consistent with peri-myocarditis occur frequently and appear to be associated with the disease stage, but not with a specific drug. Human African Trypanosomiasis (HAT) or sleeping sickness evolves in two stages, the first or early (hemo-lymphatic) stage and the second or late (meningo-encephalitic) stage which is characterized by invasion of the central nervous system (CNS) by trypanosomes. Neuropsychiatric disturbances are the most prominent and best documented features of the disease [1]. Cardiac involvement plays an important role in American trypanosomiasis (Chagas' disease); however, in the African form, cardiac involvement has been suggested but has never been studied systematically in the first stage of the disease. Cardiac involvement has been observed in up to 73% of HAT patients in post mortem histological studies [2], [3]. Those findings are supported by the recent study of Blum et al [4] that showed cardiac alterations in 71% of second stage HAT patients, but are in contrast to previous studies, where ECG findings were reported in only 35–48% of the patients [5]–[7]. The latter studies included both first and second-stage HAT patients. A low prevalence of ECG findings in first stage disease could explain this discrepancy. Thus, cardiac involvement, as documented by ECG findings, may parallel CNS involvement and ECG findings could be used as additional tool for assessing the advancement of the disease. Because of increasing resistance to the available drugs for HAT, new compounds or drug combinations are desperately needed. Evaluation of cardiotoxicity and the risk of cardiac arrhythmia is one parameter of drug safety, but without knowledge of heart involvement in HAT, cardiologic findings and drug-induced ECG alterations will be difficult to interpret. Pentamidine administered intramuscularly is currently the primary treatment for first stage HAT. A large number of diamidine compounds have been synthesized in an attempt to develop an oral agent for this disease. DB289 (pafuramidine maleate) is one of these diamidine compounds. It can be orally administered and showed good efficacy against first stage HAT in Phase II trials. Since diamidines such as pentamidine have been shown to have arrhythmic potential [8], knowledge of HAT cardiopathy and scrupulous analysis of the potential cardiac effects of new antiparasitic drugs is essential. The overall aim of the study was to assess the cardiac involvement in first stage HAT by ECG examination and to study the effect of different antiparasitic drugs on ECG findings. The objectives of this study were to assess the frequency and character of ECG findings in patients with first stage HAT and to compare them to healthy control subjects and to second stage HAT patients. Secondary objectives were to assess differences between administered HAT therapies, including ECG changes during and after treatment, and to discuss the findings with respect to clinical relevance and tolerability of medical therapy. The objectives were to study and characterize ECG alterations in T. b. gambiense patients with respect to the stage of the disease (first versus second stage) and treatment induced alterations (baseline versus after treatment). Only studies with clear definition of ECG criteria and complete ECG description (including QTc intervals), description of the stage of the disease and ECG before and after treatment were included. Using these criteria the following studies were not included: Electrocardiograms (ECG) were performed prior to and following treatment and analyzed in a total of 523 participants; 406 were patients with first stage HAT, 56 with second stage HAT and 61 were healthy controls. Patients and controls from different clinical trials are included in the present analysis. All HAT patients and healthy controls underwent a clinical assessment, including medical history, baseline physical examination, blood sampling for hematology and chemistry, and ECG. To estimate the normal intra-individual fluctuation of ECG parameters, two ECG recordings per subject were obtained at baseline. ECG changes appearing after treatment were compared to these intra-individual ECG changes. ECG data were also obtained during treatment in first stage HAT patients in all patients treated with DB 289 and in 40 patients treated with pentamidine. A clinical assessment was performed and the ECG was repeated after completion of treatment of HAT. All ECG tracings were interpreted by a single reader using standardized criteria as described below. The ECG data for the first stage HAT patients were compared to the ECG data from the healthy controls and the second stage HAT patients. The PQ, QRS and QT intervals were measured manually by the principal investigator in three consecutive cycles and mean values were calculated. Measures of the intervals were performed in lead II, when feasible with lead V2 or I as second choice. QTc was calculated by the Bazett formula (QTc = QT/SQR (RR). QTc shorter than 440 ms and shorter than 460 ms were considered normal for men and women, respectively [18], [19] and because a QTc longer than 500 ms is known as predictor of torsades de pointes [19] both limits were used for the analysis. For overall ECG interpretation, the following criteria were used. Right atrial hypertrophy (RAH): p>2. 5 mV; left atrial hypertrophy (LAH): p>120 ms; right ventricular hypertrophy (RVH): Sokolow index right: RV1 and S V5>1. 05 mV, left ventricular hypertrophy (LVH): Cornell voltage: R aVL and SV3 men >2. 8; women >2. 0; peripheral low voltage: R I and RII and R III<1. 6 mV; PR depression: >0. 8 mV; ST elevation: >0. 1 mV without notch, concave, from deep S; ST depression: >1 mV; repolarization changes: limb leads: discordant in at least one lead; precordial leads: negative in either V3, V4, V5 or V6. Early repolarization type: ST elevation concave, notch at the J point, positive T waves. Normal ECG included axis deviation, early repolarization type [20], ST elevation >0. 1 mV without notch, concave, from deep S in precordial leads [20] and partial right bundle brunch block (RBBB). Minor ECG changes included intraventricular conduction delay, left or right atrial hypertrophy, isolated premature atrial or ventricular captures and left anterior hemiblock (LAHB). Major changes included: AV block I–III, low voltage, left and right ventricular hypertrophy, complete bundle branch block, PR depression, ST depression and repolarization changes. Written informed consent (illiterates signed by fingerprint) was obtained from all study participants. Ethical approval was granted by the Ethics Committees of the DRC, Angola, South Sudan and the Ethics Committee for the two cantons of Basel, Switzerland (Ethikkomission beider Basel). Data from the various studies were pooled into one single database that contained the clinical examination, demographic data and the ECG details. Analysis was done using the statistical software package STATA 9. 0 (www. stata. com). All continuous variables are reported as mean±SD. A p-value<0. 05 was considered statistically significant. Nominal variables were compared using the Χ2- test. Comparisons between the patient groups and treatments were performed using the t-test, ANOVA plus Bonferroni correction, the Kruskal Wallis or Mann Whitney U tests where appropriate. Patient baseline characteristics are summarized in Table 1. Age and gender distribution were similar among the disease stages, the HAT treatment groups and the healthy controls, respectively. Pyrimethamine-sulfadoxine (SP) was given as first line malaria treatment prior to HAT treatment in all centers with the exception of CNPP Kinshasa, where quinine was used as standard malaria treatment due to the high level of SP resistance in Kinshasa. The ECG baseline intervals and characteristics are listed by disease stage in Table 2. At baseline, QTc prolongation, which was defined as >440 ms in men and, >460 ms in women, was observed in 11–13% of all HAT patients. These QTc values are considered to represent an increased risk for arrhythmia. Only one patient had a QTc interval over 500 ms, which is associated with an elevated risk for torsade de pointes. The proportion of major ECG findings indicating heart involvement was significantly lower (p-value = 0. 0001) in first stage (53. 5%) than in second stage HAT (69. 5%). The QTc interval of HAT patients treated with melarsoprol following malaria treatment was 412 msec in the sulfadoxin/pyrimethamin group (SD 19) and 431 msec (SD 24) in the quinine group. Changes of ECG intervals and findings according to the different treatment groups are shown in the Table 3 and 4. During treatment, no patient in the DB289 or the pentamidine groups developed a QTc longer than 500 ms. One patient with a QTc longer than 500 ms at baseline had a normal QTc after treatment. In the group of second stage patients, one patient developed a significantly prolonged QTc interval during melarsoprol treatment. The development or disappearance of AV block I consisted mostly of increases or decreases of a few milliseconds, usually from just below to just above the upper limit of normal (200 ms) or vise versa. During the treatment period in the DB289 group no relevant conduction problems such as AV block II or III or ventricular arrhythmias were seen. In the pentamidine group, two patients developed an AV block II (Type Wenckebach), which resolved spontaneously and was asymptomatic. One patient with second stage HAT developed a bigeminal rhythm during treatment with melarsoprol, which subsided after administration of corticosteroids. There were no further significant changes in rhythm or conduction, such as ventricular arrhythmia, appearance of AV block III or formation of bundle branch block, observed in ECG recordings during treatment compared to baseline or during treatment compared to after treatment. Cardiac involvement, as demonstrated by ECG alterations, appears early in the evolution of HAT and precedes CNS involvement. As HAT itself was associated with QTc prolongation in more than 10% of patients, the additional risk of a drug with potential QTc prolongation properties has to be considered because of the risk of fatal arrhythmias. DB289 and pentamidine treatment were not associated with prolongation of the QTc intervals and they had no obvious cardiotoxic effect. During treatment, ECG changes such as repolarization alterations occurred frequently, were not associated with one specific drug, and were more common in the second stage of the disease.

Title: Cardiac Alterations in Human African Trypanosomiasis (T.b. gambiense) with Respect to the Disease Stage and Antiparasitic Treatment Summary: In Human African Trypanosomiasis (HAT), neurological symptoms dominate and cardiac involvement has been suggested. Because of increasing resistance to the available drugs for HAT, new compounds are desperately needed. Evaluation of cardiotoxicity is one parameter of drug safety, but without knowledge of the baseline heart involvement in HAT, cardiologic findings and drug-induced alterations will be difficult to interpret. The electrocardiogram (ECG) is a tool to evaluate cardiac involvement and the risk of arrythmias. We analysed the ECG of 465 HAT patients and compared them with the ECG of 61 healthy volunteers. In HAT patients the QTc interval was prolonged. This comprises a risk of fatal arrhythmias if new drugs with antiarrhythmic potential will be used. Further, repolarization changes and low voltage were more frequent than in healthy controls. This could be explained by an inflammation of the heart. Treatment of HAT was associated with appearance of repolarization changes but not with a QTc prolongation. These changes appear to be associated with the disease, but not with a specific drug. The main conclusion of this study is that heart involvement is frequent in HAT and mostly well tolerated. However, it can become relevant, if new compounds with antiarrhythmic potential will be used.

lay_plos

en

Write a title and summarize: The view from the hills overlooking the Mamand Valley is beautiful. Green fields and trees fill the valley floor. Ahead, the valley narrows and hills become mountains. In the distance rises the magnificent Spin-Ghar, the White Mountain, which marks the border between Pakistan and Afghanistan. But there was no chance of quiet contemplation when I visited this area of Nangarhar province. Above, three types of American fighter planes were circling and dropping bombs. One bomb hit the narrow part of the valley. It was there, a young soldier told me, that the weapon known as the Mother of All Bombs (MOAB) had been used. I was confused. Reports of the bomb had made me think that it had wiped out the IS stronghold here in Achin district. I assumed that US and Afghan troops would have sealed off the area and that IS (or Daesh, as it is known here) would be in disarray. An Afghan officer corrected me. "For a start this bomb wasn't as powerful as you think," he said. "There are still green trees standing 100m away from the site of the impact." A large number of IS militants were killed by the MOAB, but it is hard to know how many. The Achin district governor, Ismail Shinwary, says at least 90. Either way, the battle against IS continues. "Daesh hasn't gone anywhere; there are hundreds of caves like the one the Americans bombed," the officer says, adding that strikes have continued since the bomb was dropped. "They can't get rid of them like this." The fighting appeared to be taking place along a huge area in the mountains. The bombardment was relentless, filling the valley with smoke and noise. But IS were taking casualties. Over a breakfast of eggs and green tea, the district police chief, Major Khair Mohammad Sapai, showed us pictures of dead IS fighters. They had beards and long hair. In death they looked pitiable, quite unlike the image they try to portray in their propaganda videos - riding horses, carrying their black flags or making the local Shinwari people sit on bombs and then blowing them up. Major Khair said some of them were foreigners, but from their disintegrating, dust-covered faces it was hard to tell. He showed us hand-written lists of Afghan telephone numbers seized during operations, and some of the names on the list were indeed Arabic or Pakistani. The major's claims were backed up by Hakim Khan Momand and his friends. They are members of the so-called "people's uprising" - new militias made up of local people that help with security in the area. They cooperate with state security forces but their existence is seen as a sign of weak central government and instability. The bearded men lay on portable cots, drinking strong green tea and relishing the sight of IS fighters being bombed by American planes. "They are all sorts - Uzbeks, Tajiks, Arabs and Wahhabis from Kunar Province. They have nowhere to go; best to bury them in the caves where they happen to be hiding," Hakim Khan said. His house lies in the Mamand Valley, in an area still under the control of IS. He adds: "God willing, the Americans have given us their word that they would clear the entire valley of Daesh fighters." Unlike the Taliban, who tend to have many supporters in their core areas, IS seem to have angered a lot of people. Few seemed unhappy about the US bombardment. A couple of kilometres from the frontline, ordinary life was continuing. Women carried water, boys played cricket and people went about their daily tasks. However, there was anxiety. One man, Khaled, said local people were pawns in a US game. "[Dropping the bomb] was a trick to show the world that their mission was going well. But this wasn't the type of bomb they showed in the media. The bomb did nothing." "Will IS come back?" I asked. "Yes, as soon as the government leaves, the locals won't be able to fight them. If the government makes permanent bases in the area and helps us, then we will be happy," he answered. Another local resident suggested IS could do with something a little stronger. "Let Americans bring down a bigger one, this one was small," he said. Back in the hills, Hakim Khan and his friends were listening in to IS fighters communicating via walkie-talkies with the help of their radio. The fighters were reassuring each other and communicating with their comrades in a neighbouring district. A border police officer wondered aloud if the commitment of the Trump administration would match that of IS. "The more we kill, the more they come from the other side of the Durand line, in Pakistan," he said. How successful has IS been in Afghanistan? The new 'Great Game' in Afghanistan After a night back in the safety of Jalalabad, we returned the next morning. There was no fighting so we drove into the valley until we were stopped near the bomb impact site by Afghan special forces, who agreed to show us around. They said that IS fighters saw the district as their own. After most locals fled, IS banned poppy cultivation and began farming wheat, turning the valley green. Now the lush allotments were their battlefields. Bodies lay next to hollow trees that fighters had been sleeping inside. Shear, a tough-looking special forces soldier, said that IS fighters were "crazy" and very committed. "They make the most of their basic Russian guns; they are technical fighters," he said. "You can't hear them coming in the mountains: they will wear six pairs of socks and get within striking distance without you hearing them. "In the mountains they fight individually or in groups of two or three. They don't leave their positions, so you have to kill them. And their friends don't come to collect their bodies; they lie where they die." We waited for permission to visit the impact site, surrounded by crates of military supplies dropped from the air. Our escort was Haji Beag, a unit commander, who first showed us a smaller "IS command base and prison". One door opening into a spacious courtyard led to a room which led to a small cave that could house around 10 people. It was dug into the rock and felt very solid. It was clear why finding and killing IS militants in these mountains took so much time and energy. At the entrance to the cave stood an improvised cage, made of mesh frames. It held two tight spaces which Haji Beag said were used as prison cells. He said he believed the US made a good decision to use the MOAB to target caves used over decades by different militant groups - from the Mujahedeen, to the Taliban, and most recently IS. "We found about 20 bodies around the site after the explosion. The cave system has been destroyed," he said. "It's possible that most of dead are buried inside those caves." Read more: How powerful is'mother of all bombs'? What will Trump do about Afghanistan? The drive to the impact site with Haji Beag and his unit was a short one. American planes were still flying above us, targeting the next valley a kilometre away. The mountainous terrain was hard on our four-wheel drive and as we approached the site a rocket landed 200m in front of us. No one was hurt, but it made Haji Beag cautious, and we weren't allowed to set foot on the impact site. But we could see it, and it was unremarkable. There was no big crater. Trees had been burnt and a few rooms had been flattened. Not far from it, houses still stood and there were green trees around. As we left the valley, the bombardment continued. It seemed clear that the bomb that was dropped on 13 April had not come close to delivering a knock-out blow to IS militants entrenched in the area, and the locals certainly expect more conflict ahead. To me, at least, the Mother Of All Bombs failed to live up to her reputation.

Title: The Mother of All Bombs: How badly did it hurt IS in Afghanistan Summary: On 13 April the US dropped one of its largest non-nuclear bombs on a tunnel complex used by so-called Islamic State militants in eastern Afghanistan. It was the first time such a weapon had been used in battle. The BBC's Auliya Atrafi has been to the area to see if it really had any impact in the battle against IS.

xlsum_en

en

Summarize: CROSS-REFERENCES AND RELATED APPLICATIONS [0001] This application claims the benefit of priority to Chinese Application No. 201510816842.9, entitled “A Method for Inactivating Cronobacter Sakazakii ”, filed Nov. 23, 2015, which is herein incorporated by reference in its entirety. BACKGROUND OF THE INVENTION [0002] Field of the Invention [0003] The invention is in the field of food safety technologies. In particular, it relates to a method for inactivating Cronobacter sakazakii. [0004] Description of the Related Art [0005] Cronobacter spp. (formerly known as Enterobacter sakazakii ) is an gram-negative, motile, non-spore forming, rod-shaped and facultative anaerobe foodborne pathogen, which can survive at 6° C.˜45° C. and grow well at 37° C.˜43° C. A few of Cronobacter strains can grow slowly above 47° C. or below 0° C. Cronobacter can grow in many kinds of culture medium, such as nutrient agar, eosin methylene blue (EMB) agar, tryptone soy agar (TSA) and deoxycholate agar, etc. All of Cronobacter strains can rapidly grow on TSA and deoxycholate agar, forming bacterial colonies with a diameter of 1˜1.5 mm after cultivation at 36° C. for 24 hours and forming bacterial colonies with a diameter of 2˜3 mm and producing yellow pigment after cultivation at 36° C. for 48 hours. Cronobacter has strong acid resistance and weak alkaline resistance. [0006] At present, Cronobacter spp. has been included in the list of foodborne pathogens, which can be isolated from a wide range of food materials (e.g. meat, cheese, vegetables, grains, herbs, spices and powdered infant formula), environment (e.g. factories and homes) and insects. The CDC testing report between 2010 and 2011 showed that the Cronobacter detection rate of 175 food samples from Wuzhou, Guangxi was 5.26%, the Cronobacter detection rate of 891 food samples from Suqian, Jiangsu was 2.6%, the Cronobacter detection rate of 286 food samples from Changsha, Hunan was 6.3%. The data above suggested that the contamination of Cronobacter spp. in food was widely distributed in China. [0007] Research has shown that the sources of Cronobacter spp. contamination are mainly from three areas. The first source comes from clinical hospitals. In 1980, Farmer et al. first detected Cronobacter from patient&#39;s body fluid and secretion, and Cronobacter were found in the respiratory tracts of 29 patients in the same hospital 7 months later. The second source is from powdered infant formula. Although there are a lot of living places for Cronobacter in the environment, Cronobacter in powdered infant formula is directly related to human diseases. Lversen et al. detected Cronobacter and Enterobacteriaceae from powdered infant formula and 402 other food materials. The results showed that the detection rate in formula food, dried infant food, milk powder and cheese food were 2.4%, 10.2%, 4.1% and 3.3%, respectively. Other enteric bacteria and Salmonella were not detected in these foods. The third source is from the natural environment. Cronobacter spp. is widely distributed in the environment. Cronobacter was isolated from soil, sewer, plant roots and animal excrement as early as 1974. Therefore, in order to prevent contamination of Cronobacter, not only strict monitoring of the food production process is necessary, but strict disinfection of food production environment is also needed. [0008] Cronobacter spp. in PIF (powdered infant formula) is classified as a Class A pathogen. The Cronobacter contamination in PIF can cause neonatal infection in new born babies and lead to serious diseases, such as bacteremia, necrotizing enterocolitis and cephalomeningitis, which have a death rate as high as 40% to 80%. China is a big PIF production and consumption country. We have been facing the problem of Cronobacter contamination that has long time plagued the PIF industry. [0009] Powdered infant formula is a main source of Cronobacter spp. contamination and transmission. There are two major ways for Cronobacter contamination and transmission. The first way of contamination occurs during the process of raw materials addition and product drying and packaging in PIF production. The second way is contamination of PIF production environment, usage of contaminated equipments or during the process of milk powder reconstitution. Cronobacter has strong environmental tolerance, which enables it to survive in final products and the PIF processing environment. [0010] Although PIF is a major source of Cronobacter contamination and transmission, it still can be safe to eat as long as its production, processing and consumption are handled properly. Research showed that the PIF treated with high temperature or low temperature can reduce the survival rate of Cronobacter. In addition, some food additives can reduce the strains&#39; temperature tolerance, and may directly kill the bacteria. For the production equipment, especially the inner wall of each pipeline which is easy to form biofilms, timely cleaning and effective disinfection are necessary to reduce the risk of Cronobacter contamination. For milk powder reconstitution, cleaning and disinfecting the tableware in advance are needed. The temperature of water needs to be higher than 80° C. It&#39;s better not to eat the leftover of the dissolved milk to avoid the second contamination of Cronobacter. To reduce the risk of Cronobacter contamination, continuous monitoring of raw materials and production environment must be carried out. To completely prevent and control Cronobacter, there is a urgent need of a safe and effective method for inactivating Cronobacter. [0011] In recent years, natural extracts have attracted the attention of researchers because of their natural advantage, convenience and easy access. The antimicrobial effect of natural extracts has also attracted much attention. The use of natural extracts to prevent and control Cronobacter contamination becomes the future trend of development. BRIEF SUMMARY OF THE INVENTION [0012] To solve aforementioned problems, the present invention provides a method for inactivating Cronobacter Sakazakii ( C. Sakazakii ) using tea polyphenols as the active ingredient. The method for killing Cronobacter Sakazakii and preventing Cronobacter Sakazakii contamination can be performed as follows: [0013] In one embodiment of the present invention, tea polyphenols are dissolved in normal saline or water, Cronobacter sakazakii contaminants are treated with tea polyphenols solution to inactivate Cronobacter sakazakii; [0014] In one embodiment of the present invention, tea polyphenols and other bactericidal or antimicrobial chemicals are dissolved in normal saline or water to obtain a mixed solution, Cronobacter sakazakii contaminants are treated with the mixed solution to inactivate Cronobacter sakazakii; [0015] In one embodiment of the present invention, tea polyphenols are directly dissolved in a matrix solution (a matrix solution is a solution or suspension in which additional components may be added. For example, rehydrated PIF, normal saline or water can be used as a matrix solution), and the pH of the tea polyphenol solution is adjusted, and Cronobacter sakazakii contaminants are treated with the tea polyphenol solution to inactivate Cronobacter sakazakii; [0016] In one embodiment of the present invention, tea polyphenols and other bactericidal or antimicrobial chemicals are dissolved in a matrix solution, and the pH of the matrix solution is adjusted, and Cronobacter sakazakii contaminants are treated with the above solution to inactivate Cronobacter sakazakii. [0017] In a preferred embodiment of the present invention, the mass concentration of the tea polyphenols in is 0.3%˜3%. [0018] In a preferred embodiment of the present invention, the mass concentration of the tea polyphenols is 0.3%˜3% and the pH of the tea polyphenol solution is adjusted to be 3-5. [0019] In a preferred embodiment of the present invention, the matrix solution is an acidic food. [0020] In a preferred embodiment of the present invention, the acidic food is acidic drinks, acidic milk drinks or yoghurt. [0021] In an preferred embodiment of the present invention, the other bactericidal or antimicrobial chemicals are chosen from the group consisting of ascorbic acid, malic acid, and citric acid. [0022] In one embodiment of the present invention, tea polyphenols are dissolved in normal saline or water with a mass concentration of 0.3%˜3%, Cronobacter sakazakii contaminants are treated with tea polyphenol solution for no less than one hour to inactivate Cronobacter sakazakii. [0023] In one embodiment of the present invention, tea polyphenols and other bactericidal or antimicrobial chemicals are dissolved in normal saline or water to obtain a mixed solution, Cronobacter sakazakii contaminants are treated with the mixed solution for no less than 1 hour to inactivate Cronobacter sakazakii ; and the mass concentration of the tea polyphenols is 0.3%˜3%. The other bactericidal or antimicrobial chemicals are one or more acids selected from ascorbic acid, malic acid, and citric acid. [0024] In one embodiment of the present invention, tea polyphenols are dissolved in the matrix solution with the pH adjusted to 3-5, Cronobacter sakazakii contaminants are treated with the above solution for no less than 7 hour to inactivate Cronobacter sakazakii. [0025] In one embodiment of the present invention, tea polyphenols and other bactericidal or antimicrobial components are dissolved in the matrix solution, and the pH is adjusted to 3-5, Cronobacter sakazakii contaminants are treated with above solution for no less than 7 hour to inactivate Cronobacter sakazakii, wherein the mass concentration of the tea polyphenols is 0.3%˜3%. [0026] Any of the above methods can be applied to prevent, control and eliminate the contamination of Cronobacter sakazakii in food or food production process, and to treat Cronobacter sakazakii contaminants or contaminated environment. [0027] The present invention has the following benefits: [0028] 1) The present invention provides a method of using acidified tea polyphenols to inactivate Cronobacter. It provides a new venue for using natural extracts to prevent and control Cronobacter. It provides new cleaning and evaluation methods to better control and eliminate the contamination of Cronobacter. It provides guidance to dairy production and safety in terms of Cronobacter prevention and control. [0029] 2) Based on the preliminary studies of the inactivation mechanism of tea polyphenols on Cronobacter, it is found that tea polyphenols can destroy the structure of the bacterial cell, and it has an irreversible and strong bactericidal effect on Cronobacter. Tea polyphenols can prevent resurrection and secondary contamination of Cronobacter. As tea polyphenols are natural extracts, it is relatively safe to use them in the food sterilization process. [0030] 3) The method of the present invention can be used to control and eliminate the contamination of Cronobacter, especially during the production of PIF. The method is a great cleaning and disinfection method for effectively reducing the survival of Cronobacter in PIF production equipment and environment, especially in inner walls of production pipelines where biofilms can easily form. [0031] 4) The method of the invention is simple and easy to practice, and can be applied in a wide range of applications. BRIEF DESCRIPTION OF THE DRAWINGS [0032] FIG. 1. Tolerance of Cronobacter sakazakii strains ES45, ES46, ES37, and ES39 to different natural extracts. A, Cronobacter sakazakii ES45; B, Cronobacter sakazakii ES46; C, Cronobacter sakazakii ES37; D, Cronobacter sakazakii ES39. (PIF: powdered infant formula, TP: tea polyphenols, VC: ascorbic acid) [0033] FIG. 2. Tolerance of Cronobacter sakazakii strains ES45, ES46, ES37 and ES39 to different acidified natural extracts. A, Cronobacter sakazakii ES45; B, Cronobacter sakazakii ES46; C, Cronobacter sakazakii ES37; D, Cronobacter sakazakii ES39. [0034] FIG. 3. Tolerance of Cronobacter sakazakii strains to tea polyphenols and acidified tea polyphenols. A, tea polyphenols; B, acidified tea polyphenols. [0035] FIG. 4. The electron micrographs of Cronobacter sakazakii strains growing in different media. A, in the LB broth; B, in the normal saline with 0.5% tea polyphenols. DETAILED DESCRIPTION OF THE INVENTION [0036] The following examples are provided by way of illustration only, not by way of limitation. It is not intended to use these examples to limit the scope of the invention, which is only defined by the appended claims. [0037] Bacterial suspension used in the Examples is Cronobacter sakazakii cell suspension, and samples used in the Examples are free from Cronobacter infection before addition of Cronobacter sakazakii. [0038] Cronobacter Sakazakii isolated from Chinese PIF and its processing environment is used as the study subject. Four C. sakazakii strains, ES37 (ST8), ES39 (ST1), ES45 (ST4) and ES46 (ST64), were identified by multilocus sequence typing, and selected as representative strains in the Examples. [0000] Preparation of C. sakazakii Cell Suspensions [0039] After C. sakazakii cells were cultured in a LB broth at 37° C. for 12 hours, 2 mL of culture medium was transferred to a sterile centrifuge tube and centrifuged at 8000×g for 10 min, then washed twice with normal saline (NS) at room temperature. The supernatants were discarded and the pellets were re-suspended in 1 mL of sterile NS to obtain cell suspensions with a final concentration of approximately 8.0 Log CFU/mL. For enumeration, 0.1 mL of the cell suspensions were streaked in duplicate on Tryptic Soy Agar (TSA) plates after serial dilution in NS and incubated at 37° C. for 24 hours. Example 1. The Tolerance of Cronobacter sakazakii to Tea Polyphenols [0040] 1. The Antibacterial Activity of Tea Polyphenol Solutions on C. sakazakii [0041] 0.3 g, 0.5 g, 1 g, 2 g and 3 g of the tea polyphenols (TP) were separately dissolved in 100 mL saline. 8.0 Log CFU/mL cell suspensions of C. sakazakii were added to tea polyphenol solutions to obtain a final concentration of approximately 7.0 Log CFU/mL. The cell suspensions with different amounts of tea polyphenol were incubated at 37° C. for 7 hours, and then mixed to make sure that the solution was homogeneous. After serial dilution with NS, 0.1 mL of appropriately diluted cultures were spread-plated on TSA plates in duplicate and incubated upside down at 37° C. overnight to observe the growth of C. sakazakii. The physiological saline and the physiological saline with the same pH as tea polyphenol solution were separately used as the control groups. The results were as follows: no C. sakazakii was detected after 7 hours of incubation in the TP solutions, and Cronobacter sakazakii survived in the normal physiological saline and the physiological saline with the same pH as tea polyphenol solutions. The results showed that tea polyphenols have antibacterial activity. 2. Comparison of Bactericidal Activity of Tea Polyphenol Solutions in Different Concentrations [0042] 0.1 g, 0.2 g, 1 g, 0.3 g, 0.5 g, 1 g, 3 g, 5 g of the tea polyphenols (TP) were separately dissolved in 100 mL NS. 1 mL 8.0 Log CFU/mL cell suspensions of C. sakazakii were added to the above TP solutions to obtain final concentrations of approximately 7.0 Log CFU/mL. The cell suspensions with different treatments were incubated at 37° C. for 7 hours, and taken out the incubator and mixed to make sure that they were homogeneous. After serial dilution with the saline, 0.1 mL of appropriately diluted cultures were spread-plated on TSA plates in duplicate and incubated upside down at 37° C. overnight to observe the growth of Cronobacter sakazakii. The physiological saline was used as the control groups. The results were shown in Table 1. [0000] TABLE 1 bactericidal effect of tea polyphenol solutions Strain Mass concentration of TP/% number 0 0.1 0.2 0.3 0.5 1 3 ES37 + + − − − − − ES39 + + + − − − − ES45 + + + − − − − ES46 + + − − − − − Note: “+” means survival, “−” means death [0043] Table 1 showed that the tea polyphenols solution had the best bactericidal effect with the concentration of 0.3%˜3% Example 2. The Tolerance of Cronobacter sakazakii to Different Natural Extracts [0044] The tea polyphenols was added into liquid milk. Due to pH buffering effect of liquid milk, the TP milk solution could not have the acid pH required for tea polyphenols to perform anti-bacterial function. This example studied the conditions for tea polyphenols to kill C. sakazakii in the liquid milk. 1. Preparation of Solutions [0045] A commercial PIF (Wondersun, Harbin, Hei Longjiang Province, China) was purchased and reconstituted according to the manufacturer&#39;s instruction. Briefly, 15 g of the PIF was reconstituted in 100 mL of sterile distilled water. 5 mg/mL TP, malic acid, citric acid or ascorbic acid (VC) was added to the rehydrated PIF, and shaken gently to make sure that it was fully dissolved. A pH meter was used to determine the pH of all the solutions. The initial pH of rehydrated PIF was 6.82 and it dropped to pH 3.62, pH 3.55, pH 4.55 and pH 6.46 after added 5 mg/mL malic acid, citric acid, VC and TP, respectively. The final concentration of the natural extract solutions was 0.5% and the milk powder solutions were packed into different test tubes with 9 ml solution in each tube. Milk powder solution without any natural extract product was used as the control group. [0000] 2. Treatment of C. sakazakii with Different Natural Extract Solutions [0046] 1 mL of 8.0 Log CFU/mL cell suspensions of four C. sakazakii strains were separately added to 9 mL rehydrated PIF with different natural extracts prepared above to obtain final concentrations of approximately 7.0 Log CFU/mL. The cell suspensions with different natural extracts were incubated at 37° C. for 1, 3, 5 and 7 hours, and mixed to make sure that the solutions were homogeneous. After serial dilution with NS, 0.1 mL of appropriately diluted cultures were spread-plated on TSA plates and incubated upside down at 37° C. overnight to observe the growth of Cronobacter sakazakii. [0047] The tolerance of four different ST types of Cronobacter sakazakii to different natural extracts was studied by serial dilution plate count method. The cell suspensions were separately added to PIF containing 0.5% tea polyphenols, 0.5% VC, 0.5% malic acid or 0.5% citric acid. The pH of each solution was measured using a pH meter and the plate count analysis was carried out at different time points of incubation. The results were shown in FIG. 1. [0048] According to the FIG. 1, we found that all four strains in the infant formula milk powder solution (pH 6.82) had a rapid growth trend. C. sakazakii strains treated with 0.5% TP in PIF (pH 6.46) and 0.5% VC in PIF (pH 4.55) had shown a slower growth trend. The number of bacteria in PIF containing 0.5% malic acid (pH 3.55) did not change much over the 7 hours of incubation. Only C. sakazakii strains in PIF containing 0.5% citric acid (pH 4) had shown a downward trend. The results showed that citric acid in PIF had some antibacterial effect, the antibacterial effect of VC and malic acid was not obvious, and the antibacterial effect of tea polyphenols in PIF was relatively poor. In addition, the results showed that there were significant differences (p&lt;0.05) at different time points for the same treatment. The order of inhibition strength by different treatments was showed as below: malic acid (pH 3.62)&gt;citric acid (pH 3.55)&gt;VC (pH 4.55)&gt;TP (pH 6.46). The addition of natural extracts into PIF changes the pH of the solutions. In order to eliminate the influence caused by the difference in acidity, it was necessary to have the same pH for every treatment group. [0049] This example investigated the tolerance of four C. sakazakii strains to different natural extracts. The rehydrated PIF was used as the matrix solution, and 0.5% TP (pH 6.46), VC (pH 4.55), malic acid (pH 3.55) or citric acid (pH 3.62) was added into the PIF solution. The PIF without adding any substance (pH 6.82) was used as the blank control. The results showed that citric acid had some antibacterial effect, and the antibacterial effect of tea polyphenols, VC and malic acid in PIF were not obvious. The order of antimicrobial strength of the natural extracts was shown as below: citric acid (pH 3.62)&gt;malic acid (pH 3.55)&gt;VC (pH 4.55)&gt;tea polyphenols (pH 6.46). Although the pH after the addition of 0.5% malic acid was down to 3.55, which was lower than that of the citric acid solution, the results showed that the bactericidal effect of citric acid was better than that of malic acid. Citric acid, malic acid and VC are organic acids. Reports have shown that inhibitory effect of organic acids depends on its dissociation forms, and only undissociated form of organic acids had desirable antimicrobial effect. Dissociative form of organic acids had no significant antibacterial effect. The organic acid in its undissociated form is lipophilic. It enters the cytoplasm by passive diffusion. Since the intracellular pH is close to 7, organic acid is dissociated to release H + after entering the cytoplasm, lowering the pH inside the cells. With the increase of intracellular H + concentration, bacteria rely on the ATP enzyme to pump extra H + out of the cell. This process is very energy consuming, and it can cause bacteria to die of exhaustion. In addition, a large number of anions accumulated inside the cells lead to the change of osmotic pressure of the cells, which results in cell toxicity, such as cessation of nucleic acid synthesis and glycolysis, disorder of enzymatic transduction, and inhibition of enzymatic hydrolysis reaction. Example 3. The Tolerance of Different Cronobacter sakazakii Strains to Acidified Natural Extracts Preparation of Solution [0050] A commercial PIF (Wondersun, Harbin, Hei Longjiang Province, China) was purchased and reconstituted according to the manufacturer&#39;s instruction. Briefly, 15 g of the PIF was reconstituted in 100 mL of sterile distilled water. 5 mg/mL TP was added to the rehydrated PIF and shaken gently to make sure it was fully dissolved. As controls, malic acid, citric acid and VC were dissolved in PIF in the same way as that of TP. A pH meter was used to determine the pH of all solutions. The initial pH of rehydrated PIF was 6.82 and the value of pH dropped to pH 3.62, pH 3.55, pH 4.55 and pH 6.46 after addition of 5 mg/mL malic acid, citric acid, VC and TP, respectively. The final concentration of the natural extract solutions was 0.5% (w/v) and PIF solutions were packed into different test tubes, each tube with 9 mL solution. PIF solution without adding additional substance was used as the blank control group. Acidification Treatment of Different Natural Extract Solution [0051] In order to eliminate the effect of pH on the growth of Cronobacter sakazakii, it is necessary to adjust the pH for each treatment group to be the same. The pH of all the treatment groups was adjusted to pH 3.55 with 4 M HCl and 4M NaOH, which was the minimum pH of all the treatment solutions. The PIF acidified with HCl was used as the control. 1 mL of 8.0 Log CFU/mL cell suspensions of the four C. sakazakii strains were separately added to 9 mL acidified PIF with different natural extracts. PIF without adding other substance was used as the blank control. The culture condition of the C. sakazakii was the same as described in Example 2. [0052] The experimental results on the tolerance of four C. sakazakii strains to different natural extracts (pH 3.55) were shown in FIG. 2. The results showed that all the four strains had exhibited a rapid growth in PIF (pH 6.82). On the contrary, the number of bacteria in the other five treatment groups showed a downward trend, and the number of viable C. sakazakii was significantly different (p&lt;0.05) at different time points for the same treatment group. Among them, the tea polyphenols (pH 3.55) had the strongest antibacterial effect. When treated with the TP solution (pH 3.55) for 7 hours, all the four strains were completely inactivated. The VC after acidification treatment showed stronger antibacterial activity than before. The inhibitory effect of citric acid before and after acidification were not significantly different. This may be due to the small pH change before and after acidification of citric acid solution. PIF with HCl acidification also showed some inhibitory effect. Overall, the inhibitory effect of the various natural extracts after acidification had been enhanced, and acidified tea polyphenols had the strongest antimicrobial effect. [0053] The pH of the PIF solution changed after adding different natural extracts. Therefore, the pH of all the PIF solutions containing natural extracts was adjusted to 3.55 using 4M HCl, which was the lowest pH of all the treatment solutions. The experimental results showed that acidified tea polyphenols had the strongest antibacterial effect. Organic acids exert the antimicrobial effect mainly by changing the pH inside the cell. The VC after acidification treatment showed stronger antibacterial activity than before the treatment. The inhibitory effect of citric acid before and after acidification was not significant. This may be due to the small pH change. PIF with HCl acidification also showed some antimicrobial effect. Overall, the inhibitory effect of the various natural extracts after acidification had been enhanced. This might be due to a synergistic action between inorganic acid HCl and the organic acid. Under the condition of low pH, the organic acids exhibited mostly as non-dissociated form, which enhanced their antibacterial effect. The tea polyphenols showed a much stronger antibacterial effect after acidification. Example 4. Recovery of the Stressed C. sakazakii Cells after Tea Polyphenol Treatments [0054] The matrix solution used in the above examples was PIF, in which the tolerance of C. sakazakii to different natural extracts and acidified natural extracts were studied. In order to better study the tolerance of C. sakazakii to natural extracts, the normal saline (normal saline (NS) is a solution composed of 0.85 to 0.95 percent salt in distilled water. The most frequently used salt is sodium chloride, and it can be sodium phosphate as well.) was used as the matrix solution. 9 mL of 0.5% TP dissolved in 0.85% NS and 1 mL of 8.0 Log CFU/mL cell suspensions were added together. The cell suspensions were incubated at 37° C. for 1, 3, 5 and 7 hours. After serial dilution with 0.85% NS, the cultures were spread-plated on TSA plates and incubated upside down at 37° C. overnight to observe the growth of C. sakazakii. [0055] The results showed that, for all the four C. sakazakii strains, no viable cells was detected after the treatment with acidified 0.5% TP in PIF for 7 hr or 0.5% TP in 0.85% normal saline for 1 hr. Recovery of the stressed C. sakazakii cells after TP treatment was studied to further test the antibacterial effect of TPs. [0056] After treatment with 0.5% acidified TP in rehydrated PIF for 7 hr or 0.5% TP in 0.85% NS for 1 hr, the four C. sakazakii strains were immediately transferred to fresh LB broth or PIF, and incubated at 37° C. for 6 hr and 12 hr to assess bactericidal or bacteriostatic activity of TP. The number of viable C. sakazakii cells were determined by plating 0.1 mL of appropriate diluents on TSA plates, and incubating the plates at 37° C. for overnight. Finally, count the number of colonies of Cronobacter sakazakii growing on the TSA plates. [0057] After the four C. sakazakii strains treated with 0.5% TP in PIF (pH 3.55) for 7 hr or in NS for 1 hr, the cell suspensions was added into LB broth and PIF solution for the recovery test. As shown in Table 2, the recovery test results indicated that the four C. sakazakii strains after the treatment with 0.5% TP acidified with HCl in PIF for 7 hr showed no growth after 6 hr and 12 hr incubation in fresh recovery (LB broth or PIF) media. Similarly, no C. sakazakii cells were able to restore growth in LB broth or PIF media after treatment with 5 mg/mL TP in NS (pH 3.47) for 1 hr. These results indicated that TPs have a bactericidal activity rather than just antimicrobial effect against C. sakazakii cells. The damage to C. sakazakii cells caused by TPs was not repairable. [0000] TABLE 2 Recovery experiments of acidified TP&#39;s toxicity against C. sakazakii strains Treatment Survival bacterial count (LogCFU/mL) under different ES39 ES45 ES37 ES46 conditions TIME LB PIF LB PIF LB PIF LB PIF A group 6 h − − − − − − − − 12 h − − − − − − − − B group 6 h − − − − − − − − 12 h − − − − − − − − Note: A group: C. sakazakii cells were treated with 0.5% TPs in PIF for 7 hr; B group: C. sakazakii cells were treated with 0.5% TPs in the normal saline for 1 hr; “−” means no survival bacterial count Example 5. The Mechanism of TP&#39;s Bactericidal Activity Against C. sakazakii [0058] In order to study the mechanism underlying the bactericidal effect of tea polyphenols against C. sakazakii, the C. sakazakii strains treated with TP in NS for 1 hr were examined by a transmission electron microscope (TEM), and the C. sakazakii strains cultured in LB broth for 1 hr were observed as controls. [0059] The four C. sakazakii ST strains treated with TP in NS for 1 hr and the ones incubated in LB broth for 1 hr were examined by TEM (see FIG. 4 ). Observed under the electron microscope, C. sakazakii grown in LB broth showed a rod shape with a smooth edge, the interior of the cell is full of contents, and the cytoplasm and cell wall were closely fitted (see FIG. 4A ). For cells treated in TP solution, all of four C. sakazakii strains showed similar characteristics, that is, the cell wall was destroyed and the cell morphology was altered to different degrees, which led to the overflow of inner cytoplasm and finally resulted in the death of the cells. It is clearly shown that tea polyphenols have irreversible bactericidal effect on C. sakazakii, and they can destroy the bacterial cell structure. Example 6. The Bactericidal Effects of Tea Polyphenol in PIF Solution with Different pHs [0060] 15 g PIF was reconstituted in 100 mL of sterile distilled water, and 5 mg/mL TP was added to the rehydrated PIF, and shaken gently to make sure that is was fully dissolved. The initial pH of rehydrated PIF was 6.46, and was adjusted to pH 3, 3.5, 4, 5 or 6 with 4 M HCl. 8.0 Log CFU/mL cell suspensions of C. sakazakii strains were added to TP solutions with different pHs, and the final concentration was approximately 7.0 Log CFU/mL. The cell suspensions with different treatments was incubated at 37° C. for 7 hr, and shaken to make sure that they were homogeneous. After serial dilution with the saline, 0.1 mL of appropriately diluted cultures were spread-plated on TSA plates in duplicate and incubated upside down at 37° C. overnight. Finally, the growth of Cronobacter sakazakii was observed. Cells cultured in the normal saline was used as control groups. The results were shown in table 3. [0000] TABLE 3 Comparison of bactericidal effect of tea polyphenol solutions with different pHs Strain pH number 3.0 3.5 4 5 6 ES37 − − − − − ES39 − − − − + ES45 − − − − − ES46 − − − − + Note: “+” means survival, “−” means death [0061] Table3 showed that the tea polyphenols solution has the best bactericidal effect in pH 3-5. 2. Comparison of Bactericidal Effect of Tea Polyphenols in PIF Solution at Different Concentrations [0062] 15 g PIF was reconstituted in 100 mL of sterile distilled water. 0.1 g, 0.2 g, 1 g, 0.3 g, 0.5 g, 1 g, 3 g, and 5 g tea polyphenols were separately dissolved in 100 mL above PIF solution, and the pH was adjust to 3.5. 1 mL 8.0 Log CFU/mL cell suspension of the C. sakazakii strains were separately added to the TP solutions to obtain a final concentration of approximately 7.0 Log CFU/mL. The cell suspensions with different TP treatments were incubated at 37° C. for 7 hr, and were shaken to make sure that they were homogeneous. After serial dilution with the saline, 0.1 mL appropriately diluted cultures were spread-plated on TSA plates in duplicate and incubated upside down at 37° C. overnight. Finally, the growth of Cronobacter sakazakii was observed. Cells incubated in the physiological saline was used as the control groups. The results were shown in table 4. [0000] TABLE 4 Comparison of bactericidal effect of tea polyphenol in PIF solution at different concentrations Strain Mass concentration of TP/% number 0.1 0.2 0.3 0.5 1 2 3 ES37 + − − − − − − ES39 + + − − − − − ES45 + + − − − − − ES46 + − − − − − − Note: “+” means survival, “−” means death [0063] Table 4 showed that the tea polyphenols in PIF solution has the best bactericidal effect at the range of 0.3%-3%. Example 7. Use of TP Solution (3%) to Clean PIF Production Equipment and Environment [0064] 3 g tea polyphenols was dissolved in 100 mL NS. Equipment, pipeline and environment in the factory, which have been already identified to be contaminated by Cronobacter sakazakii, were treated with above TP solution for 60 min After the TP treatment, no bacteria were detected in samples taken from the equipment, pipeline and environment previously contaminated by Cronobacter sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was used to wash the equipment and the pipeline, and to spray into the surrounding environment. Example 8. Use of TP Solution (2%) to Clean PIF Production Equipment and Environment [0065] 2 g tea polyphenols was dissolved in 100 mL NS. Equipment, pipeline and environment in the factory were treated with above TP solution for 60 min, which have been already identified to be contaminated by Cronobacter sakazakii. After the TP treatment, no bacteria were detected in samples taken from the equipment, pipeline and environment previously contaminated by Cronobacter sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was used to wash the equipment and the pipeline, and to spray into the surrounding environment. Example 9. Use of TP Solution (0.3%) to Clean PIF Production Equipment and Environment [0066] 0.3 g tea polyphenols was dissolved in 100 mL NS. Equipment, pipeline and environment in the factory were treated with above TP solution for more than 1 hr, which have been already identified to be contaminated by Cronobacter sakazakii. After the TP treatment, no bacteria were detected in samples taken from the equipment, pipeline and environment previously contaminated by Cronobacter sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was used to wash the equipment and the pipeline, and to spray into the surrounding environment. Example 10. Use of TP Solution (1%) to Clean PIF Production Equipment and Environment [0067] 1 g tea polyphenols was dissolved in 100 mL NS. Equipment, pipeline and environment in the factory were treated with above TP solution for 60 min, which have been already identified to be contaminated by Cronobacter sakazakii. After the TP treatment, no bacteria were detected in samples taken from the equipment, pipeline and environment previously contaminated by Cronobacter sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was used to wash the equipment and the pipeline, and to spray into the surrounding environment. Example 11. Use of TP Solution (1%) and Other Organic Acid to Clean PIF Production Equipment and Environment [0068] 1 g tea polyphenols and 0.5 g VC were dissolved in 100 mL NS. Equipment, pipeline and environment in the factory were treated with above TP solution for 60 min, which have been already identified to be contaminated by Cronobacter sakazakii. After the TP treatment, no bacteria were detected in samples taken from the equipment, pipeline and environment previously contaminated by Cronobacter sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was used to wash the equipment and the pipeline, and to spray into the surrounding environment. Example 12. Use of TP Solution (1%) and Other Organic Acid to Clean PIF Production Equipment and Environment [0069] 1 g tea polyphenols and 0.3 g citric acid were dissolved in 100 mL NS. Equipment, pipeline and environment in the factory were treated with above TP solution for more than 1 hr, which have been already identified to be contaminated by Cronobacter sakazakii. After the TP treatment, no bacteria were detected in samples taken from the equipment, pipeline and environment previously contaminated by Cronobacter sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was used to wash the equipment and the pipeline, and to spray into the surrounding environment. Example 13. Use of TP Solution (2%) to Clean Contaminated Rooms [0070] 2 g tea polyphenols was dissolved in 100 mL NS. Kitchen, bedrooms and other rooms that were contaminated with C. sakazakii were treated with above TP solution for more than 1 hr. Samples were taken from contaminated kitchen, bedroom, other rooms and the air. After the TP treatment, no C. sakazakii cells were detected in the kitchen, bedrooms, other rooms and the air previously contaminated by C. sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was painted to the contaminated object or sprayed into the surrounding environment. Example 14. Use of TP Solution (3%) to Clean Contaminated Rooms [0071] 3 g tea polyphenols was dissolved in 100 mL NS. Kitchen, bedrooms and other rooms that were contaminated with C. sakazakii were treated with above TP solution for more than 1 hr. Samples were taken from contaminated kitchen, bedroom, other rooms and the air. After the TP treatment, no C. sakazakii cells were detected in the kitchen, bedrooms, other rooms and the air previously contaminated by C. sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was painted to the contaminated object or sprayed into the surrounding environment. Example 15. Use of TP Solution (1%) to Clean Contaminated Rooms [0072] 1 g tea polyphenols was dissolved in 100 mL NS. Kitchen, bedrooms and other rooms that were contaminated with C. sakazakii were treated with above TP solution for more than 1 hr. Samples were taken from contaminated kitchen, bedroom, other rooms and the air. After the TP treatment, no C. sakazakii cells were detected in the kitchen, bedrooms, other rooms and the air previously contaminated by C. sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was painted to the contaminated object or sprayed into the surrounding environment. Example 16. Use of TP Solution (1%) to Clean Contaminated Rooms [0073] 0.3 g tea polyphenols was dissolved in 100 mL NS. Kitchen, bedrooms and other rooms that were contaminated with C. sakazakii were treated with above TP solution for more than 1 hr. Samples were taken from contaminated kitchen, bedroom, other rooms and the air. After the TP treatment, no C. sakazakii cells were detected in the kitchen, bedrooms, other rooms and the air previously contaminated by C. sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was painted to the contaminated object or sprayed into the surrounding environment. Example 17. Use of TP Solution (0.3%) and Other Organic Acid to Clean Contaminated Rooms [0074] 0.3 g tea polyphenols and 0.5 g malic acid were dissolved in 100 mL NS. Kitchen, bedrooms and other rooms that were contaminated with C. sakazakii were treated with above TP solution for more than 1 hr. Samples were taken from contaminated kitchen, bedroom, other rooms and the air. After the TP treatment, no C. sakazakii cells were detected in the kitchen, bedrooms, other rooms and the air previously contaminated by C. sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was painted to the contaminated object or sprayed into the surrounding environment. Example 18. Use of TP Solution (1%) and Other Organic Acid to Clean Contaminated Rooms [0075] 1 g tea polyphenols and 0.3 g citric acid were dissolved in 100 mL NS. Kitchen, bedrooms and other rooms that were contaminated with C. sakazakii were treated with above TP solution for more than 1 hr. Samples were taken from contaminated kitchen, bedroom, other rooms and the air. After the TP treatment, no C. sakazakii cells were detected in the kitchen, bedrooms, other rooms and the air previously contaminated by C. sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was painted to the contaminated object or sprayed into the surrounding environment. Example 19. Use of TP Solution (0.3%) and Other Organic Acid to Clean Contaminated Rooms [0076] 0.3 g tea polyphenols and 0.3 g VC were dissolved in 100 mL NS. Kitchen, bedrooms and other rooms that were contaminated with C. sakazakii were treated with above TP solution for more than 1 hr. Samples were taken from contaminated kitchen, bedroom, other rooms and the air. After the TP treatment, no C. sakazakii cells were detected in the kitchen, bedrooms, other rooms and the air previously contaminated by C. sakazakii. The bactericidal effect of the TP solution was quite obvious. To apply the TP treatment, the TP solution was painted to the contaminated object or sprayed into the surrounding environment. Example 20. Use of TP Solutions to Inactivate C. sakazakii in Dairy Products [0077] C. sakazakii was treated with TP solutions as follows. The growth of the bacteria was observed. [0078] A: 0.3 g tea polyphenols was added in 100 mL liquid milk, and the pH was adjusted to 3. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0079] B: 0.5 g tea polyphenols was added in 100 mL liquid milk, and the pH was adjusted to 3.5. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0080] C: 1 g tea polyphenols was added in 100 mL liquid milk, and the pH was adjusted to 4. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0081] D: 3 g tea polyphenols was added in 100 mL liquid milk, and the pH was adjusted to 4.5. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0082] E: 2 g tea polyphenols was added in 100 mL liquid milk, and the pH was adjusted to 5. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0083] F: The cell suspensions of C. sakazakii strains were added into 100 mL liquid milk to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0084] G: 0.5 g tea polyphenols was added in 100 mL yoghurt, and the pH was adjusted to 3. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0085] H: 3 g tea polyphenols was added in 100 mL yoghurt, and the pH was adjusted to 4.5. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0086] I: The cell suspensions of C. sakazakii strains was added into 100 mL yoghurt with a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0087] J: 0.3 g tea polyphenols was added in 100 mL sour milk beverage, and the pH was adjusted to 5. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0088] K: 1 g tea polyphenols was added in 100 mL sour milk beverage, and the pH was adjusted to 4. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0089] L: 2 g tea polyphenols was added in 100 mL sour milk beverage, and the pH was adjusted to 3.5. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0090] M: 3 g tea polyphenols was added in 100 mL sour milk beverage, and the pH was adjusted to 3. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0091] N: The cell suspensions of C. sakazakii strains was added into 100 mL sour milk beverage, and obtained final concentrations was approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0092] O: 3 g tea polyphenols and 0.3 g VC were added in 100 mL sour milk beverage, and the pH was adjusted to 3. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0093] P: 0.3 g tea polyphenols and 0.3 g malic acid were added in 100 mL sour milk beverage, and the pH was adjusted to 5. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0094] Q: 1 g tea polyphenols and 0.3 g citric acid were added in 100 mL sour milk beverage, and the pH was adjusted to 5. The cell suspensions of C. sakazakii strains were added to obtain a final concentrations of approximately 8.0 Log CFU/mL, and the cells were incubated for 7 hr. [0095] The cell suspensions in the treatment groups above was all C. sakazakii strains suspensions. [0096] After serial dilution with the saline, 0.1 mL appropriately diluted cultures was spread-plated on TSA plates in duplicate and incubated upside down at 37° C. overnight. Finally, observe the number of Cronobacter sakazakii strains. [0097] No C. sakazakii was detected in all groups treated with TP whereas C. sakazakii was detected in all the control groups without TP treatment. So tea polyphenols solution in the pH range 3-5 can effectively destroy C. sakazakii. Example 21: Use of TP Solutions to Inactivate C. sakazakii in Vegetables [0098] Vegetables were treated with C. sakazakii and TP solutions as follows. The growth of the bacteria was observed. [0099] A: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto the vegetables. The vegetables were uniformly sprayed with 0.3% TP solution. The vegetable was treated for 2 hr before a sample was taken for the test. [0100] B: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto the vegetables. The vegetables were uniformly sprayed with 1% TP solution. The vegetable was treated for 2 hr before a sample was taken for the test. [0101] C: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto the vegetables. The vegetables were uniformly sprayed with 3% TP and 1% malic acid. The vegetable was treated for 2 hr before a sample was taken for the test. [0102] D: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto the vegetables. The vegetables were uniformly sprayed with 2% TP and 1% citric acid. The vegetable was treated for 2 hr before a sample was taken for the test. [0103] E: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto the vegetables. The vegetables were uniformly sprayed with 3% TP and 1% VC. The vegetable was treated for 2 hr before a sample was taken for the test. [0104] F: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto the vegetables. The vegetables were uniformly sprayed with 3% TP and 1% malic acid and 1% citric acid. The vegetable was treated for 2 hr before a sample was taken for the test. [0105] G: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed to the vegetables. The vegetable was treated for 2 hr before a sample was taken for the test. [0106] After treatment, samples taken from the vegetables were spread-plated on TSA plates and incubated upside down at 37° C. overnight. Finally, the number of Cronobacter sakazakii colonies on the TSA plates were counted. [0107] In all the groups treated with TP, no Cronobacter sakazakii have not been detected. In the groups without TP treatment, Cronobacter sakazakii colonies have been detected on the TSA culture. Example 22. Use of TP Solutions to Inactivate C. sakazakii in Cereals [0108] Cereals were treated with C. sakazakii and TP solutions as follows. The growth of the bacteria was observed. [0109] A: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto cereals. The cereals were uniformly sprayed with 0.5% TP. The cereal was treated for more than 1 hr before a sample was taken for the test. [0110] B: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto cereals. The cereals were uniformly sprayed with 0.3% TP. The cereal was treated for more than 1 hr before a sample was taken for the test. [0111] C: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto cereals. The cereals were uniformly sprayed with 3% TP and 1% malic acid. The cereal was treated for more than 1 hr before a sample was taken for the test. [0112] D: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto cereals. The cereals were uniformly sprayed with 2% TP and 1% citric acid. The cereal was treated for more than 1 hr before a sample was taken for the test. [0113] E: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto cereals. The cereals were uniformly sprayed with 1% TP and 1% VC. The cereal was treated for more than 1 hr before a sample was taken for the test. [0114] F: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains was uniformly sprayed onto cereals. The cereals were uniformly sprayed with 3% TP and 1% malic acid and 1% citric acid. The cereal was treated for more than 1 hr before a sample was taken for the test. [0115] G: 1 mL of 8.0 Log CFU/mL cell suspensions of C. sakazakii strains were uniformly sprayed to the cereal. The cereal was treated for more than 1 hr before a sample was taken for the test. [0116] After treatment, samples taken from the cereal were spread-plated on TSA plates and incubated upside down at 37° C. overnight. Finally, the number of Cronobacter sakazakii colonies on the TSA plates were counted. [0117] In all the groups treated with TP, no Cronobacter sakazakii have not been detected. In the groups without TP treatment, Cronobacter sakazakii colonies have been detected on the TSA culture. These results demonstrate that TP has bactericidal effect against Cronobacter sakazakii and can be applied to eliminate Cronobacter sakazakii in vegetables and cereals. [0118] While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, appendices, patents, patent applications and publications, referred to above, are hereby incorporated by reference.

Summary: The present invention relates to a method for inactivating Cronobacter sakazakii, which belongs to the field of food safety technologies. The present invention provides a method to use tea polyphenols as an active ingredient to inactivate Cronobacter sakazakii. The invention can be used to control and eliminate the contamination of Cronobacter sakazakii in food or food processing, especially the contamination of Cronobacter sakazakii during PIF production. The present invention provides an effective method to clean and sterilize the environment and the equipment, especially to clean the inner wall of the equipment which is hard to clean due to biofilms formed inside.

big_patent

en

Summarize: BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a new and improved drawer guide assembly for a movable structure such as a drawer in a furniture article which allows for full or nearly fall extension of the movable structure. The drawer guide assembly contains mirror image assemblies, each comprising a guide rail mountable to the interior of a furniture article in a generally horizontally disposed position and a pull-out rail movable therein and mountable to the drawer, or other movable structure. Both the guide and pull-out rails are provided with one or more fix-position mounted rotatable rollers and upper and lower ledges which are in rolling contact with complimentary rotatable rollers, thus enabling forward and rearward horizontal movement of the pull-out rail and carried structure on the fixed guide rail. 2. Description of Prior Art Various types of drawer guide assemblies are used for drawers housed by desks or cabinets and the like to enable extension of the drawers within the housing and the smooth and efficient operation thereof. Drawer guides are used in pairs with each two-part drawer guide including a drawer member, the pull-out rail, which is fastened either to the side of the drawer or underneath the drawer to support the drawer, and a guide rail fastened to the corresponding side of the interior of the furniture article. Fastening the pull-out rail underneath the drawer enables the use of a wider drawer within a drawer opening of a given width. The majority of drawer guide assemblies limit the travel of the pull-out rail to a distance shorter than the depth of the associated drawer such that the rear wall of the fully open drawer remains within the associated cabinet; nearly full or full extension of the pull-out rail and thus the drawer itself is not possible. Assemblies of this type, called &#34;partial slides,&#34; hinder visibility and accessibility of the rear region of the drawer which remains within the cabinet. Drawer guide assemblies of the type of the present invention generally have a pull-out rail roller at or near the rear end of the pull-out rail and a guide rail roller at or near the front end of the guide rail. The pull-out rail roller rolls in a track within the guide rail and a portion of the pull-out rail serves as a rolling surface for the guide rail roller. Generally, such two-part drawer guides also include a stop means which limits the extension of the drawer to only about three-fourths of the way because as the pull-out rail roller rolls forward on the guide rail and approaches the guide rail roller the front of the drawer tends to sag or cantilever under the weight of the drawer and its contents. Drawer guides which allow nearly full and full extension of the drawer, &#34;full slides,&#34; and &#34;over slides&#34; in which the associated drawer can be withdrawn so far out of the cabinet that its rear wall is approximately flush with or even slightly in front of the front surface of the cabinet, are highly desirable. Currently existing full slides are constructed as a combination of three parts rather than two parts, using either an additional rail member disposed between the pull-out rail and the guide rail, or an additional running rail portion which is tiltable about a vertical or horizontal axis. In the former construction, to enable full extension, an additional member is disposed between the pull-out rail and the guide rail in combination with additional rollers to prevent sagging or cantilevering of the drawer when fully extended. In the latter construction, as the drawer is extended outward an additional running rail portion is swung by an automatic control downward about a horizontal axis or outwardly in front of the rear wall of the drawer about a vertical axis such that the drawer may be slid out further. At full extension, the additional running rail portion is in alignment with the actual running rail, thereby making an additional opening pathway available to allow a complete opening of the drawer. In either construction, such three-part full extension drawer guides are highly complicated and very expensive. In order to obtain the desired advantages, such as easy running, a high load bearing ability, and a high transverse stability in the fully open state, these devices are constructed of multiple pieces which must be precisely manufactured and assembled at significantly high cost and labor intensity. U.S. Pat. No. 5,709,443, for instances, presents a rather complicated and seemingly expensive drawer guide which has pivotably connected to the inner end of the running rail a hollow profile section which pivots from a position in which it is in alignment with the running rail to a position in which it is in the plane of the drawer bottom and substantially parallel to the rear wall of the drawer. Aligned orientation with respect to the actual running rail in the further open state is effected by means of cage mounted rolling bodies. SUMMARY OF THE INVENTION It is a feature and advantage of the present invention to provide a drawer guide assembly which overcomes the problems of cantilevering and sagging encountered in attempting to use a two-part drawer guide as a full extension drawer guide and the cost inefficiencies associated with the currently existing, multiple component three-part drawer guides. It is a further feature and advantage of the present invention to provide a drawer guide assembly comprising a swing arm at the rear end of the pull-out rail which is constructed of minimal pieces, at a low cost, and is pivotable between horizontal and vertical positions, and a curved track attached near the rear end of the guide rail which allows the swing-arm to be guided into the vertical (end) position parallel to the rear wall of the drawer. The general purpose of the present invention, which will be described subsequently in greater detail, is to provide a new and improved drawer guide to be used at each side of a drawer to guide movement of the drawer into and out of a cabinet which has all, and more, of the advantages of the prior art devices and none of the disadvantages. To attain this purpose, a representative embodiment of the present invention is illustrated in the drawings. The drawer guide of the present invention makes use of a pull-out rail, shown in FIGS. 1 and 3, which is adapted for carrying a structure such as a drawer, and a guide rail, shown in FIGS. 2 and 4, which is adapted for mounting to the interior of an article of furniture, such as a cabinet, in a generally horizontally disposed position. To overcome the problems of cantilevering and sagging encountered in attempting to use a two-part drawer guide as a full extension drawer guide and the cost inefficiencies associated with the currently existing, multiple component three-part drawer guides, the present invention provides a swing arm at the rear end of the pull-out rail which is constructed of minimal pieces and at a low cost and is pivotable between horizontal and vertical positions, and a curved track attached near the rear end of the guide rail which allows the swing-arm to be guided into the vertical (end) position parallel to the rear wall of the drawer. As the drawer is pulled out, the swing arm pivots down to a horizontal position, and when the drawer is fully extended, swing-arm cooperating guide means furnish additional leverage against sagging or cantilevering of the drawer. When the drawer is pushed in, as it approaches a fully closed position, the swing-arm cooperating guide means are engaged by the guide rail curved track so as to pivot the swing arm up to the vertical position to permit full closure of the drawer. The swing arm of the present invention, while still allowing for full or nearly full extension of the drawer, is simply constructed of minimal pieces and thus provides a lower cost means for supporting and guiding in and out a movable structure such as a drawer in a furniture article. Since the prior art is comprised mostly of multiple-component brackets like those previously described, it can be appreciated that there is a continuing need for improvements to such devices. The present invention addresses the need for such improvements. The pull-out rail of the present invention can be mounted in the advantageous so-called &#34;bottom configuration&#34;--on the underside of the base of a drawer directly adjacent the side wall projecting downwardly below the base,--or, if the side walls of the drawer are constituted by hollow profiles of metal or plastics material open at the underside, within the side wall. The guide rail is adapted for mounting to the interior of the furniture article in a generally horizontally disposed position. In brief, the pull-out rail of the present invention includes: (1) a pull-out rail upper ledge in rolling contact with a guide rail front roller so as to enable forward and rearward horizontal movement of the pull-out rail and carried structure, (2) a pull-out rail rear roller in rolling contact with the guide rail upper ledge, (3) a pull-out rail inside lower ledge in rolling contact with the guide rail front roller, (4) a swing-arm pivotable about an axis extending perpendicular to the pull-out rail, and (5) a means for mounting the pull-out rail to a drawer or other carried object. Cooperating guide means (for example, one or more track rollers) are provided on the swing arm to hold the swing arm in its extended position in alignment with the pull-out rail during movement of the pull-out rail from the open position of the drawer over the major portion of the inward movement, and to pivot the swing arm increasingly into the upright end position parallel to the rear wall of the drawer when its inner end approaches the rear wall of the cabinet. When the pull-out rail moves in the closing direction of the drawer and the closed position is approached the swing arm is held in an upright end position approximately at a 90° angle to the pull-out rail and nearly parallel to the rear wall of the cabinet. As the pull-out rail moves in the opening direction of the drawer, the swing arm lowers approximately 90° from its upright end position to its extended position in which it is aligned with the pull-out rail. As the is pull-out rail approaches its position of full extension, the swing arm, which is again in alignment with the actual pull-out rail, makes an additional opening pathway available so as to allow a complete opening of the drawer. The guide rail, which is adapted for mounting to the cabinet, includes: a receiving &#34;ramp&#34; (e.g., a guide rail upper ledge) capable of receiving the pull-out rail rear roller and the swing arm guide means; a guide rail front roller in rolling contact with the receiving &#34;ramp&#34; included on the pull-out rail (e.g., the pull-out rail upper ledge); and a curved track (or receiving ramp) in contact with the swing arm guide means so as to cause the swing arm to pivot increasingly into the upright end position parallel to the rear wall of the drawer as the pull-out rail moves inward. The curvature of the curved track is a curvature sufficient to enable the raising of the swing-arm from its extended position to its upright end position during inward movement of the pull-out rail, and vice versa during outward movement of the pull-out rail. In a preferred embodiment the pull-out rail includes an obliquely disposed retaining member (a detent) located in the front end area of the pull-out rail, which engages the guide rail front roller in a rearward position so as to resist forward movement of the pull-out rail and limit the extension of the drawer. Also preferred is the inclusion in the guide rail lower ledge at its distal end (preferably immediately subsequent to the point of attachment of the curved track) of a guide rail retaining member in the form of a downwardly sloping detent which serves as a rolling surface for the pull-out rail rear roller and has a run-in slope oriented in the same direction and preferably parallel to the run-in slope of the pull-out rail retaining member (detent). The guide rail retaining member improves the pull-in and staying closed behavior of the drawer, especially in the case of drawers of little net weight and small load capacity. Further, when the pull-out rail is moved inward (in the closing direction of the drawer), the pull-out rail rear roller and guide rail front roller simultaneously reach the guide rail retaining member and the pull-out rail retaining member, respectively; the pull-out rail rear roller rolls into the downwardly sloping area of the guide rail retaining member and the pull-out rail retaining member engages the guide rail front roller, causing the pull-out rail, under the weight of the drawer, to roll downward along the downward slope of the pull-out rail retaining member, thereby automatically closing the drawer. In order to limit further rearward movement of the pull-out rail and the carried drawer in the rearwardly disposed closed position of the drawer (i.e., to prevent the swing-arm in it raised upright position from contacting the backwall of the cabinet), the guide rail upper ledge may be provided with a means for stopping further inward movement of the pull-out rail. In the preferred embodiment, the means for stopping further inward movement of the pull-out rail comprises inclusion on the guide rail (either on the guide rail upper ledge, or on the guide rail lower ledge immediately subsequent to the guide rail retaining member) of a pull-out rail inward stop means configured to prevent further inward movement of the pull-out rail at a predetermined point, for instance, the point at which the carried structure is fully within the cabinet (i.e., the drawer is closed). The pull-out rail inward stop means comprises a downwardly depending V-shaped projection formed in the guide rail upper ledge configured to engage the pull-out rail rear roller. In a preferred embodiment, the pull-out rail upper ledge includes a downward depending flange which engages the guide rail front roller, effectively capturing the guide rail front roller between the pull-out rail upper ledge flange and the inside wall of the pull-out rail. Thus, when a lateral force is applied to the drawer or other object carried by the pull-out rail, the pull-out rail upper ledge flange prevents the pull-out rail from becoming disengaged from the guide rail front roller. In a preferred embodiment, the guide rail also includes an upwardly projecting tab located on the outer side of the guide rail front roller (i.e., towards the cabinet wall) which, during movement of the pull-out rail, moves underneath the pull-out rail upper ledge between the pull-out rail outside wall and the pull-out rail upper ledge flange. In combination with the pull-out rail upper ledge flange, the guide rail upwardly projecting tab significantly reduces side-to-side movement (known as &#34;side play&#34;) of the drawer. Preferred means for mounting the pull-out rail to a drawer or other carried object include the addition of a pull-out rail mounting means immediately preceding the point of pivot of the swing-arm adapted for mounting of the pull-out rail to the end wall of a drawer and, either a mounting adaptation of the pull-out rail outside lower ledge for mounting to the bottom side of a side wall of a drawer (for instance, holes suitable for screws or nails), or a mounting adaptation of the outside wall of the pull-out rail for mounting of the outside wall of the pull-out rail to the inside of the side wall of a drawer. If the mounting adaptation of the outside wall of the pull-out rail is used, it is preferred to also include the pull-out rail upper ledge flange. The pull-out rail upper ledge flange allows this type of mounting by providing a discrete passageway, distinct from the passageway formed by the pull-out rail upper ledge flange and the inside wall of the pull-out rail, in which the guide rail front roller can travel unobstructed and unimpeded by the presence of the means (for example, screws) necessary for mounting the pull-out rail outside wall to the side wall of the drawer. Preferred means for mounting the guide rail to the inside wall of a cabinet or article of furniture are the inclusion of both a guide rail front mounting means located on the outer side of the guide rail front roller (i.e., towards the cabinet wall) and on the outer side of the upwardly projecting tab, and a guide rail rear mounting means located at the end point of the guide rail and configured so as to permit mounting of the guide rail to the end wall of the cabinet and subsequent to such mounting, lateral adjustment of the mounted guide rail. Also preferred is the inclusion on the pull-out rail inside wall of a pull-out rail inside lower ledge and the inclusion of a downwardly depending flange on the guide rail upper ledge. The guide rail upper ledge flange, in cooperation with the guide rail lower ledge and the guide rail front roller, prevent disengagement of the pull-out rail. Additionally, during movement of the pull-out rail along the guide rail, the pull-out rail inside lower ledge, which rides underneath the guide rail upper ledge flange, prevents the drawer or carried object from contacting the cabinet frame in the event that the cabinet is in other than its normally upright position (for instance, during shipping of assembled cabinet / drawer units). The guide rail upper ledge flange, in cooperation with the swing-arm guide means (the swing-arm lower roller in the preferred embodiment, discussed below), also prevents the front-end of the pull-out rail and attached carried object from cantilevering out of the cabinet. Further preferred is the inclusion of an extension of the pull-out rail inside lower ledge for mounting to the front wall of the drawer or carried object. The pull-out rail inside lower ledge extension provides both additional strength for the pull-out rail which prevents bowing of the rail, and a means for easy alignment of the pull-out rail on the drawer or carried object during assembly. Also preferred, is the inclusion on the guide rail lower ledge of an upwardly depending flange. In addition to providing further strength to the guide rail to prevent disfigurement of the guide rail (e.g., bowing), the guide rail lower ledge flange, in conjunction with the downwardly depending flange on the guide rail upper ledge, provides a capture of the pull-out rail rear roller which prevents disengagement of the pull-out rail from the guide rail, for instance, in event of the cabinet being tipped from its normally disposed upright vertical position. When the pull-out rail is mounted in the advantageous bottom configuration, inclusion of the pull-out rail retaining member, necessarily prevents the guide rail upper ledge from contacting the bottom of the drawer other than at the highest point of the pull-out rail retaining member. Accordingly, if bottom configuration mounting is desired, it is preferred that the pull-out rail include a raised region near the rear end of the pull-out rail, which is raised to a height parallel with the highest point of the pull-out rail retaining member. The pull-out rail rear raised region provides a second point of contact for the pull-out rail on the drawer bottom, thus facilitating mounting of the pull-out rail parallel to the drawer bottom, strengthening the pull-out rail, and reducing the likelihood of disfigurement of the pull-out rail. In the preferred embodiment, the swing arm guide means comprise an upper roller (also referred to as a track roller) and a lower roller (also referred to as a ledge roller), the swing arm upper roller being located forward of, and above, the swing arm lower roller. As the drawer is pulled out, the swing arm pivots down to the horizontal position, the upper roller rolls on the topside of the upper ledge of the guide rail, and the lower roller rolls underneath (on the innerside) of the upper ledge. As the drawer is fully extended, the swing-arm lower roller, spaced rearward from the pull-out rail rear roller, furnishes additional leverage against sagging or cantilevering of the drawer. When the drawer is pushed in, as it approaches a fully closed position, the swing-arm upper roller is engaged by the curved track to pivot the swing member up to the vertical position, so the drawer can be fully closed. The swing arm lower roller may be in rolling contact with the underside of the curved track. However, it is preferred that the swing arm lower roller be configured so as not to contact the underside of the curved track; such a configuration of the swing arm lower roller allows for a greater likelihood of unimpeded movement of the pull-out rail along the guide rail in the event that either the pull-out rail or the guide rail is mounted in other than the desired/ideal position. Contact between the swing-arm upper roller and the guide rail upper ledge also prevents the front-end of the drawer member from cantilevering out of the drawer. Also preferred, is inclusion on the pull-out rail immediately preceding the pivot point of the swing arm of a pull-out rail outward stop means configured to prevent further outward movement of the pull-out rail, at a predetermined point in which the carried structure is nearly fully, or fully, extended from the cabinet (e.g., the drawer is open). In the preferred embodiment, the pull-out rail outward stop means comprises a downwardly depending V-shaped projection formed in the pull-out rail upper ledge and configured to engage the guide rail front roller. In a preferred embodiment, the pull-out rail and the guide rail each include a soft bumper to absorb and minimize shock and the noise associated therewith. Specifically, the rear-end of the pull-out rail upper ledge includes one or more pull-out rail back bumper(s) located and configured so as to minimize impact between the swing-arm and the pull-out rail upper ledge as the swing-arm pivots down to the horizontal position in which it rests on top of the pull-out rail upper ledge, for instance, as the drawer is opened and moves outward from the cabinet. The front end of the guide rail can also be equipped with a guide rail front bumper(s) positioned and configured so as to minimize impact between the inner side of the drawer front and the front end of the guide rail. The addition of the guide rail front bumper eliminates the need for the customarily used drawer front bumpers. Both the guide rail front bumper and the pull-out rail back bumper are preferably constructed of soft felt or rubber of an appropriate density to absorb shock and eliminate noise. The present invention is intended for use in pairs, that is, a right-hand drawer guide to support the right side of a drawer and a left-hand drawer guide to support the left side of the drawer. A left-hand drawer guide is a mirror image of a right-hand drawer guide and vice versa. While a right-hand guide rail is illustrated in the drawings, the specification and claims relate equally to both left-hand and right-hand drawer guide assemblies. There has been outlined rather broadly the more important features of the invention in order that the detailed description thereof that follows may be better understood and in order that the present contribution to the art may be better appreciated. There are, of course, additional features of the invention that will be described hereinafter and which will form the subject matter of the claims appended hereto. In this respect, before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not limited in its application to the details of construction and to the arrangement of the components set forth in the following description or illustrated in the drawings. The invention is capable of other embodiments and of being practiced and carried out in various ways. It is to be further understood that the phraseology and terminology employed herein are for the purpose of description and should not be regarded as limiting. As such, those skilled in the art will appreciate that the conception upon which this disclosure is based may readily be utilized as a basis for the designing of other structures, methods and systems for carrying out the several purposes of the present invention. It is important, therefore, that the claims be regarded as including such equivalent constructions insofar as they do not depart from the spirit and scope of the present invention. The abstract is neither intended to define the invention of the application, which is measured by the claims, nor is it intended to be limiting as to the scope of the invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS The invention will be better understood and objects other than those set forth above will become apparent when consideration is given to the following detailed description. Such description makes reference to the annexed drawings wherein: FIG. 1 is a perspective view of the pull-out rail and attached swing-arm for use on the right-side (determined by looking at the front) of the drawer or carried object; FIGS. 2 and 2A are a perspective view of the pull-out rail and attached swing-arm for use on the left-side (determined by looking at the front) of the drawer or carried object; FIG. 3 is a perspective view of the guide rail for use on the right-side (determined by looking at the front) of the cabinet; FIGS. 4A and 4B are perspective views of the rear-end portion of the pull-out rail and attached swing-arm coupled with the guide rail for use on the rights-side (determined by looking at the front) of the drawer and cabinet; FIG. 5 is a front view of the front-end of the right-side wall of the drawer mounted on the pull-out rail and coupled with the guide rail; the drawer is in the fully closed position; FIG. 6 is an end view of the pull-out rail and attached swing-arm coupled with the guide rail in which the swing-arm is in the lowered position in which it is aligned with the pull-out rail; and FIG. 7 is an end view of the pull-out rail and attached swing-arm coupled with the guide rail in which the swing-arm is in the upright end position approximately at a 90° angle to the pull-out rail and nearly parallel to the rear wall of the cabinet. DESCRIPTION OF THE PREFERRED EMBODIMENT Referring now to the drawings and specifically to FIGS. 1 and 2, the preferred embodiment of the pull-out rail of the present invention comprises a profiled rail including a pull-out rail upper ledge 7 having a downward depending flange 14 configured so as to engage a guide rail front roller 4, a pull-out rail retaining member 18A, said pull-out rail retaining member 18A comprising an upwardly projecting detent of a known slope configured to engage the guide rail front roller 4 so as to resist forward movement of the pull-out rail, and a pull-out rail mounting means 15A adapted for mounting of the pull-out rail to the end wall of a drawer. In an embodiment of the present invention, the profiled rail comprising the pull-out rail also includes a pull-out rail inside wall 21 downwardly depending from the pull-out rail upper ledge 7, having a pull-out rail inside lower ledge 2 projecting outward from the pull-out rail inside wall 21 configured so as to enable the pull-out rail inside lower ledge 2 to move underneath the guide rail upper ledge flange 16 during movement of the pull-out rail on the guide rail, said pull-out rail inside lower ledge 2 having a pull-out rail inside lower ledge extension 23 configured for mounting to the front wall of a drawer or other object carried by the pull-out rail in a predetermined location. In an embodiment of the present invention, the profiled rail comprising the pull-out rail further includes a pull-out rail outside wall 22 downwardly depending from the pull-out rail upper ledge 7 having a mounting adaptation 15C for mounting of the outside wall of the pull-out rail 22 to the inside of the side wall of a drawer, a pull-out rail outside lower ledge 1 projecting outward from the pull-out rail outside wall 22; said pull-out rail outside lower ledge 1 including a mounting adaptation 15B for mounting the pull-out rail outside lower ledge 1 to the bottom side of a side wall of a drawer; said pull-out rail outside wall 22 along with the pull-out rail inside wall 21 and the pull-out rail upper ledge 7 defining an inner hollow space. In an embodiment of the present invention, the profiled rail comprising the pull-out rail additionally includes a pull-out rail rear roller 3, as well as a pull-out rail outward a stop means 19A configured to prevent further outward movement of the pull-out rail at a predetermined point, said pull-out rail outward stop 19A means comprising a downwardly depending V-shaped projection formed in the pull-out rail upper ledge 7 and configured to engage the guide rail front roller 4. In an embodiment of the present invention, the profiled rail comprising the pull-out rail also includes (1) a swing arm 8 mounted immediately subsequent to the pull-out rail mounting means 15A and pivotable approximately 90° about an axis extending perpendicular to the pull-out rail, said swing arm 8 including a swing arm upper roller 10 and a swing arm lower roller 11, said swing arm upper roller 10 being located forward of and above the swing arm lower roller 11 and configured so as to roll on the topside of an upper ledge 5A of the guide rail and on the innerside of the curved track 9A so as to pivot the swing member up to the vertical position, said swing-arm lower roller 11 being configured so as roll on the underneath (on the innerside) of an upper ledge 5B of the guide rail and so as not to contact the underside of the curved track 9B, and said swing arm upper roller 10 and swing-arm lower roller 11 being configured so as to hold the swing arm in an extended position in alignment with the pull-out rail during movement of the pull-out rail from an open (extended) position over a major portion of inward movement, and pivot the swing arm increasingly into an upright end (closed) position parallel to a rear wall of the drawer as the pull-out rail approaches a rear wall of a cabinet, (2) a pull-out rail back bumper 27 located towards the rear-end of the pull-out rail upper ledge 7 and configured so as to minimize impact between the swing-arm 8 and the pull-out rail upper ledge 7, and a raised region 25 near the rear end of the pull-out rail, which is raised to a height parallel with the highest point of the pull-out rail retaining member 18A. Referring to FIG. 3, the preferred embodiment of the guide rail of the present invention comprises a profiled rail including a guide rail upper ledge 5 in rolling contact with the pull-out rail rear roller 3, a guide rail front roller 4 in rolling contact with the pull-out rail upper ledge 7, a curved track 9 in rolling contact with the swing-arm upper roller 10 during inward movement of the pull-out rail as the drawer carried by the pull-rail approaches the end of the cabinet, said curved track 9 being of a curvature sufficient to cause the raising of the swing-arm 8 from the extended position in alignment with the pull-out rail to the upright end (closed) position parallel to the rear wall of the drawer as the pull-out rail approaches the rear wall of the cabinet, and a guide rail lower ledge 6 in rolling contact with the pull-out rail rear roller 3. In an embodiment of the present invention, the profiled rail comprising the guide rail also includes guide rail retaining member 18B in the form of a downwardly sloping detent which serves as a rolling surface for the pull-out rail rear roller 3 and has a run-in slope oriented in the same direction and preferably parallel to the run-in slope of the pull-out rail retaining member (detent) 18A, said guide rail retaining member 18B being located in the guide rail lower ledge 6 immediately subsequent to the point of attachment of the curved track 9. In an embodiment of the present invention, the profiled rail comprising the guide rail further includes a pull-out rail inward stop means 19B located on the guide rail upper ledge 5 immediately subsequent to the guide rail retaining member 18B and configured to prevent further inward movement of the pull-out rail at a predetermined point, said pull-out rail inward stop means 19B comprising a downwardly depending V-shaped projection formed in the guide rail upper ledge 5 configured to engage the pull-out rail rear roller 3, and an upwardly projecting tab 24 located on the outer side of the guide rail front roller 4 configured so as, during movement of the pull-out rail, to move underneath the pull-out rail upper ledge 7 between the pull-out rail outside wall 22 and the pull-out rail upper ledge flange 14. In an embodiment of the present invention, the profiled rail comprising the guide rail additionally includes a guide rail upwardly depending flange 17 on the guide rail lower ledge 6, a guide rail downwardly depending flange 16 on the guide rail upper ledge 5, a guide rail front bumper 26 positioned on the front end of the guide rail and configured so as to minimize impact between the inner side of the drawer front and the front end of the guide rail, a guide rail front mounting means 12 located on the outer side of the guide rail front roller 4 and on the outer side of the upwardly projecting tab 24, and a guide rail rear mounting means 13 located at the end point of the guide rail and configured so as to permit mounting of the guide rail to the end wall of the cabinet and subsequent to such mounting lateral adjustment of the mounted guide rail. Obviously, any number of materials may be used to form the drawer guide assemblies described herein, and exceptional success has been experienced by the use of rigid and semi-rigid plastic or metal materials, although other materials having similar physical properties may be utilized. With respect to the descriptions set forth above, optimum dimensional relationship for the parts of the invention (to include variations in size, materials, shape, form, function and manner of operation, assembly and use) are deemed readily apparent and obvious to those skilled in the art, and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed herein. The foregoing is considered as illustrative only of the principles of the invention. Since numerous modifications and changes will readily occur to those skilled in the art, the foregoing is not intended to limit the invention to the exact construction and operation shown and described, and all suitable modifications and equivalents falling within the scope of the appended claims are deemed within the present inventive concept. The features of the present invention, together with the other objects of the invention, and along with the various features of novelty which characterize the invention, are pointed out with particularity in the claims annexed to and forming a part of this disclosure. For a better understanding of the invention, its operating advantages and the specific objects attained by its uses, references made to the accompanying drawings and descriptive matter in which like characters of reference designate like parts throughout the several views.

Summary: A drawer guide assembly for a movable structure such as a drawer in a furniture article allows for full or nearly full extension of the movable structure. A drawer guide assembly comprises a pull-out rail, a swing arm with one end hinged to the pull-out rail and having a track roller coupled thereto, a guide rail supporting the pull-out rail and communicating with the track roller, and a curved track disposed on the guide rail for receiving the track roller when a drawer is pushed into a furniture article.

big_patent

en

Summarize: Exercise machines, including those simulating rowing and bicycling, typically are fitted with backless cycle-type seats or saddles to support the user. For example, rowing machines generally have a seat slidable on a track in coordination with the rowing exercise. Bicycle exerciser machines generally are fitted with a conventional saddle. Cycles of most types are conventionally fitted with cycle-type seat mounted on a support post, and other devices such as stools are known which have cycle-type saddles. Such seats or saddles generally include a narrow leading end portion with a downwardly contoured tip and a flared wider trailing end portion with a downwardly extending periphery. A socket or clamp is provided for mounting the seat on a support post. Backless seats in exercise machines and cycles encourage back fatigue in the user, so that exercise may be terminated earlier or be less vigorous than desired to prevent backstrain. In addition, the absence of a back support prevents the machine or cycle user from exerting maximum thrust and obtaining the desired degree of exercise or propulsion. Backrests for bicycles, motorcycles and the like are known. For example of fixed position backrests, see U.S. Pat. No. 4,141,587 to Holcomb and U.S. Pat. No. 3,879,087 to Russo. Cycle backrests having some adjustability have also been disclosed. In U.S. Pat. No. 3,887,231, Bochynsky discloses a &#34;flip-up&#34; backrest which provides a limited height back support adjoining a motorcycle seat. U.S. Pat. No. 3,822,917 discloses a higher backrest which has a number of selectable, fixed angular positions and is especially adapted for use with a &#34;buddy seat&#34; on a motorcycle. None of the disclosed seats are adapted to accomodate anticipated pedaling or exercise motion of the user. In addition to accomodating user motion, an exerciser or cycle seat backrest should adjust to provide users of difference sizes and shapes with effective lumbar support. Accordingly, it is an object of the present invention to provide a backrest for a cycle-type seat or saddle that is adjustable to accomodate users of difference sizes and shapes. It is further an object of the invention to provide a backrest which provides support to the user during pedaling or throughout an exercise cycle. The objects of the invention are accomplished in its preferred form by providing a back support pivotally attached to a support frame. The support frame holds the back support above the saddle. The frame is adjustably secured to a yoke, so that the height and angle of the frame, and thereby of the back support, with respect to the saddle, can be selectably fixed at any of a plurality of selectable positions. The yoke includes a clamp for clamping it to the cycle or exerciser. In preferred embodiments of the invention, the adjustments of height and angle can be made without the use of tools. The foregoing and further features and advantages of the present invention will become apparent by reference to the accompanying drawing taken in conjunction with the detailed description of the preferred embodiment. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a partially cut away, perspective view of a cycle-type saddle with a backrest according to the present invention. FIG. 2 is a perspective view of a portion of an alternate embodiment of a cycle-type saddle with a backrest according to the present invention. DESCRIPTION OF THE PREFERRED EMBODIMENT Turning to FIG. 1, there is shown a seat 1 having a central support 3. Preferably, seat 1 is a conventional saddle, i.e., bicycle type seat, having a conventional supporting structure (not shown) which includes a conventional clamp (not shown) that attaches to support 3. Seat 1 could be any type of cycle-type seat and could be supported on more than one support within the scope of the invention. It is intended that a central member, which need not necessarily be a seat support, project from beneath the seat for attachment of the backrest of the invention. A yoke is affixed through a clamping means 7 to support 3. (A portion of seat 1 is cut away in FIG. 1 to show support 3 clearly.) Yoke 5 has two diverging flanges 9 and 11 which are generally symmetrical, and which terminate in generally parallel distal portions 13 and 15, respectively. Flanges 9 and 11 are joined by clamping means 7 which is shaped to conform generally to the circumference of central seat support 3. Clamping means 7 is firmly clamped to support 3 by a compression means. In the preferred embodiment, the compression means comprises a bolt 17 and an engaging nut 19 passing through a pair of aligned apertures in clamping means 7 opposite the part of means 7 which conforms to support 3. To increase the rigidity of flanges 9 and 11, their longitudinal edges are folded approximately 90 degrees inward to form lips 21 and 23 along the lower and upper edges, respectively, of flange 9 and to form lips 27 (only one of which is visible in FIG. 1) along the upper and lower edges, respectively, of flange 11. An optional stabilizing bar 29 may also be inserted between distal portions 13 and 15 of flanges 9 and 11 to aid rigidity of yoke 5. In the embodiment of FIG. 1, bar 29 is fitted with a pair of collars 31 (only one of which is visible in FIG. 1), affixed, respectively, near each end of bar 29. The end of bar 29 are inserted in aligned holes 35 (only one of which is visible in FIG. 1) located in distal portions 13 and 15, respectively. It may be necessary to spread the flanges of yoke 5 slightly to insert bar 29. Bar 29 with collars 31 and 33, prevents the flanges from bending inward under the influence of compressive forces. A pair of aligned apertures 39 (only one of which is visible in FIG. 1) are bored in flanges 9 and 11, respectively, proximate their distal lower edges for receiving a first rod or tube 43. A plurality of pairs of aligned apertures 45 and 47 are bored in flanges 9 and 11, respectively, proximate their distal upper edges, for receiving a second rod or tube 49. The axes of apertures 45 and 47 are arcuately arranged, approximately equi-distant from the axes of apertures 39. A generally U-shaped support frame 51 comprises two generally parallel longitudinal sections 53 and 55 connected by a shorter lateral section 57. Frame 51 is preferably of unitary tubular construction and longitudinal sections 53 and 55 have an inside spacing approximately equal to the outside span of generally parallel distal portions 13 and 15 of flanges 9 and 11. Near the ends of sections 53 and 55 opposite section 57 are drilled a plurality of pairs of aligned apertures 59 and 61, in sections 53 and 55 respectively, for receiving rods 43 and 49. Frame 51 is fitted over flanges 13 and 15 with rods 43 and 49 passing through both the flanges and frame sections 53 and 55. In order to achieve that arrangement, apertures 59 and 61 are drilled on axes approximately parallel to the axis of section 57 and the spacing of each set of apertures in each of frame sections 53 and 55 must be approximately the same as the separations of apertures 39 and 45 in flange portion 13. That is, in each longitudinal frame section, the apertures are arranged in pairs, with the members of each pair having the same spacing from each other as the corresponding apertures in the flange portion with which they are alignable. In FIG. 1, two pairs of apertures, i.e., four holes, are shown in each longitudinal frame section allowing alignment with the corresponding flange apertures in at least two, and possibly three, different positions when lateral section 57 is in its intended position above the top side of seat 1. Additional pairs of apertures would increase the number of different positions. Together, the alignable apertures in frame 51 and flange portions 13 and 15 along with rods 43 and 49 provide an adjustment means for adjusting and selectably fixing the backrest in a user-selected position. Rods 43 and 49 comprise a locking means for locking the aligned apertures in alignment. Rods 43 and 49 can preferably be fixed in place while passing through flange portions 13 and 15 and frame sections 53 and 55 by a tensioning means. In the preferred embodiment depicted in FIG. 1, one end of each of rods 43 and 49 is fitted with a stop means to prevent that end from being drawn through the adjacent apertures in the frame means. In the preferred embodiment, the stop means comprises a first threaded length (not visible in FIG. 1) on one end of each of rods 43 and 49 engaged by a knob or nut means 63 having dimensions exceeding those of the apertures in the frame sections. The stop means could also include a washer firmly fixed to an end of each rod and larger than the apertures bearing the rods. In the preferred embodiment of FIG. 1, the tensioning means comprises a second threaded length on rods 43 and 49, opposite the ends having the first threaded length and a nut or knob means 65 engaging the second threaded lengths. The knobs shown in FIG. 1 have four equally spaced projecting protrusions which permit tightening and loosening of the tensioning means without the use of tools. Other sorts of plain or scalloped knobs or washers and nuts or the like may likewise be used to fix rods 43 and 49 within the selected aligned apertures. Optional stabilizing bar 29 aids in obtaining a firm clamping of rods 43 and 49 against flanges 13 and 15. A pivot means connects lateral frame section 57 to a back support 67. In the preferred embodiment of FIG. 1, the pivot means comprises two generally symmetrically disposed loops 69 and 71, which encircle and loosely slip around the lateral section, having tangentially bent ends 73 and 75, for connection to back support 67. The method of attachment of the ends 73 and 75 to back support 67 depends upon the materials employed; in the preferred embodiment, a screw or bolt and nut is used. Preferably, back support 67 is curved generally to conform to the shape of the human back and is padded on the side contacting the user&#39;s back. An easily cleanable covering, such as vinyl, preferably covers back support 67. Referring now to FIG. 2, a portion of an alternative embodiment 101 of the flange 9 of FIG. 1 is shown. Except for the elements of alternative flange 101 described below, it is identical to flange 9 and particularly to its distal portion 13, so that reference may be made to the description of flange 9 for the portions of flange 101 not described below. Likewise, a generally symmetrical and opposing flange part would be used with flange 101 to form a yoke similar to yoke 5, so that description of such a yoke is not necessary. That is, the description that follows discusses only the difference of the alternative embodiment of the yoke from the yoke embodiment previously discussed. Flange 101 contains in its upper distal portion an elongated hole 103. The elongation of hole 103 is in the direction of the longitudinal sections 55 and 53 of frame 51 when it is attached to the yoke. Near the lower distal end of flange 101 is a complex aperture 105 having a convex arcuate edge 107 opposite hole 103 and an opposing edge containing three distinct, arcuately, generally equally distributed edge insets 109 for receiving rod 43. The axes of the edge insets are generally equidistant from an axis of the lower portion of elongated hole 103. The diameters of the edge insets and of the ends of elongated hole 103 are generally the same as those of rods 43 and 49, respectively. Apertures 103 and 105 are intended to receive tubes or rods corresponding to rods 43 and 49, respectively, of FIG. 1. Hole 111 in flange 101 corresponds to hole 35 in flange 9 for retaining optional stabilizing bar 29. The alternative embodiment of yoke 5 employing flange 101 and a symmetrical counterpart engage frame 51 with a rod or tube passing through hole 103 and its generally symmetrical counterpart and another rod or tube passing through aperture 105 and its generally symmetrical counterpart. The rods pass through apertures 59 and 61 of frame 51 as explained before in connection with FIG. 1. The lower rod rests in one of the edge insets 109 of aperture 105 and the upper rod rests in the lower portion of elongated hole 103. To adjust the angular position of back support 67 with respect to the yoke and seat 1, the frame is lifted to raise the lower rod from an edge inset 109, thereby raising the upper rod in hold 103. The angle of back support 67 and frame 51 is then changed by pivoting on the upper rod to align the lower rod with another edge inset 109 of aperture 105. Upon alignment, the frame is released so that the rods settle to the lower portion of hole 103 and an inset edge 109 of aperture 105. As is obvious to the skilled artisan, the separation of the rods, i.e., of apertures 59 and 61 in frame 51, must correspond to the separation of the insets 109 of aperture 105 and the lower part of hole 103 in flange 101. Sufficient clearance must be provided in the upper part of hole 103 and the arcuate portion 107 of aperture 105 to allow the pivoting of the frame. The rods are held by a tensioning means in the manner previously described. The advantage of the alternative embodiment in which the backrest adjustment means comprises hole 103 and aperture 105 and their symmetrical counterparts, along with apertures 59 and 61, is that back support angle adjustments can be made without withdrawing the rods from apertures 59 and 61 in frame 51. By contrast, back support angle adjustments with the yoke depicted in FIG. 1, requires withdrawal of the rods from the aligned apertures. Of course, for back support height adjustments, withdrawal of the rods is required in both embodiments. A particular advantage of the embodiment of FIG. 1 is the absence of even a slight possibility of an unintentional release of the positioning of the backrest. Likewise, yoke 5 can be inverted, i.e., installed upside down, and still function normally. That is, apertures 39 and 45 (and their symmetrical counterparts) can be interchanged. With the alternative flange embodiment, complex aperture 105 must be near the lower edge of flange 101 to obtain proper and secure back support adjustment. The backrest is simply installed on an exercise machine, cycle, stool or the like having a cycle-type seat. In the illustrated embodiments seat 1 is removed to expose central support 3. Yoke 5 is slipped over central support 3 and compression means 7 tightened to secure the yoke firmly to the support. If stabilizing bar 29 is provided, it is located within the yoke before tightening of compression means 7. Seat 1 is then reattached to support 3. Frame 51 is slipped over and outside flanges 13 and 15 with a selected pair of frame apertures 59, 61, aligned with respective aperture 39 and the selected ones of apertures 45, 47 in the flanges. The choice of apertures in frame 51 for alignment with the flange apertures determines the height of back support 67 above yoke 5. The choice made in a particular case is determined by the size of the user. The range of choices potentially available is limited solely by the length of the longitudinal portions 53 and 55 of frame 51, and the number of apertures drilled therein, and the requirement that the lower projecting ends of the frame not interfere with the operation of the device on which the seat is mounted. The choice of apertures 45 and 47 in flange portions 13 and 15 chosen for alignment with the apertures in frame 51 determines the relative angle between back support 67 and yoke 5. Since the axes of apertures 45 and 47 lie on arcs, any of them may be chosen for alignment. The variety of choices allows the user to select the best back support position for maximum user comfort. In the embodiment shown in FIG. 1, three heights and four angular options are provided so that twelve different positions are available. With a yoke employing the flange embodiment of FIG. 2 and the frame of FIG. 1, three heights and three angular options are provided, i.e., nine different positions are available. Of course, with either embodiment, greater or fewer apertures 45, 47 or edge insets 109, produce greater or fewer angular options. After the selected apertures are aligned, with either of the embodiments of FIGS. 1 and 2, rods 43 and 49 are inserted through them and knob means 65 are threaded onto the rods and tightened. Obviously, apertures 39, 45, 47, 59 and 61 are intended to pass rods 49 and 45 easily, but without allowing a great deal of &#34;play&#34; so that firm positioning of frame 51 is produced when rods 43 and 49 are tensioned. The backrest is then ready for use. The alternative embodiment yoke employing flanges of the type shown in FIG. 2, is installed in an analogous fashion. The principal installation difference is that the selection of apertures for the final adjustment of the angle of the back support need not be made before the rods are passed through the frame and flanges. Since back support 67 is pivotally mounted on frame 51, it pivots to provide continuous support to the user of the exercise machine, cycle or the like as he sways or moves during rowing or pedaling or whatever activity is provided for. As a result, back fatigue is lessened for a given period of activity and activities of longer duration and/or greater vigor may be performed with the aid of the backrest than can be sustained without back support. When a user wishes to use the backrest, he adjusts the angle and/or height of the back support with respect to the yoke. In the preferred embodiment of FIG. 1, a new user loosens knob means 65, withdraws rods 43 and 49, selects and aligns apertures 39, 45 and 59, and their counterparts to provide the desired height and angle, inserts the rods and tightens knob means 65. In the alternative embodiment of FIG. 2, rods 43 and 49 are merely loosened via knob means 65, if only angle is to be adjusted. The frame is lifted and reset to the desired angle and knob means 65 retightened. If the height of the backrest is to be adjusted, the procedure applicable to the embodiment of FIG. 1 must be followed. Of course, once the desired positioning is set, no change need be made unless a different size user seeks to use the device. The new user then selects the fixed angle and height that best suits him using the above-described procedure. The invention has thus been described in detail with emphasis on the preferred embodiment. It should be understood that variations and modifications within the spirit and scope of the invention may occur to those skilled in the art to which the invention pertains.

Summary: A backrest for use with devices having cycle-type seats mounted on support posts, such as exercise machines, bicycles, tricycles, stools and the like, in which the back support is pivotally attached to a support frame and the support frame is selectably adjustable in height and in angle with respect to the seat of said machine. The support frame is adjustably secured to a yoke which in turn is clamped to the support post of the seat.

big_patent

en

Summarize: 1st Gent. Our deeds are fetters that we forge ourselves. 2d Gent. Ay, truly: but I think it is the world That brings the iron. "Sir James seems determined to do everything you wish," said Celia, as they were driving home from an inspection of the new building-site. "He is a good creature, and more sensible than any one would imagine," said Dorothea, inconsiderately. "You mean that he appears silly." "No, no," said Dorothea, recollecting herself, and laying her hand on her sister's a moment, "but he does not talk equally well on all subjects." "I should think none but disagreeable people do," said Celia, in her usual purring way. "They must be very dreadful to live with. Only think! at breakfast, and always." Dorothea laughed. "O Kitty, you are a wonderful creature!" She pinched Celia's chin, being in the mood now to think her very winning and lovely--fit hereafter to be an eternal cherub, and if it were not doctrinally wrong to say so, hardly more in need of salvation than a squirrel. "Of course people need not be always talking well. Only one tells the quality of their minds when they try to talk well." "You mean that Sir James tries and fails." "I was speaking generally. Why do you catechise me about Sir James? It is not the object of his life to please me." "Now, Dodo, can you really believe that?" "Certainly. He thinks of me as a future sister--that is all." Dorothea had never hinted this before, waiting, from a certain shyness on such subjects which was mutual between the sisters, until it should be introduced by some decisive event. Celia blushed, but said at once-- "Pray do not make that mistake any longer, Dodo. When Tantripp was brushing my hair the other day, she said that Sir James's man knew from Mrs. Cadwallader's maid that Sir James was to marry the eldest Miss Brooke." "How can you let Tantripp talk such gossip to you, Celia?" said Dorothea, indignantly, not the less angry because details asleep in her memory were now awakened to confirm the unwelcome revelation. "You must have asked her questions. It is degrading." "I see no harm at all in Tantripp's talking to me. It is better to hear what people say. You see what mistakes you make by taking up notions. I am quite sure that Sir James means to make you an offer; and he believes that you will accept him, especially since you have been so pleased with him about the plans. And uncle too--I know he expects it. Every one can see that Sir James is very much in love with you." The revulsion was so strong and painful in Dorothea's mind that the tears welled up and flowed abundantly. All her dear plans were embittered, and she thought with disgust of Sir James's conceiving that she recognized him as her lover. There was vexation too on account of Celia. "How could he expect it?" she burst forth in her most impetuous manner. "I have never agreed with him about anything but the cottages: I was barely polite to him before." "But you have been so pleased with him since then; he has begun to feel quite sure that you are fond of him." "Fond of him, Celia! How can you choose such odious expressions?" said Dorothea, passionately. "Dear me, Dorothea, I suppose it would be right for you to be fond of a man whom you accepted for a husband." "It is offensive to me to say that Sir James could think I was fond of him. Besides, it is not the right word for the feeling I must have towards the man I would accept as a husband." "Well, I am sorry for Sir James. I thought it right to tell you, because you went on as you always do, never looking just where you are, and treading in the wrong place. You always see what nobody else sees; it is impossible to satisfy you; yet you never see what is quite plain. That's your way, Dodo." Something certainly gave Celia unusual courage; and she was not sparing the sister of whom she was occasionally in awe. Who can tell what just criticisms Murr the Cat may be passing on us beings of wider speculation? "It is very painful," said Dorothea, feeling scourged. "I can have no more to do with the cottages. I must be uncivil to him. I must tell him I will have nothing to do with them. It is very painful." Her eyes filled again with tears. "Wait a little. Think about it. You know he is going away for a day or two to see his sister. There will be nobody besides Lovegood." Celia could not help relenting. "Poor Dodo," she went on, in an amiable staccato. "It is very hard: it is your favorite _fad_ to draw plans." "_Fad_ to draw plans! Do you think I only care about my fellow-creatures' houses in that childish way? I may well make mistakes. How can one ever do anything nobly Christian, living among people with such petty thoughts?" No more was said; Dorothea was too much jarred to recover her temper and behave so as to show that she admitted any error in herself. She was disposed rather to accuse the intolerable narrowness and the purblind conscience of the society around her: and Celia was no longer the eternal cherub, but a thorn in her spirit, a pink-and-white nullifidian, worse than any discouraging presence in the "Pilgrim's Progress." The _fad_ of drawing plans! What was life worth--what great faith was possible when the whole effect of one's actions could be withered up into such parched rubbish as that? When she got out of the carriage, her cheeks were pale and her eyelids red. She was an image of sorrow, and her uncle who met her in the hall would have been alarmed, if Celia had not been close to her looking so pretty and composed, that he at once concluded Dorothea's tears to have their origin in her excessive religiousness. He had returned, during their absence, from a journey to the county town, about a petition for the pardon of some criminal. "Well, my dears," he said, kindly, as they went up to kiss him, "I hope nothing disagreeable has happened while I have been away." "No, uncle," said Celia, "we have been to Freshitt to look at the cottages. We thought you would have been at home to lunch." "I came by Lowick to lunch--you didn't know I came by Lowick. And I have brought a couple of pamphlets for you, Dorothea--in the library, you know; they lie on the table in the library." It seemed as if an electric stream went through Dorothea, thrilling her from despair into expectation. They were pamphlets about the early Church. The oppression of Celia, Tantripp, and Sir James was shaken off, and she walked straight to the library. Celia went up-stairs. Mr. Brooke was detained by a message, but when he re-entered the library, he found Dorothea seated and already deep in one of the pamphlets which had some marginal manuscript of Mr. Casaubon's,--taking it in as eagerly as she might have taken in the scent of a fresh bouquet after a dry, hot, dreary walk. She was getting away from Tipton and Freshitt, and her own sad liability to tread in the wrong places on her way to the New Jerusalem. Mr. Brooke sat down in his arm-chair, stretched his legs towards the wood-fire, which had fallen into a wondrous mass of glowing dice between the dogs, and rubbed his hands gently, looking very mildly towards Dorothea, but with a neutral leisurely air, as if he had nothing particular to say. Dorothea closed her pamphlet, as soon as she was aware of her uncle's presence, and rose as if to go. Usually she would have been interested about her uncle's merciful errand on behalf of the criminal, but her late agitation had made her absent-minded. "I came back by Lowick, you know," said Mr. Brooke, not as if with any intention to arrest her departure, but apparently from his usual tendency to say what he had said before. This fundamental principle of human speech was markedly exhibited in Mr. Brooke. "I lunched there and saw Casaubon's library, and that kind of thing. There's a sharp air, driving. Won't you sit down, my dear? You look cold." Dorothea felt quite inclined to accept the invitation. Some times, when her uncle's easy way of taking things did not happen to be exasperating, it was rather soothing. She threw off her mantle and bonnet, and sat down opposite to him, enjoying the glow, but lifting up her beautiful hands for a screen. They were not thin hands, or small hands; but powerful, feminine, maternal hands. She seemed to be holding them up in propitiation for her passionate desire to know and to think, which in the unfriendly mediums of Tipton and Freshitt had issued in crying and red eyelids. She bethought herself now of the condemned criminal. "What news have you brought about the sheep-stealer, uncle?" "What, poor Bunch?--well, it seems we can't get him off--he is to be hanged." Dorothea's brow took an expression of reprobation and pity. "Hanged, you know," said Mr. Brooke, with a quiet nod. "Poor Romilly! he would have helped us. I knew Romilly. Casaubon didn't know Romilly. He is a little buried in books, you know, Casaubon is." "When a man has great studies and is writing a great work, he must of course give up seeing much of the world. How can he go about making acquaintances?" "That's true. But a man mopes, you know. I have always been a bachelor too, but I have that sort of disposition that I never moped; it was my way to go about everywhere and take in everything. I never moped: but I can see that Casaubon does, you know. He wants a companion--a companion, you know." "It would be a great honor to any one to be his companion," said Dorothea, energetically. "You like him, eh?" said Mr. Brooke, without showing any surprise, or other emotion. "Well, now, I've known Casaubon ten years, ever since he came to Lowick. But I never got anything out of him--any ideas, you know. However, he is a tiptop man and may be a bishop--that kind of thing, you know, if Peel stays in. And he has a very high opinion of you, my dear." Dorothea could not speak. "The fact is, he has a very high opinion indeed of you. And he speaks uncommonly well--does Casaubon. He has deferred to me, you not being of age. In short, I have promised to speak to you, though I told him I thought there was not much chance. I was bound to tell him that. I said, my niece is very young, and that kind of thing. But I didn't think it necessary to go into everything. However, the long and the short of it is, that he has asked my permission to make you an offer of marriage--of marriage, you know," said Mr. Brooke, with his explanatory nod. "I thought it better to tell you, my dear." No one could have detected any anxiety in Mr. Brooke's manner, but he did really wish to know something of his niece's mind, that, if there were any need for advice, he might give it in time. What feeling he, as a magistrate who had taken in so many ideas, could make room for, was unmixedly kind. Since Dorothea did not speak immediately, he repeated, "I thought it better to tell you, my dear." "Thank you, uncle," said Dorothea, in a clear unwavering tone. "I am very grateful to Mr. Casaubon. If he makes me an offer, I shall accept him. I admire and honor him more than any man I ever saw." Mr. Brooke paused a little, and then said in a lingering low tone, "Ah?... Well! He is a good match in some respects. But now, Chettam is a good match. And our land lies together. I shall never interfere against your wishes, my dear. People should have their own way in marriage, and that sort of thing--up to a certain point, you know. I have always said that, up to a certain point. I wish you to marry well; and I have good reason to believe that Chettam wishes to marry you. I mention it, you know." "It is impossible that I should ever marry Sir James Chettam," said Dorothea. "If he thinks of marrying me, he has made a great mistake." "That is it, you see. One never knows. I should have thought Chettam was just the sort of man a woman would like, now." "Pray do not mention him in that light again, uncle," said Dorothea, feeling some of her late irritation revive. Mr. Brooke wondered, and felt that women were an inexhaustible subject of study, since even he at his age was not in a perfect state of scientific prediction about them. Here was a fellow like Chettam with no chance at all. "Well, but Casaubon, now. There is no hurry--I mean for you. It's true, every year will tell upon him. He is over five-and-forty, you know. I should say a good seven-and-twenty years older than you. To be sure,--if you like learning and standing, and that sort of thing, we can't have everything. And his income is good--he has a handsome property independent of the Church--his income is good. Still he is not young, and I must not conceal from you, my dear, that I think his health is not over-strong. I know nothing else against him." "I should not wish to have a husband very near my own age," said Dorothea, with grave decision. "I should wish to have a husband who was above me in judgment and in all knowledge." Mr. Brooke repeated his subdued, "Ah?--I thought you had more of your own opinion than most girls. I thought you liked your own opinion--liked it, you know." "I cannot imagine myself living without some opinions, but I should wish to have good reasons for them, and a wise man could help me to see which opinions had the best foundation, and would help me to live according to them." "Very true. You couldn't put the thing better--couldn't put it better, beforehand, you know. But there are oddities in things," continued Mr. Brooke, whose conscience was really roused to do the best he could for his niece on this occasion. "Life isn't cast in a mould--not cut out by rule and line, and that sort of thing. I never married myself, and it will be the better for you and yours. The fact is, I never loved any one well enough to put myself into a noose for them. It _is_ a noose, you know. Temper, now. There is temper. And a husband likes to be master." "I know that I must expect trials, uncle. Marriage is a state of higher duties. I never thought of it as mere personal ease," said poor Dorothea. "Well, you are not fond of show, a great establishment, balls, dinners, that kind of thing. I can see that Casaubon's ways might suit you better than Chettam's. And you shall do as you like, my dear. I would not hinder Casaubon; I said so at once; for there is no knowing how anything may turn out. You have not the same tastes as every young lady; and a clergyman and scholar--who may be a bishop--that kind of thing--may suit you better than Chettam. Chettam is a good fellow, a good sound-hearted fellow, you know; but he doesn't go much into ideas. I did, when I was his age. But Casaubon's eyes, now. I think he has hurt them a little with too much reading." "I should be all the happier, uncle, the more room there was for me to help him," said Dorothea, ardently. "You have quite made up your mind, I see. Well, my dear, the fact is, I have a letter for you in my pocket." Mr. Brooke handed the letter to Dorothea, but as she rose to go away, he added, "There is not too much hurry, my dear. Think about it, you know." When Dorothea had left him, he reflected that he had certainly spoken strongly: he had put the risks of marriage before her in a striking manner. It was his duty to do so. But as to pretending to be wise for young people,--no uncle, however much he had travelled in his youth, absorbed the new ideas, and dined with celebrities now deceased, could pretend to judge what sort of marriage would turn out well for a young girl who preferred Casaubon to Chettam. In short, woman was a problem which, since Mr. Brooke's mind felt blank before it, could be hardly less complicated than the revolutions of an irregular solid.

Summary: The sisters are discussing Sir James. Celia suggests he is trying hard to please Dorothea. The latter insists that he look upon her as "a future sister." Celia shatters her illusion by conveying the maids gossip that Chettam is to marry "the elder Miss Brooke." Dorothea is annoyed and disturbed. Seeing her chance, Celia doesnt spare her: "you always see what nobody else sees; it is impossible to satisfy you; yet you never see what is quite plain." Dorothea is in tears and decides to take no further interest in the laborers cottages. Her uncle returns from an official trip. He has visited Casaubon on his way home. He relays a proposal of marriage from Casaubon to her. He is rather hesitant about it and is astonished when she promptly declares her acceptance. Brooke is a man of liberal but vague ideas. He abides by his usual non-interference but conscientiously warns her of the drawbacks of the age difference of 27 years; of Casaubons indifferent health, and his poor sight, damaged by too much study. Trying to be fair, he further declares that Casaubon has a handsome property may end up a bishop, and may even suit Dorotheas tastes better than Chettam. He stunned when he promptly refuses to even consider Chettam. Eventually, he hands over Casaubons letter to her.

booksum

en

Write a title and summarize: SECTION 1. SHORT TITLE; DEFINITIONS. (a) Short Title.--This Act may be cited as the ``Native American Sacred Lands Act''. (b) Definitions.--For the purposes of this Act, the following definitions shall apply: (1) Federal lands.--The term ``Federal lands'' means any land or interests in land owned by the United States, including leasehold interests held by the United States, except Indian trust lands. (2) Indian tribe.--The term ``Indian tribe'' has the meaning given such term by section 4(e) of the Indian Self- Determination and Education Assistance Act. (3) Native hawaiian organization.--The term ``Native Hawaiian organization'' has the meaning given that term in section 301(18) of the National Historic Preservation Act (16 U.S.C. 470w(18)). (4) Sacred land.--The term ``sacred land'' means any geophysical or geographical area or feature which is sacred by virtue of its traditional cultural or religious significance or ceremonial use, or by virtue of a ceremonial or cultural requirement, including a religious requirement that a natural substance or product for use in Indian tribal or native Hawaiian organization ceremonies be gathered from that particular location. (5) Undertaking.--The term ``undertaking'' has the same meaning given that term in section 301(7) of the National Historic Preservation Act (16 U.S.C. 470w(7)). SEC. 2. PROTECTION OF SACRED LANDS. Each department or agency of the United States with administrative jurisdiction over the management of Federal lands shall-- (1) accommodate access to and ceremonial use of Indian sacred lands by Indian religious practitioners; (2) avoid significant damage to Indian sacred lands; and (3) consult with Indian tribes and Native Hawaiian organizations prior to taking significant actions or developing policies affecting Native American sacred lands. SEC. 3. DESIGNATING INDIAN SACRED LANDS UNSUITABLE FOR DEVELOPMENT. (a) In General.--Federal lands shall be designated unsuitable for any or certain types of undertakings if the head of the department or agency with administrative jurisdiction over that Federal land decides, in accordance with this section, that by a preponderance of the evidence the undertaking is likely to cause significant damage to Indian sacred lands. (b) Petition.-- (1) In general.--Any Indian tribe or Native Hawaiian organization shall have the right to petition any department or agency of the United States with administrative jurisdiction over Federal lands to have Federal lands under the jurisdiction of that department or agency designated as unsuitable for any or certain types of undertaking. (2) Supporting evidence.--Such a petition shall contain allegations of facts with supporting evidence which would tend to establish the allegations. Oral history shall be given no less weight than other evidence. After an Indian tribe or Native Hawaiian organization has filed a petition under this section, and before the hearing as required by this subsection, any person may file allegations of facts, with supporting evidence, that are relevant to the petition. (c) Hearing.-- (1) In general.--Not later than 90 days after the receipt of such petition, the department or agency with administrative jurisdiction over that Federal land involved shall hold a public hearing on the subject of the petition in the locality of that Federal land after public notice, including publication of the date, time, and location of the hearing. (2) Written decision.--Not later than 60 days after a hearing held pursuant to this subsection, the head of the department or agency with administrative jurisdiction over that Federal land shall issue and furnish to the petitioner and any other parties to the hearing a written decision regarding the petition and the reasons for the decision. (d) Appeal.--Not later than 60 days after a written decision is issued pursuant to subsection (c)(2), any petitioner or person filing under section 3(b)(2) may appeal the decision to the appropriate Federal agency appeals board or through a civil action in accordance with subsection (e). A decision regarding a petition shall not be considered final for the purposes of this section until-- (1) the deadline for filing an appeal to the decision has past and no appeal has been filed; or (2) if an appeal was timely filed, the appeal has been heard and decided. (e) Civil Actions; Jurisdiction; Relief.-- (1) In general.--The United States district courts shall have original jurisdiction over any civil action or claim against the Secretary of the Interior or the head of another Federal agency, as appropriate, arising under this section. In an action brought under this paragraph, the district courts may order appropriate relief including money damages, injunctive relief against any action by an officer of the United States or any agency thereof contrary to this Act, or regulations promulgated thereunder, or mandamus to compel an officer or employee of the United States, or any agency thereof, to perform a duty provided under this Act or regulations promulgated hereunder. (2) Application of equal access to justice act.--The Equal Access to Justice Act (Public Law 96-481; Act of October 1, 1980; 92 Stat. 2325; 5 U.S.C. 594; 28 U.S.C. 2412) shall apply to actions brought under this Act. (f) Effect of Decision of Unsuitability.-- (1) In general.--A final decision that Federal lands identified by a petition considered pursuant to subsection (b) are unsuitable for any or certain types of undertakings shall be immediately effective and the undertaking shall be prohibited. (2) Withdrawal of lands.--Subject to valid and existing rights, the Secretary of the Interior shall (with the consent of the department or agency other than the Department of the Interior in the case of Federal lands not under the administration of the Secretary of the Interior) withdraw Federal lands included in a decision of unsuitability under this section pursuant to section 204 of the Federal Land Policy and Management Act of 1976 (43 U.S.C. 1714). The Secretary's decision under this section shall constitute the documentation required to be provided under section 204(c)(12) of the Federal Land Policy and Management Act of 1976 (43 U.S.C. 1714) and in compliance with section 4. (3) Land use plans.--Any decision of unsuitability made for Federal lands under the administrative jurisdiction of the Secretary of the Interior or the Secretary of Agriculture (with respect to National Forest System lands) shall be incorporated into the appropriate land use plan when such plan is adopted, revised, or significantly amended pursuant to the Federal Land Policy and Management Act of 1976 or, as the case may be, the Forest and Rangeland Renewable Resources Planning Act of 1974. SEC. 4. CONFIDENTIALITY. (a) In General.--Notwithstanding section 5 of title 5, United States Code (commonly known as the Freedom of Information Act) or any other law, no information obtained as a result of or in connection with a petition filed or a hearing held under this Act that contains a reference pertaining to a specific detail of a Native American traditional cultural practice or religion, or the significance of an Indian or Native Hawaiian sacred land, or the location of that sacred land, shall be released except as provided in subsection (c). (b) Release of Information.-- (1) Initial violation.--Any person who intentionally releases any information knowing that it is required to be held confidential pursuant to this section shall, upon conviction, be fined not more than $10,000, or imprisoned not more than 1 year, or both. (2) Subsequent violations.--In the case of a second or subsequent violation of this section, a person shall, upon conviction, be fined not more than $100,000, or imprisoned not more than 5 years, or both. (c) Exception.--This section shall not apply in any case in which all persons filing pursuant to section 3(b), including the petitioner, waive the application of this section. SEC. 5. GRANTS. (a) Authority to Provide Grants.--The Secretary may provide grants to Indian tribes to assist the Indian tribes in carrying out activities related to this Act. (b) Authorization of Appropriations.--There are authorized to be appropriated to the Secretary such sums as may be necessary to carry out this section. SEC. 6. REGULATIONS. (a) Consultation With Indian Tribes.--In developing regulations under this Act, the Secretary shall use-- (1) an effective process to permit elected tribal officials, traditional Native American practitioner, and other representatives of Indian tribal governments to provide meaningful and timely input in that development; and (2) where appropriate, consensual mechanisms, including negotiated rulemaking. (b) Effective Date.--This Act shall become effective on the date of the enactment of this Act. Any failure of the Secretary to promulgate regulations under this section shall not affect such effective date. SEC. 7. CONSULTATION UNDER OTHER LAWS. Nothing in this Act shall affect any consultation process under the National Historic Preservation Act or any other Federal law.

Title: To protect sacred Native American Federal lands from significant damage Summary: Native American Sacred Lands Act - Requires managers of Federal lands to: (1) accommodate access and use by Indian religious practitioners; (2) prevent significant damage to Indian sacred lands; and (3) consult with Indian tribes and Native Hawaiian organizations before taking significant actions concerning such lands.Prohibits undertakings likely to cause significant damage to Indian sacred lands.Grants Indian tribes and Native Hawaiian organizations the right to petition the department or agency with administrative jurisdiction to have Federal lands designated as unsuitable for certain undertakings. Permits appeals through the Federal agency appeals board or in U. S. district courts. Provides relief through monetary damages, injunctions, or mandamus.Provides for the withdrawal of lands determined to be unsuitable. Requires Federal land use plans to be modified accordingly.Protects the confidentiality of information in a petition as it pertains to traditional cultural practice, religion, or the significance and location of sacred land. Imposes criminal penalties for violations of such confidentiality.Authorizes the Secretary of the Interior to make grants to assist Indian tribes in activities under this Act. Requires the Secretary to consult with Indian tribes in developing regulations.

billsum

en

Write a title and summarize: Neuronal migration during embryonic development contributes to functional brain circuitry. Many neurons migrate in morphologically distinct stages that coincide with differentiation, requiring tight spatial regulation. It had been proposed that neurotransmitter-mediated activity could exert this control. Here, we demonstrate that intracellular calcium transients occur in cerebellar neurons of zebrafish embryos during migration. We show that depolarization increases and hyperpolarization reduces the speed of tegmental hindbrain neurons using optogenetic tools and advanced track analysis optimized for in vivo migration. Finally, we introduce a compound screening assay to identify acetylcholine (ACh), glutamate, and glycine as regulators of migration, which act regionally along the neurons’ route. We summarize our findings in a model describing how different neurotransmitters spatially interact to control neuronal migration. The high evolutionary conservation of the cerebellum and hindbrain makes it likely that polarization state-driven motility constitutes an important principle in building a functional brain. The brain is the most complex organ in the body. It carries out its tasks by networks of neurons that form separate spatial entities, which are often organized into layers or nuclei. During embryonic development, many neurons that arise in various progenitor zones migrate in order to build these intricate structures [1]. It is thought that active cell migration is also essential to establish functional networks as neurons encounter their interacting partners along the way [2], and axonogenesis and maturation often coincide with migration [3–5]. Thereby, neuronal migration underlies the formation of functional circuitry [6]. Neuronal migration has been studied in various contexts using mostly in vitro assays or in situ rodent brain slices [7–9]. These studies have identified a number of molecules involved in cell guidance [10], but the control of forward movement is less understood. Still, these studies have discovered that activity mediated by different neurotransmitters has a complex role in the migration of neurons [11]. The best studied neurotransmitter system in this context is glutamate [12], which typically promotes migration [13–16]. The function of other neurotransmitters, such as acetylcholine (ACh), glycine, and GABA is less clear, but may depend on the type of neuron studied and assay conditions [17–24]. Studies using implants in rodent brains have been able to show that glutamate is a major influence in the correct arrangement of neurons into layers during development [25], yet this sophisticated technology did not allow for the live monitoring of cell migration. It has been proposed that different neurotransmitters act together or sequentially to fine-tune migration [12,26,27], but in vivo data from neurons migrating in their natural environment without incurring tissue damage from invasive procedures are scarce [25,28]. Here, we use live zebrafish embryos to track individual neurons along their route in the developing cerebellum to investigate neurotransmitter-mediated membrane polarization in neuronal migration. In the adult zebrafish brain, tegmental hindbrain nuclei neurons (THNs) form clusters that are involved in gustatory, viscero-sensory, and visual information processing [29]. These are homologous to the mammalian parabrachial, parabigeminal, and laterodorsal-pedunculopontine tegmental hindbrain nuclei. During embryonic development, THNs arise at the upper rhombic lip (URL) of the cerebellar primordium between 24 hours post fertilization (hpf) and 48 hpf [29,30]. They emigrate from the URL in a first phase to reach the midbrain-hindbrain boundary (MHB) [30]. THNs then follow the MHB in a second migratory phase to reach their destination at the ventral end of the MHB [4,30]. This migration in distinct phases suggests that the necessary spatiotemporal control could be exerted by neurotransmitter-mediated activity as a fast acting, spatially limitable regulator. Zebrafish embryos rapidly develop their most important brain regions while they are still translucent. This makes them an ideal model for tracking individual cells in their natural environment without damaging the surrounding tissue. Early zebrafish embryos are also easily accessible for pharmacological intervention and optogenetic manipulations by light microscopy. Taking advantage of these properties, we demonstrate that calcium transients are present in the THNs, and that de- and hyperpolarization produce opposite effects on THN migration speed in spatially defined regions. We identify ACh, glycine, and glutamate as key neurotransmitters in the regulation of migration. These findings are summarized in a model outlining the interactions of the neurotransmitters to spatially control THN migration. The URL in zebrafish embryos is a germinal zone along the dorsoposterior surface of the developing cerebellum, which gives rise to different long-distance migrating neurons, such as THNs and cerebellar granule cells, similar to the situation in mammals [29]. THNs are first to emerge from the URL from 24 hpf and traverse the whole cerebellar primordium to reach the tegmental hindbrain. Early emerging neurons, THNs are characterized by the expression of the transcription factor atonal 1a (atoh1a) [4]. Long-term in vivo imaging of THNs expressing green fluorescent protein (GFP) in a bipartite Gal4 (transcriptional activator protein) /upstream activating sequence (UAS) system driven by the atoh1a promoter [4] shows that THNs first reach the MHB after leaving the URL (Fig 1A and 1B). Next, they follow the MHB ventrally, where they form clusters in the tegmentum of the hindbrain from around 60 hpf onwards (S1 Video). These separate into the secondary gustatory/viscerosensory nucleus, the nucleus isthmi, and the superior reticular nucleus, which contain cholinergic neurons during further development, and establish connections in the di- and mesencephalon similar to the equivalent nuclei in mammals [29]. Along this migratory route, THNs change shape dramatically. In the first migratory phase between URL and MHB, THNs exhibit an elongated bipolar shape and retain contact with the URL at the rear (Fig 1C, top panel, and zoom in left in Fig 1D). Once the nucleus is located near the MHB, THNs retract their trailing ends. THNs that reach the MHB at its dorsal end often exhibit a brief, highly protrusive phase. These short-lived protrusions extend in all directions (Fig 1C, bottom panel, and middle image in Fig 1D). In contrast, THNs that reach the MHB more ventrally often directly assume the morphology of migratory phase 2, which consists of a very elongated leading process with the nucleus situated at the rear (Fig 1C, bottom panel and Fig 1D, right; see also S2 Video). A schematic overview of THN morphology along their migratory route is depicted in Fig 1E. These changes suggest a close co-regulation of the morphology and migratory progress associated with the specific region that the cells migrate through. Results from rodent neurons tracked in in situ brain slices [24,31] suggest that locally regulated, neurotransmitter-mediated plasma membrane (PM) potential changes could exert this control on THN migration in vivo. Neurotransmitters evoke intracellular calcium transients as propagating signals (for review see [11]). This prompted us to determine if calcium transients can be detected in THNs. In order to improve the quantification of calcium transients, we made use of the Tg (elavl3: Hsa. H2B-GCaMP6s) fish line (kindly provided by Misha Ahrens, [32]). In these embryos, the nuclear localized calcium sensor is easy to track and measure in all mature neurons. Out of all Histone 2B (H2B) fused to genetically encoded calcium sensor, circular permutated green florescent protein-Calmodulin-M13 peptide 6s (GCaMP6s) -expressing neurons, we selected those as THNs that (1) were positioned at the MHB at several μm depth from the body surface, (2) were oriented towards the ventral end of the MHB based on the long axis of the elliptic nuclei, and (3) expressed the marker at increasing strength towards the ventral end of the MHB, in line with the observation that THNs begin their differentiation along route at the MHB [4] (Fig 2A). The GCaMP6s fluorescence of these nuclei was recorded in 30-min videos at 436 ms intervals in a single z plane. We measured the total fluorescence intensity of individual nuclei by region of interests (ROIs) that the nucleus under investigation occupied during the observation window. Due to tissue shifts arising from embryo growth, active migration and pressure from the surrounding cells, some nuclei left the focal plane or were joined by other nuclei that invaded the ROI. In these cases, we included only data from the durations in which the nuclei remained alone and in focus in their ROIs in our analysis (Fig 2B for example stills from nucleus 12 indicated in 2A). These raw traces were background-corrected by calculating the baseline intensity value (F0) for each timepoint from all values in a 100 frame window ([33]; Fig 2C for example nucleus 12). Dividing the raw fluorescence intensity (F) by this baseline value at each timepoint produced the fluorescence over background (F/F0) trace depicted in Fig 2D. The resulting traces were still rather noisy, especially in nuclei with low expression levels of H2B-GCaMP6s. The noise was removed by applying a bandpass filter with cutoff frequencies at 20 and 200 mHz, respectively (Fig 2E). A calcium transient was detected when the amplitude of this F/F0 trace after filtering reached >0. 25, and was checked against the original film to remove false-positives. Using this method, we analyzed 195 nuclei from 15 embryos and detected a total of 55 calcium transients. We noticed that different patterns of calcium transients occur in THNs (Fig 2F); many nuclei showed mostly single short-term peaks, while others appeared dormant (no signal). The strengths of individual signals as seen in the maximal values for each signal in the F/F0 trace varied widely (Fig 2G, signals pooled from all 195 nuclei; S1 Data). We also noticed that a significant portion of nuclei exhibited very regular calcium transients that occurred at low F/F0 amplitudes, and were therefore excluded from the previous analysis by setting the 0. 25 cutoff level (trace 14 in Fig 2F). To determine the frequency spectrum contained in the data, all F/F0 traces were Fourier transformed (Fig 2H; for control, the transformations were repeated with unfiltered datasets to avoid losing frequency information). From these fast Fourier transform (FFT) values, we first determined the dominant frequencies contained in each trace by identifying the frequencies with the highest amplitude in each FFT (Fig 2I, S1 Data). These spread over a range of frequencies when looking at all 195 nuclei. As the full dataset includes nuclei without prominent oscillations, which could mask results for the oscillating population, we selected 32 nuclei out of the 195 total number, which showed very regular oscillations by visual inspection of the F/F0 traces, and calculated their mean oscillation frequency by Gaussian fitting to the FFTs. This yielded an oscillation frequency close to 14 mHz (Fig 2I, S1 Data). This value is close to the 16. 7 mHz used in the optogenetics experiments (see next paragraph). Hence, we tested all 195 FFTs for the prominence of 16. 7 mHz ± 1. 67 mHz. Surprisingly, this analysis revealed that signal components in this range occur in approximately 90% of all nuclei (N = 176). Yet in only 32. 3% of all nuclei (N = 63), this frequency is prominent, or corresponding to the highest amplitude of the FFT within the 16. 7 mHz ± 1. 67 mHz frequency range. Taken together, it appears likely that a mix of stronger, individual calcium events and low-level oscillations exists in many THNs. A further investigation of the types of calcium signals in THNs, as well as the relevance of individual calcium transient types for THN migration, will continue in the future as better calcium signal detection technology for THNs becomes available. Although these results clearly show that calcium transients occur in THNs at the MHB, the limitations set by the confinement of H2B-GCaMP6s expression in THNs to phase 2 THNs at the MHB does not allow us to infer the extent of calcium transients occurring along the whole migration route from the URL. Likewise, we could miss hotspots of activity that occur in the cerebellum. Consequently, we co-expressed a PM-targeted version of GCamp6s as calcium sensor and FyntagRFP-T for positional control from a bidirectional vector in THNs, taking advantage of the Gal4/UAS system driven by the atoh1a-promoter [4]. THNs were again continuously imaged for 30 min in a single focal plane. Next, THNs were screened for calcium transients, which were defined by an increase of green fluorescence of at least 2-fold over baseline, whereas the red fluorescence remained unchanged (S1 Fig). Next, the position of every signaling THN was marked within the cerebellum using the transmitted-light channel images. These images were registered using the dorsal surface of the cerebellum and the MHB as anatomical landmarks, and then individually size-adjusted to align at their URLs. All signaling cell positions (N = 50 cells out of a total of 238 analyzed from 20 embryos) were superimposed to produce the image in Fig 2J (see also S1 Fig), illustrating that calcium transients of widely varying duration and rate can be recorded throughout the tissue (see S1 Fig). Taking a closer look at these signals, we observed that the calcium transients tend to occur at the front of the THN in about one-third of the cells (Fig 2K and 2L; see also S1 Fig and S3 Video). This phenomenon has been described before in cells migrating in vitro and slice culture [34] [35]. In sum, these results demonstrate that calcium transients occur in many THNs, with a tendency to arise at the front of migrating THNs. The calcium transients exhibit diverse patterns and occur throughout the migratory route of THNs in the cerebellum. Such calcium transients could be caused by neurotransmitter-induced changes of the polarization state of the neurons [7]. The presence of calcium transients at the time of THN migration could be due to neuronal activity. Therefore, we directly manipulated activity in THNs to analyze the effects on migration by cell tracking using optogenetics to circumvent the need to manipulate specific neurotransmitters at this point of the investigation. As the morphological changes in THNs are most prominent at the MHB, we focused our analysis on this region. To test the suitability of the optogenetic channels for inducing changes to the calcium transients in THNs, we first expressed the channels using cytomegalovirus (CMV) promoters in Tg (elavl3: Hsa. H2B-GCaMP6s) embryos (Fig 3A and S2 Fig). We expressed either channelrhodopsin (ChR2) or mutated channelrhodopsin (SwiChR), each tagged with YFP for identification. ChR2 is a commonly used cation channel that depolarizes cells upon application of blue light. SwiChR is a mutated version of ChR2 that retains the same activation spectrum but allows the inward passage of anions, thereby hyperpolarizing cells [36]. The fact that ChR2 and SwiChR share the same physical and biological parameters, e. g., ion influx rates, expression levels of the proteins and protein architecture, facilitates the comparison between de- and hyperpolarization effects. We depolarized cells by blue light illumination for a duration of 6. 57 μs/pixel using a confocal microscope. This is equivalent to the exposure to the blue light for a total duration of 1. 64 ms every 60 s for an average sized THN. The fluorescence of the calcium sensor was measured in cells located at the ventral end of the MHB, as these expressed the H2B-GCaMP6s most strongly (nuclei 1 and 2 in Fig 3A–3C). Regular increases in fluorescence intensity (Fig 3B) occurred at a frequency of 16. 7 mHz, as is expected if ChR2 depolarizes cells in response to a blue light pulse every 60 s (arrows in Fig 3C). All 20 nuclei from eight embryos that were analyzed in this way showed the same response at 16. 7 mHz. Thirty low-expressing cells more dorsal at the MHB or cells at the URL that do not express H2B-GCaMP6s served as internal negative controls (nuclei 3 and 4 in Fig 3B and 3C). Sixteen of these control nuclei from 11 embryos showed a weak response at 16. 7 mHz in this analysis, likely due to the weaker expression of GCaMP6s relative to ChR2-YFP. Fourteen nuclei did not show any frequency preference (nucleus 4 in Fig 3C). As additional controls, we repeated the experiment in SwiChR-YFP expressing cells in the same genetic background, as well as in atoh1a: KalTA-positive embryos co-expressing a nuclear localized GCaMP6s and either ChR2-YFP or SwiChR-YFP. In these experiments, neither of the SwiChR-expressing cells showed a calcium signal upon blue light illumination, whereas ChR2-positive cells responded as expected to the channel opening at 16. 7 mHz (S2 Fig). Having established that the optogenetic tools allow us to de- and hyperpolarize cells migrating in the cerebellum, we stimulated atoh1a: KalTA-positive embryos expressing either ChR2-YFP or SwiChR-YFP in THNs every 10 min for 4 h with 476 nm illumination at 14. 77 μs/pix or 3. 15 ms for an average sized THN to open the respective channel, and 514 nm illumination to locate the THNs (Fig 3D). In addition, we used PM-targeted YFP as migration control for these illumination settings (see also S4 Video). To determine migration speeds of individual THNs, the cells were tracked in SIMI°BioCell [37] (orange spheres in Fig 3E, see also S5 Video), and the tracks were subsequently corrected for tissue shift (reference markers as cyan spheres in Fig 3E; N [control] = 569 tracks/23 embryos, N [ChR2_10ʹ] = 557 tracks/33 embryos, N (ChR2_1ʹ) = 175 tracks/15 embryos, N [SwiChR_10ʹ] = 594 tracks/32 embryos; see also S1 Table for N and statistic parameters). Next, tracks were classified by their starting point in bins of 10% of total MHB length, where 0% is the dorsal and 100% the ventral end. This analysis revealed that THNs begin to slow in their progression along the MHB from approximately 25%–35% MHB on (Fig 3F and 3G; S2 Data). As this speed profile suggested that dorsal tracks are different from ventral tracks, we considered dorsal and ventral tracks separately in all other experiments, using 27. 5% MHB as discrimination point (see also S3 Fig, S2 Data, and Materials and methods for determination of the cutoff point). Under mild hyperpolarizing conditions, SwiChR-induced hyperpolarization results in a migration speed reduction independent of the position at the MHB (Fig 3D–3H). To test if such a mild hyperpolarization is a strong signal in THN migration, we activated SwiChR every 10 min for 48 h. We found that cluster formation at the ventral end of the MHB was delayed, but over time THNs migrated a short distance (S4 Fig and S6 Video). This suggests that hyperpolarization is a regulator of THN migration, though probably not the only one acting on THNs at the MHB. In contrast to hyperpolarization, depolarization every 10 min via ChR2 did not affect THN speed (Fig 3G and 3H). When the depolarization interval was increased to 1 min and 6. 57 μs per pixel or 1. 64 ms per cell, THNs migrated faster than control cells, irrespective of their position at the MHB (Fig 3D–3H). Yet even in these highly depolarizing conditions, cells reduced their speed towards the ventral side of the MHB (Fig 3G and 3H). This hints at the presence of regulatory mechanisms other than membrane potential, which are able to modulate the depolarization-induced cell speed increase in the ventral portion of the MHB. Interestingly, none of the optogenetic manipulations induced THNs to deviate from their usual route, showing that activity controls migration progress rather than directionality. As the optogenetic experiments demonstrated that cell-autonomous activity is directly involved in regulating THN motility, we set out to identify the neurotransmitter systems that drive the migration. We developed an assay that allows us to quantitatively evaluate pharmacological compounds for their effects on migration. In atoh1a: KalTA/4xUAS-GFP embryos, all THNs in the developing cerebellum appear labelled by GFP expression [4]. This allows the tracking of the whole population under different conditions. Six to 12 fluorescent embryos from 27 hpf to 34 hpf were embedded laterally to improve tracking of THNs along the MHB. The embryos were kept in their normal medium supplemented with different compounds (S2 Table, see also S7 Video). The cerebellum was imaged in 5 μm steps every 10 min for a duration of 4 h. Each condition was analyzed at least in triplicate (see S3 Table for N and statistical parameters, see also S8 Video). Next, cells were tracked and tissue-shift corrected as in the optogenetic experiments. First, we tested the ACh system, as mature THNs are cholinergic [29]. THNs migrating under control (1% dimethyl sulfoxide [DMSO]) conditions made good progress along the MHB (Fig 4A and 4B; N = 600 tracks/19 embryos). Quantification revealed that migration speed again decreases as THNs approach the ventral end of the MHB, matching results from the optogenetic experiments (Fig 4C and 4D and S3 Fig, S3 Data). Blocking nicotinic ACh receptors with 500 μM hexamethonium strongly decreased migration speed, irrespective of the starting point (Fig 4A–4D; N = 694 tracks/23 embryos; see S3 Fig for the determination of cutoff points for dorsally- and ventrally-located cells). This reduction in THN speed is unlikely to be due to a gross mis-organization of the actin cytoskeleton, as hexamethonium does not appear to introduce obvious changes in THN morphology (S5 Fig). The total number of calcium transients is also reduced by approximately 30% in Tg (elavl3: Hsa. H2B-GCaMP6s) embryos (9. 31 × 10−3 signals per min, or 39 signals in total observation time of 53. 4 h collectively from 161 nuclei out of 15 embryos, compared to 13. 37 × 10−3 signals per min in control cells or 56 signals in total observation time of 69. 8 h from 195 nuclei out of 15 embryos, using a 0. 25 F/F0 amplitude cutoff that excludes low-level oscillations; see also S1 Data). Yet the effect is most prominent on the strongest signals as determined by a 0. 5 F/F0 amplitude cutoff, reflected in a reduction of approximately 64% (1. 91 × 10−3 signals per min in hexamethonium-treated embryos versus 5. 25 × 10−3 in control embryos). This suggests that hexamethonium dampens, rather than abolishes, calcium transients (Fig 4E and S2 Fig). The prominent transient frequencies contained in the dataset as determined by the maximal amplitude values in the FFT analysis do not differ significantly from controls (Fig 4F); neither does the proportion of nuclei exhibiting low-amplitude oscillations around 16. 7 mHz (53 out of 161 nuclei total, or 32. 9). Long-term imaging also suggested that the speed reduction is a strong effect, as THNs under continuous hexamethonium treatment lagged behind controls in their progress along the MHB and cluster formation (arrows in S4 Fig, see also S15 Video). In sum, hexamethonium appears to modulate calcium transient strength in THNs, which could be related to its speed reduction effect on migrating THNs. In order to further characterize the effects of the ACh system on migrating THNs, we also blocked muscarinic ACh receptors by atropine. This treatment had only a slight effect on THNs in the ventral portion of the MHB. The attempt to activate nicotinic receptors by nicotine had no impact on the cells (Fig 4C and 4D). As this could be due to the low solubility of nicotine in water, we also tested the effect of 1 mg/ml ACh on THN migration, as ACh is readily soluble in water. This agonist induced a speed increase in dorsal THNs (Fig 4A–4D, N = 1223 tracks/28 embryos). The absence of a stimulating effect in the ventral region at the MHB could be due to the increased presence of acetylcholinesterase (AchE), which inactivates ACh [38,39]. Hence, we tested the effect of overexpressed AchE on THN motility. We hypothesized that the overexpression, or premature expression, of AchE in THNs could mimic the migration inhibition by hexamethonium via efficient removal of ACh from the immediate surroundings of the THNs. In order to restrict the effect of AchE to the THNs, we used a GFP-tagged version of an isoform of human AchE, known as Ache GPI-anchored isoform H (AcheH), which is anchored to the cell surface by glycosylphosphatidylinositol (GPI) modification ([40]; S3 and S5 Figs). Cell-type–specific overexpression was achieved by injecting the GFP-AcheH construct under 5xUAS control into atoh1a: KalTA embryos. As shown in Fig 4A–4D, overexpression of this construct induces a strong decrease in migration speed, similar to hexamethonium (N = 319 tracks/24 embryos). This demonstrates that ACh is indeed an important regulator of THN migration, acting directly on the THNs in a cell-autonomous manner. Finally, we attempted to show that THNs express genes that play a role in the perception of ACh. As nicotinic ACh receptors are composed of five different subunits, each of which is represented by a large gene family in zebrafish, we decided to localize RIC3 acetylcholine receptor chaperone b (ric3b) and ache by whole mount in situ hybridization (WISH) instead. Ric3b is a chaperone involved in folding a number of various nicotinic ACh receptors [41,42]. Ric3b is widely expressed in the brain at 30 hpf (S3 Fig), especially in the ventral region of the hindbrain and the cerebellum. Staining is also visible at the MHB, and lighter staining in the cerebellar tissue. Similar results were obtained for AchE, with additional, very strong staining in the muscles as expected (S3 Fig). Taken together, these results suggest that ACh-mediated activity is the source of regular depolarization for THNs. Therefore, we next asked whether ChR2-mediated depolarization can compensate for the loss of ACh-mediated depolarization. We accordingly depolarized THNs that were kept in 500 μM hexamethonium optogenetically at 1 min intervals as in the previous experiments (Fig 4A and 4B). Under these conditions, THNs migrate with increased speed, the depolarization substituting for the loss of ACh input (N = 535 tracks/17 embryos; Fig 4G and 4H, S2 Data). These results support the notion that depolarization is the primary migration-promoting signal, and it is normally achieved by ACh. The optogenetic experiments indicated that hyperpolarization negatively influences THN migration. This prompted us to screen for neurotransmitter systems that could modulate THN migration by hyperpolarization. We exposed embryos to either 200 μM Bicuculline to block GABA receptors, or 10 mM glycine to activate the glycine receptor. On THN migration, bicuculline exhibited no effect, but glycine slowed THNs down, although the effects appeared to be subtle (Fig 5A and 5B). After quantification, the effect of glycine on THNs is smaller than the one imposed by hexamethonium (Fig 5C and 5D, N = 748 tracks/20 embryos; see S3 Table for N and statistic parameters, S3 Data and S9 and S10 Videos), yet is similar to the speed reduction induced by optogenetics (Fig 3H). The effect is strongest in the central part of the MHB, between 20% and 50%, which is the critical region where most THNs initiate axonogenesis and nucleokinesis [4] (Fig 5C and 5D, and S3 Fig, S3 Data). Again, no morphological changes caused by glycine were detected (S5 Fig). In order to rule out that the effect of glycine is the result of its co-activating N-methyl-D-aspartate (NMDA) receptors, we repeated the analysis on embryos treated with 10 mM glycine, as well as either 50 μM dizocilpine (MK801) to block NMDA channels or 10 μM strychnine, which inhibits the glycine receptor (Fig 5C and 5D; S3 Data, N [MK801] = 682 tracks per 18 embryos, N [strychnine] = 357 tracks per 13 embryos). The speed reduction effects of glycine disappeared only upon strychnine treatment (N = 438 tracks per 16 embryos), proving that glycine acts via the glycine receptor. In addition, if glycine acts directly on THNs via the glycine receptor, a change to the observed calcium transients in Tg (elavl3: Hsa. H2B-GCaMP6s) embryos should be observed. When using the most sensitive cutoff for signals (0. 25), glycine reduces the rate of calcium transients by approximately 58% (5. 49 × 10−3 signals per min or 27 signals from 256 nuclei per 15 embryos and a total observation time of 81. 9 h, compared to control 13. 12 × 10−3 signals per min or 56 signals from 195 nuclei per 15 embryos and a total observation time of 69. 8 h; see also S2 Fig, S2 Data). Similarly, the maximal amplitude values for the remaining transients spread over a large range (Fig 5E), suggesting that glycine-induced hyperpolarization blocks transients from arising rather than modulating their strength. Regular calcium oscillations below the cutoff level appeared largely unaffected as seen in the FFT frequency analysis (Fig 4F) and by the proportion of nuclei with dominant frequencies in the 16. 7 mHz range of 27. 0%, or 69 nuclei out of 256 total number (control: 32. 3%). In all these experiments, embryos were exposed to high concentrations of glycine, and pharmacological treatments make it difficult to distinguish between direct and indirect effects of glycine on THNs. In order to prove that glycine is perceived by THNs, we overexpressed glycine receptor alpha1 subunit (GlyRa1) in the THNs. Glra1 encodes for the alpha1 subunit found in many glycine receptors. As glycine receptors are composed of only alpha and beta subunits, we hypothesized that the overexpression of alpha subunits would only result in the formation of functional receptors when THNs endogenously express beta subunits. If functional glycine receptors are in this way overproduced in the THNs, it could increase their susceptibility to endogenous glycine (Fig 5A and 5B). For control, we expressed a point-mutated version (glycine receptor alpha1 subunit Y226 mutated to F [Y226F]) of GlyRa1, which is thought to abolish glycine binding [43,44]. Overexpressing this mutated protein should not result in increased susceptibility to endogenous glycine, and fully functional receptors in these THNs derive from the endogenously expressed proteins. After tracking THNs and calculating their speeds (N [GlyRa1 wild-type (wt) ] = 347 tracks per 25 embryos, N [GlyRa1 Y226F] = 270 tracks per 18 embryos; see also S3 Data), we found that the overexpression of wt GlyRa1 is sufficient to slow THNs in the central part of the MHB in the absence of exogenous glycine to a similar extent as a high dose of glycine on normal THNs does (Fig 5D and 5G). The THNs overexpressing the point-mutated version behave like control cells. The ability of glycine to hyperpolarize cells depends on the co-expression of the ion channel solute carrier family 12 (potassium/chloride transporter), member 5b (KCC2) and the glycine receptor. As had been reported in the literature, KCC2 is very difficult to detect in young embryos because its expression increases with neuronal maturation [45,46]. Nevertheless, we succeeded in localizing KCC2 in a distinct pattern along the spinal cord (Fig 5H and 5I). Weak staining was observed in the ventral part of the hindbrain, as well as at the MHB (Fig 5H and S3 Fig), making it likely that glycine acts as hyperpolarizer in THNs at least at the MHB. Taken together, these results indicate that glycine could act as an opponent to ACh in controlling THN migration by balancing depolarization against hyperpolarization, especially in the transition region at the MHB. The THN tracking assay identified glycine and ACh as neurotransmitters that influence THN motility. Their effects recapitulated the results from optogenetic hyper- and depolarization. During screening for modulators of THN migration, we also tested the glutamate system. Glutamate has been shown to promote the migration of diverse neuron types in other animal models [14,15]. Glutamate acts on neurons via several receptors, of which two types are best studied: α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPA) receptors can be activated by glutamate and inhibited by 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), whereas NMDA receptors are activated by NMDA or glutamate together with a co-activator, and are inhibited by MK801. Surprisingly, treating embryos with 20 μM CNQX results in an increase in THN speed (Fig 6A and 6B). Moreover, the strongest effect occurred in the ventral part of the MHB where THNs normally slow down to settle (Fig 6C and 6D, see also S11 and S12 Videos, S3 Data). No morphological changes were detected upon CNQX treatment (S5 Fig). When THNs were exposed to CNQX over extended periods, cluster formation at the ventral end of the MHB appeared prematurely (S4 Fig). Next, we attempted to activate the glutamate system by adding 1 mM glutamate. However, we were unable to induce a slowdown in migration (Fig 6C and 6D). As we chose a comparatively low concentration of glutamate to avoid excitotoxicity [13], and glutamate is readily taken up by glial cells in zebrafish [47], it is possible that the concentration of glutamate in the tissue was too low to produce an effect. Therefore, we simulated the response to glutamate via activating NMDA receptors by adding 300 μM NMDA. This led to a THN migration speed decrease (Fig 6A–6D) in the ventral portion of the MHB (Fig 6C and 6D). Moreover, in several embryos that were treated with NMDA, we could observe highly protrusive, poorly polarized cells in the ventral region of the MHB (S5 Fig) where control cells are unipolar. For control, we also added 50 μM MK801 to block NMDA receptors, which had no effect on THN migration (Fig 6C and 6D). Taken together, glutamate acting via AMPA receptors is a slowdown signal to THNs near their terminal place of differentiation. Although ACh and glutamate are both considered depolarizing neurotransmitters, they produce opposite effects on THNs. This led us to test whether glutamate and ACh could counteract each other. We added 20 μM CNQX together with 500 μM hexamethonium to the embryos and repeated the analysis. The drugs did counteract each other in the ventral region of the MHB to reach control levels (Fig 6A–6D, see also S13 and S14 Videos), suggesting that the glutamate and ACh responses are finely balanced. Surprisingly though, in the dorsal region—where only hexamethonium had shown a strong effect on THNs—THNs migrated faster, similar to THNs treated with CNQX alone (Fig 6F). This suggests that the glutamate-induced migration-blocking effect is more important to dorsal-situated cells, indicating that a slowing down in that region is crucial. This effect could be outbalanced by ACh over time, as THNs that continue to differentiate express more ACh receptor [29]. Testing this hypothesis, as well as answering the question how glutamate causes the speed reduction along the dorsoventral extent of the MHB, which was detected in all conditions, is an intriguing starting point for future investigation. Previous studies using slice, implant, or in vitro cultures of neurons to investigate neurotransmitter-mediated activity in the context of migration had hinted that neurotransmitters can concertedly act on neurons to regulate migration [25,31,48]; e. g., a dualism between a hyperpolarizing and a depolarizing neurotransmitter had been described for hippocampal neurons and cortical interneurons [24,26,27]. Most of these assays, however, follow neurons in a partially or completely disrupted environment. This makes it difficult to interpret results in the context of in vivo migration in which additional stimuli affect neurons that are difficult to reconstitute artificially. Hence, we used live zebrafish embryos as models to study THN migration in vivo with minimal invasiveness. We find that modulating the polarization state of THNs is a well-tuned regulator of in vivo migration as THNs pursue their normal route through the cerebellum. Using a combination of advanced quantitative track analysis and optogenetic tools, we demonstrate that depolarization increases THN motility, whereas hyperpolarization reduces THN migration speed. We developed a screening method for compounds that act in neuronal migration, and identified ACh as the likely source of depolarization of THNs, whereas glycine hyperpolarizes THNs to reduce migration. Glutamate has additional, spatially defined negative effects on migration that counterbalance the depolarization by ACh. The results from our study can be summarized in a comprehensive model incorporating all effects (Fig 7A); several neurotransmitter systems act on THNs as they migrate from the URL towards the ventral end of the MHB, and postmitotic THNs emerging from the URL are influenced by glycine and glutamate [49–51]. As THNs reach the MHB, they undergo a critical change in migration type, morphology, and differentiation. Distel et al. [4] demonstrated that axonogenesis begins when THNs reach the MHB, and correct axon orientation is crucial for future functionality of the neuron. Typically, patterns of chemical attractants and repellants guide the axon [10]. Although chemical cues guiding THNs have yet to be identified, the direction of axon outgrowth never changed upon interference with activity in our study, making it likely that the determination of migration direction relies on other cues. A temporary slowing down of THNs to facilitate transition and pathfinding could be introduced by glycine-mediated hyperpolarization at the MHB. This is counteracted by increased depolarization by ACh when THNs move further ventral. As mature THNs are cholinergic [29], the migration-promoting effect of ACh would lead to a strong migration speed increase near their destination where THNs need to stop, due to the increased expression of ACh receptors. Therefore, glutamate is used as a restraint. Glutamate could either be perceived by the THNs directly or by a second, as yet unidentified, neuronal population that releases an inhibitory factor (Fig 7B). As optogenetic depolarization leads to a strong THN speed increase, and glutamate-mediated depolarization produces the opposite effects on the cells, we think the latter model to be more likely. A similar interaction of two neuron populations during migration has recently been described in mice [52]. Still, as the perception of glutamate is complex and may go beyond membrane depolarization, e. g., via metabotropic glutamate receptors, we are currently not able to distinguish between the two models. The concerted action of the neurotransmitters can be summarized as a map of the developing cerebellum (Fig 7C) in which the neurotransmitters mark out territories of influence. Overall, none of the neurotransmitters was able to impose a complete stop, or cause over-migration of THNs, arguing that neurotransmitters are an important modulator of migration, but not the only one. THNs are likely to integrate input also from nonactivity-related sources, such as chemical cues, extracellular matrix changes, or mechanosensory influences at the MHB. They also respond to internal parameters such as maturation stage, so that the overall effect of the polarization state on migration is determined by the individual THN. In the course of this study, we were surprised to find that even mild hyperpolarization has a clear effect on THN migration. This was demonstrated in optogenetic experiments as well as in the overexpression of only one subunit of a glycine receptor. This suggests that the cells are highly sensitive to changes in their polarization state, and that low-level activity could be sufficient to regulate migration. In this respect, the low levels of calcium transients that we detected in the THNs could be very meaningful in the context of determining migratory behavior. Technological improvements will help with the further analysis of calcium transients in the future. Of particular interest will be a correlation of the different calcium transient patterns that we identified with the migratory stages of individual THNs over extended observation periods, following the neurons in their 3D migration through the tissue. Likewise, the role of the regular calcium oscillations that we found in a subset of neurons remains unsolved as present, but becomes even more interesting in light of their independence from the ACh- and glycine-mediated effects. Still, neurotransmitters could make an important contribution to ensuring that the neurons arrive at their destination in an orderly fashion in time, even without having the ability to fully block migration. As THNs migrate during a defined developmental window between 24 hpf and 48 hpf [29], cells that have failed to reach their destination during this time are likely to become trapped permanently in the wrong environment. They could come into contact with granule cells of the cerebellum, the next neuronal population to emerge from the URL that follows a very similar route [30]. This could result in the formation of interactions between the cell types that would not occur in the normal situation. The consequences of this could be dramatic for the whole organism, and will be an important research area in the future. Our study demonstrates that different neurotransmitters antagonize each other in regulating migration in vivo. A similar counteracting balance between glutamate and GABA has been reported for cortical neurons [24]. Our regional tracking analysis revealed that ACh and glutamate, and most likely also ACh and glycine, have distinct regions at the MHB where they interact to produce a fine-tuned regulation of migration progress. The successive action of different neurotransmitters in cortical neurons controls their ability to traverse various layers [24]. As THNs do not cross distinct layers along their route, the successive action of neurotransmitters appears to be related to aligning maturation stage to migratory progress, e. g., by maintaining a temporary halt to migration until axonogenesis has been established. In this respect, it seems that successive and antagonistic neurotransmitter-mediated activity is a fundamental, but versatile, principle to control migration that is conserved across vertebrates. Our THN in vivo migration model is going to provide us with more fundamental, transferable insights into neuronal cell migration on the cellular and subcellular level in the future. Ultimately, it will add to our understanding about how neuronal layers and nuclei are properly positioned in a spatiotemporal pattern. All procedures involving animals were carried out according to EU guidelines and German legislation (EU Directive 2010_63, licence number AZ 325. 1. 53/56. 1-TU-BS). Zebrafish were housed in groups of 20–40 individuals in a fish facility (Aquaneering, San Diego, CA) maintaining around 700 mS, pH 6. 9–7. 1 and 28°C under a 14/10 h light/dark cycle in accordance with common zebrafish handling guidelines [53]. All experiments involving live cell imaging were carried out using fertilized eggs from the fish line Tg (atoh1a: Gal4TA4) (line hzm2Tg) [4], crosses of Tg (atoh1a: Gal4TA4) with Tg (4xUAS-GFP) (hzm3Tg) [54], or Tg (elavl3: Hsa. H2B-GCaMP6s), jf5Tg; [32]. Wt brass embryos were used for WISH. All embryos were kept in egg water (0. 03 g/l sea salt) for 1 h before incubating the eggs in 30% Danieau medium (0. 12 mM MgSO4,0. 21 mM KCl, 0. 18 mM Ca (NO3) 2,17. 4 mM NaCl, 1. 5 mM HEPES, pH 7. 2). To avoid pigmentation, 150 μM PTU was added to the 30% Danieau medium at 8–12 hpf. All embryos were incubated at 28°C. For imaging, normally developed embryos of similar fluorescence were selected from the same clutch. Data arising from the quantification procedures described below and incorporated into the graphs depicted in the figures and supplemental figures can be found in S1–S3 Data.

Title: Neurotransmitter-mediated activity spatially controls neuronal migration in the zebrafish cerebellum Summary: Postmitotic neurons migrate from their site of origin to their final destination in the developing brain to form functional structures. These neurons typically follow defined routes through the tissue. Previous studies investigating progress along such route have identified neurotransmitters-chemicals that transmit the signals between neurons-as important regulators in neuronal migration using mostly rodent brain slice cultures and cultivated neurons. In this study, we use live zebrafish embryos to test the influence of neurotransmitters on migrating hindbrain neurons. First, we demonstrate that calcium transients can be measured in these neurons using genetically encoded reporters. Next, we use optogenetic channels to specifically de- or hyperpolarize the plasma membrane of the neurons to show that the polarization state is linked to migratory speed. Finally, we use a screening method to identify the neurotransmitter systems involved in migration progress control. We summarize these findings in a model that suggests that there are regions of influence for different neurotransmitters that act successively on the neurons to ensure their timely arrival at their destination.

lay_plos

en

Write a title and summarize: Information is carried in the brain by the joint spiking patterns of large groups of noisy, unreliable neurons. This noise limits the capacity of the neural code and determines how information can be transmitted and read-out. To accurately decode, the brain must overcome this noise and identify which patterns are semantically similar. We use models of network encoding noise to learn a thesaurus for populations of neurons in the vertebrate retina responding to artificial and natural videos, measuring the similarity between population responses to visual stimuli based on the information they carry. This thesaurus reveals that the code is organized in clusters of synonymous activity patterns that are similar in meaning but may differ considerably in their structure. This organization is highly reminiscent of the design of engineered codes. We suggest that the brain may use this structure and show how it allows accurate decoding of novel stimuli from novel spiking patterns. Noise is prevalent in the nervous system, from ion channels through synapses and single neurons, and up to the system level (Mainen and Sejnowski, 1995; Schneidman et al., 1998; Rieke et al., 1999; Osborne et al., 2005; Faisal et al., 2008; Ala-Laurila et al., 2011). Consequently, even when presented with identical stimuli, the brain may receive different spiking patterns from the sensory neurons (Mainen and Sejnowski, 1995; Berry et al., 1997; de Ruyter van Steveninck et al., 1997; Reich et al., 2001). The nature of neural noise thus determines how information is encoded in the brain (Borst and Theunissen, 1999; Stocker and Simoncelli, 2006; Cafaro and Rieke, 2010; Rolls and Treves, 2011), and how it might be read out from neural activity (Warland et al., 1997; Dan et al., 1998; Vargas-Irwin et al., 2010). To correctly decode, the brain must overcome this noise (Osborne et al., 2005; Sreenivasan and Fiete, 2011). In engineering, codes are designed to solve this problem by choosing codewords that are far apart in the space of patterns, relative to the typical noise levels. That way, if noise corrupts a message, it would still be easily distinguishable from the noisy variants of other codewords (Cover and Thomas, 1991; Sreenivasan and Fiete, 2011; Curto et al., 2013). It is not clear however, how this issue is resolved in the brain, or how it affects the design of the neural code, where information is carried by the joint activity patterns of large groups of noisy neurons (Nicolelis et al., 1995; Maynard et al., 1999; Mazor and Laurent, 2005; Fujisawa et al., 2008; Pillow et al., 2008; Truccolo et al., 2010; Ganmor et al., 2011a; Harvey et al., 2012). It is clear that the nature of correlations among neurons is central in shaping the code' s capacity and content, in particular in the context of noise (Zohary et al., 1994; Zemel et al., 1998; Abbott and Dayan, 1999; Diesmann et al., 1999; Sompolinsky et al., 2001; Schneidman et al., 2006; Pillow et al., 2008; Shlens et al., 2009; Ganmor et al., 2011b; Schwartz et al., 2012; Granot-Atedgi et al., 2013). However, the functional role of these correlations in encoding information by large populations has been heavily debated (Nirenberg et al., 2001; Amari et al., 2003; Pola et al., 2003; Schneidman et al., 2003a, 2006; Averbeck et al., 2006; Tkacik et al., 2006; de la Rocha et al., 2007; Pillow et al., 2008; Ecker et al., 2010; Ohiorhenuan et al., 2010; Oizumi et al., 2010; Ganmor et al., 2011a), partly because of the difficulty to study them directly at the network level and the limitations of generalizing from small groups of cells to large ones. To uncover the structure and content of neural population codebooks, we must be able to quantify the similarity between population activity patterns. In other words, we need to understand network noise well enough to know which patterns are likely to be interchanged in encoding the same stimulus. Several studies suggested intuitive and computationally efficient measures of spike train similarity (Victor and Purpura, 1997; van Rossum, 2001; Houghton and Sen, 2008). However, they mostly focused on single neurons and often assumed the functional form of similarity between responses. Despite their computational simplicity, it is not clear whether such simple metrics can adequately represent similarity between neural responses. The Hamming distance, for example, is a very intuitive measure of similarity between population activity patterns, simply defined as the number of neurons that switch state from spiking to silence and vice versa. Yet, it measures similarity in form, or syntactic similarity, but not necessarily similarity in meaning, that is, semantic similarity (Huth et al., 2012). This would be analogous to suggesting that ‘night’ and ‘light’ are similar in meaning because they differ by just one letter. Extending such metrics to large populations requires additional assumptions on the way the similarity measures between different cells should be combined. We suggest here that the semantic similarity between neural activity patterns can be measured by comparing what each pattern tells the brain about the stimulus. We demonstrate that in the vertebrate retina, responding to natural and artificial stimuli, we can estimate this similarity between any pair of population responses, using models of population encoding noise. Using this similarity structure, or ‘thesaurus’, we can map the semantic organization and content of the population codebook and show how it enables the accurate decoding of novel population patterns. The encoding noise determines which population patterns may be used to encode the same stimulus and thus implicitly defines similarity between patterns. We submit that two neural activity patterns are similar, in terms of their meaning, to the extent that they convey similar information to the brain. This constitutes semantic similarity between population patterns, which does not necessarily rely on any syntactic similarity (for example total spike count). Intuitively, this is analogous to synonyms in natural language, which may not look similar, but still have the same meaning (Pereira et al., 1993). The meaning of a neural activity pattern r is given by what it tells the brain about its corresponding input, or in the case of sensory systems, the potential stimuli that could have resulted in that response. Since the mapping between stimulus and response is probabilistic, the meaning of r is given by the probability distribution over stimuli conditioned on that response, namely P (s|r). We therefore defined the distance between two neural population activity patterns rk and rl as the dissimilarity between P (s|rk) and P (s|rl), (1) d (rk, rl) =DJS (P (s|rk) ||P (s|rl) ), where DJS is the Jensen-Shannon divergence between the distributions (see ‘Materials and methods’) —a symmetric measure of dissimilarity that varies between 0, for identical distributions, and 1, for non-overlapping distributions. Here, 0 would imply that the two activity patterns are perfect ‘synonyms’ and have identical meaning, whereas 1 would imply completely different meaning. Rather than directly estimating P (s|r), which is challenging both experimentally and statistically, we can instead estimate P (r|s) and infer P (s|r) through Bayes' rule, namely P (s|r) = P (r|s) P (s) /P (r), where P (s) is the distribution over stimuli (set to be a uniform distribution over all video frames used in the experiment), and P (r) is the distribution of the neural responses (calculated by marginalizing over stimuli, P (r) =∑sP (s) P (r|s) ). Our experimental design, in which we presented many repeats of the same video, allowed us to draw hundreds of samples from P (r|s), for every s. However, due to the exponential number of possible population activity patterns one cannot directly sample this distribution in full even for groups of 20 neurons. Instead, we construct accurate models of population encoding noise, which we then use to estimate d (ri, rj) for any pair of population patterns. The properties of encoding noise, and in particular, the magnitude and importance of correlations between neurons in encoding a stimulus, commonly known as ‘noise correlations’, have been heavily debated (Nirenberg et al., 2001; Schneidman et al., 2003a; Ohiorhenuan et al., 2010; Oizumi et al., 2010). For pairs of neurons, average noise correlations are typically weak (Cafaro and Rieke, 2010; Ecker et al., 2010), implying that pairs of neurons are not far from being conditionally independent given the stimulus. If groups of cells were encoding information independently, that is, if P (r|s) =ΠiP (ri|s) for large populations, then P (r|s) would be defined by the individual and independent noise of each neuron and would be easily learned from the noise of each neuron P (ri|s). However, weak pairwise correlations do not imply that large groups are conditionally independent in encoding stimuli (Schneidman et al., 2006; Pillow et al., 2008; Vidne et al., 2012; Granot-Atedgi et al., 2013). Moreover, noise correlations are often estimated on average, over a range of different stimuli, and it is not clear what low average noise correlations imply for population encoding of specific stimuli. We therefore estimated the noise correlations at the population level, for each stimulus s. Specifically, we quantified the correlation of the population in encoding the stimulus s, by the multi-information, I (r|s) =H[Pind (r|s) ]−H[P (r|s) ] (Amari, 2001; Schneidman et al., 2003b), where H[Pind (r|s) ] is the entropy assuming neurons are independent given the stimulus—Pind (r|s) =ΠiP (ri|s), and H[P (r|s) ] is the entropy of the joint population response to the stimulus s (estimated following Strong et al., 1998). We note that I (r|s) measures the total correlations of all orders among the cells. We found that most stimuli did not evoke a substantial response from the retina, which gave rise to low noise correlation in the network for these stimuli. However, when something ‘interesting’ happened in the video and the ganglion cells increased their firing rates, we found a sharp increase in the degree of network noise correlations for both natural and artificial videos (Figure 2A, B; see Figure 2—figure supplement 1 for analysis of sampling properties). Thus, while on average the network noise correlations may be weak, the population was strongly correlated and far from conditionally independent in response to interesting stimuli. In other words, for these stimuli, the variability or noise at the level of the network is significantly reduced compared to what would be expected from the apparent noise level of individual cells. 10. 7554/eLife. 06134. 004Figure 2. Strong noise correlations, at the population level, at interesting times in the video. (A) Population noise correlation, measured by the multi-information over the conditional population responses, at each point in time in response to an artificial video. Thin gray lines correspond to individual groups of 20 cells; average over groups is shown in purple. (B) Population noise correlation as a function of average population firing rate for one representative group. Interesting events in the video evoke a vigorous response by the retina, characterized by strong network correlations. (C) Distribution of spike counts across different repeats of the same stimulus for the time point marked by black dot in A. Purple dots correspond to empirical estimates, gray line is what we would expect if neurons were conditionally independent, given the stimulus; and red line is the prediction of the maximum entropy pairwise model. (D–F) Same as A–C but for a natural video clip. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 00410. 7554/eLife. 06134. 005Figure 2—figure supplement 1. Accurate sampling of entropy. (A) Pairwise maximum entropy upper bound on entropy (gray) and the extrapolation corrected noise entropy (Treves and Panzeri, 1995; Strong et al., 1998) (purple) are shown as a function of the naive noise entropy estimate. Each dot corresponds to the distribution at a single time point in the artificial video; black line marks identity. The bias corrections are on the order of a few percent at most. (B) Same as A, but for data taken from the natural video data set (693 repeats). DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 00510. 7554/eLife. 06134. 006Figure 2—figure supplement 2. Log likelihood ratio of the pairwise model and the conditionally independent model. (A) A pairwise (second order maximum entropy as in the text) and an independent model (product of marginals) was fit to each time point (equivalently stimulus) in the artificial video using 90% of video repeats. The log likelihood ratio of the two models (log[LikelihoodPairwise/LikelihoodCond. − Indep. ]) is plotted as a function of time (equivalently stimulus), for the held out 10% of repeats. The likelihoods are similar much of the time, corresponding to low firing epochs, but for many points in time the likelihood of the pairwise model can be orders of magnitude higher. (B) Same as A, for the natural video. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 006 Indeed, conditionally independent models of population encoding (which assume no noise correlations) fail exactly at such interesting stimuli (Pillow et al., 2008; Granot-Atedgi et al., 2013), reflecting that in order to accurately characterize the population responses and the noise, we need a model that takes into account correlations between the cells that depend on the stimulus. We extended the framework of maximum entropy models for neural activity patterns (Schneidman et al., 2006; Shlens et al., 2009), to the population responses to each stimulus (Granot-Atedgi et al., 2013): for each stimulus, s, we fit the minimal model that has the same stimulus dependent firing rates and pairwise noise correlations observed over the repeats of that stimulus. This stimulus-dependent pairwise maximum entropy model is given by (2) P (2) (r|s) =1Z (s) exp (∑iαi (s) ri+∑i<jβij (s) rirj), where αi (s) and βij (s) were fit to obey the constraints. We found that P (2) (r|s) gave relatively accurate models of the distribution of patterns that the population displayed across repeats, for the different stimuli (Figure 2—figure supplement 2), in agreement with Granot-Atedgi et al. (2013). In particular, they captured accurately the strong network noise correlations (Figure 2C). We then use the distributions P (2) (r|s) that describe the population encoding noise, to estimate the dissimilarity, d (ri, rj), between any pair of patterns over the population in a reliable and precise manner. Since there are over a million possible population activity patterns for 20 neurons, we present here only the similarity matrix of all the population patterns that were observed in the test data (half of the data, which was randomly selected and not used to learn the similarity between activity patterns). If stimuli were represented by overall population rates (Bohte et al., 2000; Amari et al., 2003; Loebel et al., 2007; Schwartz et al., 2012), then responses containing the same number of spiking neurons would be similar, and thus would have a small d between them. Figure 3A shows the similarity matrix d (ri, rj) for one representative group of 20 cells, where matrix rows (and columns) stand for individual population patterns and are ordered according to the total number of spikes in each response. The lack of structure in the matrices for both artificial and natural stimuli shows that similar spike counts do not imply similar meaning. 10. 7554/eLife. 06134. 007Figure 3. The population code of the retina is comprised of clusters of responses with highly similar meaning. (A) Top: Similarity matrices of the population responses of representative groups of 20 neurons to an artificial (left) and natural (right) video. Each entry in the matrix corresponds to the similarity, d (see text), between two population responses observed in the test data (responses shown at bottom). Matrix rows (and columns) are ordered by total spike count in the population responses. Bottom: The population responses corresponding to the entries in the matrix; black ticks represent spikes. Each column is a population activity pattern corresponding to the matrix column directly above. Blue lines mark borders between different clusters. The lack of structure in the matrices implies that population responses with similar spike counts do not carry similar meanings. (B) Same as A, only here the matrix is clustered into 120 clusters. Matrix rows (and columns) are ordered such that responses from the same cluster appear together. A clustered organization of the population code is clearly evident. (C) Same as B, but using the Hamming distance between population responses, instead of the similarity measure d. A simple measure of syntactic similarity does not reveal the underlying clustered organization of the code. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 00710. 7554/eLife. 06134. 008Figure 3—figure supplement 1. Clustered organization is highly significant. (A) The similarity matrix used in Figure 3 in the main text was first randomly shuffled and only then clustered. Clearly the grouping structure has disappeared, suggesting the structure is a property of the code' s organization and not the values in the matrix or the power of the clustering algorithm. (B) For each of the ten 20 neuron groups we calculated the C Index (Hubert and Schultz, 2011) (left, labeled ‘Data’), which measures goodness of clustering; a smaller C Index corresponds to better clustering. For each matrix, we then measured the C Index for 100 randomly shuffled versions and took the minimal value of all shuffled matrices (right, labeled ‘Shuffled’). None of the shuffled values came close to the real values, indicating a p-value smaller than 0. 01 for each matrix. (C) Correlation coefficient between similarity matrices estimated using different fractions of data. Overall we had 641 repeats of the artificial video. Using 70% of the repeats, we are at ∼0. 9 correlation with our estimates using all available repeats (Data are for the same matrix shown in Figure 3 of main text). (D–F) Same as A–C but for data taken from the natural video data set. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 00810. 7554/eLife. 06134. 009Figure 3—figure supplement 2. Semantic similarity between population patterns can be explained by a simple local similarity measure, but not by a global similarity measure. (A) We sought a simple formula to approximate the similarity measure d, in the spirit of the measures described in Victor and Purpura (1997); van Rossum (2001); Houghton and Sen (2008). The Hamming distance gave a very poor approximation of similarity and even a measure which gave a different weight to each neuron, δ1 (ri, rj) =∑μwμ (riμ−rjμ) 2, performed very poorly. Shown is a joint histogram of the similarity values d (ri, rj) (x-axis) and the corresponding values predicted by a global second order similarity model δ2 (ri, rj) =∑μ∑νwμν (riμ−rjν) 2 (y-axis. w parameters fit to train data; results for cross-validated test data are shown) for the responses of a representative group of 20 neurons (same as in Figure 3) to an artificial video. For clarity, values were normalized about the y-axis, such that each vertical slice sums to one. (B) Joint histogram of the similarity values of pairs of responses from the same cluster (x-axis) and the similarity predicted by a local second order model for similarity, that is, δ2 applied independently to each cluster. Other details as in A. These results suggest that noise is highly stimulus dependent and cannot be accurately described by a global, stimulus independent, model. Yet, for a given cluster, we can accurately describe its similarity neighborhood, using the appropriate set of single neurons and neuron pairs. (C) In support of the previous conclusion, we found that close inspection of large response clusters reveals an obvious structure within clusters. Many of the clusters of similar responses can be characterized as having very precise neurons (almost always spiking or almost always silent), alongside more noisy neurons, which appear to be nearly random within a cluster. These precise and noisy neurons differ from one cluster to another. Shown is a detailed view of the responses in a subset of the clusters, which contain between 20 and 50 different patterns and appear most frequently in the data. Top: All population responses belonging to each cluster (clusters separated by vertical lines). Each horizontal line corresponds to one neuron; each vertical slice is the response of the population to a single repeat. Bottom: The average response of each cluster. The spiking probability of each neuron is represented by its gray scale intensity (color bar: dark—high spike probability, light—low spike probability). (D-F) same as (A-C), but for a natural video stimulus. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 009 In clear contrast, when we used a hierarchical clustering algorithm on d (ri, rj) matrices and grouped responses together according to their similarity (see ‘Materials and methods’), we found that the ordered matrices exhibit an almost perfect block diagonal structure (Figure 3B; see Figure 3—figure supplement 1 for statistical analysis). Thus, the population code that is used by the retina both for artificial videos, and for natural videos, is arranged in sets, or clusters, of highly similar activity patterns, which are very different from all other patterns. We term these groups of highly similar responses neural ‘synonyms’, and by analogy we refer to the similarity measure d as a neural thesaurus. We examined whether the Hamming distance, which is a simple and intuitive measure of similarity between population responses (the number of neurons that differ in their spiking or silence state), was sufficient to reveal the structure of the population codebook. We thus constructed the matrices of Hamming distances between all pairs of population activity patterns, and clustered the responses, using the same hierarchical agglomerative clustering. Figure 3C shows the Hamming matrix for the same group of 20 cells from a–d, where matrix rows (and columns) are ordered according to the clustering results. We did not find evident structure in the codebook used for natural stimuli, and only slightly more structure was apparent for the artificial stimuli. We emphasize that the results of Figure 3 were typical for many independent choices of groups of cells (as is summarized later in Figure 5). These results reflect the importance of measuring similarity in meaning and not similarity in structure. Using a syntactic (structure based) measure, we would not have been able to uncover the clustered organization of the neural population code that the semantic similarity reveals. Patterns that belong to the same cluster do exhibit some shared structure, namely some of the neurons almost always fire in a specific cluster and others are always silent (Figure 3B, bottom). However, importantly, we found that the semantic similarity structure over all the patterns we observed could not be captured by a simple linear or bilinear function of the population patterns (Figure 3—figure supplement 2). The clustered structure of the neural population codebook suggests that the same stimulus may be represented by different, yet semantically similar population patterns, or synonyms. Such structure is commonly used in engineered codes in computer science and communications (Cover and Thomas, 1991; Sreenivasan and Fiete, 2011; Curto et al., 2013). This gives rise to two important predictions, which we confirmed by cross-validation, using novel (held out) test stimuli: 1. Responses to repeated presentations of a stimulus should come from the same cluster. 2. Responses from the same cluster should be nearly interchangeable. To directly show the advantages of cluster-based encoding of information by the retina, we quantified the reliability of population patterns used to encode the same stimulus. Because of the noise, the responses to repeated presentations of the same stimulus are so variable that even the most frequent population pattern would occur only a handful of times (Figure 4A, B). However, the reliability of the population code is revealed when instead of focusing on individual patterns, we count how many of the population patterns evoked by the same stimulus belong to the same cluster. Notably, even when the population response was highly unreliable (i. e., the most frequent response pattern appeared less than 20% of the time), often over 70% of the observed responses would fall within a single cluster (mostly for the natural video), for the cross-validated test data (see Figure 4—figure supplement 1 for statistical analysis). 10. 7554/eLife. 06134. 015Figure 4. Responses to the same stimulus tend to come from the same cluster. (A) The probability of the most frequent response across video repeats is plotted as a function of stimulus identity in gray (stimuli are sorted by reliability). In purple, we plot the reliability of the clustered response, that is, the probability of observing a response from the most frequent cluster for each stimulus (clustering matrix presented in Figure 3). Only the 100 stimuli that evoked the strongest response are shown. Clearly, responses to the same stimulus tend to come from the same cluster, even when the most frequent single response occurs less than 20% of the time, thus the cluster code is far less noisy. (B) Same as A but for the natural video data set. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 01510. 7554/eLife. 06134. 016Figure 4—figure supplement 1. Increased reliability of clustered responses is highly significant. (A) Responses recorded at the same time point across video repeats cluster together significantly. Shown is the probability of the most frequent cluster, plotted as a function of stimulus id (purple; stimuli sorted by reliability), for the clustered response; that is, the probability of the most frequent cluster evoked by each stimulus (same as Figure 4A). For comparison, we also shuffled the cluster assignment of each response and repeated the analysis. Shown in gray is mean ± STD of the most frequent cluster in 100 randomly shuffled cluster assignments. Clearly, for many time points the high reliability of the clustered response is not merely a result of response grouping, but the tendency of responses from the same cluster to be associated with the same stimulus. (B) Same as A, but for natural video data set. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 016 The most direct test of ‘coding by clusters’ is to ask how much information about the stimulus would be lost if instead of knowing the precise population activity pattern (exactly which neurons spiked and which ones were silent) we only knew which cluster the pattern belongs to. We therefore compared the information that the full set of population responses r carry about the stimulus I (s; r), to the information that is carried just by knowing which cluster (out of k possible ones) the response belongs to, I (s; Ck (r) ). To that end, we labeled every population pattern in the test data according to its cluster identity, Ck (r), based on the similarity structure learned from training data (see ‘Materials and methods’). To avoid any arbitrary assumptions about the number of clusters, we assessed how much information is carried by k clusters, for different values of k (Figure 5) on novel test data that was not used for learning the similarity structure. We found that ∼100 clusters were enough to account for over 80% of the information available about the stimulus in the detailed population patterns, for both types of stimuli. Importantly, clustering the responses based on the Hamming distance between them gave significantly worse results. This clearly reflects that responses in the same cluster have a similar meaning and can indeed be viewed as noisy variants of a noise-free codeword, similar to the ground states or attractors in a Hopfield model (Hopfield, 1982; Tkacik et al., 2006). 10. 7554/eLife. 06134. 010Figure 5. Cluster identity conveys most of the information about the stimulus. (A) The fraction of information retained about the stimulus when population responses are replaced with the label of the cluster they belong to, plotted as a function of the number of clusters used. Lines correspond to the average of 10 groups of 20 neurons, line widths represent SEM. Purple—clustering based on the similarity measure described in the text, gray—clustering based on the Hamming distance. Inset: Fraction of information as a function of the number of clusters on a linear scale. Individual groups are shown in gray, and the orange line marks the curve corresponding to the representative matrix from Figure 3. Very few clusters are required to account for most of the information, suggesting responses from the same cluster have a similar meaning. (B) Same as A, but for a natural video clip. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 01010. 7554/eLife. 06134. 011Figure 5—figure supplement 1. The similarity measure generalizes well across stimuli. (A) Fraction of information retained about the stimulus plotted against the number of response clusters. The similarity measure learned from the artificial video train data is applied either to cross-validated test data (same as Figure 5 of main text; purple line), or to the train data itself (purple dots). We see nearly identical performance on cross-validated and non cross-validated data. Shown is the same representative group of 20 neurons as in Figure 3. (B) The number of clusters required to recover over 50% (filled purple circles) or 80% (open triangles) of the information available about the stimulus, plotted as a function of the inverse number of stimuli in the test data (train data remained fixed), on a semi-logarithmic scale. Also shown, for comparison, is the overall number of observed patterns (black line). Depicted are average and SEM (may be smaller than markers) over 10 different groups of 20 neurons. As the number of stimuli in the test set increased, we saw a very mild increase in the number of clusters required to account for either 50% or 80% of the information. In fact, there was no significant increase in the number of clusters when the number of stimuli increased from 200 to 250 (p > 0. 4, sign rank test), while the number of observed patterns grew significantly by over 500 (p < 0. 01 sign rank test). This suggests that the clusters (or ‘code-words’) we identified are relevant to a wide range of stimuli within the same stimulus class. (C, D) Same as panels A and B, but for data taken from the natural video data set. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 01110. 7554/eLife. 06134. 012Figure 5—figure supplement 2. Clustering aimed at maximizing the mutual information yields similar results to clustering based on similarity alone. (A) Fraction of information retained about the stimulus plotted against the number of response clusters (full field flicker stimulus). Responses were either clustered using simple agglomerative clustering (purple. Same as in main text, see ‘Materials and methods’), or using agglomerative information bottleneck clustering (Slonim and Tishby, 1999), which explicitly aims to cluster responses such that maximal information about the stimulus is retained (black). Although, we would expect clustering aimed at information maximization to do a better job, after cross-validation (applying the clustering to novel responses to novel stimuli), we see that the simple similarity based clustering performs just as well. The data shown are for the same representative group as used throughout the main text. We note that results are shown for cross-validated test data, and that information bottleneck clustering is a greedy approach with no guarantee of optimality, thus it is possible for similarity based clustering to outperform information bottleneck clustering. (B) Same as A, but for the responses to a natural video stimulus. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 01210. 7554/eLife. 06134. 013Figure 5—figure supplement 3. Comparing response similarity derived from the conditionally independent model and pairwise model. (A) Left: The probability of observing the most frequent response across repeats of the artificial video is plotted as a function of stimulus i. d. in gray; for clarity, the stimuli are sorted by reliability of their responses. In black is the reliability of the clustered response, that is, the probability of the most frequent cluster evoked by each stimulus, where responses were clustered by similarity derived from a conditionally independent model. In purple is the clustered reliability as derived from the pairwise model used in the main text (same as Figure 4). Only stimuli that evoked a strong response (at least one spike in over 75% of the repeats) are shown. Here, reliability is much higher when using the more accurate pairwise model to derive similarity between population responses. Right: Same as left, but for the Natural video data set. Here, differences between conditionally independent and pairwise models are less pronounced. (B) Left: Similarity derived from the conditionally independent model is directly compared with the similarity derived from the pairwise model, for test responses to the artificial video. Similarities between response pairs calculated using the conditionally independent model were binned (x-axis) and the mean and standard deviation of the similarity for the same pairs was calculated using the pairwise model (y-axis). Black line marks identity. Right: Same as left, but for the natural video. We see that similarity measured using the conditionally independent model is closer to that measured using the more accurate pairwise model under natural stimulation. (C) Left: same as Figure 5A, but here we compare the fraction of information as a function of number of clusters curve obtained by using the pairwise model (purple) and the one obtained using the conditionally independent model, in which noise correlations are ignored (gray). DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 01310. 7554/eLife. 06134. 014Figure 5—figure supplement 4. The neural ‘thesaurus’ remains stable across different bin sizes. (A) Correlation matrix between the similarity values estimated for all possible response pairs. For a given group of 8 neurons from the artificial video data set, we calculated the full similarity matrix over all 256 possible responses. This was done for bin sizes between 5 and 80 ms. We then calculated the correlation between the similarity matrices for each combination of bin sizes. Shown is an average across 8 randomly chosen groups of 8 neurons. The results indicate that except for extreme differences in bin size, we recover highly consistent similarity structures. (B) The fraction of information is shown as a function of the number of clusters in the similarity matrix (compare to Figure 5 in main text). Different bin sizes are indicated by colors. Different lines correspond to different individual 8 neuron groups (same groups as A). We see very similar results except for the very short time bin of 5 ms. (C, D) Same as A and B but for data taken from the natural video data set. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 014 We therefore conclude that grouping responses by their similarity in the training data identified clusters that conserved the information available about the stimuli in the test data, thus indicating that the similarity we measured is a general feature of the code and not limited to a particular set of stimuli. Importantly, all stimuli in the test data and many of the neural responses they evoked were not observed in the training data that we used to learn d (ri, rj). Thus, the limited number of stimuli and responses observed in the training data were sufficient to identify semantic clusters and predict the similarity between over a million possible neural responses evoked by a multitude of different possible stimuli, which were verified using the test data. We further point out that d (ri, rj) was so stable across time and for different selections of train and test data, that the information curves derived from clustering the cross-validated test data and the training data itself were nearly identical (Figure 5—figure supplement 1). In addition, the number of clusters required to convey 80% of the information seems to saturate with the size of the test set (Figure 5—figure supplement 1). We conclude that the similarity between neural responses does not rely on the specific stimuli we used and would generalize to other stimuli at least within the same stimulus class. We further emphasize that clustering of the responses was based on similarity alone and was not optimized to maximize information in any way (which could therefore give even better results). Yet, even if we clustered patterns by explicitly trying to maximize the information, we achieved very similar results (Figure 5—figure supplement 2). This suggests that grouping responses simply by their semantic similarity may be nearly optimal from an information transmission standpoint. We also estimated the semantic similarity between population patterns with simpler models for the population responses to the stimuli—using conditionally independent models of encoding, where for each stimulus s the response is described by P (r|s) =ΠiP (ri|s). Although these models give a different and less accurate estimate for the probability distribution than the pairwise model P (2) (r|s) (Figure 2), we find that grouping the population activity patterns using this model results in a similar clustered structure (see Figure 5—figure supplement 3). This may suggest that the codebook organization into clusters is sufficiently robust, so that even when using a less accurate model of the neural responses one can identify the organization of the response space (see more in the ‘Discussion’). Given that almost all information about the stimulus is carried by the identity of the cluster that a given activity pattern belongs to, we asked whether we can map the functional organization of the population codebook. We used Isomap (Tenenbaum et al., 2000) to present a low dimensional embedding of all the population responses associated with clusters that contain 30–300 responses in three-dimensional Euclidean space (Figure 6A; see ‘Materials and methods’ and Video 1 for the raw data points in 3D). Isomap is an embedding algorithm for high dimensional data that preserves the geodesic distance between points. While this embedding is imperfect (one would need more dimensions to achieve a nearly perfect embedding; see Figure 6—figure supplement 1), it provides an approximate view of the organization of the population code of a sensory system and coarsely reflects the ‘cloud’ of patterns that make up each cluster. 10. 7554/eLife. 06134. 017Figure 6. Response similarity predicts stimulus similarity. (A) The responses belonging to clusters that contain 30–300 patterns were embedded using Isomap. Each ellipse represents the 1 STD Gaussian fit to all responses belonging to a single cluster. The Euclidean distance in the plot approximates the similarity measure d (see text). The coordinates also correspond to the RGB value of each ellipse, thus nearby clusters share similar colors. Same representative group as in Figure 3. (B) Embedding of cluster triggered average waveforms in 2D Euclidean space. For each pair of clusters from panel A, we calculated the inter-cluster distance as the average similarity between pairs of responses, one from each cluster. Clusters were then embedded in 2D space using Isomap in a manner that approximates the calculated distances. Each cluster is represented by the mean stimulus that preceded (250 ms) responses belonging to that cluster. Thus, nearby waveforms belong to similar clusters. Clusters are colored as in panel A, therefore the blue channel corresponds to the third dimension of embedding not shown in the plot. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 01710. 7554/eLife. 06134. 018Figure 6—figure supplement 1. Cluster similarity implies stimulus similarity. (A) Geodesic vs embedded distances for the embedding shown in Figure 6A. The x-axis is the Geodesic distance between clusters (i. e., distances in the neighborhood graph; methods), vs the Euclidean distances after embedding in 3D. (B) Residual variance as a function of dimensionality for embedding of waveforms in Figure 6A. The residual variance is defined as 1 − r2 (dG, dIso), where r is the correlation coefficient, dG is the geodesic distances between points as defined by the weighted neighborhood graph (Tenenbaum et al., 2000), and dIso is the Euclidean distances between points after embedding. (C) Same as A, but for embedding of responses in Figure 6B. Due to the large number of population responses embedded (2391), we show the joint histogram of the geodesic (x-axis) and embedded (y-axis) distance values. Colorbar represents frequency of occurrence of distance pairs. (D) Same as B, but for embedding of responses in Figure 6B. (E) For each pair of clusters shown in Figure 6A, we calculated the correlation coefficient between the cluster triggered average stimulus (the average of all stimuli preceding responses in a cluster) of each cluster, and plot it as a function of the distance between the clusters. Inter cluster distance was defined as the average similarity between pairs of responses, one from each cluster. Even though the correlation coefficient is not the ideal measure to quantify similarity among stimuli, we still see a clear and significant relationship between cluster similarity and stimulus similarity. Namely, clusters that are more similar (smaller values on the x-axis) have a higher correlation between their associated average stimuli. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 01810. 7554/eLife. 06134. 019Video 1. Embedding of responses in 3D using Isomap. Each dot represents a single population response to the artificial video; the Euclidean distance between points approximates the similarity d between them. Similar to Figure 6A, only we explicitly plot every population activity pattern in each cluster. Colors represent different clusters and correspond to the colors in Figure 6A, B. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 019 To show the functional correlates of these clusters in coding, we present the similarity between clusters in terms of the stimuli that they encode. To that end, we quantified the distance between each pair of clusters, Cm and Cl, by the average distance between all inter-cluster response pairs, 〈d (ri, rj) 〉i∈C1, j∈C2. We then embed the clusters in a Euclidean space according to the similarity between them (again using Isomap). Thus, in Figure 6B each cluster is represented by the average of its associated stimulus ensemble (we emphasize that the stimuli were taken exclusively from the test data). Hence, waveforms that are closer in space belong to clusters that are more similar. We find that response similarity measured from the training data predicts stimulus similarity in the test data (Figure 6—figure supplement 1 shows the correlation between cluster similarity and stimulus similarity; for more accurate metrics on stimulus space, see [Tkačik et al., 2013]). Thus, the similarity measure proposed here for the population responses captures similarity in meaning and generalizes across stimuli. We note that this analysis could only be carried out on the simple one dimensional full field video, as there is no evident way to reduce the dimensionality of natural stimuli. The organization of the retina codebook may also explain how the brain can decode novel stimuli from novel neural activity patterns. Namely, if we observe a response r that we have never seen before, we can now ask what similar responses tell us about the stimulus. Importantly, this can be done since P (2) (r|s) allows us to estimate d (ri, rj) even for patterns we have not seen in the past. Indeed, we found that P (s|r) for a held-out test response, r, could be well estimated simply by taking P (s|r′) for the response, r′, which is most similar to it. Similarity was assessed using the thesaurus that we learned from the training data, that is, for different stimuli than the ones we tested on (Figure 7A, B). This approach clearly improved our ability to estimate the stimulus compared to our prior knowledge about the stimulus, as measured by the Jensen-Shannon divergence between the ‘true’ P (s|r) and the estimate (Figure 7C). Using a thesaurus based on the Hamming distance clearly degraded performance and reduced the accuracy of the stimulus estimate (Figure 7C). 10. 7554/eLife. 06134. 020Figure 7. Accurate decoding of new stimuli from previously unseen population responses, using a neural thesaurus. (A) The conditional distribution over stimuli for one population response, P (s|r), to the artificial video is shown (black dots). P (s|r) can be well approximated by the conditional distribution over stimuli P (s|r′) where r′ is the response most similar to r according to the thesaurus d (‘r′Nearest’, purple line). Actual responses are shown as inset. The same representative group of 20 neurons shown in Figure 3 was used here. Error bars represent standard errors of the probability estimates B. Same as in A, but for a natural video clip. (C) Top: The average Jensen-Shannon divergence between the ‘true’ P (s|r) and the estimate described in panel A (Semantic), or for an estimate derived using the Hamming distance instead of our similarity measure (Hamming), for the artificial video data. Also shown is the average divergence from the prior over stimuli (Prior). Plotted are mean and standard errors (barely discernable) across all patterns that had at least one close neighbor (<0. 25 bits away). Bottom: Same as above, but for the natural video data. Having a thesaurus markedly improves our ability to gain some knowledge about never before seen responses, compared to a naive prior, or even to using Hamming distance as a similarity measure. DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 02010. 7554/eLife. 06134. 021Figure 7—figure supplement 1. Comparing decoding performance using the conditionally independent model and pairwise model. Left: The average Jensen-Shannon divergence between the ‘true’ P (s|r) and the estimate based on the most similar response as measured using either the conditionally independent model or the pairwise model used in the main text (see Figure 7), for responses evoked by an artificial video. Plotted are mean and standard errors (barely discernable) across all patterns that had at least one close neighbor (<0. 25 bits away). The pairwise model performs on average slightly yet significantly better (p < 10−4, two-sided paired sign test). Right: Same as left, but for the natural video. Again, the pairwise model performs on average slightly yet significantly better (p < 10−4, two-sided paired sign test). DOI: http: //dx. doi. org/10. 7554/eLife. 06134. 021 Thus, using a very limited set of known responses it is possible to decode novel responses to novel stimuli. This may be crucial when encountering new responses to known stimuli, due to sensory noise, or when generalizing prior knowledge to novel stimuli. We presented a thesaurus for a neural population code—a similarity measure between population activity patterns, based on the meaning of the responses and not on their syntactic structure. This is a general framework for mapping the codebook in any sensory system, since it makes no assumptions about what makes two spike trains similar, or that the similarity structure should obey a metric in the strict mathematical sense. Indeed, it revealed that the neural code of the brain is very different than our usual mathematical intuition: what we may regard as intuitive measures, like the Hamming distance, fail to capture the similarity between neural population responses. Instead, we found a highly structured codebook, organized in groups of responses that carry very similar information, and are distinct from all other responses. This organization of the neural population codebook into a relatively small number of semantically different clusters is reminiscent of the design of engineered codes used in communication. There, to overcome noise, different codewords are placed far apart in space of codewords, to allow for error-correction. Since noise may corrupt a message that is sent through a channel, when a pattern is received, it is compared to all possible codewords and is classified according to the nearest one. Importantly, the distance between codewords must be defined by the nature of the noise. Here, we found a neural population code that seems to be built along similar lines. Our thesaurus revealed that most of the information that the population encodes is held by the identity of the cluster that a specific activity pattern belongs to, and that more detailed information may be carried by the fine structure of the pattern. These results generalized across novel stimuli and scaled slowly with the number of stimuli used (Figure 5—figure supplement 1). We thus suggest that our analysis reveals a design principle of the population codebook of a sensory circuit. What are the advantages of such a population code design? We note that for a large neural population, most network activity patterns are observed at most once (Ganmor et al., 2011a). Thus, the brain frequently receives from its sensory neurons activity patterns that were never seen before. This may occur either due to sensory noise, corrupting the response to a known stimulus but also as a result of a truly novel stimulus. In either case, a semantic similarity measure between neural population responses may explain how these novel inputs may be deciphered: when a novel response pattern is encountered it can take on the information content of similar responses, whose meaning is already known. Therefore, the thesaurus may not only explain how sensory noise can be overcome but also how the brain can generalize across stimuli. Indeed, the thesaurus enabled us to decode neural activity patterns we have not seen before, based on their similarity to other responses. Uncovering the structure and organization of the population code relied on our ability to accurately model the noisy nature of the population response to specific stimuli. It is the nature of the noise that determines how likely two responses are to be interchanged, and consequently the semantic similarity between them. Here, we used pairwise maximum entropy models to capture the ‘noise correlations’ at every time point, (Figure 2), which were weak on average, but significant at specific times, as was also shown in (Kohn and Smith, 2005; Pillow et al., 2008; Cafaro and Rieke, 2010; Granot-Atedgi et al., 2013). Interestingly, learning a thesaurus using the conditionally independent model of the neural responses to the stimuli, recovered a similarity structure that was on par with that revealed by the pairwise model, in terms of the information that the clusters carried about the stimulus. These results are surprisingly given that the cells were clearly not conditionally independent. One possible explanation is that the organization of the codebook may be so robust, namely that the separation between clusters is sufficiently large, that even an inaccurate model can capture the identity clusters because the errors of the model are smaller than the distance between clusters. The results of (Schwartz et al., 2012; Granot-Atedgi et al., 2013) suggest that the contribution of noise correlations to shaping the population response to stimuli will increase significantly with network size. Since by definition, the conditional independent model implies larger encoding noise (noise entropy), this suggests that the clusters would be ‘wider’ in this case. It would therefore be most interesting to explore the thesaurus that these models would give for larger populations of cells, beyond groups of 20 cells that we used here for sampling reasons. Finally, we note again that the pairwise models gave better results for decoding stimuli over the conditionally independent model. Previous studies have suggested mathematically elegant and computationally efficient measures of spike train similarity, relying mostly on edit-distance based metrics (Victor and Purpura, 1997; van Rossum, 2001; Victor, 2005; Houghton and Sen, 2008). Our approach is fundamentally different, as it does not assume a metric structure, or particular features of the code (Haslinger et al., 2013) and does not require assumptions about the syntactic similarity between activity patterns. But maybe most importantly, we found that the semantic similarity between population responses could not be approximated by simple linear or bilinear functions of the patterns. This is mostly due to the fact that noise showed a high degree of stimulus dependence (Figure 3—figure supplement 2). This means that the correlated nature of neural noise shapes the population code differently for different stimuli. The approach we presented here could be immediately applied to other neural circuits (Bathellier et al., 2012; Parnas et al., 2013), and it is therefore important to note where our approach has been restrictive and could be extended. First, our clustering was not optimized to maximize the information that the clusters carry about the stimulus, but only to group similar responses together. Interestingly, such an information maximization clustering approach (Slonim and Tishby, 1999) does not result in significantly more information using fewer clusters (Figure 5—figure supplement 2). Second, hard clustering of the population responses into k clusters is somewhat arbitrary, and it is possible to consider generalizations to fuzzy rather than hard clustering—where responses may be associated with several clusters, or categories, simultaneously in a probabilistic manner (Zemel et al., 1998). Lastly, while both agglomerative and spectral clustering yielded similar results in our analysis of the nature of the retinal population code, it is possible that other ways of clustering would reveal further structure of the code. Experiments were performed on the adult tiger salamander (Ambystoma tigrinum). All experiments were approved by the institutional animal care and use committee of Ben-Gurion University of the Negev and were in accordance with government regulations. Prior to the experiment the salamander was adapted to bright light for 30 min. Retinas were isolated from the eye and peeled from the sclera together with the pigment epithelium. Retinas were placed with the ganglion cell layer facing a multi-electrode array with 252 electrodes (Ayanda Biosystems, Lausanne, Switzerland) and superfused with oxygenated (95% O2/5% CO2) Ringer medium which contains: 110 mM NaCl, 22 mM NaHCO3,2. 5 mM KCl, 1 mM CaCl2,1. 6 mM MgCl2, and 18 mM Glucose, at room temperature (Meister et al., 1994). The electrode diameter was 10 μm and electrode spacing varied between 40 and 80 μm. The array was lowered onto the retina from above by means of a standard mechanical manipulator. Extracellularly recorded signals were amplified (Multi Channel Systems, Germany) and digitized at 10k Samples/s on four personal computers and stored for off-line spike sorting and analysis. Spike sorting was done by extracting the amplitude and width from each potential waveform, and then by clustering using an in-house written MATLAB program (Source code 1). 48/31 retinal ganglion cells were recorded and cleanly isolated in the artificial/natural video experiment. Natural video clips were acquired using a digital video camera (Sony Handycam DCR-HC23) at 30 frames per second. The stimulus was projected onto the salamander retina from a CRT video monitor (ViewSonic G90fB) at a frame rate of 60 Hz such that each acquired frame was presented twice, using standard optics (Puchalla et al., 2005). The original color videos were converted to gray scale, using a gamma correction for the computer monitor. Artificial full-field flicker stimuli were generated by sampling a uniform gray level from a normal distribution. In both cases, the visual stimulus covered the retinal patch that was used for the experiment entirely. A 10 s clip was taken from each video and played to separate retinas repetitively for approximately 2 hr. Each video was therefore replayed to the retina over 600 times. Analysis was carried out in MATLAB. We examined the responses of ten randomly chosen groups of 20 neurons from each retina. Spikes were binned at 20 ms (different bin sizes did not qualitatively affect our results, see Figure 5—figure supplement 4). Each response r is a 20 bit binary vector with each bit corresponding to the activity of a single neuron (0 representing silence and 1 representing spiking) in a single time bin. To estimate the probability distribution of responses to a given stimulus P (r|s), we considered the ensemble of responses recorded at a single point in time in the video across repeats. Note that the retina is displayed with the exact same stimulus, including several minutes of stimulus history, at each repeat. We then estimated the single neuron and pairwise spiking probability from the data in order to generate a maximum entropy pairwise model as detailed in previous work (Ganmor et al., 2011b). Briefly, the maximum entropy pairwise distribution is known to take the form (Jaynes, 1957) P (2) (r|s) =1Z (s) exp (∑i=1Nαi (s) ri+∑i<jβij (s) rirj). The parameters can be found by optimizing the likelihood of the data L (Data|α, β). Since the log likelihood is concave, the global optimum can be found using gradient methods, with local derivatives ∂L∂αi (s) =〈ri〉PData (r|s) −〈ri〉P (2) (r|s), where <f (r) >P represents the expected value of some function of the response, f, with respect to the probability distribution P. Data were split into train and test sets. The train set was used to learn the conditional probabilities P (r|s), which were then used to construct P (s|r) through Bayes' rule P (s|r) = P (r|s) P (s) /P (r). The dissimilarity matrix between all responses observed in the test set was defined as d (r1, r2) = DJS (P (s|r1) ||P (s|r2) ) (where DJS stands for the Jensen-Shannon divergence, and s represents only train stimuli). This matrix was clustered using hierarchical agglomerative clustering with the distance between clusters defined as the average distance between inter-cluster pairs. Different methods of spectral clustering yielded similar results. The number of clusters, k, was systematically varied. For a given value of k, the mutual information between stimulus and clusters I (s; Ck (r) ) was estimated as follows: Each response in the test data was replaced with its cluster label Ck (r) (Ck (r) can take a value in {1…k}) and then mutual information was estimated as I (s; Ck (r) ) = H (Ck (r) ) − H (Ck (r) |s), where H is the Shannon entropy. H (Ck (r) ) is the total entropy of different clusters in the data. H (Ck (r) ) =−∑i=1kP (Ck (r) =i) log (P (Ck (r) =i) ), where P (Ck (r) =i) is the frequency of the ith cluster, out of k, in the data. H (Ck (r) |s) is the average conditional entropy of clusters given stimulus s. In our case, we treat each time point in the 10 s video as a unique stimulus, and thus H (Ck (r) |s) is given by the conditional entropy at each time point across video repeats, averaged over time points—H (Ck (r) |s) =H (Ck (r) |t) =−∑t=1T1T∑i=1kP (Ck (r) =i|t) log⁡P (Ck (r) =i|t), where P (Ck (r) =i|t) is the frequency of cluster i, out of k, at time t in the video. The representative matrices in Figure 3 were chosen as the matrices with the fifth (out of 10) highest average ratio of the within cluster similarity and the overall similarity. The total degree of network correlation was measured using the multi-information (Amari, 2001; Schneidman et al., 2003b), defined as IN = Hind − H, where Hind is the independent entropy (sum of all individual neuron entropies) and H is the entropy estimated from the actual data. In all cases where information or entropy was estimated, we used the method of extrapolation (Treves and Panzeri, 1995; Strong et al., 1998) to correct for finite sampling biases. These corrections were on the order of a few percent (see Figure 2—figure supplement 1). For a given response r in the test set, we compared the ‘true’ P (s|r), constructed from P (r|s) across test stimuli as previously described, to one of three estimates P˜ (s|r): (1) The true prior over stimuli P (s), which is a uniform distribution over stimuli. (2) A nearest neighbor estimate, that is, P˜ (s|r) = P (s|r′) where d (r, r′) is minimal across all responses in the test set. (3) Same as 2, only r′ is a nearest neighbor in Hamming distance (arbitrarily chosen out of all nearest neighbors). Responses were embedded using the Isomap algorithm (Tenenbaum et al., 2000). Given a set of pairwise distances, Isomap finds a configuration of points in k dimensions that most closely recreate the geodesic distances between points. The geodesic distance between two points is either the dissimilarity d between them, if they are connected in the neighborhood graph, or the shortest weighted path if they are not. Two nodes were connected if their dissimilarity was smaller than 0. 5 bits (epsilon neighborhood). Isomap was chosen over multi dimensional scaling approaches as it gave better results, in particular since dissimilarities are bounded from above (1 bit maximum). We limited the number of points to embed so that a 2–3 dimensional embedding gave a reasonably faithful reconstruction of the geodesic distances as measured by the residual variance.

Title: A thesaurus for a neural population code Summary: Our ability to perceive the world is dependent on information from our senses being passed between different parts of the brain. The information is encoded as patterns of electrical pulses or'spikes', which other brain regions must be able to decipher. Cracking this code would thus enable us to predict the patterns of nerve impulses that would occur in response to specific stimuli, and 'decode' which stimuli had produced particular patterns of impulses. This task is challenging in part because of its scale-vast numbers of stimuli are encoded by huge numbers of neurons that can send their spikes in many different combinations. Furthermore, neurons are inherently noisy and their response to identical stimuli may vary considerably in the number of spikes and their timing. This means that the brain cannot simply link a single unchanging pattern of firing with each stimulus, because these firing patterns are often distorted by biophysical noise. Ganmor et al. have now modeled the effects of noise in a network of neurons in the retina (found at the back of the eye), and, in doing so, have provided insights into how the brain solves this problem. This has brought us a step closer to cracking the neural code. First, 10 second video clips of natural scenes and artificial stimuli were played on a loop to a sample of retina taken from a salamander, and the responses of nearly 100 neurons in the sample were recorded for two hours. Dividing the 10 second clip into short segments provided a series of 500 stimuli, which the network had been exposed to more than 600 times. Ganmor et al. analyzed the responses of groups of 20 cells to each stimulus and found that physically similar firing patterns were not particularly likely to encode the same stimulus. This can be likened to the way that words such as 'light' and 'night' have similar structures but different meanings. Instead, the model reveals that each stimulus was represented by a cluster of firing patterns that bore little physical resemblance to one another, but which nevertheless conveyed the same meaning. To continue on with the previous example, this is similar to way that 'light' and 'illumination' have the same meaning but different structures. Ganmor et al. use these new data to map the organization of the 'vocabulary' of populations of cells the retina, and put together a kind of 'thesaurus' that enables new activity patterns of the retina to be decoded and could be used to crack the neural code. Furthermore, the organization of'synonyms' is strikingly similar to codes that are favored in many forms of telecommunication. In these man-made codes, codewords that represent different items are chosen to be so distinct from each other that even if they were corrupted by noise, they could be correctly deciphered. Correspondingly, in the retina, patterns that carry the same meaning occupy a distinct area, and new patterns can be interpreted based on their proximity to these clusters.

lay_elife

en

Summarize: BACKGROUND OF THE INVENTION This invention relates to a method and an inspection catheter for easy and safe fixation of pervenous electrodes at the optimum position within the right atrium for treatment of arrhythmia through the electrical stimulation of the affected heart. The pacemakers of the kind which require that electrodes for delivering rhythmical electrical stimuli be fixed within the atrium include the P-synchronized pacemaker, the bifocal demand pacemaker, the fixed-rate pacemaker, the demand pacemaker and the radio-frequency induced atrial pacemaker. The electrodes for delivering electrical stimulating pulses from pacemakers to the atrium are broadly grouped by the method of fixation thereof into two types: Myocardial electrodes which are fixed as by thoracotomy and allowed to generate electrical stimuli epicardially and pervenous electrodes which are fixed after insertion through the incised subclavian vein and allowed to generate electrical stimuli endocardially. The myocardial electrodes are highly susceptible to surgical incursions and, therefore, are not suitable for use on senile patients and poor risk patients unable to endure surgery. The present invention relates to a method for the endocardial stimulation by use of a pervenous electrode. The methods which have heretofore been developed for the fixation of pacemaker pervenous electrodes in the right atrium include those involving insertion of a J-shaped lead or anchored electrodes in the right atrial appendages and those involving insertion of a pair of pacemaker pervenous electrodes in the coronary sinuses, for example. In all these conventional methods, since the electrodes are not sutured to the endocardium, there is a possibility of the electrodes being detached from the positions of the endocardium where they were initially fixed, with the result that the pacemakers will fail to provide required pacing and sensing actions. The inventor, therefore, performed clinical trials in search of a way of improving the conventional methods described above. On the basis of the outcomes of the clinical trials, the inventor perfected a method for safe fixation of the pervenous electrodes at the optimum position within the right atrium to provide required atrial pacing in a given case. At the 30th general meeting of the Japanese Association for Thoracic Surgery held on Sept. 25, 1977, the inventor published this method. He further published this method in medical journals, specifically in the February, 1978 and August, 1978 issues of the &#34;Japanese Journal of Thoracic Surgery&#34; and in the &#34;Journal of the Japanese Association for Thoracic Surgery&#34;, Vol. 26, No. 8. The gist of the publication is as follows: The subclavian fossa of a given patient is subjected to skin incision to expose the right cepharic vein and a catheter with a pair of inspection electrodes for potential detection is inserted through the vein into the right atrium. The right atrium is explored with the inserted catheter to determine the optimum position of a permanent pervenous pacemaker electrode through measurement of the stimulating thresholds and endocardial potentials in the anterior and lateral walls inside the right atrium. When the optimum position for fixing the pacemaker electrode is found, the catheter for potential detection is extracted. Then in the same manner, a guide catheter consisting of an outer tube and guidewire slidably built in the outer tube is inserted into the right atrium. The rear end of the guidewire is pushed into the outer tube to form at the predetermined optimum position a loop of the guidewire at the leading end of the outer tube under fluoroscopic observation. Thereafter, a double lumen needle is pierced through the chest wall in the direction of the formed loop of the guidewire inside the right atrium under fluoroscopic observation. After a doubly folded fine steel wire is inserted into the right atrium through the double lumen needle, the guidewire is drawn back through the outer tube to contract the loop of the guidewire thereby to catch firm hold of the inserted end of the steel wire and then, the guide catheter is extracted together with the steel wire. The guide catheter thus extracted is released from the steel wire and instead, the pervenous pacemaker electrode is connected to the steel wire by means of a sutural thread. The steel wire is next caused to introduce the pacemaker electrode into the interior of the right atrium by pulling outwardly the rear ends of the steel wire remaining the outer side of the lumen needle so as to pull the sutural thread out of the lumen needle. When the pacemaker electrode reaches the predetermined optimum position, the double lumen needle is removed from the chest wall and the sutural thread is sutured on the subcutaneous tissue for thereby fixing the pacemaker electrode in the endocardium of the atrium. Even this method unfortunately requires more time and labor and higher surgical skill. An object of the present invention, therefore, is to provide a method and an inspection catheter for ready fixation of the pervenous pacemaker electrode at the optimum position within the atrium, with ample saving in the time and labor required for the fixation of the pacemaker electrode in the endocardium in the atrial pacing. SUMMARY OF THE INVENTION To accomplish the object described above according to the present invention, there is provided a method, which comprises the steps of inserting through the subclavian vein into the right atrium an inspection catheter provided with a pair of inspection electrodes at the leading end thereof and a slidably built-in guidewire, causing the inspection catheter to explore the endocardium of the atrium thereby to determine the optimum position for a pacemaker electrode, pushing the guidewire into the inspection catheter to form a loop at the optimum position thus determined within the atrium, piercing a double lumen needle through the chest wall in the direction of the loop of the guidewire, passing an induction steel wire through the double lumen needle, drawing the guidewire to contact the loop of the guidewire thereby to catch firm hold of the inserted end of the steel wire, withdrawing completely the inspection catheter together with the steel wire, releasing the inspection catheter from the steel wire and instead, tying a pervenous pacemaker electrode to the steel wire by the medium of a sutural thread, drawing the tail end of the steel wire remaining on the outer exposed side of the double lumen needle pierced through the chest wall to introduce the pacemaker electrode into the interior of the atrium until the pacemaker electrode is brought into contact with the endocardium of the right atrium and thereafter the sutural thread fixed to the pacemaker electrode is withdrawn all the way through the skin, removing the lumen needle from the chest wall and suturing the sutural thread on the subcutaneous tissue thereby to keep the pacemaker electrode attached tightly on the endocardium of the atrium. Although the method of this invention necessitates advanced surgical technique on the part of the surgeon in the process in which the inspection catheter designed for detection of endocardial potential is introduced inside the right atrium and operated to explore the endocardium of the right atrium and determine the optimum position for the permanent pervenous electrodes, it enjoys an advantage that, once the optimum position is determined, the fixation of the pervenous electrodes can be accomplished with a comparatively simple technique, the step of again guiding the pervenous electrodes to the predetermined optimum position and fastening it to the optimum position, which has proved to be the most troublesome work in the conventional surgical technique is no longer required and the possibility of exposing the patient to surgical incursion is minimized. The method of this invention can be practiced by using an inspection catheter which comprises a slender outer tube having a pair of inspection electrodes at the leading end thereof, guidewire slidably built in the outer tube and tied to the leading end of the tube and a double lumen needle which is adapted to introduce an induction steel wire doubly folded into the right atrium. The other objects and characteristic features of the present invention will become apparent from a detailed description of the invention to be given hereinafter with reference to the accompanying drawing. BRIEF EXPLANATION OF THE DRAWING FIG. 1 is a partially cutaway overall view of one preferred embodiment of the inspection catheter for the detection of endocardial potential according to the present invention. FIGS. 2 and 3 are sectioned views showing in detail the leading end of the catheter of FIG. 1 in the states assumed respectively after and before the guidewire forms a loop. FIG. 4 is an enlarged sectioned view of the tail end of the catheter of FIG. 1. FIGS. 5-12 are explanatory diagrams showing the steps which are involved in working the method of this invention for the fixation of the pervenous electrodes inside the right atrium in the order in which they are performed. DETAILED DESCRIPTION OF THE INVENTION The method of the present invention for the fixation of the pervenous electrodes in the atrial pacing necessitates use of an inspection catheter designed for the detection of endocardial potential, a pair of pervenous electrodes designed for permanent fixation onto the endocardium of the right antrium, a double lumen needle adapted to pierce through the chest wall into the right atrium and an induction steel wire doubly folded. First, the inspection catheter designed for the detection of endocardial potential will be described with reference to FIGS. 1 through 4. This catheter 1 is used for the purpose of determining the optimum position for the fixation of the pervenous electrodes inside the right atrium by detecting the stimulating threshold through probing contact of the anterior and lateral walls of the right atrium and by measuring the endocardial potential. As illustrated, the inspection catheter comprises a long slender outer tube 2 and a flexible guidewire 3 slidably passing through the outer tube, with the leading end of the guidewire 3 tied to the leading end of the outer tube. When the rear portion 3&#39; of the guidewire 3 which extends outwardly from the tail end of the outer tube is pushed into the outer tube in the same way as in a release cable for a camera, the leading portion of the guidewire 3 is pushed out of the leading end of the outer tube. In the guidewire, a fine steel wire 3b provides support from inside for a covering tube of a coiled wire 3a and helps the covering tube 3a slide smoothly inside the outer tube 2 at the time that the catheter is put to use. The fine steel wire 3b further serves the purpose of expanding the loop 4 which the guidewire 3 forms outside the leading end of the outer tube 2 when the rear portion of the guidewire is pushed into the outer tube. A tough, very thin string 6 is passed through the opening of an obliquely cut end 5 of the outer tube 2 and a hole 5&#39; perforated immediately behind the base of the cut end and the opposite ends of this thin string 6 are secured to the leading end of the covering tube 3a. The leading ends of the outer tube 2 and the guidewire 3 are united to each other in the manner just described. At the tail ends of the outer tube 2 and the guidewire 3, there may be provided squeezing pieces 7, 8 similar to those in a release cable for a camera to facilitate the operation of the inspection catheter. The squeezing pieces 7, 8 are desired to be made of a plastic material to preclude adhesion of blood. When the rear portion 3&#39; of the guidewire 3 which extends outwardly from the tail end of the outer tube 2 is pushed down toward the tail end of the outer tube, the leading end portion of the guidewire 3 is forced out in a manner folded backwardly from the leading end of the outer tube because the leading end of the guidewire 3 is secured by a string 6 to the base of the obliquely cut end 5 of the outer tube, causing the guidewire 3 to form a loop of a size corresponding to the extent of the push given to the rear portion 3&#39; outside the leading end of the outer tube. When the rear portion 3&#39; is pulled away from the rear end of the outer tube after the guidewire 3 has formed the loop, the exposed leading end portion of the guidewire retracts into the leading end portion of the outer tube and the loop 4 gradually diminishes and eventually disappears. The obliquely cut end 5 formed at the leading end of the outer tube 2 facilitates the formation of the loop of the guidewire mentioned above and the smooth retraction of the formed loop. The cut end is so formed as to allow easy insertion of the catheter through a hole incised in the vein via the cepharic vein into the right atrium. What is most important about the cut end of the outer tube is the fact that the leading end of the guidewire is tied to one lateral side of the leading end of the outer tube. When the guidewire 3 is composed of a covering tube 3a and a fine steel wire 3b passing through the covering tube and the leading end of the fine steel wire 3b is fastened to the covering tube 3a as in the case of the present preferred embodiment, the formation of the loop and the retraction of the formed loop can be facilitated by causing the leading end of the fine steel wire to be fixed onto the covering tube slightly back from the leading end of the covering tube so that the leading end portion of the guidewire is formed solely of covering tube and, therefore, is allowed to enjoy great freedom of flexing. The loop can always be formed in a fixed direction in relation to the outer tube owing to the obliquely cut end 5 and the string 6 by which the guidewire and the outer tube are connected at their leading ends with each other. The inspection catheter is provided outside the leading end portion of the outer tube 2 with a pair of electrodes 9a, 9b. These electrodes 9a, 9b can be formed by having conductive pieces tightly wound on the outer surface of the outer tube 2, for example. In the present preferred embodiment, lead wires 10a, 10b connected respectively to the electrodes 9a, 9b extend backwardly in the wall of the outer tube 2 and drawn out of the tail end of the outer tube 2. To the rear ends of the lead wires 10a, 10b are optionally attached suitable connectors 11a, 11b for electrical connection to a measuring instrument. The aforementioned lead wires 10a, 10b are not necessarily required to be extended in the wall of the outer tube 2. They may be extended on the outer surface of the outer tube or they may be extended inside the hollow interior of the outer tube in such a way as not to interfere with the sliding of the guidewire. The portions of the lead wires 10a, 10b which are drawn out of the tail end of the outer tube 2 may be covered with an insulating coat and the portions where the lead wires depart from the tail end may be wrapped in an insulating tape 10 as occasion demands. The fixation of the pacemaker electrodes to the endocardium of the right atrium of a given patient by means of the inspection catheter of this invention is carried out by the following procedure. As described previously, a local incision is formed directly below the center of the patient&#39;s clavicle, and the catheter 1 is inserted through the subclavian vein into the right atrium RA until the aforementioned electrodes 9a, 9b provided at the leading end portion of the outer tube 2 comes into contact with the endocardium of the right atrium RA (FIG. 5). The rear ends of the lead wires 10a, 10b are connected to an external instrument for the measurement of endocardial potential of the right atrium. Further, the rear ends of the lead wires 10a, 10b are connected to an extracorporeal pacemaker so as to forward electric current to the right atrium and measure the electrical stimulating threshold of the right atrium. The measurement of the endocardial potential and the measurement of the electrical stimulating threshold are continued while the leading end portion of the catheter is moved about inside the right atrium and the electrodes 9a, 9b are consequently brought into contact with various regions of the endocardium of the right atrium. In this manner, the optimum position for the fixation of the pacemaker electrodes is determined. After the optimum position has been determined, the movement of the catheter is discontinued and the leading end portion thereof is kept at the optimum position. Then, the rear portion of the guidewire 3 is pushed down into the outer tube 2 so that the leading end portion of the guidewire forms a loop 4 of a desired size at the leading end of the outer tube inside the right atrium as described previously (FIG. 6). Subsequently, a skin incision of approximately 2 cm is formed at the righthand extremity of the sternum in the fourth intercostal space. Through this skin incision, a double lumen needle 12 is pierced in the direction of the leading end portion of the outer tube inside the right atrium under fluoroscopic observation and the center of the loop 4 is positioned at the leading end of the needle by slightly pulling out the outer tube. Thereafter, a doubly folded induction steel wire 13 used for the fixation of the pacemaker electrodes is inserted, with the folded end first, into the double lumen needle 12 until the folded end of the induction steel wire 13 passes the vicinity of the center of the loop 4 inside the right atrium (FIG. 7). After that, the guidewire 3 is pulled backwardly relative to the outer tube 2 so as to contract the loop 4. Eventually, the guidewire 3 is retracted via the leading end of the outer tube with the result that the induction steel wire 13 is caught fast between the leading ends of the guidewire 3 and the outer tube 2 (FIG. 8). Then, the catheter is completely extracted from the subclavian vein (FIG. 9), so that the firmly gripped end of the induction steel wire 13 is drawn out of the body. At this point, the catheter is released from the induction steel wire 13. Now, the leading end of an endocardial lead 14&#39; which has a pair of pacemaker pervenous electrodes 14 disposed in an exposed state on the outer surface of the leading end thereof is connected with a sutural thread to the induction steel wire 13 (FIG. 10), and rear end portion of the induction steel wire 13 protruding from the exposed end of the double lumen needle 12 is pulled away from the needle 12 so as to draw the endocardial lead 14&#39; into the interior of the right atrium (FIG. 11). As the result of the pull of the induction steel wire 13, the induction steel wire is first drawn out of the double lumen needle 12 and a part of the thread 15 is drawn out of the needle 12 subsequently. Shortly thereafter, the pull of the thread 15 through the double lumen needle 12 comes to a halt when the leading end of the endocardial lead 14&#39; connected to the sutural thread collides into the leading end of the double lumen needle 12 which passes into the cavity of the right atrium. At this point, the double lumen needle 12 is drawn out of the patient&#39;s body. Then the thread 15 is sutured on the subcutaneous tissue at the righthand extremity of the sternum in the fourth intercostal space. A pacemaker 16 connected to the end of the endocardial lead 14&#39; is implanted in the chest wall (FIG. 12). Since the inspection catheter 1 forms the loop at a predetermined optimum position and the double lumen needle 12 is pierced in the direction of the center of the loop, the pervenous electrodes 14 disposed at the leading end of the endocardial lead 14&#39; which has been drawn by the induction steel wire 13 and the sutural thread 15 and brought into collision with the leading end of the double lumen needle will consequently come into contact with the endocardium of the right atrium at or near the optimum position determined in advance by the inspection catheter. According to the present invention, therefore, the pacemaker pervenous electrodes can be fixed at the optimum position determined in advance on the endocardium of the right atrium by having the electrodes 9a, 9b disposed as close to the leading end of the outer tube 2 as permissible. Since the determination of the optimum position for the fixation of the pervenous electrode and the fixation of the pervenous electrode at that predetermined optimum position are realized by having the inspection catheter inserted just once into the right atrium, the time and labor required for the attachment of the pacemaker can be notably saved by the method of the present invention. In the preferred embodiment described above, one pair of electrodes 9a, 9b are used and the measurement of endocardial potential and that of stimulating threshold are effected by suitably switching the connection of the lead wires 10a, 10b. Instead, there may be incorporated two pairs of electrodes, one of the two pairs used for the measurement of endocardial potential and the other pair for the measurement of stimulating threshold. Although the present invention has been described with reference to one illustrated preferred embodiment, it is not limited to this preferred embodiment but may be practiced in various modifications without departing from the spirit of this invention.

Summary: A method for the fixation of a permanent pervenous electrode for atrial pacing, comprising the steps of inserting an inspection catheter into the right atrium to determine the optimum position inside the right atrium for the fixation of a pervenous electrode, causing a guidewire slidably built in the inspection catheter to be forced out and allowed to form a loop along the endocardium of the right atrium, inserting into the right atrium an induction steel wire via a double lumen needle pierced through the chest wall in the direction of the loop of guidewire, causing the loop to tighten around and catch firm hold of the induction steel wire and withdrawing completely the inspection catheter while the induction steel wire is held in a state caught fast in the contracted loop of guidewire at the end of the catheter, replacing the inspection catheter with the permanent pervenous electrode, drawing the steel wire backwardly and thereby introducing the pervenous electrode into the right atrium and suturally fixing the pervenous electrode at the aforementioned optimum position.

big_patent

en

Write a title and summarize: Characterizing the fitness landscape, a representation of fitness for a large set of genotypes, is key to understanding how genetic information is interpreted to create functional organisms. Here we determined the evolutionarily-relevant segment of the fitness landscape of His3, a gene coding for an enzyme in the histidine synthesis pathway, focusing on combinations of amino acid states found at orthologous sites of extant species. Just 15% of amino acids found in yeast His3 orthologues were always neutral while the impact on fitness of the remaining 85% depended on the genetic background. Furthermore, at 67% of sites, amino acid replacements were under sign epistasis, having both strongly positive and negative effect in different genetic backgrounds. 46% of sites were under reciprocal sign epistasis. The fitness impact of amino acid replacements was influenced by only a few genetic backgrounds but involved interaction of multiple sites, shaping a rugged fitness landscape in which many of the shortest paths between highly fit genotypes are inaccessible. Predicting function and fitness of organisms from their genotypes is the ultimate goal of many fields in biology, from medical genetics to systems biology to the study of evolution [1–5]. Among the conceptual frameworks for understanding the genotype-to-phenotype connection is the fitness landscape, which assigns a fitness (phenotype) to every possible genotype (sequence) of a gene or genome under consideration [4,6]. The recognition of the importance of the fitness landscape stimulated the development of a variety of theoretical approaches to describe it, including its general shape and epistatic interactions between alleles, a key property which determines the complexity of the fitness landscape (see [4] and references within). Before the advent of next-generation sequencing, experimental assays of the fitness landscape were few and could not address the issue at the sequence level. Recently, large-scale experimental assays described the shape of the fitness landscape a few mutations away from a local fitness peak (see [7–10] and references within). Also, some assays involving a smaller number of genotypes considered combinations of mutations with established functional [11–17] or evolutionary [18–25] significance. Empirical evidence of the nature of large-scale fitness landscapes mostly comes from the study of genotypes incorporating random mutations [4,7–10], the majority of which are deleterious [7–10,26]. Thus, our present knowledge of fitness landscapes is primarily driven by the study of deleterious mutations and their interactions, although local adaptive trajectories have also been considered [2,4, 16,27–29]. Deleterious mutations were found to engage in synergistic epistasis, whereby the joint effect of multiple mutations was stronger than the sum of their individual effects [4,7–10,16]. Furthermore, sign epistasis among random mutations was mostly rare [5,7–10,16,30], although some of these conclusions differ from study to study (e. g. see [4,30]). Unfortunately, there are fundamental limitations to assaying the fitness landscape on a large or macroevolutionary level with random mutation libraries. The number of genotypes underlying the fitness landscape is the combinatorial set of all amino acids across the length of the protein [4,6]. For example, for the 220 amino acid protein coded by the His3 gene in Saccharomyces cerevisiae, the fitness landscape is a 220-dimensional genotype space with 20220 different possible sequences. Such immense spaces are both computationally and experimentally intractable. Fortunately, it may not be necessary to survey all genotypes to study the evolutionary-relevant section of the fitness landscape. Because the vast majority of mutations in protein sequences are deleterious [26], a randomly sampled protein sequence is non-functional [31,32]. Here we propose an evolutionary approach for assaying fitness landscapes on a macroevolutionary scale in a high-throughput manner that avoids the random sampling of mostly non-functional sequences. The functionally and evolutionarily relevant section of the fitness landscape can be represented by the combination of extant amino acid states, those found in extant species. This approach applied previously on a limited scale [18–25] mitigates the problem of exploring a prohibitively large fitness landscape while highlighting the relationships between evolutionarily-relevant genotypes (Fig 1A). Crucially, substitutions that have been fixed in evolution are fundamentally different from random mutations [26], the former are either neutral or beneficial in at least some genetic contexts and represent the driving force of molecular evolution, while the latter are mostly deleterious and are primarily relevant on a microevolutionary scale. Therefore, current empirical data do not shed much light on the impact of interactions between amino acid states that were fixed in the course of evolution by natural selection. Combinations of extant amino acid states represent the area of the sequence space that considers all possible orders in which amino acid substitutions from evolution could have happened allowing one to assay a much wider functionally relevant area of the sequence space than approaches based on random mutagenesis of a single sequence (Fig 1B and 1C). We studied His3, a gene coding for imidazoleglycerol-phosphate dehydratase (IGPD, His3p), an enzyme essential for histidine synthesis. In a multiple alignment of His3 orthologues from 21 yeast species we identified 686 extant amino acid states (S1 Supporting Information), which were evenly distributed across the His3p structure (Fig 1D). These 686 states, which represent the end product of ~400 million years of evolution [33] (Fig 1B and 1C) correspond to ~1083 sequences, even a tiny fraction of which would be too many to survey. Thus, we sectioned His3 into 12 independent segments such that the full combinatorial set of amino acid states that occurred in His3 during yeast evolution comprised 10,000-100,000 genotypes per segment (see Methods and S1A Fig). The 12 segments were of similar length, constrained by the molecular methods employed for library construction (see Methods), and covered a diverse range of secondary structures and functional elements (S1C Fig). For each of the 12 segments of His3 we performed an independent experiment surveying its fitness landscape. For each segment we used degenerate oligonucleotides to construct genotypes consisting of combinations of amino acids present in extant His3 sequences, and determined the fitness conferred by these genotypes by expressing them in a Δhis3 strain of S. cerevisiae and measuring the rate of growth (S1B Fig). This way for each segment we assayed the fitness landscape of the genotype space that was traversed over the course of the last ~400 million years of evolution [33]. The segmentation of the His3 protein into 12 segments at first glance appears not to be relevant to understanding the fitness landscape of the entire protein. Indeed, it would have been more informative to survey combinations of extant amino acid states across the entire His3 sequence. Our choice to study independent segments was dictated by our preference for depth over width, in other words, we were more curious to consider combinations of extant amino acid states from distant orthologues rather than consider combinations of extant amino acids states from a few closely related species across the entire gene. Our choice of selecting random segments across the protein is justified in the same way as surveys of individual genes; segments may interact to form a functional protein while genes interact to contribute to the overall organismal fitness. Indeed, the lessons learned from fitness landscapes of random protein segments are likely to be scalable to the level of the entire protein to a greater extent than how fitness landscapes of an entire protein can be scaled to understand the fitness landscape of a genome. Across 11 experiments, we measured fitness for a total of 4,018,105 genotypes (875,151 unique amino acid sequences) with high accuracy (S2 Fig). Of these, 422,717 consist solely of combinations of extant amino acid states from His3 orthologues, while the remaining genotypes incorporate other amino acid changes (S2 Supporting Information and Methods). Throughout the study, we considered the logarithm of fitness to allow for the sum of the impact of individual amino acid replacements on fitness to represent the fitness function. For one segment, 9, the accuracy of our experiment was low, and it was not used in cumulative analyses. For each segment we measured fitness for 60% - 99. 8% of all possible genotypes from the combinatorial set of selected extant amino acid states found in 21 yeast species and a smaller fraction of combinations found across all domains of life (S2 Supporting Information), characterizing the evolutionary relevant fitness landscape (Fig 1B). For segment 3 for instance, 11 out of 17 amino acid sites had more than one extant amino acid state: L145 = 2, L147 = 2, Q148 = 3, K151 = 2, V152 = 2, D154 = 3, L164 = 3, E165 = 4, A168 = 2, E169 = 4, A170 = 4, with the full yeast combinatorial set consisting of 2*2*3*2*2*3*3*4*2*4*4 = 55,296 genotypes out of which we determined the fitness for 48,198, or 87% of the possible yeast extant states combinations in our library. Our experimental design not only generated combinations of extant amino acids, but also allowed us to distinguish real variants from less abundant aberrations originating from sequencing errors (S2 Fig). We further reduced genotyping errors by sequencing every variant twice through paired-end sequencing (S2A Fig), and by using an error-correction algorithm (see Sequencing error rate section). Most of the genotypes that can be created by the combination of extant amino acid states are not ancestral His3 protein segments. In a high-dimensional sequence space, the number of actual ancestral sequences is exponentially smaller than the number of combinations of extant states (Fig 1A). Out of the 48,198 extant amino acid state combinations in segment 3 only seven sequences actually match the reconstructed ancestral states of the entire segment. The combinations of extant amino acid states represent the evolutionary-relevant segment of the fitness landscape because they represent all possible alternative evolutionary trajectories in sequence space that consist of the same substitutions that have occurred in evolution of the extant protein sequences under consideration. Furthermore, some of these seven sequences were likely found in a different context of the entire protein, so they do not represent the ancestral states of the entire His3 protein but rather the ancestral states found in segment 3 across different genetic context of the rest of the His3 protein. A substantial proportion of combinations of extant amino acid states led to genotypes with low fitness (Fig 2, Fig 3A and 3B, S3 Fig), an observation that takes into account the false discovery rate in our data (S2 Supporting Information). This observation could be explained by i) some extant amino acids having a universally deleterious effect, ii) some amino acid states exerting a negative effect on fitness because of intergenic interactions with other S. cerevisiae genes, or iii) by epistatic interactions between the extant amino acid states within His3 [34]. We exclude the possibility that some extant amino acid states had a universally lethal effect in S. cerevisiae background because no extant amino acid states were present only in unfit genetic backgrounds, genotypes conferring a fitness of zero. Indeed, no extant amino acid states had a universally strong deleterious effect, a decline of fitness by more than 0. 4 (Fig 3D), and the smallest number of fit backgrounds in which any extant state was found was approximately 300 (Fig 3C). We use the 0. 4 threshold because it corresponds to ~1% false discovery rate (see Methods). We exclude the possibility that some extant amino acid states disrupt intergenic interactions because the complete His3 coding sequences from extant species fully complemented a His3 deletion in S. cerevisiae (S4C Fig). Thus, the observed genotypes with low fitness can only be explained by epistatic interactions among extant amino acid states within the His3 gene in the same or different segments. Remarkably, 85% (330/389) of replacements between extant amino acid states had substantially different effects on fitness in different backgrounds (Fig 3D). By contrast, only 15% of amino acid replacements are truly neutral, in the sense that they do not exert strong influence on fitness in any genetic background. Three quarters of the universally neutral amino acid replacements were observed in the disordered region of the protein (44/59). Taken together, the His3 fitness landscape across the 11 segments with high accuracy was strongly influenced by epistasis on a macroevolutionary scale, i. e. the impact of an extant amino acid state on fitness often depends on the background in which it occurs [34–37]. An epistatic fitness landscape is rugged in the sense that evolving genotypes must avoid fitness valleys that emerge through deleterious combinations of amino acid states that may also be found in fit genotypes [19,20,37–38]. Characterizing the ruggedness and the mechanisms that determine the underlying epistasis becomes the primary challenge in understanding the fitness landscape of His3. The ruggedness of the fitness landscape can be characterized by different measures of complexity of the underlying epistatic interactions. In the simplest case, epistasis may be unidimensional, in the sense that the fitness landscape can be described as a function of an intermediate variable, the fitness potential [40–42]. The fitness landscape is a function from the space of genotypes to fitness. In analogy with a scalar field, we can characterize the ruggedness of this function with standard measures of complexity if genotypes are arranged in a linear space. The simplest case is that of a linear predictor called the fitness potential: p = c1x1 + c2x2 + … + cnxn, where ci is a coefficient and xi is a binary variable that signifies the presence (1) or absence (0) of a given amino acid at a given position. By definition, ep describes a non-epistatic fitness landscape because the effect of every amino acid replacement is multiplicative, and it depends only on the associated c. Any other function of p leads to epistasis. If the f (p) function is “simple”, meaning that it has a small number of local extrema, such as a bimodal function, the epistasis is called unidimensional [42]. The limitation of simplicity of f (p) is necessary because any function f0 (x1, …, xn) can be represented by a function f’ (p) and choosing appropriate coefficients c1, …, cn in p. Thus, a simple f (p) leads to unidimensional epistasis because the entire genotype space can be reduced to a single dimension [42]. To quantitatively determine how well fitness differences between genotypes can be explained by unidimensional epistasis we used a deep learning approach to estimate the coefficients c for each allele x in the fitness potential and determine the unidimensional function f (p) that best approximated the fitness landscape. We used a dense neural network architecture composed of three layers. Each neuron in the architecture performed a linear transformation of its input and then applied a nonlinear (sigmoid) function. The single neuron of the first layer computes the fitness potential, which is then mapped to a fitness value obtained from f (p), the function of the fitness potential which is found by the three layers of the neural network architecture (see Methods; Fig 4). For ten protein segments, f (p) converged to the same shape: a threshold function in which organismal fitness remains constant with decreasing fitness potential and then is rapidly reduced to lethal after a certain threshold (Fig 5A). This analysis, coupled with previous observations of thresholds in fitness landscapes [7,10,43] suggests that macroevolutionary fitness landscapes may in fact represent instances of truncation selection. Remarkably, no fitness functions showed a defined optimum, implying a lack of stabilizing selection on His3 protein function and that it was maintained at an optimized state throughout its evolution. The ability of the cliff-like threshold fitness function [44] to predict fitness from genotype varied between the His3 segments from near perfect (r2 = 0. 97) in segment 7, to relatively poor (r2 = 0. 44) in segment 5 (S5 Fig). Thus, while the fitness landscape of His3 is approximately unidimensional for some segments, it has a higher degree of complexity for others. Ruggedness is a general property of fitness landscapes that quantifies the accessible paths of high fitness that connect fit genotypes [45–47]. A path between highly fit genotypes is inaccessible when one of the intermediate genotypes has low fitness [6,21–23,45,48] (e. g., for genotypes AB and ab, the intermediate are aB and Ab). Such instances also manifest in sign epistasis on the fitness landscape, that the same amino acid replacement may be beneficial or deleterious when occurring in a different genetic background [48,49]. To quantify the ruggedness of the His3 fitness landscape we identified instances of sign epistasis: replacements between extant amino acid states that were strongly beneficial in some backgrounds (increasing fitness by at least 0. 4 in absolute fitness) or strongly deleterious (decreasing fitness by at least 0. 4 in absolute fitness) in other backgrounds [48]. Some of these instances may be due to miscalled fitness of very few genotypes. Therefore, we considered a pair of extant amino acid states to be under sign epistasis only when sign epistasis was observed in a statistically significant number of different genetic backgrounds (see Methods section Quantifying sign epistasis). An example of sign epistasis is the C141S replacement in the second segment that had an opposite effect on fitness depending on amino acid at site 143 (I, V or T). The I143T replacement in turn exhibits sign epistasis depending on the amino acid at site 163 (F, I, V or L) (Fig 6A). These epistatic interactions can be represented by a graph in which nodes represent a pair of extant amino acid states at a specific site and nodes are connected by edges if strong sign epistasis has been detected between them (C141S - I143T - I163F) (Fig 5B). We found that 86 out of 128 (67%) sites in our library exhibit sign epistasis and 46% (59/128) exhibit reciprocal sign epistasis with 8% (968/11597) of all pairs of sites exhibiting sign epistasis (see S2 Supporting Information Table 5). Most sites showed a sign epistatic interaction with multiple other sites (Fig 6C, S6 Fig) demonstrating that, although sign epistasis affects few genotypes, it leads to a fitness landscape that requires the interaction of multiple sites for proper characterization. Sign epistasis can appear when fitness is described by a unidimensional function of the fitness potential, for example, when the fitness landscape is a unimodal function with an optimum in an intermediate range of the fitness potential [45,49]. However, sign epistasis may also be a sign of multidimensional epistasis, when a unidimensional function of the fitness potential cannot fully describe genotype fitness [42]. Many genotypes were predicted poorly by a unidimensional function of the fitness potential (S5A Fig). Two lines of evidence suggest that such genotypes reveal the presence of multidimensional epistasis. First, genotypes with a higher number of amino acid replacements influenced by sign epistasis were less well-predicted by a unidimensional fitness function (Fig 5C and S7B Fig). Second, we explain a larger fraction of genotypes by using a more complex neural network architecture accommodating multiple fitness potentials instead of one. We found that increasing the number of neurons in the first layer of the neural network architecture, which is equivalent to increasing the number of independent fitness potentials, gradually improves the prediction power of the obtained models for most of the segments (Fig 5D). Thus, adding dimensions to the function of fitness potential increases the prediction power of the model. For example, for a two-dimensional case fitness was described by f1 (p1, p2) with p1 = a1x1 + a2x2 + … + anxn and p2 = b1x1 + b2x2 + … + bnxn. For several His3 segments, a fitness function with multiple underlying fitness potentials described the fitness landscape more accurately than a simple unidimensional function of a single fitness potential (S7A Fig). For instance, for these segments, fitness function of two fitness potentials described the shape with a higher degree of accuracy than a function of a single fitness potential (Fig 5D and 5E). By contrast, epistasis in segment 7 is entirely unidimensional (Fig 5D and 5E and S3 Supporting Information); we do not see any improvement in the model’s predictive power when adding extra dimensions. On a smooth fitness landscape, evolution can proceed along any of the evolutionary paths connecting two fit genotypes, as none of the intermediate genotypes confer low fitness (see Box 2 in [50]). Alternatively, the fitness landscape is rugged when it contains non-connected fitness peaks, such that there are no viable paths between some pairs of genotypes that confer high fitness [4,5]. In other words, the presence of deleterious intermediate genotypes between highly fit ones leads to inaccessibility of some evolutionary trajectories between extant or ancestral sequences [6,21–23,48]. The simplest explanation for the substantial ruggedness of the landscape observed in many of the His3 segments lies in the unidimensional threshold fitness function (Fig 7A). On a threshold function, a combination of amino acid replacements that are all neutral in some genetic backgrounds can take a genotype beyond the fitness threshold through their additive effect on fitness potential, making some genotypes inaccessible for evolution (Fig 7A). Between any two fit genotypes, the fraction of intermediate genotypes that are unfit depends on the fitness potential of the two parental genotypes (Fig 7B). Evolution between two fit genotypes with high fitness potential can proceed unhindered because all intermediate genotypes also have high fitness potential and, consequently, high fitness. Conversely, when both fit genotypes are located close to the threshold, many of the intermediate genotypes between them have low fitness and many evolutionary paths between them are inaccessible (Fig 7C). Thus, the cliff-like threshold fitness function is the major determinant of the observation that not all paths between two fit genotypes are accessible to evolution (Fig 7B). We find that unfit intermediate genotypes are in genetic proximity with each other and are on a limited number of paths; the fraction of inaccessible paths is smaller than if the same number of unfit genotypes were distributed randomly in genotype space (Fig 7D and 7E). The effect of synergistic epistasis dominates the His3 fitness landscape (Fig 5A), affecting over 85% of amino acid replacements from our library that occurred in His3 evolution (Fig 3D). This synergistic epistasis may reflect the folding free energy of the protein [10,51,52], as evidenced by a weak to modest correlation between the fitness potential and the impact of amino acid replacements on the folding free energy of His3p (S8 Fig). Similarly, instances of sign epistasis may also be explained by changes in protein stability; for example, in the 143T background C141S increased fitness and also had a positive effect on stability (Fig 6B). Consistent with protein stability contributing to the observed sign epistasis we find that sites that exhibited reciprocal sign epistasis are close together in the His3p structure (S8 Fig). Only a relatively distant His3 structure to S. cerevisiae was used in this analysis, with about 30% divergence, likely reducing the accuracy of the free energy estimates. An additive contribution to free energy can lead only to a unidimensional fitness function [51], indicating that other non-additive mechanisms, such as catalytic activity or inter-subunit interactions, or non-additive contribution to protein stability must be responsible for the multidimensionality of the His3 fitness landscape. Epistasis may be caused by interaction among positions within a segment (intra-segmental epistasis) or by interaction of the segment with the rest of the S. cerevisiae His3 sequence (inter-segmental epistasis). In other words, a specific genotype of one segment may be associated with low fitness because of interaction of amino acid states on that segment with amino acid states at other segments. To some extent, the contribution of inter- versus intra-segmental interactions can be decoupled. Given two fit genotypes (e. g., ABC & abc in one His3 segment), any unfit intermediate states (e. g., aBc in the same His3 segment) must be due to intra-segmental epistasis because the rest of the protein remains constant. For each segment, we took as a measurement of intra-segmental epistasis all pairs of fit genotypes and calculated the proportion of unfit intermediate genotypes as a function of the Hamming distance between the two fit genotypes. We then compared this proportion with the total proportion of all unfit genotypes as a function of Hamming distance from S. cerevisiae, a measurement that includes both inter- and intra-segmental epistasis. We found three times more inter-segmental than intra-segmental epistasis (S9 Fig), likely because a single segment provides a much smaller target space for interactions than the entire His3 protein. On the other hand, inter-segmental epistasis was just three times more frequent, rather than ten times more frequent, possibly due to higher probability of interaction of amino acid residues that are proximal in primary structure [53]. The proportion of sites under epistatic interactions increased exponentially with Hamming distance (S9 Fig), analogous to Orr’s snowball, the accumulation of genetic incompatibilities in the course of speciation [34,54]. The concept of the fitness landscape introduced by Sewall Wright (Figs 1 and 2 in [6]) is an indispensable tool for understanding multiple biological phenomena [1–5]. Experimental high-throughput assays of random mutations have begun to unravel some local properties of fitness landscapes [4]. Here, we described a fitness landscape on a macroevolutionary scale by focusing on amino acid states that have been put through the sieve of natural selection. We found that only 15% of amino acid states that were fixed in the evolution of His3 are universally neutral. For the remaining 85%, amino acid replacements had a profound influence on each other’s effect on fitness, providing an experimental confirmation that epistasis is one of the defining features of molecular evolution [36]. Substitutions that occur in evolution have properties vastly different from those of random mutations, which are mostly deleterious [26]. Therefore, the way in which combinations of extant amino acid states affect fitness may also be different from that of combinations of random mutations. Unexpectedly, we found that the interaction of extant amino acid states was dominated by synergistic epistasis in a manner similar to that previously found for random mutations [7–10,16]. However, the accumulation of random mutations leads to low fitness much faster than the accumulation of extant amino acid states (compare Fig 2 from [16] and Fig 3B from [10] to Fig 2A). The experimental data showing that 85% of amino acid states found in extant species confer low fitness in a different genetic background lends strong support to the notion that epistasis is a key factor in protein evolution [34,36]. We showed that the fitness landscape of several segments of the His3 gene cannot be reduced to a single unidimensional forms of epistasis, with a function of multiple fitness potentials providing a more accurate description of the fitness landscape. By contrast, large-scale fitness landscapes incorporating multiple random mutations away from the wildtype sequence in a constant test environment have not displayed evidence of multidimensional epistasis [8–10,16]; however, it appears to be a more prevalent factor among amino acid replacements that have been subject to positive selection [12–16,19–23,37–39]. We also found that up to 67% of sites with an extant amino acid state were influenced by sign epistasis, resulting in a rugged fitness landscape and a limited number of fitness ridges connecting extant sequences for most His3 segments. However, sign epistasis substantially influenced fitness in only a small number of genotypes (Fig 5D). Overall, the evolutionary-relevant section of the His3 fitness landscape is best described as a fitness ridge, with the crest of the ridge defined by a fitness potential. In some cases, the crest is multidimensional requiring several independent underlying fitness potentials. Evolution can proceed unhindered along the crest (Fig 7A and 7C), however, pathway availability declines rapidly when evolution proceeds close to the edge of the fitness ridge. The raw and processed data have been submitted to the NCBI Gene Expression Omnibus (GEO; http: //www. ncbi. nlm. nih. gov/geo/) under accession number GSE99990. A virtual machine containing a running version of the data processing pipeline is available as a Docker image https: //hub. docker. com/r/gui11aume/epi/. The scripts to reproduce the figures are on Github at https: //github. com/Lcarey/HIS3InterspeciesEpistasis. The His3 gene was selected for three principal reasons, it is short, conditionally essential and has not been known to be involved in protein-protein interactions. Studying 20220 variants of His3 is impossible, thus, we have chosen an approach to survey the fitness landscape in a manner that would elucidate the area most relevant to His3 evolution while managing the technical limitations of our experimental design. We considered amino acid states found in extant species, focusing on yeast species, which translated into a full combinatorial set of ~1083 unique genotypes. Technically, it is feasible to measure fitness on the order of 100,000 unique genotypes in a single growth experiment. Therefore, we split the His3 gene into 12 independent segments such that the full combinatorial set of extant amino acid states from 21 yeast species in each segment was 10,000 – 100,000 genotypes. We then considered the combinatorial library for each segment in an independent growth experiment, which allowed us to study a tractable section of the sequence space while considering trajectories across a vast part of the space connecting extant species (Fig 1A). We constructed these combinations in 12 plasmid libraries and transformed them into a haploid His3 knockout S. cerevisiae strain. Growth rate (fitness) of yeast carrying different mutations in His3 was measured using serial batch culture in the absence of histidine. We split the His3 gene sequence into segments in a manner agnostic to the structure of the His3 protein (S1A Fig). For technical reasons, a segment consisted of two variable regions with a constant region between them (S1B and S2A Fig). All growth experiments were performed independently for each segment, with the exception of one experiment on a limited group of genotypes from each segment which was done for the normalization of fitness values across different segments (S4 Fig). As a control, we measured the rate of growth of S. cerevisiae whose entire His3 gene sequence came from another distant species. We found that the replacement of an entire gene sequence of His3 leads to wild-type rates of growth of S. cerevisiae even when the His3 sequence comes from very distant yeasts, as far as S. pombe (S4 Fig). Therefore, His3 appears to be an independent unit of the fitness landscape and is a good model for the study of fitness landscapes of an isolated gene. We isolated 197 strains from all segment libraries of extant amino acid combinations (9-26 strains per segment) and used Sanger sequencing to determine the sequence. For each strain we performed 6 repeats of growth assay and calculated the average growth rate. Fitness values from competition and growth rates are highly correlated (r = 0. 82, p = 10-48). Correlation was significant and greater than 0. 6 for all segments except segment 9, where all selected genotypes appeared to be neutral (S4 Fig). The individual sequences of the variants were recovered from pair-end reads with the following steps: the constant region between the two variable regions was identified by inexact matching allowing up to 20% errors using the Seeq library version 1. 1. 2 (https: //github. com/ezorita/seeq). The reads are not oriented because the Illumina sequencing adapters were added by ligation, so the constant regions were searched on both reads. Forward and reverse reads were swapped when a match was found on the reverse read. This ensured that all of the sequences are in the same orientation. For multiplexing purposes, the sample identity was encoded in the left and right primers used to PCR-amplify the variants. To demultiplex the reads, we used inexact matching with the candidate primers, allowing up to 20% errors. To merge the reads, the sequence of the reverse reads was reverse complemented and the constant region was searched by inexact matching allowing up to 20% errors. The position of the constant part in each read indicated how they must be stitched together. This approach was faster and less error-prone than using FLASH [56]. In the region of overlap, the consensus sequence was determined by picking the nucleotide with highest quality as indicated in the quality line of the fastq files. If' N' persisted in the final sequence, the reads were discarded. The PCR primers were trimmed so that all the sequences of the same competition would start and end at the same location. Reads that did not have the constant region, that could not be oriented or that could not be demultiplexed were discarded. The remaining errors in the reads were corrected by sequence clustering. We used Starcode version 1. 0 [57] with default parameters and allowing up to two errors. The corrected reads were translated using the genetic code. Variants encoding the same proteins were not merged; they were kept separate for downstream analyses. A running Docker virtual machine with commented scripts to replay the whole the process is available for download at https: //hub. docker. com/r/gui11aume/epi/. The total number of reads for 12 segments, 3 time points and 4 replicas are shown in S2 Supporting Information. Genotypes frequencies are defined as the number of reads for a given genotype divided by the total number of reads in that replicate. Mean frequency was calculated over 4 replicas to be used in further analysis. However, to eliminate influence of outliers the median was taken instead of mean if absolute difference between mean and median was greater than the median value. Only genotypes present in both technical replicas of both biological replicas with at least ten reads (summed across all time points) in each of them were kept. The length of the segment was designed so that each variable region was read twice by pair-end reads (S2A Fig). This strategy led to a substantial reduction in the sequencing error rate because mismatches between the two reads were corrected to the nucleotide with the higher quality call. The raw Illumina sequencing error rate was estimated by measuring the frequency of mismatches between forward and reverse reads. The rationale of this estimate is that each mismatched nucleotide must be a sequencing error for at least one of the reads. The variant calling error rate was estimated by collecting groups of reads that differ by only one nucleotide in the constant region (S2A Fig). Since the variable regions are identical, such reads come from the same variant and the different nucleotide in the constant region must originate from a calling error (mutations in S. cerevisiae are negligible because they occur at a much lower rate). The frequency of such reads was used to approximate the per-nucleotide variant calling error rate. The raw Illumina error rate was computed by custom Python scripts and reads differing by one nucleotide were collected using the “sphere” clustering option of Starcode with a maximum distance of 1 (see the Data access section for the code repositories). The results are summarized in S2 Supporting Information. The design strategy and the low error rate allow us to distinguish variants incorporated in the library from random sequencing errors. Each library contained on the order of 105 individual sequence variants, so that each library variant would be found at a frequency several orders of magnitude higher than variants created by sequencing errors. For example, for segment 7, the number of nucleotide variants was 176,879 with 31,815,448 possible single mutants of these variants. The error rate in segment 7 was 0. 04% per nucleotide, which translates into 2. 4% of reads being miscalled. Thus, the expected frequency of a particular miscalled variant is 0. 024 / 31,815,448 ≈ 8x10-10, considerably smaller than the expected frequency of real variants 0. 976 / 176,879 ≈ 6x10-6. The estimated frequencies of library variants for all segments of His3 are reported in S2 Supporting Information. The final variant calling error rate was smaller than the numbers shown in S2 Supporting Information because errors were further corrected by sequence clustering using Starcode (see Initial data filtering section). In line with the rationale above, low frequency erroneous reads are converted to the closest high frequency variant at a maximum Levenshtein distance of 2. It is known that PCR can create new genotypes by template switching [58]. To test the magnitude of this effect, we took advantage of the two-block design of the variants and estimated the frequency of recombination between the left and the right variable regions. The structure of reads can be represented like this: AAAAAA-------BBBBBB. In this example, “A” represents the left part of the variable region of the segment, “-“ represents the invariable region and “B” represents the right part of the variable region. Insertions of two or more nucleotides are rare events caused by errors during the library synthesis; so, if the same insertion in a left half of the variant is associated to several variants on the right half, it is likely an occurrence of template switching (the same holds for insertions in the right half of the variant). For example, if the region with A*AAA*AA-------BBBBBB, where “*” represents a deletion, is found with several different variants of the B segment then such a situation likely represents template switching. Focusing on the initial time point to avert the effect of selection, we counted a total of 11,454 variants with two or more insertions on either the left side or the right side. Among those, 76 had the same insertion as another variant. This means that > 98. 6% of the variants were free of template switching. Extrapolating to the rest of the dataset, this means that the “leakage” of reads between variants is substantially lower than the magnitude of the observed epistasis and we can rule out this artefact as a potential explanation for our results. In either case, all errors in our experimental pipeline, including template switching, are taken into account when we calculate the false discovery rate. The major factors causing noise in genotype frequency measurements are sampling errors, PCR amplification errors and genetic drift during the competition. For all of these factors, the amount of error depends on the genotype frequency. Therefore, we estimated measurement errors as the function of genotype frequency. For a given segment, time point and a pair of biological or technical replicas for each genotype we calculated the mean frequency and the squared difference of frequencies from these two replicas. We sorted genotypes by mean frequency and grouped them such that each bin contains 5000 genotypes. We calculated the average frequency and the average squared difference in each bin. Additionally, squared error for frequency 0 was set equal to 12∙ ( (0. 5Ni) 2+ (0. 5Nj) 2), where Ni and Nj are total read numbers in replicas i and j. Finally, by linear interpolation we obtained dependencies of squared differences as a function of frequency, sij2 (f), where i and j are different replicas. Using squared differences from pairwise comparison of replicas we can estimate variance of mean frequency over four replicas. Let numerate replicas 1,2, 3,4 where 1,2 are technical replicas of the first biological repeat and 3,4 are the technical replicas of the second biological repeat. Errors coming from the competition (e. g. : genetic drift) are shared for replicas 1,2 and for replicas 3,4. Let’s call them Δfb1 and Δfb2 and their variances σb12 and σb22, respectively. Technical errors of sampling from the population and from PCR are unique for each replica. Let’s call them Δfti, i=1.. 4 and their variances σti2, i=1.. 4, respectively. All variances are function of frequency and when writing σXi2 we assume σXi2 (f). In the introduced notations the mean frequency over 4 replicas is: f=14∙ (f1+f2+f3+f4) =14∙ ( (f*+Δfb1+Δft1) + (f*+Δfb1+Δft2) + (f*+Δfb2+Δft3) + (f*+Δfb2+Δft4) ) =f*+12∙ (Δfb1+Δfb2) +14∙ (Δft1+Δft2+Δft3+Δft4), where f* is the true frequency. Applying basic properties of variance, the variance of mean frequency: σ2=14∙ (σb12+σb22) +116∙ (σt12+σt22+σt32+σt42) To estimate σb12, σb22, σt12, σt22, σt32, σt42 we used squared differences from pairwise comparison of replicas calculated above s122, s132, s142, s232, s242, s342: E[s122]=E[ (Δft1−Δft2) 2]=σt12+σt22 E[s132]=E[ (Δfb1+Δft1−Δfb2−Δft3) 2]=σb12+σt12+σb22+σt32 E[s142]=E[ (Δfb1+Δft1−Δfb2−Δft4) 2]=σb12+σt12+σb22+σt42 E[s232]=E[ (Δfb1+Δft2−Δfb2−Δft3) 2]=σb12+σt22+σb22+σt32 E[s242]=E[ (Δfb1+Δft2−Δfb2−Δft4) 2]=σb12+σt22+σb22+σt42 E[s342]=E[ (Δft3−Δft4) 2]=σt32+σt42 Therefore, the variance of mean frequency f can be found as: σ2=116∙ ( (s132+s142+s232+s242) − (s122+s342) ) Recalling that variance and squared differences are a function of frequency: σ2 (f) =116∙ ( (s132 (f) +s142 (f) +s232 (f) +s242 (f) ) − (s122 (f) +s342 (f) ) ) For each segment and time point we calculated the numerical function σ2 (f). Then for each genotype having mean frequency fx we estimated its variance as σ2 (fx) We merged nucleotide genotypes that corresponded to the same amino acid sequence and summed their frequencies and variances. We filtered out all genotypes x that had any of following patterns: fxt0=0, fxt1=0, fxt2>0 or fxt0=0, fxt1>0, fxt2=0 or fxt0>0, fxt1=0, fxt2>0. Fraction of such genotypes were <0. 5% for all segments except S9, for which it was 4. 5% For further analysis, this amino acid dataset was used except when specified. Number of cells in a pool with particular genotype x after time interval t increases exponentially nxt=nx0∙Exp[sx∙t], where sx is absolute fitness. Frequency of genotype x as well depends exponentially on absolute fitness with an additional multiplicative factor: fxt=nxtNt=nx0∙Exp[sx∙t]Nt=fx0∙Exp[sx∙t]Nt/N0, where Nt and N0 are total cell numbers in a pool at time points 0 and t. Factor 1Nt/N0 reflects the total growth of population, it changes with time but is the same for all genotypes. Therefore, we can rewrite genotype frequency at time t as: fxt=fx0∙Exp[ (sx−s0t¯) ∙t], where s0t¯=1t∙Log (NtN0) In the measured dataset for each genotype x we have 3 measurements of frequency fxt0, fxt1, fxt2 and their errors σ2 (fxt0), σ2 (fxt1), σ2 (fxt2). To estimate genotype fitness, we minimized relative squared errors of exponential fit as function of fitness sx and initial frequency fx0: (sx, fx0) =argminsx, fx0 ( (fxt0−fx0) 2σ2 (fxt0) + (fxt1−fx0∙Exp[ (sx−s01¯) ∙t1]) 2σ2 (fx1) + (fxt2−fx0∙Exp[ (sx−s02¯) ∙t2]) 2σ2 (fx2) ) (1) This formula contains four parameters common for all genotypes from one segment: s01¯, s02¯, t1, t2. Further we will perform additional shifting and scaling of fitness values (see next section), therefore, without loss of generality we could set s01¯=0 and t1 = 1. Ideally, t2/t1 should equal 14; however, we noticed that this ratio does not hold for many segments and fitted k = t2/t1 from data instead of using value 14. To find specific s02¯ and k for each segment we selected genotypes with high frequencies at t0 (t0>25∙10−6) that corresponds to ~500-1000 reads per technical replicate. Each segment contains 103-104 genotypes that meet this criterion. We minimized eq. (1) for selected genotypes trying all possible combinations of (s02¯, k) from a grid where s02¯ϵ[0,1. 2] with step 0. 01 and kϵ[1,14] with step 0. 1 and choose (s02¯, k) which gives minimal (*). Finally, given (s02¯, k) for each segment we found sx for each genotype. Errors for fitness values, sxstd, were estimated as standard error of best-fit parameter. For genotypes with frequencies pattern fxt0>0, fxt1=0, fxt2=0 fit of Eq (1) cannot be obtained. Therefore, we defined upper boundary for their fitness value as sxboundary=Log (1max (N1t1, N2t1, N3t1, N4t1) ), where Nit1, i=1.. 4 are total read numbers at time point t1 in i-th replica. We scaled fitness such that lethal genotypes have fitness 0 and neutral genotypes have fitness 1. We assumed that genotypes with a stop codon or frame shift are lethal. Thus, for each segment we linearly rescaled the fitness distribution so that 95% of genotypes with nonsense mutations have a fitness of 0 and so that the local maximum of the fitness distribution of genotypes with extant amino acids is 1. The scaling around the local maximum led to the shift of fitness values of less than +/- 0. 025 in each of the 12 segments compared to the measured wildtype strains and did not affect our results (for scale, we called an amino acid change non-neutral if its effect on fitness was > 0. 4). All fitness values that became smaller than 0 were set to 0. We used nucleotide synonymous sequences as an internal control. The error rate for a measurement of fitness of an amino acid sequence depends on the number of synonymous sequences, n, that were used to estimate it. Therefore, we estimated the false discovery rates separately for categories with n = 1,.. 10 variants. For each amino acid genotype with more than n synonymous variants we merged random combination of n of its nucleotide genotypes and estimated fitness. We then calculated the difference between this fitness and the fitness of the corresponding amino acid sequence. We classified case as “false unfit” if difference was <-0. 4 and as “false fit” if difference was >0. 4. The fraction of such cases gives us false discovery rates for genotypes having n synonymous variants. To get total false discovery rates for each segment we averaged “false unfit” and “false fit” rates for different n with weights equal to the fractions of genotypes in amino acid dataset which have n synonymous variant (S2 Supporting Information). The high correlation between biological replicas (S2 Supporting Information) confirms high accuracy of our high-throughput experiments, with the exception of segment 9. For each amino acid replacement, we calculated its fitness effect in different backgrounds. We estimated the fraction of backgrounds in which a replacement exhibits deleterious, beneficial and neutral effects. To get the fraction of backgrounds with neutral effects we utilized the approach of mixture distribution analysis from Sarkisyan et al. [10]. We assume that neutral replacements have the same distribution as the fitness effects of synonymous replacements and are caused by measurement noise. We then calculated the fraction of backgrounds in which mutations have a neutral effect as the overlap between the distribution of synonymous mutations and distribution of fitness effects across different backgrounds. In remaining backgrounds, the amino acid replacement was called to have a non-neutral effect. Among them we counted those with strong fitness effects, including deleterious mutations when the fitness effect was < -0. 4 and beneficial when the fitness effect was > 0. 4. We concluded that a particular amino acid replacement exhibits a strong deleterious or beneficial effect in some background if the fraction of such backgrounds exceeded the false discovery rate. To predict the unidimensional fitness function based on additive contribution of extant amino acid states we used deep learning, a machine learning technique capable of constructing virtually any function, even with a simple neural network architecture [59] (Fig 4B). To convert amino acid sequences into a binary feature matrix we used one-hot encoding strategy, in which each feature (column in the matrix) indicates the presence or absence of a particular amino acid state. For neural network implementation the TensorFlow library was used (www. tensorflow. org/about/bib). To optimise the accuracy/overfitting ratio, we tested different combinations of neural network architectures and parameters. As a starting point, we selected a number of complex architectures, which describe our data but are prone to overfitting due to their large number of parameters. We then gradually reduced the number of layers and neurons to reduce the overfitting, while empirically controlling for accuracy. Our final architecture consists of three layers and 22 neurons in total (Fig 4). Each neuron performs a linear transformation of the input and subsequently applies a non-linear sigmoid activation function to the result. The output of the first layer is a single sigmoid of a linear transformation of the feature vector, i. e. σ (c1Tx+b1) where x is the feature vector, c1 is the vector of coefficients, b1 is the bias and σ (t) = (1+e−t) −1. Looking forward, observe that c1Tx is a fitness potential of the genotype x (see main text). The second layer decompresses the hidden nonlinear representation into 20 sigmoids, the combination of which is further linearly transformed with the only neuron of the third layer and wrapped into another sigmoid function: F (x) =σ (∑i=120c3, i∙ (c2, i∙σ (c1Tx+b1) +b2, i) +b3) In the formula above, c2, i is the coefficient of the i-th neuron in the n-th layer, and b2, i is the bias of the i-th neuron in the second layer (the biases of the only neurons of the first and third layers are b1 and b3, correspondingly). The key idea of our approach is that the number of neurons in the first layer of the neural network determines the number of linear combinations of mutations (or fitness potentials) used in order to predict the fitness of the variant. In other words, each neuron in the first layer assigns a single unique weight to every amino acid state in the dataset (Fig 4). Thus, the number of neurons in the first layer of the architecture is the dimensionality of epistasis in the model (i. e. one in this case). The fitness potentials are then transformed by a nonlinear phase shift function constructed by the 22 neurons of the neural network. The simplicity of the architecture minimizes overfitting, which was further prevented by keeping 10% of the data as a test set (in order to see how well the model performs on a fraction of the data it has never seen) and early stopping (training was stopped if the test accuracy did not improve for 10 epochs). The loss function that is being optimised is not convex, which leads to a high probability of getting stuck in different local minima. To ensure reproducibility, each of our models was constructed ten independent times using random train-test splits. The accuracies of the 10 constructed models varied by at most 2%. Each model was trained for under 100 epochs using mean squared error as the loss function. An adaptive learning rate method proposed by Geoffrey Hinton, RMSProp, was used as the optimiser [60]. This algorithm is a version of a mini-batch stochastic gradient descent, utilising the gradient magnitude of the recent gradients in order to normalise the current ones. All the weights were initialised using Xavier normal initialiser [61]. For analysis in Fig 7D, we first choose two fit “parental” genotypes, one randomly chosen genotype (eg: ABE) and the other parental genotype that is either S. cerevisiae wildtype genotype (inter-segmental) or another random fit genotype in the data (intra-segmental) (eg: abe). The two genotypes in this example are Hamming Distance 3 apart (HD = 3). We next compute all (2HD-2) intermediate genotypes (eg: AbC, aBc, et cetera) and retain the subset that were experimentally measured. We represent the two parental genotypes and all measured intermediate genotypes as an undirected graph in which each genotype is a vertex. All genotypes one amino acid replacement apart are connected by an unweighted edge. The shortest possible path for a given pair of genotypes is of length HD. We find all shortest paths between the two parental genotypes using a breadth-first search. We next remove all vertices (genotypes) that are unfit, and recompute the number of shortest between the two parental genotypes. For example, in Fig 7A, there are six paths of length three if you take into account all genotypes, but only three paths of length three if you take into account only fit genotypes. For the analysis in Fig 7E, we first represent the two parental genotypes and all measured intermediate genotypes as an undirected graph in which each genotype is a vertex. All genotypes one amino acid replacement apart are connected by an unweighted edge. We can then compute the degree (number of genotypes of distance one) for each vertex (genotype). We do so randomly drawing from all measured genotypes and using only unfit genotypes or using the same number but randomly chosen genotypes. For the randomly chosen genotypes, the value is the average over 1000 runs. For each amino acid replacement (eg: C -> S at position 141), we considered only those that exhibit a large fitness effect (abs. difference > 0. 4) comprising a set of amino acid replacements with large effects. For each amino acid replacement, we divided the genetic backgrounds into two categories: those in which the replacement caused a > 0. 4 increase in fitness, and those backgrounds in which the replacement caused > 0. 4 decrease in fitness. A single amino acid replacement can cause a large increase in fitness in some backgrounds and a large decrease in others due to two possible reasons: sign epistasis or experimental error. To differentiate the two cases, we identified secondary amino acid replacements that significantly alter the ratio of large increases to large decreases in fitness (Fisher’s exact test, Bonferroni corrected p-value < 0. 05). We only consider a site to be under sign epistasis if there is a second site that alters the frequency of sign epistasis in a statistically significant manner, i. e. more frequently than expected by chance alone. We reconstructed ancestral amino acid states using maximum likelihood approach implemented in CODEML program of PAML 4 [62].

Title: An experimental assay of the interactions of amino acids from orthologous sequences shaping a complex fitness landscape Summary: An intuitive understanding of protein evolution dictates that, with the exception of adaptive substitutions, amino acid states should be freely exchangeable between the same gene from different species. However, the extent to which this assertion holds true has not been tested in a controlled experiment. Here, we show that whether an amino acid state can be exchanged between orthologues depends on other amino acid states in the same protein. Furthermore, we show that the mode of interaction of amino acid states is multidimensional. Assuming that amino acid replacements influence the protein in several independent ways substantially improves our ability to predict the effect of an amino acid state in a protein sequence that has not been observed in nature.

lay_plos

en

Summarize: Russian punk protesters Pussy Riot have made a surprising foray into U.S. politics with a new music video dedicated to the memory of Eric Garner, the African-American man whose death at the hands of NYPD officers sparked protests across the country last December. Related Hear Emotional Eric Garner Tribute Song His Family Recorded "It's sad how my brother Eric Garner was killed/The pain in my heart still refuses to heal," Garner's daughter and another relative say in "This Ends Today" "I Can’t Breathe" shows Pussy Riot members Nadya Tolokonnikova and Masha Alyokhina lying in a freshly dug grave wearing Russian police uniforms as they are slowly buried alive. The song, their first sung in English, was recorded in New York during the protests following a grand jury’s decision not to indict any officer over Garner’s death. The activists, who spent two years in grueling Russian prisons for a performance attacking Vladimir Putin, managed to bring legendary punk pioneer Richard Hell temporarily out of retirement. Yeah Yeah Yeahs guitarist Nick Zinner and Andrew Wyatt of Swedish electro outfit Miike Snow also contribute to the track, while the group enlisted singers from Russian bands Jack Wood and Scofferlane for additional vocals. Hell repeats Garner’s "I can't breathe" statement that became the slogan of the protests condemning police violence against African-American men. The participation of Hell, who hasn’t performed musically since the 1990s, was impromptu, Pussy Riot member Masha Alyokhina tells Rolling Stone. The group arrived at Hell’s apartment a couple of hours before they were due in the studio without ever having met him. "We just went to his house," says Alyokhina. "We invited him to go with us and he abruptly stood up and sat with us in the taxi. There’s not many people who you could say, 'Come with us, we're writing a new political song,' and fewer who would respond, 'Yes, of course.' But he and we did that — that’s how punks can recognize each other." In a statement released with the single-take video, the two Pussy Riot members explained how they’d been inspired to use Garner’s words as an international expression for all those who suffer state violence. Related Exclusive Q&A: Pussy Riot's Maria Alyokhina Russian activist/musician speaks out after being released from prison after nearly two years "Pussy Riot’s first English song is dedicated to those who can no longer breathe," said the band. " Those words are his, but we hope they can also stand for us and for many around the world, for all who can’t breathe because authorities act with impunity in using power to humiliate, intimidate, hurt, kill and oppress." The group said the video was an attack on the war in Ukraine, where Russia has been arming separatist rebels in a bid to split the country. By fostering the conflict which has prompted harsh Western sanctions, the band wrote, "Russia is burying itself alive in terms of the rest of the world. Committing suicide. Daily." With mordent, soulful vocals over slow beats, the song is a departure from Pussy Riot’s usually raucous, homemade punk. "The genre of this isn’t like other Pussy Riot songs. It’s an industrial ballad. Dark and urban," the band wrote. "The rhythm and beat of the song is the beat of a heart before it's about to stop. The absence of our usual aggressive punk vocals in this song is a reaction to this tragedy." Garner died after police officers put him in a chokehold as they arrested him. A video of the incident showed the 43-year-old surrounded by officers and violently pushed to the ground; one of the officers then sits on Garner as he repeats that he is suffocating. The failure to indict the officer, coming in the wake of the Ferguson shooting of teenager Michael Brown, prompted an outpouring of anger over racial injustice in American society. Other musicans have also condemned the lack of police accountability, including Nicki Minaj in a Rolling Stone cover story interview. "It's gotten to the point where people feel like there's no accountability: If you are law enforcement and you do something to a black person, you can get away with it," Minaj said. Paul McCartney recently said he had struggled fruitlessly to write a song about the protests. Published on Feb 18, 2015 Pussy Riot's first song in English is dedicated to Eric Garner and the words he repeated eleven times before his death. This song is for Eric and for all those from Russia to America and around the globe who suffer from state terror - killed, choked, perished because of war and state sponsored violence of all kinds - for political prisoners and those on the streets fighting for change. We stand in solidarity. Pussy Riot's Masha and Nadya are being buried alive in the Russian riot police uniforms that are worn during the violent clashes of police and the protesters fighting for change in Russia. A pack of "Russian Spring" brand cigarettes is on the ground at the beginning. "Russian Spring" is a term used by those who are in love with Russia's aggressive militant actions in Ukraine, and the cigarettes are a real thing. "I Can't Breathe" was recorded in New York in December 2014 during the protests against police brutality together with Pussy Riot, Richard Hell, Nick Zinner, Andrew Wyatt, Shahzad Ismaily (The Ceramic Dog) and Russian bands Jack Wood and Scofferlane. MUSIC VIDEO: Concept, directed and produced: Tasya Krugovyh Video directors - Gogol Wives Director of Photography and editor: Mikhail Vikhrov. MUSIC: Concept, produced: Pussy Riot Vocals: Sasha Klokova (Jack Wood), Matt Kulakov (Scofferlane), Richard Hell Lyrics: Matt Kulakov (Scofferlane) Monologe of Eric Garner: Richard Hell Bit: Andrew Wyatt Piano, Bass: Nick Zinner Drums: Shahzad Ismaily Engineered and mixed by Philip Weinrobe at Figure Eight Studios in Brooklyn, NY LYRICS: He's become his death The spark of the riots That's the way he's blessed To stay alive. It never leads to an end It's never getting quiet If it's unfair, my friend, Make up your mind It's getting dark in New York city It's getting dark in New York city It's getting tight in New York city I need to catch my breath You know this world of hate You know this stubborn light They're in the prayers you pray Late at night We're only half way down Who dares to take a breath? Some fairness might be found From ashes of his death. Eric Garner's last words (read by Richard Hell): Get away [garbled] for what? Every time you see me, you want to mess with me. I'm tired of it. It stops today. Why would you...? Everyone standing here will tell you I didn't do nothing. I did not sell nothing. Because everytime you see me, you want to harass me. You want to stop me [garbled] Selling cigarettes. I'm minding my business, officer, I'm minding my business. Please just leave me alone. I told you the last time, please just leave me alone. please please, don't touch me. Do not touch me. [garbled] I can't breathe. I can't breathe. I can't breathe. I can't breathe. I can't breathe. I can't breathe. I can't breathe. I can't breathe. I can't breathe.

Summary: As one might expect from a couple of veterans of Vladimir Putin's fun camps, Pussy Riot isn't exactly going gently into the night. Rather, they're roaring ashore in America with their English-language debut, and "I Can't Breathe" doesn't stop to ask if it's too soon to talk about the death of Eric Garner. The group says on its YouTube page that the song "is dedicated to Eric Garner and the words he repeated eleven times before his death," and "for political prisoners and those on the streets fighting for change. We stand in solidarity." Musically haunting, the video shows band members Nadya Tolokonnikova and Masha Alyokhina lying in a grave as shovels of dirt are thrown on their faces. Tolokonnikova and Alyokhina dug up some punk royalty to help out, reports Rolling Stone, in the form of Yeah Yeah Yeahs guitarist Nick Zinner and Andrew Wyatt of Miike Snow. But perhaps most interesting is Richard Hell, who Rolling Stone notes hasn't performed since the '90s. Alyokhina recounts how they got him involved: "We just went to his house," she says. "We invited him to go with us and he abruptly stood up and sat with us in the taxi. There's not many people who you could say, 'Come with us, we're writing a new political song,' and fewer who would respond, 'Yes, of course.' But he and we did that-that's how punks can recognize each other."

multi_news

en

Summarize: Il lungo inverno della pandemia, che sembrava non avere mai fine, è passato: tra una restrizione e l’altra; tra zone rosse, arancioni e gialle; chiusi in casa ad attendere di poter tornare a una vita normale; ma è terminato. E così, ora che finalmente la bella stagione è arrivata davvero, sono iniziate le grandi manovre: tutti a sistemare balconi, terrazzi e giardini, perché di stare chiusi in casa non se ne può più; e al tempo stesso, tutti all’opera con le tradizionali pulizie di primavera e con le piccole manutenzioni domestiche, che non si possono comunque trascurare e che per molti sono comunque un hobby e una soddisfazione. Vuoi mettere quanto sia soddisfacente riparare da sé il tubo del lavandino che perde, invece di dover chiamare l’idraulico? O imbiancare da soli il garage, la cantina o la taverna senza ricorrere all’imbianchino? Per chi invece è alle prime armi, ecco qualche consiglio utile per sistemare al meglio gli spazi aperti, a partire dagli arredi per esterno. I mobili da giardino in plastica possono tornare al loro splendore utilizzando una soluzione composta da un litro d’acqua calda, un cucchiaino di detersivo per piatti e un cucchiaio di bicarbonato, mentre quelli in legno vanno puliti con una spugna inumidita in acqua e sapone neutro. Per gli arredi in ferro battuto, invece, dopo aver tolto la polvere, si può utilizzare una soluzione di acqua e ammoniaca; quindi, una volta asciutti, vanno lucidati con un pennello (o uno straccio) intinto nell’olio d’oliva e quindi ripassati con un panno asciutto. Per gli amanti del fai-da-te in casa, invece, anche se può sembrare controintuitivo, l’olio vegetale può essere utilizzato per pulirsi le mani sporche di vernice o di grasso. E ottimi risultati si ottengono anche con i fondi del caffè, che grazie al loro potere abrasivo diventano un’ottima pasta lavamani. Tra una mano di vernice e una rasatura del prato, tra una stuccata alla parete e la pulizia del tavolo da giardino, però, per evitare di far danni è sempre bene avere a portata di mano le attrezzature giuste per ogni lavoro. E per trovare tutto ciò che serve per il giardino e l’arredo da esterni (compresi i barbecue che in questo periodo tornano ad accendersi), per il fai-da-te e per home decor, arredo casa e bricolage, il posto giusto è da sempre il marketplace di eBay: migliaia di articoli per ogni esigenza e per ogni portafoglio sempre a portata di click. Serve un tosaerba? C’è. Manca una punta del trapano? Eccola. Voglia di una piscina in giardino? Presente. Serve una lampada per dare nuova luce alla sala? C’è anche quella. Pinza, pappagallo e scaletta? Ci sono anche loro.

Summary: Dopo un accenno di primavera e l'ultimo colpo di coda dell'inverno, la bella stagione è finalmente tornata. E, come da tradizione, anche case e giardini "rifioriscono": l'erba da tagliare e la siepe da potare, le piantine da travasare e i fiori da sistemare; e in casa e fuori ci sono sempre qualche piccolo lavoretto fai-da-te e qualche piccola riparazione. E se mancano un attrezzo o accessorio fondamentali, o se semplicemente quest'anno si vuole dare un tocco diverso alla propria casa, cambiando qualche dettaglio? La soluzione si trova online, sul marketplace di eBay.

fanpage

it

Summarize: Ed ecco che al "Grande Fratello 2015" un nuovo triangolo amoroso è servito, con tanto di inganni e sotterfugi come manco in una puntata di "Il Segreto". Si parla del nuovo arrivato nella casa, Francesco, e di Federica, tornata in forma dopo il piccolo malore che l'ha colpita alcuni giorni fa (in conseguenza a una crisi allergica). La Lepanto e il neo-inquilino si stanno avvicinando "pericolosamente", con tanto di abbracci, bagni sexy in piscina e massaggi. Sta nascendo un nuovo amore? Quello che Federica non sa, però, è che il vero nome di Francesco è Livio e che lui in realtà l'ex fidanzato di Barbara. Come ben sanno i fan, nell'ultimo serale gli autori del reality hanno dato inizio a un diabolico intrigo che sta mettendo in difficoltà tutti i concorrenti. Con l'ingresso di Livio/Francesco, che rimarrà nella Casa per una settimana, gli inquilini dovranno indovinare chi è veramente e la povera Barbara, rimasta letteralmente impietrita all'arrivo del suo ex, ha l'ordine tassativo di non rivelarne la vera identità. Mentre i ragazzi della casa si arrovellano per cercare di capire qual è il suo segreto (c'è chi pensa sia un nobile, chi una drag queen), si stanno mettendo in moto dinamiche decisamente curiose. Paradossalmente, è nata subito una sincera amicizia tra Livio e Manfredi, che proprio con Barbara ha avuto una relazione. Ora, il flirt con Federica che, malgrado lo abbia giudicato inizialmente come una persona arrogante, nei giorni scorsi ha cercato spesso la sua compagnia. Inizialmente, lo scopo della ragazza era ovviamente carpire il suo segreto. Poi, però, la cosa sembra esserle sfuggita di mano: tra i due è nata una notevole intimità, come confermano le immagini che li mostrano abbracciati sia nella casa che in piscina. Da alcune foto pubblicate sul sito ufficiale del GF, pare che ci sia stato anche un bacio, non andato in onda. E indovinate un po' con quale amica la Lepanto ha scelto di confidare i suoi sentimenti? Con Barbara, ovviamente. Come mostra un video pubblicato sul sito, nonostante l'evidente attrazione che prova nei suoi confronti, Federica confessa di sentirsi anche un po' spaventata: "Vorrei cercare di conoscerlo meglio, ma è strano, a volte mi fa paura". Con invidiabile nonchalance, la Donadio riesce a non tradirsi e a fingere non non conoscerlo.

Summary: L'ingresso di Livio/Francesco, ex fidanzato di Barbara di cui i concorrenti devono indovinare l'identità, sta mettendo in moto dinamiche pericolose per l'equilibrio della Casa. Tra lui e Federica sta nascendo qualcosa: i due flirtano da alcuni giorni e, come mostrano alcune foto del sito, potrebbe esserci stato un bacio non andato in onda. La Lepanto sta semplicemente cercando di carpire il suo segreto o si sta innamorando di lui?

fanpage

it

Summarize: Chastened Bloomberg fights to save reputation after string of snow-removal snafus Ward for News Mayor Bloomberg briefs the press about the city's response to the blizzard at OEM Headquarters in Brooklyn. A testy Mayor Bloomberg fended off criticism of the city's failure to clear hundreds of snow-choked streets Tuesday as an avalanche of critics attacked his reputation as a supermanager. "This mayor prides himself on saying the buck stops with him, and it should. We hold him responsible for what we're calling theBloomberg Blizzard," said CityCouncilman David Greenfield (D-Brooklyn). "The whole world is laughing that the greatest city in the world cannot manage to clear the streets. New York today looks like a Third World country." Greenfield, normally a backer of the mayor, said every side street - and some larger avenues - in Borough Park were waiting for a plow 30 hours after the storm's end. Similar and worse complaints were heard from much of the snow-buried city outside Manhattan. A Queens woman's death Monday was blamed on the backlog of911 calls and on snow-clogged streets that delayed first responders from reaching her Corona home, said state Sen. Jose Peralta (D-Queens). "Like many New Yorkers, I woke up two days straight to an unplowed street outside my frontdoor," said city Public Advocate Bill de Blasio. "This is not business as usual, and frustration is mounting." Bloomberg asked for patience. "This storm is not like any other we've had to deal with," he said. "We are doing everything we canthink of, working as hard as wecan." He traveled to hard-hit Brooklyn and acknowledged the anger of people whose streets hadn't been plowed. "I'm angry, too," he said. Bloomberg insisted city workers were doing their best. "We won't get to everybody every time," he said. "Yelling about it and complaining doesn't help." Still, the chorus of complaints about the city's sluggish response was just getting revved up. "This is unacceptable," said CityCouncil Speaker Christine Quinn (D-Manhattan), who set a Jan. 10 hearing on how the storm was handled. "The mayor has to stop acting like 'Baghdad Bob' saying the streets are fine. No they aren't. Where the hell are the plows?" Councilman Peter Vallone (D-Queens) wrote on Facebook. "Seniors are trapped at home with little or no food. Emergency vehicles aren't able to respond to emergencies," said Assemblyman Dov Hikind (D-Brooklyn). "This lack of response from the city cannot go unanswered." Mike for President? Ha! Bronx Borough President Ruben Diaz Jr. said city residents outside Manhattan scoffed at Bloomberg's vaunted management skills. "He wants to run for President? Can you imagine a national catastrophe or crisis if hecan't even plow the streets ofthe Bronx?" Diaz said. Have you ever watched a child play with toy trucks? Like, backhoes and front-end loaders and other heavy machinery made of plastic? They love to drive and smash them around, as if the light toys were actually causing serious damage, or at least doing some heavy lifting. Well, that's what it's like to watch these Sanitation Department workers attempting to pull a snowplow out of an embankment on Joralemon Street in Brooklyn Heights yesterday. Except the massive machines that are floundering about are very much real, and they are very much destroying a white Ford Explorer and the cars around it. If you watch the video with the sound turned off (which we kind of recommend at first because the guy who filmed it is firing off expletives left and right), it almost looks innocent and silly. But then when you listen to the crunching noises, you realize what kind of damage these things are actually doing. The kicker? The Ford that received the brunt of the damage was a city-owned vehicle. [via NYP]

Summary: Rough day for Mayor Bloomberg, who faced the media to plead for patience with storm cleanup. He was at various times "chastened" (Daily News), "testy" (New York Post), "conciliatory" (New York Times) and even sarcastic-as when he replied, "I regret everything in the world" after being pressed on the city's response amid mounting criticism. Scores of streets remain unplowed, and the mayor said he couldn't guarantee crews would get to them in the next 24 hours. "This storm is not like any other we've had to deal with," he said. "We are doing everything we possibly can." At another point, he interrupted a question to say, "I'm angry, too." The overall tone was a marked contrast to yesterday's news conference, notes the Times, the one in which he declared: "The world has not come to an end. The city is going fine." Click here to see street crews destroy a Ford Explorer, and not on purpose.

multi_news

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Independent Living Centers Technical Adjustment Act''. SEC. 2. INDEPENDENT LIVING CENTERS TECHNICAL ADJUSTMENT. (a) Grants to Centers for Independent Living in States in Which Federal Funding Exceeds State Funding.-- (1) In general.--If the conditions described in paragraph (2) are satisfied with respect to a State, in awarding funds to existing centers for independent living (described in section 722(c) of the Rehabilitation Act of 1973 (29 U.S.C. 796f-1(c))) in the State, the Commissioner of the Rehabilitation Services Administration-- (A) in fiscal year 2010-- (i) shall distribute among such centers funds appropriated for the centers for independent living program under part C of title VII of the Rehabilitation Act of 1973 (29 U.S.C. 796f et seq.) by any Act other than the American Recovery and Reinvestment Act of 2009 (Public Law 111-5) in the same proportion as such funds were distributed among such centers in the State in fiscal year 2009, notwithstanding section 722(e) of the Rehabilitation Act of 1973 (29 U.S.C. 796f-1(e)) and any contrary provision of a State plan submitted under section 704 of such Act (29 U.S.C. 796c); and (ii) shall disregard any funds provided to such centers from funds appropriated by the American Recovery and Reinvestment Act of 2009 for the centers for independent living program under part C of title VII of the Rehabilitation Act of 1973 (29 U.S.C. 796f et seq.); and (B) in fiscal year 2011 and subsequent fiscal years, shall disregard any funds provided to such centers from funds appropriated by the American Recovery and Reinvestment Act of 2009 (Public Law 111-5) for the centers for independent living program under part C of title VII of the Rehabilitation Act of 1973 (29 U.S.C. 796f et seq.). (2) Conditions.--The conditions described in this paragraph are the following: (A) The Commissioner receives a request from the State, not later than August 5, 2010, jointly signed by the State's designated State unit (referred to in section 704(c) of such Act (29 U.S.C. 796c(c))) and the State's Statewide Independent Living Council (established under section 705 of such Act (29 U.S.C. 796d)), for the Commissioner to disregard any funds provided to centers for independent living in the State from funds appropriated by the American Recovery and Reinvestment Act of 2009 for the centers for independent living program under part C of title VII of the Rehabilitation Act of 1973 (29 U.S.C. 796f et seq.). (B) The Commissioner is not conducting a competition to establish a new part C center for independent living with funds appropriated by the American Recovery and Reinvestment Act of 2009 in the State. (b) Grants to Centers for Independent Living in States in Which State Funding Equals or Exceeds Federal Funding.--In awarding funds to existing centers for independent living (described in section 723(c) of the Rehabilitation Act of 1973 (29 U.S.C. 796f-2(c))) in a State, the director of the designated State unit that has approval to make such awards-- (1) in fiscal year 2010-- (A) may distribute among such centers funds appropriated for the centers for independent living program under part C of title VII of the Rehabilitation Act of 1973 (29 U.S.C. 796f et seq.) by any Act other than the American Recovery and Reinvestment Act of 2009 in the same proportion as such funds were distributed among such centers in the State in fiscal year 2009, notwithstanding section 723(e) of the Rehabilitation Act of 1973 (29 U.S.C. 796f-2(e)) and any contrary provision of a State plan submitted under section 704 of such Act (29 U.S.C. 796c); and (B) may disregard any funds provided to such centers from funds appropriated by the American Recovery and Reinvestment Act of 2009 for the centers for independent living program under part C of title VII of the Rehabilitation Act of 1973 (29 U.S.C. 796f et seq.); and (2) in fiscal year 2011 and subsequent fiscal years, may disregard any funds provided to such centers from funds appropriated by the American Recovery and Reinvestment Act of 2009 for the centers for independent living program under part C of title VII of the Rehabilitation Act of 1973 (29 U.S.C. 796f et seq.). Speaker of the House of Representatives. Vice President of the United States and President of the Senate.

Title: To provide a technical adjustment with respect to funding for independent living centers under the Rehabilitation Act of 1973 in order to ensure stability for such centers Summary: Independent Living Centers Technical Adjustment Act - Directs the Commissioner of the Rehabilitation Services Administration of the Department of Education, in awarding funds in a state during FY2010 to existing centers for independent living for people with disabilities under the Rehabilitation Act of 1973, if certain conditions are satisfied, to distribute such funds among such centers according to a proportional allocation, disregarding any funds previously distributed from appropriations by the American Recovery and Reinvestment Act of 2009 (ARRA). Sets as such conditions that: (1) the Commissioner receives from the state, by August 5, 2010, a request to disregard ARRA funds, jointly signed by the designated state unit that receives and disburses funds to such centers and the state's Statewide Independent Living Council; and (2) the Commissioner is not conducting a competition to establish a new center for independent living in the state with ARRA funds. Requires the distribution of funds among such centers in a state for FY2010 (except under ARRA) to be in the same proportion as the regular funds appropriated for FY2009 for such centers, disregarding any ARRA funds. Requires continued disregard of ARRA funds in the allocation of funds for such centers in FY2011 and subsequent fiscal years. Authorizes the director of the designated state unit with approval to award funds to existing centers for independent living in the state to: (1) distribute non-ARRA funds among such centers during FY2010 in the same proportion as such funds were distributed in FY2009, disregarding ARRA funds; and (2) continue disregarding ARRA funds in distributions for FY2011 and subsequent fiscal years.

billsum

en

Summarize: It may have started as a humble circuit of rubber strips, but that wouldn't stop Scalextric becoming a thing of dreams. For generations, millions of children have routinely spread themselves onto the floor for hours on end to get the best track-side view of their miniature plastic cars in action. Now, 56 years later, the inventor's family has unveiled the first ever set - completely untouched. Historic: Diane Francis, widow of Scalextric inventor Freddie Francis, has unveiled the vintage set 56 years later. Nostalgia: Mr Francis modelled a blue Maserati and a green Ferrari to launch the set at Harrogate Toy Fair in 1957. Freddie Francis launched the car racing kit at Harrogate Toy Fair in 1957. It was an instant hit with dealers, and a year later he sold the brand to Lines Bros. for mass production. But besotted by the toy, he put the first set ever made aside to one day pass on to his children or grandchildren. The previously unopened set has been preserved in a wooden box at the Francis family home. But when Mr Francis lay on his death bed in 1998, suffering from cancer, he told his wife Diane his dying wish was to hand the priceless plaything to their daughters, Caroline and Julia. The plastic and rubber circuit, with this rudimentary controller, was cutting-edge technology. The original manual is completely untouched. But Mr Francis vowed to give it to his children after he died. The kit comes complete with skid patch oil to maintain the track and car oil to apply to the miniatures. Finally, after fifteen years, and now with two grandchildren, Mrs Francis decided this Christmas was the time to unearth the vintage box from storage to give to Callum, four, and Luke, two. Mrs Francis, 68, from Birdham in West Sussex, said: 'My husband launched Scalextric in 1957 and kept one of the original boxes. 'It is one of the very first sets ever made and it has been kept in a wooden box which my husband built to safeguard it. 'After. we had our two daughters Catherine and Julia, Freddie came up with the. idea of giving them an original box set when they were older. Freddie Francis (front) is pictured cutting the grass at Minimodels Ltd where the first model was produced. The kits were an instant hit. Here, Formula One driver Stirling Moss is seen playing with his very own set. 'Freddie. sadly passed away from cancer in 1998 and it was his dying wish that. our daughters got this set - it was uppermost in his mind. 'I felt now was the right time to give my daughters the set. 'Julia and Catherine grew up playing with various Scalextric sets which they used to set up under the snooker table. 'Freddie wanted them to have it as something to remember him by. 'Opening the wooden box which contained the Scalextric set brought a lump to my throat. Family: Mr Francis, pictured with wife Diane (top left), and daughters Caroline and Julia, always had kits for the family over the years. He vowed to give them the precious original when he died aged 78 in 1998. Love: Mr Francis attached a picture of him and his wife to his greatest invention. 'Scalextric is at the heart of our family and our daughters are very proud of their father. 'Now. they have children of their own who never got to meet their grandfather. but thanks to this Scalextric set his memory will live on.' Scalextric was born out of Freddie's company Minimodels which made tin plate toys and models. Among the firm's most popular products were its clockwork racing cars called Scalex - and when Freddie added an electric motor they became Scalex-electric or Scalextric. Grandsons Callum, four, and Luke, two, unwrapped the gift, now worth more than £1,500, this year. The toy fuelled fanatic interest in real-life cars as the manuals included information about the Grand Prix. Original sets came with pieces of interconnecting track made from rubber and two metal model racing cars. The cars chosen for the first sets were a Ferrari 375 and a Maserati 250F - driven by big name Grand Prix rivals like Stirling Moss, Juan Fangio and Alberto Ascari. The tracks and cars were built to a scale of 1:30 - and the cars were capable of a scale speed of 130mph. The speed of the cars was determined by handheld controllers and to make racing more fun the sets came with'skid patch fluid' to create on-track hazards. A 1957 set cost five pounds, 17 shillings and six pence - the equivalent of 120 pounds in today's money. So sought after are original sets that the Francis family's unopened Scalextric track could now be worth upwards of £1,500

Summary: Callum, 4, and Luke, 2, unwrap slot circuit kept in storage since 1957. Freddie Francis launched the racing kit at Harrogate Toy Fair. Kept it hidden but dying wish in 1998 was to give it to his daughters. This year, widow Diane decided it was time to pass it to next generation. Set which originally cost £5 is now worth more than £1,500.

cnn_dailymail

en

Summarize: Gigi D'Alessio e Denise Esposito sarebbero ormai una coppia consolidata. Il gossip ha acceso da tempo i riflettori sulla bella 28 enne napoletana, un tempo fan del cantante neo melodico, ora compagna e persino convivente, si ipotizza. Gigi D'Alessio l'avrebbe conosciuta la scorsa estate a Capri e da allora non l'avrebbe più lasciata, cercando di proteggere la loro relazione dagli occhi indiscreti del gossip e dal mondo dello spettacolo, che con Denise non avrebbe nulla a che vedere. Eppure è bastato un video circolato sui social nel quale il cantante e la giovane napoletana vengono immortalati mano nella mano per riaccendere la curiosità sulla vita privata di Gigi D'Alessio, separato lo scorso anno dopo la lunga storia d'amore con Anna Tatangelo. A confermare il gossip, la testimonianza video circolata in rete che sorprende il cantante il compagnia di Denise a Napoli, a quanto pare dopo un evento. Gigi D'Alessio è accerchiato dalla sicurezza e dai fan, gli stessi che non appena si allontana frettolosamente stringendo la mano di Denise lo seguono fino alla sua macchina. Salito alla guida del suv con la ragazza bionda al suo fianco, Gigi si trova a dover rispondere ad alcune fan che a quasi urlando il suo nome attirano l'attenzione: "Gigi ti abbiamo riconosciuto!". Il cantante, cappellino e occhiali da vista, cerca di coprirsi il viso, poi fa cenno con la mano di fare silenzio, in modo da poter fuggire senza essere troppo notato. Lo scorso marzo il direttore di Novella 2000 pubblicava su ‘Alta Portineria', rubrica di Libero, il gossip bomba sulla vita privata di Gigi D'Alessio che, tempo record, dopo la rottura con Anna Tatangelo avrebbe ritrovato il sorriso con la nuova ragazza. Stando alle indiscrezioni il cantante avrebbe conosciuto Denise la scorsa estate a Capri, ad un evento. Si sarebbero innamorati e avrebbero continuato così la frequentazione, cercando di tenerla il più possibile lontana dagli occhi indiscreti. Centra senz'altro la differenza di età tra i due (26 anni), per la quale qualcuno avrebbe sin da subito storto il naso. Ma per Gigi l'amore non ha età, tanto che avrebbe già fatto il passo della convivenza "a città alterne, un po' a Roma, dove ha casa lui, un po' a Napoli, dove vive lei".

Summary: Gigi D'Alessio l'avrebbe conosciuta la scorsa estate a Capri e da allora non l'avrebbe più lasciata, cercando di proteggere la loro relazione dagli occhi indiscreti del gossip che con Denise non avrebbe nulla a che vedere. Eppure è bastato un video circolato sui social nel quale la coppia viene sorpresa mano nella mano per riaccendere la curiosità sulla vita privata del cantante, che a marzo 2020 ha ufficializzato la rottura con Anna Tatangelo. Appena un mese dopo gli indizi social lasciano ipotizzare che sia scoppiata la passione con la 28enne napoletana.

fanpage

it

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Stable Oil Supply Home Heating Act''. SEC. 2. FINDINGS AND PURPOSE. (a) Findings.--Congress finds that-- (1) more than 35 percent of families in the northeastern United States depend on oil to heat their homes each winter, and most of those families have no practical alternative to paying the going price for home heating oil or seeking public or private assistance to pay for home heating oil; (2) consumers experienced sudden and dramatic increases in prices for home heating oil during the winters of 1989, 1996, and 1999, causing hardship to families and other people of the United States, including people on fixed and low incomes, people living in rural areas, the elderly, farmers, truckers and the driving public, and governments that pay home heating oil bills; (3) a substantial part of each sudden increase in home heating oil prices has been caused by vastly inadequate supplies of home heating oil accumulated during the summer, fall, and winter months by importers, refiners, and wholesalers; and (4) increased stability in home heating oil prices is necessary to maintain the economic vitality of the Northeast. (b) Purpose.--The purpose of this Act is to ensure that minimally adequate stocks of home heating oil are accumulated in the Northeast to meet reasonably foreseeable demand during each winter while protecting consumers from sudden increases in the price of home heating oil. SEC. 3. DEFINITIONS. Section 152 of the Energy Policy and Conservation Act (42 U.S.C. 6232) is amended-- (1) by redesignating paragraphs (2), (3), (4), (5), (6), (7), (8), (9), (10), and (11) as paragraphs (3), (4), (5), (8), (9), (10), (11), (12), (13), and (14), respectively; (2) by inserting after paragraph (1) the following: ``(2) Home heating oil.-- ``(A) In general.--The term `home heating oil' means distillate fuel oil. ``(B) Inclusions.--The term `home heating oil' includes No. 1 and No. 2 diesel and fuel oils.''; (3) by inserting after paragraph (5) (as redesignated by paragraph (1) of this section) the following: ``(6) Northeast.--The term `Northeast' means the States of Maine, New Hampshire, Vermont, Massachusetts, Rhode Island, Connecticut, New York, Pennsylvania, and New Jersey. ``(7) Primary heating oil inventory.-- ``(A) In general.--The term `primary heating oil inventory' means a heating oil inventory held by an importer, refiner, or wholesaler. ``(B) Exclusion.--The term `primary heating oil inventory' does not include any inventory held by a retailer for the direct sale to an end user of home heating oil.''; and (4) by adding at the end the following: ``(15) Wholesaler.--The term `wholesaler' means any person that-- ``(A) owns, operates, leases, or otherwise controls a bulk terminal having a total petroleum storage capacity of 50,000 barrels or more; ``(B) stores heating oil; and ``(C)(i) resells petroleum products to retail businesses that market the petroleum products to end users; or ``(ii) receives petroleum products by tanker, barge, or pipeline. ``(16) Winter season.--The term `winter season' means the months of November through March.''. SEC. 4. HOME HEATING OIL RESERVE FOR THE NORTHEAST. (a) Amendment.--Part B of title I of the Energy Policy and Conservation Act (15 U.S.C. 6231 et seq.) is amended by inserting after section 157 the following: ``SEC. 157A. VOLUNTARY PLANS FOR HOME HEATING OIL RESERVE. ``(a) Development and Submission of Voluntary Plans.--Importers, refiners, and wholesalers that hold primary heating oil inventories for sale to markets in the Northeast, acting individually or in 1 or more groups, shall, for the purposes of ensuring stability in energy fuel markets and protecting consumers from dramatic swings in price-- ``(1) develop voluntary plans, in consultation with interested individuals from nonprofit organizations and the public and private sectors, to maintain readily available minimum product inventories of home heating oil for sale in the Northeast, possibly in combination with the hedging of future inventories, to mitigate the risk of severe price increases to consumers and to reduce adverse impacts on the regional and national economies; and ``(2) submit the voluntary plans to the Secretary not later than 180 days after the date of enactment of this section. ``(b) Certification and Report.-- ``(1) In general.--If the Secretary determines that a plan submitted under subsection (a)-- ``(A) is likely to achieve the purposes of the Stable Oil Supply Home Heating Act, the Secretary shall so certify, and the importer, refiner, or wholesaler shall implement the plan; or ``(B) is not likely to achieve the purposes of the Stable Oil Supply Home Heating Act, the Secretary shall issue a statement explaining why the plan does not appear likely to achieve those purposes. ``(2) Report.--Not later than 240 days after the date of enactment of this section, the Secretary shall submit to Congress a report describing the findings and reasons for a certification or failure to certify each plan submitted under subsection (a). ``(c) Defense to Antitrust Actions.-- ``(1) In general.--There shall be available as a defense to a civil or criminal action brought under the antitrust laws (or any similar State law) with respect to an action taken by an importer, refiner, or wholesaler the fact that-- ``(A) the action is taken-- ``(i) in the course of developing a voluntary plan for submittal under subsection (a); or ``(ii) in the course of carrying out the voluntary plan, if the voluntary plan is certified by the Secretary under subsection (b)(1)(A), but only to the extent specified in or within the reasonable contemplation of the voluntary plan; ``(B) the action is not taken for the purpose of injuring competition; and ``(C) the importer, refiner, or wholesaler is in compliance with this section and section 157B. ``(2) Burden of proof.--A person asserting the defense under paragraph (1) shall have the burden of proof, except that the burden shall be on the person against which the defense is asserted with respect to whether an action is taken for the purpose of injuring competition. ``(d) Applicability.--The requirements of this section and section 157B shall not apply to an importer or refiner whose total petroleum storage capacity is less than 50,000 barrels. ``(e) Report.--Not later than 1 year after the date of enactment of this section, and annually thereafter, the Secretary shall submit to Congress a report describing the results of the implementation of all voluntary plans certified under this section, including specific compliance by importers, refiners, and wholesalers that serve the Northeast market with respect to the adequacy of the home heating oil supply. ``SEC. 157B. HOME HEATING OIL RESERVE FOR THE NORTHEAST. ``(a) Establishment of Private Home Heating Oil Reserves.--If, after the expiration of 240 days after the date of enactment of this section, a certified plan described in section 157A has not been implemented in accordance with that section for an importer, refiner, or wholesaler that stores heating oil for sale in the Northeast, not later than 300 days after the date of enactment of this section, the Secretary shall issue an order requiring the establishment of a private home heating oil reserve for the Northeast in accordance with this section. ``(b) Inventory.-- ``(1) In general.--Except as provided in paragraph (2), the Secretary shall periodically monitor supply levels as necessary to ensure that each importer, refiner, and wholesaler of heating oil for sale in the Northeast shall have in inventory and readily available to retailers or consumers in the Northeast a quantity of home heating oil that the Secretary determines is equal to the quantity that each importer, refiner, or wholesaler may reasonably be expected to require to supply the needs of its customers during the present or following winter season without subjecting consumers to sudden price increases that are due in part to inadequate buildup of heating oil inventories. ``(2) Increased inventory.--If the Secretary determines under paragraph (1) that an inventory of home heating oil is insufficient, the Secretary shall direct an importer, refiner, or wholesaler to acquire, store, and maintain in readily available inventories any quantity of home heating oil that the Secretary determines to be necessary to supply home heating oil needs in the Northeast without subjecting consumers to sudden price increases that are due in part to inadequate buildup of heating oil inventories. ``(3) Limitation.--The Secretary shall not require any importer, refiner, or wholesaler to store any product under this subsection in a quantity greater than 95 percent of the average storage capacity for heating oil reasonably available to the importer, refiner, or wholesaler during the preceding 2 years. ``(4) Regulations.--As soon as practicable after the date of enactment of this section, the Secretary shall promulgate regulations necessary to carry out this section, including regulations that-- ``(A) establish civil penalties to enforce this section; and ``(B) provide that the Secretary shall cooperate with State energy authorities in carrying out this section. ``(c) Excess Inventory.--At the end of each winter season, the Administrator of the Environmental Protection Agency shall take appropriate and reasonable action to enable importers, refiners, and wholesalers of home heating oil to sell any remaining excess inventories of home heating oil that the importers, refiners, and wholesalers may have. ``(d) Implementation.--In implementing this section, the Secretary shall ensure, to the maximum extent practicable, that the manner of implementation supports the maintenance of an economically sound and competitive petroleum industry. ``(e) Report.--Not later than 22 months after the date of enactment of this section, the Secretary shall submit to Congress a report describing the results of the implementation of this section and section 157A, including specific compliance by importers, refiners, and wholesalers subject to the requirements of this section and section 157A with respect to home heating oil supply buildup.''. (b) Table of Contents Amendment.--The table of contents of the Energy Policy and Conservation Act is amended by inserting after the item relating to section 157 the following items: ``Sec. 157A. Voluntary plans for home heating oil reserve. ``Sec. 157B. Home heating oil reserve for the Northeast.''.

Title: Stable Oil Supply Home Heating Act Summary: Directs the Secretary to: (1) issue an order requiring the establishment of a private home heating oil reserve for the Northeast if a certified plan has not been implemented within a specified time frame for an importer, refiner, or wholesaler that stores heating oil for sale in the Northeast; (2) periodically monitor supply levels to ensure that home heating oil inventories in the Northeast are adequate to supply customer needs during the present or following winter season so as to obviate sudden price increases caused by inadequate inventories; (3) require an importer, refiner, or wholesaler to increase its inventory if the Secretary determines that inventories are insufficient; and (4) establish civil penalties and cooperate with State energy authorities in carrying out this Act. Instructs the Administrator of the Environmental Protection Agency to take action to enable importers, refiners, or wholesalers to sell their remaining excess inventories at the end of each winter season.

billsum

en

Summarize: Serena Cervantes has been struggling to earn her bachelor's degree for seven years. With tuition for two courses at her California university demanding $2,300, it's not the workload that has her putting off the final class she needs to graduate in May. Money is tight. The 25-year-old has worked as a maid and retail clerk to make ends meet, but she says that dating the men she encounters on Sugardaddie.com has proved to be a more lucrative endeavor. "I've had a hard time finding jobs and keeping jobs," she said. "I thought this would be a good way for me to have a relationship with someone and also make it, as these sites all say, mutually beneficial." Cervantes is just one of many students who've sought out sugar daddies online in a time of need. Dating site SeekingArrangement.com, which connects wealthy men with women looking for financial support, reports that female college students made up 44% of the site's total users in 2012. With tuition on the rise, that number will likely continue to climb. While some may compare the practice to prostitution or question the morality of trading money and gifts for affection, the people who use these sites contend that they're merely a conduit for both parties getting what they want. What's the draw? Men who engage in such relationships, many of whom are older and married, enjoy taking care of young women and assuming a mentor role in their lives, said Steven Pasternack, who launched Sugardaddie.com in 2002. "You have some guys who like to spoil and pamper their women by taking them out to nice dinners, buying them gifts. Some maybe help with the utility bills or take them on trips," Pasternack added. "And there are other guys that will have an ongoing relationship in which they'll say, 'OK, I'll give you an allowance and you can put this toward whatever your needs are.' " The average monthly "allowance" sugar daddies on the site said they shell out is $3,000, according to SeekingArrangement.com. So what do these "sugar daddies" get in return for all their generosity? Surprisingly, sex isn't a given. It's obviously on the table, says Cervantes, but there are other motivations. "Some of them just wanted to go out to eat," she said. "Some of them just wanted someone to talk to. Some of them just said outright, 'Can we (have sex) for this amount of money?' And I've said no." But she admits that sex ups the ante -- if a sugar baby consents to an intimate relationship, she's likely to get more gifts out of her benefactor. "If you look at the language of various state statutes, the terms of many of the relationships fall under the definition of prostitution," said New Jersey attorney Alex Miller, who has studied "sugar dating." Authorities shy away from prosecuting sugar websites and their users because the relationships can mirror a typical romance, Miller said. Plus, users are savvy enough not to broadcast online whether they're trading sex for cash. Sex isn't the only motivator for sugar daddies, according to Brandon Wade, the founder and CEO of SeekingArrangement.com. Some also want to help a struggling young woman. Wade, 42, (who met his wife, 27, on the site) said most of the men on the site begin communication with potential sugar babies by asking them why they're looking for a sugar daddy. He's found that women who say they need money to pay for school get asked out more often than those who admit they want cash for breast implants, for instance. While most of the sugar daddies Cervantes has met through the website prefer to arrange a per-date per diem, one married man wrote her a check for $1,600 to go toward her tuition and rent after their monthlong courtship. She said she prefers dating married men because they tend to be more paternal and offer a steadier source of income than single men. Is it prostitution by another name? SeekingArrangement.com's Wade said the men who subscribe to his site are discouraged from offering money on a per-date basis to avoid operating like an escort service. By crosschecking users' photos with those on Craigslist.com and Backpage.com, as well as monitoring conversations between members, Wade says he is able to weed out the escorts posting on his site. Atlanta-based criminal defense attorney Bernard Brody said there's no crime in paying someone solely for his or her companionship. "The crime is when you pay someone to engage in sexual conduct," he added. Read more: Pimps hit social networks to recruit underage sex workers. Kimberly Mackey, who attends college in the South, says she had one Sugardaddie.com suitor pay her $500 to have lunch with him. She said she doesn't consider herself a prostitute because she doesn't have sex with most of the men she meets through the site. The 23-year-old started engaging in relationships with older, wealthy men after moving away from home at 18. An older colleague saw she was having trouble supporting herself, so he started inviting her on golf trips with his friends and buying her gifts. The man told her, "You're only going to be young and hot for so long. Take advantage of it while you can." Mackey got used to the perks. She said sugar daddies have offered her cars, vacations and apartments, but she prefers cash. Why go the sugar route? Atlanta-based licensed mental health therapist Harrison Davis said sugar relationships are all about power and youth. On one hand, he said, these relationships remind the men of a more carefree time in their own lives. On the other hand, there's a great sense of control. "They can take things away and limit the amount of money they're going to spend on the young lady. They can steer (the relationship) into any direction they want to." Though Mackey says she's not ashamed of her unconventional part-time job, she doesn't make a habit of telling everyone about it. When her mother asks how she can afford to not work, she says her ex-boyfriend helps her pay her credit card bills, which some people might consider a sugar relationship in its own right. Cervantes, on the other hand, said her relationship with a family member suffered after she opened up about her experience dating sugar daddies: "He said, 'You're selling your body online.'" Despite Cervantes' qualms about accepting money in exchange for her companionship, she has no plans to deactivate her account anytime soon. She said she doesn't have parents who can help her pay for school, so she relies on the kindness of wealthy men out of desperation. Without the extra income, Cervantes said she'd be back at the homeless shelter she lived in for three months in 2009. "In my heart of hearts I don't really like the situation," Cervantes said. "Right now it's a survival mechanism." Sugardaddie.com's Pasternack said the relationship between a sugar baby and sugar daddy is all about perspective. "I helped my wife get through school, I pay for the bills, take her on trips, buy her nice gifts," he said. "I guess you could say a lot of married guys are sugar daddies without them realizing it. I think you can say basically any guy who wants to impress a woman is a sugar daddy."

Summary: Serena is one of many college students who've sought out sugar daddies in a time of need. SeekingArrangement.com: Average monthly allowance for sugar babies is $3,000. SeekingArrangement.com: Students made up 44% of the site's users in 2012. Go inside the "sugar daddy/sugar baby" dating scene on "This is Life with Lisa Ling".

cnn_dailymail

en

Summarize: Image caption David Cameron's renegotiation could paralyse the EU, a German MP said The popular German tabloid Bild asked today: "Is Britain destroying the EU?" The headline reflects the unease felt across Europe over David Cameron's promise to re-negotiate its EU membership. Europe now knows what it long suspected: many in Britain have a completely different vision of the EU than those on the continent. David Cameron's European idea is of a flexible, pragmatic union that focuses on trade. The question he asks is: can the EU, as it is currently structured, deliver prosperity? In the rest of Europe they believe that closer integration will build the European dream. Officials in Brussels said that Cameron was offering a "pick and mix Europe". His vision was for a Europe "a la carte", where countries chose what they liked and disliked. The German Foreign Minister Guido Westerwelle said "cherry picking was not an option". There was a similar reaction from the French Foreign Minister Laurent Fabius. "We can't have Europe a la carte," he said. "Imagine the EU was a football club; once you've joined up and you're in this club you can't then say you want to play rugby." As regards trying to repatriate powers to Westminster, the President of the European Parliament, Martin Schulz, said it would be a "drawn out and cumbersome negotiation" involving long and complex procedures. The head of the German European Affairs Committee Gunther Krichbaum said the "EU was not a multiple choice event". He compared re-negotiation to "opening Pandora's box". No special case The German foreign minister went out of his way to say that he hoped the UK would continue to play an "active" and "constructive" role in the EU. He offered a concession: he agreed that not everything decided in Brussels needed to remain at a European level. He signalled that Germany would support some regulations returning to the member states. Here's the dilemma. There are several states which believe that some measures, currently operated at EU level, could be returned to national governments. Any adjustments, however, they insist must include all 27 members. There is little support for Britain being treated as a special case. The problem for David Cameron is that he is fighting for a complete overhaul of Britain's relationship with Europe, not a tinkering at the edges. The question I heard asked time and again today was what would the prime minister do if he felt he wasn't winning enough concessions. Might he recommend leaving the EU if he didn't get a good deal? A German MP said he thought this negotiation risked "paralysing the EU for years". One German minister was asked about the risk of Britain blackmailing other states to win further opt-outs. He declined to answer. So there is great uncertainty as to what these next years will bring. One other unknown. It is far from clear whether the German Chancellor, Angela Merkel, will push for a major revision of the treaties in 2015. If she doesn't, that will make Britain's task of re-negotiating far more difficult. There are divided views in Europe about the referendum. One senior EU official said he welcomed Britain finally deciding whether it wanted to be in or out of Europe. "Let's settle it once and for all," he said. Others said a referendum was "highly risky". Voters might decide to punish the government by voting to leave the EU. There were lots of statements about how much Europe needs the UK - but not at any price. Some officials welcomed David Cameron's positive remarks about the EU. However, ultimately David Cameron's vision for the EU - a flexible, adaptable union - is not widely shared. The German foreign minister said: "We do not need less Europe but more integration." Nothing said today can avoid the reality that Britain and much of the EU have very different ideas about the future of the union. What is clear is that Britain will face a difficult and uphill battle if and when it starts to re-negotiate its membership. Photo Advertisement Continue reading the main story BRUSSELS — The French are engaged in a lonely military adventure in Africa. The Germans are preoccupied with domestic elections rather than regional affairs. Unemployment in some countries is at historic highs and economies across Europe are still mired in recession. Now Prime Minister David Cameron of Britain has added to Europe’s malaise, vowing to reduce British entanglement with the European Union — or allow his people to vote in a referendum to leave the bloc altogether. The pledge from the British prompted swift retorts from France and Germany, which said no member has the option of “cherry picking” whatever European rules it wants to enforce. But it reflected a growing sense of unease, not only in Britain but across the Continent, that while the acute phase of the financial crisis has passed, the challenge to Europe’s mission and even its membership has not. Even the United States has injected itself into the matter, with an unusually public insistence that Britain, a close ally, stay in the union, fearing that its departure would heighten centrifugal forces that would weaken Europe as a diplomatic, military and financial partner. With the threat of a sudden breakup of the euro zone appearing to recede in recent months, Europe has seen a resurgence of narrow national interests that risks swamping always-elusive common goals. The bickering is undercutting hopes in some circles that the struggle to save the euro had laid the groundwork for “more Europe.” “As pressure from the financial markets recedes and a sense of urgency lifts, the appetite for serious reform is melting away like butter in the sun,” said Thomas Klau, head of the Paris office of the European Council on Foreign Relations. “Now that markets no longer hold a knife under leaders’ throats, they are slipping back into their normal mode, which is to manage their own immediate reality.” For Mr. Cameron, with elections coming in 2015, that means heading off a challenge from the hard-right, anti-Europe United Kingdom Independence Party while shoring up support for his government, which recently admitted that its unpopular austerity program would have to be extended to 2018, analysts said. He is also anxious to avoid the sort of ruinous intraparty split over Europe that bedeviled the prime ministerships of two of his Conservative predecessors, Margaret Thatcher and John Major. That comes against a backdrop of declining favorability ratings for the European Union among the British — only 45 percent last year, down from 51 percent in 2011, in polls conducted by the Pew Research Global Attitudes Project. Mr. Cameron’s speech Wednesday in London calling for a referendum had been in the works for some time but, Mr. Klau noted, it was delivered at a moment when the European Union had begun to declare victory over doomsayers who predicted the common currency and even the whole union could crumble. This mood of calm, Mr. Klau said, has given leaders “the political space” to turn their eyes from Europe toward more pressing and, for politicians seeking re-election, far more important domestic concerns. Advertisement Continue reading the main story Advertisement Continue reading the main story The decision by President François Hollande of France to send troops to Mali to halt an advance by rebels with ties to Islamist extremists reprises a long tradition of French interventions in its former African colonies — and has bolstered the Socialist president’s previously flagging popularity. The French move has been supported by the European Union, whose member states share French fears about the spread of radicalism across the Mediterranean. But it has superseded the bloc’s own ambitions to become a serious player in global affairs and still left the French to fight mostly on their own. The union is sending some military trainers. Europe’s economic troubles, meanwhile, are far from over, with much of the Continent expected to be in recession this year. Even Germany seems to be losing momentum — its economy contracted by 0.5 percent in the final months of last year. Elsewhere, unemployment is soaring to levels that could threaten grave social unrest, with more than a quarter of working-age people in Greece and Spain without jobs. But the European Union, widely criticized as not doing enough to raise employment, has been struggling to put even its own economic house in order after leaders failed in November to agree on a long-term budget for the 27-nation bloc. Leaders will take another swipe at this divisive issue early next month. After being consumed for so long by efforts to salvage the euro zone, “leaders now think it is safe and are becoming perhaps too complacent,” said Charles Grant, director for the Center for European Reform, a London-based research unit. “The only time European leaders have agreed to take important steps is when there is a crisis. As soon as the crisis stops they relax.” Germany, he said, has now backed away from tentative support for a change in the basic European Union treaties that could help the European Union forge common policies. Already distracted by national elections next September, Germany could turn even more inward-looking as Chancellor Angela Merkel seeks to overcome her party’s defeat over the weekend in a down-to-the-wire state election in Lower Saxony. She remains the dominant figure in German and European affairs, but the surprise election setback has dented her aura of invincibility. Other leaders, tightly focused on their own domestic concerns, are stalling on critical decisions about how far they want to go in engaging with the union. President Bronislaw Komorowski of Poland, for example, said Wednesday that his country should delay a decision on adopting the euro until after elections in 2015. While the Polish economy, the biggest in central Europe, has been spared the tumult that has afflicted other nations, opinion polls show flagging interest in adopting the euro. Less than a third of Poles want to ditch the national currency, the zloty, according to recent surveys. Farther to the east in Latvia, which plans to join the euro zone next year, support for the common currency has slumped to under 15 percent in a sign of growing unease with a “European project” that most Latvians had eagerly embraced. Domestic politics have regularly trumped broader European concerns throughout the six-decade history of the union and its predecessor organizations, to the dismay of those who want to see Europe live up to a commitment in the 1957 Treaty of Rome for an “ever closer union.” But Mr. Cameron’s pledge to hold a referendum on European Union membership threatens to elevate national political calculations over common interests to an extent that has alarmed even countries that often share British concerns. BERLIN BERLIN Jan 23 (Reuters) - The European Union and Britain must be prepared to make compromises, German Chancellor Angela Merkel said on Wednesday after British Prime Minister David Cameron demanded a radical reform of the EU and a referendum on UK membership. "Germany, and I personally, want Britain to be an important part and an active member of the European Union," Merkel told reporters. "We are prepared to talk about British wishes but we must always bear in mind that other countries have different wishes and we must find a fair compromise. We will talk intensively with Britain about its individual ideas but that has some time over the months ahead," said Merkel.

Summary: British PM David Cameron made an impassioned case today for his country to stick with the European Union, but said it's time for Britons "to have their say" on the matter, reports the New York Times. He promised an "in-or-out" referendum as early as 2017-provided, of course, he wins reelection in 2015. The Conservative Party leader acknowledged that many Brits "feel that the EU is heading in a direction they never signed up to," citing increased regulation by the European Commission as particularly problematic. The Times notes that Cameron's move could be an attempt to pick up votes in the next election, but it is reverberating throughout the globe: "Germany, and I personally, want Britain to be an important part" of the EU, said Angela Merkel, while noting that a "fair compromise" must be found. Meanwhile, the BBC notes that Germany's Bild is running a headline that asks, "Is Britain destroying the EU?" In Washington, the Obama administration has been open about its desire to see the UK remain part of the EU. Cameron noted that an exit from the Union would be a "one-way ticket."

multi_news

en

Write a title and summarize: Expanded GGGGCC repeats in the first intron of the C9orf72 gene represent the most common cause of familial amyotrophic lateral sclerosis (ALS), but the mechanisms underlying repeat-induced disease remain incompletely resolved. One proposed gain-of-function mechanism is that repeat-containing RNA forms aggregates that sequester RNA binding proteins, leading to altered RNA metabolism in motor neurons. Here, we identify the zinc finger protein Zfp106 as a specific GGGGCC RNA repeat-binding protein, and using affinity purification-mass spectrometry, we show that Zfp106 interacts with multiple other RNA binding proteins, including the ALS-associated factors TDP-43 and FUS. We also show that Zfp106 knockout mice develop severe motor neuron degeneration, which can be suppressed by transgenic restoration of Zfp106 specifically in motor neurons. Finally, we show that Zfp106 potently suppresses neurotoxicity in a Drosophila model of C9orf72 ALS. Thus, these studies identify Zfp106 as an RNA binding protein with important implications for ALS. Expanded GGGGCC repeats in the first intron of the C9orf72 gene represent the most common cause of familial amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) (DeJesus-Hernandez et al., 2011; Renton et al., 2011). The repeat expansion has been identified in more than 40% of familial ALS and in at least 7% of sporadic cases (Majounie et al., 2012). Several gain-of-function mechanisms for how the expanded hexanucleotide repeats cause disease have been proposed. One idea suggests that toxic dipeptide repeat (DPR) proteins generated by repeat associated non-ATG (RAN) translation of the RNA repeats cause neurodegeneration (Kwon et al., 2014; Mizielinska et al., 2014; Mori et al., 2013). Another major proposed gain-of-function mechanism for C9orf72 ALS is via the formation of pathogenic repeat RNA aggregates that sequester one or more RNA binding proteins, leading to altered RNA processing and metabolism in motor neurons (Cooper-Knock et al., 2015; Haeusler et al., 2014; Lee et al., 2013; Prudencio et al., 2015; Sareen et al., 2013). Zfp106 is a C2H2 zinc finger protein with four predicted zinc fingers and seven WD40 domains (Grasberger and Bell, 2005). The mouse Zfp106 gene is located on chromosome 2 at 60. 37 cM (Chr2: 120,506,820–120,563,843 bp; Genome Reference Consortium, Mouse Build 38). In addition, the human ortholog, ZNF106, is located at human chromosome 15q15. 1 (Chr15: 42,412,437–42,491,197; Genome Reference Consortium Human Build 38), a region with strong linkage to a rare recessive familial form of ALS (Hentati et al., 1998), suggesting a possible role in human ALS. Consistent with this notion, mice lacking Zfp106 function show evidence of nondevelopmental neuromuscular degeneration, also suggestive of a possible role for Zfp106 in ALS (Anderson et al., 2016; Joyce et al., 2016; van der Weyden et al., 2011). Here, we identify a previously unknown role for Zfp106 as an RNA binding protein that specifically interacts with GGGGCC repeats and with a network of ALS-associated RNA-binding proteins, including TDP-43. In addition, we establish that knockout of Zfp106 in mice results in an ALS-like motor phenotype and that transgenic restoration of Zfp106 expression specifically in motor neurons suppresses the neurodegenerative phenotype in knockout mice. Finally, we show that Zfp106 is a potent suppressor of neurotoxicity caused by expression of GGGGCC repeats in a Drosophila model of C9orf72 ALS. Thus, these studies have important implications for the most common form of human ALS. Sequestration of RNA binding proteins by rGGGGCC repeats has been implicated in the pathology of C9orf72 ALS (Mizielinska and Isaacs, 2014). Therefore, to identify rGGGGCC-binding proteins that may be sequestered by repeat-containing RNA and involved in the pathology of C9orf72 ALS, we performed a pull-down assay using biotinylated r (GGGGCC) 8 RNA and identified the zinc finger protein Zfp106 as a previously unknown rGGGGCC-binding protein. Zfp106 bound specifically to r (GGGGCC) 8 but not the control sequence r (AAAACC) 8 (Figure 1a). RNA electrophoretic mobility shift assay (EMSA) using purified Zfp106 protein demonstrated that Zfp106 bound directly to the rGGGGCC repeats and that this binding was specific since it was efficiently competed by unlabeled self oligonucleotide but not a 30× molar excess of the control oligonucleotide (Figure 1b). Importantly, Zfp106 binding to r (GGGGCC) 4 was not competed by 30× molar excess of a mutated RNA probe of equal length, nor was it competed by 30× molar excess of rCUG repeats comprising a MBNL1 binding site (Figure 1—figure supplement 1a). Likewise, MBNL1, an unrelated RNA-binding protein involved in myotonic dystrophy (Miller et al., 2000), bound efficiently and specifically to rCUG repeats under conditions in which Zfp106 showed no binding to the same rCUG sequence (Figure 1—figure supplement 1b) and, as previously described (Reddy et al., 2013), was not able to bind GGGGCC repeats (Figure 1—figure supplement 1a). Together, these data demonstrate that Zfp106 binds efficiently and specifically to GGGGCC RNA repeats. 10. 7554/eLife. 19032. 003Figure 1. Zfp106 is an rGGGGCC binding protein. (a) Western blot analysis of Zfp106 eluted from a biotinylated-RNA pulldown of Neuro-2a nuclear proteins. Endogenous Zfp106 was specifically pulled down by (GGGGCC) 8 biotinylated RNA and not by the unrelated (AAAACC) 8 biotinylated RNA oligonucleotide. (b) RNA EMSA performed with purified Zfp106 protein demonstrates that Zfp106 directly binds (GGGGCC) 4 RNA in vitro. 30× molar excess of unlabeled self competitor, but not 30× r (AAAACC) 4, competes with Zfp106 binding to r (GGGGCC) 4, establishing specificity of the interaction. (c) Immunofluorescence with an anti-Zfp106 antibody detects Zfp106 expression in the nucleolus (arrowheads) and in other discrete nuclear puncta (arrows) in cultured Neuro-2a cells. The three images are the same section showing the red channel in (c), the blue channel in (c′), and both channels in (c′′). Scale bar, 20 μm. (d, d′) Immunohistochemical detection of human ZNF106 shows strong nucleolar expression in human motor neurons in the anterior horn of spinal cord. The two images are from different post-mortem individuals. Arrowheads mark nucleolar ZNF106 expression; arrows mark other nuclear and perinucleolar foci of ZNF106 expression. Scale bar, 25 µm. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 00310. 7554/eLife. 19032. 004Figure 1—figure supplement 1. Zfp106 binds specifically to rGGGGCC repeats. (a) RNA EMSA performed with purified Zfp106 protein demonstrates that Zfp106 binds specifically to r (GGGGCC) 4in vitro since binding is efficiently competed by 30× molar excess of unlabeled self competitor but not 30× molar excess of r (AAAACC) 4, r (CUG) 8 or a mutated r (GGGGCC) 4 sequence [mut, r (GAGGCCGGGACCGAGACCGAGGCC) ]. Purified MBNL1 protein was used as a negative control for r (GGGGCC) 4 binding. MBNL1 does not bind to r (GGGGCC) 4 under the same conditions in which Zfp106 shows efficient binding. (b) RNA EMSA using purified Zfp106 protein demonstrates that Zfp106 does not bind r (CUG) 8 repeats under conditions in which the RNA binding protein MBNL1 efficiently binds r (CUG) 8. MBNL1 binding to r (CUG) 8 is specific since binding is competed by 30× molar excess of self competitor but not 30× molar excess of r (GGGGCC) 4. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 004 Patients with C9orf72 ALS show evidence of post-mortem nucleolar stress (Haeusler et al., 2014). Interestingly, in cultured Neuro-2a neuronal cells, Zfp106 was primarily present in the nucleolus and in other discrete nuclear puncta (Figure 1c). Likewise, in lower motor neurons from post-mortem human spinal cord samples, ZNF106 was primarily observed in the nucleolus (Figure 1d, d′) and also showed occasional localization in other puncta in the nucleus outside of the nucleolus (Figure 1d′). The localization of Zfp106 to the nucleolus is in accordance with previous studies showing that Zfp106 is predominantly located in the nucleolus of C2C12 myoblast cells (Grasberger and Bell, 2005), and taken together, the results presented in Figure 1 support a possible role for Zfp106 in the biology of C9orf72 neurodegeneration. As noted above, previous studies have demonstrated a requirement for Zfp106 in neuromuscular function in mice. Abnormal skeletal morphology in Zfp106tm1a (KOMP) Wtsihomozygous mice was briefly reported as part of a large-scale phenotypic screen of genetically modified mice by the Sanger Mouse Genetics Project (van der Weyden et al., 2011). More recently, more extensive phenotypic studies demonstrated progressive neuromuscular disease in the absence of Zfp106 gene function (Anderson et al., 2016; Joyce et al., 2016). These studies, combined with the interaction of Zfp106 with the C9orf72 hexanucleotide repeat sequence, prompted us to examine Zfp106 knockout mice in additional detail and to determine whether the observed defects were autonomous to motor neurons. Therefore, we obtained the previously described Zfp106tm1a (KOMP) Wtsimice from the KOMP knockout consortium (van der Weyden et al., 2011) and generated the presumptive null allele (Zfp106lacz; also referred to herein as Zfp106-null or Zfp106−/−) using a universal germline deleter transgenic mouse line (Ehlers et al., 2014). Consistent with published studies, we found that loss of Zfp106 function caused a progressive neuromuscular phenotype. Zfp106-null mice were born at normal Mendelian frequency and were indistinguishable from control mice until approximately 4 weeks of age, when 100% of knockout mice began to exhibit evidence of a wasting disease and loss of muscle strength (Figure 2—figure supplement 1; Video 1). Transverse sections of the quadriceps from 4-week-old Zfp106-null mice showed increased variation in fiber size and evidence of grouped atrophy with very few centrally located nuclei (Figure 2a, b), consistent with neurogenic rather than myopathic disease (Baloh et al., 2007). By three months of age, near end stage disease, Zfp106-null mice displayed extensive muscular atrophy and severe degeneration of muscle fibers (Figure 2c, d). The number of choline acetyltransferase (ChAT) -positive motor neurons was also profoundly and significantly reduced in Zfp106 knockout spinal cords compared to littermate control mice (Figure 2e–i), providing further evidence that loss of Zfp106 in mice causes a neurodegenerative phenotype. Independently, we confirmed the knockout phenotype observed with the KOMP allele (van der Weyden et al., 2011) using CRISPR-mediated gene disruption by non-homologous end joining (NHEJ) and creation of a frameshift mutation leading to a premature stop codon. The CRISPR-generated mutation resulted in an essentially identical wasting and histological phenotype (data not shown). 10. 7554/eLife. 19032. 005Figure 2. Zfp106 loss-of-function causes a severe neuromuscular phenotype in mice. (a–h) Evidence of profound neuromuscular pathology in Zfp106-null mice. H&E stained sections of quadriceps muscles (a–d) from 4-week old and 12-week old wild type (a, c) and Zfp106 knockout (b, d) mice are shown. Note the presence of grouped small angular fibers in knockout mice (dashed circle), already clearly evident by 4-weeks of age (b, arrowheads) compared to the rounder, more evenly-shaped fibers in controls (a). By 12-weeks (end stage disease), Zfp106 knockout mice have profound pathology and the presence of atrophic and degenerated muscle fibers with numerous inclusions (d, asterisks). Scale bar, 100 μm. ChAT immunohistochemical staining (e–h) of lumbar spinal cord sections from 8-week old wild type (e, g) and Zfp106 knockout (f, h) mice show a drastic reduction in the number of ChAT+ motor neurons. Arrowheads mark ChAT-expressing motor neurons in the ventral horn. Scale bar, 200 μm in all panels. (i) Quantification of ChAT-positive neurons in the lumbar spinal cord of wild type and Zfp106 knockout mice at 8 weeks of age shows a ~ 47% loss of motor neurons in Zfp106 knockout mice. n = 5 mice for each genotype. Data are expressed as percent of control ± SD and were analyzed by t-test. ***p<0. 001. (j) Schematic of the HB9-3×FLAG-2×STREP-Zfp106-IRES-gfp (HB9-Zfp106) transgene. (k, l, m) Transgenic expression of Zfp106 in motor neurons suppresses the wasting phenotype (k), the reduction in grip strength (l) and the loss of lumbar spinal cord motor neurons (m) in Zfp106 knockout mice. Wasting data are expressed as the mean weight ± SEM. Grip strength data are expressed as the mean grip score ± SD; grip score: 1,1–10 s; 2,11–25 s; 3,26–60 s; 4,61–90 s; 5, > 90 s. ChAT-positive neuron counts are expressed as percent of control ± SD. n = 5 female mice at 8 weeks of age for each genotype. Data were analyzed by one-way ANOVA and Bonferroni' s Multiple Comparison Test. *p<0. 05; ***p<0. 001, ****p<0. 0001. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 00510. 7554/eLife. 19032. 006Figure 2—figure supplement 1. Zfp106 knockout mice exhibit progressive and severe weight and grip strength loss over time. (a) Dorsal view of skinned wild type and Zfp106 knockout mice at 12-weeks of age. Zfp106 knockout mice show severe muscle wasting and kyphosis compared to wild type mice. (b) Female mice were weighed at the indicated ages, n = 5 for each group. Body weight of Zfp106 knockout mice was significantly reduced at 2 months of age compared to control and further reduced at 3 months of age. (c) Zfp106-null mice exhibit profound loss of grip strength; grip score: 1,1–10 s; 2,11–25 s; 3,26–60 s; 4,61–90 s; 5, > 90 s. n = 5 age-matched female mice for each group tested at the indicated ages. Graphical data are presented as the mean ± SD. Data were analyzed by one-way ANOVA and Bonferroni' s Multiple Comparison Test. ns, not significant; ***p<0. 001, ****p<0. 0001. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 00610. 7554/eLife. 19032. 007Figure 2—figure supplement 2. Zfp106 is expressed in skeletal muscle and motor neurons. Expression of Zfp106 as detected by β-galactosidase activity in quadriceps (a) and spinal cord (b) of 8-week-old Zfp106laczflox/+ mice. β-galactosidase is expressed from a lacZ knock-in at the Zfp106 locus. A section of the quadriceps muscle from an 8-week old Zfp106laczflox/+ mouse stained with X-gal is shown in (a). Arrowheads show β-galactosidase-expressing muscle fibers, weakly detectable by X-gal staining; scale bar, 100 μm. A section through the ventral horn of the spinal cord (lumbar region) of a Zfp106laczflox/+ mouse is shown in (b). The same section is shown in all three panels in (b); the green channel shows expression of the neuronal marker NeuN; the red channel shows expression of β-galactosidase expressed from the Zfp106 locus. Arrows denote co-expression of β-galactosidase and NeuN in large motor neurons in the ventral horn of the spinal cord; scale bar, 50 μm. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 00710. 7554/eLife. 19032. 008Figure 2—figure supplement 3. Expression of Zfp106 in wild type, knockout and HB9-Zfp106 transgenic mice. (a) Evaluation of Zfp106 expression by RT-qPCR in lumbar spinal cord of wild type, KOMP Zfp106 knockout and CRISPR Zfp106 knockout mice. Expression of Zfp106 mRNA is drastically and significantly reduced in lumbar spinal cord of both KOMP and CRISPR knockout mice. (b) Schematic of the transgenic construct used for generation of the motor neuron specific Zfp106 mice. The HB9 promoter drives expression of a 3xFLAG-2xSTREP N-terminally tagged Zfp106 and IRES-EGFP. (c) Evaluation of transgene expression by RT-qPCR in lumbar spinal cord at P10. Expression of Zfp106 mRNA ranged from ~1. 5 to 2 fold of wild type expression in two independent transgenic mouse lines, as assessed by qPCR with primers amplifying both endogenous and transgenic Zfp106. Data in a, c were analyzed by one-way ANOVA and Bonferroni' s Multiple Comparison Test. *p<0. 05; ***p<0. 001. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 00810. 7554/eLife. 19032. 009Figure 2—figure supplement 4. Rescue of ChAT+ motor neuron loss by restoration of Zfp106 to motor neurons in Zfp106 knockout mice. Representative images of transverse sections of lumbar spinal cord from wild type (a), motor neuron-specific Zfp106 transgenic (b), Zfp106 knockout (c), and Zfp106 knockout/motor neuron-specific Zfp106 transgenic mice (d), stained by anti-ChAT antibody. Arrowheads mark ChAT+ motor neurons. Scale bar, 200 µm. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 00910. 7554/eLife. 19032. 010Video 1. Zfp106-null mice exhibit a severe progressive neurodegenerative phenotype. The video shows a Zfp106 knockout mouse and a littermate control at 10 weeks of age. The Zfp106 knockout displays abnormal gait due to hind limb paralysis, severe kyphosis, wasting, and persistent hind limb clasping at tail suspension. The wild type mouse displays normal gait and normal extension of the hind limbs away from the abdomen during the tail suspension test. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 010 To gain insight into the cell autonomous requirements for Zfp106, we used the KOMP lacZ knock-in allele (van der Weyden et al., 2011) to examine Zfp106 expression using β-galactosidase activity as a sensitive method for detecting expression. This approach showed Zfp106 expression in both skeletal muscle and motor neurons (Figure 2—figure supplement 2a, b). Given the multiple lines of evidence for a role of Zfp106 in neurodegeneration, and the evident denervation observed in the knockout mice, we hypothesized that the primary requirement for Zfp106 was likely to be in motor neurons. We confirmed a highly significant and dramatic reduction in Zfp106 expression in spinal cord (Figure 2—figure supplement 3a). The ~80% reduction in Zfp106 expression is consistent with previous studies (Anderson et al., 2016; Joyce et al., 2016). Therefore, we used a transgenic approach in mice to restore Zfp106 expression only in motor neurons under the control of the Mnx1 promoter (herein called HB9, HB9-Zfp106) on a Zfp106 germline knockout background (Figure 2j; and Figure 2—figure supplement 3b, c). Importantly, restoration of Zfp106 specifically in motor neurons significantly suppressed the Zfp106 knockout wasting and muscle grip phenotypes and resulted in restoration of the number of ChAT-expressing motor neurons (Figure 2j–m; Figure 2—figure supplement 4), indicating a cell autonomous requirement for Zfp106 in motor neurons. To gain additional insights into the molecular function of Zfp106, we used mass spectrometry to identify all proteins co-immunoprecipitated by Zfp106 from 293T cells (Figure 3). Several controls were included in the mass spectrometry experiments, including the DNA-binding factors Etv2 and MEF2C and the RNA-binding proteins Vif and Tat. The interactomes for each of the controls were compared to the Zfp106 interactome using the previously described MiST algorithm, which determines specific interactions based on enrichment, reproducibility, and specificity compared to interaction with the negative controls (Jager et al., 2012). These experiments identified thirty-nine proteins that specifically interacted with Zfp106 (Figure 3a; Supplementary file 1). Gene ontology (GO) and protein complex analyses revealed a significant enrichment in interactors with roles in RNA processing, metabolism, and splicing (Figure 3a, b; Supplementary file 2), suggesting that Zfp106 may also play roles in these processes. 10. 7554/eLife. 19032. 011Figure 3. Zfp106 interacts with a network of other ALS-associated RNA-binding proteins. (a) Network representation of the Zfp106 interactome generated by Cytoscape. Zfp106 (yellow node) interacts with 39 proteins with top 5% MiST score (blue nodes). Curated protein-protein interactions from the CORUM database are indicated as nodes connected by green lines. (b) Gene Ontology (GO) Biological Process analysis of the Zfp106 interactome ranked by p value. The number of interacting proteins (top 5% by MiST score) in each category is indicated inside each bar. (c) Selected ALS-associated proteins within the top 5% MiST-scoring hits from the Zfp106 interactome are listed with putative functions associated with the pathobiology of ALS indicated. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 01110. 7554/eLife. 19032. 012Figure 3—figure supplement 1. Zfp106 interacts with TDP43 and Nup107 in Neuro-2a cells. Endogenous TDP43 and Nup107 coimmunoprecipitated with Zfp106 in Neuro-2a cells. Cells were transfected with 3×FLAG-2×STREP-Zfp106 or 3×FLAG-2×STREP parental vector and lysates were subjected to immunoprecipitation with anti-FLAG beads, followed by anti-FLAG (top), anti-Nup107 (middle), and anti-TDP43 (bottom) western blotting. Nup107 and TDP43 were coimmunoprecipitated by anti-FLAG IP only in lysates from cells expressing FLAG-Zfp106. The immunoglobulin heavy chain (IgG HC) of the anti-FLAG antibody is indicated. Molecular weight markers in kD are indicated on the left. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 012 There is growing and compelling genetic and pathological evidence that dysregulated RNA processing and metabolism contribute to the development of ALS and C9orf72 ALS in particular (Ling et al., 2013; Prudencio et al., 2015). Interestingly, several of the Zfp106-interacting proteins identified in our affinity purification-mass spectrometry experiment are proteins directly associated with ALS and/or C9orf72 ALS, including splicing factors TDP-43 and FUS, the nucleolar protein Nucleolin, and the nuclear pore component Nup107 (Freibaum et al., 2015; Haeusler et al., 2014; Lagier-Tourenne et al., 2010; Ling et al., 2013); Figure 3c; Supplementary file 1). We further examined the interaction of Zfp106 with TDP-43 and Nup107, as examples of interacting proteins, by anti-Flag-Zfp106 immunoprecipitation followed by western blot for TDP43 and Nup107 in Neuro-2a cells (Figure 3—figure supplement 1). These experiments confirmed and validated the interaction with these other ALS-associated proteins and support the notion that Zfp106 is part of an RNA metabolic pathway (or pathways) that when dysregulated leads to neurodegeneration. Prior studies have used Drosophila as an in vivo gain-of-function model of C9orf72 neurodegeneration (Freibaum et al., 2015; Tran et al., 2015; Xu et al., 2013; Zhang et al., 2015). Here, we used the GAL4-UAS system to coexpress mouse Zfp106 and GGGGCC repeats in the fly in a gain-of-function approach to determine if the interaction between Zfp106 and GGGGCC repeats had a functional consequence in this model (Figure 4; Figure 4—figure supplement 1a). Expression of 30 tandem copies of the GGGGCC hexanucleotide in the 5′-untranslated region of a UAS-dependent gfp transcript (30R-GFP) in glutamatergic neurons using OK371-GAL4 (Mahr and Aberle, 2006) caused ~50% lethality due to an apparent failure of flies to eclose from the pupal case (Figure 4a). Furthermore, 28 day-old OK371; 30R-GFP-expressing flies that did manage to successfully eclose exhibited profound defects in locomotor activity compared to control flies (Figure 4b). No overt eclosion or locomotor phenotype was observed in flies expressing GFP only, 3R-GFP, or Zfp106 alone in glutamatergic neurons (Figure 4a, b). Previous studies have also shown that expression of 30R-GFP causes a reduction in the number of active zones in Drosophila larval neuromuscular junctions (Zhang et al., 2015). Consistent with those studies, we found that expression of 30R-GFP reduced active zones as measured by anti-Bruchpilot (Brp) immunofluorescence and quantification (Figure 4c–f). Remarkably, co-expression of Zfp106 with 30R-GFP restored Brp expression at larval active zones (Figure 4c–f) and completely suppressed the ~50% lethality caused by expression of 30R-GFP (Figure 4a). Moreover, co-expression of Zfp106 partially suppressed the adult locomotor defect caused by expression of 30R-GFP (Figure 4b). Importantly, co-expression of Zfp106 did not result in a reduction in the expression of 30R-GFP mRNA Figure 4—figure supplement 1b), indicating that the suppression of the neurotoxic phenotype in Drosophila was not due to dilution of GAL4 protein. Taken together, these data show that Zfp106 is a potent suppressor of neurodegeneration in a C9orf72 ALS model, and the results from this gain-of-function model support the idea that Zfp106 functionally interacts with C9orf72 GGGGCC RNA repeats. 10. 7554/eLife. 19032. 013Figure 4. Zfp106 suppresses GGGGCC-mediated neurotoxicity in Drosophila. (a) Schematics and Punnett squares from crosses of UAS-Zfp106; UAS-30R-GFP (left) and UAS-Zfp106; UAS-3R-GFP (right) transgenic flies to OK371-GAL4 flies. The Punnett squares show the number of flies that eclosed from the indicated crosses and show that expression of 30R-GFP resulted in failure of ~50% of flies to eclose (25 actual versus 54. 5 predicted); this defect was completely suppressed by co-expression of Zfp106. The Chi-square test (χ2) was used to determine the significance of the differences between the observed and expected frequencies of the expected genotypes. (b) Locomotor activity of 28-day post-eclosion flies of the indicated genotypes assessed by rapid iterative negative geotaxis (RING) assay. Data are presented as the mean height climbed ± SEM. A two-way ANOVA analysis of the locomotor data revealed a significant effect of repeat expression (p<0. 0001) and Zfp106 expression (p<0. 01) on locomotor activity, with a significant interaction between the two factors (p<0. 01); i. e. Zfp106 coexpression significantly suppresses neurotoxicity induced by expression of 30R (p<0. 01) by Bonferroni' s posthoc Multiple Comparison Test. n = 25 male flies for each genotype; ****p<0. 0001, **p<0. 01. (c, d, e) Representative NMJs of muscle 6/7 in abdominal segment A3 of third instar larvae of the indicated genotypes co-stained with anti-HRP (neuronal marker, red channel) and anti-Bruchpilot (Brp) (active zone marker, green channel). Staining of the active zone component Brp shows that expression of 30R causes a reduction in Brp-positive active zones [arrowheads in (d) compared to control in c]. Coexpression of Zfp106 suppressed the reduction in Brp-positive active zones caused by 30R [arrowheads in e compared to d]. (f) Quantification of active zones as total voxel occupancy by Brp signal at each terminal shows that Zfp106 significantly suppresses the reduction in active zone caused by expression of 30R. Data were analyzed by one-way ANOVA and Bonferroni' s Multiple Comparison Test. ***p<0. 001, ****p<0. 0001. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 01310. 7554/eLife. 19032. 014Figure 4—figure supplement 1. GAL4-dependent expression of Zfp106 in Drosophila does not affect 30R-gfp mRNA levels. (a) Anti-FLAG western blot conducted on lysates from heads dissected from transgenic flies of the indicated genotypes. The band in lane 3 migrating below the 225 kD marker indicates that UAS-3×FLAG-2×STREP-Zfp106 (UAS-Zfp106) transgenic flies express Zfp106 in a GAL4-dependent manner. (b) Evaluation of 30R-gfp expression by RT-qPCR in flies expressing 30R alone or coexpressing 30R and Zfp106. Zfp106 coexpression does not cause alterations in 30R-gfp mRNA levels. DOI: http: //dx. doi. org/10. 7554/eLife. 19032. 014 The ability of Zfp106 to suppress the neurotoxic gain-of-function effect of rGGGGCC repeats has important implications for understanding and possibly ameliorating the pathology of C9orf72 ALS. Previous studies have suggested roles for Zfp106 in rDNA transcription and in pre-rRNA processing (Ide and Dejardin, 2015; Tafforeau et al., 2013). Zfp106 was also identified as a polyadenylated mRNA binding protein in an interactome capture study aimed at defining an atlas of mammalian mRNA binding proteins (Castello et al., 2012). Interestingly, our interactome data also suggest possible roles for Zfp106 in multiple steps of RNA metabolism and processing and interaction with key RNA binding proteins involved in various forms of neurodegeneration. Precisely how disrupting these processes leads to neurodegeneration and exactly how this relates to C9orf72 ALS/FTD remains to be determined. A simple model is that sequestration of Zfp106 by the expanded repeats disrupts normal Zfp106 function in patients with C9orf72 ALS in a sponge-like mechanism (Cooper-Knock et al., 2014; Mizielinska and Isaacs, 2014). Alternatively, one might speculate that Zfp106 plays other functions important in the biology of C9orf72, such as influencing dipeptide repeat protein (DPR) production or affecting nucleolar function or nucleocytoplasmic transport via interactions with Nucleolin or Nup107, which have also been implicated in the pathobiology of C9orf72 ALS (Boeynaems et al., 2016; Freibaum et al., 2015; Haeusler et al., 2014; Jovičić et al., 2015; Kwon et al., 2014; Zhang et al., 2015). Future studies will address the molecular targets and mechanisms of action of Zfp106 in order to gain further insights into the pathogenesis of C9orf72 ALS and to identify new possible therapeutic targets for neuroprotection. A murine Zfp106 cDNA corresponding to NCBI accession number XM_006499044. 2 and a murine Mbnl1 cDNA corresponding to NCBI accession number NM_020007. 4 were cloned by PCR from an E13. 5 embryonic heart cDNA library; the amplified cDNAs were subcloned into mammalian expression plasmid pcDNA4/TO (Invitrogen, Carlsbad, CA) modified to include N-terminal 3×FLAG-2×STREP tags. The 3×FLAG-2×STREP-Zfp106 cassette was subsequently subcloned into the EcoRI/XhoI sites of pUAST (Brand and Perrimon, 1993; Flybase ID FBmc0000383) for subsequent generation of transgenic flies, and into the AgeI/SpeI sites of HB9-MCS-IRES-EGFP (Addgene plasmid #16283) for generation of motor neuron-specific HB9-Zfp106 transgenic mice. The Zfp106Δ allele was generated by CRISPR-mediated genome editing (Wang et al., 2013). 5′-atattgtgccacatcgtgtatgg-3’ and 5′-tttttgagccatacacgatgtgg-3’ sgRNAs, which target exon 1 (ENSMUSE00001311370) of mouse Zfp106, were transcribed in vitro using the MEGAshortscript T7 kit (Life Technologies, AM1354) and were purified using the MEGAclear kit (Life Technologies, AM1908). Purified sgRNAs and in vitro-transcribed Cas9 mRNA were co-injected into the cytoplasm of fertilized mouse oocytes using standard transgenic technology as described previously (De Val et al., 2004). Two independent F0 founders were independently outcrossed to wild-type mice, and F1 offspring were used for subsequent Zfp106Δ intercrosses. The mouse strain Zfp106tm1a (KOMP) Wtsi (RRID: IMSR_KOMP: CSD26348-1a-Wtsi) was generated from ES cell clone EPD0033_4_C03, obtained from the NCRR-NIH supported KOMP Repository (www. komp. org) and generated by the CSD consortium for the NIH funded Knockout Mouse Project (KOMP). The targeted allele contains a promoterless LacZ-Neo cassette, which also contains an En2 splicing acceptor (En2 SA) and polyadenylation signal (pA), flanked by FRT sites; the targeted allele also has loxP sites flanking exon 2 (Testa et al., 2004; ENSMUSE00000454975). To generate Zfp106laczΔ/+ mice, male Zfp106laczflox/+ mice were crossed to female Mef2c-AHF-Cre mice (Verzi et al., 2005); RRID: MMRRC_030262-UNC). When crossed from the female, Mef2c-AHF-Cre functions as a universal deleter line due to Cre expression in the female germline, resulting in Cre-dependent recombination in all cells in all offspring (Ehlers et al., 2014). Transgenic HB9-3×FLAG-2×STREP-Zfp106-IRES-egfp (HB9-Zfp106) mice expressing Zfp106 in motor neurons under the control of the promoter of the Mnx1 gene (herein called HB9), were generated by standard pronuclear injection of the HB9-3×FLAG-2×STREP-Zfp106-IRES-EGFP plasmid linearized by XhoI digestion. Injected embryos were implanted into pseudo-pregnant females, and F0 founders were screened by PCR. Grip strength was measured by Kondziella inverted screen test (Deacon, 2013; Kondziella, 1964). Genotyping of mutant and transgenic mice was performed by PCR on genomic DNA isolated from tail biopsies using the following primers: Zfp106Δ, 5′-caggaggctgtgctgtgata-3’ and 5′-attctaggactgggaggcaga-3′; Zfp106laczΔ and Zfp106laczflox 5′-ccccctgaacctgaaacata-3’ and 5′-gaaagtcccagctgcaagac-3’ for the mutant allele and 5′-tgaatcagctcgtaaacggac-3’ and 5′-atgaccgctcaaatcgatcaa-3’ for the wild type allele; HB9-3×FLAG-2×STREP-Zfp106-IRES-egfp, 5′-aagttcatctgcaccaccg-3’ and 5′-tccttgaagaagatggtgcg-3′. UAS-GFP, UAS-3R-GFP and UAS-30R-GFP transgenic Drosophila melanogaster lines were a generous gift of Peng Jin (Emory University) and have been described previously (Xu et al., 2013). GMR-GAL4 (FBst0008605) and OK371-GAL4 (FBst0026160) lines were obtained from the Bloomington Stock Center. UAS-3×FLAG-2×STREP-Zfp106 (UAS-Zfp106) transgenic D. melanogaster were generated by standard w+ P-element-mediated transgenesis (Brand and Perrimon, 1993) on a w1118 background (BestGene, Inc.). Flies were maintained at 23°C, unless otherwise indicated. For western blot detection of the Zfp106 transgene, flies were shifted to 30°C for 3 days prior to removing heads for protein extraction to induce higher expression of GAL4 from GMR-GAL4. Mouse Neuro-2a (ATCC, CCL-131; RRID: CVCL_0470) and human HEK293T cells (ATCC, CRL-3216; RRID: CVCL_0063) were obtained directly from ATCC and maintained in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum (FBS, Gibco, Waltham, MA) and penicillin-streptomycin (Gibco). All cell lines were routinely tested for Mycoplasma contamination with the MycoAlert PLUS Mycoplasma Detection Kit (Lonza, Switzerland, LT07-705) and found to be negative. Biotinylated-RNA pull-down of nuclear proteins was performed as previously described with modifications (Marin-Bejar and Huarte, 2015). 100 pmol of ssRNA oligomer [either r (GGGGCC) 8 or r (AAAACC) 8] biotinylated at the 3’ end (Integrated DNA Technologies, Inc.) were incubated with 50 µl of pre-washed Nucleic Acid Compatible Streptavidin Magnetic Beads (Pierce Magnetic RNA-Protein Pull-Down kit, cat. n. 20164) in RNA capture buffer (20 mM Tris, pH 7. 5; 1 M NaCl; 1 mM EDTA) for 30 min on a rotary shaker. The beads were washed twice in 20 mM Tris at 4°C for 5 min each and then incubated with nuclear extract for 4 hr at 4°C. Approximately 1 × 107 Neuro-2a cells were detached from cell culture dishes when they were approximately 80% confluent with 10 mM EDTA in PBS, incubated in Harvest Buffer (10 mM HEPES, pH 7. 9; 50 mM NaCl; 0. 5 M sucrose; 0. 1 mM EDTA; 0. 5% NP-40) for 10 min on ice. Nuclei were pelleted by centrifugation at 4500 × g for 10 min at 4°C, washed for 5 min in buffer A (10 mM HEPES, pH 7. 9; 10 mM KCl; 0. 1 mM EDTA; 0. 1 mM EGTA), centrifuged again at 4500 × g for 5 min at 4°C and lysed in IP buffer (50 mM Tris, pH7. 4; 150 mM NaCl; 1 mM EDTA) plus 0. 5% NP-40. Complete protease inhibitor and PhosSTOP phosphatase inhibitor (Roche) were added to all buffers. After incubation with the nuclear extracts, beads were washed 3× in IP buffer plus 0. 05% NP-40, and then 1× in IP buffer without NP-40. Co-precipitated proteins were eluted from bound biotinylated RNAs in 45 µl 50 mM Tris-Cl, pH7. 4; 150 mM NaCl; 1 mM EDTA plus 0. 05% RapiGest (Waters Corp., Milford, MA). Precipitated proteins were then detected by mass spectrometry or western blot. 100 pmol of r (GGGGCC) 4 or r (CUG) 8 single-stranded RNA (Integrated DNA Technologies, Inc.) were 5′-end labeled with [γ-32P]ATP and T4 Polynucleotide Kinase (New England Biolabs) as previously described (Rio, 2014). Unincorporated radioactivity was removed using Illustra MicroSpin G-25 Columns (GE Healthcare Life Sciences, UK). RNA EMSA was then performed as previously described (Rio, 2014) by incubating the labeled RNA (100,000 cpm) with purified Zfp106 or MBNL1 protein for 30 min at room temperature in 1× binding buffer (40 mM Tris-Cl, pH 8. 0; 30 mM KCl; 1 mM MgCl2; 0. 01% NP-40; 1 mM DTT; 5% glycerol; 10 µg/ml bovine serum albumin). The RNA-protein mixtures were then electrophoresed in 6% acrylamide-TBE gels. Gels were dried and exposed to X-ray film for analysis. For the competition experiments, the purified proteins were preincubated for 10 min at room temperature with 30-fold molar excess of the following unlabeled single-stranded RNAs: r (GGGGCC) 4, r (AAAACC) 4, r (CUG) 8, or a mutated (mut) GGGGCC repeat sequence, r (GAGGCCGGGACCGAGACCGAGGCC). Skeletal muscles were isolated from sex- and age-matched mice, mounted on cork discs with 10% tragacanth gum (Sigma) and immediately frozen in liquid nitrogen-cooled isopentane. Frozen muscles were then cryosectioned at a thickness of 10 μm and stained with hematoxylin and eosin as previously described (Verzi et al., 2005). For X-gal staining, cryosections were fixed in ice cold 4% formaldehyde, 0. 5% glutaraldehyde in PBS for 2 min and then stained as previously described (Verzi et al., 2005). Spinal cords were dissected from mice perfused with 4% PFA, additionally post-fixed with 4% PFA overnight, equilibrated with 30% sucrose in PBS and embedded in OCT. Immunostaining for choline acetyltransferase (ChAT) was performed on 40 μm free-floating cryostat sections as described previously (Qiu et al., 2014) with goat anti-ChAT antibody (1: 300; Millipore, AB144P; RRID: AB_2079751) and biotinylated rabbit anti-goat (1: 200; Vector Laboratories, BA-5000; RRID: AB_2336126) as secondary antibody, followed by diaminobenzidine immunoperoxidase development using the Vectastain Elite ABC kit (Vector Laboratories, PK-6105) and the DAB substrate kit for peroxidase (Vector Laboratories, SK-4100). Post-mortem human spinal cord tissue was obtained from the UCSF Neurodegenerative Disease Brain Bank (NDBB). Formalin fixed paraffin-embedded tissue blocks were cut into 10 µm-thick sections. Tissue sections were subjected to antigen retrieval by autoclaving at 120°C for 5 min in 0. 1M citrate buffer, pH 6. 0. Immunohistochemistry was performed with rabbit anti-Zfp106 (1: 500; Bethyl, A301-526A; RRID: AB_999690). Following immunostaining, digital images were captured using a high resolution digital camera (Nikon DS-U2/L2) mounted on a Nikon Eclipse80i microscope using NIS-Elements (Version 3. 22, Nikon) imaging software. Mouse spinal cords were dissected and then fixed in 2% paraformaldehyde overnight at 4°C, embedded in paraffin and then sectioned at 20 μm for subsequent immunofluorescence analyses. Neuro-2a cells were grown on coverslips and fixed with 4% PFA for 10 min. Immunofluorescence was performed as described previously (Anderson et al., 2004) with the following antibodies: mouse anti-NeuN (1: 500; Millipore, MAB377; RRID: AB_177621), chicken anti-β-gal (1: 500; Aves, BGL1040; RRID: AB_2313507), rabbit anti-Zfp106 (1: 100; Bethyl, A301-527A; RRID: AB_999691). Alexa Fluor 594 goat anti-chicken (1: 500; Molecular Probes A11042; RRID: AB_142803), Alexa Fluor 488 donkey anti-mouse (1: 500; Molecular Probes A21202; RRID: AB_141607), and Alexa Fluor 594 donkey anti-rabbit (1: 500; Molecular Probes A21207 RRID: AB_141637) were used as secondary antibodies. The slides were counterstained and mounted with SlowFade Gold antifade reagent with DAPI (Life Technologies, Waltham, MA). Confocal images were acquired with a Leica TCS SPE laser scanning confocal system. For coimmunoprecipitation, Neuro-2a cells were transfected with 7 µg of 3×FLAG-2×STREP-Zfp106 or 3×FLAG-2×STREP parental vector per 55 cm2 plate by using GenJet in vitro DNA Transfection Reagent for Neuro-2A Cells, according to the manufacturer’s recommendations (Signagen, Rockville, MD). Cells were lysed in Benzonase Lysis Buffer [20 mM Tris-HCl (pH 7. 5), 40 mM NaCl, 2 mM MgCl2,0. 5% NP-40 and Complete EDTA-free protease inhibitor (Roche, Switzerland) ] with the addition of 100 U/ml benzonase (Novagen, Germany) to digest nucleic acids. After incubation for 30 min on ice, NaCl concentration was increased to 150 mM and the lysates were further incubated with agitation for 30 min at 4°C. After clearing, the lysates were incubated with pre-washed anti-FLAG (M2) -conjugated magnetic beads (Sigma, St. Louis, MO, M8823) for 4 hr at 4°C. The beads were then washed five times with IP Buffer with 0. 05% NP40, before incubation at 70°C for 10 min in 2× NuPAGE Sample Buffer (ThermoFisher Scientific, Waltham, MA, NP0007) supplemented with NuPAGE Sample Reducing Agent (ThermoFisher Scientific, NP0004) to release coimmunprecipitated proteins. Samples were then subjected to SDS-PAGE and western blot using standard procedures. For western blot to detect Zfp106 in transgenic D. melanogaster, heads from 40 Gmr-Gal4, UAS-3×FLAG-2×STREP-Zfp106, and Gmr-Gal4; UAS-3×FLAG-2×STREP-Zfp106 flies were removed and homogenized in RIPA buffer (50 mM Tris-Cl, pH 7. 4; 150 mM NaCl; 2 mM EDTA; 1% NP-40; 0. 2% SDS) with a Dounce homogenizer (Wheaton, Millville, NJ). Homogenates were cleared by centrifugation, and total protein content was quantified with the Bio-Rad Protein Assay kit (Bio-Rad, 5000002). An equivalent amount of total protein for each sample was subjected to SDS-PAGE and western blot using standard procedures. The following antibodies were used for western blot: rabbit anti-Zfp106 (1: 1000; Bethyl, A301-527A; RRID: AB_999691); mouse anti-FLAG (1: 1,000; Sigma, F3165 (clone M2); RRID: AB_439685), mouse anti-actin (1: 500; Developmental Studies Hybridoma Bank, JLA20; RRID: AB_528068), rabbit anti-TDP-43 (1: 1000; Proteintech, 12892–1-AP; RRID: AB_2200505) and rabbit anti-Nup107 (1: 1000; Proteintech, 19217–1-AP; RRID: AB_10597702). For RT-qPCR, total RNA was extracted from lumbar spinal cord from mice or from 20 flies per genotype using Trizol (Invitrogen). RNA was treated for 1 hr at 37°C with DNaseI, followed by cDNA synthesis using the Omniscript RT kit (Qiagen). qPCR was performed using the MAXIMA SYBR Green kit (Thermo Scientific) and a 7900HT Fast Real Time PCR System (Applied Biosystems). The SDS 2. 4 software package was used to extract raw qPCR data. Data were normalized to housekeeping genes by the 2−ΔΔCt method. The following primers were used for qPCR in mice: primers 5′-atttggcgttgtggatcact-3’ and 5′-gcgttcaatatgtcctgcaa-3’ for amplification of Zfp106 exon 21–22 and 5′-accacagtccatgccatcac-3’ and 5′-tccaccaccctgttgctgta-3’ for amplification of gapdh. The following primers were used for qPCR in flies: 5′-gcgcggttactctttcacca-3’ and 5′- atgtcacggacgatttcacg-3’ for actin, and 5′-gcacgacttcttcaagtccgccatgcc-3’ and 5′-gcggatcttgaagttcaccttgatgcc-3’ for egfp. HEK293T cells were transfected with 20 µg of 3×FLAG-2×STREP-Zfp106 or 5 µg of 3×FLAG-2×STREP-MBNL1 plasmid per 150 cm2 plate by using PolyJet DNA In Vitro Transfection Reagent, according to the manufacturer’s recommendations (Signagen). For RNA EMSA, Zfp106 and MBNL1 were purified from HEK293T total cellular lysates using the Strep-Tag system (Schmidt and Skerra, 2007), with Strep-Tactin Sepharose (IBA, catalog #2-1201-010), according to the manufacturer’s protocol. 0. 1% Triton X-100 was added to all buffers for cell lysis and chromatography to enrich for purified proteins. Eluted fractions were analyzed by SDS-PAGE stained with Coomassie brilliant blue. Comparable amounts of Zfp106 and MBNL1 were used in RNA EMSA. A parallel purification from HEK293T cells transfected with the 3×FLAG-2×STREP parental vector was performed and the corresponding fractions in which Zfp106 and MBNL1 were eluted were used in RNA EMSA as a negative control. Affinity purification of Zfp106 for identification of interacting proteins by mass spectrometry was performed as previously described (Jager et al., 2012). Briefly, cleared nuclear extracts from HEK293T cells were prepared as described above (Biotinylated-RNA pull-down section) with the introduction of a benzonase digestion step to digest nucleic acids (100 U/ml for 30 min in the presence of 1 mM MgCl2) and incubated with pre-washed anti-FLAG (M2) -conjugated magnetic beads (Sigma, M8823) for 2 hr at 4°C. Following purification, complexes bound to beads were washed and then eluted in IP buffer containing 100 µg/ml 3×FLAG peptide (Elim Biopharm) and 0. 05% RapiGest (Waters Corp.). To analyze proteins by liquid chromatography-mass spectrometry (LC-MS/MS), the eluates were digested with trypsin, and the peptides were analyzed on a Velos Pro mass spectrometry system (Thermo Scientific). Peptides were matched to protein sequences by the Protein Prospector Algorithm (RRID: SCR_014558), and data were searched against a database containing SwissProt human protein sequences (UniProt Consortium, 2015; UniProtKB, RRID: SCR_004426; http: //www. uniprot. org). Parallel FLAG-affinity purifications were performed on untransfected HEK293T cells and HEK293T cells transfected with 3xFLAG-2xSTREP tag only, GFP-3xFLAG-2xSTREP or the following 3xFLAG-2xSTREP-tagged proteins: Vif, Tat, MEF2C, Myocardin, and Etv2. The bait-prey datasets were analyzed with the APMS scoring algorithm MiST (Jager et al., 2012), and an in-house curated APMS dataset used for determining machine background noise. The MiST algorithm compares peak intensities from the mass spectrum to determine abundance, reproducibility across multiple replicated experiments (n = 5 for each condition), and specificity based on the uniqueness of each interaction, and then these three metrics are used to determine a composite score by the algorithm (Jager et al., 2012). The Zfp106 interactome was compiled by selecting bait-prey pairs with a top 5% MiST score. Enrichment analysis for GO biological process terms overrepresented in the interactome was performed on the Gene Ontology Consortium website (Gene Ontology Consortium, 2015; RRID: SCR_002811; http: //www. geneontology. org). The top 5% MiST hits were visualized as network representation using Cytoscape (Cline et al., 2007; RRID: SCR_003032). Protein complex analysis was performed using the manually curated CORUM protein complex database (Ruepp et al., 2008; RRID: SCR_002254; http: //mips. helmholtz-muenchen. de/corum/). For analysis of neuromuscular junction (NMJ) phenotypes in Drosophila, wandering third instar larvae were dissected as previously described (Smith and Taylor, 2011). Dissected larvae were fixed in 3. 7% formaldehyde in PBS for 20 min, washed in PBT (PBS with 0. 4% Triton X-100) and blocked with 10% normal goat serum for 1 hr at room temperature. The larvae were then incubated overnight at 4°C with mouse anti-Brp antibody (1: 50; Developmental Studies Hybridoma Bank, nc82; RRID: AB_2314865) to label the active zones and Cy3 goat anti-HRP (1: 200; Jackson ImmunoResearch, 123-165-021; RRID: AB_2338959) to label the NMJ membrane and axons. Next, samples were washed in PBT and incubated with Alexa Fluor 488 goat anti-mouse (1: 200; Molecular Probes, A11001; RRID: AB_2534069) in PBT + 10% normal goat serum at room temperature for 2 hr. Multiple confocal stacks were acquired using a point scanning confocal microscope (Leica TCS SPE) and then processed using the DeadEasy Synapse ImageJ plugin (Sutcliffe et al., 2013), which provides total voxel occupancy by Brp signal at each nerve terminal. Brp signal was quantified at muscle 6/7 NMJs from abdominal segment A3. Locomotor activity in 28-day post-eclosion flies was assayed by the Rapid Iterative Negative Geotaxis (RING) assay, as previously described (Gargano et al., 2005; Nichols et al., 2012). Briefly, 25 flies for each genotype were transferred without anesthetizing in polystyrene vials assembled in a RING apparatus. The RING apparatus was sharply tapped down three times and negative geotaxis was recorded on video for six trials for each genotype. The average height climbed at 3 s after completion of the third tap was scored for each genotype. Statistical analyses were performed using GraphPad Prism 5. 0 (GraphPad Software; RRID: SCR_002798). Data were analyzed by one-way or two-way ANOVA followed by Bonferroni’s Multiple Comparison Test or by t-test.

Title: Suppression of C9orf72 RNA repeat-induced neurotoxicity by the ALS-associated RNA-binding protein Zfp106 Summary: Molecules of ribonucleic acid (or RNA for short) have many roles in cells, including acting as templates to make proteins. RNA is made of building blocks called nucleotides that are assembled to form strands. The precise order of the nucleotides in an RNA molecule can have a dramatic effect on the role that RNA plays in the body. For example, amyotrophic lateral sclerosis (ALS) is a deadly disease caused by the gradual loss of the nerve cells that control muscle (known as motor neurons). The most common cause of inherited ALS is a genetic mutation that results in some RNA molecules having many more copies of a simple six nucleotide sequence known as GGGGCC than normal cells. RNA molecules with these "GGGGCC repeats" form clumps in motor neurons. The clumps of RNA molecules also contain proteins, but the identities of these RNA-binding proteins and the roles they play in ALS remain largely unknown. Celona et al. have now identified a new RNA-binding protein called Zfp106, which binds specifically to GGGGCC repeats in mice and fruit flies. Removing the gene that encodes Zfp106 from mice causes the mice to develop ALS. On the other hand, restoring Zfp106 only to the motor neurons of these mutant mice prevents the mice from developing disease. This suggests that Zfp106's role is specific to motor neurons. Indeed, fruit flies that have too many copies of GGGGCC develop severe symptoms reminiscent of ALS. Introducing a mammalian version of Zfp106 into these flies prevents them from developing the disease. The findings of Celona et al. suggest that Zfp106 might be a potential new drug target for treating ALS in humans. The next step following this work will be to find out exactly how Zfp106 regulates normal cellular processes by binding to RNA and how it suppresses ALS-like disease by binding to GGGGCC RNA-repeats.

lay_elife

en

Write a title and summarize: Perinatal brain injuries, including hippocampal lesions, cause lasting changes in dopamine function in rodents, but it is not known if this occurs in humans. We compared adults who were born very preterm with perinatal brain injury to those born very preterm without perinatal brain injury, and age-matched controls born at full term using [18F]-DOPA PET and structural MRI. Dopamine synthesis capacity was reduced in the perinatal brain injury group relative to those without brain injury (Cohen’s d = 1. 36, p=0. 02) and the control group (Cohen’s d = 1. 07, p=0. 01). Hippocampal volume was reduced in the perinatal brain injury group relative to controls (Cohen’s d = 1. 17, p=0. 01) and was positively correlated with striatal dopamine synthesis capacity (r = 0. 344, p=0. 03). This is the first evidence in humans linking neonatal hippocampal injury to adult dopamine dysfunction, and provides a potential mechanism linking early life risk factors to adult mental illness. More than 10% of babies born in the USA are born preterm (born before 37 weeks of gestation), and about 2% are born very preterm (VPT, before 32 weeks of gestation) (Hamilton et al., 2015). Premature birth is a risk factor for cognitive impairment (Anderson, 2014) and a number of psychiatric disorders, including schizophrenia and affective disorders (Nosarti et al., 2012). The second and third trimesters of gestation are critical periods for neurodevelopment, particularly for axon and synapse formation, glial proliferation and the development of neurotransmitter systems including the dopaminergic system (de Graaf-Peters and Hadders-Algra, 2006). Thus, VPT birth occurs during a critical time for the development of a number of neural systems, when the brain is particularly susceptible to exogenous and endogenous insults (Volpe, 2009). VPT babies are at risk of sustaining a variety of perinatal brain injuries, including periventricular haemorrhage, ventricular dilatation and periventricular leukomalacia that are often associated with hypoxic-ischaemic events (Huang and Castillo, 2008). The sequelae of VPT birth include long-lasting and widespread structural brain alterations, with hippocampal and prefrontal cortical development consistently affected (Nosarti and Froudist-Walsh, 2016). There is substantial evidence from animal models that perinatal brain injury due to hippocampal lesions (Lipska et al., 1993) or obstetric complications (Boksa and El-Khodor, 2003) can lead to long-term alterations in the dopamine system, which remain evident in adulthood. Several animal models of schizophrenia have linked hippocampal lesions at different life stages to altered dopaminergic function. Neonatal ventral hippocampal lesions lead to behavioural alterations normally associated with increased dopaminergic activity (Lipska et al., 1993) despite a reduction, or no change in presynaptic dopamine activity (Lillrank et al., 1999; Wan et al., 1996). In contrast, both adult hippocampal lesions and pre-natal injection of the mitotoxin methylazoxymethanol acetate (MAM) into the ventral hippocampus lead to similar behavioural effects and increased presynaptic dopaminergic activity (Lodge and Grace, 2007; Wilkinson et al., 1993). This may mirror the increased dopamine synthesis and release seen in human schizophrenia (Howes et al., 2012), a condition that has long been associated with obstetric complications (Cannon et al., 2002). In rodents, neonatal hippocampal lesions lead to disrupted development of the prefrontal cortex (Flores et al., 2005; Tseng et al., 2008). We have previously demonstrated structural and functional cortico-striatal connectivity alterations following very preterm birth (Karolis et al., 2016; White et al., 2014), which could have significant effects on dopamine transmission (Cachope and Cheer, 2014; Zhang and Sulzer, 2003). However, it is not known if perinatal brain injury is associated with dopaminergic alterations in adulthood in humans, or how this relates to hippocampal and prefrontal structural alterations. We aimed to disentangle the preclinical, post-mortem and indirect clinical evidence regarding the effects of early brain insults on later dopamine function by directly comparing two contrasting hypotheses, namely that early brain injury leads to hyper-, or alternatively hypo-dopaminergia in the striatum. Moreover, in view of the preclinical findings showing that perinatal hippocampal lesions can lead to lasting alterations to the dopamine system (Lipska and Weinberger, 2000), and the vulnerability of the hippocampus to perinatal brain injury (Liu et al., 2004), we hypothesised that hippocampal volume and striatal dopaminergic function would be related. In an exploratory analysis we further investigated whether dorsolateral prefrontal cortex (dlPFC) volume was associated with striatal dopamine synthesis, or whether it mediated the relationship between hippocampal volume and striatal dopamine. Seventeen individuals from the VPT-perinatal brain injury group, fourteen from the VPT-no diagnosed injury group and fourteen from the term-born control group were recruited. One VPT-perinatal brain injury participant was excluded from both PET and MRI analysis as a diagnosis of hypothyroidism was discovered at assessment. Incomplete PET data were acquired in one subject from the VPT-no diagnosed injury group because the participant felt unwell and finished the PET scan early. This participant was also excluded from further analysis. In addition to the two participants (one perinatal brain injury, one very preterm no diagnosed injury) excluded from the PET study, four further participants (three perinatal brain injury, one control) were not included in the MRI study due to contraindications to scanning. Thus, thirteen individuals from the VPT-perinatal brain injury group, thirteen from the VPT-no diagnosed injury group and thirteen from the term-born control group had complete PET- and MRI-derived measures. VPT-perinatal brain injury participants had a lower gestational age and birth weight than VPT-no diagnosed injury participants (Table 1). This was expected as lower gestational age at birth and birth weight are strongly associated with increased risk of perinatal brain injury (Vollmer et al., 2003). There were no group differences in age at scanning, IQ, injected dose, gender, alcohol consumption, smoking or socio-economic status between the groups in the PET sample (Table 1). There was a significant effect of group on Kicer corresponding to a partial eta-squared of 0. 233 (a large effect size, Table 2). Post-hoc tests showed Kicer was significantly reduced in the VPT-perinatal brain injury group compared to the VPT-no diagnosed injury group (p=0. 023, Cohen’s d = 1. 36) and controls (p=0. 010, Cohen’s d = 1. 07) in the whole striatum with large effect sizes (Figure 1 Table 2; see also associated Figure 1 source data and Create Figure 1 script). There was no significant difference in Kicer between the VPT-no diagnosed injury group and controls (Figure 1, Table 2). The reduction in dopamine synthesis capacity was significant in the caudate nucleus and the nucleus accumbens, but not the putamen (see Table 2). Additional sensitivity analyses showed that the reduction in Kicer in the VPT-perinatal brain injury group remained significant when removing all participants who had a history of psychiatric diagnosis (VPT-perinatal brain injury group n = 4, VPT-no diagnosed injury group n = 2, control group n = 1) in the whole striatum (F = 4. 825, p=0. 023) and the caudate nucleus (F = 5. 608, p=0. 023) but not the nucleus accumbens (F = 3. 047, p=0. 061). Furthermore, when just including the participants who also took part in the MRI study (and hence had individual FreeSurfer-based striatal segmentations), reduced Kicer in the VPT-perinatal brain injury group remained significant in the whole striatum (F = 5. 708, p=0. 018), the caudate nucleus (F = 10. 130, p=0. 003) and in the nucleus accumbens (F = 4. 306, p=0. 034). The reduction in Kicer in the VPT-perinatal brain injury group remained significant when co-varying for age, IQ, region-of-interest (i. e. whole striatum, caudate, putamen or nucleus accumbens) volume and intracranial volume in the whole striatum (F = 7. 113, p=0. 005), the caudate nucleus (F = 7. 083, p=0. 005) and in the nucleus accumbens (F = 3. 663, p=0. 037). The two VPT groups differed not only on perinatal brain injury status, but also on gestational age at birth and birth weight (Table 1). Furthermore, younger gestational age and lower birth weight are both common risk factors for perinatal brain injury (Vollmer et al., 2003). When we combined these three neonatal risk factors into a single model to predict whole striatal Kicer, perinatal brain injury remained a significant predictor of dopamine synthesis capacity (F = 9. 23, p=0. 006), but neither gestational age at birth (F = 0. 01, p=0. 929), nor birth weight (F = 0. 01, p=0. 925) significantly predicted dopamine synthesis capacity. In order to further probe whether group differences in Kicer varied across striatal subregions, we performed a repeated-measures ANOVA with striatal subregion as the within-subjects factor, group as the between subjects factor and Kicer as the dependent variable. There was no significant subregion-by-group interaction (F = 1. 03, p=0. 398). As expected, there were significant effects of subregion (F = 81. 26 p<0. 001) and group (F = 6. 95, p=0. 003). There was a significant difference in hippocampal volumes across the three groups (Table 3). The VPT-perinatal brain injury group had significantly lower volumes than controls, while the VPT-no diagnosed injury group did not differ significantly from either group (Table 3). The group differences in hippocampal volume remained significant after controlling for intracranial volume (ICV) (F = 7. 19, p=0. 002). On assessing striatal volume with repeated-measures ANOVA, with striatal sub-region volume as a within-subjects factor and group as a between-subjects factor, we found no significant main effect of group (p=0. 081) and no significant group*subregion interaction (p=0. 123). Analysing the whole striatum and each sub-region separately using one-way ANOVAs and post-hoc t-tests confirmed that there were no significant between-group volumetric differences in the striatum (Table 3). We additionally analysed the estimated striatal volumes for all individuals with PET scans (i. e. including those without MRI), and again found that there were no significant between group differences in striatal volume as a whole (F = 0. 77, p=0. 628) or in any striatal subregion after FDR correction for multiple comparisons (caudate, F = 0. 17, p=0. 841; putamen, F = 2. 73, p=0. 154), although there was a trend for differences between groups in the volume of the nucleus accumbens, which did not reach significance (F = 4. 38, p=0. 076). There were no statistically significant differences between the control group and both VPT groups in dlPFC volume (Raw volumes, F = 0. 711, p=0. 499; Relative volumes, F = 1. 169, p=0. 324). A significant correlation was observed between hippocampal volume and Kicer in the caudate (r = 0. 34, p=0. 032, Figure 2A; see also associated Figure 2—source data 1 and Create Figure 2 script) and in the nucleus accumbens (r = 0. 32, p=0. 049, Figure 2B) across the whole sample. These associations remained significant when controlling for ICV (caudate Kicer - hippocampal volume, r = 0. 39, p=0. 017; nucleus accumbens Kicer, r = 0. 34, p=0. 036). In order to test the interaction between hippocampal volume and striatal subregion, we again performed a repeated-measures ANOVA, with subregion as the within-subject factor, hippocampal volume and intracranial volume as covariates and and Kicer as the dependent variable. We found a significant effect of hippocampal volume (F = 4. 90, p=0. 033), but no hippocampal volume by striatal subregion interaction (F = 0. 88, p=0. 420). Additionally, there was no significant effect of ICV on Kicer (F = 1. 11, p=0. 299). We then examined whether the relationship between hippocampal volume and striatal Kicer varied significantly by group, again by using region as a within-subjects factor, and this time having group and the group-by-hippocampal-volume interaction term as between-subjects factors. Again we found a significant main effect of group (F = 4. 794, p=0. 015), but no group by hippocampal volume interaction (F = 0. 41, p=0. 747). We recently conducted a large-scale structural analysis in an overlapping sample (Karolis et al., 2017). In that study, we found evidence of accelerated maturation of the prefrontal cortex, and slower maturation of the caudate nucleus in adults born very preterm. Within the prefrontal cortex, the dlPFC (anatomically the caudal middle frontal gyrus) shows consistent grey matter reductions in schizophrenia (Glahn et al., 2008), and reduced activation during working memory in adults born very preterm with perinatal brain injury (Froudist-Walsh et al., 2015). We therefore examined the relationship between dlPFC volume, hippocampal volume and striatal dopamine synthesis capacity. Using a general linear model, we used as dependent variables Kicer in the two subregions of the striatum which previously showed significant associations with hippocampal volume, namely the caudate nucleus and the nucleus accumbens, and used hippocampal and dlPFC volumes as independent variables. In the caudate model, hippocampal volume was still a significant predictor of dopamine synthesis capacity (F = 4. 45, p=0. 043), but dlPFC volume was not (F = 0. 05, p=0831). This was also the case when using relative, instead of raw dlPFC volumes (hippocampus: F = 4. 79, p=0. 03; dlPFC: F = 0. 33, p=0. 569). In the nucleus accumbens model, neither the hippocampus (F = 1. 81, p=0. 187) nor the dlPFC (F = 1. 56, p=0. 221) significantly predicted dopamine synthesis. Again, using relative dlPFC volumes did not alter the result (hippocampus: F = 2. 20, p=0. 148; dlPFC: F = 0. 99, p=0. 328). We recently demonstrated that in adulthood individuals born very preterm continue to display impairments in executive function, which are associated with less real-life achievement (Kroll et al., 2017). Striatal dopamine synthesis capacity has previously been associated with executive function ability, showing an inverted U-shaped relationship such that striatal dopamine synthesis capacity at both the upper and lower ends of the normal range are associated with poorer executive performance (Cools and D' Esposito, 2011). We performed an additional exploratory analysis to assess whether dopamine synthesis capacity was associated with performance on the Hayling Sentence Completion Test (Burgess and Shallice, 1997), Controlled Oral Word Association Test (COWAT) (Ruff et al., 1996), the Stockings of Cambridge and the Intra-Extra Dimensional Shift tasks from the Cambridge Neuropsychological Test Automated Battery (CANTAB) (Fray et al., 1996) and part B of the Trail Making Test (Tombaugh, 2004). The relationship between each of these measures of executive function and dopamine synthesis capacity was examined using Spearman correlations. We found no significant associations between striatal dopamine synthesis capacity and executive function in any group (closest association found in controls between striatal dopamine synthesis and performance on the COWAT: r = 0. 575, p=0. 05). We recently showed in an expanded sample, including the subjects from the present study, that adults born very preterm are more likely to exhibit subclinical symptoms across a range of symptom dimensions (Kroll et al., 2017b), as assessed using the Comprehensive Assessment of At Risk Mental States (CAARMS) (Yung et al., 2005) compared to controls. In the subsample used in the present study, there were no significant between group differences in subclinical symptoms on any CAARMS subscale (max F = 1. 188, min p=0. 318). Nonetheless, it is possible that the presence of subclinical symptoms is associated with alterations to the dopamine system. We thus performed an exploratory analysis, to identify potential relationships between subclinical symptom expression and regional striatal dopamine synthesis. We found that, across the entire study sample, there was a negative correlation between dopamine synthesis capacity in the nucleus accumbens, and cognitive symptoms identified by the CAARMS (r = −0. 92, p=0. 020). At a group level, there was a significant negative correlation between nucleus accumbens dopamine synthesis capacity in the VPT-PBI group, and both cognitive (r = −0. 57, p=0. 032) and negative symptoms (r = −0. 57, p=0. 035). There were no significant correlations between dopamine synthesis capacity and subclinical symptoms in the other two groups, or in other striatal subregions (all p>0. 06). Adults with a history of macroscopic perinatal brain injury associated with VPT birth had reduced dopamine synthesis capacity in the striatum compared to controls born VPT and those born at term, and reduced hippocampal volume compared to individuals born at term. Individuals born similarly preterm but without evidence of macroscopic brain injury showed no significant differences in presynaptic dopamine synthesis capacity from controls, suggesting that preterm birth in the absence of macroscopic brain injury is not sufficient to disrupt striatal dopaminergic function in adult life. It is possible that perinatal brain insults resulted in a long-lasting reduction in the number of dopaminergic neurons (Burke et al., 1992; Chen et al., 1997) or caused a down-regulation in dopamine synthetic enzyme levels, in line with post-mortem findings showing reduced tyrosine hydroxylase expression in dopaminergic neurons following prolonged hypoxia (Pagida et al., 2013). One alternative possibility is that a common genetic or environmental cause predisposes to both low striatal dopamine synthesis and the direct causes of perinatal brain injury. We also found that reduced striatal dopamine synthesis capacity was associated with reduced hippocampal volume. Several preclinical models, including the MAM model (Lodge and Grace, 2007) and adult hippocampal lesions (Wilkinson et al., 1993), have linked hippocampal damage to increased striatal dopaminergic synthesis and release, and behavioral effects including hyper-responsiveness to stress and amphetamine, which are traditionally associated with hyper-dopaminergia (Kelly et al., 1975; Pijnenburg and van Rossum, 1973). The MAM model involves injection of the mitotoxin methylazoxymethanol acetate (MAM) into the ventral hippocampus of the rat at gestational day 17. This primarily affects parvalbumin-expressing interneurons, and the resulting reduced inhibitory control leads to increased hippocampal activity, which is sufficient to increase dopaminergic input to the striatum (Floresco et al., 2001; Legault et al., 2000). The neonatal ventral hippocampal lesion model is of particular relevance to the present study due to the vulnerability of the hippocampus to perinatal brain injury. In perhaps the best known result from this animal model, Lipska and colleagues showed that rats that received neonatal excitotoxic lesions of the hippocampus developed hyper-responsiveness to stress and amphetamine, but only after adolescence. Furthermore, these symptoms were successfully treated with haloperidol, a dopamine D2 receptor antagonist (Lipska et al., 1993). Later investigation of dopamine synthesis and release in this model by the same group surprisingly found relatively reduced dopamine release, and lower dihydrophenylacetate (DOPAC) concentrations indicating reduced dopamine synthesis in response to stress and amphetamine in the lesioned group compared to controls (Lillrank et al., 1999). Another study, examining the same lesion model found similar behavioural effects in response to amphetamine, but no alterations to presynaptic dopaminergic function, and led the authors to conclude that ‘presynaptic release of DA had no major contribution to lesion-enhanced DA transmission in the mesolimbic DA system’ (Wan et al., 1996). This suggests that similar behavioural symptoms can be evoked by either increased presynaptic dopamine synthesis and release or other mechanisms, such as increased postsynaptic D2 receptor sensitivity. The present study suggests that the first mechanism is not present in humans who were born very preterm or suffered perinatal brain injury. It should also be recognized that reduced presynaptic dopamine synthesis could be a secondary consequence of increased autoregulatory feedback (Jauhar et al., 2017), potentially due to increased tonic synaptic dopamine levels in the striatum. Whether increased postsynaptic D2 receptor sensitivity or increased synaptic dopamine levels are seen in humans born very preterm should be tested in further studies. Dopamine also has effects on neurodevelopment, influencing neuronal migration, neurite outgrowth and synapse formation (Money and Stanwood, 2013), and these effects are particularly marked during the second half of a typical pregnancy (Kostović and Jovanov-Milosević, 2006), indicating that dopaminergic changes could also influence hippocampal development. Untangling the timing of dopaminergic or hippocampal alterations would seemingly require serial measurements of both systems over the perinatal period, which likely requires post-mortem or preclinical studies. We did not find evidence of a link between dlPFC volume and presynaptic striatal dopamine synthesis in the present sample. It is possible that measures of fronto-striatal connectivity may be more sensitive to detect the effects of prefrontal cortex on striatal dopamine transmission than volumes (Tziortzi et al., 2014). Alternatively, other striatal dopaminergic mechanisms, such as dopamine release, may be more directly affected by prefrontal input to the striatum (Cachope and Cheer, 2014). These results may have implications for cognitive function in people born preterm. While the current group of study participants were not cognitively impaired, cognitive deficits are commonly found in individuals born VPT, and are exacerbated following perinatal brain injury (Nosarti et al., 2011). Both longitudinal studies of individuals born preterm and preclinical studies have suggested a link between neonatal hippocampal injury and later working memory impairments (Beauchamp et al., 2008; Lipska et al., 2002; Nosarti and Froudist-Walsh, 2016). The dopaminergic system is crucial for cognitive functions such as reward-based learning (Schultz et al., 1997) and working memory (Williams and Goldman-Rakic, 1995), and both hypo- and hyper-dopaminergic function lead to suboptimal cognitive performance (Cools and D' Esposito, 2011). In the present study, we did not find an association between striatal dopamine synthesis and several measures of executive function. An important limitation of this finding is that our battery of cognitive tests did not include a comprehensive assessment of working memory. Working memory is a particularly common deficit in children born with perinatal brain injury (Anderson et al., 2010; Ross et al., 1996), and is associated with academic outcome in this population (Mulder et al., 2010). Individuals with lower presynaptic dopamine synthesis in the caudate nucleus tend to have worse working memory performance (Cools et al., 2008; Landau et al., 2009) and respond better to dopamine agonists as cognitive enhancers than individuals with higher baseline dopamine synthesis (Cools et al., 2009). VPT individuals with perinatal brain injury who experience working memory deficits could benefit from dopamine agonists as cognitive enhancers, perhaps by dopamine’s role in enhancing intrinsic plasticity mechanisms (Calabresi et al., 2007) that have been observed in this population (Froudist-Walsh et al., 2015; Froudist-Walsh et al., 2017). Reduced dopamine synthesis capacity is also associated with substance dependence (Ashok et al., 2017; Bloomfield et al., 2014), major depression (Martinot et al., 2001) and Parkinson’s disease (Pavese et al., 2011). Our findings thus suggest that people with perinatal brain injury could be at increased risk for a number of neuropsychiatric disorders. We recently found that individuals born very preterm experience elevated subclinical psychiatric symptoms across a broad range of symptom dimensions (Kroll et al., 2017b). Here, in an exploratory analysis, we found a negative correlation between striatal dopamine synthesis capacity and subclinical cognitive and negative symptoms in adults born very preterm with perinatal brain injury. ‘Cognitive symptoms’ refer to subjective experience of cognitive change, including concentration, memory and attention problems, whereas ‘negative symptoms’ refer to items such as social isolation, anhedonia and depression. The reduced dopamine synthesis in this group may provide a biological explanation for cognitive and internalising aspects of the ‘preterm behavioural phenotype’ (Johnson and Marlow, 2011). In contrast, dopamine synthesis capacity is increased in the majority of people with schizophrenia (Howes et al., 2012) and people at risk of schizophrenia (Howes et al., 2011). As yet there have been no PET studies specifically of those people with schizophrenia who have had severe obstetric complications, although it is known that they are especially likely to have small left hippocampi (Stefanis et al., 1999). Nevertheless, it is not clear how our results fit with findings that obstetric complications increase the risk of schizophrenia, where interaction with genetic risk factors is likely to be involved (Howes et al., 2017; Nicodemus et al., 2008). In contrast to the increased dopamine synthesis capacity seen in most schizophrenia patients, those who develop schizophrenia-like psychoses following abuse of drugs (Thompson et al., 2013), and those with treatment resistant schizophrenia do not share this increased synthesis capacity (Demjaha et al., 2012). It is thus possible that the relationship between VPT birth, perinatal brain injury and increased risk for psychosis does not depend on presynaptic dopamine synthesis capacity. It may be important to closely monitor the condition of those individuals born VPT with perinatal brain injury who are treated with antipsychotic medication, as reducing an already-reduced dopaminergic system could lead to unintended extrapyramidal and cognitive effects. Alternatively, it is possible that hypersensitive postsynaptic dopaminergic D2 receptors could unite the seemingly discordant findings of reduced presynaptic dopamine synthesis and increased psychosis risk, as appears to be the case in substance-dependent patients with schizophrenia (Thompson et al., 2013). If such disruption were to occur during development, it could have dramatic effects on the developing brain (Abi-Dargham, 2017), with pre-frontal dependent cognitive functions such as working memory being particularly vulnerable (Simpson and Kellendonk, 2017). Our finding that there are not marked alterations in dopamine synthesis capacity in the VPT-no diagnosed injury group is also important for the large numbers of people born preterm, as it indicates that the development of the dopamine system, or at least those aspects related to dopamine synthesis, is not disrupted long-term in the absence of macroscopic perinatal brain injury. The VPT-perinatal brain injury and VPT-no diagnosed injury groups in the present study also differed in gestational age, and birth weight, as these neonatal risk factors tend to co-occur (Vollmer et al., 2003). Nonetheless, when all three factors were introduced in the same model, only perinatal brain injury was a significant predictor of adult dopamine synthesis capacity. This suggests that reduced striatal dopamine synthesis capacity in adulthood is specific to those individuals with perinatal brain injury. From a methodological perspective, it is possible that between-group differences in the accuracy of image registration may contribute to the apparent reduction in dopamine synthesis capacity seen in the VPT-perinatal brain injury group. However, we used the subject’s own MRI to define the PET region of interest which should mitigate, although not entirely avoid, this risk. Moreover, the results remained significant after controlling for both striatal and total intracranial volume or excluding subjects without MRI scans, suggesting that volume reductions or normalisation differences do not account for the findings. The postnatal ultrasound scans exclude macroscopic brain injury in the VPT-no diagnosed injury group but do not exclude a variety of other microscopic alterations. However, this would not explain our results, as it would, if anything, reduce group differences. Lastly, the final sample size for individuals with combined PET and MRI data of 13 individuals per group is not large. However, PET studies of presynaptic dopamine synthesis with clinical samples have consistently been able to detect group differences with group sizes of between 5 and 12 individuals (Hietala et al., 1999; Howes et al., 2009; Lindström et al., 1999; Meyer-Lindenberg et al., 2002; Reith et al., 1994). Nonetheless, further studies with larger samples investigating pre- and post-synaptic dopamine function in the striatum and other brain areas may help to identify the precise mechanism that links perinatal brain injury with psychiatric risk in adulthood. In summary, we found reduced presynaptic dopamine synthesis capacity in the striatum in individuals born VPT with macroscopic perinatal brain injury. This may help to guide pharmacological interventions for cognitive deficits in this group. We additionally found significant associations between dopaminergic function and reduced hippocampal volume. These results indicate there are long-term neurochemical and structural consequences of perinatal brain injury. We assessed a group of individuals born VPT who were admitted to the Neonatal Unit of University College Hospital, London in 1979–1985. These individuals were enrolled in a longitudinal study and have been studied periodically for their entire lives. Macroscopic perinatal brain injury was qualitatively assessed in all participants born VPT and diagnosis of perinatal brain injury was made after consensus between at least two neuroradiologists with a special interest in neonatology. Hemorrhage into the germinal matrix, and those extending to the lateral ventricles or brain parenchyma was labeled as periventricular hemorrhage (Stewart et al., 1983), with the grade defined according to the criteria described by Papile and colleagues (Papile et al., 1978). Ventricular dilatation was defined as visible dilatation of the lateral ventricles with cerebrospinal fluid while being insufficient to meet the criteria for hydrocephalus. We compared the perinatal brain injury group to: (1) a group of VPT individuals who were similarly assessed at birth but not diagnosed as having perinatal brain injury (to control for the effects of preterm birth) and (2) healthy controls without a history of perinatal brain injury or preterm birth (control group). Participants who gave consent at previous study time-points to be contacted regarding the study were recruited using the contact details provided previously, and control participants were recruited via advertisements in the local community. Exclusion criteria for all groups were history of post-natal head injury, neurological condition (including stroke, meningitis, multiple sclerosis, and epilepsy) or significant physical illness (such as endocrine or metabolic disorder requiring treatment), substance dependence or abuse, psychotic disorder, current antipsychotic use, and pregnancy. The study was undertaken with the understanding and written informed consent and consent to publish of each subject, with the approval of the London Bentham Research Ethics Committee (Study 11/LO/0732), and in compliance with national legislation and the Code of Ethical Principles for Medical Research Involving Human Subjects of the World Medical Association (Declaration of Helsinki). Birth weight was recorded for all VPT participants and socio-economic status measured in all subjects using the Standard Occupational Classification (Her Majesty’s Stationary Office, 1991). In adulthood, all participants underwent a 3,4-dihydroxy-6-[18F]-fluoro-/-phenylalanine ([18F]-DOPA) scan in a Biograph 6 PET/CT scanner with Truepoint gantry (SIEMENS, Knoxville, TN). Subjects were asked to fast from midnight and abstain from smoking tobacco and consuming food and liquids (except for buttered toast and water) from midnight before the day of imaging to ensure there were no group differences in amino acid consumption prior to the scan. On the day of the PET scan, a negative urinary drug screen was required and a negative pregnancy test was required in all female subjects. Subjects received carbidopa 150 mg and entacapone 400 mg orally 1 hr before imaging to reduce the formation of radiolabeled [18F]-DOPA metabolites (Cumming et al., 1993; Guttman et al., 1993). Head position was marked and monitored via laser crosshairs and a camera, and minimized using a head-strap. A transmission CT scan was performed before radiotracer injection for attenuation and scatter correction. Approximately 150 MBq of [18F]-DOPA was administered by bolus intravenous injection 30 s after the start of PET imaging. We acquired emission data in list mode for 95 min, rebinned into 26 time frames (30 s background frame, four 60 s frames, three 120 s frames, three 180 s frames, and fifteen 300 s frames). On a separate day an MRI scan was performed on a 3 Tesla GE Signa MR scanner (GE Healthcare). T1-weighted images were acquired (TR/TE/TI: 7. 1/2. 8/450 ms, matrix: 256 × 256), allowing for 196 slices with no gap and an isotropic resolution of 1. 1 × 1. 1 × 1. 1 mm3. To correct for head movement, nonattenuation-corrected dynamic images were denoised using a level 2, order 64 Battle-Lemarie wavelet filter (Turkheimer et al., 1999), and individual frames were realigned to a single frame acquired 10 min after the [18F]-DOPA injection using a mutual information algorithm (Studholme et al., 1996). Transformation parameters were then applied to the corresponding attenuation-corrected frames, and the realigned frames were combined to create a movement-corrected dynamic image (from 6 to 95 min following [18F]-DOPA administration) for analysis. Automatic reconstruction of the hippocampus, caudate nucleus, putamen, nucleus accumbens and cerebellum was performed in the native space of each of the participants with MRI data, allowing for both individual masks and regional volume information extraction, using FreeSurfer version 5. 1 (Fischl et al., 2002). FreeSurfer assigns an atlas label to voxels via use of a probabilistic atlas of region location, which was previously created from a manually labelled training set. Importantly in order to register the atlas and the structural input image, a registration procedure is used that is robust to ventricular enlargement (Fischl et al., 2002). The accuracy of the FreeSurfer segmentations of the striatal structures, hippocampus and cerebellum, was assessed by visual comparison with the intensity-corrected t1-weighted scan, which has high grey-white matter contrast around the structures of interest. The primary striatal region of interest was the whole striatum (nucleus accumbens, caudate and putamen combined) but we also report the sub-regions separately to determine if there were sub-regional variations. A linear transformation was created between each participant’s T1-weighted structural scan and their individual PET image using FSL FLIRT (Jenkinson et al., 2002). This transformation was then applied to each of the previously specified regions of interest in order to obtain individually defined masks of the striatum on the PET scan. Intra-subject registration is generally more accurate than between-subject registration, as there is no between-subject anatomical variability to take into account. In addition to the two participants (one perinatal brain injury, one very preterm no diagnosed injury) excluded from the PET study, four further participants (three perinatal brain injury, one control) were not included in the MRI study due to contraindications to scanning. In order allow for the inclusion of these participants’ data in the PET analysis, we created a study-specific PET template using Advanced Normalization Tools (ANTs) (Avants et al., 2011). The template we created was an average of each individual summed PET scan, after mapping onto a common space. We mapped each individual’s FreeSurfer regions-of-interest (ROIs) to this custom template again using ANTs. These ROIs were binarised and summed together before being thresholded in order to include only voxels in which the striatum was present in more than 50% of participants. This custom striatum mask was then warped back into the native PET space for those subjects who did not have MRI scans using the inverse (template-to-native) transformation that was generated using ANTs. All PET ROIs were visually inspected for accuracy. Once the ROIs were defined in native PET space, we determined [18F]-DOPA uptake [Kicer (min–1) ], for each ROI using the Gjedde-Patlak graphic analysis adapted for a reference tissue input function (Patlak and Blasberg, 1985). The cerebellum region was used as the reference region as it represents non-specific uptake (Kumakura and Cumming, 2009). We additionally undertook exploratory analyses in order to investigate the relationship between presynaptic dopamine synthesis capacity in the striatum and dorsolateral prefrontal cortex volume, executive function abilities and subclinical psychiatric symptoms. Relative and absolute dlPFC volumes were taken from our recent large scale study of volumetric alterations following preterm birth (Karolis et al., 2017). Ten individuals from the VPT-perinatal brain injury, 13 individuals from the VPT-no diagnosed group, and 12 controls were included in both studies. Briefly, in that study grey matter volume was analysed at three hierarchical levels, global, modular, and regional. We analysed both raw dorsolateral prefrontal cortex volume, and relative volume (after regressing out global and module-specific grey matter volumes). Measures of executive function were taken from our recent study of cognitive outcome and real-life function (Kroll et al., 2017). 16 individuals from the VPT-perinatal brain injury, 13 individuals from the VPT-no diagnosed group, and 12 controls were included in both studies. Briefly, the Hayling Sentence Completion Test (HSCT) (Burgess and Shallice, 1997) assessed initiation and suppression responses. The Controlled Oral Word Association Test (COWAT) (Benton and Hamsher, 1976) measured verbal fluency. Two subtests from the Cambridge Neuropsychological Test Automated Battery (CANTAB) (Fray et al., 1996) were included. The Stockings of Cambridge (SOC) is a task that assesses spatial planning. The Intra-Extra Dimensional Set Shift (IED) is a task involving maintaining attention to a reinforced stimulus and then shifting attention to a previously irrelevant stimulus. The Trail Making Test part B (Tombaugh, 2004) measured visual attention, set shifting, and cognitive flexibility. Assessment of subclinical psychiatric symptoms was taken from a larger study (Kroll et al., 2017b) using the Comprehensive Assessment of At-Risk Mental States (CAARMS) (Yung et al., 2005). 14 individuals from the VPT-perinatal brain injury, 11 individuals from the VPT-no diagnosed group, and 10 controls were included in both studies. ANOVA was used to test the primary hypotheses that there was an effect of group on whole striatal dopamine synthesis capacity and hippocampal volume. p-values from the ANOVAs were adjusted using FDR correction across striatal subregions (appropriate for positively correlated samples) (Benjamini and Hochberg, 1995). Additional sensitivity analyses were conducted using an ANCOVA with Kicer as the dependent variable, group as the independent variable and possible confounds (age, IQ, intra-cranial and striatal ROI volume) as covariates. Separately, in those participants born very preterm, we tested for the independent effects of three neonatal risk factors (perinatal brain injury, gestational age at birth and birth weight) on dopamine synthesis capacity in the whole striatum using an ANCOVA, with Kicer as the independent variable, group (VPT-perinatal brain injury vs VPT-no diagnosed injury) as an independent variable and gestational age at birth and birth weight as covariates. In order to test for regional differences in the effect of VPT birth and perinatal brain injury on dopamine synthesis capacity (analyzing the entire sample), we performed a repeated-measures ANOVA with striatal subregion as the within-subjects factor, group as the between-subjects factor and Kicer as the dependent variable. To test for a hippocampal volume by striatal subregion interaction, we again performed a repeated-measures ANOVA, with subregion as the within-subject factor, hippocampal volume and intracranial volume as covariates and and Kicer as the dependent variable. To examine whether the relationship between hippocampal volume and striatal Kicer varied significantly by group, we used region as a within-subjects factor, with group and the group-by-hippocampal-volume interaction term as between-subjects factors. A two tailed p value<0. 05 was taken as significant. In our exploratory analyses the following methods were used. To assess the relationship between dlPFC volume, hippocampal volume and striatal dopamine synthesis capacity, we used a general linear model, with dlPFC volume and hippocampal volume as dependent variables, and either caudate nucleus or nucleus accumbens dopamine synthesis as independent variables. The relationship between dopamine synthesis capacity and both executive function measures was assessed with Spearman correlations. Statistical analysis was performed in MATLAB 9. 2 (RRID: SCR_001622) and SPSS Version 23 (RRID: SCR_002865). Supporting data are available on request: please contact: oliver. howes@kcl. ac. uk

Title: The effect of perinatal brain injury on dopaminergic function and hippocampal volume in adult life Summary: Thirteen million infants are born too early every year. Improved care allows many to survive, but these "preterm infants" still face an increased risk of death and many other complications. Infants born very early, before 32 weeks, are at risk of brain injury because the brain is normally still developing in the later stages of pregnancy. They also have an increased risk of developing mental health problems later in life. Early-life brain injuries in rats cause changes in the production of a chemical called dopamine. Dopamine is a chemical messenger in the brain that reinforces rewarding behaviour. People with schizophrenia and attention deficit hyperactivity disorder (ADHD) have abnormal levels of dopamine. Changes in brain dopamine levels may explain why early-life brain injury is linked to later mental illness. But first scientists must study whether similar changes occur in humans with an early-life brain injury. Now, Froudist-Walsh et al. use brain imaging to show that people born very early who suffered a brain injury have lower dopamine levels than other adults. Imaging techniques were used to scan the brains of 13 adults who were born before 32 weeks and who had a brain injury around birth, 13 adults born before 32 weeks without a brain injury, and 13 adults born at "full term" (around 39 to 40 weeks). Individuals with low dopamine levels reported difficulty concentrating and a lack of motivation and enjoyment in their lives. Both can be warning signs of mental health problems. People born prematurely without a brain injury had normal dopamine levels and did not report such symptoms. More studies may help scientists understand how early brain injuries may cause brain chemical differences later in life, and how these brain changes affect individual's mental health. They may also help scientists develop treatments to prevent or treat mental illness in people who experienced a brain injury after a very early birth.

lay_elife

en

Summarize: May 16, 2012 12:13 PM Winchester Businessman Donates $200K Worth Of Items To Clark County Charity It's an unbelievable story of generosity out of Clark County. A business owner took his hard-earned money to buy an amazing amount of clothing and supplies to help the less fortunate there. His name is Rankin Paynter. He was buying items at a Clark County K-Mart before it closed for good. That's when he wondered where all the unsold items were going. A clerk said power buyers take it all, so he signed up to be one. Six hours and four cash registers later, Paynter was the proud owner of a couple hundred thousand dollars worth of merchandise, all of which he donated to Clark County Community Services. "What I see is people coming in my store, needy people sell their stuff," said Paynter, who owns a jewelry exchange business in Winchester. "It's bad nowadays. I just told (the clerk) lets just give it away to charity." Visit msnbc.com for breaking news, world news, and news about the economy A Kentucky businessman walks into a K-Mart, buys everything in it and donates it all to charity. It's no joke. Rankin Paynter tells LEX18.com he wandered into the K-Mart in Clark County, Ky., before it closed for good, looking for a few good deals. He was curious what would happen to the stuff nobody bought, and a clerk told him "power buyers" take it all. "Six hours and four cash registers later, Paynter was the proud owner of about $200,000 worth of merchandise, all of which he donated to Clark County Community Services," LEX18 reports. Paynter, who owns a jewelry exchange business, told the website that he sees plenty of people selling jewelry because of the economic hard times. "It's bad nowadays. I just told (the clerk) let's just give it away to charity," he told the website.

Summary: When his local Kmart was getting ready to close, a Kentucky man decided to buy all the store's stuff-and hand it to charity. While visiting the store to score some deals, Rankin Paynter asked what happened to all the unsold items; the clerk told him "power buyers" snap it up, USA Today reports. Paynter knows times have been tough: The owner of a jewelry exchange, he often sees struggling people selling their valuables to make ends meet. So over the course of six hours, he bought up $200,000 worth of items. He gave it all to his county's community service office. "It's bad nowadays. I just told (the clerk) let's just give it away to charity," he told LEX18.com.

multi_news

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Innovative Technologies Investment Incentive Act of 2010''. SEC. 2. CREDIT FOR INVESTMENTS IN HIGH TECHNOLOGY AND BIOTECHNOLOGY BUSINESS CONCERNS DEVELOPING INNOVATIVE TECHNOLOGIES. (a) In General.--Subpart B of part IV of subchapter A of chapter 1 of the Internal Revenue Code of 1986 is amended by adding after section 30D the following new section: ``SEC. 30E. INVESTMENTS IN HIGH TECHNOLOGY AND BIOTECHNOLOGY BUSINESS CONCERNS DEVELOPING INNOVATIVE TECHNOLOGIES. ``(a) Allowance of Credit.--There shall be allowed as a credit against the tax imposed by this chapter for the taxable year an amount equal to 25 percent of the qualified equity investments made by the taxpayer during the taxable year. ``(b) Limitations.-- ``(1) National limitation.-- ``(A) In general.--There is a national innovative technology investment credit limitation of $500,000,000. ``(B) Allocation of limitation and issuance of certificate.--Under regulations, the Administrator of the Small Business Administration shall make allocations of the national innovative technology investment credit limitation among qualified equity investments and shall issue an innovative technology investment credit certificate for each such allocation. ``(C) Per business investment limitation.--The amount of the national innovative technology investment credit limitation allocated to a qualified technology small business concern shall not exceed 50 percent of the total amount awarded to such concern under the Small Business Innovation Research (SBIR) program under section 9 of the Small Business Act. ``(D) Certificate required for credit eligibility.--The amount allowed as a credit under subsection (a) with respect to any qualified equity investment shall not exceed the amount of the national innovative technology investment credit limitation allocated to such investment and shown on the innovative technology investment credit certificate pursuant to subparagraph (E)(ii). ``(E) Innovative technology investment credit certificate.--For purposes of this subsection, an innovative technology investment credit certificate is a certificate which-- ``(i) certifies the amount of the qualified equity investment, ``(ii) relates such investment to an award under the Small Business Innovation Research (SBIR) program under section 9 of the Small Business Act which qualifies for purposes of this section, and ``(iii) contains such other information as the Administrator, in consultation with the Secretary, determines to be necessary or appropriate to carry out this section. The amount of any award under the Small Business Innovation Research program, once related under subparagraph (B) with a qualified equity investment, may not thereafter be available for purposes of this section. ``(2) Limitation based on percentage ownership.--The amount of the credit under subsection (a) allowed to the taxpayer with respect to a qualified equity investment in a qualified technology small business concern shall be zero if, after such investment, the taxpayer owns (within the meaning of section 318) 50 percent or more of-- ``(A) in the case that such concern is a corporation, the outstanding stock of the corporation (either by vote or value), and ``(B) in the case that such concern is not a corporation, the capital and profits interests of such concern. ``(c) Qualified Equity Investment.--For purposes of this section-- ``(1) In general.--The term `qualified equity investment' means any equity investment in a qualified technology small business concern made during the investment period if such investment is acquired by the taxpayer at its original issue (directly or through an underwriter) solely in exchange for cash. ``(2) Equity investment.--The term `equity investment' means-- ``(A) any stock (other than nonqualified preferred stock, as defined in section 351(g)(2)) in an entity which is a corporation, and ``(B) any capital or profits interest in an entity which is not a corporation. ``(3) Qualified technology small business concern.--The term `qualified technology small business concern' means, with respect to any taxable year, any small business concern (as defined in section 3 of the Small Business Act) if such concern-- ``(A) is engaged in a high technology or biotechnology trade or business, and ``(B) employs an average of fewer than 500 employees on business days during such year. ``(4) Investment period.--The term `investment period' means the period-- ``(A) beginning on the date the qualified technology small business concern first receives funds pursuant to a funding agreement under the Small Business Innovation Research (SBIR) program under section 9 of the Small Business Act, and ``(B) ending on the last day of the 18-month period beginning on the date on which such funding agreement ceases to be in effect. ``(d) Application With Other Credits.-- ``(1) Business credit treated as part of general business credit.--Except as provided in paragraph (2), the credit which would be allowed under subsection (a) for any taxable year (determined without regard to this subsection) shall be treated as a credit listed in section 38(b) for such taxable year (and not allowed under subsection (a)). ``(2) Personal credit.-- ``(A) In general.--In the case of an individual who elects the application of this paragraph, for purposes of this title, the credit allowed under subsection (a) for any taxable year (determined after application of paragraph (1)) shall be treated as a credit allowable under subpart A for such taxable year. ``(B) Limitation based on amount of tax.--In the case of a taxable year to which section 26(a)(2) does not apply, the credit allowed under subpart A for any taxable year (determined after application of paragraph (1)) by reason of subparagraph (A) shall not exceed the excess of-- ``(i) the sum of the regular tax liability (as defined in section 26(b)) plus the tax imposed by section 55, over ``(ii) the sum of the credits allowable under subpart A (other than this section) and section 27 for the taxable year. ``(C) Carryforward of unused credit.--If the credit allowable under subsection (a) by reason of subparagraph (A) exceeds the limitation imposed by section 26(a)(1) or subparagraph (B), whichever is applicable, for such taxable year, reduced by the sum of the credits allowable under subpart A (other than this section) for such taxable year, such excess shall be carried to each of the succeeding 20 taxable years to the extent that such unused credit may not be taken into account under subsection (a) by reason of subparagraph (A) for a prior taxable year because of such limitation. ``(e) Special Rules.-- ``(1) Related parties.--For purposes of this section-- ``(A) In general.--All related persons shall be treated as 1 person. ``(B) Related persons.--A person shall be treated as related to another person if the relationship between such persons would result in the disallowance of losses under section 267 or 707(b). ``(2) Basis.--For purposes of this subtitle, the basis of any investment with respect to which a credit is allowable under this section shall be reduced by the amount of such credit so allowed. ``(3) Recapture.--The Secretary shall, by regulations, provide for recapturing the benefit of any credit allowable under subsection (a) with respect to any qualified equity investment which is held by the taxpayer less than 3 years, except that no benefit shall be recaptured in the case of-- ``(A) transfer of such investment by reason of the death of the taxpayer, ``(B) transfer between spouses, or ``(C) transfer incident to the divorce (as defined in section 1041) of such taxpayer. ``(f) Regulations.--The Secretary shall prescribe such regulations as may be appropriate to carry out this section, including regulations-- ``(1) which prevent the abuse of the purposes of this section, and ``(2) which impose appropriate reporting requirements.''. (b) Credit Made Part of General Business Credit.--Subsection (b) of section 38 of such Code (relating to current year business credit) is amended by striking ``plus'' at the end of paragraph (35), by striking the period at the end of paragraph (36) and inserting ``, plus'', and by adding at the end the following new paragraph: ``(37) the portion of the qualified equity investment credit to which section 30E(d)(1) applies.''. (c) Conforming Amendments.-- (1) Section 1016(a) of such Code is amended by striking ``and'' at the end of paragraph (36), by striking the period at the end of paragraph (37) and inserting ``, and'', and by inserting after paragraph (37) the following new paragraph: ``(38) to the extent provided in section 30E(d)(2).''. (2) Section 24(b)(3)(B) of such Code is amended by striking ``and 30D'' and inserting ``30D, and 30E''. (3) Section 25(e)(1)(C)(ii) of such Code is amended by inserting ``30E,'' after ``30D,''. (4) Section 25A(i)(5)(B) of such Code is amended by striking ``and 30D'' and inserting ``, 30D, and 30E''. (5) Section 25A(i)(5) of such Code is amended by inserting ``30E,'' after ``30D,''. (6) Section 25B(g)(2) of such Code is amended by striking ``and 30D'' and inserting ``30D, and 30E''. (7) Section 26(a)(1) of such Code is amended by striking ``and 30D'' and inserting ``30D, and 30E''. (8) Section 30(c)(2)(B)(ii) of such Code is amended by striking ``and 30D'' and inserting ``, 30D, and 30E''. (9) Section 30B(g)(2)(B)(ii) of such Code is amended by striking ``and 30D'' and inserting ``30D, and 30E''. (10) Section 30D(d)(2)(B)(ii) of such Code is amended by striking ``and 25D'' and inserting ``, 25D, and 30E''. (11) Section 904(i) of such Code is amended by striking ``and 30D'' and inserting ``30D, and 30E''. (12) Section 1400C(d)(2) of such Code is amended by striking ``and 30D'' and inserting ``30D, and 30E''. (d) Clerical Amendment.--The table of sections for subpart B of part IV of subchapter A of chapter 1 of such Code is amended by inserting after the item relating to section 30D the following new item: ``Sec. 30E. Investments in high technology and biotechnology business concerns developing innovative technologies.''. (e) Effective Date.--The amendments made by this section shall apply to investments made after December 31, 2009, in taxable years ending after such date.

Title: To amend the Internal Revenue Code of 1986 to allow a credit for equity investments in high technology and biotechnology small business concerns developing innovative technologies that stimulate private sector job growth Summary: Innovative Technologies Investment Incentive Act of 2010 - Amends the Internal Revenue Code to allow a new business-related tax credit for 25% of the equity investment (i.e., stock and capital or profits interest) in a small business concern that is engaged in a high technology or biotechnology trade or business and employs an average of fewer than 500 employees in a taxable year. Establishes a national innovative technology investment credit limitation of $500 million.

billsum

en

Summarize: |MRS. Rachel Lynde lived just where the Avonlea main road dipped down into a little hollow, fringed with alders and ladies' eardrops and traversed by a brook that had its source away back in the woods of the old Cuthbert place; it was reputed to be an intricate, headlong brook in its earlier course through those woods, with dark secrets of pool and cascade; but by the time it reached Lynde's Hollow it was a quiet, well-conducted little stream, for not even a brook could run past Mrs. Rachel Lynde's door without due regard for decency and decorum; it probably was conscious that Mrs. Rachel was sitting at her window, keeping a sharp eye on everything that passed, from brooks and children up, and that if she noticed anything odd or out of place she would never rest until she had ferreted out the whys and wherefores thereof. There are plenty of people in Avonlea and out of it, who can attend closely to their neighbor's business by dint of neglecting their own; but Mrs. Rachel Lynde was one of those capable creatures who can manage their own concerns and those of other folks into the bargain. She was a notable housewife; her work was always done and well done; she "ran" the Sewing Circle, helped run the Sunday-school, and was the strongest prop of the Church Aid Society and Foreign Missions Auxiliary. Yet with all this Mrs. Rachel found abundant time to sit for hours at her kitchen window, knitting "cotton warp" quilts--she had knitted sixteen of them, as Avonlea housekeepers were wont to tell in awed voices--and keeping a sharp eye on the main road that crossed the hollow and wound up the steep red hill beyond. Since Avonlea occupied a little triangular peninsula jutting out into the Gulf of St. Lawrence with water on two sides of it, anybody who went out of it or into it had to pass over that hill road and so run the unseen gauntlet of Mrs. Rachel's all-seeing eye. She was sitting there one afternoon in early June. The sun was coming in at the window warm and bright; the orchard on the slope below the house was in a bridal flush of pinky-white bloom, hummed over by a myriad of bees. Thomas Lynde--a meek little man whom Avonlea people called "Rachel Lynde's husband"--was sowing his late turnip seed on the hill field beyond the barn; and Matthew Cuthbert ought to have been sowing his on the big red brook field away over by Green Gables. Mrs. Rachel knew that he ought because she had heard him tell Peter Morrison the evening before in William J. Blair's store over at Carmody that he meant to sow his turnip seed the next afternoon. Peter had asked him, of course, for Matthew Cuthbert had never been known to volunteer information about anything in his whole life. And yet here was Matthew Cuthbert, at half-past three on the afternoon of a busy day, placidly driving over the hollow and up the hill; moreover, he wore a white collar and his best suit of clothes, which was plain proof that he was going out of Avonlea; and he had the buggy and the sorrel mare, which betokened that he was going a considerable distance. Now, where was Matthew Cuthbert going and why was he going there? Had it been any other man in Avonlea, Mrs. Rachel, deftly putting this and that together, might have given a pretty good guess as to both questions. But Matthew so rarely went from home that it must be something pressing and unusual which was taking him; he was the shyest man alive and hated to have to go among strangers or to any place where he might have to talk. Matthew, dressed up with a white collar and driving in a buggy, was something that didn't happen often. Mrs. Rachel, ponder as she might, could make nothing of it and her afternoon's enjoyment was spoiled. "I'll just step over to Green Gables after tea and find out from Marilla where he's gone and why," the worthy woman finally concluded. "He doesn't generally go to town this time of year and he _never_ visits; if he'd run out of turnip seed he wouldn't dress up and take the buggy to go for more; he wasn't driving fast enough to be going for a doctor. Yet something must have happened since last night to start him off. I'm clean puzzled, that's what, and I won't know a minute's peace of mind or conscience until I know what has taken Matthew Cuthbert out of Avonlea today." Accordingly after tea Mrs. Rachel set out; she had not far to go; the big, rambling, orchard-embowered house where the Cuthberts lived was a scant quarter of a mile up the road from Lynde's Hollow. To be sure, the long lane made it a good deal further. Matthew Cuthbert's father, as shy and silent as his son after him, had got as far away as he possibly could from his fellow men without actually retreating into the woods when he founded his homestead. Green Gables was built at the furthest edge of his cleared land and there it was to this day, barely visible from the main road along which all the other Avonlea houses were so sociably situated. Mrs. Rachel Lynde did not call living in such a place _living_ at all. "It's just _staying_, that's what," she said as she stepped along the deep-rutted, grassy lane bordered with wild rose bushes. "It's no wonder Matthew and Marilla are both a little odd, living away back here by themselves. Trees aren't much company, though dear knows if they were there'd be enough of them. I'd ruther look at people. To be sure, they seem contented enough; but then, I suppose, they're used to it. A body can get used to anything, even to being hanged, as the Irishman said." With this Mrs. Rachel stepped out of the lane into the backyard of Green Gables. Very green and neat and precise was that yard, set about on one side with great patriarchal willows and the other with prim Lombardies. Not a stray stick nor stone was to be seen, for Mrs. Rachel would have seen it if there had been. Privately she was of the opinion that Marilla Cuthbert swept that yard over as often as she swept her house. One could have eaten a meal off the ground without over-brimming the proverbial peck of dirt. Mrs. Rachel rapped smartly at the kitchen door and stepped in when bidden to do so. The kitchen at Green Gables was a cheerful apartment--or would have been cheerful if it had not been so painfully clean as to give it something of the appearance of an unused parlor. Its windows looked east and west; through the west one, looking out on the back yard, came a flood of mellow June sunlight; but the east one, whence you got a glimpse of the bloom white cherry-trees in the left orchard and nodding, slender birches down in the hollow by the brook, was greened over by a tangle of vines. Here sat Marilla Cuthbert, when she sat at all, always slightly distrustful of sunshine, which seemed to her too dancing and irresponsible a thing for a world which was meant to be taken seriously; and here she sat now, knitting, and the table behind her was laid for supper. Mrs. Rachel, before she had fairly closed the door, had taken a mental note of everything that was on that table. There were three plates laid, so that Marilla must be expecting some one home with Matthew to tea; but the dishes were everyday dishes and there was only crab-apple preserves and one kind of cake, so that the expected company could not be any particular company. Yet what of Matthew's white collar and the sorrel mare? Mrs. Rachel was getting fairly dizzy with this unusual mystery about quiet, unmysterious Green Gables. "Good evening, Rachel," Marilla said briskly. "This is a real fine evening, isn't it? Won't you sit down? How are all your folks?" Something that for lack of any other name might be called friendship existed and always had existed between Marilla Cuthbert and Mrs. Rachel, in spite of--or perhaps because of--their dissimilarity. Marilla was a tall, thin woman, with angles and without curves; her dark hair showed some gray streaks and was always twisted up in a hard little knot behind with two wire hairpins stuck aggressively through it. She looked like a woman of narrow experience and rigid conscience, which she was; but there was a saving something about her mouth which, if it had been ever so slightly developed, might have been considered indicative of a sense of humor. "We're all pretty well," said Mrs. Rachel. "I was kind of afraid _you_ weren't, though, when I saw Matthew starting off today. I thought maybe he was going to the doctor's." Marilla's lips twitched understandingly. She had expected Mrs. Rachel up; she had known that the sight of Matthew jaunting off so unaccountably would be too much for her neighbor's curiosity. "Oh, no, I'm quite well although I had a bad headache yesterday," she said. "Matthew went to Bright River. We're getting a little boy from an orphan asylum in Nova Scotia and he's coming on the train tonight." If Marilla had said that Matthew had gone to Bright River to meet a kangaroo from Australia Mrs. Rachel could not have been more astonished. She was actually stricken dumb for five seconds. It was unsupposable that Marilla was making fun of her, but Mrs. Rachel was almost forced to suppose it. "Are you in earnest, Marilla?" she demanded when voice returned to her. "Yes, of course," said Marilla, as if getting boys from orphan asylums in Nova Scotia were part of the usual spring work on any well-regulated Avonlea farm instead of being an unheard of innovation. Mrs. Rachel felt that she had received a severe mental jolt. She thought in exclamation points. A boy! Marilla and Matthew Cuthbert of all people adopting a boy! From an orphan asylum! Well, the world was certainly turning upside down! She would be surprised at nothing after this! Nothing! "What on earth put such a notion into your head?" she demanded disapprovingly. This had been done without her advice being asked, and must perforce be disapproved. "Well, we've been thinking about it for some time--all winter in fact," returned Marilla. "Mrs. Alexander Spencer was up here one day before Christmas and she said she was going to get a little girl from the asylum over in Hopeton in the spring. Her cousin lives there and Mrs. Spencer has visited here and knows all about it. So Matthew and I have talked it over off and on ever since. We thought we'd get a boy. Matthew is getting up in years, you know--he's sixty--and he isn't so spry as he once was. His heart troubles him a good deal. And you know how desperate hard it's got to be to get hired help. There's never anybody to be had but those stupid, half-grown little French boys; and as soon as you do get one broke into your ways and taught something he's up and off to the lobster canneries or the States. At first Matthew suggested getting a Home boy. But I said 'no' flat to that. 'They may be all right--I'm not saying they're not--but no London street Arabs for me,' I said. 'Give me a native born at least. There'll be a risk, no matter who we get. But I'll feel easier in my mind and sleep sounder at nights if we get a born Canadian.' So in the end we decided to ask Mrs. Spencer to pick us out one when she went over to get her little girl. We heard last week she was going, so we sent her word by Richard Spencer's folks at Carmody to bring us a smart, likely boy of about ten or eleven. We decided that would be the best age--old enough to be of some use in doing chores right off and young enough to be trained up proper. We mean to give him a good home and schooling. We had a telegram from Mrs. Alexander Spencer today--the mail-man brought it from the station--saying they were coming on the five-thirty train tonight. So Matthew went to Bright River to meet him. Mrs. Spencer will drop him off there. Of course she goes on to White Sands station herself." Mrs. Rachel prided herself on always speaking her mind; she proceeded to speak it now, having adjusted her mental attitude to this amazing piece of news. "Well, Marilla, I'll just tell you plain that I think you're doing a mighty foolish thing--a risky thing, that's what. You don't know what you're getting. You're bringing a strange child into your house and home and you don't know a single thing about him nor what his disposition is like nor what sort of parents he had nor how he's likely to turn out. Why, it was only last week I read in the paper how a man and his wife up west of the Island took a boy out of an orphan asylum and he set fire to the house at night--set it _on purpose_, Marilla--and nearly burnt them to a crisp in their beds. And I know another case where an adopted boy used to suck the eggs--they couldn't break him of it. If you had asked my advice in the matter--which you didn't do, Marilla--I'd have said for mercy's sake not to think of such a thing, that's what." This Job's comforting seemed neither to offend nor to alarm Marilla. She knitted steadily on. "I don't deny there's something in what you say, Rachel. I've had some qualms myself. But Matthew was terrible set on it. I could see that, so I gave in. It's so seldom Matthew sets his mind on anything that when he does I always feel it's my duty to give in. And as for the risk, there's risks in pretty near everything a body does in this world. There's risks in people's having children of their own if it comes to that--they don't always turn out well. And then Nova Scotia is right close to the Island. It isn't as if we were getting him from England or the States. He can't be much different from ourselves." "Well, I hope it will turn out all right," said Mrs. Rachel in a tone that plainly indicated her painful doubts. "Only don't say I didn't warn you if he burns Green Gables down or puts strychnine in the well--I heard of a case over in New Brunswick where an orphan asylum child did that and the whole family died in fearful agonies. Only, it was a girl in that instance." "Well, we're not getting a girl," said Marilla, as if poisoning wells were a purely feminine accomplishment and not to be dreaded in the case of a boy. "I'd never dream of taking a girl to bring up. I wonder at Mrs. Alexander Spencer for doing it. But there, _she_ wouldn't shrink from adopting a whole orphan asylum if she took it into her head." Mrs. Rachel would have liked to stay until Matthew came home with his imported orphan. But reflecting that it would be a good two hours at least before his arrival she concluded to go up the road to Robert Bell's and tell the news. It would certainly make a sensation second to none, and Mrs. Rachel dearly loved to make a sensation. So she took herself away, somewhat to Marilla's relief, for the latter felt her doubts and fears reviving under the influence of Mrs. Rachel's pessimism. "Well, of all things that ever were or will be!" ejaculated Mrs. Rachel when she was safely out in the lane. "It does really seem as if I must be dreaming. Well, I'm sorry for that poor young one and no mistake. Matthew and Marilla don't know anything about children and they'll expect him to be wiser and steadier that his own grandfather, if so be's he ever had a grandfather, which is doubtful. It seems uncanny to think of a child at Green Gables somehow; there's never been one there, for Matthew and Marilla were grown up when the new house was built--if they ever _were_ children, which is hard to believe when one looks at them. I wouldn't be in that orphan's shoes for anything. My, but I pity him, that's what." So said Mrs. Rachel to the wild rose bushes out of the fulness of her heart; but if she could have seen the child who was waiting patiently at the Bright River station at that very moment her pity would have been still deeper and more profound.

Summary: Mrs. Rachel Lynde Is Surprised Isn't it splendid to think of all the things there are to find out about. It just makes me feel glad to be alive. Mrs. Rachel Lynde, the town busybody, lives with her meek husband on the main road of Avonlea, a small rural town in Prince Edward Island in Canada. Mrs. Rachel, as she is known, sits on her porch one afternoon in early June. She sees her neighbor, Matthew Cuthbert, leaving his home. This activity is surprising, since the painfully shy Matthew is known as a bit of a recluse. Even more surprising is that fact that he is wearing his best suit and driving his buggy, evidence that an important errand calls him away. Mrs. Rachel, her mind abuzz with questions, goes to the Cuthbert house to seek an explanation. Matthew and Marilla Cuthbert live tucked away on a farm called Green Gables. Marilla, though more talkative than Matthew, is severe and private. Her house and her appearance reflect this severity: the immaculate house seems too sterile for comfort, and Marilla has an angular face and tightly knotted hair. Despite her stiffness, however, something about her mouth suggests a natural, if undeveloped, sense of humor. When Mrs. Rachel asks about Matthew's errand, Marilla informs her that he is on his way to pick up the Cuthberts' new orphan from the train station. With Matthew getting older--he is sixty--they realized they needed help around the farm and decided to adopt a boy from the orphanage. This news shocks Mrs. Rachel, who launches into a monologue about the horror stories she has heard about orphans--a boy who set fire to his new home, another who used to suck eggs, and a girl who put strychnine in the well. Marilla acknowledges her concerns about bringing a stranger into the house, but she comforts herself with the knowledge that the boy will at least be Canadian and thus not too different from themselves. Marilla wonders why anyone would adopt a girl, since girls cannot work on farms.

booksum

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Small Business Tax Cut Act''. SEC. 2. DEDUCTION FOR DOMESTIC BUSINESS INCOME OF QUALIFIED SMALL BUSINESSES. (a) In General.--Part VI of subchapter B of chapter 1 of the Internal Revenue Code of 1986 is amended by adding at the end the following new section: ``SEC. 200. DOMESTIC BUSINESS INCOME OF QUALIFIED SMALL BUSINESSES. ``(a) Allowance of Deduction.--In the case of a qualified small business, there shall be allowed as a deduction an amount equal to 20 percent of the lesser of-- ``(1) the qualified domestic business income of the taxpayer for the taxable year, or ``(2) taxable income (determined without regard to this section) for the taxable year. ``(b) Deduction Limited Based on Wages Paid.-- ``(1) In general.--The amount of the deduction allowable under subsection (a) for any taxable year shall not exceed 50 percent of the greater of-- ``(A) the W-2 wages of the taxpayer paid to non- owners, or ``(B) the sum of-- ``(i) the W-2 wages of the taxpayer paid to individuals who are non-owner family members of direct owners, plus ``(ii) any W-2 wages of the taxpayer paid to 10-percent-or-less direct owners. ``(2) Definitions related to ownership.--For purposes of this section-- ``(A) Non-owner.--The term `non-owner' means, with respect to any qualified small business, any person who does not own (and is not considered as owning within the meaning of subsection (c) or (e)(3) of section 267, as the case may be) any stock of such business (or, if such business is other than a corporation, any capital or profits interest of such business). ``(B) Non-owner family members.--An individual is a non-owner family member of a direct owner if-- ``(i) such individual is family (within the meaning of section 267(c)(4)) of a direct owner, and ``(ii) such individual would be a non-owner if subsections (c) and (e)(3) of section 267 were applied without regard to section 267(c)(2). ``(C) Direct owner.--The term `direct owner' means, with respect to any qualified small business, any person who owns (or is considered as owning under the applicable non-family attribution rules) any stock of such business (or, if such business is other than a corporation, any capital or profits interest of such business). ``(D) 10-percent-or-less direct owners.--The term `10-percent-or-less direct owner' means, with respect to any qualified small business, any direct owner of such business who owns (or is considered as owning under the applicable non-family attribution rules)-- ``(i) in the case of a qualified small business which is a corporation, not more than 10 percent of the outstanding stock of the corporation or stock possessing more than 10 percent of the total combined voting power of all stock of the corporation, or ``(ii) in the case of a qualified small business which is not a corporation, not more than 10 percent of the capital or profits interest of such business. ``(E) Applicable non-family attribution rules.--The term `applicable non-family attribution rules' means the attribution rules of subsection (c) or (e)(3) of section 267, as the case may be, but in each case applied without regard to section 267(c)(2). ``(3) W-2 wages.--For purposes of this section-- ``(A) In general.--The term `W-2 wages' means, with respect to any person for any taxable year of such person, the sum of the amounts described in paragraphs (3) and (8) of section 6051(a) paid by such person with respect to employment of employees by such person during the calendar year ending during such taxable year. ``(B) Limitation to wages attributable to qualified domestic business income.--Such term shall not include any amount which is not properly allocable to domestic business gross receipts for purposes of subsection (c)(1). ``(C) Other requirements.--Except in the case of amounts treated as W-2 wages under paragraph (4)-- ``(i) such term shall not include any amount which is not allowed as a deduction under section 162 for the taxable year, and ``(ii) such term shall not include any amount which is not properly included in a return filed with the Social Security Administration on or before the 60th day after the due date (including extensions) for such return. ``(4) Certain partnership distributions treated as w-2 wages.-- ``(A) In general.--In the case of a qualified small business which is a partnership and elects the application of this paragraph for the taxable year-- ``(i) the qualified domestic business taxable income of such partnership for such taxable year (determined after the application of clause (ii)) which is allocable under rules similar to the rules of section 199(d)(1)(A)(ii) to each qualified service- providing partner shall be treated for purposes of this section as W-2 wages paid during such taxable year to such partner as an employee, and ``(ii) the domestic business gross receipts of such partnership for such taxable year shall be reduced by the amount so treated. ``(B) Qualified service-providing partner.--For purposes of this paragraph, the term `qualified service-providing partner' means, with respect to any qualified domestic business taxable income, any partner who is a 10-percent-or-less direct owner and who materially participates in the trade or business to which such income relates. ``(5) Acquisitions and dispositions.--The Secretary shall provide for the application of this subsection in cases where the taxpayer acquires, or disposes of, the major portion of a trade or business or the major portion of a separate unit of a trade or business during the taxable year. ``(c) Qualified Domestic Business Income.--For purposes of this section-- ``(1) In general.--The term `qualified domestic business income' for any taxable year means an amount equal to the excess (if any) of-- ``(A) the taxpayer's domestic business gross receipts for such taxable year, over ``(B) the sum of-- ``(i) the cost of goods sold that are allocable to such receipts, and ``(ii) other expenses, losses, or deductions (other than the deduction allowed under this section), which are properly allocable to such receipts. ``(2) Domestic business gross receipts.-- ``(A) In general.--The term `domestic business gross receipts' means the gross receipts of the taxpayer which are effectively connected with the conduct of a trade or business within the United States within the meaning of section 864(c) but determined-- ``(i) without regard to paragraphs (3), (4), and (5) thereof, and ``(ii) by substituting `qualified small business (within the meaning of section 200)' for `nonresident alien individual or a foreign corporation' each place it appears therein. ``(B) Exceptions.--For purposes of paragraph (1), domestic business gross receipts shall not include any of the following: ``(i) Gross receipts derived from the sale or exchange of-- ``(I) a capital asset, or ``(II) property used in the trade or business (as defined in section 1231(b)). ``(ii) Royalties, rents, dividends, interest, or annuities. ``(iii) Any amount which constitutes wages (as defined in section 3401). ``(3) Application of certain rules.--Rules similar to the rules of paragraphs (2) and (3) of section 199(c) shall apply for purposes of this section (applied with respect to qualified domestic business income in lieu of qualified production activities income and with respect to domestic business gross receipts in lieu of domestic production gross receipts). ``(d) Qualified Small Business.--For purposes of this section-- ``(1) In general.--The term `qualified small business' means any employer engaged in a trade or business if such employer had fewer than 500 full-time equivalent employees for either calendar year 2010 or 2011. ``(2) Full-time equivalent employees.--The term `full-time equivalent employees' has the meaning given such term by subsection (d)(2) of section 45R applied-- ``(A) without regard to subsection (d)(5) of such section, ``(B) with regard to subsection (e)(1) of such section, and ``(C) by substituting `calendar year' for `taxable year' each place it appears therein. ``(3) Employers not in existence prior to 2012.--In the case of an employer which was not in existence on January 1, 2012, the determination under paragraph (1) shall be made with respect to calendar year 2012. ``(4) Application to calendar years in which employer in existence for portion of calendar year.--In the case of any calendar year during which the employer comes into existence, the number of full-time equivalent employees determined under paragraph (2) with respect to such calendar year shall be increased by multiplying the number so determined (without regard to this paragraph) by the quotient obtained by dividing-- ``(A) the number of days in such calendar year, by ``(B) the number of days during such calendar year which such employer is in existence. ``(5) Special rules.-- ``(A) Aggregation rule.--For purposes of paragraph (1), any person treated as a single employer under subsection (a) or (b) of section 52 (applied without regard to section 1563(b)) or subsection (m) or (o) of section 414 shall be treated as a single employer for purposes of this subsection. ``(B) Predecessors.--Any reference in this subsection to an employer shall include a reference to any predecessor of such employer. ``(e) Special Rules.-- ``(1) Elective application of deduction.--Except as otherwise provided by the Secretary, the taxpayer may elect not to take any item of income into account as domestic business gross receipts for purposes of this section. ``(2) Coordination with section 199.--If a deduction is allowed under this section with respect to any taxpayer for any taxable year-- ``(A) any gross receipts of the taxpayer which are taken into account under this section for such taxable year shall not be taken into account under section 199 for such taxable year, and ``(B) the W-2 wages of the taxpayer which are taken into account under this section shall not be taken into account under section 199 for such taxable year. ``(3) Application of certain rules.--Rules similar to the rules of paragraphs (1), (2), (3), (4), (6), and (7) of section 199(d) shall apply for purposes of this section (applied with respect to qualified domestic business income in lieu of qualified production activities income). ``(f) Regulations.--The Secretary shall prescribe such regulations as are necessary to carry out the purposes of this section, including regulations which prevent a taxpayer which reorganizes from being treated as a qualified small business if such taxpayer would not have been treated as a qualified small business prior to such reorganization. ``(g) Application.--Subsection (a) shall apply only with respect to the first taxable year of the taxpayer beginning after December 31, 2011.''. (b) Conforming Amendments.-- (1) Section 56(d)(1)(A) of such Code is amended by striking ``deduction under section 199'' both places it appears and inserting ``deductions under sections 199 and 200''. (2) Section 56(g)(4)(C) of such Code is amended by adding at the end the following new clause: ``(vii) Deduction for domestic business income of qualified small businesses.--Clause (i) shall not apply to any amount allowable as a deduction under section 200.''. (3) The following provisions of such Code are each amended by inserting ``200,'' after ``199,''. (A) Section 86(b)(2)(A). (B) Section 135(c)(4)(A). (C) Section 137(b)(3)(A). (D) Section 219(g)(3)(A)(ii). (E) Section 221(b)(2)(C)(i). (F) Section 222(b)(2)(C)(i). (G) Section 246(b)(1). (H) Section 469(i)(3)(F)(iii). (4) Section 163(j)(6)(A)(i) of such Code is amended by striking ``and'' at the end of subclause (III) and by inserting after subclause (IV) the following new subclause: ``(V) any deduction allowable under section 200, and''. (5) Section 170(b)(2)(C) of such Code is amended by striking ``and'' at the end of clause (iv), by striking the period at the end of clause (v) and inserting ``, and'', and by inserting after clause (v) the following new clause: ``(vi) section 200.''. (6) Section 172(d) of such Code is amended by adding at the end the following new paragraph: ``(8) Domestic business income of qualified small businesses.--The deduction under section 200 shall not be allowed.''. (7) Section 613(a) of such Code is amended by striking ``deduction under section 199'' and inserting ``deductions under sections 199 and 200''. (8) Section 613A(d)(1) of such Code is amended by redesignating subparagraphs (C), (D), and (E) as subparagraphs (D), (E), and (F), respectively, and by inserting after subparagraph (B) the following new subparagraph: ``(C) any deduction allowable under section 200,''. (9) Section 1402(a) of such Code is amended by striking ``and'' at the end of paragraph (16), by redesignating paragraph (17) as paragraph (18), and by inserting after paragraph (16) the following new paragraph: ``(17) the deduction provided by section 200 shall not be allowed; and''. (c) Clerical Amendment.--The table of sections for part VI of subchapter B of chapter 1 of such Code is amended by adding at the end the following new item: ``Sec. 200. Domestic business income of qualified small businesses.''. Passed the House of Representatives April 19, 2012. Attest: KAREN L. HAAS, Clerk.

Title: To amend the Internal Revenue Code of 1986 to provide a deduction for domestic business income of qualified small businesses Summary: Small Business Tax Cut Act - Amends the Internal Revenue Code to allow a qualified small business a tax deduction equal to 20% of the lesser of qualified domestic business income or taxable income. Defines: (1) "qualified small business" as any employer engaged in a trade or business if such employer had fewer than 500 full-time employees in either 2010 or 2011; and (2) "qualified domestic business income" as an amount equal to the excess (if any) of the taxpayer's domestic business gross receipts (i.e., gross receipts effectively connected with a trade or business within the United States) for a taxable year over the sum of the cost of goods sold allocable to such receipts and other expenses, losses, or deductions properly allocable to such receipts. Limits the amount of such deduction to 50% of the greater of: (1) the taxpayer's W-2 wages (payroll) paid to non-owners of the taxpayer's business; or (2) the sum of the W-2 wages paid to individuals who are non-owner family members of direct owners (i.e., stockholders of the business), plus any W-2 wages paid to direct owners who have an ownership interest in the business of 10% or less. Directs the Secretary of the Treasury to prescribe regulations to carry out this Act, including regulations to prevent a taxpayer that reorganizes from being treated as a qualified small business if such taxpayer would not have been treated as a qualified small business prior to such reorganization.

billsum

en

Summarize: Former Home Secretary Leon Brittan was only questioned over allegations he raped a student in 1967 following demands by the Director of Public Prosecutions, it has been claimed. Alison Saunders is understood to have insisted the Metropolitan Police re-investigate claims Lord Brittan raped a 19-year-old woman at his London flat in 1967 because no questions were asked at the time. Lord Brittan was in his late 20s and not yet an MP at the time of the alleged incident, with police saying the woman originally made a complaint in late 2012. Today Lord Brittan released a statement confirming he was interviewed by police in relation to a'serious allegation', but insisted that the allegation was 'wholly without foundation'. Scroll down for video. Allegations: The Director of Public Prosecutions Alison Saunders (right) is understood to have insisted the Metropolitan Police re-investigate claims Lord Brittan (left) raped a woman at his London flat in 1967. Denial: Lord Brittan (pictured leaving his North Yorkshire home this morning) has released a statement confirming he was interviewed by police, but insisted that the allegation was 'wholly without foundation' The Metropolitan Police only investigated claims Lord Brittan raped the student after the Director of Public Prosecutions demanded to know why he wasn't questioned when the alleged victim came forward, investigative news website Exaro claimed. As a result of Saunders' intervention, officers questioned Lord Brittan under caution in June at his solicitor's office and the allegations are now being investigated by officers from the Metropolitan Police’s Sexual Offences, Exploitation and Child Abuse Command. Saunders is believed to have looked into the case herself after the campaigning Labour MP Tom Watson wrote to her asking that she examine the way the police handled the case. The Metropolitan Police has now replaced the officer in charge of the investigation, Exaro claims. This morning Lord Brittan released a statement confirming he had been questioned by police in June, but denying the allegations. 'It is true that I have been questioned by the police about a serious allegation made against me. This allegation is wholly without foundation,' he said. Investigation: Lord Brittan was in his late 20s and not yet an MP at the time of the alleged rape, with police saying the woman originally first made a complaint against him in late 2012. In his statement Lord Brittan also referred to an 'explosive' dossier containing historic child abuse allegations against at least eight public figures was compiled by ex-Conservative MP Geoffrey Dickens, who died in 1995. The 114 files now known to have been. either lost or destroyed, fueling fears of a cover-up at the heart of. the establishment. 'I would like to put on record that I welcome the fact that there is now to be an independent review to look at the missing files belonging to the Home Office,' he said. 'It has been alleged that when I was Home Secretary I failed to deal adequately with the bundle of papers containing allegations of serious sexual impropriety that I received from the late Geoff Dickens MP,' he added. This too is completely without foundation... I passed this bundle of papers to the relevant Home Office officials for examination, as was the normal and correct practice,' Lord Brittan went on to say. This morning Prime Minister David Cameron said there would be 'no stone unturned' by an independent inquiry into how institutions handled allegations of child abuse, adding that it was 'vital' to find out the truth of what happened and to learn lessons. Sorry we are not currently accepting comments on this article

Summary: Alison Saunders understood to have told Met Police to re-investigate claims. Was reportedly unhappy that officers closed case without asking questions. Lord Brittan accused of raping 19-year-old student in 1967 at London flat. Alleged victim made complaint to police in 2012 but he was not questioned. Today Lord Brittan released statement confirming questioning by police. But he denied rape claims, insisting they are 'wholly without foundation'

cnn_dailymail

en

Summarize: By. Jade Watkins and Eleanor Gower. PUBLISHED:. 18:50 EST, 6 August 2013. |. UPDATED:. 16:45 EST, 7 August 2013. Custody: Tameka Raymond, pictured in court last August, has re-launched her bid for full custody. Usher's ex-wife Tameka Raymond has filed for custody of their two children following Monday's pool accident which left their five-year-old Usher V in a coma. Tameka, who divorced the 34-year-old singer in November 2009, filed legal documents on Tuesday asking for an emergency hearing on grounds Usher is allegedly creating a 'dangerous environment' for the children. According to TMZ, the documents were filed in Fulton County, Georgia, and ask for the hearing to take place later this week. Tameka is seeking decision-making power over the children's education, healthcare, religion and extracurricular activities. She is allegedly claiming Usher is 'abdicating' his parental responsibilities by letting other people care for their two children,' report the website. She is also said to be doubtful of the people Usher leaves in charge of looking after the children - Usher Jr and four-year Naviyd. Apparently Usher's aunt - Rena Oden - was in charge of watching the youngster when his arm got stuck in the pool drain on Monday which led him to be rushed to intensive care, say TMZ. Tameka believes that Oden was 'not on the ball' when the incident occurred. In her documents, she also claims that Usher is '85% of the time out of town' and therefore delegates the care of the children to other people. According to Tameka, the singer's family members have been looking after her children because The Voice judge continues to fire nannies that were previously on staff. Usher currently has primary custody while Tameka has limited custodial rights after their split, but now she is seeking to reverse the situation. Usher Raymond V is currently being. treated in the ICU at an Atlanta, Georgia hospital after his arm got. caught in the drain of a pool at the star's home early Monday evening. The incident came just over a year on from the death of Tameka's stepson Kile following a jet ski crash. Scroll down for video. Hospital dash: Usher's son Usher Raymond V, five, was rushed to intensive care after a serious pool accident on Monday. The accident happened when the youngster was said to playing in the swimming pool with Usher's aunt Oden, according to TMZ. After spying a toy in the drain of the pool, he reportedly dove down to retrieve it but his arm got caught in the process. Seeing Usher Raymond V underwater, Rena immediately swam down to rescue the boy but to no avail. A maid also tried but failed to help. before two men working in the house were said to have rushed out and. dove into the pool, finally freeing the boy's arm from the drain. Usher Raymond V was then reportedly given CPR and rushed to hospital. His. famous father was not home at the time of the incident, but as soon as. he was notified, was said to have promptly rushed to his Atlanta. property. Happier times: Tameka and Usher, pictured back in 2007, two years before their divorce became finalised. He rode in the ambulance with his son and was later joined at the hospital by Tameka, TMZ reports. The little boy's state is currently described as 'okay' and doctors are reportedly running tests on him. Meanwhile, the frantic 911 call which Usher's aunt placed to emergency services has now been released and obtained by TMZ. During the call, Rena can be heard hysterically begging the operator for an ambulance. 'My. nephew was in the pool. He went and I couldn't get him. I tried to get. him. They did CPR on him,' she is heard saying in the audio. She is also heard trying to calm. Usher's younger brother Naviyd, four, down, all whilst asking the two men. doing CPR on little Usher Raymond V, if he was breathing. She then reports to the dispatcher that the youngster is in fact breathing after the CPR. 'Is he OK?' she asks the men. 'He's breathing', she is then heard telling the operator. Tragic: The incident comes after Usher's stepson Kile Glover,pictured here, tragically passed away at the age of 11 last year following a jet-ski accident. When the ambulance does arrive whilst. Rena is on the line, little Naviyd is heard saying that his brother is. 'faking it' to which Rena bluntly tells him: 'He is not faking it, come here.' The terrifying turn of events come. after Usher's 11-year-old stepson Kile Glover died over a year ago, two. weeks after he was critically injured in a boating accident. Kile passed away from the injuries he obtained after being run over on July 6, 2012 by a personal watercraft on Lake Lanier. The young boy, whose mother is Tameka, was taken off life support by doctors on July 21, who determined that he would not recover from his injuries. Kile was struck in the head during a jet ski collision while riding an inner tube on the lake in Atlanta, Georgia. Rights : Usher has custody of his two sons, Usher Raymond V and Naviyd Ely Raymond, after a custody battle with his ex-wife Tameka Raymond. According. to authorities, a family friend who was riding a jet ski behind the. pontoon lost control and collided with Glover's tube. Kile. was with an unidentified 15-year-old girl at the time of the accident. and both children were airlifted to Children's Healthcare of Atlanta at. Egleston. He was later declared brain dead. In August last year, Usher was granted primary custody of his two paternal sons, Usher Raymond V and Naviyd, four, both of who he shares with Tameka. He had been locked in a custody battle with Tameka when Kile passed away. The. singer had been involved in a bitter dispute with his ex-wife over the. welfare of the boys, and a judge in Atlanta, Georgia, sided with the. star. The children spent the majority of time with their father, while Tameka retained some custodial rights. Heartbroken: Tameka tweeted this picture of Kile with his younger brother just before his death last year. Before the case closed, Usher's attorney labelled Tameka ‘incapable of being a proper parent’ to their children. He had accused Tameka of trying to interfere with the time he was allowed with their kids under their joint custody arrangement - a charge she denied. During closing arguments in the case, the legal representative said she ‘does not have the emotional stability or capacity to bond with them, and therefore she is handicapped’. Tameka's attorney, counter argued that Usher travels all the time and does not have a good relationship with his mother, whom he had testified was part of the family unit that would help take care of Usher V and Navyid when he was on the road

Summary: Tameka accused her ex of raising their sons in a 'dangerous environment. Usher V rushed to intensive care after his arm was trapped in a pool drain. A workman at the house revived him with CPR. Usher V was in the care of the singer's aunt who Tameka has 'issues' with. Incident comes a year after Tameka's son Kile, 11, died following a jet ski crash.

cnn_dailymail

en

Summarize: By. Emma Innes. PUBLISHED:. 07:20 EST, 15 March 2013. |. UPDATED:. 14:01 EST, 15 March 2013. A hospital investigation has been launched after a confused patient was discharged at 3.30am without a coat in sub-zero temperatures. Michael Atkinson, 64, was discharged from the Royal Bolton Hospital in Greater Manchester before being found by police tearful, frozen and wandering the streets more than half a mile away. He had hurt himself after he fell while he was lost and was ‘very distressed’ by his ordeal. He was also wearing a hospital wristband bearing the name and details of a two-year-old girl. Michael Atkinson, 64, was discharged from the troubled Royal Bolton Hospital in Greater Manchester before being found by police tearful, frozen and wandering the streets more than half a mile away. Earlier this month, Jonathan Hastilow-Sands, a 90-year-old Alzheimer’s sufferer, was reported missing from the same hospital. He was discovered in Bristol, 175 miles away. This week it was also revealed that an unnamed 76-year-old male patient walked more than a mile from the hospital in his pyjamas and dressing gown before he was stopped and taken in by a hairdresser. Hospital bosses have now launched a ‘full review’ into what happened to Mr Atkinson on March 6. His wife, Helen, who had been told her husband was being admitted to the hospital for a brain scan following a stroke, is also calling for action to be taken against the hospital for ‘negligence’. Mrs Atkinson, from Breightmet, Bolton, said: ‘When the police brought him back, he was in a terrible state. I was distraught and he was crying. He was like a bag of ice. It has made him worse. ‘Something is very wrong at that hospital. You don’t discharge a man in his state at 3.30am.’ Hospital bosses have now launched a 'full review' into what happened to Mr Atkinson on March 6. She has told how she called the hospital to find out. why she had not been contacted to collect him and said she was told they. ‘couldn’t find my number in his notes’ and that her husband could not. remember his phone number. Mr Atkinson suffered a stroke in 2005 and has been taking morphine for a slipped disc that has trapped a nerve. He suffers from emphysema and lung disease and has had pneumonia three times. Mrs Atkinson said her husband had been due to be collected by an ambulance for a brain scan, following a possible second stroke, between 3.30pm and 7.30pm on March 5. However, an ambulance did not arrive at the couple’s home until 11.40pm that night. Mrs Atkinson said the ambulance staff did not know why they were collecting her husband and, when at the hospital, no scan was carried out. After her husband was brought home by police at 4.30am the next morning, the 64-year-old said she was ‘livid’. He was found without his coat, which had been a Christmas present, and was missing his medication. Mrs Atkinson believes if he had not been found he could have got hypothermia and died. Mr Atkinson was re-admitted to the Royal Bolton Hospital for treatment, but has since been discharged and is back at the couple’s home. His wife has complained to the hospital and has contacted solicitors. She said: ‘I am so upset that my poor husband has suffered for so long unnecessarily. It is disgusting. The hospital says that it is carrying out an investigation into what happened. ‘Every time I walked in there to go and see him I took notes because I don’t trust them.’ Heather Edwards, head of communications at Bolton NHS Foundation Trust, said: ‘We are aware of Mrs Atkinson’s concerns and a full review is taking place to understand exactly what happened.’ Last year hospitals were told to end the ‘obviously unacceptable’ practice of sending elderly or vulnerable patients home in the middle of the night. Sir Bruce Keogh, medical director of the NHS, ordered an urgent review of how the service is discharging hundreds of thousands of patients amid concerns some are being left to fend for themselves. His intervention came after The Times newspaper obtained figures showing 293,000 patients at 100 hospital trusts had been sent home between 11pm and 6am in 2011

Summary: Michael Atkinson, 64, was discharged by the Royal Bolton Hospital at 3.30am. He was confused and was found an hour later by police tearful and freezing. He was wearing a hospital wristband bearing the name of a two-year-old girl. The hospital is investigating but his wife, Helen, wants to take legal action. At least two other similar cases have emerged recently at the same hospital.

cnn_dailymail

en

Summarize: FIELD OF THE INVENTION [0001] The present invention is directed generally to storage units for use with video game consoles for storing video games, video game controllers, memory cards and other accessories and more particularly to storage units incorporating a power strip and surge protection for providing power and surge protection for video game consoles and other electronic equipment. BACKGROUND OF THE INVENTION [0002] Home entertainment systems often include video game systems and other expensive pieces of electronic equipment. Much of this equipment is typically connected to an AC power source. Additionally, certain elements of these systems are often connected to the Internet or other network through Ethernet, coaxial, telephone or other types of cabling. Therefore, these systems are susceptible to power surges and signal line disturbances due to lighting and power fluctuations. [0003] In addition, video game systems typically include video game consoles, game controllers, game disks, memory cards and other various components. Many of these systems, however, fail to provide adequate or appropriate storage means for these various video game components. As the number of various components increase, so too does the need for a system for managing and storing them. [0004] There are several prior art surge protection devices for protecting home entertainment systems and other types of electronic equipment. In addition, other systems exist for storing the various components of a video game system. A need exists for a combination system that is capable of both protecting home entertainment systems from power surges and that will also provide adequate storage for the various components that typically accompany these systems, including the video game components listed above as well as DVD&#39;s, CD-ROM&#39;s, etc. SUMMARY OF THE INVENTION [0005] In embodiments of the present invention, in order to overcome these and other shortcomings, a different approach has been taken; a game management system is provided that provides surge protection to a video game console and other home entertainment equipment as well as provide storage means for storing video game disks, memory cards, DVD&#39;s, CD-ROM&#39;s, game controllers and other accessories. [0006] In one aspect, the present invention is directed to a video game management system. The video game management system includes at least one storage module, wherein the storage module is constructed and arranged to store at least one disk and or may store at least one memory card and at least one controller clip, wherein the controller clip is configured to cradle a video game controller. [0007] The video game management system may be constructed and arranged such that the controller clip is configured to accept a video game controller cord. The video game management system may be constructed and arranged such that the controller clip is removable. The video game management system may be constructed and arranged such that the storage module is constructed and arranged to store one or more DVD, CD-ROM and or video game disks. The video game management system may be constructed and arranged such that the storage module is removable from the game storage unit. The video game management system may be constructed and arranged such that the storage module includes a closable door. The video game management system may be constructed and arranged such that the storage module further includes a label. The video game management system may be constructed and arranged to store one or more DVD, CD-ROM, memory card and or video game disks in their original cases. [0008] The video game management system may be constructed and arranged to further include a surge suppression system, wherein the surge suppression system is constructed and arranged to provide surge protected power to one or more electronic devices. The video game management system may be constructed and arranged such that the surge suppression system includes one or more surge protected power outlets. The video game management system may be constructed and arranged such that the surge suppression system includes a power on and or a surge protection status light. The video game management system may be constructed and arranged such that the surge suppression system provides surge protection to one or more electronic devices through at least one jack. The video game management system may be constructed and arranged such that the surge suppression system further includes at least one coaxial cable jack and or at least one RJ 45 jack and or at least one RJ 11 jack. The video game management system may be constructed and arranged to correspond with a specific video game console. [0009] In another aspect, the present invention is directed to a video game management system wherein the video game management system includes a main housing, a surge suppression system disposed within the housing, wherein the surge suppression system is constructed and arranged to provide surge protected power to one or more electronic devices and at least one storage module disposed within the housing, wherein the storage module is constructed and arranged to store at least one disk and or at least one memory card. The video game management system may be constructed and arranged such that the storage module is removable from the housing. The video game management system may further be constructed and arranged to store one or more DVD, CD-ROM and or video game disks. The video game management system may further be constructed and arranged such that the storage module includes one or more sliding trays that are constructed and arranged for storing a disk and or may store a memory card. The video game management system may be constructed and arranged wherein the storage module further includes a door. The video game management system may be constructed and arranged wherein the storage module further includes a label. The video game management system may be constructed and arranged to store one or more DVD, CD-ROM, memory card and or video game disks in their original cases. The video game management system may be constructed and arranged such that the surge suppression system is constructed and arranged to provide surge protection to one or more electronic devices through at least one jack. The video game management system may be constructed and arranged to further include at least one coaxial cable jack and or at least one RJ 45 jack and or at least one RJ 11 jack. The video game management system may be constructed and arranged to further include at least one controller clip, wherein the controller clip is configured to cradle a video game controller. The video game management system may be constructed and arranged such that the controller clip is configured to accept a video game controller cord. The video game management system may be constructed and arranged to correspond with a specific video game console. The video game management system may be constructed and arranged such that certain features of the video game management system are accented in a color that corresponds with a specific video game console. [0010] In yet another aspect, the present invention is directed to a video game management system wherein the video game management system includes storage means for storing video game components and surge protected power means for providing surge protected power to at least one electronic device. [0011] In yet another aspect, the present invention is directed to a video game management system wherein the video game management system includes a housing, wherein the housing is constructed and arranged to provide a thermal barrier between a video game console or other electronic device and a surface of an object and a surge suppression system disposed within the housing, wherein the surge suppression system is constructed and arranged to provide surge protected power to one or more electronic devices. [0012] The video game management system may be further constructed and arranged such that certain features of the video game management system are constructed and arranged to correspond with a specific video game console. The video game management system may be further constructed and arranged such that certain features of the video game management system are accented in a color that corresponds with a specific video game console. The video game management system may be further constructed and arranged to include at least one storage module, wherein the storage module is constructed and arranged to store at least one disk and or at least one memory card. The video game management system may be further constructed and arranged such that the storage module is constructed and arranged to store one or more DVD, CD-ROM and or video game disks. The video game management system may be further constructed and arranged such that the storage module is removable. BRIEF DESCRIPTION OF THE DRAWINGS [0013] For a better understanding of the present invention, reference is made to the drawings, which are incorporated herein by reference, and in which: [0014] [0014]FIG. 1 is a perspective view of a video game management system in accordance with a first embodiment of the present invention; [0015] [0015]FIG. 2 is a perspective view of the video game management system of FIG. 1 showing a game controller clipped to the attached to video game management system; [0016] [0016]FIG. 3 is a perspective view of the video game management system of FIG. 1 showing various features of the storage modules; [0017] [0017]FIG. 4 is a perspective view of the video game management system of FIG. 1 showing optional mounting feet; [0018] [0018]FIG. 5 is a perspective view of an alternative embodiment of the video game management system; [0019] [0019]FIG. 6 a is a rear view of the video game management system in accordance with an embodiment of the present invention; [0020] [0020]FIG. 6 b is a blown-up view of the RJ-45 connection jack of FIG. 6 a; [0021] [0021]FIG. 6 c is a blown-up view of the coaxial cable connections of FIG. 6 a ; and [0022] [0022]FIG. 7 is a schematic diagram of a surge protection circuit in accordance with an embodiment of the present invention. DETAILED DESCRIPTION [0023] For purposes of illustration only, and not to limit generality, the present invention will now be described with reference to video game management systems for use with video game consoles, such as the PlayStation1 and PlayStation2 video game consoles sold under the trademark SONY, the XBOX video game console sold under the trademark MICROSOFT and the Nintendo 64 or Super Nintendo sold under the trademark NINTENDO. One skilled in the art, however, will appreciate that embodiments of the present invention are not limited to video game management systems. The present invention may also serve as a combination surge protection and storage device system for other electronic devices, such as a TV, VCR, DVD or CD-ROM player, wherein the system can provide surge protection to one or more electronic devices and can accommodate several types of disks (e.g., CD&#39;s, DVD&#39;s etc.) and other accessories. [0024] FIGS. 1 - 3 show a first embodiment of a video game management system 10, which includes a housing 12 and a pair of removable game storage modules 22, 24, for storing video game disks outside of their original case. The game storage modules 22, 24 are removably housed in a pair of game manager bays 26, 28 and may be used to safely store and transport several video game disks, CD-ROM&#39;s, DVD&#39;s and or memory cards from one location to another. In this and the following embodiments, the game management system 10 is shown in a horizontal orientation, however, it is contemplated that the game management system 10 may also be oriented vertically. [0025] The game storage modules 22, 24 each include a number of spring loaded disk trays 40 for storing video game disks 42. It should be noted that the disk trays 40 are configured to store other types of disks, such as CD-ROM&#39;s, DVD&#39;s, etc. Each disk tray 40 also includes a spring wire (not shown) attached to the back of the disk tray. The video game management system 10 also includes a plurality of numbered tray release tabs 44, which trigger the release of a corresponding disk tray 40. With the disk tray 40 extending out from the game storage modules 22, 24 the video game disk 42 is placed on the disk tray face 46 and then the tray 40 is pushed back into the storage module 22, 24 until it snaps in place. In the present embodiment, each game storage module can safely hold up to eleven video game disks 42 outside their original case. Other storage modules are contemplated for holding additional or fewer disks. [0026] In certain embodiments, the game storage modules 22, 24 also include a memory card tray 54 having four slots 58 for storing up to four memory cards 56. The memory card tray 54 is released in the same manner as the disk trays 40. Because not all memory cards 56 are of the same thickness, one or more trays above the memory card tray 54 may be removed to accommodate thicker memory cards. In addition, because not all memory cards are the same size, variations in the size and number of slots 58 are contemplated. Also, the number and arrangement of disk trays 40 and memory card trays 54 in each game storage module may be adjusted to accommodate a variety of disk and memory card configurations. [0027] In embodiments of the present invention, the game storage modules 22, 24 include module covers 50. The module covers 50 protect the video game disks 42 and the memory cards 56 when the storage module is either in or out of the video game management system 10. In some embodiments, the module cover 50 is a molded door that closes to protect and contain the disks during travel, which may be folded back and out of the way when the game storage modules 22, 24 are inserted into the video game management system 10. [0028] In certain embodiments, the module covers 50 may include labels 52 for listing the video game disks 42 and the memory cards 56 stored within the game storage modules 22, 24. A clear plastic strip 78, located on a surface 80 of the video game management system 10, allows the user to read entries on the label 52, without having to remove the game storage modules from their storage bays. [0029] In certain embodiments, the video game management system 10 also includes a pair of optional and or removable video game controller clips 32, 34, which provide storage for up to two video game controllers 62, while keeping their cords from getting tangled. The controller clips 32, 34 each include a hook 60 for storing a video game controller 62 and a set of chassis tabs 64, 66 about which a video game controller cord (not shown) may be wrapped when not in use. [0030] Additionally, the sets of chassis tabs 64, 66, about which the controller cord is wrapped, also serve strain relief and protection from disconnect functions. When the controller cord is threaded through the pincer fingers 68 of the chassis tabs 64, 66 by displacing the fingers enough to allow the cord to pass through, the pincers 68 act as a strain relief, absorbing some force imparted by accidental or unintended pulling on the controller cord. This feature of the present invention prevents accidental disconnect of the controller cords during excited game play. Referring now to FIG. 4, in this and other embodiments, the video game management system may be used as a platform for various game consoles and other components of a home entertainment system. For example, a set of optional mounting feet 70 may be placed on the top surface 80 of the video game management system 10. When installed, the mounting feet 70 allow a game console (not shown) to be safely and securely placed on top of the video game management system 10. The mounting feet 70 allow airflow between the video game management system 10 and the video game console, which helps to dissipate heat between the devices. The mounting feet 70 also serve to prevent slippage between the game management system 10 and a game console, thereby keeping the units neatly stacked with one another. [0031] [0031]FIG. 5 shows another embodiment of the present invention, wherein the video game management system 10 is configured for storing video game disks 42 in their original cases 96. In this embodiment, one or both of the game storage modules 22, 24 is removed from the game manager bays 26, 28 and a pair of guide rails 90, 92 are placed in the game manager bays 26, 28 in their place. As shown, guide rails 90, 92 form a series of four slots 94, wherein each slot 94 can accommodate a video game in its original case 96. The guide rails 90, 92 may also be configured for storing CD-ROM and DVD disks in their original cases as well. [0032] [0032]FIGS. 6 a - 6 c show an optional surge protection module 100 mounted in the back end 106 of the video game management system 10. The surge protection module 100 includes a series of power outlets 102, which may be used to supply surge protected power to a video game console and additional devices, such as a television, DVD player, CD player, etc. In this embodiment, the surge protection module 100 includes an additional outlet 104 for accommodating a device having a transformer block. [0033] The surge protection module 100 also includes surge protected coaxial jacks 110, 112, which may be used to protect a cable modem, cable television box, gaming equipment or other equipment that requires a coaxial cable connection. To protect a piece of equipment requiring a coaxial connection, a coaxial cable is connected from a wall jack (not shown) to coaxial jack 110. Then, using a separate cable, the piece of equipment is then connected to coaxial jack 112. [0034] Also shown in this embodiment, because it may be desirable to connect a video game module or other device to the Internet or other network using a 10-Base T or 100-Base T cable (not shown), the surge protection module 100 includes surge protected RJ-45 jacks 120, 122. The RJ-45 jack 120 is used to connect the video game management system 10 to a wall or similar type jack (not shown) and the RJ-45 jack 122 is used to connect the video game management system 10 to the piece of equipment to be protected. [0035] In other embodiments, it is contemplated that other jacks may be employed for providing surge protection for other types of cabling. For example, RJ-11 or telephone type jacks (not shown) may be used for connecting phone lines or other similar type cabling to and from the game management system. [0036] The video game management system 10 includes a power cord 128 for connecting the system to a power source (not shown) and a power switch circuit breaker 130 (See FIGS. 2 - 5 ), which provides power to outlets 102, 104 and other surge protected receptacles and acts as a circuit breaker to protect against overload conditions. The video game management system 10 further includes a removable on/off switch guard 136, which helps to prevent accidental turn offs. [0037] The video game management system 10 may further include various indicators that alert a user to the status of power and or surge protection capabilities. For example, a protection-working indicator 140 illuminates when the video game management system 10 is turned on and the surge protection module 100 is functioning properly, thereby protecting connected equipment from harmful power surges. In certain embodiments, the surge protection capabilities of the surge protection module 100 continue to operate when the video game management system 10 is turned off. The video game management system 10 may also include a site wiring fault indicator 142, which indicates when lit that there is an issue with the building wiring, such as an improper building ground, which may present a potential shock hazard and or may limit the protection features of the surge protection module 100. [0038] In certain embodiments of the present invention, the video game management system 10 may be configured to correspond with a specific video game console or other electronic devices. For example, the size, shape and color of housing 12 may be constructed and arranged to interrelate with the dimensions and appearance of any of a number of video game consoles. Also, certain other features of the video game management system 10, such as the video game controller clips 32, 34, the clear plastic strip 78 and the on/off switch guard 136 may be colored or otherwise accented to highlight or interrelate with certain colors and features of specific video game consoles (e.g., they may be made blue for use with the SONY PlayStation, green for use with the MICROSOFT XBOX, or purple for use with NINTENDO brand Nintendo 64 or Super Nintendo consoles. Additionally, certain markings or labels may be affixed to the video game management system 10 to further relate to a specific electronic device. [0039] [0039]FIG. 7 shows a schematic diagram of a surge suppression system of one embodiment of the present invention. Although a typical surge suppression system is described, one skilled in the art will appreciate that alternative power protection designs may be employed that include, for example line-conditioning capabilities. Alternatively, a power station or power manager (not shown) may be used to protect the video game console or other equipment from unwanted power surges as well as allowing for separate on off features, with some, all or none of the components contained within the video game management system 10. [0040] Having thus described at least one illustrative embodiment of the invention, various alterations, modifications and improvements will readily occur to those skilled in the art. Such alterations, modifications and improvements are intended to be within the scope and spirit of the invention. Accordingly, the foregoing description is by way of example only and is not intended as limiting. The invention&#39;s limit is defined only in the following claims and the equivalents thereto.

Summary: Aspects of the present invention are directed to methods and apparatus for providing a power strip with surge suppression, game controller storage with cord management and CD, DVD, game disk and memory card storage. A game console storage unit is provided which includes a power strip with surge suppression for powering a video game console as well as other devices for storing.... The invention can exist in several configurations including a single storage bay or combinations of multiple storage bays. In some configurations the storage bays are removable and or transportable.

big_patent

en

Summarize: The bodies of six teenagers were discovered in the Bavarian town of Arnstein on Sunday. Public prosecutors said the bodies of both men and women were found. All the dead were between the ages of 18 and 19, with three of the victims from Arnstein and the other three from neighboring localities. According to police, a concerned father found the bodies after going to look for his missing son and daughter, who had held a small party in the shed the night before. Upon realizing they had not returned home, the father set out searching Sunday morning and discovered his children's bodies alongside four other teens. Police initally suggested that initial signs pointed to a possible overdose on an unknown substance. However, they later stated carbon monoxide poisoning may have caused the youths' deaths after discovering a woodstove in the shed that had been used the previous evening. Still, any purported cause of death at this point was "pure speculation," a police spokesperson said. An official investigation has been opened. "It remains unclear what led to the death of the six people, but police said there were no indications of any violent crime," investigators said. An autopsy to confirm the cause of death could take several days. A town in shock Police currently can only speculate at the cause of death. The gruesome discovery has shaken the small locality of around 8,000 inhabitants. The second mayor of Arnstein, Franz-Josef Sauer (Christian Democratic Union), told dpa that he will focus on the victims' families, giving them the space they need. "We must also ensure that we support our city as well as possible," he added. City hall flew mourning flags from the steps of the building, and Arstein's Catholic parish, St. Nikolaus church, will commemorate the teenagers' deaths with a mourning hour Monday evening. cmb/kms (AFP, dpa) Image copyright AFP/Getty Images Image caption A German policeman at the entrance to the area where the bodies were found A father in Germany has found the bodies of six teenagers, including his son and daughter, in his secluded garden hut in Bavaria. The five young men and a woman aged 18 and 19 had been having a party outside the town of Arnstein on Saturday night. The hut's owner went to look for the teenagers when they failed to reappear on Sunday. Police say the cause of the deaths is unclear, but that there are no initial indications of a violent crime. The father called emergency services for help but it was too late. A neighbour told German media that his daughter had been celebrating her 18th birthday. The brick-built building was some distance outside Arnstein and the area was covered in snow. Police are trying to find out whether a wood-burning stove used to heat the secluded building had led to the deaths. One theory is that they may have died of carbon monoxide poisoning. Image copyright EPA Image caption The remote hut is in a remote wooded area some distance from the small Bavarian town of Arnstein "The circumstances remain unclear," said police spokesman Bjorn Schmitt on Monday. "We don't want to get involved in any speculation." A criminal investigation has been launched and a post mortem examination will be carried out into the cause of the teenagers' deaths. Starting in 1996, Alexa Internet has been donating their crawl data to the Internet Archive. Flowing in every day, these data are added to the Wayback Machine after an embargo period. BERLIN (AP) — Police in Germany say the bodies of six teenagers have been found dead in a garden house near the southern city of Wuerzburg. Bavarian police say the owner of the garden in Arnstein, about 75 kilometers (46.6 miles) east of Frankfurt, found the bodies of his son, daughter and four others, all aged 18 or 19, on Sunday morning. He went there to investigate after failing to reach his children, who held a party at the garden on Saturday night. Wuerzburg police said in a statement that the circumstances surrounding the deaths still are unclear. They say there were no immediate indications of a violent crime at the garden house.

Summary: A worried father in Bavaria made a horrifying discovery Sunday morning: the bodies of six teenagers, including his own son and daughter, in a garden shed. Police say there were no signs of violence. The youths, all 18 or 19 years old, were initially thought to have overdosed on an unknown substance, but investigators now suspect that carbon monoxide poisoning caused the deaths, Deutsche Welle reports. Police say the teens had been using a wood-burning stove in the shed. A neighbor told local media that the teenagers had been celebrating the daughter's 18th birthday, the BBC reports. The AP reports that the owner of the building in a secluded area outside Arnstein, a Bavarian town near Frankfurt, went to the shed after he couldn't reach his children the morning after the party. Police say that while carbon monoxide poisoning is thought to have been the cause, that remains "pure speculation" until autopsy results come in several days from now, MDR reports.

multi_news

en

Summarize: Published on May 31, 2016 This is why we beg and plead with our visitors to please refrain from touching objects in museums. The couple did notify Museum staff immediately. The NAWCC Museum houses the largest collection of clocks and watches in America and is appreciative of concerned queries regarding the recent unfortunate damage sustained to a clock. Your donations help ensure the long-term survival of these timekeeping treasures. Visit www.watchandclockcollectors.org to donate. A couple visiting the National Watch and Clock Museum in Columbia, Pennsylvania, got a quick lesson in why all those "Don't Touch" signs are up in every museum you visit. In a CCTV clip released by the museum, you can see a man taking a picture of a one-of-a-kind James Borden clock before approaching it and touching it repeatedly. Finally, after repeated pokes and taps, the inevitable happens: Advertisement - Continue Reading Below The museum decided not to press charges against the couple, but did post the video on their Instagram page as a teachable moment, with the caption, "This is why we beg visitors not to touch museum object. #museumfail #museums #visitorfail #clock #timepiece." Speaking to nbcphiladelphia.com, museum director Noel Poirier says he believes the man was attempting to get the clock to start running again. Many of the clocks on display don't run all day. Most Popular "Once he pulled it up a little too high, that weight came off track and the heavy weight came down, hit the clock, knocked the clock off the wall, so then you see the results," Poirier told the local NBC station. "I think what he was trying to do was raise the weight up because I think he thought that would make the clock run." The clock has been hanging in the museum for more than 20 years, and won a national award in 1994. Luckily, Borden says he'll repair the piece. Source: nbcphiladelphia.com One man visiting the National Watch and Clock Museum in Columbia, Pennsylvania, just couldn't resist touching a sculpted, wooden clock hanging on a wall. After he touches it repeatedly, it crashes to the ground, breaking into several pieces. The man and a woman accompanying him are seen trying to fix the shattered clock, before they walk away when they can't piece it back together. The museum isn't pressing charges against the pair, but instead wants to educate visitors on why it's important to follow the rules. The museum director also says there are more problems with adults than children with touching objects. The clock sculpture has hung in the museum for more than 20 years and won a national award in 1994. Artist James Borden has agreed to repair the piece. (Published Friday, June 3, 2016) The National Watch & Clock Museum in Pennsylvania decided it was time for a teachable moment when surveillance cameras captured a guest touching a rare modern clock earlier this week and accidentally knocking it off the wall. The museum shared the video on Instagram and YouTube, reminding visitors that there's a no-touching rule at the museum for a reason. "This is why we beg visitors not to touch museum object. #museumfail #museums #visitorfail #clock #timepiece," the caption on the Instagram video reads. The video shows a man and a woman who visited the Columbia, Lancaster County, museum on Tuesday admiring a wooden sculpture clock created by artist James Borden for a few seconds before the man gets bold and decides to try to move the weights on the clock. Museum Director Noel Poirier said he and the museum staff who've watched the video several times think the man was probably trying to see if he could get the timepiece to run. Some of the roughly 1,500 clocks that are on display at the museum at any given time don't constantly run. "Once he pulled it up a little too high, that weight came off track and the heavy weight came down, hit the clock, knocked the clock off the wall, so then you see the results," Poirier said. "I think what he was trying to do was raise the weight up because I think he thought that would make the clock run." In the video, the clock falls from the wall, and pieces scatter on the floor. The man picks up the clock itself and tries to hang it back on the wall, but then leans it against the wall before he and the woman walk away. Poirier said that despite media reports saying the man ran away to try to go unnoticed, he actually went to find a museum staffer so the clock's parts could be properly cleaned up. Poirier said museum curators are happy to make any clock run should a curious visitor want to see how it works. But they prefer that visitors not take matters into their own hands. "Apparently this visitor really wanted to see this one run," Poirier said. "For us, it's a learning opportunity for folks because there are reasons that museums ask folks not to touch things." Poirier said in the roughly 10 years he's worked at the museum, this is the first time he can recall a visitor accidentally breaking something. People touch things all the time, though, he said. "There are people who touch things in museums regardless of what you do," he said. "Most times, it's adults. People think it's children, but it's really not." Borden, the artist who sculpted the clock out of wood, donated it to the museum's collection of some 13,000 objects in 1994, Poirier said. Fortunately, he said, the clock is fixable, and most of its repairs can be done in-house at the museum. He said the clock should be back on display in the next few months.

Summary: Even a broken clock is right twice a day. Unless that clock has been smashed into pieces by a museum-goer with self-control issues. In that case, it's totally useless. NBC Philadelphia reports a visitor to the National Watch & Clock Museum in Pennsylvania was caught on video Tuesday poking and pulling at a rare wooden sculpture clock. Inverse quotes astounded video viewers, who noted on Reddit that the man "practically stress tested that thing" and "would NOT. STOP. TOUCHING IT." The museum's director, Noel Poirier, thinks the man was trying to get the clock to work. All he succeeded in doing was yanking it off the wall. The clock, which Popular Mechanics reports had been hanging in the museum for two decades and has won a national award, hit the ground and broke into pieces. The man futilely tried to re-hang the clock while his female companion gathered the pieces. They eventually had to inform museum staff of what they'd done. The museum hopes to repair the clock over the next few months, and Poirier calls it a "learning opportunity." "There are people who touch things in museums regardless of what you do," he tells NBC. "Most times, it's adults. People think it's children, but it's really not." While the museum isn't pressing charges, the man will have to endure some light internet humiliation. "This is why we beg visitors not to touch museum object. #museumfail #museums #visitorfail," the museum posted on Instagram.

multi_news

en

Summarize: House Speaker John Boehner has stuck an Internet sales tax proposal in a drawer and he doesn't intend to dust it off before the end of the Christmas shopping season – if he considers it at all. The Marketplace Fairness Act, passed last year in the Senate, would allow each state to force out-of-state online retailers to collect sales taxes from its residents. But a Boehner spokesman said late Monday in a statement that the plan isn't going anywhere. SHOPPING FREEDOM? House Speaker John Boehner wants online purchases to be tax-free so retailers – including small Internet businesses – won't have to do paperwork for all 45 states that collect sales taxes. 'The speaker has made clear in the past he has significant concerns about the bill, and it won’t move forward this year,” said spokesman Kevin Smith. 'The Judiciary Committee continues to examine the measure and the broader issue. In the meantime, the House and Senate should work together to extend the moratorium on Internet taxation without further delay.' The committee, chaired by Virginia Republican Rep. Bob Goodlatte, has sat on the Marketplace Fairness Act since early in 2013. A congressional aide told MailOnline that Goodlatte fears forcing Internet stores to collect sales taxes could create new tax-compliance nightmares. They would have to manage the requirements of all 45 states that collect sales taxes, the staffer explained, while traditional stores with no more than a few locations only need to worry about one. That wouldn't be a problem for a shoe store like Zappos, but it could be a paperwork headache for every small business that has an online presence. The National Retail Federation, a trade group, is backing brick-and-mortar shops that want to see Internet sales taxes everywhere since their walk-in customers have to pay the taxes on everything they buy. 'The bill may change or even be folded into another piece of "must-pass" legislation. NRF communications director Stephen Schatz tweeted Monday. 'The fight is far from over.' 'We have about three weeks in the lame duck. Anything can happen. Retailers are all in to get this done this year.' The Obama administration backed the proposal when the Senate bill made national news. 'We believe that the Marketplace Fairness Act will level the playing field for local small business retailers who are undercut every day by out-of state online companies,' the White House's then-press secretary Jay Carney told reporters in April 2013. 'Today, while local small business retailers follow the law and collect sales taxes from customers who make purchases in their stores, many big business online and catalogue retailers do not collect the same taxes. This puts local neighborhood-based small businesses at a disadvantage to big, out-of-state, online companies.' Big money: State legislators hope new laws will help recapture tax revenue lost when consumers makes billions in purchases each year from sites like Amazon. But Grover Norquist, the famously anti-tax president of Americans for Tax Reform, lashed out at the idea. 'Too many politicians in state capitols and Washington have looked at the internet only as a way to raise taxes,' he told MailOnline on Tuesday. 'They want to tax Internet access, they want to raise Internet sales.' 'Boehner has drawn a line in the sand saying the American people come first and politicians need to keep their hands off the Internet.... Obama says yes to taxing the Internet, Reid says yes to taxing the Internet. Speaker Boehner just said "hell no" to taxing the Internet. Boehner wins.' One odd development will strike the states of Virginia and Maryland if the Marketplace Fairness Act doesn't become law, according to Roll Call. Transportation funding calculations in both of those states will change unless they can start collecting sales tax from their residents who buy things across state lines. The net results will be higher gas taxes beginning in January, meaning that the Old Dominion and the 'Free State' – Maryland – will get their money either way. Amazon already collects sales tax from residents of 23 states and wants the bill passed so it can establish its own 'level playing field' with other online giants like eBay and Overstock. Both of those companies oppose the legislation

Summary: House speaker isn't going to bring up a Senate-passed 'fairness' bill during the lame-duck congressional session. Legislation would allow states to collect sales taxes from their residents' online purchases, no matter where the e-tailer is located. Brick-and-mortar stores and their trade groups want a mandate because they all have to collect sales taxes from walk-in customers. Republicans worry that all online stores, including small businesses, will find themselves having to deal with paperwork for nearly every US state.

cnn_dailymail

en

Summarize: Supplemental Security Income (SSI) Under the provisions of Title XVI of the Social Security Act, disabled individuals and persons who are 65 or older are entitled to benefits from the SSI program if they have income and assets that fall below program guidelines. SSI benefits are paid out of the general revenue of the United States and all participants receive the same basic monthly federal benefit. In most states, adults who collect SSI are automatically entitled to coverage under the Medicaid health insurance program. The basic monthly federal benefit amount for 2009 is $674 for a single person and $1,011 for a couple. This amount is supplemented by 44 states and the District of Columbia. Arkansas, Kansas, Mississippi, North Dakota, Tennessee, West Virginia, and the Commonwealth of the Northern Mariana Islands do not offer a state supplement. A participant in the SSI program receives the federal benefit amount, plus any state supplement, minus any countable income. At the end of December 2008, over 7.5 million people received SSI benefits. In that month, these SSI beneficiaries each received an average cash benefit of $477.80 and the program paid out a total of just under $3.9 billion in SSI benefits. The average monthly benefit is lower than the federal benefit amount because a person's total monthly benefit may be lowered based on earnings and other income. SSI Resource Limits Individuals and couples must have limited assets or resources in order to qualify for SSI benefits. Resources are defined by regulation as "cash or other liquid assets or any real or personal property that an individual (or spouse, if any) owns and could convert to cash to be used for his or her support and maintenance." When a couple marries and pools their assets, they may find themselves with resources that render them ineligible for continued SSI benefits. The countable resource limit for SSI eligibility is $2,000 for individuals and $3,000 for couples. These limits are set by law, are not indexed for inflation and have been at their current levels since 1989. Not all resources are counted for SSI purposes. Excluded resources include an individual's home, a single car used for essential transportation and other assets specified by law and regulation. Potential Impact of Marriage on SSI Eligibility and Benefits Marriage As Defined by the SSI Program Federal regulations establish the definition of marriage for the purposes of determining SSI eligibility and calculating SSI benefits. Two people are considered married for the purposes of the SSI program if one of the following conditions is present: The couple is legally married under the laws of the state in which they make their permanent home; The SSA has determined that either person is entitled to Social Security benefits as the spouse of the other person; or The couple is living together in the same household and is leading people to believe that they are married. Under the terms of the Defense of Marriage Act, P.L. 104-199, a married couple must consist of one man and one woman for the purposes of the SSI program. Marriage of an SSI Beneficiary to Another SSI Beneficiary When two SSI beneficiaries marry, they are considered a beneficiary couple. As a result, they are entitled to a federal benefit of up to $1,011 per month and may have countable resources valued at up to $3,000. Their combined countable income is used to reduce their monthly benefit. The marriage of two SSI beneficiaries can have a negative effect on their eligibility for benefits and their total amount of benefits. As a married couple, both beneficiaries are presumed to have access to the couple's shared income and resources. Compared with two single beneficiaries as single persons, a married couple has a lower resource limit, a lower maximum federal benefit, and a lower amount of excluded income as shown in Table 1. Resource Limitations Single SSI beneficiaries can have countable resources valued at up to $2,000. Combined, two such single beneficiaries can have a total of up to $4,000 in countable resources and can exclude from their countable resources two cars and two houses. However, as a married couple, their maximum amount of resources is $3,000 and they may exclude from their countable resources one car and one house. Maximum Federal Benefit The maximum federal SSI benefit for 2008 is $674 per month for a single beneficiary and $1,011 per month for a married couple. Two unmarried beneficiaries could each receive up to $674 per month in benefits or a combined monthly benefit of up to $1,348. However, as a married couple, these beneficiaries can receive a maximum benefit of $1,011 per month. Income Exclusions A single SSI beneficiary is allowed to exclude $85 of income (the first $20 in monthly earnings and $65 in earned income on top of the first $20) as well as one-half of all earned income above $65 from the income used to reduce the monthly SSI benefit. Two single beneficiaries can each exclude the basic $85 for a combined exclusion of $170. However, a married couple is entitled to exclude only the basic $85 and one-half of their combined earnings over $65. Marriage of an SSI Beneficiary to a Non-Beneficiary The marriage of an SSI beneficiary to a person who does not receive SSI benefits can have a negative effect on the SSI beneficiary's eligibility and amount of benefits if the ineligible spouse brings significant income or assets to the family. Generally, the income and assets of both persons in a marriage are considered shared and equally available to either person, which can result in an increase in the beneficiary's countable income or resources after marriage. Deeming of Income When an SSI beneficiary marries a person who does not receive SSI benefits, a portion of the ineligible spouse's income is assigned, or deemed, to the SSI beneficiary and is counted as income for the purposes of determining benefit eligibility and the amount of monthly benefits. The procedure used to deem income from an ineligible person to his or her spouse who receives SSI benefits consists of several steps set by regulation and takes into account the overall size of the family. The four steps in the income deeming process are included below and two examples of income deeming are provided in Table 2 at the end of this report. Step 1. Determining the countable income of the ineligible spouse The first step in the deeming process is to determine the countable monthly income of the ineligible spouse by taking his or her total earned and unearned income and reducing it by a special limited set of income exclusions. Generally, most income other than federal social service benefits is counted. Step 2. Allocating income for ineligible children and sponsored aliens Once the countable income of the ineligible spouse has been established, this amount is further reduced to account for any ineligible children living in the household or any aliens that the ineligible spouse may be sponsoring. For each child or sponsored alien, the countable income of the ineligible spouse is reduced by an amount equal to the difference between the monthly federal SSI benefit rate for a couple and the monthly federal SSI benefit rate for an individual. For 2009, this amount is $337, the difference between the federal SSI benefit rate for a couple of $1,011 and the rate for an individual of $674. Step 3. Determining SSI eligibility The final countable monthly income of the ineligible spouse is used to determine the continued SSI eligibility of the beneficiary. If the final countable income of the ineligible spouse is less than or equal to the difference between the monthly federal SSI benefit rate for a couple and the monthly federal SSI benefit rate for an individual ($337 for 2009), then no income is deemed to the beneficiary and the beneficiary is eligible to continue receiving SSI benefits as an individual. If, however, the final countable income of the ineligible spouse is greater than the difference between the monthly federal SSI benefit rate for a couple and the monthly federal SSI benefit rate for an individual, then the beneficiary and his or her spouse are considered a couple and eligible to receive SSI benefits at the level for a couple. Step 4. Determining the SSI benefit If a married beneficiary is considered an individual after Step 3, then his or her monthly SSI benefit is equal to the federal benefit rate for an individual minus any of his or her countable income. The income of the ineligible spouse is not considered when determining the benefit amount in this case. If, however, the married beneficiary and his or her spouse are considered a couple after Step 3, then their benefit is reduced by their combined countable income. The final countable income of the ineligible spouse is added to the total income of the beneficiary. This amount is then reduced by the standard income exclusions and the couple's monthly benefit is reduced by this final income amount. Deeming of Resources Unlike the rules governing the deeming of income from an ineligible spouse to an SSI beneficiary, the resource deeming rules are straightforward. Any resources owned by the ineligible spouse are deemed to the beneficiary. All of the resources of a married couple are considered to be available to the SSI beneficiary and are subject to the regular SSI resource limitations. If the beneficiary is considered a single beneficiary, then he or she may have countable resources valued at up to $2,000. If, after the deeming of income, he or she is considered part of a beneficiary couple, then the countable resource limit is $3,000. The only exception to this rule is that the pension plan of an ineligible spouse is not deemed to a beneficiary.

Summary: Supplemental Security Income (SSI) is a major benefit program for low-income persons with disabilities and senior citizens. As a means tested program, SSI places income and resource limits on individuals and married couples for the purposes of determining their eligibility and level of benefits. To become and remain eligible to receive SSI benefits, single individuals may not have countable resources valued at more than $2,000 and married couples may not have countable resources valued at more than $3,000. Although a person's home and car are excluded from these calculations, most other assets owned by a person or married couple are counted and in most cases, the assets of both partners in a marriage are considered shared and equally available to both the husband and the wife. A person's countable income must be below SSI program guidelines to qualify for benefits and a person's monthly benefit level is reduced by a portion of his or her earned and unearned income. The income of a person ineligible for SSI can be considered when calculating the benefit amount of that person's spouse. A complicated process of deeming is used to determine how much of the ineligible person's income is to be considered when calculating his or her spouse's monthly SSI benefits. In some cases marriage may result in a person being denied SSI benefits or seeing his or her SSI benefit level reduced because of the increase in family income or assets that results from the marriage. This can occur if an SSI beneficiary marries another SSI beneficiary or a person not in the SSI program. This potential effect of marriage on the SSI eligibility and benefits of SSI beneficiaries has been called a "marriage penalty" by the National Council on Disability. This report provides an overview of the potential effect of a marriage to another SSI recipient or an ineligible person on an individual's eligibility for and level of SSI benefits. Examples of cases in which a marriage can reduce a person's SSI benefits are provided. This report will be updated to reflect any legislative changes.

gov_report

en

Write a title and summarize: Viruses have two modes spread in a host body, one is to release infectious particles from infected cells (global infection) and the other is to infect directly from an infected cell to an adjacent cell (local infection). Since the mode of spread affects the evolution of life history traits, such as virulence, it is important to reveal what level of global and local infection is selected. Previous studies of the evolution of global and local infection have paid little attention to its dependency on the measures of spatial configuration. Here we show the evolutionarily stable proportion of global and local infection, and how it depends on the distribution of target cells. Using an epidemic model on a regular lattice, we consider the infection dynamics by pair approximation and check the evolutionarily stable strategy. We also conduct the Monte-Carlo simulation to observe evolutionary dynamics. We show that a higher local infection is selected as target cells become clustered. Surprisingly, the selected strategy depends not only on the degree of clustering but also the abundance of target cells per se. For the first step, we checked whether a strain with a certain G value can be endemic or not by using the stability analysis of the disease free equilibrium. A similar analysis is done by Hiebeler [18] but the endemic condition was calculated for extreme cases (G = 0 or G = 1) in that study. Here we showed that the endemic condition is also obtained for a virus strain with intermediate G value. In addition to the stability analysis, we also obtained the next generation matrix [20] from the linearized dynamics and calculated basic reproductive number (R0), as, R0=12α (gxC+lqC/C+ (gxC+lqC/C) 2+4gψpCC), (6) where g = βGG, l = βL (1−G) (1−θ), and ψ = βL (1−G) θ. The derivation is shown in Appendix A (S1 Text). When G = 1, R0 is βGxC/α ≡ ρ1, which is consistent with the result from the SIS model without spatial structure. In this case, the infection becomes endemic when ρ1 > 1 that means an infected cell infects more than one susceptible cell. When G = 0, R0 is βL (1−θ) qC/C/α ≡ ρ0. ρ0 > 1 is consistent with the" dyad heuristic" of Levin and Durrett [21], that is, a pair of infected cells will reproduce more than one pair of infected cells. For general values of G, the endemic condition is obtained by stability analysis of the disease free equilibrium, α2−α (gxC+lqC/C) −gψpCC<0. (7) By solving (7) with respect to α, the result becomes consistent with R0 > 1. For the intermediate value of G, the condition (7) is rewritten by using ρ1 and ρ0, [1−1ρ1G][1−1ρ0 (1−G) ]<11−θ. Fig 1 shows the region of G that satisfies endemic condition (7) with changing the recovery rate α. The difference among Fig 1D–1F is the degree of spatial correlation, pCC/xC2 (but it is not exactly same as the spatial correlation (pCC−xC2) / (xC−xC2) ). Of course, viruses cannot be endemic when the recovery rate α is too high. With increasing α, highly locally infecting strains drop out first when host cells distribute like CSR or when cells distribute more uniform than CSR. On the other hand, strains with intermediate G value are more resistant to the increase of α than other strains when host cells distribute with a positive correlation. Results of the simulation (Fig 1G–1I) indicate that the probability of survival in several trials show similar dependence as predicted by condition (7). Using the invasibility analysis, we drew a pairwise invasibility plot (PIP); Fig 2A is an example of a single parameter set in which intermediate value of G is evolutionarily stable strategy (ESS). In all parameter region examined, there is a unique ESS and ESS strategy is any of completely global (G = 1), a mixture of local and global infections (an intermediate G), or completely local (G = 0). In the present model, there are no other patterns like the evolutionary branching, or more than two evolutionary singular points in the present model. The dependence of ESS on the parameters is shown in Fig 2B–2D. When target cells are relatively less clustered like CSR, ESS G is independent of α (red line in Fig 2B). In contrast, when target cells are relatively clustered, increase of α makes the ESS proportion of global infection higher (green and blue lines in Fig 2B). This is because high recovery rate increases the density of disease-free clusters, which makes global infection beneficial in accessing the isolated clusters. This dependence is also observed with βG < βL (S1 Fig). In Fig 2C and 2D, the dependence of ESS on the degree of clustering for target cells, pCC/xC2, is shown. In general, the higher the degree of target cell clustering becomes, the more local infection is optimal. When the rates of global and local infection are equal (βG = βL), the threshold below which the completely global infection becomes ESS is CSR, pCC/xC2=1 (Fig 2C). In addition to the dependence on pCC/xC2, the ESS proportion of global infection also depends on the fraction of cells xC alone (Fig 2C). If xC becomes higher with fixing pCC/xC2, the ESS level of global infection becomes lower. The reason is that in this alteration, the conditional probability that a randomly chosen target cell has a target cell at its nearest neighbor, qC/C = pCC/xC, becomes higher. Thus, local infection becomes more efficient in finding susceptible cells than global infection. The threshold point at which the completely global strain cannot be ESS does not change by altering xC, which is analytically shown in the next section. When the two infection rates differ, the ESS G value tends to prefer the infection mode of better efficiency (Fig 2D). It should be noted that the ESS proportion of global infection is not always a R0 maximizing strategy (Fig 2E). When pCC/xC2 is very high, the ESS proportion is much lower than the G value that maximizes R0. In most epidemiological or infection dynamics without structure, the ESS trait is to maximize R0 [22,23]. When cells are spatially clustered, however, the ESS is not always maximizing R0, which may be due to a “self-shading” problem as discussed in a previous study [8]. Here we consider the special case in which a mutant strain with a certain G′ (< 1) invades a completely global resident strain (G = 1). The endemic equilibrium of the completely global strain is obtained from Eq (4) (for the calculation, see equations (A9) in S1 Text), x^I=xC−αβG, p^SI= (1−αβGxC) αβGxCpCC, p^IO= (1−αβGxC) (xC−pCC), where x^I, p^SI and p^IO are pair densities at the equilibrium. In this case, we can analytically obtain the condition for a mutant strain to increase its density around the resident' s endemic equilibrium (for derivation, see Appendix B in S1 Text), βGβL (1−θ+G′θ) <pCCxC2. (8) The right-hand side of (8) denotes the degree of spatial correlation, and this is the reason why we choose pCC/xC2 as the horizontal axis of Fig 2C and 2D. The left-hand side of (8) represents an increasing function of the mutant’s proportion of global infection G’. Therefore if βG/βL>pCC/xC2 holds, the completely global strain prevents any kind of mutant from invading and it is an ESS. Especially when βG = βL, the threshold of the spatial configuration at which the completely global strain can be the ESS corresponds to complete spatial randomness (CSR). It means that when cells distribute with a negative correlation, the completely global strain is the ESS, but when cells distribute with a positive correlation, some degree of contact infection can be beneficial. As predicted in this section, the threshold point moves to βG/βL when βG ≠ βL (Fig 2D). The mean G in the population quickly converges to a certain level, and fluctuates around that level (Fig 3A). As long as we use the same parameters, the evolutionary outcomes are similar to each other regardless of the initial condition and the number of trials. We found that evolutionary branching never occurs and the distribution of strains is always unimodal (see S2 Fig). Fig 3B and 3C shows evolutionary outcomes with changing the degree of spatial correlation pCC/xC2 like Fig 2C and 2D, where 20 trials are conducted for each parameter set. In general, the results are similar to the pair approximation, notably, 1) high pCC/xC2 prefers local infection, 2) evolutionary outcome depends on both pCC/xC2 and xC, and 3) increasing xC promotes the local infection. The difference between the results from pair approximation (Fig 2C and 2D) and those from simulations (Fig 3B and 3C) is that the mean value of G in the simulations does not converge to extreme values (the completely global or the completely local). This may be because the population is always polymorphic as a result of mutations. In addition, there are two other reasons for the region in which the completely local is the ESS according to the pair approximation. The first reason is the effect of finite population size. Especially, since the completely local strain spreads only in a contiguous cluster, the number of available hosts is smaller than for other strains. Therefore, diffusing to other clusters becomes adaptive. The second one is the limitation of pair approximation. In this approximation, we approximate qσ/σ′σ″ the conditional probability that a randomly chosen nearest of a σ' σ''pair has a σ site by qσ/σ′ the conditional probability that a randomly chosen nearest neighbor of σ' site is a σ site. When viruses are too biased toward local infection, infected cells tend to form a large cluster and the approximation does not work well. For these reasons, there is a discrepancy between pair approximation and simulation. To check whether these results are specific to our method of generating a spatial structure, we also conducted the same evolutionary simulations on the several different deterministically generated structures each having the same global and pair densities (xC and pCC) as those in randomly generated structure. Fig 4 shows the comparison of results between randomly and deterministically generated structures. These results suggest the robustness of our results on the evolution of local and global infections based on the randomly generated spatial configurations for given singlet and doublet densities, xC and pCC. In the above sections, we assumed a linear trade-off, that is, the proportion of local infection decreases at the same amount as the proportion of global infection G is increased. However, this should not be always the case in reality. When the local infection decreases in proportion to G0. 5, the result is quite different (Fig 5). In this case, the PIP shows bistability in which the evolutionary outcome depends on an initial state (Fig 5B). This prediction by pair approximation is also confirmed by simulation (Fig 5C). From an ecological point of view, our model can be applied for considering the evolution of long and short dispersal. Target cells correspond to habitats for animals or plants, with S sites and I sites corresponding to unoccupied and occupied sites, and non-target cells representing unsuitable sites to settle. According to the endemic condition (6), the persistence of a species with some local colonization rate depends on the spatial structure. Our results, if applied to a conservation biological setting, suggest that, even if we conserve the abundance of habitats for an endangered species, extinction might occur only due to the change in spatial arrangement of habitats. In terms of the evolution of dispersal distance, previous studies add other settings such as a trade-off between survivability and dispersal range [30], the population dynamics in local patches [31], kin selection [32], the existence of pests [33], or the disturbance structure [34,35]. However, the effect of spatial structure per se has not been clarified yet. We therefore checked how spatial structure affects the evolution of shot and long dispersal. Our results suggest that the ESS proportion of short dispersal depends not only on the degree of clustering but also on the density of habitats per se. Short dispersal is selected when habitats are clustered, and this tendency is strong when the abundance of habitats is high. Our model is also regarded as a model of dispersal rate evolution that considers how much an offspring should disperse beyond its natal patch if we arrange habitats like patches. In this interpretation, local infection denotes staying in a natal patch and global infection represents outgoing from a natal patch. The infection rates βG and βL correspond to survival rate of outgoing and staying individuals, respectively. The conventional result in this situation suggests that even if the survival rate of an outgoing individual (βG) is much lower than that of a staying individual (βL), at least half of all offsprings should go out [36]. Pair approximation in the present study does not predict this result but this is clearly due to the limit of pair approximation. Actually, Monte-Carlo simulation shows that the completely local strategy is never selected. In addition to the previous result, we suggest that even if the survival rate of outgoing individual is higher than that of staying one (βG > βL), there is a parameter region in which some offspring should be left due to high pCC/xC2. Although a similar result has been suggested [37], the reasoning differs to our study. The previous result is due to the variation of patch quality, which means that an individual born in a good patch should leave its offspring in a natal patch. In our model, high clustering of habitats prefers leaving offsprings in a natal patch without assuming differences in patch quality. When the habitats are highly clustered (pCC/xC2>1), the probability of finding new habitat is higher for local dispersal (qC/C = pCC/xC) than for global dispersal (xC). Therefore, the advantage of finding a new habitat can outweigh the disadvantage of low survival rate. Our model predicts the evolutionarily stable dispersal strategy only but some previous models suggest evolutional branching of dispersal rate [38,39] or evolutionary bistability in which the evolutionary outcome differs in initial state [40]. In general, branching or bistability may occur when the fitness of a phenotype depends on the frequencies of other existing phenotypes and possible phenotypes have a proper trade-off [41,42]. In our model, there is a trade-off between global and local infection. The reason why we only observe ESS is that the linear trade-off is not suitable for causing evolutionary branching or bistability. In fact, if we assume nonlinear trade-off between global and local infection is assumed, we can observe the evolutionary bistability (Fig 5). Our model suggests that spatial structure has an important role, while it is not commonly considered in the field of virology. In in vitro experimental cases, two-dimensional cell culture is commonly used and this condition is similar to our model. Hence, there is a possibility that the evolution of global and local infection can occur. In an example of culture of measles viruses (MVs), a higher level of local infection was selected for in continuing passages [43], indicating the emergence of mutant viruses with a high ability to induce membrane fusion in vitro. When the evolution of global or local infection occur, other viral traits like virulence will evolve as shown in Boots and Sasaki [8]. They analytically showed that a lower virulence is predicted as infection becomes more local. The importance of local infection in the evolution of influenza viruses is shown experimentally [3,4]: cell-to-cell transmission promotes a faster expansion of the diversity of virus quasispecies and may facilitate viral evolution and adaptation when influenza viruses’ neuraminidases are inhibited and virus release from infected cells is suppressed [3,4]. Therefore, we emphasize the relationship between the spatial distribution of target cells and the evolution of viral infection mode when studying in vitro infectious dynamics. If we manipulate cell density and the efficiency of viral transmission by antibodies, viruses that have favorable level of global and local infection may be obtained. In a host body, it is rare that cells distribute like two-dimensional cell culture systems except for epithelia. Epithelial cells form a continuous sheet and they may be different in susceptibility because of surface molecule expression, response to interferons and other immune cell activities. Therefore, epithelia can be a place where evolution of cell-to-cell infection can occur, and in fact, some viruses are known to have an ability for cell-to-cell infection in epithelia like MVs [44] (for other examples, see Table 1 in [5]). In contrast, influenza viruses can also infect epithelial cells but the evolution of local infection is not known. The reason may be the short length of infection period; influenza infection period can be as short as a week but some viruses like HIV survive in the host body for a long time. Such persistent viruses may have sufficient time for the within-host evolution and the adaptive dynamics framework can be applied. Since MVs also have an ability to establish persistent infection, these viruses may also have a chance to evolve efficient cell-to-cell infection in the host body. It has been shown that cell-to-cell viral transmission through virological synapse occurs in retroviruses such as human T-lymphotropic virus type 1 (HTLV-1) [45] and HIV [46]. This process is thought to have important role because the contribution of cell-to-cell infection on HIV spread is estimated to be equal to or more that of cell-free infection by comparing static and shaking culture conditions [47,48]. Since infected cells can move in the lymphoid tissue and find a connection to susceptible cells, the spatial viscosity of the infected target cells in the lymph nodes should be weakened in these viruses. However, there would remain some non-random correlation of uninfected target cells (pCC/xC2>1) because of the locality of T cells in the lymph nodes, and this could favor cell-to-cell transmission over cell-free transmission in retroviruses too. Therefore, we suggest new conditions that evolutionarily promote cell-to-cell infection in those viruses: highly localized distribution of target cells in the lymphoid tissues (pCC/xC2>1). These points have not been suggested in the previous theoretical study [16]. Our model may explain the emergence of mutant MVs that are isolated from patients of subacute sclerosing panencephalitis (SSPE). These viruses have mutations that provide high ability of cell fusion (i. e. high level of local infection) [49] and can infect central nervous system cells, while wild type MVs cannot [43,49]. Since MVs can spread in a cell-to-cell manner between epithelial cells, epithelia is a candidate place in which the evolution of local infection occurs. Another possibility is lymph nodes because the main target cell of MVs is SLAM (signaling lymphocytic activation molecule, also known as CD150) expressing immune cells such as T and B cells etc. [50,51]. As discussed in the case of HIV, concentrating target cells in the lymph nodes satisfies the condition under which local infection is selected. Consequently, MVs are prone to evolve local infection in a host body and to gain the ability to infect cells of central nervous system but how MVs reach the central nervous system remains unknown. In conclusion, our results suggest that the mode of viral spread, global or local infection, may undergo adaptive evolutionary change in vitro and in vivo. In the future, we can consider more realistic situation such as evolutionary dynamics in three-dimensional space or the repulsion of superinfecting virions that attenuates self-shading effect [29]. In order to examine the emergence of mutant virus or the evolution of virulence, we need to take into account the fact that the mode of infection itself is subject to selection.

Title: The role of spatial heterogeneity in the evolution of local and global infections of viruses Summary: Viruses such as human immunodeficiency virus and measles virus can spread through physical contact between infected and susceptible cells (cell-to-cell infection), as well as normal cell-free infection through virions. Some experimental evidences support the possibility that high ability of cell-to-cell infection is selected in the host. Since the mode of spread affects the evolution of life history traits, it is important to reveal what condition favors high ability of cell-to-cell infection. Here we address what level of cell-to-cell infection is selected in different target cell distributions. Analysis of ordinary differential equations that keep track of dynamics for spatial configuration of infected cells and the Monte-Carlo simulations show that higher proportion of local infection is selected as target cells become clustered. The selected strategy depends not only on the degree of clustering but also the abundance of target cells per se. Our results suggest viruses have more chances to evolve the ability of local infection in a host body than previously thought. In particular, this may explain the emergence of measles virus strains that gained the ability to infect the central nervous system.

lay_plos

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of provisional patent application Ser. No. 61/018,090, filed 2007 Dec. 31 by the present inventor. FEDERALLY SPONSORED RESEARCH Not Applicable SEQUENCE LISTING OR PROGRAM Not Applicable REFERENCES CITED U.S. Patent Documents 4,627,385 Vinci Dec. 9, 1986 5,494,002 Greene Feb. 27, 1996 5,566,645 Cole Oct. 22, 1996 5,911,199 Farkas, et al. Jun. 15, 1999 6,003,474 Slater, et al. Dec. 21, 1999 6,047,664 Lyerly Apr. 11, 2000 6,327,998 Andre, et al. Dec. 11, 2001 D454,991 Muller Mar. 26, 2002 6,612,264 Levine Sep. 2, 2003 6,668,760 Groh, et al. Dec. 30, 2003 6,820,571 Cory Nov. 23, 2004 7,174,856 Neri Feb. 13, 2007 Application 20070261645 Van De, et al. Nov. 15, 2007 BACKGROUND 1. Field of Invention This invention relates to animal training, specifically to devices for training an animal such as a dog to discontinue undesired behaviors such as pulling, when attached to a leash or other restraining device. 2. Prior Art Because animals, such as dogs, are generally required by law to be on a leash when in public, and because walking an animal is often its only available exercise, various training strategies and devices have been developed over the years to try to control an animal&#39;s behavior while on a leash. Some professional trainers prefer the use of training strategies alone without any special devices, but among the vast population of animal owners, access to training devices has long been welcomed. Existing devices break down into correction devices, which rely on negative reinforcement to instill long-term behavioral changes; and behavioral management devices, which attempt to manage leash pulling during a walk, with less certain claims to long-term behavioral change. Among correction devices, the most familiar are choke collars (also known as slip collars or choke chains), prong collars (also known as pinch collars), and shock collars (also known as electronic collars). The underlying principle of these particular devices is that through repeated administration of physical discomfort to the animal&#39;s neck by a skilled and judicious user, the animal&#39;s inappropriate behavior, be it leash pulling or another unwanted behavior, will be corrected over time. However, these two operational characteristics—reliance on physical discomfort and on the qualifications of the user—set the stage for serious injuries to the animal as well as poor training results. For example, correct use of a choke collar entails positioning the device in one of two possible orientations on the dog&#39;s neck and applying a quick tightening and release action. User errors can be easily committed with respect to both the orientation used and the amount of tightening applied; the former error being especially grave in that the collar&#39;s release feature is fully disabled. As a result, numerous animal neck injuries and deaths have occurred in association with choke collars. Also, correction collars of this type are not appropriate for use with an extendible leash. Insufficiency of user skill and/or an excess of physical discomfort to the animal are likewise operational risks inherent to the other above named examples in the correction device category, with consequences similarly ranging from poor training results to serious animal injuries. The prong collar additionally has the drawback of presenting a frightening appearance, even when not engaged. Accidents can also occur when these correction devices are left on an animal unattended. However, even where appropriately used and behaviorally effective, correction devices that administer discomfort or pain are increasingly rejected by pet owners in favor of more humane sanctioning methods, such as spraying animals with odorless or aversive fluids or generating startling sounds. An example of a spray device is the electronic remote citronella collar, such as is described in U.S. Pat. No. 5,868,103. Such devices enable an owner to remotely administer a spray of citronella, which is found offensive by many animals. Although considered humane, the effectiveness of this device is easily compromised if a user fails to execute the split second timing required for an animal to associate the punishment with a behavior. Moreover, remote collars have the potential to misfire, further complicating the training. Also, because existing citronella collars are electronic, they entail the inconvenience of battery replacement or recharging, as well as the environmental concerns associated with battery disposal. (Shock collars are also subject to the concerns inherent in an electronic device.) Devices that use an electric wire connection rather than a wireless connection between owner and animal to facilitate owner-activated spraying, as proposed in U.S. Pat. No. 6,327,998 by Andre et. al., also share the drawbacks intrinsic both to electronic devices and to devices that depend on user skill. Correction devices that employ sound deterrence are considered humane, and in devices such as described in U.S. Pat. No. 5,494,002 by Greene, do not depend on user skill; however, they typically fall short of intended training goals because the sound emitted tends to be ignored by the animal, yet be bothersome to the owner and passersby. U.S. Pat. No. 5,911,199 proposes a correction device that is self-activating in response to varying degrees of pulling by an animal on a leash, however the corrective feedback is in the form of electrical stimulus pulses, which can cause pain to the animal. Many animal owners have turned to behavior management devices, as they are generally more humane than existing correction devices; however, these devices typically do not make claims to lasting behavioral change, nor do they have the versatility of most correction devices to address behaviors other than leash pulling. The leading management devices are harnesses and halters. Harnesses distribute the force of pulling to the animal&#39;s torso, thereby tending to avoid neck related injuries and strangulation. However, their aptness for training is questionable. Indeed, many argue that sled dogs wear harnesses specifically because they promote pulling. As such, standard harnesses have been relegated primarily to use with smaller animals whose leash pulling is not troublesome enough to warrant correction, but whose fragile necks benefit from a harness&#39;s neck protective advantages over regular collars. Larger animals, for whom control is required, are typically not well served by harnesses. The fact that the leash does not attach to the neck area makes it near impossible to “steer” and signal the animal, as required for management, let alone training. One type of harness, such as is described in U.S. Pat. No. 7,107,939 by Lady, attempts to address the “steering” issue by positioning the leash connector in the middle of the forechest rather than at the back. However, since the sizing challenges common to harnesses still obtains, such devices must effectively overcome the possibility of the “steering” juncture becoming displaced, or of an animal slipping out of a harness altogether. Additionally, because harnesses require either a multiplicity of straps or a single complexly looped strap, they tend to be both hard to fit and inconvenient to repeatedly put on and take off an animal. Finally, to the degree that harnesses are designed for mobility constraint and are prone to be imperfectly fit, they can cause shoulder injuries, chafing of the animal&#39;s legs, or gagging. Halters, the other leading management device, are designed for pets such as dogs with the same intent as a horse&#39;s halter; namely, to control the direction of the animal&#39;s body by controlling the head. As such, they typically contain a strap behind the animal&#39;s head and over the muzzle, with the leash attachment at the animal&#39;s head. U.S. Pat. No. 4,838,206 by Anderson et al. provides an example of a halter. While some owners of dogs, particularly large ones, report good results with a halter, the halter&#39;s drawbacks make this device inappropriate for many animals and owners. The most widely reported drawback is that many animals simply do not accept wearing a halter and have even been known to rub their muzzles against the ground in an effort to remove it. Other animals require a long adjustment period. Average animal owners also must assume responsibility for using halters correctly, as evidenced by the existence of literature published on the art of managing dogs with a halter. Additionally, since a halter resembles a restraining muzzle in appearance, owners must be reconciled to this perception when walking their animals publicly. Other concerns are that the muzzle strap in some designs may make it difficult for the animal to open its mouth to pant, drink, or receive food rewards. Because the leash is attached to the halter at the head, the user must take care not to allow any twisting strain to the animal&#39;s neck, which could cause serious injury. For this reason, the halter is not appropriate for use with an extendible leash. Hence there is the need for a device that, like choke collars and other early correction devices, offers generic control of a range of behaviors, not just leash pulling; and moreover, provides long-term stimulus-response conditioning rather than the temporary and limited control of a management device like the halter. The invention described herein fills this need while overcoming limitations of existing correction devices; namely, over-reliance on user skill; inhumane or ineffective sanctioning means; high susceptibility to injury infliction though ignorant misuse; risks when left on an animal unattended; inappropriateness for an extendible leash; frightening appearance to passersby; and reliance on electronics, with its associated expense, inconvenience, and known instances of malfunctioning. SUMMARY OF THE INVENTION The object of this invention is to humanely control the behavior of an animal that is attached to a restraint such as a leash or tie-out. In its numerous embodiments, the device, which is mechanically trigger-activated, is worn by an animal such that the force of the animal&#39;s body against a taut restraint depresses the triggering mechanism to activate release of a sanctioning substance or sound. Embodiments used with a leash can condition the animal to walk on a loose leash by releasing an odorless or odorous substance that causes a distraction or deterrence when the animal pulls the leash taut. The distraction or sanction occurs as a direct and immediate response to the animal&#39;s pulling, rather than requiring a perfected trainer technique. Since dogs frequently pull on leash to follow a scent, release of an aversive scent for leash pulling is particularly appropriate as an olfactory interception. An individual walking a dog could also initiate a correction at will for behaviors such as barking or drifting in a lateral arc from the dog walker by pulling the leash taut to release the distraction or deterrence. Embodiments in use with a tie-out could be purposed to condition an animal not to pull the tie-out to its full length, which might otherwise result in neck injury. The springiness of the triggering mechanism serves additionally as a shock absorber for the animal&#39;s neck. In embodiments that use fluid release as the sanction and a resilient bladder as the fluid reservoir, the triggering mechanism is the reservoir itself. Compression of the resilient bladder forces fluid from the bladder through an outlet consisting of one or more holes. Other embodiments use a discrete reservoir for a fluid or gas. In some of these embodiments, the triggering mechanism consists of a spring-loaded lever as found commonly in spray bottles or aerosol cans. In others of these embodiments, the trigger mechanism is a squeeze bulb, with a spray or gas diffusion assembly for the outlet, as exemplified by perfume atomizers. Some of the above embodiments are adapted to be removably secured to paraphernalia the animal regularly wears for attachment to a restraining device, such as its collar or harness. Other embodiments are secured directly to both the animal and to the restraining device. Some embodiments further include trigger threshold adjustability; a means to optimize positioning of the substance dispersion device, for example against rotation around an animal&#39;s neck; wind compensation; substance depletion indicators; directional control for the substance outlet; enhanced cushioning on the triggering mechanism; and a sound making device. Embodiments are also possible in which all training components are optional add-ons via tubing and Velcro® (or similar securing material) to a trigger-ready collar. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a perspective view of a preferred embodiment of the invention. FIG. 2, FIG. 3, FIG. 3A, FIG. 4 through FIG. 9, FIG. 10, FIG. 10A, FIG. 11, FIG. 12, and FIG. 12A depict alternative preferred embodiments of the invention comprising variations in triggering mechanism, attachment component, reservoir, outlet, refill means, and/or sanctioning means. DETAILED DESCRIPTION The same numbers are used on different drawings to identify components serving equivalent functions. FIG. 1 is a perspective view in which can be seen an attachment component 8 that secures to an animal; a restraint connector 10 on the attachment component 8 to which the restraining device 1 is connected; a reservoir 2 ; an outlet 4 ; and a triggering mechanism 6. In a typical usage of this embodiment to walk a dog, the attachment component 8 would be fitted to a dog&#39;s neck with the triggering mechanism 6 resting lightly across the front of the dog&#39;s neck, while a leash 1 is attached from behind to the restraint connector 10. The attachment component 8 is size adjustable for different animals, accomplished through any of numerous means known in the art of size adjustable attachments, as for example with a standard buckle closure with holes 3. The triggering mechanism 6 in this example is a lever 6 contoured for a dog&#39;s neck and made of material that is substantially rigid while allowing for enough flexibility toward the extremities to bend as needed within the collar. The lever 6 is spring-loaded in like manner to the trigger of an ordinary plastic spray bottle and as is standard in the art of trigger mechanisms. The triggering mechanism 6 becomes temporarily depressed as a result of the dog&#39;s forward movement in opposition to a taut leash 1, or as a result of the dog walker pulling the leash 1 taut. It is envisioned that a great many variations in lever dimensions and materials are possible to fulfill the lever&#39;s functionality; however, an elongate shape, as exemplified in this figure, favors its responsiveness to pressure even when the nozzle 4 is not in a direct line with the leash 1, but is somewhat offset. When depressed to the triggering threshold, the triggering mechanism 6 causes fluid to be drawn from the reservoir 2 for release through the outlet 4, which in this embodiment, is a spray nozzle assembly 4 including intake tube 5, that is based on known spray bottle technology. Additional nozzle(s) that are in communication with the triggering mechanism 6 may be added in order to disperse the fluid to a wider area to compensate for wind dispersion of the spray. The triggering mechanism 6 may further include a means for threshold adjustability as for example through varying the tension of the spring loaded lever 6, either by the end user or as pre-configured nozzle assemblies 4. The triggering mechanism 6, in addition to activating the release of fluid, also distributes energy to the spring inside the nozzle assembly 4 when depressed, thereby offering shock absorbing protection for the animal&#39;s neck. To enhance shock absorbing effects, the lever 6 may be constructed with or covered with materials possessing shock absorbing properties, such as a spongy material or padding. The apparatus may hence be used strictly for the purpose of the neck protection afforded by the triggering mechanism 6 ; as for example in the case of an animal that has completed its training. The reservoir 2 may be refilled with a liquid of choice such as water, vinegar, citronella, or bitter apple, via the refill cap 7 that is integrated with the spray nozzle assembly 4. The refill cap 7 may be adapted with child-proof features, or the reservoir may use a standard injection port instead of a refill cap. The injection port may further be designed with a keyed opening that accepts only the specific refill injector shape of proprietary products, as is known in the art of refill injectors. Alternative to a reservoir 2 that is refilled by the end user, the apparatus may be designed with a housing that allows for insertion and removal of ready-made cartridges, as for example containing citronella. The nozzle assembly 4 may further be designed for pivoting, extensibility, and/or varying the stream properties of the nozzle, as known in the art of fluid outlets and nozzles, in order to optimize fluid release for individual animals or training purposes. The restraint connector 10 of FIG. 1 is composed of a smooth, rigid substance and is curved to allow the leash clasp 9 to slide along the restraint connector 10 in response to any lateral movement by the animal. To facilitate putting the apparatus on the animal and taking it off, the restraint connector 10 is pivotally attached to one end 12 of the attachment component 8 and removably attached to one of multiple connection points 13 at the opposite end of the attachment component 8 using a clasping mechanism 11, as known in the art of clasping mechanisms. The availability of multiple connection points 13 allows for size adjustability among animals. The curved restraint connector 10 and the elongate design of the lever 6 are examples of approaches to compensate for rotation of a collar, although other approaches are possible. At present I believe the embodiment shown in FIG. 1 operates most efficiently, but other embodiments are also satisfactory. FIG. 2 depicts an embodiment in which the attachment component 14 is a clip 14 or similar fastening device known in the art of fasteners, which is adapted for attachment to paraphernalia 8 already worn by the animal; in this case, its everyday collar 8. The existing paraphernalia is then attached via its own restraint connector 10 to the restraining device, such as a leash or tie-out. The portability of the apparatus offered by this embodiment is of interest in certain situations; namely, where the apparatus is shared among multiple dogs in a household; where there is a desire to eliminate collar changes before and after a training session; and where sensory consistency between “training” collar and “everyday” collar is sought—an issue of known relevancy to some dogs&#39; behavior; i.e., the dog will only obey when her “training” collar is on. In the embodiment of FIG. 2, the triggering mechanism 6 is a squeeze bulb 6, of the type known in the art of perfume atomizers and squeeze bulb technology. The reservoir 2 and outlet 4 are also based on atomizer technology. The resilient properties of the squeeze bulb triggering mechanism 6 serve additionally as a shock absorber for the animal&#39;s neck. FIG. 3 and FIG. 3A depict respectively an open rear view and closed front view of an embodiment that uses a squeeze bulb 6 for its triggering mechanism 6. This embodiment coils its reservoir 2 within the attachment component 8, to be fitted around an animal&#39;s neck. When the attachment component 8 is pulled closed, the refill cap 7 is used to stopper the coiled reservoir 2, which is then covered over by a flap 16. The flap can be secured to the attachment device with a temporary binding material such as Velcro® 15. FIG. 4 depicts an embodiment in which the reservoir 2 and triggering mechanism 6 are one and the same; specifically, a bladder-like component. A multiplicity of holes 4 in the bladder-like component 2 serve as the outlet 80, providing redundant spraying to counter any wind dispersion or collar rotation. The reservoir/triggering mechanism 2, 6 may be filled with a fluid of the end user&#39;s choosing via a refill screw cap 7 or similar re-closable structure known in the art of receptacle closures. Alternative filling options such as injectors for pre-packaged fluids are also possible. The reservoir/triggering mechanism 2, 6 is constructed of a resilient material such that it yields to pressure of an animal&#39;s body, thereby directly forcing fluid from the reservoir/triggering mechanism 2, 6 through the outlet 80 in a continuous stream or streams, subject to the duration of the appropriate pressure. Based on principles known in the art of materials science and fluid dispersion, the reservoir/triggering mechanism&#39;s 2, 6 dimensions are configured to allow for consistency in the pressure needed to disperse the fluid even as it becomes depleted; and in addition, to retain the reservoir/triggering mechanism&#39;s 2, 6 shape when depleted, thereby preventing an animal from taking advantage of a collapsed bladder-like component to slip out of the attachment device. The version of this embodiment shown in FIG. 4 comprises a rigid outward facing material 17 that braces the reservoir/triggering mechanism 2, 6 and contains openings through which holes 80 in the bladder are exposed. A standard or other restraint connector 10 may be used for attachment to a restraint. FIG. 5 through FIG. 10 also depict embodiments that use a bladder-like component with holes to serve as the reservoir/triggering mechanism and outlet. FIG. 5 depicts an embodiment that uses a bladder-like reservoir/triggering mechanism 2, 6 that is integrated within an attachment component 8, from which it may be unscrewed for refilling via the refill cap 7. FIG. 6, FIG. 7, and FIG. 8 depict embodiments in which the bladder-like reservoir/triggering mechanism 2, 6 is fused to an attachment component 14 that is removably secured to paraphernalia that the animal regularly uses for connection to a restraining device, such as an everyday collar 8. In the embodiment of FIG. 6, the attachment component 14 is a clip 14 that fits over the top edge of the collar 8. The bladder-like reservoir/triggering mechanism 2, 6 is fused to the clip 14 and sits against the animal&#39;s neck inside the collar 8, with an accessible refill cap 7. In the FIG. 7 embodiment, a pliant backing with side slits 14 serves as the attachment component 14. The bladder-like reservoir/triggering mechanism 2, 6 with exposed injector refill port 32 is fused to the pliant backing 14, which sits against the animal&#39;s neck, with the bladder-like reservoir/triggering mechanism 2, 6 in-between the backing 14 and the inside of the collar 8. In the embodiment of FIG. 8, the attachment component 14 is a rigid backing to which the bladder-like reservoir/triggering mechanism 2, 6 is fused. The bladder-like reservoir/triggering mechanism 2, 6 is secured against the animal&#39;s neck by threading a collar 8 through retaining hoops and rollers 30 on the backing 8. As seen in FIG. 8A, cutouts on the backing&#39;s outward facing plane expose a refill cap 7 as well as output holes 80 for fluid release. FIG. 9 depicts an embodiment in which the attachment component 8 is a collar 8. A bladder-like reservoir 2 is situated outside the collar 8, and a triggering mechanism 6 made of an optimally curved rigid plate 6 is pivotally connected to the collar 8 with springs 31 such that triggering pivots the plate upward to compress the bladder-like reservoir 2. The refill cap 7 is situated on top of the bladder-like reservoir 2. FIG. 10 and FIG. 10A depict an embodiment with a bladder-like component for its reservoir/triggering mechanism 2, 6, an injector refill port 32, and a collar 8 for its attachment component 8. A retractable inner collar 18 moves forward to compress the reservoir/triggering mechanism 2, 6 in accordance with a threshold set by tension adjustable springs 19 that are secured to the collar 8 as known in the art of tension adjustable springs. FIG. 10A shows this embodiment in cross-section viewed from below. FIG. 11 depicts an embodiment in which the attachment component is a collar 8, and all training components are easily detachable from the front face of the collar 8 via a standard temporary binding material such as Velcro® 20. In the example shown, one available training component is a fluid dispersion device 33 with a spray nozzle assembly 4. Another training component is an air horn 21 for distracting or deterring the animal through noise. The triggering mechanism 6 is a contoured squeeze bulb 6 that is permanently affixed to the inside of the collar 8 and provides shock absorption for the animal&#39;s neck, whether or not training components are attached. All training components comprise a tube 22 adapted for attachment to holes 23 in the squeeze bulb 6. Attached training components are triggered simultaneously via the squeeze bulb 6. FIG. 12 and FIG. 12A depict an embodiment that uses inert gas as the substance that is released. The reservoir 2 is a pressurized aerosol can 2. It is impermanently secured to the outside of an attachment component 8 by a wire brace 24 or other conventional securing mechanism. In the embodiment illustrated, the attachment component 8 is a dog&#39;s collar 8, but adaptations for use with other attachment components is possible. The triggering mechanism 6 is a lever 6 that is positioned against the animal&#39;s neck and is secured to the front of the collar with a spring 25. The lever 6 protrudes past the top edge of the collar and is pivotally joined at its sides 26 to an extension arm 27 made of a rigid material. The end of the extension arm 27 forms a hammer head 28, appropriately angled and weighted so that it may depress the release valve 4 of the can 2 when the lever 6 is engaged. FIG. 13A shows a cross-section of this embodiment after the lever 6 has been depressed via a force between the animal&#39;s body and the restraint. This force, facilitated by the curvature 29 of the extension arm 27 against the smooth underside of the lever 6, pivots the hammer head 28 end of the extension arm 27 downward to depress the release valve 4 causing a continuous spray. Exact specifications of this mechanism are to be informed by the known art of lever mechanisms. Notwithstanding the above descriptions of several embodiments of the invention, additional variations are possible that would not depart from the essence of the invention as laid out in the claims but may be envisioned by those skilled in the art.

Summary: A device for humanely controlling an animal&#39;s behavior while on a restraining device such as a leash by using the resistant force between animal and restraint to engage a trigger that activates release of a distracting or deterrent spray or gas, or a sound. The device is attached to the animal&#39;s body, with the triggering mechanism against the animal&#39;s skin. In its application as a means to train dogs to walk on a loose leash, the trigger may be situated inside a collar, such that triggering occurs when the dog pulls the leash taut. Triggering can also occur if the user pulls back on the leash to administer a correction. The trigger&#39;s springiness additionally provides shock-absorbing protection to the animal&#39;s neck. Embodiments with enhanced features, based on the same mechanical principle, are also described.

big_patent

en

Summarize: ACT I. SCENE I. Venice. A street. Enter Roderigo and Iago. RODERIGO. Tush, never tell me! I take it much unkindly That thou, Iago, who hast had my purse As if the strings were thine, shouldst know of this. IAGO. 'Sblood, but you will not hear me. If ever I did dream of such a matter, Abhor me. RODERIGO. Thou told'st me thou didst hold him in thy hate. IAGO. Despise me, if I do not. Three great ones of the city, In personal suit to make me his lieutenant, Off--capp'd to him; and, by the faith of man, I know my price, I am worth no worse a place. But he, as loving his own pride and purposes, Evades them, with a bumbast circumstance Horribly stuff'd with epithets of war, And, in conclusion, Nonsuits my mediators; for, "Certes," says he, "I have already chose my officer." And what was he? Forsooth, a great arithmetician, One Michael Cassio, a Florentine (A fellow almost damn'd in a fair wife) That never set a squadron in the field, Nor the division of a battle knows More than a spinster; unless the bookish theoric, Wherein the toged consuls can propose As masterly as he. Mere prattle without practice Is all his soldiership. But he, sir, had the election; And I, of whom his eyes had seen the proof At Rhodes, at Cyprus, and on other grounds Christian and heathen, must be belee'd and calm'd By debitor and creditor. This counter--caster, He, in good time, must his lieutenant be, And I--God bless the mark!--his Moorship's ancient. RODERIGO. By heaven, I rather would have been his hangman. IAGO. Why, there's no remedy. 'Tis the curse of service, Preferment goes by letter and affection, And not by old gradation, where each second Stood heir to the first. Now, sir, be judge yourself Whether I in any just term am affined To love the Moor. RODERIGO. I would not follow him then. IAGO. O, sir, content you. I follow him to serve my turn upon him: We cannot all be masters, nor all masters Cannot be truly follow'd. You shall mark Many a duteous and knee--crooking knave, That doting on his own obsequious bondage Wears out his time, much like his master's ass, For nought but provender, and when he's old, cashier'd. Whip me such honest knaves. Others there are Who, trimm'd in forms and visages of duty, Keep yet their hearts attending on themselves, And throwing but shows of service on their lords Do well thrive by them; and when they have lined their coats Do themselves homage. These fellows have some soul, And such a one do I profess myself. For, sir, It is as sure as you are Roderigo, Were I the Moor, I would not be Iago. In following him, I follow but myself; Heaven is my judge, not I for love and duty, But seeming so, for my peculiar end. For when my outward action doth demonstrate The native act and figure of my heart In complement extern, 'tis not long after But I will wear my heart upon my sleeve For daws to peck at: I am not what I am. RODERIGO. What a full fortune does the thick--lips owe, If he can carry't thus! IAGO. Call up her father, Rouse him, make after him, poison his delight, Proclaim him in the streets, incense her kinsmen, And, though he in a fertile climate dwell, Plague him with flies. Though that his joy be joy, Yet throw such changes of vexation on't As it may lose some color. RODERIGO. Here is her father's house; I'll call aloud. IAGO. Do, with like timorous accent and dire yell As when, by night and negligence, the fire Is spied in populous cities. RODERIGO. What, ho, Brabantio! Signior Brabantio, ho! IAGO. Awake! What, ho, Brabantio! Thieves! Thieves! Thieves! Look to your house, your daughter, and your bags! Thieves! Thieves! Brabantio appears above, at a window. BRABANTIO. What is the reason of this terrible summons? What is the matter there? RODERIGO. Signior, is all your family within? IAGO. Are your doors lock'd? BRABANTIO. Why? Wherefore ask you this? IAGO. 'Zounds, sir, you're robb'd! For shame, put on your gown; Your heart is burst, you have lost half your soul; Even now, now, very now, an old black ram Is tupping your white ewe. Arise, arise! Awake the snorting citizens with the bell, Or else the devil will make a grandsire of you. Arise, I say! BRABANTIO. What, have you lost your wits? RODERIGO. Most reverend signior, do you know my voice? BRABANTIO. Not I. What are you? RODERIGO. My name is Roderigo. BRABANTIO. The worser welcome. I have charged thee not to haunt about my doors. In honest plainness thou hast heard me say My daughter is not for thee; and now, in madness, Being full of supper and distempering draughts, Upon malicious bravery, dost thou come To start my quiet. RODERIGO. Sir, sir, sir-- BRABANTIO. But thou must needs be sure My spirit and my place have in them power To make this bitter to thee. RODERIGO. Patience, good sir. BRABANTIO. What tell'st thou me of robbing? This is Venice; My house is not a grange. RODERIGO. Most grave Brabantio, In simple and pure soul I come to you. IAGO. 'Zounds, sir, you are one of those that will not serve God, if the devil bid you. Because we come to do you service and you think we are ruffians, you'll have your daughter covered with a Barbary horse; you'll have your nephews neigh to you; you'll have coursers for cousins, and gennets for germans. BRABANTIO. What profane wretch art thou? IAGO. I am one, sir, that comes to tell you your daughter and the Moor are now making the beast with two backs. BRABANTIO. Thou are a villain. IAGO. You are--a senator. BRABANTIO. This thou shalt answer; I know thee, Roderigo. RODERIGO. Sir, I will answer anything. But, I beseech you, If't be your pleasure and most wise consent, As partly I find it is, that your fair daughter, At this odd--even and dull watch o' the night, Transported with no worse nor better guard But with a knave of common hire, a gondolier, To the gross clasps of a lascivious Moor-- If this be known to you, and your allowance, We then have done you bold and saucy wrongs; But if you know not this, my manners tell me We have your wrong rebuke. Do not believe That, from the sense of all civility, I thus would play and trifle with your reverence. Your daughter, if you have not given her leave, I say again, hath made a gross revolt, Tying her duty, beauty, wit, and fortunes In an extravagant and wheeling stranger Of here and everywhere. Straight satisfy yourself: If she be in her chamber or your house, Let loose on me the justice of the state For thus deluding you. BRABANTIO. Strike on the tinder, ho! Give me a taper! Call up all my people! This accident is not unlike my dream; Belief of it oppresses me already. Light, I say, light! Exit above. IAGO. Farewell, for I must leave you. It seems not meet, nor wholesome to my place, To be produced--as, if I stay, I shall-- Against the Moor; for I do know, the state, However this may gall him with some check, Cannot with safety cast him, for he's embark'd With such loud reason to the Cyprus wars, Which even now stands in act, that, for their souls, Another of his fathom they have none To lead their business; in which regard, Though I do hate him as I do hell pains, Yet for necessity of present life, I must show out a flag and sign of love, Which is indeed but sign. That you shall surely find him, Lead to the Sagittary the raised search, And there will I be with him. So farewell. Exit. Enter, below, Brabantio, in his nightgown, and Servants with torches. BRABANTIO. It is too true an evil: gone she is, And what's to come of my despised time Is nought but bitterness. Now, Roderigo, Where didst thou see her? O unhappy girl! With the Moor, say'st thou? Who would be a father! How didst thou know 'twas she? O, she deceives me Past thought! What said she to you? Get more tapers. Raise all my kindred. Are they married, think you? RODERIGO. Truly, I think they are. BRABANTIO. O heaven! How got she out? O treason of the blood! Fathers, from hence trust not your daughters' minds By what you see them act. Is there not charms By which the property of youth and maidhood May be abused? Have you not read, Roderigo, Of some such thing? RODERIGO. Yes, sir, I have indeed. BRABANTIO. Call up my brother. O, would you had had her! Some one way, some another. Do you know Where we may apprehend her and the Moor? RODERIGO. I think I can discover him, if you please To get good guard and go along with me. BRABANTIO. Pray you, lead on. At every house I'll call; I may command at most. Get weapons, ho! And raise some special officers of night. On, good Roderigo, I'll deserve your pains. Exeunt.

Summary: On a street in Venice, there is an argument between Roderigo, a nobleman, and Iago, an ancient in the defense forces. Roderigo, in love with the noble lady Desdemona, has paid large sums of money to Iago, on the understanding that Iago would give her gifts from him and praise him to her. Roderigo hopes to win Desdemona's love and marry her. However, they now have news that Desdemona has left the house of her father, Brabantio, a Senator, and eloped with Othello, a Moor who is a General in the defense forces. Roderigo fears he has lost both his lady and his money. Iago reveals to Roderigo that it is in his nature to plot and tell lies to get what he wants and that he has a plan. He hates Othello for promoting Cassio to the position of lieutenant, a position that Iago wanted for himself. Iago plans to bring about Othello's downfall, and Roderigo will have Desdemona. First, they must wake Brabantio and cause an outcry. They bang and shout until Brabantio comes out onto the balcony. Iago tells him in inflammatory words that Desdemona has run away with Othello, and Brabantio, enraged, joins Roderigo to wake the neighbors and organize a search party.

booksum

en

Summarize: A health care worker removes another's protective glove as they train at the Palomar Medical Center during a decontamination drill in Escondido, California October 17, 2014. (Reuters Health) - Florescent lotion and black light revealed that health care workers often contaminate their skin and clothing while removing their protective gear, researchers say. This contamination can spread germs and place the health care workers at risk for infection, the authors write in JAMA Internal Medicine. “It was surprising for the participants in the study to see that they frequently contaminated themselves during (personal protective equipment) removal,” said senior author Dr. Curtis J. Donskey of the Cleveland Veterans Affairs Medical Center. “Most of the participants appeared to be unaware of the high risk for contamination and many reported receiving minimal or no training in putting on and taking off (personal protective equipment),” he told Reuters Health by email. Contaminated personnel can also spread pathogens to other susceptible patients. The researchers recruited doctors, nurses and other health care personnel such as phlebotomists and physical therapists at four Cleveland-area hospitals to participate in the simulations. More than half of the 435 simulations were performed by nurses. The participants put on protective gowns and gloves in their usual manner and then had a small amount of fluorescent lotion placed in the palm of their hands, which they then rubbed between their hands for 15 seconds to simulate dirtied gloves, then smeared the gloves over the chest and abdomen area of the gown. Then the gloves were exchanged for clean ones. After they removed their gloves and gowns in their usual manners, researchers used a black light to check for lotion contamination of the hands, forearms, neck, face, hair or clothing. Skin or clothing contamination happened 46 percent of the time, more frequently during glove removal. Researchers also noted whether participants had used proper protective equipment technique, e.g., wearing gloves extended over the wrists of the gown, gown removed first by pulling away from the neck and body, and gloves removed second. Contamination happened 70 percent of the time when proper technique was not followed, compared to 30 percent of the time when it was followed. “When dealing with pathogens that are potentially fatal, the goal has to be zero contamination,” Donskey said. “In routine care settings, we would like personnel to be well trained and confident that they can minimize contamination, but would not insist on zero contamination.” It is important for personnel to perform hand hygiene after removing gloves and gowns since contamination could have happened, he said. The researchers also conducted these tests with a group of personnel who had attended special infection control sessions, with a 10-minute video presentation and 20 minutes of demonstrations and practice in using and removing protective gear. Before the training sessions, these individuals contaminated themselves 60 percent of the time, compared to almost 19 percent after the sessions. The improvements were still seen at re-tests done one and three months later. “This suggests that training using fluorescent lotion can be useful to identify minor deficiencies in technique that lead to contamination,” Donskey said. Recent experience with the Ebola virus in the U.S. demonstrated that self-contamination during removal of protective equipment does occur, but this study exposes a more widespread issue that may be happening during routine patient care, said Dr. Michelle Doll of Virginia Commonwealth University in Richmond who coauthored a commentary on the new study. “Use of gowns and gloves for contact precautions on a busy inpatient unit is costly on multiple levels,” Doll told Reuters Health by email. “In situations when we do decide to use these tools (for infection prevention, we need to optimize techniques to achieve the best efficacy possible. Otherwise it is wasteful of healthcare worker efforts and hospital resources.” The sight of fluorescent dye on one’s face and hands would be a powerful and lasting lesson, she said. “Being able to see where contamination occurs allows personnel to make adjustments in their technique,” Donskey said. “Because training alone did not result in zero contamination, there is a need for other approaches such as improving (equipment) design or disinfection of (equipment) prior to removal.” SOURCES: bit.ly/1NBRjqz and bit.ly/1jklyFS JAMA Internal Medicine, online October 12, 2015. These crawls are part of an effort to archive pages as they are created and archive the pages that they refer to. That way, as the pages that are referenced are changed or taken from the web, a link to the version that was live when the page was written will be preserved.Then the Internet Archive hopes that references to these archived pages will be put in place of a link that would be otherwise be broken, or a companion link to allow people to see what was originally intended by a page's authors.The goal is to fix all broken links on the web. Crawls of supported "No More 404" sites. Importance Contamination of the skin and clothing of health care personnel during removal of personal protective equipment (PPE) contributes to dissemination of pathogens and places personnel at risk for infection. Objectives To determine the frequency and sites of contamination on the skin and clothing of personnel during PPE removal and to evaluate the effect of an intervention on the frequency of contamination. Design, Setting, and Participants We conducted a point-prevalence study and quasi-experimental intervention from October 28, 2014, through March 31, 2015. Data analysis began November 17, 2014, and ended April 21, 2015. Participants included a convenience sample of health care personnel from 4 Northeast Ohio hospitals who conducted simulations of contaminated PPE removal using fluorescent lotion and a cohort of health care personnel from 7 study units in 1 medical center that participated in a quasi-experimental intervention that included education and practice in removal of contaminated PPE with immediate visual feedback based on fluorescent lotion contamination of skin and clothing. Main Outcomes and Measures The primary outcomes were the frequency and sites of contamination on skin and clothing of personnel after removal of contaminated gloves or gowns at baseline vs after the intervention. A secondary end point focused on the correlation between contamination of skin with fluorescent lotion and bacteriophage MS2, a nonpathogenic, nonenveloped virus. Results Of 435 glove and gown removal simulations, contamination of skin or clothing with fluorescent lotion occurred in 200 (46.0%), with a similar frequency of contamination among the 4 hospitals (range, 42.5%-50.3%). Contamination occurred more frequently during removal of contaminated gloves than gowns (52.9% vs 37.8%, P =.002) and when lapses in technique were observed vs not observed (70.3% vs 30.0%, P <.001). The intervention resulted in a reduction in skin and clothing contamination during glove and gown removal (60.0% before the intervention vs 18.9% after, P <.001) that was sustained after 1 and 3 months (12.0% at both time points, P <.001 compared with before the intervention). During simulations of contaminated glove removal, the frequency of skin contamination was similar with fluorescent lotion and bacteriophage MS2 (58.0% vs 52.0%, P =.45). Conclusions and Relevance Contamination of the skin and clothing of health care personnel occurs frequently during removal of contaminated gloves or gowns. Educational interventions that include practice with immediate visual feedback on skin and clothing contamination can significantly reduce the risk of contamination during removal of PPE. MONDAY, Oct. 12, 2015 (HealthDay News) -- Health care workers often contaminate their skin and clothing when they remove their medical gowns and gloves, new research suggests. For the study, workers at four Ohio hospitals simulated gown and glove removal. Additional health care workers from a separate facility participated in a program that included education and practice of removing contaminated gowns and gloves. The health care workers simulated 435 gown and glove removals. The researchers used a fluorescent lotion to determine "contamination." Skin or clothing got contaminated 46 percent of the time, the investigators found. But, the education and practice program led to a significant drop in the contamination rate -- from 60 percent to about 19 percent, the findings showed. This improvement lasted even when health care workers were retested after one and three months, Dr. Curtis Donskey, of the Cleveland Veterans Affairs Medical Center, and colleagues reported in the study published in the Oct. 12 issue of JAMA Internal Medicine. The study findings highlight the urgent need to come up with ways to reduce the risk of contamination, Donskey said in a journal news release. It's also important to figure out better ways to train people in how to best remove these items, Donskey's team said. And, ideally, the design of protective clothing should be improved to reduce the risk of contamination, the study authors suggested. More information The U.S. National Library of Medicine has more about job safety for health care workers.

Summary: A startling number of hospital workers are putting themselves and patients at risk of infection simply because they aren't putting on or taking off protective gear properly, according to a new study. Researchers asked hundreds of medical personnel in the Cleveland area, including many doctors and nurses, to touch a fluorescent lotion and then remove their gowns and gloves as they normally would, the Los Angeles Times reports. They discovered that the lotion, which simulated bacteria, ended up on the skin or clothes of the health workers 46% of the time, according to the study published in the JAMA Internal Medicine journal. Lead researcher Dr. Curtis J. Donskey tells Reuters that workers were shocked to see how often they may have been contaminating themselves. "Most of the participants appeared to be unaware of the high risk for contamination and many reported receiving minimal or no training," he says, though even after training, 19% of the workers couldn't avoid contamination. The researchers say that to reduce risk, workers should receive better training in the removal of protective equipment and that the equipment itself should be redesigned, HealthDay reports. The Times notes since workers of anything other than average size had more trouble removing their equipment, it will help to offer gowns in different sizes.

multi_news

en

Summarize: Alaska Airlines apologized this week after a flight attendant asked a gay man to give up his seat next to his partner so a straight couple could sit together, an exchange that put the airline on the defensive as it rebutted claims of discrimination. David Cooley, the owner of a gay bar in West Hollywood called the Abbey, wrote on Facebook on Sunday that he and his partner had boarded a flight to Los Angeles from New York when a flight attendant asked if Mr. Cooley’s partner would move from his seat “so a couple could sit together.” Mr. Cooley said he told the attendant that the two men were a couple and that he wanted to sit with his partner. But the attendant gave Mr. Cooley’s partner a choice: Move for the other couple or get off the plane. “We could not bear the feeling of humiliation for an entire cross-country flight and left the plane,” Mr. Cooley said. “I cannot believe that an airline in this day and age would give a straight couple preferential treatment over a gay couple and go so far as to ask us to leave.” Add this Tweet to your website by copying the code below. مزید جانیئے Add this video to your website by copying the code below. مزید جانیئے ہہم، سرور تک پہنچنے میں ایک مسئلہ تھا۔ دوبارہ کوشش کریں؟ بنیادی ٹویٹ شامل کریں میڈیا شامل کریں ٹوئٹر کا مواد اپنی ویب سائٹ یا ایپلی کیشن میں ایمبیڈ کر کے، آپ ٹوئٹر کے ڈیولپر اقرارنامہ اور ڈیولپر پالیسی سے اتفاق کر رہے ہیں۔ پیش منظر Alaska Airlines apologized after a gay couple were forced to give up their seats so a straight couple could sit together. The complainant accepted the apology, but the social-media response created a public-relations nightmare for the airline. Alaska Airlines faces a public-relations storm after a gay couple were forced to give up their seats on a flight from New York City to Los Angeles on Sunday to make room for a straight couple. Though the complainant Tuesday accepted an apology from Alaska, which said the outcome was a mistake and not reflective of any disrespect, dissemination of the incident on social media has damaged the airline’s image. Henry Harteveldt, an airline analyst with Atmosphere Research Group, said in an interview that Alaska had previously earned a reputation as a gay-friendly airline. “As an airline analyst who has known Alaska for a long time, and who also happens to be gay, I know that Alaska and Virgin America are two of the most supportive airlines in the business of their LGBT employees and the LGBT community,” Harteveldt said. But in the social-media blitz between Sunday and Tuesday, that reputation was eclipsed by a torrent of outrage. David Cooley, owner of a popular upscale gay bar in the West Hollywood section of Los Angeles, recounted the incident in posts on Facebook and Twitter. He said he and his traveling companion were on board in their assigned premium seats when a gate agent asked his companion to give up his seat and move to the economy cabin so that another couple could sit together. Although Cooley said he protested that the two men were also a couple and wanted to sit together, he said the agent insisted that his traveling companion had to either move to coach or get off the plane. “We could not bear the feeling of humiliation for an entire cross-country flight and left the plane,” Cooley wrote in his posts. “I have never been so discriminated against while traveling.” He added: “I cannot believe that an airline in this day and age would give a straight couple preferential treatment over a gay couple and go so far as to ask us to leave.” Cooley ended his post by thanking rival airline Delta for getting the couple home to L.A. afterward and calling for a boycott of Alaska Airlines by the LGBT community. The social-media posts quickly stirred a strong reaction as some celebrities weighed in, spreading news of the incident. James Corden, popular host of “The Late Late Show with James Corden” on CBS who has more than 10 million followers, tweeted: “Dear @AlaskaAir This is no way to behave. x” Many online commenters were more strident, saying they will never fly Alaska again. “Shame on you Alaska air for employing bigots” wrote one typical Twitter commenter. Alaska responded by posting an apology on social media that said “this unfortunate incident was caused by a seating mix-up on a full flight.” “It’s our policy to keep all families seated together whenever possible,” Alaska’s response continued. “That didn’t happen here. We are deeply sorry for the situation and did not intend to make Mr. Cooley and his partner feel uncomfortable in any way.” In an interview, Alaska spokeswoman Bobbie Egan said the incident was “a human mistake” made by a gate agent who didn’t have full information and was merely trying to move people around so a family could sit together. “We feel terrible. It was a mistake,” Egan said. “This was a misunderstanding and we own every part of it.” Egan pointed out that Alaska Air Chief Executive Brad Tilden has prominently and publicly championed marriage equality and, as a Boy Scout leader, the acceptance of gay Scouts in the organization. In 2014, Tilden joined other airline CEOs in writing an open letter to Arizona Gov. Jan Brewer that helped persuade her to veto a proposed law that would have allowed businesses to invoke religion and deny service to gay people. On Tuesday, Cooley declined to speak to the media, but in the afternoon, he took down his original Facebook post and posted another that said: “Alaska Airlines has reached out, apologized, and we are discussing making things right. I accept Alaska Airlines apology and appreciate it addressing the situation.” Airline analyst Harteveldt said that after discussing the incident with Alaska, he believes the fault lies in the lack of information relayed to the gate agent, who should have been able to see that Cooley and his companion had made a joint reservation and therefore were together and shouldn’t have been asked to separate. But he said he’s certain the incident was a genuine mistake rather than due to bias against gays. “Alaska’s commitment to the LGBT community has been exemplary,” he said. “That’s why this was just such a shock.” The Alaska Airlines website includes a page devoted to “gay travel,” which encourages LGBT travel and highlights gay-friendly destinations that support marriage equality, Pride celebrations, and other events of interest to the gay community. The heading on that page begins: “At Alaska, we are longtime supporters of the LGBT community and remain committed to a more equitable society.” But that message was lost in the social-media storm. On Twitter, Billy Eichner, the gay actor and comedian known for his faux anger and for his TV show “Billy on the Street,” responded to Alaska’s online apology with a line that summed up the public-relations problem the airline now faces. “Thank you for the explanation @AlaskaAir,” Eichner wrote. “But this is Twitter and it’s 2018 so I will continue to be outraged with no appreciation for fact, context or nuance SORRY!”

Summary: Alaska Airlines has issued an apology amid widespread outrage that stemmed from an incident in which a flight crew reportedly appeared to favor a straight couple over a gay couple. Per the New York Times, David Cooley, owner of West Hollywood gay bar The Abbey, was preparing to fly to New York from Los Angeles when a member of the crew asked his partner to move from his seat "so a couple could sit together." That's according to Cooley's account of Sunday's events, which he posted about in a lengthy Facebook post that has been shared by thousands. "I explained that we were a couple and wanted to sit together. He was given a choice to either give up the premium seat and move to coach or get off the plane," Cooley wrote. They chose to leave the flight. In the ensuing days, nationwide backlash prompted Alaska Airlines' response on Tuesday. "This unfortunate incident was caused by a seating mix-up on a full flight. It's our policy to keep all families seated together whenever possible. That didn't happen here. We are sorry for the situation and did not intend to make Mr. Cooley and his partner feel uncomfortable in any way," the airline's statement said, in part. Per the Seattle Times, Cooley tweeted on Tuesday that he's accepted the apology. "Thank you to everyone for all the support. @AlaskaAir has reached out, apologized, and we are discussing making things right," he wrote.

multi_news

en

Write a title and summarize: Douglas FraserBusiness/economy editor, Scotland Furlough goes on. We were due to be starting a new era of economic recovery and transition to a new jobs market from this morning. Ballet dancers were to reskill as cyber security consultants, at least according to the poster. But that's not how it's turned out. In mid-summer and many times after that, we were told Halloween would be the end of it, for sure. But less than five hours from the end of October, the prime minister announced that it goes on, at least to 2 December. That's with the announcement that England is going back into lockdown. We're back to the furlough scheme as it was in August. The government pays 80% of normal pay for those on furlough, and employers pay about 5% of their total pay bill in National Insurance and pension contributions. Plus employers can take furloughed workers back part-time. So that's more generous than September or October. Some important details: neither the employer nor the employee needs to have previously used the furlough scheme. That's important for many people who have shifted jobs in recent months, and for new firms. To qualify, you have to have been on the payroll and registered for PAYE tax before midnight on Friday 30 October. You can be furloughed for as little as seven days. There has previously been a three-week minimum. There are grants being paid to firms forced to close, and local councils in England are getting £20 per head of population to help out - a total of £1.1bn. There should be a share of that distributed through the funding formula for Scotland, Wales and Northern Ireland. There's no mention yet of what happens to the Self-Employed Income Support Scheme, which was due to fall, from 1 November, to 40% of past year's profits to cover the next three months. That's for the limited number of self-employed people who qualify. Meanwhile, the Financial Conduct Authority, the industry regulator, said mortgage lenders should extend payment holidays to a maximum of six months. So if you've already taken a six month holiday from payments, you may not get that continued. Half a million closures We were due for a new system that required people in firms that did not have to close to work at least 20% of their normal hours. In that case the UK government would pay out nearly half of normal earnings. That system required two big revisions, and even after that, it is not being introduced, at least until early December. Meanwhile, furlough applies across the UK, though the need for it is lower in Scotland, for now. There's a lot less that has to close. I'm told that governments in Scotland and Wales and Northern Ireland all asked for a return to full furlough support in order to let them put in place tight restrictions they deemed necessary to suppress viral infection. Downing Street said no as there isn't enough money. But now that England requires lockdown, there is enough money - borrowed money. That's clearly going to rankle and doesn't sound like a partnership of equals. There will be talks on Sunday between the Scottish government and the Treasury about how this is to apply, given that Scotland does not require closure of half million non-essential shops, car showrooms, betting shops almost all hospitality, pubs, bars, cafes, restaurants other than takeaways, most hotels, leisure, indoor entertainments, from bingo to bowls, hairdressers and beauty salons. And that's the issue raised by Nicola Sturgeon, the first minister saying that a crucial point is whether support on the scale announced for English businesses will be available if Scotland needs to impose further restrictions later - or if it is only available if Scotland happens to require a full lockdown at the same time as a lockdown in England. There's relief across business that furlough has been extended, but absolute dismay from some sectors about this happening in November. Shops are carrying a lot of Christmas stock, and they foresee a lot of business going to the big online retailers. People they were about to recruit but were not yet on the books will not qualify for furlough. The British Retail Consortium says the new English lockdown will cause "untold damage" in the run-up to Christmas, costing countless jobs, setting back the recovery and, it says, with only minimal effect on virus transmission. For Scottish shops, which can remain open, this raises questions about supply chains being disrupted. The UK Hospitality trade body says its members need more support than in spring. It'll have to sustain them through winter, and they're looking for a clear roadmap out of here. The Food and Drink Federation said the extended furlough scheme is "extremely welcome", but the lockdown decision still threatens calamity if they don't see a detailed rescue package within only three days. Independent retailers fear that there will be many more permanent closures, having lost quarter of shops from the first lockdown. And brewers face having to pour a lot of stale beer down the drain in December, with replacement costs. Fixed costs go on, even if the pay bill is covered by furlough, and they say the supply chain for hospitality tends to be forgotten. Let's not forget travel, which will affect those Scots who travel through English airports, now facing a ban on international travel, so flights are likely to be cut back sharply. Airports and airlines say they require an immediate additional economic support package throughout winter, and a roll-out of a traveller testing regime. Job search So far, the furlough scheme has helped 9.6m people stay in jobs, though not all at the same time. It's come down a long way from its peak. And it's cost more than £40bn. This week, we had interesting insights into what's happened to the people on furlough, from the Resolution Foundation think tank. It found 9% of people furloughed at some point had lost their jobs by September. Among young people, that's as high as 19%, so furlough had helped delay the point that were going to lose their jobs anyway. It found that, of people who were self-employed in February, 10% were unemployed seven months later, so they've been much less well protected. A really important finding from this research is that people have been losing jobs, as they did in past recessions, but much more than in the past, they've not been getting back into jobs. So there are big outflows from work, and poor outflows back into work. That's particularly true of young people. One of the reasons is that people are looking to get back into jobs like the ones they left, notably those in hospitality and leisure. The signs are that they're not going to sectors where there are recruitment shortages, such as social care. And that raises a big challenge about re-skilling people to have the skills and confidence to seek out the work opportunities that are out there.

Title: Furlough's further furlong Summary: The Job Retention Scheme has been retained across the UK, while England enters a new month of lockdown. But it's not clear it will also be there if Scotland needs to deploy it at a time when England does not. Businesses welcome the return of furlough, but there's dismay in some sectors about the implications for their costs. Furlough has supported 9.6m people to stay in jobs, though 9% of them went on to lose their jobs. That goes for 19% of young people.

xlsum_en

en

Summarize: CHAPTER XI Who rears the bloody hand? SAYERS Emily remained in her chamber, on the following morning, without receiving any notice from Montoni, or seeing a human being, except the armed men, who sometimes passed on the terrace below. Having tasted no food since the dinner of the preceding day, extreme faintness made her feel the necessity of quitting the asylum of her apartment to obtain refreshment, and she was also very anxious to procure liberty for Annette. Willing, however, to defer venturing forth, as long as possible, and considering, whether she should apply to Montoni, or to the compassion of some other person, her excessive anxiety concerning her aunt, at length, overcame her abhorrence of his presence, and she determined to go to him, and to entreat, that he would suffer her to see Madame Montoni. Meanwhile, it was too certain, from the absence of Annette, that some accident had befallen Ludovico, and that she was still in confinement; Emily, therefore, resolved also to visit the chamber, where she had spoken to her, on the preceding night, and, if the poor girl was yet there, to inform Montoni of her situation. It was near noon, before she ventured from her apartment, and went first to the south gallery, whither she passed without meeting a single person, or hearing a sound, except, now and then, the echo of a distant footstep. It was unnecessary to call Annette, whose lamentations were audible upon the first approach to the gallery, and who, bewailing her own and Ludovico's fate, told Emily, that she should certainly be starved to death, if she was not let out immediately. Emily replied, that she was going to beg her release of Montoni; but the terrors of hunger now yielded to those of the Signor, and, when Emily left her, she was loudly entreating, that her place of refuge might be concealed from him. As Emily drew near the great hall, the sounds she heard and the people she met in the passages renewed her alarm. The latter, however, were peaceable, and did not interrupt her, though they looked earnestly at her, as she passed, and sometimes spoke. On crossing the hall towards the cedar room, where Montoni usually sat, she perceived, on the pavement, fragments of swords, some tattered garments stained with blood, and almost expected to have seen among them a dead body; but from such a spectacle she was, at present, spared. As she approached the room, the sound of several voices issued from within, and a dread of appearing before many strangers, as well as of irritating Montoni by such an intrusion, made her pause and falter from her purpose. She looked up through the long arcades of the hall, in search of a servant, who might bear a message, but no one appeared, and the urgency of what she had to request made her still linger near the door. The voices within were not in contention, though she distinguished those of several of the guests of the preceding day; but still her resolution failed, whenever she would have tapped at the door, and she had determined to walk in the hall, till some person should appear, who might call Montoni from the room, when, as she turned from the door, it was suddenly opened by himself. Emily trembled, and was confused, while he almost started with surprise, and all the terrors of his countenance unfolded themselves. She forgot all she would have said, and neither enquired for her aunt, or entreated for Annette, but stood silent and embarrassed. After closing the door he reproved her for a meanness, of which she had not been guilty, and sternly questioned her what she had overheard; an accusation, which revived her recollection so far, that she assured him she had not come thither with an intention to listen to his conversation, but to entreat his compassion for her aunt, and for Annette. Montoni seemed to doubt this assertion, for he regarded her with a scrutinizing look; and the doubt evidently arose from no trifling interest. Emily then further explained herself, and concluded with entreating him to inform her, where her aunt was placed, and to permit, that she might visit her; but he looked upon her only with a malignant smile, which instantaneously confirmed her worst fears for her aunt, and, at that moment, she had not courage to renew her entreaties. 'For Annette,' said he,--'if you go to Carlo, he will release the girl; the foolish fellow, who shut her up, died yesterday.' Emily shuddered.--'But my aunt, Signor'--said she, 'O tell me of my aunt!' 'She is taken care of,' replied Montoni hastily, 'I have no time to answer idle questions.' He would have passed on, but Emily, in a voice of agony, that could not be wholly resisted, conjured him to tell her, where Madame Montoni was; while he paused, and she anxiously watched his countenance, a trumpet sounded, and, in the next moment, she heard the heavy gates of the portal open, and then the clattering of horses' hoofs in the court, with the confusion of many voices. She stood for a moment hesitating whether she should follow Montoni, who, at the sound of the trumpet, had passed through the hall, and, turning her eyes whence it came, she saw through the door, that opened beyond a long perspective of arches into the courts, a party of horsemen, whom she judged, as well as the distance and her embarrassment would allow, to be the same she had seen depart, a few days before. But she staid not to scrutinize, for, when the trumpet sounded again, the chevaliers rushed out of the cedar room, and men came running into the hall from every quarter of the castle. Emily once more hurried for shelter to her own apartment. Thither she was still pursued by images of horror. She re-considered Montoni's manner and words, when he had spoken of his wife, and they served only to confirm her most terrible suspicions. Tears refused any longer to relieve her distress, and she had sat for a considerable time absorbed in thought, when a knocking at the chamber door aroused her, on opening which she found old Carlo. 'Dear young lady,' said he, 'I have been so flurried, I never once thought of you till just now. I have brought you some fruit and wine, and I am sure you must stand in need of them by this time.' 'Thank you, Carlo,' said Emily, 'this is very good of you Did the Signor remind you of me?' 'No, Signora,' replied Carlo, 'his excellenza has business enough on his hands.' Emily then renewed her enquiries, concerning Madame Montoni, but Carlo had been employed at the other end of the castle, during the time, that she was removed, and he had heard nothing since, concerning her. While he spoke, Emily looked steadily at him, for she scarcely knew whether he was really ignorant, or concealed his knowledge of the truth from a fear of offending his master. To several questions, concerning the contentions of yesterday, he gave very limited answers; but told, that the disputes were now amicably settled, and that the Signor believed himself to have been mistaken in his suspicions of his guests. 'The fighting was about that, Signora,' said Carlo; 'but I trust I shall never see such another day in this castle, though strange things are about to be done.' On her enquiring his meaning, 'Ah, Signora!' added he, 'it is not for me to betray secrets, or tell all I think, but time will tell.' She then desired him to release Annette, and, having described the chamber in which the poor girl was confined, he promised to obey her immediately, and was departing, when she remembered to ask who were the persons just arrived. Her late conjecture was right; it was Verezzi, with his party. Her spirits were somewhat soothed by this short conversation with Carlo; for, in her present circumstances, it afforded some comfort to hear the accents of compassion, and to meet the look of sympathy. An hour passed before Annette appeared, who then came weeping and sobbing. 'O Ludovico--Ludovico!' cried she. 'My poor Annette!' said Emily, and made her sit down. 'Who could have foreseen this, ma'amselle? O miserable, wretched, day--that ever I should live to see it!' and she continued to moan and lament, till Emily thought it necessary to check her excess of grief. 'We are continually losing dear friends by death,' said she, with a sigh, that came from her heart. 'We must submit to the will of Heaven--our tears, alas! cannot recall the dead!' Annette took the handkerchief from her face. 'You will meet Ludovico in a better world, I hope,' added Emily. 'Yes--yes,--ma'amselle,' sobbed Annette, 'but I hope I shall meet him again in this--though he is so wounded!' 'Wounded!' exclaimed Emily, 'does he live?' 'Yes, ma'am, but--but he has a terrible wound, and could not come to let me out. They thought him dead, at first, and he has not been rightly himself, till within this hour.' 'Well, Annette, I rejoice to hear he lives.' 'Lives! Holy Saints! why he will not die, surely!' Emily said she hoped not, but this expression of hope Annette thought implied fear, and her own increased in proportion, as Emily endeavoured to encourage her. To enquiries, concerning Madame Montoni, she could give no satisfactory answers. 'I quite forgot to ask among the servants, ma'amselle,' said she, 'for I could think of nobody but poor Ludovico.' Annette's grief was now somewhat assuaged, and Emily sent her to make enquiries, concerning her lady, of whom, however, she could obtain no intelligence, some of the people she spoke with being really ignorant of her fate, and others having probably received orders to conceal it. This day passed with Emily in continued grief and anxiety for her aunt; but she was unmolested by any notice from Montoni; and, now that Annette was liberated, she obtained food, without exposing herself to danger, or impertinence. Two following days passed in the same manner, unmarked by any occurrence, during which she obtained no information of Madame Montoni. On the evening of the second, having dismissed Annette, and retired to bed, her mind became haunted by the most dismal images, such as her long anxiety, concerning her aunt, suggested; and, unable to forget herself, for a moment, or to vanquish the phantoms, that tormented her, she rose from her bed, and went to one of the casements of her chamber, to breathe a freer air. All without was silent and dark, unless that could be called light, which was only the faint glimmer of the stars, shewing imperfectly the outline of the mountains, the western towers of the castle and the ramparts below, where a solitary sentinel was pacing. What an image of repose did this scene present! The fierce and terrible passions, too, which so often agitated the inhabitants of this edifice, seemed now hushed in sleep;--those mysterious workings, that rouse the elements of man's nature into tempest--were calm. Emily's heart was not so; but her sufferings, though deep, partook of the gentle character of her mind. Hers was a silent anguish, weeping, yet enduring; not the wild energy of passion, inflaming imagination, bearing down the barriers of reason and living in a world of its own. The air refreshed her, and she continued at the casement, looking on the shadowy scene, over which the planets burned with a clear light, amid the deep blue aether, as they silently moved in their destined course. She remembered how often she had gazed on them with her dear father, how often he had pointed out their way in the heavens, and explained their laws; and these reflections led to others, which, in an almost equal degree, awakened her grief and astonishment. They brought a retrospect of all the strange and mournful events, which had occurred since she lived in peace with her parents. And to Emily, who had been so tenderly educated, so tenderly loved, who once knew only goodness and happiness--to her, the late events and her present situation--in a foreign land--in a remote castle--surrounded by vice and violence--seemed more like the visions of a distempered imagination, than the circumstances of truth. She wept to think of what her parents would have suffered, could they have foreseen the events of her future life. While she raised her streaming eyes to heaven, she observed the same planet, which she had seen in Languedoc, on the night, preceding her father's death, rise above the eastern towers of the castle, while she remembered the conversation, which has passed, concerning the probable state of departed souls; remembered, also, the solemn music she had heard, and to which the tenderness of her spirits had, in spite of her reason, given a superstitious meaning. At these recollections she wept again, and continued musing, when suddenly the notes of sweet music passed on the air. A superstitious dread stole over her; she stood listening, for some moments, in trembling expectation, and then endeavoured to re-collect her thoughts, and to reason herself into composure; but human reason cannot establish her laws on subjects, lost in the obscurity of imagination, any more than the eye can ascertain the form of objects, that only glimmer through the dimness of night. Her surprise, on hearing such soothing and delicious sounds, was, at least, justifiable; for it was long--very long, since she had listened to any thing like melody. The fierce trumpet and the shrill fife were the only instruments she had heard, since her arrival at Udolpho. When her mind was somewhat more composed, she tried to ascertain from what quarter the sounds proceeded, and thought they came from below; but whether from a room of the castle, or from the terrace, she could not with certainty judge. Fear and surprise now yielded to the enchantment of a strain, that floated on the silent night, with the most soft and melancholy sweetness. Suddenly, it seemed removed to a distance, trembled faintly, and then entirely ceased. She continued to listen, sunk in that pleasing repose, which soft music leaves on the mind--but it came no more. Upon this strange circumstance her thoughts were long engaged, for strange it certainly was to hear music at midnight, when every inhabitant of the castle had long since retired to rest, and in a place, where nothing like harmony had been heard before, probably, for many years. Long-suffering had made her spirits peculiarly sensible to terror, and liable to be affected by the illusions of superstition.--It now seemed to her, as if her dead father had spoken to her in that strain, to inspire her with comfort and confidence, on the subject, which had then occupied her mind. Yet reason told her, that this was a wild conjecture, and she was inclined to dismiss it; but, with the inconsistency so natural, when imagination guides the thoughts, she then wavered towards a belief as wild. She remembered the singular event, connected with the castle, which had given it into the possession of its present owner; and, when she considered the mysterious manner, in which its late possessor had disappeared, and that she had never since been heard of, her mind was impressed with an high degree of solemn awe; so that, though there appeared no clue to connect that event with the late music, she was inclined fancifully to think they had some relation to each other. At this conjecture, a sudden chillness ran through her frame; she looked fearfully upon the duskiness of her chamber, and the dead silence, that prevailed there, heightened to her fancy its gloomy aspect. At length, she left the casement, but her steps faltered, as she approached the bed, and she stopped and looked round. The single lamp, that burned in her spacious chamber, was expiring; for a moment, she shrunk from the darkness beyond; and then, ashamed of the weakness, which, however, she could not wholly conquer, went forward to the bed, where her mind did not soon know the soothings of sleep. She still mused on the late occurrence, and looked with anxiety to the next night, when, at the same hour, she determined to watch whether the music returned. 'If those sounds were human,' said she, 'I shall probably hear them again.'

Summary: Em wakes up from a little nappy-nap and decides to finally ask Montoni about letting Annette out of the room. Nice of her to be in such a hurry. She sees remnants of the battle strewn all about. Em runs into Montoni in the hallway. He's worried that she overheard something he was saying, but promises to get Annette out of the room. When Annette finally gets out, she's all shaken up about Ludovico. It seems he's received a near-mortal wound. Em's indulging in her favorite habit when she hears some strange music from afar. It's actually comforting to the poor girl, who's reminded of her dearly departed dad.

booksum

en